Altered Gene Expression during Rat Wolffian Duct Development in Response to in Utero Exposure to the Antiandrogen Linuron

Katie J. Turner1, Barry S. McIntyre2, Suzanne L. Phillips, Norman J. Barlow2, Christopher J. Bowman and Paul M. D. Foster2

CIIT Centers for Health Research, Research Triangle Park, North Carolina 27709-2137

Received January 29, 2003; accepted March 20, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Linuron is an herbicide with weak androgen receptor (AR) antagonist activity. Exposure to linuron from gestation days (GD) 12 to 21 perturbs androgen-dependent male reproductive development. In utero exposure to 50-mg/kg/day linuron induces malformations of the epididymis and the vas deferens. The objective of this study was to identify alterations in gene expression within the testis and epididymis associated with abnormal Wolffian duct development and to correlate changes in gene expression with the gross morphology of the affected epididymides. Pregnant Sprague-Dawley rats were administered either corn oil vehicle or linuron (50 mg/kg/day) by gavage from GD 12 to 21 (n = 3–6 controls, n = 5–10 linuron-treated dams per time point). Changes in gene expression were evaluated in testes on GD 21 and in epididymides on GD 21 and postnatal day (PND) 7, using cDNA microarrays and confirmed by real-time reverse transcriptase polymerase chain reaction (RT-PCR) analyses. RNA was isolated from intact epididymides with reduced or no ductal coiling from the linuron groups, and epididymides with noncontiguous ducts were excluded. In the fetal testis, exposure to linuron did not result in reduced mRNA expression of the AR or that of several steroidogenic enzymes, supporting the hypothesis that linuron does not reduce fetal testosterone production. Linuron induced a significant decrease in AR mRNA expression in GD 21 epididymides. Significant changes in mRNA expression in GD 21 and PND 7 epididymides were also identified in the epidermal growth factor (EGF), insulin-like growth factor 1 (IGF-1), bone morphogenetic protein (BMP), fibroblast growth factor (FGF), and Notch signaling pathways. These pathways are involved in tissue morphogenesis. Changes in the expression of AR and IGF-1 receptors were detected by immunostaining in malformed epididymides from linuron-exposed rats. Linuron induced changes in epididymal gene expression suggestive of altered paracrine interactions between the mesenchyme and epithelial cells during development. The EGF, Notch, IGF-1, BMP4, and FGF signaling pathways may be involved in normal testosterone-mediated development of the Wolffian duct.

Key Words: linuron; androgen receptor antagonist; Wolffian duct development; epididymis.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Linuron is a commonly used pre- and postemergence herbicide applied to suppress broadleaf and grassy weeds (U.S. EPA, 1995Go). Studies have demonstrated that linuron is a weak competitive androgen receptor (AR) antagonist in vitro and that prenatal exposure induces dose-dependent alterations in androgen-mediated reproductive development in male rats (McIntyre et al., 2000Go). Furthermore, in utero exposure to 50 mg/kg/day linuron and higher dose levels induces epididymal and testicular malformations (Lambright et al., 2000Go; McIntyre et al., 2000Go, 2002aGo). Thus demonstrating that linuron preferentially impairs testosterone-mediated, rather than dihydrotestosterone (DHT)-mediated, reproductive development. The primary targets of linuron-induced toxicity appear to be the epididymis and vas deferens (McIntyre et al., 2002aGo). Linuron-induced epididymal malformations caused obstruction of testicular fluid outflow, which resulted in testicular atrophy (McIntyre et al., 2002aGo). On postnatal day (PND) 7, approximately 21% of the male offspring exposed to 50 mg/kg/day linuron in utero displayed epididymides that were malformed as evidenced by decreased number of ductules or absence of the head, body, or tail (McIntyre et al., 2002bGo). In contrast, no testicular lesions were observed during late gestation and early postnatal life. Intratesticular and serum testosterone levels were not decreased in the linuron-exposed male fetuses on gestation days (GD) 17, 19, and 21 (McIntyre et al., 2002bGo). Since linuron is a weak AR antagonist but does not alter fetal testosterone production, we hypothesize that linuron disrupts the development of the Wolffian duct by inhibiting AR signaling.

Testosterone, rather than DHT, is required for stabilization and differentiation of the Wolffian duct (George and Wilson, 1994Go). Fetal rat testes begin synthesizing testosterone around GD 15.5, and production becomes markedly elevated around GD 19.5, which coincides with the time when testosterone is required for stabilization of the Wolffian ducts (Warren et al., 1973Go). Tsuji et al.(1991)Go showed that the addition of testosterone to mouse urogenital ridges in culture-elicited ductal coiling within the epididymis in a dose-dependent manner, and that induction of coiling was inhibited in the presence of the antiandrogen cyproterone acetate. Testosterone has been proposed to induce proliferation of the epithelial cells and ductal coiling through mesenchymal-epithelial cell interactions involving paracrine factors (Cunha et al., 1992Go; Thomson, 2001Go). In support of this hypothesis, immunolocalization studies in the fetal rat have shown that during normal development of the Wolffian duct, the AR is initially expressed in the mesenchyme cells surrounding the developing Wolffian duct, with subsequent induction of expression within the epithelial cells around GD 18 (Bentvelsen et al., 1995Go). Elegant tissue recombination experiments have demonstrated that it is the mesenchyme that determines the morphologic and functional fate of the overlying epithelium (Cunha et al., 1992Go). For example, recombination of seminal vesicle mesenchyme with embryonic upper Wolffian duct reprograms differentiation of the duct to become a seminal vesicle rather than an epididymis (Higgins et al., 1989Go). Growth factors and components of the extracellular matrix have been proposed to mediate signaling from the mesenchyme to the epithelium. However, direct regulation of growth factor expression by androgens in vivo has yet to be demonstrated unequivocally.

The objective of this study was to identify alterations in gene expression within the testis and epididymis associated with abnormal Wolffian duct development and to correlate changes in gene expression with the gross morphology of the affected epididymides. Since linuron is an AR antagonist, we hypothesize that epididymal malformations are the result of linuron-induced attenuation of AR signaling. To date, 17 types of signal transduction pathways have been identified in animals. These pathways are used repeatedly in various combinations and at different times and locations in the developing embryo and fetus (Gerhart, 1999Go). Signaling pathways are of critical importance for all aspects of development since they regulate many cellular responses including gene expression, protein secretion, cell proliferation, differentiation, migration, and apoptosis (Gerhart, 1999Go). These pathways have been conserved through evolution and are potential targets for disruption by toxicants; therefore we were especially interested in determining whether linuron exposure altered the expression of components of cell signaling pathways. Pregnant rats were treated with linuron (50 mg/kg/day) from GD 12 to 21, since this has been shown in previous studies to maximize the incidence of epididymal abnormalities with minimal maternal toxicity (McIntyre et al., 2000Go; 2002aGo,bGo). Gene expression was analyzed in testes and epididymides obtained from fetuses on GD 21 and from epididymides removed from pups on PND 7 using microarrays and real-time reverse transcriptase polymerase chain reaction (RT-PCR) analyses. Immunohistochemistry was used to evaluate whether alterations in AR and insulin-like growth factor-1 receptor (IGF-1R) mRNA expression correlated with changes in a distribution or intensity of expression of the protein. The changes in epididymal gene expression were linked to abnormal differentiation of the upper Wolffian duct.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals.
This study was conducted in accordance with Federal guidelines for the care and use of laboratory animals (National Research Council, 1996Go) and was approved by the Institutional Animal Care and Use Committee of the CIIT Centers for Health Research (CIIT). Time-mated, 8- to 10-week-old, nulliparous Crl:CD(SD)BR rats were obtained from Charles River Laboratories Inc. (Raleigh, NC) on GD 0, defined as the day sperm was found in the vagina of the mated female. Animal allocation to treatment groups was done by body-weight (bw) randomization. Animals were housed in a HEPA-filtered, mass air-displacement room with a 12-h light-dark cycle at 18–26°C and relative humidity of 30–70% in the CIIT animal care facility, which is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care, International. Animals had access to deionized water and rodent chow ad libitum (NIH-07, Zeigler Brothers, Gardner, PA). Individual dams and offspring were housed in polycarbonate cages on ALPHA-dri bedding (Shepherd Specialty Papers, Kalamazoo, MI).

