Full-length cDNAs: more than just reaching the ends

MANJULA DAS1, ISABELLE HARVEY1, LEE LEE CHU1, MANISHA SINHA1 and JERRY PELLETIER1,2

1 Department of Biochemistry
2 McGill Cancer Center, McGill University, Montreal, Quebec, Canada H3G 1Y6


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 
The development of functional genomic resources is essential to understand and utilize information generated from genome sequencing projects. Central to the development of this technology is the creation of high-quality cDNA resources and improved technologies for analyzing coding and noncoding mRNA sequences. The isolation and mapping of cDNAs is an entrée to characterizing the information that is of significant biological relevance in the genome of an organism. However, a bottleneck is often encountered when attempting to bring to full-length (or at least full-coding) a number of incomplete cDNAs in parallel, since this involves the nonsystematic, time consuming, and labor-intensive iterative screening of a number of cDNA libraries of variable quality and/or directed strategies to process individual clones (e.g., 5' rapid amplification of cDNA ends). Here, we review the current state of the art in cDNA library generation, as well as present an analysis of the different steps involved in cDNA library generation.

gene hunting; complementary DNA cloning; expressed sequence tags; expression validated gene


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 
THE TWO MOST POPULAR WAYS of cataloging human genes are sequencing expressed sequence tags (ESTs) and utilization of computational approaches. Several gene-prediction programs, like GeneWise (17), ExoFish (127), and GenScan (30) are available. Although all of these have the advantage of being "genome based" (rely on the properties of the genome sequence only, and thus are not affected by relative abundance of the encoded transcript), the evidence used is indirect and often statistical in nature. Thus bioinformatic approaches must be supported by experimental validation. EST sequencing is a direct approach to human gene cataloging and has been responsible for the identification of thousands of genes in humans and other species. But, the rate of novel EST discovery has fallen dramatically in recent years, from an estimated 10.6% in 1996 to 2.7% in 1998 (160) and is limited by the relative abundance of the encoded transcript. Recently, microarray-based strategies for gene hunting ("exon-scanning" and "tiling") (136) have been performed and, although notable for their simplicity and ability to be scaled up, they lack absolute confirmation. In some cases a single expression validated gene (EVG) may correspond to multiple coregulated genes or vice versa. Thus full-length (FL) cDNA identification and characterization still remains the most reliable way to determine how the exons of a gene are woven together.

A set of FL cDNA clones have "value-added" features that ESTs do not carry. FL cDNAs define the boundary of the transcriptional unit (and thus identify the immediate upstream basal promoter), provide a record of isoform diversity when posttranscriptional modifications alter the primary pre-mRNA transcript in various ways (such as alternate promoter usage, alternative splicing, alternate polyadenylation, and RNA editing), provide the complete coding region of the encoded protein for functional studies, and provide sequence characterization of two mRNA segments important for posttranscriptional gene regulation, i.e., the 5' and 3' untranslated regions (UTRs).


    COMPLEMENTARY DNA CLONING
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 
The conversion of mRNA into cDNA for the purposes of functional studies is a complex, interrelated series of enzyme-catalyzed reactions involving the in vitro synthesis of a cDNA copy from mRNA, its subsequent conversion to duplex cDNA, and insertion into an appropriate cloning vector. Although a number of different approaches can be used to generate cDNA libraries, most suffer from common limitations producing libraries with a number of inherent problems. Thus there remains considerable room for improving the approach used to generate cDNA libraries. One strategy we have explored is outlined in Fig. 1.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1. Schematic diagram of a strategy utilized to generate plasmid-based cDNA libraries. The approach is divided into three sections: I) mRNA isolation and fractionation, II) cDNA synthesis, and III) cDNA cloning. mRNA is purified from cytoplasmic total RNA by affinity selection on oligo (dT) columns. The mRNA is then size fractionated on sucrose gradients containing methylmercury hydroxide. cDNA is then prepared on the individual size cuts utilizing Superscript II, NC-p7 (an RNA chaperone), and oligo pd(T·Z) [an oligo (dT) primer designed to minimize mispriming to internal A-rich sequences on mRNA templates]. Double-stranded cDNA is generated utilizing RNase H, E. coli ligase, and E. coli polymerase. The ends of the cDNA are polished with T4 DNA polymerase, and BstXI adaptors are ligated to the cDNA ends. The adaptors have noncomplementary overhangs and thus cannot concatenate. Following ligation, the cDNA is fractionated on sucrose gradients to eliminate unligated adaptors, dimerized adaptors, and truncated cDNAs. Individual size fractions are ligated into an appropriate vector and transformed, by electroporation, into a bacterial host. Amplification of libraries is avoided; rather, individual clones are picked and processed.

 
RNA Fractionation
Cytoplasmic RNA isolation.
There are two basic approaches to the isolation of RNA: those that entail subcellular fractionation, and those that dissociate macromolecular complexes in denaturing solutions (10, 11). By far, the most reproducible method found to yield the highest quality RNA involves lysis of cells/tissues in the presence of guanidinium thiocyanate. [Guanidinium salts are more efficient denaturants than phenol, and their relative efficiencies are guanidinium thiocyanate > guanidine hydrochloride > urea.]

