Localization of a blood pressure QTL on rat chromosome 1 using Dahl rat congenic strains

YASSER SAAD, MICHAEL R. GARRETT, SOON JIN LEE, HOWARD DENE and JOHN P. RAPP

Department of Physiology and Molecular Medicine, Medical College of Ohio, Toledo, Ohio 43614-5804


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Saad, Yasser, Michael R. Garrett, Soon Jin Lee, Howard Dene, and John P. Rapp. Localization of a blood pressure QTL on rat chromosome 1 using Dahl rat congenic strains. Physiol. Genomics 1: 119–125, 1999.—We previously reported that markers on rat chromosome 1 are genetically linked to blood pressure in an F2 population derived from Dahl salt hypertension-sensitive (S) and Lewis (LEW) rats. Because there was evidence for more than one blood pressure quantitative trait locus (QTL) on chromosome 1, an initial congenic strain introgressing a large 118-centimorgan (cM) segment of LEW chromosome 1 into the S background had been constructed. This initial congenic strain had a reduced blood pressure compared with S rats, proving the existence of a blood pressure QTL, but not giving a good localization of the QTL. In the present work a series of five overlapping congenic substrains were produced from the original congenic strain in order to localize a blood pressure QTL to a 25-cM region near the center of chromosome 1. The congenic substrains also ruled out the Sa locus as a blood pressure QTL in the S vs. LEW comparison because the Sa locus was contained in a congenic substrain that did not alter blood pressure.

Sa gene; genetic hypertension; salt-sensitive hypertension; cardiac hypertrophy


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
GENETIC MARKERS on rat chromosome (chr) 1 have been shown to be genetically linked to blood pressure in genetic crosses involving spontaneously hypertensive rats (SHR; 12, 14, 15, 17, 20, 22, 27), Dahl salt-sensitive (S) rats (5, 7, 9), Sabra hypertensive (SBH) rats (30), or fawn-hooded rats (FHR) (2). In all these studies the alleles from the hypertensive strain were associated with increased blood pressure, and the alleles from the normotensive strain were associated with lower blood pressure.

Linkage analysis for quantitative traits such as blood pressure yields only a very approximate localization of the locus controlling the trait (quantitative trait locus, QTL). Further analysis usually takes the form of construction of a congenic strain whereby a chromosomal segment from one strain (donor) is introgressed into another strain (recipient) by a backcross breeding scheme. If a variant allele for a blood pressure QTL is present in the chromosomal segment moved, then the resulting congenic strain will have a blood pressure different from the recipient strain. The congenic strategy is critical to 1) confirm or refute initial linkage analysis, and 2) provide better chromosomal localization of the QTL by construction of congenic substrains with progressively smaller introgressed chromosomal segments (25).

We had previously constructed a congenic strain introgressing a large segment of chr 1 from Lewis (LEW) rats into Dahl S rats (5). In agreement with the linkage analysis using S and LEW (7) the introgressed LEW segment lowered blood pressure in the congenic strain compared with S rats. In the present work congenic substrains were constructed and an improved localization of a blood pressure QTL near the center of chr 1 was obtained.