Treatment.
For each treatment block, dams were gavaged daily (between 0800 and 0900 A.M.) from GD 12 to 21 with either corn oil (Sigma Chemical Co. St. Louis, MO) or linuron (Chem Service, Inc., West Chester, PA) in corn oil at 50 mg/kg/day at a volume of 2 ml/kg/day. This dose level of linuron was selected based on previous studies in which 50 mg/kg/day linuron administered to pregnant rats from GD 12 to 21 resulted in limited maternal toxicity (decreased weight gain during treatment without alteration of organ weights or any litter parameters) but induced epididymal abnormalities with an approximate incidence of 25% (McIntyre et al., 2002Go). Dams were examined daily for clinical signs of toxicity.

Study design.
The tissues analyzed in the present study were obtained from three separate blocks of animals. In the first block, six control dams were gavaged with corn oil, and six dams were treated with 50 mg/kg/day linuron. All the dams were euthanized on GD 21 by CO2 asphyxiation and exsanguination, and the fetuses were removed. The epididymides and testes were removed from the male fetuses and inspected under a dissecting microscope with transillumination. The gross morphology of the testes and epidiymides from these fetuses was recorded. These tissues were then separated and snap-frozen in liquid nitrogen for use in the molecular analyses. A second block of pregnant rats, four control and five linuron-treated dams, was treated so that macroscopic images of the testes and epididymides on GD 21 could be captured and the morphology recorded. These tissues were left intact and fixed in neutral-buffered formalin for 7 h for immunohistochemistry. The molecular analyses and immunohistochemistry performed on epididymides removed from pups on PND 7 utilized tissue collected in a previous study (McIntyre et al., 2002bGo). This block included three control dams and 10 dams treated with linuron. The right testes and epididymides were separated and snap-frozen in liquid nitrogen. The left testes and epididymides were fixed individually in 10% neutral-buffered formalin and then processed and embedded in paraffin for immunohistochemistry.

DNA array analysis.
Total RNA was isolated from testes on GD 21 and epididymides on GD 21 and PND 7 using STAT-60TM (Tel-Test, Inc., Friendswood, Texas). Epididymides were pooled from 3–4 pups from the same litter to obtain sufficient RNA for the molecular analyses. The pools consisted of linuron-exposed epididymides that displayed reduced-to-no ductal coiling in comparison with control epididymides. Due to the variability in incidence of abnormal epidiymides, it was not possible to gain sufficient tissue from each litter to make separate pools of epididymides that showed decreased versus no coiling. Epididymides with noncontiguous ducts were excluded from the molecular analyses, as the absence of tissue would have complicated interpretation of the biological relevance of decreases in gene expression. Testes were pooled from the same pups as the epididymides. The quality of the RNA was evaluated using a spectrophotometer and gel electrophoresis. The total RNA was DNase-treated with RNase-free DNase (Roche, Indianapolis, IN) at 37°C for 60 min to ensure the absence of genomic DNA. Reverse-transcription (RT) reactions were performed using 3.5 µg of total RNA, [32P]-dATP, and Superscript-II MMLV reverse transcriptase (Gibco BRL, Gaithersburg, MD) for 60 min at 50°C. Following purification, probes were added to each Clontech (Palo Alto, CA) Atlas Rat Toxicology 1.2 cDNA expression array (1279 genes), with hybridization and washing performed according to the manufacturer’s instructions. Arrays were placed on a phosphor screen for 2–4 days and visualized using a PhosphorImagerTM SI (Molecular Dynamics, Amersham Biosciences Corp, Piscataway, NJ). These images were imported into AtlasImage software (Clontech) for quantification. These data were then imported into GeneSpring (Silicon Genetics, Redwood, CA) for analysis. Array analysis was performed on three to four samples (representing at least three individual litters) per treatment group. During analysis of the arrays within GeneSpring the raw data was normalized by gene and by array, and genes with a signal below 10 within the control group were excluded from the analysis to prevent inclusion of data close to the background signal of the arrays. To obtain lists of genes that showed significantly different expression levels between the control and linuron groups, a Welch t-test (variances not assumed equal) was performed without a multiple testing correction. Lists were also generated showing genes that were twofold up- or downregulated by linuron exposure.

Real-time RT-PCR.
Changes in gene expression were confirmed using real-time RT-PCR on the GeneAmp® 5700 Sequence Detection System (Applied Biosystems, Foster City, CA). Total RNA (1 µg) from each tissue pool was aliquoted in quadruplicate for RT using TaqMan® RT Reagents (Applied Biosystems) and SuperScript-II reverse transcriptase (Gibco BRL), with one aliquot designated to receive no enzyme. Quality of the RT reactions was confirmed by comparison of triplicate RT versus no enzyme control for each RNA sample, using the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer set according to manufacturer’s protocols (Applied Biosystems). PCR was performed using SYBR® Green PCR Core Reagents (Applied Biosystems) according to manufacturer’s instructions, using a reaction volume of 25 µl. Primer sets were selected by Primer Express software. Production of a single PCR product was confirmed using gel electrophoresis, and primer efficiency was determined according to manufacturer’s recommended protocol (Applied Biosystems). Sequences of gene primer sets are given in Table 1Go. Quantitation of P450 side chain cleavage (P450scc) and 17{alpha}hydroxylase, c17,20 lyase (17{alpha}OH) were performed using TaqMan® probes in conjunction with the primers listed in Table 1Go, according to the manufacturer’s instructions (Applied Biosystems). The probe sequences for GAPDH, P450scc, and 17{alpha}OH (5' to 3') were CCGCCTGGAGAAACCTGCCAAGTATG, CCAGCGGTTCATCGACACGCCGT, and CCTACGTACTGGTCAATCTCCTTTTGGATCTTCTTTCTT, respectively. A standard curve was generated by making appropriate dilutions of a sample of cDNA, synthesized from GD 21 testicular RNA from control fetuses. The samples were quantitated using values calculated from the standard curves for the gene- and the GAPDH-specific primers. Real-time RT-PCR and Taqman® analyses were performed in triplicate on at least 4 samples per treatment group, representing a minimum of three individual litters per time point. PCR reactions for the mRNA of interest were performed in parallel with reactions using GAPDH specific primers to allow standardization across the samples for cDNA input. Relative quantitation of gene expression was performed according to User Bulletin #2 supplied by Applied Biosystems.


View this table:
[in this window]
[in a new window]
 
TABLE 1 List Of mRNAs Selected for Quantification by Real-Time RT-PCR on the ABI 5700 Sequence Detection System and the Sequences of the Primer Sets Used
 
Immunohistochemistry.
Immunohistochemistry was performed on 5 µm epididymal sections from a minimum of 15 animals from at least three different litters per group at each time point. Immunolocalization of AR utilized a rabbit polyclonal antibody (N20) raised against a peptide within the N-terminal domain of the human AR (Santa Cruz Biotechnology, Santa Cruz, CA). Immunolocalization of IGF-1R utilized a rabbit polyclonal antibody (C20) raised against a peptide within the carboxy terminus of the human IGF-1R (Santa Cruz Biotechnology). The antibodies are known to cross-react with the rat AR and IGF-1R proteins by Western blotting and immunohistochemistry (Santa Cruz). Optimal staining was obtained with heat-induced antigen retrieval, using an antigen unmasking solution (Vector Laboratories, Inc., Burlingame, CA) in conjunction with a steamer. Anti-AR antibody was used at 1:200, and the anti-IGF-1R antibody was diluted 1:2000 in Tris-buffered saline (0.05 M Tris pH 7.4, 0.85% saline) containing normal goat serum (1:200, Vectastain Elite ABC kit, Vector Laboratories) and 5% bovine serum albumin (Sigma, St. Louis, MO). Detection was performed using the reagents in the Vectastain Elite ABC kit according to the manufacturer’s instructions (Vector Laboratories). Bound antibodies were visualized by incubating the sections with an ABC-HRP complex followed by incubation with liquid 3,3'-diaminobenzidine tetra-hydrochloride (BioGenex, San Ramon, CA). The specificity of the immunostaining was established by incubating sections with primary antibody preabsorbed with a 10-fold excess of the peptide antigen prior to use. Sections were counterstained with hematoxylin. Images were captured using a Nikon Labphot-2 microscope (Nikon, Melville, NY) equipped with a Polaroid PDMC-2 camera (Polaroid Co., Cambridge, MA). Captured images were compiled using Photoshop 6.0 (Adobe, Mountain View, CA).