Given that metabolic labeling experiments in mammalian cells estimate that steady-state levels of heterogeneous nuclear RNA (hnRNA) represent about 7% of total RNA (24), it should be little surprise that a significant fraction of cDNA clones within any given library will contain intron sequences. Indeed, there are many published reports documenting the presence of introns within cDNA clones (e.g., 5, 8, 39, 55, 70, 122, 165; see also Ref. 89 for additional examples). To complicate matters, there is anecdotal data suggesting that 5' introns are excised more slowly than internal introns (89), possibly a consequence of differences in the mechanism by which these introns are recognized (13, 79). The presence of such cDNA clones in libraries can significantly delay the progress of gene characterization due to misleading interpretations on predicted protein structure, incorrect assignment of translation initiation codons, incorrect assignment of 5'-UTRs, and false information on promoter location. The frequency with which this problem is encountered is difficult to estimate, since reports documenting intron-containing cDNAs are generally not published.

Given these issues, it follows that mRNAs for cDNA library generation should, if possible, be prepared from cytoplasmic fractions obtained from cells or tissues. Alternatively, cDNAs obtained from libraries based on total mRNA (which is the case for the majority of current libraries) should be carefully examined to ensure they lack retained introns. By removing the bulk of nuclear pre-mRNA, this modification significantly decreases the amount of intron-containing clones that contaminate the final cDNA library. Protocols for isolating cytoplasmic mRNA have been extensively used with cultured cells, not very much with tissues, and produce RNA preparations of variable quality (12). It is reasonable to expect that the procedure may have to be tailored for different cell lines or tissues. Also, it is likely that some interesting nuclear transcripts, such as XIST, a nuclear transcript involved in X-chromosome inactivation, will be selected against by this strategy.

We have modified conventional cytoplasmic RNA purification schemes (12) to isolate cytoplasmic RNA of sufficient quality and purity for cDNA library construction from cell lines and tissues. The approach we utilize is described in the legend to Fig. 2A and has been successfully applied to isolation of RNA from a number of cell lines and tissues. When our isolation method was piloted on MDAH cells, an ovarian cancer cell line, the quality of the cytoplasmic RNA was as good as the quality of total RNA obtained in parallel (Fig. 2B, compare lane 2 with 1). We have successfully applied this procedure to a number of cell lines, as well as fresh and frozen tissues. In the cases of isolation from tissue, the material is first disrupted using a Teflon homogenizer. One tissue source from which we have failed to isolate good quality cytoplasmic RNA is kidney, presumably due to the presence of nucleases in this tissue.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 2. Fractionation of cytoplasmic and nuclear RNA from MDAH ovarian cancer cells. A: MDAH cells (American Type Culture Collection) were grown to 80% confluence in DMEM supplemented with 10% fetal bovine serum. For harvesting, cells were washed twice with prechilled PBS, scraped with a rubber policeman, and harvested by centrifugation at 800 g for 5 min. After removal of the PBS, 2 ml of lysis buffer (50 mM Tris-Cl, pH 8.0, 5 mM MgCl2, 0.5% Nonidet P-40, 0.5% sodium deoxycholate, and 10 mM vanadyl-ribonucleoside complex) was added, and the tube was vortexed for 15 s. Nuclei were removed by centrifugation at 14,000 g for 2 min, and the supernatant was transferred to 15 ml Trizol (LTI, Life Technologies). Isolation of RNA was then performed as recommended by LTI, with the exception that following precipitation from the Trizol/chloroform mixture, the pellet was resuspended in GTC [4 M guanidinium thiocyanate (GITC), 25 mM sodium citrate, pH 7.0, 0.5% N-lauroylsarcosine, and 0.1 M ß-mercaptoethanol], transferred to another tube, and precipitated with an equal volume of isopropanol. Eighty 150-cm2 dishes of MDAH cells yielded 10 mg of cytoplasmic RNA. B: formaldehyde/agarose gel analysis of total RNA, cytoplasmic RNA, and nuclear RNA isolated from MDAH cells. Ten micrograms of RNA was fractionated on a 1% agarose/formaldehyde gel and visualized by staining with SYBR gold (Molecular Probes). The positions of migration of the 28S and 18S rRNA are indicated to the left. C: PCR analysis for the presence of contaminating genomic DNA in the RNA preparations. PCR primers directed to intron 7 (5'-ATGAGATCCCCTTTTCCAG-3') and intron 8 (5'-GGAACACAGCTGCCAGC-3') of the WT1 tumor suppressor gene and designed to amplify WT1 exon 8 (176 bp) were used in a PCR with 0.2 µg of either cytoplasmic or nuclear RNA (lanes 1 and 3) or 0.2 µg of cytoplasmic or nuclear RNA supplemented with 100 ng of genomic DNA (lanes 2 and 4). Amplifications were performed as previously described (157) using 26 cycles, and the products were analyzed on a 1.2% agarose gel. The solid square to the right indicates the position of migration of the expected product. PCR product is obtained in the nuclear RNA fraction (lane 3) but not in the cytoplasmic RNA fraction (lane 1), indicating a minimal amount of genomic DNA is contaminating the cytoplasmic RNA preparation. A PCR product is also obtained when cytoplasmic RNA was supplemented with genomic DNA (compare lane 2 to 1), indicating the absence of a trans-inhibitor for the PCR in the cytoplasmic RNA preparation. D: RT-PCR analysis of the MIC2 and XIST genes in cytoplasmic and nuclear RNA fractions. Cytoplasmic and nuclear RNA was converted to cDNA using random hexamers as primers and Superscript II as recommended by LTI. RNA corresponding to equivalent cell numbers was used in each reaction. PCR amplifications were performed with primers directed against the nuclear XIST transcript (HXIST-8, 5'-AGCTCCTCGGACAGCTGTAA-3'; and HXIST-11r, 5'-TGTTGATCTTCAGGTGGGAA-3') (27) or the X-encoded cytoplasmic MIC2 transcript (MIC2A, 5'-ACCCAGTGCTGGGGATGACT-3'; and MIC2B, 5'-TCTCCATGTCCACCTCCCCT-3') (27) for 26 cycles. Products were analyzed on a 1% agarose, and the position of migration of the expected products is indicated by a solid square. E: slot-blot analysis of XIST and MIC2 RNA present in cytoplasmic and nuclear RNA fractions. Two or 10 µg of RNA was denatured in 1.3 M formaldehyde/32% formamide/10x SSC at 65°C for 15 min and loaded onto Hybond N+ paper using a slot-blot manifold apparatus. The blot was baked under vacuum at 80°C for 2 h and prehybridized in Church buffer. Hybridizations were performed in Church buffer with either a XIST or MIC2 probe (108 cpm/µg; 106 cpm/ml). Washes were performed twice with 2x SSC/0.1% SDS at 65°C for 30 min and once in 0.2x SSC/0.1% SDS at 65°C for 30 min. Blots were exposed to X-OMAT X-ray film (Kodak) at -70°C overnight. Cytoplasmic RNA preparations contain MIC2 transcripts, but not any contaminating nuclear XIST transcripts.