Our initial congenic strain included the Sa gene, which has been proposed as a candidate for influencing blood pressure in SHRs. The Sa gene was discovered by Iwai and Inagami (13) in a screening procedure to detect genes differentially expressed in the kidneys of SHR and Wistar-Kyoto rats (WKY). SHR kidney expressed higher Sa mRNA levels compared with WKY. It was subsequently found that the Sa gene is mainly expressed in the renal proximal tubule (23, 31). The term Sa is arbitrary, and the function of the gene product is unknown. Polymorphisms in the Sa gene were also shown to cosegregate with its differential expression in a population derived from SHR and WKY (27), with the higher expression being associated with the SHR allele. The present work, however, excludes the Sa gene as a candidate for effects on blood pressure in the Dahl S vs. LEW strain comparison because the Sa locus is outside of the newly defined QTL region but was included in a congenic region that had no effect on blood pressure.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Strains.
Inbred Dahl salt-sensitive (SS/Jr) and Dahl salt-resistant (SR/Jr) strains, respectively designated S and R, were from our colony. Lewis rats (LEW/NCrlBR) were obtained from Charles River Laboratories (Wilmington, MA) and are referred to as LEW. Spontaneously hypertensive rats (SHR/NHsd), referred to as SHR, Brown Norway (BN), and WKY were obtained from Harlan-Sprague-Dawley (Indianapolis, IN). The Milan normotensive strain (MNS) originated from the Veterinary Resources Branch at the National Institutes of Health (Bethesda, MD), and Albino Surgery (AS) rats were from the National Institute for Medical Research (Mill Hill, UK). The congenic substrains, Chr1 x 3, Chr1 x 7, Chr1 x 8, Chr1 x 14 and Chr1 x 15 were derived from the original congenic strain, S.LEW(chr 1), developed earlier by introgressing a large segment of chr 1 from LEW rats into the S rat (5). To obtain the congenic substrains, the S.LEW(chr 1) congenic was crossed to the S strain to yield F1 rats that were heterozygous for the original introgressed chromosomal segment. F1 rats were intercrossed to obtain F2 rats that were genotyped for markers in the congenic segment to look for recombinants. Rats with appropriate recombinant chromosomes were crossed to S again to duplicate the recombinant chromosome. The offspring were genotyped to select rats retaining the desired recombinant region. Two rats with the same recombinant chromosomal segment were crossed and the litters were genotyped to obtain rats that were homozygous throughout the recombinant region of interest. The homozygous rats were crossed to fix the recombinant chromosomal segment in a new congenic substrain.

Genotyping.
DNA was extracted from a tail biopsy using the QIAamp tissue kit (Qiagen, Valencia, CA). PCR genotyping with microsatellite markers was done as described earlier (7). Markers for the Sa gene were developed previously (8); the Sa marker used is D1Mco13, previously called PSA1.

Blood pressure determination.
We employed an experimental design in which the blood pressure of a congenic strain was compared only to its own separate group of control S rats that were bred, housed, and studied concomitantly. Rats were weaned at 30 days of age to low salt (0.3% NaCl) Harlan Teklad diet 7034 (Madison, WI). Twenty male congenic substrain rats were matched by age and weight with twenty male S control rats and were caged in 10 cages; each cage contained two congenics and two S rats. At 40–42 days of age, the rats were fed a 2% NaCl Harlan Teklad diet (TD94217) for 24 days. Systolic blood pressure was measured using the tail-cuff method on conscious restrained rats warmed to 28°C. The operator did not know the identity of the rat during these measurements. Blood pressure was measured on each rat once a day for four consecutive days. The blood pressure value of each day was the average of three to four consistent readings. The final blood pressure value used was the averaged blood pressure value of the 4 days. Rats were killed with CO2, and body and heart weights were measured. Statistical analysis was done using programs from SPSS (Chicago, IL).

Heart weight.
To corroborate the blood pressure data, heart weight was evaluated in two ways: heart weight-to-body weight ratio and heart weight adjusted for body weight. Heart weight-to-body weight ratio has been criticized because it is valid only if the regression of heart weight on body weight passes through the origin (1). In the present experiments such regression lines did pass through the origin in all but one case (Chr1 x 14). We have therefore also calculated heart weight adjusted for body weight using the regression equation relating heart and body weight (28) if the body weights differed between S and a congenic strain.

Marker development.
Microsatellite markers were identified using chromosome 1-sorted DNA as previously described (7, 10), except that the reamplification of the chromosome-sorted DNA was done using Cloned Pfu DNA polymerase from Stratagene (La Jolla, CA) and the PCR products were directly ligated using the zero blunt PCR cloning kit from Invitrogen (San Diego, CA). Clones were screened for CA and CT repeated elements and sequenced using the Thermo Sequenase radiolabeled terminator cycle sequencing kit from Amersham (Arlington Heights, IL). Newly developed markers were placed on the chromosome 1 map by genotyping 92 rats from our previously used F2(S x LEW) population of 151 rats. The chromosome 1 map was constructed using the MAPMAKER/EXP program (19) (http://www.genome.wi.mit.edu/ftp/distribution/mapmaker3/).