Statistical analysis.
Statistical analyses were conducted using JMP (version 4.0, SAS Institute, Cary, NC), and significance was assumed where p < 0.05. For analyses on reproductive parameters, the male pups were nested by dam to yield mean-body-weight data. Either analysis of variance (ANOVA) or analysis of covariance (ANCOVA) was used to test for significance of treatment effects; covariants are listed in the legend for Table 2Go. The data presented are means or least-square means ± SE. The Fisher’s exact test was used to determine whether the incidence of underdeveloped and malformed epididymides was significantly different in the linuron-exposed groups. Statistical analysis of the real-time RT-PCR data was performed on the relative gene expression data (Applied Biosystems, User Bulletin #2). These data are shown graphically as percentages of the controls in the results. In addition, statistical analysis was performed on the individual sample data for each tissue normalized to GAPDH and then log-transformed to normalize the distribution. Significance in both analyses was determined by performing a t-test. The two analyses of the real-time RT-PCR data gave similar p values.


View this table:
[in this window]
[in a new window]
 
TABLE 2 Effect of in Utero Linuron Exposure on Parameters in Pregnant Female Rats and the Male Offspring
 

    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Effect of Linuron on Dams and Reproductive Performance
Dams treated with linuron showed some signs of toxicity based on decreases in body weight on GD 21 and in body weight gain over the 10-day dosing period (GD 12 to 21) when compared to vehicle-treated control animals (Table 2Go). The blocks were analyzed individually since the total number of pups born to each dam was not recorded for block 1 and thus could not be used as a covariate. In addition, there were significant differences in the control-dam body weight on GD 21 among the blocks. Body weight on GD 21 was decreased by 10% in the three blocks of linuron-treated dams relative to the corresponding control group. However, the difference in body weight on GD 21 between the control and linuron-treated dams reached statistical significance only in the third block of dams. Body weight gain was significantly decreased by 35% in the dams in blocks 1 and 3, relative to the corresponding control group. Body weight gain in the second block of linuron-treated dams was decreased by 25% but did not attain statistical significance. Gestational exposure did not delay parturition or alter litter size and sex ratio (data not shown) in agreement with previous studies performed within our group (McIntyre et al., 2000Go, 2002aGo,McIntyre et al., bGo).

Male fetuses exposed to linuron from GD 12 to 21 exhibited a small decrease in fetal weight on GD 21 (Table 2Go). This reached statistical significance only in the fetuses from the dams in block 2. Testes and epididymides from these fetuses were fixed for immunohistochemistry and not utilized in the molecular analyses. Pup weights on PND 7 were also decreased by approximately 6% in the linuron-exposed group, but did not reach statistical significance (Table 2Go).

Effect of Linuron on the Gross Morphology of the Developing Epididymis
The morphology of epididymides was noted during dissection of the fetal and postnatal male offspring. Representative images of testes and epididymides on GD 21 from a control fetus and from three linuron-exposed fetuses (three different litters) are shown to illustrate the different morphologies that were observed using a dissection microscope with transillumination (Fig. 1Go). Approximately half the linuron-exposed fetuses possessed developing epididymides that showed no apparent differences in morphology in comparison with the controls (Figs. 1AGo and 1BGo; Table 2Go). However, prenatal exposure to linuron resulted in 16–30% of fetuses with epididymides that displayed reduced ductal coiling in comparison with controls (Fig. 1CGo; Table 2Go). In addition, linuron exposure induced a 20% incidence of epididymides that had an incomplete duct or the duct showed no visible coiling on GD 21 (Fig. 1DGo; Table 2Go). This incidence of epididymal malformations is consistent with that noted on PND 7 (Table 2Go) and in previous studies where necropsies were performed on PND 14, 35, 56, and 100 following in utero exposure to 50 mg/kg/day linuron (McIntyre et al., 2000Go; 2002aGo,bGo).



View larger version (72K):
[in this window]
[in a new window]
 
FIG. 1. Effect of prenatal linuron exposure from gestation day (GD) 12 to 21 on the morphology of the epididymis developing on GD 21 visualized using a dissecting microscope with transillumination. A testis and epididymis from a control fetus are shown in (A), and representative testes and epididymides from linuron-exposed fetuses are shown in (B)–(D). Note the variation in development of the fetal epididymides from linuron-exposed fetuses. Some of the epididymides have no apparent abnormalities and resemble those from control fetuses (B); however, a number of epididymides appear underdeveloped with no apparent coiling (C), and in a few cases the epididymides are small and malformed with an incomplete duct (D). Scale bars are 0.5 mm.

 
Analysis of Gene Expression
Microarray analysis was performed utilizing GeneSpring software. Gene lists showing genes with significantly different expression levels between the control and linuron groups were generated by performing a Welch t-test with no multiple testing correction within the GeneSpring analysis software. Gene lists with corresponding information on the fold change and direction of change are shown in the supplemental data associated with this article. Since the analysis only made of use of three to four arrays per treatment group at each time point, the statistical analysis of the gene expression data was not considered sufficiently quantitative to provide a definitive assessment of alterations in gene expression. However, the arrays provided a useful guide for the selection of other mRNAs to quantify, besides those indicated by the literature on the role of androgens in the development of the male reproductive tract. Thus, the real-time RT-PCR data discussed in the subsequent sections of the results is considered to be the most accurate representation of the alterations in gene expression induced by exposure to linuron. All the mRNAs that were quantified during this investigation are listed in Table 1Go. This table shows whether the mRNAs were selected for quantification based on the array data or from information in the literature, and also whether real-time RT-PCR was performed on GD 21 testes and/or GD 21 and PND 7 epididymides. It should be noted that if an mRNA was selected for quantification at one of the epididymal time points it was automatically quantified at the other time point. Thus, it was possible to assess whether a change in expression at GD 21 was maintained through to PND 7 or occurred following the cessation of treatment with linuron. In addition, when a change in mRNA expression was identified by real-time RT-PCR, primers were designed to the corresponding ligand or receptor to further substantiate a potential change in the signaling pathway.

Linuron Exposure and Testicular mRNA Expression
Changes in testicular mRNA expression were suggested for a few genes (24/1176) by the array data (see supplemental material for a list of the genes). The following mRNAs were selected from the gene list for confirmation by real-time RT-PCR (Table 1Go): follicle-stimulating hormone receptor (FSHR), the transcription factor GATA-4, insulin-like growth factor binding protein 6 (IGFBP6), and bone morphogenetic protein 4 (BMP4); however, real-time RT-PCR analysis was unable to confirm any alterations in gene expression between control and linuron samples (data not shown). It was not possible to design primers that could accurately quantify the following mRNAs that also showed changes in expression based on the array analysis: activin receptor, inhibinßA, thyroid stimulating hormone receptor, and the 5-hydroxytryptamine receptor 1B. Since linuron is a weak AR antagonist, AR mRNA expression was quantified. EGFR and IGF-1R were selected as they represented growth factor signaling pathways relevant to the development of the male reproductive tract. The steroidogenic enzymes 3ß-hydroxysteroid dehydrogenase (3ßHSD), P450 side-chain cleavage (P450scc), or 17{alpha}-hydroxylase/C17,20 lyase (17{alpha}OH) were quantified because of suggestions that linuron might inhibit testosterone synthesis (Lambright et al., 2000Go). Prenatal linuron exposure did not alter mRNA expression of AR, EGFR, and IGF-1R or of the steroidogenic enzymes 3ßHSD, P450scc, or 17{alpha}OH within the GD 21 testes (data not shown). Thus, real-time RT-PCR was unable to identify any alterations in the expression of 10 mRNAs (Table 1Go) that had the potential to be modulated by androgens.

Effect of Linuron on Androgen Receptor and Epidermal Growth Factor Receptor mRNA Expression in Epididymides
In contrast to the fetal testis, quantitation of AR expression by real-time RT-PCR demonstrated that this mRNA was significantly reduced by 45% in the epididymides of fetuses exposed to linuron in comparison with the control group (Fig. 2AGo). This decrease in expression was not observed in the epididymides removed from pups on PND 7 that were exposed to linuron in utero. Quantitation of EGFR expression showed that the steady-state levels of this mRNA were significantly decreased in epididymides on GD 21 by 36% (Fig. 2AGo). On PND 7, EGFR mRNA expression was decreased by 22% and approached statistical significance (p = 0.068; Fig. 2BGo). Comparison of the GD 21 and PND 7 arrays hybridized with epididymal samples did not indicate that AR and EGFR were altered in expression between the control and linuron groups. Several attempts were made to design primers that could accurately quantitate the expression of EGF but these proved unsuccessful.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 2. Effect of prenatal linuron exposure from gestation day (GD) 12 to 21 on androgen receptor (AR) and epidermal growth factor receptor (EGFR) epididymal mRNA expression on GD 21 (A) and PND 7 (B). Total RNA from fetal and postnatal epididymides was subjected to real-time RT-PCR analysis. The results shown represent the relative change in expression compared to the control group where the mean expression is assumed to be 100%. The data presented are % means ± SE, where n = 4 control samples (4 litters) and n = 7 linuron-exposed samples (6 litters) on GD 21 and n = 5 control samples (3 litters) and n = 6 linuron-exposed samples (6 litters) on PND 7; *p < 0.05 was significantly different from the corresponding control groups.