 
To obtain an estimate as to how much nuclear material is contaminating our cytoplasmic RNA preparations, we perform a series of analyses. First, utilizing a primer pair directed to exon 8 of the WT1 tumor suppressor gene, amplification reactions are performed to assess the amount of contaminating nuclear DNA in our cytoplasmic preparations (Fig. 2C, compare lane 1 with 3). Controls are performed to ensure the absence of trans-inhibitors of the PCR in the RNA preparation under analysis by adding genomic DNA to the cDNA preparations to be used in the PCRs (Fig. 2C, compare lane 2 with 1). Second, we probe for the presence of a 15-kb inactive X-specific transcript (XIST) located solely in the nucleus (26, 28), since this serves as a good marker by which to determine the amount of contaminating nuclear RNA in our cytoplasmic RNA preparations. The MIC2 transcript serves as a control, since it is also X-encoded, but located in the cytoplasm. As determined by RT-PCR and slot-blot analysis on cytoplasmic and nuclear RNA from equivalent cell numbers (Fig. 2, D and E), our fractionation procedure significantly enriches for cytoplasmic RNA, with little contamination from high molecular weight nuclear RNA (Fig. 2, D and E).

There is potential valuable information to be gained from properly characterizing cDNAs prepared from cytoplasmic mRNA. Intron retention by cytoplasmic mRNAs may also occur as a mechanism of posttranscriptional regulation in some situations. Libraries generated from cytoplasmic mRNA will make it easier to identify these events above the background generally provided by total cellular mRNA preparations. The best studied example of this is the trans-regulation of the nucleocytoplasmic distribution of unspliced mRNA by the human immunodeficiency virus (HIV) rev product (48, 60, 101). This phenomenon requires a cis-acting Rev-responsive element (RRE) in the env region of HIV-1, within the common intron of Tat and Rev coding sequences. In the presence of rev, the RRE mediates the cytoplasmic appearance of HIV mRNAs containing introns. It appears that rev affects a general process that retains precursor mRNAs in the nucleus (36). Another example of this sort of regulation is the Mason-Pfizer monkey virus where efficient accumulation of unspliced mRNAs appears to depend on the interaction of a cis-acting RNA element with the ATP-dependent RNA helicase A (25, 150) or with other cellular factors (57, 118). Thus some representatives of specific genes within cDNA libraries generated from cytoplasmic mRNA might contain introns. The identification of such clones would be a first step toward cataloging cellular genes potentially utilizing this mechanism of posttranscription regulation. Recent descriptions of mRNAs harboring retained introns suggests that in some cases this phenomenon may be at work to regulate gene expression (84) and increase protein isoform diversity (117, 123, 125, 155). This form of regulation of gene expression may function similarly to a recently identified sequence element within the intronless H2a gene which functions to promote mRNA transport, inhibit splicing, and stimulate polyadenylation (75). Similar elements have been identified within HSV-TK (98) and HBV (74, 76). Hence, the presence of related elements within introns have the potential to inhibit splicing and increase accumulation of unspliced transcripts in the cytoplasm.

Oligo (dT) chromatography.
One fractionation procedure that most individuals utilize when synthesizing cDNA libraries is to generate poly(A)+ mRNA by oligo (dT) selection of total RNA. This makes good sense given that RNA PolII transcripts represent only ~5% of the total RNA population within a given cell. However, what is generally not appreciated is that some mRNA transcripts are not polyadenylated (e.g., histones) or may have shortened poly(A) tails that do not permit selection by oligo (dT) chromatography (160). It is interesting to note that although to date, the only class of poly(A)- mRNA transcripts which have been defined are some of the histone mRNAs, estimates have indicated that there could be a large fraction of genes expressed in postnatal brain uniquely as poly(A)- transcripts (156). These reports indicate that a large proportion of the complexity in poly(A)- mRNA comprises sequences distinct from those in poly(A)+ mRNA. Hybridization with 3H-labeled poly(U) indicated that the poly(A)- mRNA fraction was relatively free of poly(A)+ mRNA since the equivalent of only one A tract of 20 residues per 100 average-sized molecules (1,500 nt) was observed (156). The complexities of the poly(A)+ and poly(A)- mRNA classes were also found to be additive, since the sum of their complexities equaled that of polysomal RNA (37, 156). Another interpretation of these data is that the poly(A)- mRNA species are derived from the poly(A)+ mRNA transcripts, and indeed in a number of situations, specific mRNAs have been found in both poly(A)+ and poly(A)- forms, such is the case for some histone species, casein mRNA, and protamine mRNA (52, 72, 130). It is also known that the length of the poly(A) tail can be regulated (41). Indeed, there is some suggestion that this phenomenon may be tissue restricted, since analysis of RNA from kidney indicates extensive homology between poly(A)+ mRNA and purified nominal poly(A)- mRNA (116). For poly(A)+ mRNA preparations to be used for cDNA library construction, it is imperative to assess the quality of the preparation and efficiency of fractionation. We assess the quality of our cytoplasmic RNA preparations by Northern blotting with probes to three ubiquitously expressed transcripts; histone H4 [a poly(A)- transcript], ß-actin (~1.8 kb), and protein tyrosine phosphatase 1E (mRNA is ~8 kb) (Fig. 3A).