RNA analysis.
Kidneys were obtained from 42-day-old male rats fed 0.3% NaCl Teklad rat chow. RNA was extracted from whole kidney homogenate using the Ultraspec-II RNA isolation system from Biotecx Laboratories (Houston, TX). Northern analysis was done with 30 µg of total RNA using standard techniques. Hybridization of filters was done at 42°C using a partial Sa cDNA fragment, bases 1204–1890 of the published sequence (7, 13), labeled with 32P using the RadPrime DNA labeling system (Life Technologies, Gaithersburg, MD). The filter was also hybridized to 32P-labeled glyceraldehyde 3-phosphate dehydrogenase (G3PDH) to normalize for loading differences among the samples. The G3PDH fragment used as a probe was obtained by PCR amplification of rat genomic DNA using primers from Life Technologies (sense CCATGGAGAAGGCTGGG and antisense CAAAGTTGTCATGGATGACC).

Quantitative analysis of Sa gene expression.
Sa mRNA levels were quantitated using a Hewlett-Packard Scan Jet 3C scanner and NIH Image 1.61 software (Biomedical Magnetic Resonance Laboratory, University of Illinois at Urbana-Champaign). Quantitation was done on the same filter at different time exposures to ensure that the values obtained were not obtained from an overexposed X-ray film. Both Sa and G3PDH mRNA levels were quantitated, and the ratio of Sa to G3PDH was taken for purposes of normalization. The quantitative results obtained from S, Chr1 x 7, and SHR (each with n = 5) were analyzed using SPSS programs (Chicago, IL). A one-way analysis of variance (ANOVA) and a Bonferroni post hoc test (28) were done on the Sa-to-G3PDH ratios to determine significance of the Sa mRNA expression among the three strains tested.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Genetic markers.
To improve the rat chromosome 1 genetic map, nine new microsatellite markers were identified from chromosome-sorted DNA and linked to rat chromosome 1 (Table 1). In addition, 53 markers from the rat genome project (http://www.genome.wi.mit.edu) that are polymorphic between S and LEW were also placed on our genetic map of chromosome 1. An improved map of rat chromosome 1 based on the F2(S x LEW) cross is given in Fig. 1.


View this table:
[in this window]
[in a new window]
 
Table 1. New rat microsatellite markers for rat chromosome 1

 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 1. Linkage map of rat chromosome 1 with schematic showing introgressed chromosomal segments for various congenic substrains. Numbers at left of genetic map represent map distances in centimorgans (cM) with Kosambi's correction. Map was constructed from an F2(S x LEW) population with a minimum of 92 rats typed at each locus. Intervals marked with an asterisk (*) have been drawn shorter, in relative terms, than they actually should be. Solid bars, LEW congenic segment introgressed onto background of S rat. Open bars at ends of these congenic segments, regions of crossover between LEW and S. Horizontal dashed lines connect congenic bars to exact markers used in determining their ends. Crosshatched region of congenic substrain Chr1 x 8 is region that was segregating at time blood pressure was taken. Top: blood pressure and heart weight effects are shown as changes of congenic strain from control S value (congenic strains are identified at bottom). Bottom: for comparison, 4 congenic strains around the Sa locus constructed by other research groups [St. Lezin et al. (26), Frantz et al. (4), and Iwai et al. (16)] are placed to right of congenic strains from current study. Position of the Sa locus: in bottom part of map at marker D1Mco13 (at Sa) and also at right of all congenic strains (at horizontal arrow). See MATERIALS AND METHODS for description of rat strains.