 
Effect of Linuron on mRNA Expression of Delta Like and the Notch2 Receptor in Epididymides
Comparison of the arrays hybridized with epididymal samples from GD 21 fetuses indicated that the mRNA for a gene known as delta like (Dlk) was markedly upregulated in the linuron group. The Notch2 receptor, a potential target for Dlk, showed a small decrease in expression on the linuron arrays. The array results were confirmed by real-time RT-PCR such that Dlk mRNA expression was significantly increased, relative to the control group, by 253%, and Notch2 was decreased by 40% (Fig. 3AGo). No difference in their expression was apparent on the PND 7 arrays when compared to controls, and was supported by the PCR results (Fig. 3BGo).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. Effect of prenatal linuron exposure from gestation day (GD) 12 to 21 on the epididymal mRNA expression of Delta like (Dlk) and the Notch2 receptor (Notch2) on GD 21 (A) and PND 7 (B). Total RNA from fetal and postnatal epididymides was subjected to real-time RT-PCR analysis. The results shown represent the relative change in expression compared to the control group where the mean expression is assumed to be 100%. The data presented are % means ± SE, where n = 4 control samples (4 litters) and n = 7 linuron-exposed samples (6 litters) on GD21, and n = 5 control samples (3 litters) and n = 6 linuron-exposed samples (6 litters) on PND 7. *p < 0.05 was significantly different from the corresponding control groups.

 
Effect of Linuron on Insulin-Like Growth Factor-1 Receptor mRNA Expression in Epididymides
Array analysis suggested that mRNA expression of IGF-1 was increased in the epididymides from linuron-exposed rats on GD 21 and that IGF-1R mRNA expression was increased on PND 7. A change in IGF-1R expression was confirmed by real-time RT-PCR, although the direction of the change in expression was found to be opposite to that indicated by the arrays. IGF-1R mRNA expression was significantly decreased relative to the control group on GD 21 and PND 7 by 42% and 32%, respectively (Fig. 4Go). However, IGF-1 mRNA expression was not significantly altered at either time point (Fig. 4Go). IGFBP5 mRNA expression was significantly reduced in the linuron group by 38% in comparison to the controls (Fig. 4BGo). No change in IGFBP5 expression was detected by the arrays or by PCR on GD 21, where as the expression of IGFBP5 appeared to be increased relative to the control samples on the PND 7 arrays.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 4. Effect of prenatal linuron exposure from gestation day (GD) 12 to 21 on the epididymal mRNA expression of insulin-like growth factor-1 receptor (IGF-1R), and insulin-like growth factor–1 (IGF-1), and insulin-like growth factor binding protein 5 (IGFBP5) on GD 21 (A) and PND 7 (B). Total RNA from fetal and postnatal epididymides was subjected to real-time RT-PCR analysis. The results shown represent the relative change in expression compared to the control group where the mean expression is assumed to be 100%. The data presented are % means ± SE, where n = 4 control samples (4 litters) and n = 7 linuron-exposed samples (6 litters) on GD 21 and n = 5 control samples (3 litters) and n = 6 linuron-exposed samples (6 litters) on PND 7; *p < 0.05 was significantly different from the corresponding control group.

 
Effect of Linuron on mRNA Expression of Bone Morphogenetic Protein 4 and One of Its Receptors in Epididymides
Comparison of the arrays hybridized with GD 21 epididymal samples indicated that the mRNA expression of BMP2 and BMP4 were decreased in the linuron group. Real-time RT-PCR confirmed that steady-state levels of these two mRNAs were significantly decreased relative to the control group by 45 and 34%, respectively (Fig. 5AGo). There was no indication from the array analysis that BMP2 and BMP4 mRNA expression was altered on PND 7. However, real-time PCR showed that BMP4 mRNA expression was significantly reduced by 43% in epididymides in the linuron group (Fig. 5BGo). Since BMP4 mRNA expression was altered at both GD 21 and PND 7, primers were designed to quantitate the expression of the two receptors that bind BMP4, BMPR-1A (also known as ALK3), and BMPR-1B (also known as ALK6) (ten Dijke et al., 1994Go). Real-time PCR showed that expression of BMPR-1B was significantly decreased relative to the controls on both GD 21 and PND 7 by 70 and 39%, respectively (Fig. 5Go). BMPR-1A mRNA expression was not altered at either time point.



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 5. Effect of prenatal linuron exposure from gestation day (GD) 12 to 21 on the epididymal mRNA expression of bone morphogenetic protein 2 (BMP2), BMP4, the BMP-1A receptor (BMPR-1A), and the BMP-1B receptor (BMPR-1B) on GD 21 (A) and PND 7 (B). Total RNA from fetal and postnatal epididymides was subjected to real-time RT-PCR analysis. The results shown represent the relative change in expression compared to the control group where the mean expression is assumed to be 100%. The data presented are % mean ± SE, where n = 4 control samples (4 litters) and n = 7 linuron-exposed samples (6 litters) on GD 21, and n = 5 control samples (3 litters) and n = 6 linuron-exposed samples (6 litters) on PND 7; *p < 0.05 was significantly different from the corresponding control group.

 
Effect of Linuron on mRNA Expression of Fibroblast Growth Factor Receptor 2, Glypican, and Tissue Inhibitor of Metalloproteinases 3 in Epididymides
To evaluate whether mRNA expression of members of the fibroblast growth factor (FGF) signaling pathway were altered during perturbation of epididymal development by linuron, attempts were made to design primers to FGFR2, as well as FGFs 2, 7, and 10. Suitable primers were designed to allow quantitation of FGFR2 and FGF10. The primers to FGFR2 recognized the iiib variant, which is expressed in epithelial cells, and the iiic variant, which is expressed in mesenchyme cells (Ornitz et al., 1996Go). Real-time RT-PCR demonstrated that FGFR2 mRNA expression was significantly reduced by 34% in epididymides in the linuron group on PND 7 but not on GD 21 (Fig. 6Go). No alteration in FGF10 mRNA expression was detected at either time point (data not shown). FGFR2 was not present on the arrays, and the expression of FGFs 2, 7, and 10 was variable between arrays from the same treatment group.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 6. Effect of prenatal linuron exposure from gestation day (GD) 12 to 21 on the epididymal mRNA expression of fibroblast growth factor receptor 2 (FGFR2), the heparan sulfate proteoglycan, glypican, and tissue inhibitor of metalloproteinases 3 (TIMP3), on GD 21 (A) and PND 7 (B). Total RNA from fetal and postnatal epididymides was subjected to real-time RT-PCR analysis. The results shown represent the relative change in expression compared to the control group where the mean expression is assumed to be 100%. The data presented are % means ± SE, where n = 4 control samples (4 litters) and n = 7 linuron-exposed samples (6 litters) on GD 21, and n = 5 control samples (3 litters) and n = 6 linuron-exposed samples (6 litters) on PND 7; *p < 0.05 was significantly different from the corresponding control groups.

 
The PND 7 array comparisons indicated that glypican1, a heparan sulfate gycoprotein expressed on the cell surface, was upregulated in epididymides from the linuron group. Real-time RT-PCR showed that glypican mRNA expression was significantly decreased in the epididymides from the pups exposed to linuron in utero on GD 21 and PND 7 by 32 and 27%, respectively (Fig. 6Go).

Array analysis on PND 7 showed that mRNA expression of tissue inhibitor of metalloproteinases 3 (TIMP3) and matrixmetalloproteinase 16 (MMP16) were upregulated in the linuron group. Real-time RT-PCR demonstrated a significant reduction (33%) in TIMP3 mRNA, whereas expression of MMP16 showed no change on PND 7 (data not shown, Fig. 6BGo). No alterations in TIMP3 and MMP16 expression were observed on GD 21 by real-time RT-PCR. Although no change in TIMP3 expression was indicated by the arrays at this time point, the arrays did suggest that MMP16 was decreased relative to the control group.