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. A: Northern blot analysis of poly(A)+ and poly(A)- RNA. One microgram poly(A)+ and 20 µg of poly(A)- RNA were fractionated on a 1.2% formaldehyde/agarose gel, transferred to Hybond N+, and hybridized with probes to the genes indicated at bottom. Prehybridizations and hybridizations were performed in Church buffer. Two washes were performed with 2x SSC/0.1% SDS at 65°C for 30 min and one wash in 0.2x SSC/0.1% SDS at 65°C for 30 min. Arrows indicate the position of migration of the expected mRNA species. B: formaldehyde/agarose gel analysis of size fractions obtained after fractionating 100 µg of total RNA on a 10–30% methylmercury hydroxide sucrose gradient. The first left lane contains an aliquot of the sample loaded onto the sucrose gradient. The agarose gel was stained with SYBR gold (Molecular Probes) to visualize the RNA. C: Northern blotting analysis of size fractions obtained after fractionating 100 µg of poly(A)+ RNA isolated from MDAH cells and probed with the Huntington disease (HD) and ß-actin genes. Fraction numbers are indicated at top.

 
Size fractionation.
Another problem that affects clone representation in a cDNA library is the issue of competition between more abundant, shorter mRNA species and less abundant, longer mRNA species at various steps during library construction. For example, size competition during transformation will bias clone representation in the final library product. One manner to deal with this is to size fractionate the mRNA before the start of library construction and treat each size cut as a distinct subcomponent of the library. This also allows one to implement an additional size fraction step at the end of library construction to select against smaller cDNA products produced as a result of failure to reach the vicinity of the 5' end of the mRNA or inefficient conversion to second-strand product.

There are two procedures that are amenable to preparative mRNA size fractionation-agarose gel electrophoresis and sucrose gradient centrifugation. Preparative agarose gel electrophoresis is relatively simple and provides sharp size cuts and good resolving power between 500 and 10,000 bases, but the RNA recovery is lower than with sucrose gradients, and some lots of commercial agarose contain contaminants (that inhibit subsequent downstream enzymatic steps) that copurify with the RNA (49). On the other hand, sucrose gradient centrifugation allows the fractionation of large amounts of RNA and allows recovery in high yields, although the size cuts are not as sharp as with agarose gels (61, 90). An example of total RNA fractionated on methylmercury hydroxide sucrose gradients is shown in Fig. 3B. We generally load 100 µg of poly(A)+ mRNA on 10–30% sucrose gradients. Following centrifugation, we collect 30-drop fractions, precipitate, and analyze 10% of the material by Northern blotting, probing for ß-actin transcripts and for the Huntington disease (HD) transcript (~11 kb). The HD gene is ubiquitous but of very low abundance, making it difficult to detect (Fig. 3C).

Correction of Mispriming by the Oligo (dT) Primer During First-Strand Synthesis
Priming from the mRNA poly(A) tract with oligo (dT) is necessary to obtain a copy of the entire 3'-UTR. However, it has been estimated that ~10–15% of clones in cDNA libraries have 3' truncations due to internal misannealing of the oligo (dT) primer to internal A-rich sites (23). Such clones are identified by the absence of a polyadenylation signal sequence (generally AATAAA) ~30 nucleotides upstream of the oligo (dA) tail of the cDNA. If enhanced discrimination could be achieved between annealing of the oligo (dT) primer to the bona fide poly(A) tail vs. internal A-rich sequences, then the frequency of this mispriming artifact should be significantly reduced. Guo et al. (59) have shown that increased discrimination of single nucleotide polymorphisms by oligonucleotides can be achieved by introducing artificial mismatches into an oligonucleotide probe using the base analog 3-nitropyrrole (Fig. 4A). This base analog acts as a universal nucleoside that hydrogen bonds minimally with all four bases without steric disruption of the DNA duplex. Differences in thermal stability ({Delta}Tm) between hybrids formed with normal and single-nucleotide variant DNA targets are increased by as much as 200% over conventional hybridization (59). We tested whether an oligo (dT) primer in which some of the internal thymidine residues were replaced with 3-nitropyrrole [called oligo (dT)·Z1; 5' d(T)7·Z·d(T)9·Z·d(T)5 3'] significantly decreased the frequency of 3' end mispriming (Fig. 4).