 
Congenic substrains.
Figure 1 shows the chromosomal segments derived from the LEW strain that were introgressed into the genetic background of the S strain. The original congenic, S.LEW(chr1), had a 118-centimorgan (cM) segment introgressed from LEW rats spanning from the D1Mco2 to the D1Mco35 markers. Five congenic substrains with shorter introgressed segments were constructed from the original congenic strain in order to better localize the blood pressure QTL. Congenic substrains that lacked the Sa gene region included Chr1 x 3, which had a 57-cM introgressed LEW segment spanning from D1Mco2 to D1Rat49, and Chr1 x 14, which had a 40-cM introgressed segment from D1Mco2 to D1Wox6. Congenic substrains that contained the Sa gene region included Chr1 x 7, Chr1 x 8, and Chr1 x 15, which carried differential segments of 43 cM spanning from D1Rat45 to D1Mco41, 71 cM from D1M7Mit87 to D1Mco41, and 43 cM from D1Rat42 to D1Wox10, respectively. Subsequent genotyping with newly linked markers showed that Chr1 x 14 carried a 2.5-cM residual segment centered around D1Mco41, and that Chr1 x 8 was segregating in the region between D1Mco38 and D1Mco36. The residual segment in Chr1 x 14 and the segregating region in Chr1 x 8 went undetected due to the lack of markers in those regions at the time of congenic substrain construction. The rats used for blood pressure determination were tested retrospectively using newly developed markers in the segregating region of Chr1 x 8. Of 20 rats from Chr1 x 8 used in blood pressure determination, 14 were homozygous for the LEW alleles from D1Mco38 to D1Mco36 and 6 were heterozygous between S and LEW in this region. Excluding the segregating rats from the statistical analysis did not have a meaningful effect on the blood pressure results or on the other variables tested using this congenic substrain, so all 20 rats from Chr1 x 8 were used in the analysis.

The effect of the introgressed segments on blood pressure, body weight, and heart weight.
Figure 1 and Table 2 show the effects of the congenic strains on blood pressure and heart weight. Other variables measured included body weight, heart weight, and the heart weight-to-body weight ratio (Table 2). A significant blood pressure-lowering effect ranging from 23 ± 5.0 to 38 ± 3.5 mmHg was observed among some of the congenic substrains compared with S rats. The same congenic substrains also showed a lowering effect on heart weight ranging from 49 ± 19.8 to 133 ± 18.6 mg. Two congenic substrains, Chr1 x 7 and Chr1 x 15, did not show a significant blood pressure effect compared with the control S rats. The heart weight effect observed was not significant for Chr1 x 7, whereas Chr1 x 15 showed a significant increase in heart weight. The body weight effects observed among the congenic substrains were not significant except for Chr1 x 14 and Chr1 x 15, which showed a significant increase in body weight of 13 ± 3.5 and 10 ± 4.2 g, respectively, compared with the control S rats.


View this table:
[in this window]
[in a new window]
 
Table 2. Effects of congenic strains on blood pressure, body weight, heart weight, and heart weight-to-body weight ratio

 
Sa gene expression.
Figure 2 and Table 3 show differences in the level of Sa gene expression among the strains SHR, S, and the congenic substrain Chr1 x 7 (containing the LEW strain Sa allele on the S background). Sa gene expression was ~10-fold higher in S than in Chr1 x 7. For comparative purposes, we also looked at the expression levels in the S vs. SHR. Sa gene expression was approximately 2.5- to 3.0-fold higher in SHR than in S (Fig. 2 and Table 3).



View larger version (5K):
[in this window]
[in a new window]
 
Fig. 2. Northern filter analysis of total RNA obtained from kidneys of 42-day-old male rats probed for Sa and glyceraldehyde 3-phosphate dehydrogenase (G3PDH) mRNA. S, Dahl salt-sensitive rats; SHR, spontaneously hypertensive rats; Chr1 x 7, congenic substrain with donor segment of chromosome 1 containing the Sa allele from LEW rats (see Fig. 1).

 

View this table:
[in this window]
[in a new window]
 
Table 3. Quantitation of Sa mRNA levels in kidneys from 42-day-old male rats

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Linkage analysis at best identifies only a broad chromosomal region harboring a QTL influencing blood pressure. Proof that a QTL is real involves construction of an initial congenic strain to prove or disprove the actual existence of the QTL. The initial congenic strain should encompass a large chromosomal segment to ensure trapping a contrasting QTL allele if it is present in the donor strain. Such a large congenic region may contain one or more QTL. Further localization of the blood pressure QTL involves fine genetic mapping of the region of interest using congenic substrains containing introgressed segments of varying sizes. The gene of interest is very well localized when it is trapped in a congenic strain showing an effect on blood pressure that contains a relatively short (1–2 cM) introgressed segment. The present work is only the first iteration of this process and allows us to evaluate the effect that an introgressed chr 1 segment obtained from a normotensive rat (LEW) has on the blood pressure of the hypertensive S rat.