Since many of the receptors analyzed above are expressed in epithelial cells, it was important to determine whether there were any changes in the relative amounts of the epithelial and mesenchymal tissue compartments as a result of exposure to linuron. Cytokeratin 8 mRNA was selected as a marker of the epididymal epithelium since it is expressed within the epithelial cells of the Wolffian duct (Sainio et al., 1997Go). Fibronectin mRNA expression was also quantitated since fibronectin is a component of the basement membrane that is synthesized by stromal cells; changes in fibronectin levels are associated with epithelial proliferation (Woodward et al., 2001Go). The epididymal expression of these two mRNAs in the linuron group was not altered relative to the controls at either time point, suggesting that the changes in steady-state mRNA levels described above are not the result of a marked change in the ratio of epithelial to mesenchymal cells (data not shown).

Immunolocalization of Androgen Receptor and IGF-1 Receptor
Immunohistochemical localization of AR within epididymides from control fetuses confirmed previous reports that the receptor is expressed in the nuclei of both mesenchymal and epithelial cells on GD 21 (Fig. 7AGo). On GD 21, AR immunoexpression in controls was more abundant in the mesenchyme when compared with the epithelium. This pattern of AR immunostaining was altered in malformed epididymides from linuron-exposed fetuses such that AR immunostaining in the ductal epithelial cells was decreased (Fig. 7BGo). In some fetuses with epididymides showing decreased coiling, the number of AR-positive mesenchymal cells appeared reduced (data not shown); however, the response was variable. On PND 7, immunostaining for the AR in control epididymides was more intense in the ductal epithelial cells in comparison with that seen on GD 21 (data not shown). In addition, the density of mesenchymal cells surrounding the ducts and expressing AR was greatly reduced in comparison to GD 21 epididymides. This pattern of immunostaining was not altered by prenatal exposure to linuron (data not shown). AR immunoexpression was absent in sections incubated with antisera preabsorbed with peptide.



View larger version (184K):
[in this window]
[in a new window]
 
FIG. 7. Comparative expression of androgen receptor (AR) and insulin-like growth factor-1 receptor (IGF-1R) in the epididymides of rats on GD 21 and PND 7 following in utero exposure to 50 mg/kg/day linuron from GD 12. Images of AR (A, B) and IGF-1R (C–F) immunostaining in the caput region of the epididymis are shown from control (A, C, E) and linuron-exposed (B, D, F) fetuses on GD 21 (A–D) and from rats on PND 7 (E–F). AR protein was localized to the nuclei of epithelial and mesenchymal cells. AR immunoexpression was decreased in the ductal epithelial cells of malformed epididymides on GD 21. IGF-1R protein was localized to the cytoplasm of epithelial and mesenchymal cells. IGF-1R immunoexpression was decreased in the mesenchyme cells of epididymides from rats exposed to linuron. The inset (panel E) shows a PND 7 epididymal section incubated with peptide-absorbed antiserum, demonstrating that the immunostaining for IGF-1R is specific. Magnification A and B, x250; C through F, x500.

 
On GD 21 and PND 7, immunostaining for the IGF-1R was detected in the cytoplasm of both the ductal epithelial cells and the mesenchymal cells immediately surrounding the ducts (Fig. 7C, EGo). Immunoexpression of IGF-1R was slightly decreased in the mesenchymal cells of malformed epididymides on GD 21 (Fig. 7C, DGo). This reduction in immunoexpression of IGF-1R within the mesenchymal cells was also apparent on PND 7 in the epididymides from the linuron group (Fig. 7E, FGo). Specificity of the antiserum was confirmed by the absence of immunostaining in sections incubated with antisera preabsorbed with peptide (Fig. 7EGo, inset).


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The objective of the present study was to identify alterations in gene expression associated with linuron-induced malformations of the epididymis. Since linuron is an AR antagonist, we hypothesized that changes in gene expression would be a result of inhibition of AR signaling. Real-time RT-PCR identified changes in mRNA expression in a variety of growth factor signaling pathways that were consistent with a disturbance of paracrine interactions between the mesenchymal and epithelial cells within the Wollfian ducts of linuron-exposed fetuses. Further investigation is required to determine whether these changes in the pattern of gene expression are the direct result of repression of AR-mediated gene transactivation or are secondary events downstream of the AR.

Several studies have demonstrated that prenatal exposure to linuron induces epididymal malformations; however, the incidence was variable such that only 20–40% of male offspring displayed lesions and not all offspring from within the same litter were affected (McIntyre et al., 2000Go, 2002aGo,McIntyre et al., bGo). This was also observed in the present study such that 20–30% of the male fetuses had epididymal malformations on GD 21 and only half of the litters had affected fetuses. Epididymal malformations have never been observed in control Sprague-Dawley rats during any of the studies that have been performed by our laboratory. Lambright et al. (2000)Go have shown that administration of a higher dose of linuron (100 mg/kg/day) from GD 14 to 18 resulted in a greater than 50% incidence in epididymal lesions in the adult offspring. This issue of variability in response was not addressed in the present study; however, a study investigating the distribution and metabolism of linuron within the pregnant dam and her male offspring would help to understand this phenomenon. In a previous study performed by our laboratory, no apparent differences in Wolffian duct morphology were observed on GD 17, 19, and 21 in fetuses that had been exposed to 50 mg/kg/day linuron (McIntyre et al., 2002bGo). Alterations in gross morphology were not observed until PND 7. In the present study, alterations in the morphology of the Wolffian duct indicative of abnormal development were apparent on GD 21. A potential explanation for this discrepancy in incidence of abnormalities is the use of dissection microscopes that employ transillumination, which improves the ability of the dissector to evaluate whether the Wolffian duct is intact and exhibits normal ductal coiling. The variability in incidence of epididymal lesions that has been observed may also contribute to the discrepancy. Androgens are required for stabilization and induction of coiling of the Wolffian duct during GD 17 to 21 in the rat (George and Wilson, 1994Go). Thus, morphological differences should be apparent by GD 21 if androgen action is inhibited during fetal development. The incidence of epididymal abnormalities observed on GD 21 appeared to be greater than that observed on PND 7. A significant number of epididymides looked underdeveloped (intact with decreased coiling) and it is possible that with the cessation of linuron-exposure that these epididymides may recover during postnatal life. Whereas epididymides displaying no coiling or with noncontiguous ducts will result in the permanent malformations observed in adulthood. However, it is difficult to draw definite conclusions about the ability of underdeveloped epididymides to undergo complete recovery when there is such a variable incidence in epididymal lesions from study to study.

Microarray and real-time RT-PCR analysis of testes from the fetuses with epididymides that displayed decreased or no ductal coiling did not identify any consistent alterations in gene expression in comparison with the control group. This supported the observations of McIntyre et al. (2002b)Go, who demonstrated that fetal testosterone concentration was not reduced by exposure to the 50-mg/kg/day linuron dose from GD 12. Moreover, there was no evidence of testicular pathology in testes examined during late gestation and early postnatal life (McIntyre et al., 2002bGo). Fetal testicular mRNA expression was altered by prenatal exposure to 50 mg/kg/day flutamide, a more potent AR antagonist than linuron, which downregulated the expression of several genes involved in cholesterol synthesis and enhanced expression of P450scc and 17{alpha}OH during late gestation (Shultz et al., 2001Go). These gene changes occurred in the absence of any alteration in testosterone concentration. Evaluation of the expression of 10 testicular mRNAs by real-time RT-PCR was unable to identify any alterations in expression between the control and linuron samples. Based on the limited data available linuron did not appear to significantly alter testicular gene expression on GD 21, which is in agreement with the hypothesis that the epididymis is the primary target of linuron-induced developmental toxicity (McIntyre et al., 2002aGo,bGo).