View larger version (93K):
[in this window]
[in a new window]
 
Fig. 4. A: structure of the universal nucleoside 3-nitropyrrole. B: structure of eukaryotic initiation factor-4GII (eIF-4GII) construct used to analyze mispriming at the 3' end. The locations of four internal A-rich sequences are shown, all of which generated 3' truncated clones when eIF-4GII was isolated from a cDNA library. The plasmid was linearized with Asp718, and T7 RNA polymerase was used to generate an ~2,400-nt 3H-test transcript. The locations of five oligos (a, b, c, d, e) used in the hybridization assay to map the sites of 3' mispriming by oligo (dT) are shown. The nucleotide targets of the oligonucleotides on eIF-4GII are as follows: oligo a, (5567)GAAATTGACTCAGTACTATT(5584); oligo b, (5416)GAAGGAAATGCTGTGGACC(5535); oligo c, (5194)TGTATAATAGAAAAGCAGAG(5213); oligo d, (5068)TTTTAAACAAGGACTCATAC(5087); and oligo e, (4781)AAGAGGAGTCTGAGGATAAC(4800). C: the integrity of the in vitro generated transcript is shown following fractionation on a formaldehyde/1.2% agarose gel, treatment with EN3HANCE, and autoradiography of the dried gel. D: alkaline agarose (1.2%) analysis of RT products generated by priming synthesis with oligo (dT)15 (lane 1) or oligo (dT)·Z1 primer [5'-d(T)7·Z·d(T)9·Z·d(T)5-3'] (lane 2) using Superscript II. cDNA was labeled with [{alpha}-32P]dCTP. The gel was neutralized in 5% trichloroacetic acid, dried, and exposed to X-OMAT film (Kodak). The positions of migration of truncated products are indicated by solid squares, and full-length (FL) product is indicated by an arrow. E: Southern blot of alkaline agarose gel of RT products generated by priming synthesis with either oligo (dT) or oligo (dT)·Z. Marker lane refers to the 1-kb size ladder from GIBCO-BRL, and sizes (in nt) are indicated to the left in E. eIF-4GII DNA refers to a DNA fragment of eIF-4GII used as a positive control for DNA hybridizations. Oligos used as probes on each blot are indicated at bottom (ae). On left in E: *, cDNA product obtained by priming at the correct poly(A) site; •, cDNA product obtained by priming from the internal A-rich stretch between nucleotides 5550–5575; arrow, cDNA obtained by internal priming from nucleotides 5085–5120.

 
When eukaryotic initiation factor-4GII (eIF-4GII) cDNAs were initially isolated, only one of five clones had the correct 3' end; all other truncated clones were the result of internal priming by oligo (dT) at four different sites (Fig. 4B) (A. Gradi and N. Sonenberg, unpublished data). In vitro transcribed RNA generated from this clone thus served as an excellent test reagent by which to determine the ability of oligo (dT)·Z1 to decrease the frequency of internal mispriming events (Fig. 4C). This RNA was annealed to either oligo (dT) or oligo (dT)·Z1, and reverse transcription was performed with Superscript II. Use of oligo (dT) on this template resulted in shorter than FL products (>95%) generated as a result of two internal mispriming events (Fig. 4D, lane 1). However, utilizing oligo (dT)·Z1 as primer on the same template dramatically improves the yield of FL product (Fig. 4D, lane 2). We have mapped the 3' ends of the various reverse transcriptase (RT) products by hybridization of the cDNA with oligonucleotides which spanned the 3'-UTR (Fig. 4E). cDNA was generated with oligo (dT)23 or oligo (dT)·Z2 [5' d(T)5·Z·d(T)5·Z·d(T)5·Z·d(T)5 3'] on eIF-4GII RNA, fractionated on an alkaline agarose gel, and transferred to Hybond N+ for analysis. These products were analyzed by probing with radiolabeled oligonucleotides directed to different regions of the eIF-4GII 3'-UTR (Fig. 4B). These results confirm that priming with oligo dT·Z2 dramatically reduces 3' end mispriming.

RNA-Dependent DNA Polymerases
Inhibition of reverse transcriptase processivity by secondary structure.
The central enzyme to cDNA library construction has always been RT, since all current cDNA library generation procedures employ an RNA-dependent DNA polymerase to convert mRNA into a cDNA copy. This enzyme performs multiple functions during the life cycle of a retrovirus, including the copying of RNA in DNA, the hydrolysis of RNA from the RNA-DNA hybrid, and the copying of single-stranded DNA into double-stranded DNA. The two most commonly used RTs for cDNA library construction have been those derived from avian myeloblastosis virus (AMV) and Moloney murine leukemia virus (MMLV). The AMV RT is a heterodimeric molecule containing two related subunits, the {alpha}-subunit (~63 kDa) and the ß subunit (~95 kDa) (71). The {alpha}-subunit of AMV RT carries both polymerase and RNase H activity. The MMLV RT differs from the avian form in that it is a single 84-kDa polypeptide (159) with the polymerase activity mapping to the amino terminus and the RNase H activity to the carboxy terminus (149). The error rates of MMLV and AMV RT on DNA template has been estimated to be ~1/30,000 and 1/17,000, respectively (81, 126). On RNA, the error rate of MMLV RT is 1/37,000 (81). The error rate of HIV RT has been found to be significantly higher ~1/4,600 to 1/7,000 (6, 7, 78, 80, 81), precluding the use of the native HIV enzyme in cDNA library construction. One drawback with current RTs is that they have a very poor rate of processivity, in the range of 5–15 nucleotides per second (77, 100). Reducing the RNase H activity of MMLV RT improves the efficiency of RT (53), suggesting that generation of truncated products by RNase H+ RTs may be the result of pausing by the RT on the RNA template, followed by degradation of the RNA moiety by the RNase H activity. Recombinant MMLV RT engineered to be devoid of RNase H activity has resulted in the generation of several commercial products.