The original congenic strain was constructed to try to include possible multiple QTLs because linkage analysis had suggested more than one blood pressure QTL on chromosome 1 (5, 7, 30). The blood pressure-lowering effect of 34 mmHg (Fig. 1 and Table 2) observed using the S.LEW(chr 1) congenic strain confirmed that at least one QTL was trapped within this chromosomal region. Similar data on S.LEW(chr1) were reported previously (5), but the data in Table 2 represent an additional test on this strain. The present analysis (Fig. 1) using congenic substrains derived from S.LEW(chr1) allowed for the localization of a blood pressure QTL to the 25-cM region flanked by D1M7Mit87 and D1N64. The QTL was conservatively localized to this region as the difference between congenic substrains Chr1 x 8 and Chr1 x 15. One could argue that the QTL is likely to be in the D1M7Mit87 to D1Wox6 (15 cM) region, because this region is common to the two substrains Chr1 x 8 and Chr1 x 14, both of which showed a significant blood pressure effect. This argument is not technically complete based only on the data in Fig. 1 because theoretically there could be another QTL in Chr1 x 14 between D1Mco2 and D1M7Mit87 that accounts for the blood pressure effect of Chr1 x 14. Preliminary unpublished data (Saad and Rapp) on other congenic strains indicate, however, that the second blood pressure QTL on chr 1 suggested by linkage analysis (5, 7) is located more proximally between D1Uia8 and D1Rat95.

It is obvious in Table 2 that there is significant variation in the blood pressure of S rats among experiments. Because S rats have been inbred for more than 75 generations of brother-sister mating, they should be highly genetically homogeneous. Variation among S rat groups studied at different times is attributed to unknown environmental influences. On the assumption that such environmental influences affect the S and congenic strains similarly, the only valid comparison in determining if a congenic strain has a different blood pressure compared with the S strain is between the S and congenic strains raised and studied concomitantly.

We also measured body and heart weights of our congenic substrains. There was no significant strain difference in body weight with the exception of substrains Chr1 x 14 and Chr1 x 15. These showed a significant increase in body weight of 13 and 10 g, respectively, compared with S. These effects were not great enough to warrant further study. In most of the congenic substrains a decrease in blood pressure correlated well with a decrease in heart weight compared with S rats as measured by either heart weight-to-body weight ratio or by heart weight adjusted (if necessary) by regression for differences in body weight (Fig. 1 and Table 2). Changes in heart weight are presumably largely a consequence of changes in blood pressure (afterload). Congenic substrain Chr1 x 15 had no significant effect on blood pressure, but heart weight (adjusted for differences in body weight) was increased compared with the S. This was not reflected in the heart weight-to-body weight ratio, and so the increased heart weight in Chr1 x 15 is problematic. Clearly, heart weight in Chr1 x 15 is not decreased as would be expected if the strain included the blood pressure QTL. It could be that the Chr1 x 15 congenic region contains a heart weight QTL that is independent of blood pressure, but the present data would need to be independently corroborated before such a heart weight QTL can be accepted. Heart weight QTLs independent of blood pressure have been claimed to exist on rat chr 14 (3), chr 17 (24), and chr X (29).