Linuron exposure disrupts stabilization and differentiation of the upper Wolffian duct into the epididymis, and the most plausible mode of action appears to be attenuation of AR signaling within the Wolffian duct. An alteration in AR signaling during development of the Wolffian duct was supported by the observation that AR mRNA expression was decreased in epididymides on GD 21 following exposure to linuron. Furthermore, AR immunoexpression was decreased in the ductal epithelial cells of severely malformed epididymides and was reduced in the mesenchymal cells of epididymides showing reduced ductal coiling. Epididymal AR immunoexpression has been shown to be modulated by AR antagonists or inhibition of testosterone levels during fetal life (Bentvelsen et al., 1995Go; Mylchreest et al., 2002Go). Treatment of pregnant rats with 100 mg/kg/day flutamide from GD 11 to 20 resulted in a complete absence of AR immunostaining in the mesenchyme surrounding Wolffian ducts removed from fetuses on GD 21 (Bentvelsen et al., 1995Go). Mylchreest et al.(2002)Go reported that AR immunoexpression was decreased in mesenchymal and epithelial cells of fetal epididymides following flutamide treatment. Gestational exposure to 500 mg/kg/day DBP, an inhibitor of fetal testosterone production, resulted in similar effects on AR immunoexpression as seen with linuron exposure, such that AR immunostaining was absent from the ductal epithelial cells in severely malformed epididymides (Mylchreest et al., 2002Go). This dose level of DBP did not induce maternal toxicity or any changes in litter parameters.

Several studies have proposed that EGF may be involved in the development of the male reproductive system; thus, the decrease in epididymal EGFR mRNA expression observed in the present study, following linuron exposure, was of note. Cain et al. (1994aGo,b)Go demonstrated that epididymal abnormalities induced by flutamide treatment of either pregnant rats or mice could be reversed by the supplementation of EGF during gestation. In vitro studies utilizing mouse genital tract explants have shown that EGF mediated partial masculinization of the Wolffian duct, and that the presence of antisera to either EGF or its receptor inhibits development of the Wolffian duct, even in the presence of testosterone (Gupta, 1996Go; Gupta et al., 1991Go). EGF protein has been localized to the epithelial cells of the mouse Wolffian duct and both protein and mRNA expression are reduced by prenatal exposure to flutamide (Gupta, 1997Go; Gupta and Singh, 1996Go). The receptors for EGF are also expressed in the epithelium of the Wolffian duct (Bossert et al., 1990Go). EGF can stimulate androgen-binding activity and enhance androgen-induced transcriptional activity in cells of the mouse reproductive tract in vitro (Gupta,1999Go). It has been proposed that activation of the mitogen-activated protein kinase signal transduction cascade by EGF may induce phosphorylation of the AR; this phosphorylation is essential for AR-mediated transcriptional activity (Gupta, 1999Go).

Alterations in Dlk and Notch2 mRNA expression in fetal epididymides on GD 21 were of interest, since the proteins encoded by these genes are known to be members of a highly conserved signaling pathway that operates between adjacent cells and is important for determining cell fate decisions during development (Artavanis-Tsakonas et al., 1999Go). Dlk is known to be expressed in embryonic tissues, but its presence in the male reproductive tract has not been reported previously. The expression of Dlk in several tissues correlates with cellular maturation such that differentiation is accompanied by a downregulation of Dlk expression (Laborda, 2000Go). The increased steady-state levels of Dlk mRNA expression in epididymides, following linuron treatment, may indicate a delay or block in cell differentiation. The role of Notch2 in mammalian development is not well defined, but Notch2 signaling appears to be essential for normal morphogenesis of several epithelial tissues in Drosophila (for references, see McCright et al., 2002Go).

Real-time RT-PCR analysis confirmed that components of the IGF-1 signaling pathway in fetal epididymides appeared to be decreased in expression following linuron exposure. The IGF system is known to be essential for normal embryonic and fetal growth (Stewart and Rotwein, 1996Go). Mice homozygous for a null mutation in the IGF-1 gene were infertile dwarfs and all androgen-dependent organs were decreased in size, which was consistent with an 80% reduction in testosterone production in these mice (Baker et al., 1996Go). However, the reduction in weight of the epididymis was not uniform for the entire length of the duct, such that the corpus and cauda regions were more severely affected than the caput, and the cauda showed decreased ductal coiling. The pattern of expression of IGF-1 and IGF-1R has been evaluated in rodent epididymides only during postnatal life. IGF-1 mRNA expression has been localized to the myofibroblast cells surrounding the epididymal duct but not the epithelial cells (Baker et al., 1996Go), while the protein is present in the myofibroblast cells and in the apical cytoplasm of the epithelial cells (Leheup and Grignon, 1993Go). The mRNA and protein for IGF-1R are expressed in epithelial cells (Antich et al., 1995Go; Baker et al., 1996Go). There were no previous reports of androgen regulation of IGF-1R expression at either the mRNA or protein level within the epididymis. However, testosterone has been shown to increase the mRNA expression of IGF-1 and IGF-1R in growing follicles of the primate ovary (Vendola et al., 1999Go). IGFBP5 levels can also be modulated by androgens. In vitro studies utilizing foreskin fibroblasts have shown that coexposure to testosterone and IGF-1 increased the abundance of IGFBP5 bound within the extracellular matrix (Yoshizawa and Clemmons, 2000Go). Thus, IGFBP5 is ideally localized to regulate the availability of IGF-1 to its receptor by providing a local storage depot of the growth factor.

Bone morphogenetic proteins are members of the TGF-ß superfamily and are involved in the development of many organs and tissues (Hogan, 1996Go). No reports were found in the literature demonstrating androgen regulation of either BMP4 or BMPR-1B mRNA expression. BMP4 is usually expressed in regions of developing organs where inductive paracrine interactions occur between the mesenchyme and the adjacent epithelium (Hogan, 1996Go). Consistent with this pattern of localization, BMP4 has been shown to regulate ductal budding and elongation into the surrounding mesenchyme during branching morphogenesis in the developing prostate (Lamm et al., 2001Go), kidney (Miyazaki et al., 2000Go), and lung (Weaver et al., 2000Go). Expression of the BMP4 receptors has been localized within the Wolffian duct and showed contrasting patterns of expression such that BMPR-1B (ALK6) mRNA expression was confined to the epithelium of the Wolffian ducts (Clarke et al., 2001Go), while BMPR-1A (ALK3) mRNA was expressed in mesenchymal cells in fetal mice (Jamin et al., 2002Go). Developing epididymides do not display ductal branching, but instead the duct undergoes complex coiling to give rise to morphologically distinct regions. BMP4 may conceivably play some role in defining how the duct coils in normal epididymal development.

The FGFs comprise a large family of proteins that are highly conserved in vertebrate species and have many diverse roles during embryonic development that include the regulation of cell proliferation, migration and differentiation (Goldfarb, 1996Go; Ornitz and Itoh, 2001Go). Similar to BMP4, FGFs and their receptors are also expressed at sites of mesenchymal-epithelial cell interactions and are involved in the regulation of branching morphogenesis in the prostate (Thomson, 2001Go), kidney (Qiao et al., 2001Go), and lung (Metzger and Krasnow, 1999Go). FGFs have been proposed as mediators of androgen-induced development of the male reproductive tract (Cunha et al., 1992Go; Thomson, 2001Go). Studies have shown that FGF10 mimics androgen-stimulated growth of the ventral prostate and seminal vesicles by eliciting growth and ductal branching (Thomson, 2001Go). FGF10 is a ligand for the iiib variant of the type 2 FGF receptor (FGFR2). In the present study, epididymal FGFR2 mRNA expression was decreased postnatally following linuron exposure. The primers used did not distinguish between the epithelial (FGFR2iiib) and mesenchymal (FGFR2iiic) isoforms of the receptor (Ornitz et al., 1996Go), Thus, it was not possible to implicate specific ligands that may be affected. However, an alteration in FGF signaling within epididymides was supported by the observation that steady-state levels of glypican1 mRNA expression were decreased in fetal and postnatal epididymides from rats exposed to linuron. Glypican belongs to a family of glycosylphosphatidylinositol anchored proteoglycans, which are attached to the cell surface and possess heparan sulfate chains (Litwack et al., 1998Go). FGFs have a high affinity for heparan sulfate proteoglycans and require heparan for effective biological activity (Ornitz and Itoh, 2001Go). Glypicans have been shown to modulate the activity of FGFs in vitro (Bonneh-Barkay et al., 1997Go), and show marked changes in expression during fetal and postnatal development suggestive of their involvement in morphogenesis through the regulation of growth factor signaling pathways (Litwack et al., 1998Go; Song and Filmus, 2002Go).