To assess pausing by RTs on mRNA templates during first-strand synthesis, we have developed a series of test vectors that have stable stem-loop structures in an NcoI site positioned 918 bp upstream of the WT1 3' end (4) (Fig. 5A). It is well documented that stable hairpin loops can inhibit RT processivity (154). Also, plasmid SP/flWT1 contains 433 bp of the 5'-UTR of WT1 and is ~70% GC rich. Indeed, when cDNA clones for the murine WT1 gene were first isolated, none of the clones were full length, and 5 of 9 clones terminated within 21 nucleotides of each other, 182 bases upstream of the ATG codon, suggesting the presence of a strong RT stop signal in this region. The murine WT1 5' end could only be obtained by 5' RACE and genomic DNA sequencing (J. Pelletier, data not published). We have used in vitro generated WT1 transcripts (ranging in size from ~1.4 to 2.0 kb) to elucidate and optimize conditions most effective in allowing RTs of various sources to proceed through these blocks.




View larger version (115K):
[in this window]
[in a new window]
 
Fig. 5. Effects of mRNA secondary structure on RT activity. A: a schematic diagram illustrating test constructs generated in which stable stem-loop structures were inserted into the NcoI site of the WT1 gene. A Sau3A I fragment of the WT1 gene was inserted into pSP65(A)18, positioning a tract of 18 adenosine residues downstream of the WT1 gene (pSP/WT1), thus allowing first-strand synthesis to be primed with an oligo (dT) primer. Clones containing either one or two copies of the GNRA stem-loop structure were constructed in pSP/flWT1, a derivative of pSP/WT1 in which 433 bp of the GC-rich 5'-UTR of WT1 was present. Termination of RT by the stem-loop structures is expected to generate a truncated product of 918 bases, whereas generation of FL cDNA is expected to generate a product of ~1.4–1.5 kb in the case of pSP/WT1 and a product of ~1.9–2.0 kb in the case of pSP/flWT1 and pSP/flWT1/(GNRA). B: alkaline agarose gel analysis of RT products obtained by priming WT1, flWT1, and flWT1/(GNRA)2 mRNA with oligo (dT)15 and Superscript II (lanes 2–4) or AMV (lanes 5 and 6). cDNA reactions were performed with [{alpha}-32P]dCTP, and products were visualized by autoradiography. The positions of migration of the predicted FL cDNA products are indicated by arrows. Radioactive DNA markers (Life Technologies) are shown in lane 1. C: alkaline agarose gel analysis of RT products obtained by priming WT1, flWT1, flWT1/(GNRA), and flWT1/(GNRA)2 mRNA with oligo (dT)15 and Superscript II (lanes 1–4) or Thermoscript (lanes 5–8). cDNA reactions were performed with [{alpha}-32P]dCTP, and products were visualized by autoradiography. The positions of migration of the predicted FL cDNA products are indicated by arrows. D: alkaline agarose gel analysis of RT products obtained by priming flWT1/(GNRA)2 mRNA with oligo (dT)15 and MMLV RT (lanes 1 and 3) or Superscript II (lanes 2 and 4). cDNA reactions were performed with [{alpha}-32P]dCTP, and products were visualized by autoradiography. The effect of the RNA chaperone, NCp7 (1 µg), on RT activity was assessed (lanes 3 and 4). The positions of migration of the predicted FL cDNA products are indicated by arrows. E: assessment of denaturation conditions currently used to improve RT processivity during first-strand cDNA synthesis. First-strand RT reactions were performed with oligo (dT)15 and Superscript II, utilizing either RNA made from in vitro transcription of pSP/WT1 (lane 1), pSP/flWT1 (lane 2), or pSP/flWT1/(GNRA)2 (lanes 3–11). Inhibition of RT processivity by the GNRA stem-loop structure is expected to yield a product of ~918 bases (asterisk). Treatments performed on the RNA sample before the RT reaction are indicated and included as follows: lane 3, addition of oligo (dT)15 primer before the RT enzyme; lane 4, addition of oligo (dT)15 primer after the RT enzyme; lane 5, incubation of the RNA at 65°C for 5 min; lane 6, denaturation at 65°C for 5 min, followed by snap freezing on dry ice and slow thawing on ice; lane 7, preincubation with methylmercury hydroxide followed by neutralization with ß-mercaptoethanol; lane 8, incubation in 5% DMSO followed by dilution to 1% DMSO (since 5% DMSO inhibits the RT reaction); lane 9, incubation in 5% DMSO/35% glycerol, followed by dilution to 1% DMSO/7% glycerol; lane 10, addition of trehalose to an RT reaction performed at 45°C; lane 11, addition of trehalose to an RT reaction performed at 55°C. cDNA reactions were performed with [{alpha}-32P]dCTP, and products were visualized by autoradiography. Radioactive DNA markers are from LTI.