As illustrated in Fig. 1, our QTL localization partially overlaps with the differential segments found in congenic strains constructed by other groups around the Sa gene (4, 16, 26). Our QTL region, however, does not include the Sa gene. Substrains Chr1 x 7 and Chr1 x 15, carrying the Sa gene region, had no effect on blood pressure, suggesting that the Sa gene does not play a role in the S vs. LEW comparison of blood pressure (Fig. 1 and Table 2). This also eliminates the ß and {gamma} subunits of the epithelial sodium channel as candidate blood pressure genes in the S vs. LEW comparison because these genes are closely linked to the Sa locus (6, 11, 18). Frantz et al. (4) constructed a congenic substrain, SHR.WKY-Sa, spanning a region similar to our Chr1 x 7 congenic substrain (Fig. 1). Although our Chr1 x 7 congenic strain had no effect on blood pressure, SHR.WKY-Sa had a modest lowering effect on blood pressure. This difference may be due to a number of factors, primarily the rat models used (S/LEW vs. SHR/WKY), diet (salt loading in our case), and age of rats at which blood pressure was taken (10 wk here vs. 16 and 20 wk). Cursory examination of Fig. 2 and Table 3 also suggests that Sa gene expression in SHR is uniquely high, and this might represent an Sa allele in SHR with a unique effect. It will, therefore, be of interest to determine if congenic substrains involving SHR also eliminate the Sa locus as a blood pressure locus.

Introgressing a chromosomal segment harboring the Sa gene obtained from a strain with low Sa gene expression levels onto the genetic background of a hypertensive strain is expected to lower blood pressure as seen in the work done on the congenic strains SHR.WKY-Sa and SHR.BN-D1Mit3/Igf2 (4, 26). Introgressing the high-expressing Sa gene allele onto the background of a normotensive strain increased blood pressure in the WKY.SHR-Sa and WKY.SHR-D1Mit3/Rat57 congenic strains (4, 16). The extent of the congenic segments in these strains is also shown in Fig. 1. The congenic strains used by these groups obviously also contained a large segment of the chromosome around the Sa gene, which must contain a large number of other genes. Thus it cannot be concluded that differential expression of the Sa gene directly results in changes in blood pressure without further substitution mapping using congenic substrains. In our study, the Sa gene was expressed at higher levels in the kidneys of S rats compared with that of the Chr1 x 7 congenic substrain (carrying the LEW Sa allele), where Sa gene expression was essentially not detectable (Fig. 2). Thus the S vs. LEW allelic comparison showed a markedly different expression pattern for the Sa gene, but the blood pressure effect observed by congenic analysis was not significant (Fig. 1 and Table 2). This provided evidence that Sa gene expression is not involved in blood pressure regulation. Our conclusion corroborates the work of Lodwick et al. (21), who showed that there was a major difference in expression of the Sa gene between the Milan hypertensive strain (MHS) and the Milan normotensive strains (MNS) but that the Sa gene in this model did not cosegregate with blood pressure.


    ACKNOWLEDGMENTS
 
This work was supported by grants from the National Institutes of Health and by the Helen and Harold McMaster Endowed Chair in Biochemistry and Molecular Biology to J. P. Rapp.

Address for reprint requests and other correspondence: J. P. Rapp, Dept. of Physiology and Molecular Medicine, Medical College of Ohio, 3035 Arlington Ave., Toledo, OH 43614-5804 (E-mail: jrapp{at}mco.edu).