Growth factors are the main determinants of cell fate. However, the extracellular matrix, as well as providing mechanical support to cells, can also modulate cell proliferation and differentiation by regulating the availability of growth factors reaching the cell surface (Streuli, 1999Go). Tissue morphogenesis is associated with reorganization of the components of the extracellular matrix and this process is regulated by matrix metalloproteinases (MMPs) and their inhibitors (TIMPs; Streuli, 1999Go). In addition to observing decreases in mRNA expression of IGFBP5 and glypican, the expression of TIMP3 was decreased in postnatal epididymides from rats exposed to linuron in utero. TIMP3 is the only member the MMP inhibitor family that is bound to the extracellular matrix and this would imply that TIMP3 provides local restriction of MMP activity (Yeow et al., 2002Go). TIMP3 may to be involved in regulating extracellular matrix reorganization during the folding and branching of ductal epithelia, since TIMP3 is specifically localized to the epithelia of ductal organs in the developing mouse embryo (Apte et al., 1994Go). In support of a role for TIMP3 in ductal branching, mRNA expression of MMPs decreased while TIMP3 showed a marked increase in expression as the structural complexity of the branching tubules increased during branching morphogenesis of the ureteric bud in vitro (Pohl et al., 2000Go). In the present study, disruption of epididymal development was associated with a decrease in TIMP3 mRNA expression, which may be a reflection of the decreased ductal coiling that was observed. Further work is required to address whether the MMP to TIMP ratio is altered, which would be indicative of a disruption in the normal turnover of the extracellular matrix.

In summary, we demonstrate that exposure to linuron in utero results in altered expression of genes within the epididymis known to be involved in growth factor signaling and tissue morphogenesis. Immunohistochemical evaluation of the cellular distribution of protein expression for AR and IGF-1R was supportive of the mRNA changes observed. The specific functions of many of these genes during the development and differentiation of the epididymis have not been established. However, the changes observed were consistent with a disruption of paracrine interactions between mesenchymal and epithelial cells. The fundamental importance of these growth-factor signaling pathways is highlighted by the fact that they have been conserved during evolution (Gerhart, 1999Go). Further investigation is required to determine whether these changes in gene expression can be considered as biomarkers of abnormal development of the epididymis or represent alterations in cell communication as a consequence of attenuation of AR signaling. Evaluation of the gene expression profiles in linuron-exposed epididymides that did not display any visible abnormalities would aid correlation of the changes in gene expression with pathogenesis. Additional studies are necessary to examine the time course of alterations in gene expression in relation to protein levels and Wolffian duct morphology on GD 17 through to GD 21, since this represents the most critical period for testosterone-mediated stabilization and differentiation of the Wolffian duct.


    ACKNOWLEDGMENTS
 
The authors would like to thank Kim Lehmann for technical assistance, Dr. Kevin Gaido and Dr. David Dorman for critical review of this manuscript, and Dr. Barbara Kuyper for editorial review of the manuscript. The authors are very grateful to Mr. Paul Ross and the animal care staff and to Ms. Elizabeth Gross Bermudez and the necropsy and histology staff. This study was made possible by funds from the American Chemistry Council.


    NOTES
 
1 To whom all correspondence should be addressed at Merck Research Laboratories, WP 45–120, West Point, PA 19486. Fax: (215) 652-7758. E-mail: katie_turner{at}merck.com. Back

2 Present addresses: Schering-Plough Research Institute, Lafayette, NJ 07848 (B.S.M.); Aventis Pharmaceuticals, Bridgewater, NJ 08807 (N.J.B.); and National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (P.M.D.F.). Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Antich, M., Fabian, E., Sarquella, J., and Bassas, L. (1995). Effect of testicular damage induced by cryptorchidism on insulin-like growth factor I receptors in rat Sertoli cells. J. Reprod. Fertil. 104, 267–275.[Abstract]

Apte, S. S., Hayashi, K., Seldin, M. F., Mattei, M. G., Hayashi, M., and Olsen, B. R. (1994). Gene encoding a novel murine tissue inhibitor of metalloproteinases (TIMP), TIMP-3, is expressed in developing mouse epithelia, cartilage and muscle, and is located on mouse chromosome 10. Dev. Dyn. 200, 177–197.[ISI][Medline]

Artavanis-Tsakonas, S., Rand, M. D., and Lake, R. J. (1999). Notch signaling: Cell fate control and signal integration in development. Science 284, 770–776.[Abstract/Free Full Text]

Baker, J., Hardy, M. P., Zhou, J., Bondy, C., Lupu, F., Bellve, A. R., and Efstratiadis, A. (1996). Effects of an Igf1 gene null mutation on mouse reproduction. Mol. Endocrinol. 10, 903–918.[Abstract]

Bentvelsen, F. M., Brinkmann, A. O., van der Schoot, P., van der Linden, J. E., van der Kwast, T. H., Boersma, W. J., Schroder, F. H., and Nijman, J. M. (1995). Developmental pattern and regulation by androgens of androgen receptor expression in the urogenital tract of the rat. Mol. Cell. Endocrinol. 113, 245–253.[CrossRef][ISI][Medline]

Bonneh-Barkay, D., Shlissel, M., Berman, B., Shaoul, E., Admon, A., Vlodavsky, I., Carey, D. J., Asundi, V. K., Reich-Slotky, R., and Ron, D. (1997). Identification of glypican as a dual modulator of the biological activity of fibroblast growth factors. J. Biol. Chem. 272, 12415–12421.[Abstract/Free Full Text]

Bossert, N. L., Nelson, K. G., Ross, K. A., Takahashi, T., and McLachlan, J. A. (1990). Epidermal growth factor binding and receptor distribution in the mouse reproductive tract during development. Dev. Biol. 142, 75–85.[ISI][Medline]

Cain, M. P., Kramer, S. A., Tindall, D. J., and Husmann, D. A. (1994a). Alterations in maternal epidermal growth factor (EGF) effect testicular descent and epididymal development. Urology 43, 375–378.[CrossRef][ISI][Medline]

Cain, M. P., Kramer, S. A., Tindall, D. J., and Husmann, D. A. (1994b). Epidermal growth factor reverses antiandrogen-induced cryptorchidism and epididymal development. J. Urol. 152, 770–773.[ISI][Medline]

Clarke, T. R., Hoshiya, Y., Yi, S. E., Liu, X., Lyons, K. M., and Donahoe, P. K. (2001). Mullerian inhibiting substance signaling uses a bone morphogenetic protein (BMP)-like pathway mediated by ALK2 and induces SMAD6 expression. Mol. Endocrinol. 15, 946–959.[Abstract/Free Full Text]

Cunha, G. R., Alarid, E. T., Turner, T., Donjacour, A. A., Boutin, E. L., and Foster, B. A. (1992). Normal and abnormal development of the male urogenital tract. Role of androgens, mesenchymal-epithelial interactions, and growth factors. J. Androl. 13, 465–475.[Abstract]

George, F. W., and Wilson, J. D. (1994). Sex determination and differentiation. In The Physiology of Reproduction (E. Knobil and J. D. Neill, Eds.). Raven Press, New York.

Gerhart, J. (1999). 1998 Warkany lecture: "Signaling Pathways in Development." Teratology 60B, 226–239.[CrossRef][ISI][Medline]

Goldfarb, M. (1996). Functions of fibroblast growth factors in vertebrate development. Cytokine Growth Factor Rev. 7, 311–325.[CrossRef][Medline]

Gupta, C. (1996). The role of epidermal growth factor receptor (EGFR) in male reproductive tract differentiation: Stimulation of EGFR expression and inhibition of Wolffian duct differentiation with anti-EGFR antibody. Endocrinology 137, 905–910.[Abstract]

Gupta, C. (1997). Cellular localization of immunoreactive epidermal growth factor during Wolffian duct differentiation of the fetal mouse. Urol. Res. 25, 277–281.[ISI][Medline]

Gupta, C. (1999). Modulation of androgen receptor (AR)-mediated transcriptional activity by EGF in the developing mouse reproductive tract primary cells. Mol. Cell. Endocrinol. 152, 169–178.[CrossRef][ISI][Medline]

Gupta, C., Siegel, S., and Ellis, D. (1991). The role of EGF in testosterone-induced reproductive tract differentiation. Dev. Biol. 146, 106–116.[CrossRef][ISI][Medline]

Gupta, C., and Singh, M. (1996). Stimulation of epidermal growth factor gene expression during the fetal mouse reproductive tract differentiation: Role of androgen and its receptor. Endocrinology 137, 705–711.[Abstract]

Higgins, S. J., Young, P., and Cunha, G. R. (1989). Induction of functional cytodifferentiation in the epithelium of tissue recombinants: II. Instructive induction of Wolffian duct epithelia by neonatal seminal vesicle mesenchyme. Development 106, 235–220.[Abstract]