 
We have attempted to define which currently available RT is capable of best "negotiating" regions of secondary structure. In all, we have compared the quality of first-strand product obtained on these test templates with Superscript II (Fig. 5B), AMV RT (Fig. 5B), tTH (data not shown), MMLV RT (Fig. 5D), Expand RT (Roche) (data not shown), and Thermoscript (thermostable avian RT obtained from LTI) (Fig. 5C). Representative data is shown in Fig. 5, B–D. Superscript II is capable of efficiently copying WT1, flWT1, and flWT1/(GNRA)2 into cDNA, with a minimal of truncated products (Fig. 5, B and C, compare lanes 2–4). The indicated products are known to be full length, because we have recloned them and by sequencing showed that they contain the expect 5' end (data not shown). By comparison, AMV is a poor choice for production of cDNA, since the majority of cDNA products from all three RNA templates are truncated (Fig. 5B, compare lanes 5–7). This is not a peculiarity of this particular AMV enzyme preparation, since we have tested AMV RTs from a variety of major suppliers (data not shown) and obtained similar results. Thermoscript is a RNase H- RT derived from an avian source which can function at 55°C, thus allowing one to perform RT reactions under conditions that should otherwise destabilize mRNA secondary structure. When we compared the efficiency of this enzyme to Superscript II, we also found it to be inferior since it produced a lower proportion of FL product than Superscript II (Fig. 5C, compare lanes 5–8 to lanes 1–4). Use of wild-type MMLV RT produced only truncated product when attempting to copy flWT1/(GNRA)2, as assessed by alkaline agarose gel electrophoresis (Fig. 5D, lane 1). We noticed that a small fraction of cDNA produced with Superscript II was larger than full length (Fig. 5D, lane 2) and attribute this to hairpin priming of second-strand from first-strand product. The thermostable polymerase, tTH, has been previously reported to harbor significant RT activity. In our hands, the yield and quality of cDNA product obtained with this enzyme was very disappointing (data not shown).

Our results indicate that MMLV RNase H- enzyme appears to be best at negotiating regions of secondary structure. Recently a number of such products have appeared on the market, and although we have not tested all of them, our preliminary results indicate that many of the RNase H- MMLV RTs show similar activities. In our hands, Expand RT (Roche) also produces high-quality first-strand product (data not shown). We have also tested a number of RT RNase H inhibitors such as suramine (147), heparin (113), novobiocin (2), and illimaquinone (99) for their ability to suppress RNase H activity present in the native MMLV and AMV enzymes. This approach was to attempt to reduce the amount of pausing on flWT1/(GNRA)2 templates. However, in our hands, none of these improved the activity of the native enzymes on templates containing structural features inhibitory to RT processivity. Parenthetically, we have noticed variation in quality of some lots of buffers that accompanied Superscript II and that resulted in the synthesis of a major truncated product when the enzyme was assayed on poliovirus mRNA [an ~7.5-kb RNA template with a poly(A)+ tail], compared with the same buffer made in our lab. One should thus be wary about utilizing any reagents from manufacturers unless they are first quality controlled in the investigator’s lab.

A number of conditions have been reported in the literature to improve the processivity of RT. These include denaturing the RNA template at 65°C for 5 min before starting the RT reaction, pretreatment of the RNA with methylmercury hydroxide before the RT reaction, addition of DMSO to the RT reaction, and performing the RT reaction at a higher temperature (55°C) in the presence of the thermostabilizer, trehalose (34). However, the usefulness of these conditions has never been tested on controlled test transcripts harboring defined structural features capable of blocking RT activity. RT reactions performed with Superscript II and either WT1 or flWT1 result in exclusive production of FL products as assessed by denaturing alkaline agarose gels (Fig. 5E, lanes 1 and 2). RT reactions on flWT1/(GNRA)2 template show FL product, as well as a truncated product due to a block in processivity at 918 bp by the GNRA stem-loop (denoted by an asterisk) (Fig. 5E, lane 3). None of the methods in common use today to denature RNA templates before the commencement of an RT reaction improves the processivity of Superscript II on the flWT1/(GNRA)2 template (Fig. 5E, lanes 5–11). We interpret these results to indicate that denaturation of local stem-loop structures by any of these conditions is transient, and once the treatment is terminated, structured regions rapidly reform. We do not know why trehalose did not improve the processivity of RT, but it is possible that even at 55°C, the GNRA stem-loop structure is very stable. Additionally, it is not clear how cDNA synthesis at 55°C, in the presence of trehalose, affects the error rate of Superscript II. Also, given the problem of metal-induced hydrolysis of RNA at high temperatures (see below), the utility of this modification remains to be established (108). It is evident that current treatments for enabling RT enzymes to proceed through regions of high secondary structure within RNAs simply are not effective.

Effect of temperature on mRNA template stability.
Many current cDNA protocols aim to perform reactions under conditions in which the temperature of the reaction is maintained as high as possible (without interfering with the activity of the enzyme). The underlying premise is that reduced hydrogen bonding at elevated temperatures will decrease mRNA secondary structure, leading to reduced pausing of the RT on the mRNA template and resulting in a higher proportion of FL product. Examples of this include 1) utilization of Thermoscript (LTI) at 55°C, 2) addition of trehalose to stabilize Superscript II at 60°C (34), and 3) use of Display Thermo-RT (Display Systems Biotech). However, these approaches disregard the fact that at elevated temperatures, mRNA is susceptible to metal catalyzed degradation (108). We have assessed the effect of incubating mRNA with a range of heavy metals at room temperature for 60 min (Fig. 6A). The results demonstrate that under these conditions La3+, Lu3+, and Zn2+ are very effective at hydrolyzing mRNA (Fig. 6A, compare lanes 2, 3, and 6 with lane 1), whereas Mg2+, Mn2+, and Cu2+ did not appreciably degrade the test template (Fig. 6A, compare lanes 4, 5, and 7 with lane 1). Incubation of test mRNA template with 3 mM MgCl2 at a series of temperatures demonstrated that at 55°C, degradation by Mg2+ is significant (Fig. 6B). Given the absolute requirement of RTs for divalent metal cations, our results would suggest that RT reactions performed at or above 55°C will result in significant damage to mRNA templates. As a matter of precaution, we do not perform RTs at temperatures greater than 45°C.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 6. Degradation of RNA by metal ions. A: agarose/formaldehyde gel analysis of 3H-labeled WT1 mRNA produced by in vitro transcription and incubated with various metal salts and hydroxides; 0.4 µg of RNA in 50 mM Tris·HCl, pH 8.0, was incubated with no salt (lane 1), 2.5 mM LaCl3·7H2O (lane 2), 2.5 mM LuCl3·6H2O (lane 3), 2.5 mM MnCl2 (lane 4), 2.5 mM MgCl2 (lane 5), 2.5 mM ZnCl2 (lane 6), or 2.5 mM CuCl2 (lane 7) at 22°C for 1 h. The quality of the RNA transcripts was analyzed by electrophoresis into a 1.2% agarose gel, treating the gel with EN3HANCE (NEN), drying, and exposing to X-OMAT film (Kodak). B: agarose/formaldehyde gel analysis of 3H-WT1 mRNA produced by in vitro transcription and incubated with 3 mM MgCl2 at 22°C (lanes 1 and 2), 37°C (lanes 3–5), 45°C (lanes 6–8), and 55°C (lanes 9–11). Transcripts were incubated for 5 min (lanes 3, 6, and 9) or for 60 min (lanes 1, 2, 4, 5, 7, 8, 10, 11) and analyzed by agarose gel electrophoresis as described in A.