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Angervall, L., and E. Carlström. Theoretical criteria for the use of relative organ weights and similar ratios in biology. J. Theoret. Biol. 4: 254–259, 1963.[Medline]
  2. Brown, D. M., A. P. Provoost, M. J. Daly, E. S. Lander, and H. J. Jacob. Renal disease susceptibility and hypertension are under independent genetic control in the fawn-hooded rat. Nat. Genet. 12: 44–51, 1996.[Medline]
  3. Clark, J. S., B. Jeffs, A. O. Davidson, W. K. Lee, N. H. Anderson, M.-T. Bihoreau, M. J. Brosnan, A. M. Devlin, A. W. Kelman, K. Lindpaintner, and A. F. Dominiczak. Quantitative trait loci in genetically hypertensive rats. Possible sex specificity. Hypertension 28: 898–906, 1996.[Abstract/Free Full Text]
  4. Frantz, S. A., M. Kaiser, S. M. Gardiner, D. Gauguier, M. Vincent, J. R. Thompson, T. Bennett, and N. J. Samani. Successful isolation of a rat chromosome 1 blood pressure quantitative trait locus in reciprocal congenic strains. Hypertension 32: 639–646, 1998.[Abstract/Free Full Text]
  5. Garrett, M. R., H. Dene, R. Walder, Q.-Y. Zhang, G. T. Cicila, S. Assadnia, A. Y. Deng, and J. P. Rapp. Genome scan and congenic strains for blood pressure QTL using Dahl salt-sensitive rats. Genome Res. 8: 711–723, 1998.[Abstract/Free Full Text]
  6. Gründer, S., L. Zagato, C. Yagil, Y. Yagil, J. Sassard, and B. C. Rossier. Polymorphisms in the carboxy-terminus of the epithelial sodium channel in rat models for hypertension. J. Hypertens. 15: 173–179, 1997.[Medline]
  7. Gu, L., H. Dene, A. Y. Deng, B. Hoebee, M.-T. Bihoreau, M. James, and J. P. Rapp. Genetic mapping of two blood pressure quantitative trait loci on rat chromosome 1. J. Clin. Invest. 97: 777–788, 1996.[Abstract/Free Full Text]
  8. Gu, L., H. Dene, and J. P. Rapp. Three microsatellites defining four alleles for the Sa gene. Mamm. Genome 5: 833, 1994.[Medline]
  9. Harris, E. L., H. Dene, and J. P. Rapp. Sa gene and blood pressure cosegregation using Dahl salt-sensitive rats. Am. J. Hypertens. 6: 330–334, 1993.[Medline]
  10. Hoebee, B., J. M. de Stoppelaar, R. F. Suijkerbuijk, and S. Monard. Isolation of rat chromosome-specific paint probes by bivariate flow sorting followed by degenerate oligonucleotide primed-PCR. Cytogenet. Cell Genet. 66: 277–282, 1994.[Medline]
  11. Huang, H., M. Pravenec, J.-M. Wang, V. Kren, E. St. Lezin, C. Szpirer, J. Szpirer, and T. W. Kurtz. Mapping and sequence analysis of the gene encoding the ß-subunit of the epithelial sodium channel in experimental hypertension. J. Hypertens. 13: 1247–1251, 1995.[Medline]
  12. Innes, B. A., M. G. McLaughlin, M. K. Kapuscinski, H. J. Jacob, and S. B. Harrap. Independent genetic susceptibility to cardiac hypertrophy in inherited hypertension. Hypertension 31: 741–746, 1998.[Abstract/Free Full Text]
  13. Iwai, N., and T. Inagami. Isolation of preferentially expressed genes in the kidneys of hypertensive rats. Hypertension 17: 161–169, 1991.[Abstract]
  14. Iwai, N., and T. Inagami. Identification of a candidate gene responsible for the high blood pressure of spontaneously hypertensive rats. J. Hypertens. 10: 1155–1157, 1992.[Medline]
  15. Iwai, N., T. W. Kurtz, and T. Inagami. Further evidence of the Sa gene as a candidate gene contributing to the hypertension in spontaneously hypertensive rat. Biochem. Biophys. Res. Commun. 188: 64–69, 1992.[Medline]
  16. Iwai, N., Y. Tsujita, and M. Kinoshita. Isolation of a chromosome 1 region that contributes to high blood pressure and salt sensitivity. Hypertension 32: 636–638, 1998.[Abstract/Free Full Text]
  17. Kovács, P., B. Voigt, and I. Klöting. Novel quantitative trait loci for blood pressure and related traits on rat chromosomes 1, 10, and 18. Biochem. Biophys. Res. Commun. 235: 343–348, 1997.[Medline]