Hogan, B. L. (1996). Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10, 1580–1594.[CrossRef][ISI][Medline]

Jamin, S. P., Arango, N. A., Mishina, Y., Hanks, M. C., and Behringer, R. R. (2002). Requirement of Bmpr1a for Mullerian duct regression during male sexual development. Nat. Genet. 32, 408–410.[CrossRef][ISI][Medline]

Laborda, J. (2000). The role of the epidermal growth factor-like protein dlk in cell differentiation. Histol. Histopathol. 15, 119–129.[ISI][Medline]

Lambright, C., Ostby, J., Bobseine, K., Wilson, V., Hotchkiss, A. K., Mann, P. C., and Gray, L. E., Jr. (2000). Cellular and molecular mechanisms of action of linuron: An antiandrogenic herbicide that produces reproductive malformations in male rats. Toxicol. Sci. 56, 389–399.[Abstract/Free Full Text]

Lamm, M. L., Podlasek, C. A., Barnett, D. H., Lee, J., Clemens, J. Q., Hebner, C. M., and Bushman, W. (2001). Mesenchymal factor bone morphogenetic protein 4 restricts ductal budding and branching morphogenesis in the developing prostate. Dev. Biol. 232, 301–314.[CrossRef][ISI][Medline]

Leheup, B. P., and Grignon, G. (1993). Immunohistochemical localization of insulin-like growth factor I (IGF- I) in the rat epididymis. J. Androl. 14, 159–163.[Abstract]

Litwack, E. D., Ivins, J. K., Kumbasar, A., Paine-Saunders, S., Stipp, C. S., and Lander, A. D. (1998). Expression of the heparan sulfate proteoglycan glypican-1 in the developing rodent. Dev. Dyn. 211, 72–87.[CrossRef][ISI][Medline]

McCright, B., Lozier, J., and Gridley, T. (2002). A mouse model of Alagille syndrome: Notch2 as a genetic modifier of Jag1 haploinsufficiency. Development 129, 1075–1082.[ISI][Medline]

McIntyre, B. S., Barlow, N. J., and Foster, P. M. D. (2002a). Male rats exposed to linuron in utero exhibit permanent changes in anogenital distance, nipple retention, and epididymal malformations that result in subsequent testicular atrophy. Toxicol. Sci. 65, 62–70.[Abstract/Free Full Text]

McIntyre, B. S., Barlow, N. J., Sar, M., Wallace, D. G., and Foster, P. M. (2002b). Effects of in utero linuron exposure on rat Wolffian duct development. Reprod. Toxicol. 16, 131–139.[CrossRef][ISI][Medline]

McIntyre, B. S., Barlow, N. J., Wallace, D. G., Maness, S. C., Gaido, K. W., and Foster, P. M. D. (2000). Effects of in utero exposure to linuron on androgen-dependent reproductive development in the male Crl:CD(SD)BR rat. Toxicol. Appl. Pharmacol. 167, 87–99.[CrossRef][ISI][Medline]

Metzger, R. J., and Krasnow, M. A. (1999). Genetic control of branching morphogenesis. Science 284, 1635–1639.[Abstract/Free Full Text]

Miyazaki, Y., Oshima, K., Fogo, A., Hogan, B. L., and Ichikawa, I. (2000). Bone morphogenetic protein 4 regulates the budding site and elongation of the mouse ureter. J. Clin. Invest. 105, 863–873.[Abstract/Free Full Text]

Mylchreest, E., Sar, M., Wallace, D. G., and Foster, P. M. (2002). Fetal testosterone insufficiency and abnormal proliferation of Leydig cells and gonocytes in rats exposed to di(n-butyl) phthalate. Reprod. Toxicol. 16, 19–28.[CrossRef][ISI][Medline]

National Research Council (1996). Guide for the Care and Use of Laboratory Animals. National Academy Press, Washington, DC.

Ornitz, D. M., and Itoh, N. (2001). Fibroblast growth factors. Genome Biol. 2, 3005.1–3005.9.

Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur, C. A., Coulier, F., Gao, G., and Goldfarb, M. (1996). Receptor specificity of the fibroblast growth factor family. J. Biol. Chem. 271, 15292–15297.[Abstract/Free Full Text]

Pohl, M., Sakurai, H., Bush, K. T., and Nigam, S. K. (2000). Matrix metalloproteinases and their inhibitors regulate in vitro ureteric bud branching morphogenesis. Am. J. Physiol. Renal Physiol. 279, F891–F900.[Abstract/Free Full Text]

Qiao, J., Bush, K. T., Steer, D. L., Stuart, R. O., Sakurai, H., Wachsman, W., and Nigam, S. K. (2001). Multiple fibroblast growth factors support growth of the ureteric bud but have different effects on branching morphogenesis. Mech. Dev. 109, 123–135.[CrossRef][ISI][Medline]

Sainio, K., Hellstedt, P., Kreidberg, J. A., Saxen, L., and Sariola, H. (1997). Differential regulation of two sets of mesonephric tubules by WT-1. Development 124, 1293–1299.[Abstract/Free Full Text]

Shultz, V. D., Phillips, S., Sar, M., Foster, P. M., and Gaido, K. W. (2001). Altered gene profiles in fetal rat testes after in utero exposure to di(n-butyl) phthalate. Toxicol. Sci. 64, 233–242.[Abstract/Free Full Text]

Song, H. H., and Filmus, J. (2002). The role of glypicans in mammmalin development. Biochim. et Biophys. Acta 1573, 241–246.[ISI][Medline]

Stewart, C. E., and Rotwein, P. (1996). Growth, differentiation, and survival: Multiple physiological functions for insulin-like growth factors. Physiol. Rev. 76, 1005–1026.[Abstract/Free Full Text]

Streuli, C. (1999). Extracellular matrix remodelling and cellular differentiation. Curr. Opin. Cell Biol. 11, 634–640.[CrossRef][ISI][Medline]

ten Dijke, P., Yamashita, H., Sampath, T. K., Reddi, A. H., Estevez, M., Riddle, D. L., Ichijo, H., Heldin, C. H., and Miyazono, K. (1994). Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4. J. Biol. Chem. 269, 16985–16988.[Abstract/Free Full Text]

Thomson, A. A. (2001). Role of androgens and fibroblast growth factors in prostatic development. Reproduction 121, 187–195.[Abstract/Free Full Text]

Tsuji, M., Shima, H., and Cunha, G. R. (1991). In vitro androgen-induced growth and morphogenesis of the Wolffian duct within urogenital ridge. Endocrinology 128, 1805–1811.[Abstract]

United States Environmental Protection Agency (U.S. EPA) (1995). Re-registration eligibility document for linuron. Environmental Protection Agency, Washington, DC.

Vendola, K., Zhou, J., Wang, J., and Bondy, C. A. (1999). Androgens promote insulin-like growth factor-I and insulin-like growth factor-I receptor gene expression in the primate ovary. Hum. Reprod. 14, 2328–2332.[Abstract/Free Full Text]

Warren, D. W., Haltmeyer, G. C., and Eik-Nes, K. B. (1973). Testosterone in the fetal rat testis. Biol. Reprod. 8, 560–565.[ISI][Medline]

Weaver, M., Dunn, N. R., and Hogan, B. L. (2000). Bmp4 and Fgf10 play opposing roles during lung bud morphogenesis. Development 127, 2695–2704.[Abstract/Free Full Text]

Woodward, T. L., Mienaltowski, A. S., Modi, R. R., Bennett, J. M., and Haslam, S. Z. (2001). Fibronectin and the alpha(5)beta(1) integrin are under developmental and ovarian steroid regulation in the normal mouse mammary gland. Endocrinology 142, 3214–3222.[Abstract/Free Full Text]

Yeow, K. M., Kishnani, N. S., Hutton, M., Hawkes, S. P., Murphy, G., and Edwards, D. R. (2002). Sorsby’s fundus dystrophy tissue inhibitor of metalloproteinases-3 (TIMP-3) mutants have unimpaired matrix metalloproteinase inhibitory activities, but affect cell adhesion to the extracellular matrix. Matrix Biol. 21, 75–88.[CrossRef][ISI][Medline]

Yoshizawa, A., and Clemmons, D. R. (2000). Testosterone and insulin-like growth factor (IGF) I interact in controlling IGF-binding protein production in androgen-responsive foreskin fibroblasts. J. Clin. Endocrinol. Metab. 85, 1627–1633.[Abstract/Free Full Text]