  18. Kreutz, R., B. Struk, S. Rubattu, N. Hübner, J. Szpirer, C. Szpirer, D. Ganten, and K. Lindpaintner. Role of the {alpha}-, ß-, and {gamma}-subunits of epithelial sodium channel in a model of polygenic hypertension. Hypertension 29: 131–136, 1997.[Abstract/Free Full Text]
  19. Lander, E., P. Green, J. Abrahamson, A. Barlow, M. Daly, S. Lincoln, and L. Newburg. Mapmaker: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1: 174–181, 1987.[Medline]
  20. Lindpaintner, K., P. Hilbert, D. Ganten, B. Nadal-Ginard, T. Inagami, and N. Iwai. Molecular genetics of the Sa gene: cosegregation with hypertension and mapping to rat chromosome 1. J. Hypertens. 11: 19–23, 1993.[Medline]
  21. Lodwick, D., L. Zagato, M. A. Kaiser, L. Torielli, G. Casari, G. Bianchi, and N. J. Samani. Genetic analysis of the Sa and Na+/K+-ATPase {alpha}1 genes in the Milan hypertensive rat. J. Hypertens. 16: 139–144, 1998.[Medline]
  22. Nara, Y., T. Nabika, K. Ikeda, M. Sawamura, M. Mano, J. Endo, and Y. Yamori. Basal high blood pressure cosegregates with the loci on chromosome 1 in F2 generation from crosses between normotensive Wistar Kyoto rats and stroke-prone spontaneously hypertensive rats. Biochem. Biophys. Res. Commun. 194: 1344–1351, 1993.[Medline]
  23. Patel, H. R., A. S. Thiara, K. P. West, D. Lodwick, and N. J. Samani. Increased expression of the Sa gene in the kidney of the spontaneously hypertensive rat is localized to the proximal tubule. J. Hypertens. 12: 1347–1352, 1994.[Medline]
  24. Pravenec, M., D. Gauguier, J.-J. Schott, J. Buard, V. Kren, V. Bílá, C. Szpirer, J. Szpirer, J.-M. Wang, H. Huang, E. St. Lezin, M. A. Spence, P. Flodman, M. Printz, G. M. Lathrop, G. Vergnaud, and T. W. Kurtz. Mapping of quantitative trait loci for blood pressure and cardiac mass in the rat by genome scanning of recombinant inbred strains. J. Clin. Invest. 96: 1973–1978, 1995.[Medline]
  25. Rapp, J. P., and A. Y. Deng. Detection and positional cloning of blood pressure quantitative trait loci: is it possible? Hypertension 25: 1121–1128, 1995.[Abstract/Free Full Text]
  26. St. Lezin, E., W. Liu, J.-M. Wang, N. Wang, V. Kren, D. Krenova, A. Musilova, M. Zdobinska, V. Zidek, D. Lau, and M. Pravenec. Genetic isolation of a chromosome 1 region affecting blood pressure in the spontaneously hypertensive rat. Hypertension 30: 854–859, 1997.[Abstract/Free Full Text]
  27. Samani, N. J., D. Lodwick, M. Vincent, C. Dubay, M. A. Kaiser, M. P. Kelly, M. Lo, J. Harris, J. Sassard, M. Lathrop, and J. D. Swales. A gene differentially expressed in the kidney of the spontaneously hypertensive rat cosegregates with increased blood pressure. J. Clin. Invest. 92: 1099–1103, 1993.[Medline]
  28. Sokal, R. R., and F. T. Rohlf. Biometry (3rd ed.). New York: Freeman, 1995, p. 240 and p. 488–490.
  29. Vincent, M., G. Hadour, V. Oréa, N. J. Samani, and J. Sassard. Left ventricular weight but not blood pressure is associated with sex chromosomes in Lyon rats. J. Hypertens. 14: 293–299, 1996.[Medline]
  30. Yagil, C., M. Sapojnikov, R. Kreutz, G. Katni, K. Lindpaintner, D. Ganten, and Y. Yagil. Salt susceptibility maps to chromosomes 1 and 17 with sex specificity in the Sabra rat model of hypertension. Hypertension 31: 119–124, 1998.[Abstract/Free Full Text]
  31. Yang, T., S. A. Hassan, I. Singh, A. Smart, F. C. Brosius, L. B. Holzman, J. B. Schnermann, and J. P. Briggs. Sa gene expression in the proximal tubule of normotensive and hypertensive rats. Hypertension 27: 541–545, 1996.[Abstract/Free Full Text]




This Article
Abstract
Full Text (PDF)
Citation Map
Services
Email this article to a friend
Similar articles in this journal
Similar articles in PubMed
Alert me to new issues of the journal
Download to citation manager
Google Scholar
Articles by SAAD, Y.
Articles by RAPP, J. P.
Articles citing this Article
PubMed
PubMed Citation
Articles by SAAD, Y.
Articles by RAPP, J. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online