 
Use of an RNA chaperone to improve the quality of first-strand synthesis.
In an attempt to improve the quality of first-strand products, without having to resort to increasing the temperature of the RT reaction, we have taken advantage of the unique biological properties of nucleic acid chaperones and have modified the conditions for first-strand synthesis. Nucleocapsid (NC) proteins are very small, highly basic proteins. NC proteins bind both to single-strand/double-strand DNA and to single-strand RNA in vitro and are associated with the genomic RNA in the interior of the mature retrovirus particle (92). The NC proteins of most retroviruses contain one or two zinc fingers of the form CX2CX4HX4C, which according to nuclear magnetic resonance analysis form very tight, rigid loops within the protein. NC proteins catalyze the folding of nucleic acids into conformations that have the maximal number of base pairs and appear to do this by lowering the energy barrier for breakage and re-formation of base pairs. Thus interaction between a nucleic acid molecule and an NC protein results in the transient unpairing of bases within the chain, which makes the bases available for re-pairing in alternative combinations. This activity allows nucleic acid molecules to escape from suboptimal conformations, which would otherwise represent kinetic traps.

The ability of NC proteins to refold RNA has been demonstrated in a wide variety of assay systems: NC proteins accelerate annealing of complementary strands (40, 43, 93, 153, 163), facilitate transfer of a nucleic acid strand from one hybrid to a more stable hybrid (93, 153), cause unwinding of tRNA (83), and stimulate release of the products of hammerhead ribozyme-mediated RNA cleavage (16, 68, 110). In addition, supplementing HIV RT with recombinant HIV NC protein has been shown to reduce pausing and increase the efficiency of synthesis of FL DNA products (81, 148, 162). This effect is almost certainly due to the ability of the NC protein to transiently eliminate secondary structures in the template RNA that obstruct the polymerization process. Dose-response studies have shown that a threshold concentration of the protein is required to demonstrate nucleic acid chaperone effects (83, 162, 163). This minimum concentration is generally in the range of 1 protein molecule per 7 nucleotides, approximately the ratio at which a nucleic acid becomes saturated with NC protein.

To determine whether NC can function with MMLV RT, recombinant NCp7 (Fig. 7A) was added to native MMLV RT and Superscript II (Fig. 5D). Addition of NCp7 to MMLV RT did not improve the quality of first-strand product produced with this enzyme (Fig. 5D, compare lane 3 with 1). However, addition of NCp7 to Superscript II dramatically improved the quality of first-strand product obtained with this enzyme (compare lane 4 with lane 2). We noticed two effects of NCp7: 1) a reduction in the amount of truncated first-strand product and 2) a reduction in the amount of undesired hairpin primed second-strand product (Fig. 5D, compare lane 4 with 2). Titrations of NCp7 in RT reactions primed from WT1 or flWT1/(GNRA)2 mRNA templates were performed (Fig. 7B). Addition of NCp7 to Superscript II reactions containing WT1 RNA did not affect the quality of the products, producing only a slight reduction in yield (compare lanes 1–5). Addition of increasing amounts of NCp7 to flWT1/(GNRA)2 showed a significant improvement in the quality of the RT products (compare lanes 6–10). At the highest concentration of NC (1.2 µg), the majority of the RT products are full length (lane 10). These results demonstrate that NCp7 is capable of improving the processivity of Superscript II, and we have incorporated its use to generate better quality first-strand product. Parenthetically, we have found that not all RNase H- RTs are stimulated by NCp7 and that not all preparations of NCp7 are equally effective at providing the effect we have described herein. The reasons for this are currently not well understood.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7. A: primary amino acid structure of HIV NCp7, a well-characterized nucleic acid chaperone. The two zinc fingers are underlined. B: titration of NCp7 into RT reactions performed with Superscript II. The nature of the input RNA is shown below the panel. Asterisk denotes the major truncated RT product obtained due to termination of DNA synthesis by the RT enzyme when regions of secondary structure are encountered by the enzyme. The amount of exogenously supplied NCp7 is indicated above each well. First-strand synthesis was performed with 0.2 µg of template RNA, 50 ng of oligo (dT)15 primer, and 100 U of Superscript II in a final volume of 25 µl. Following first-strand synthesis in the presence of [{alpha}-32P]dCTP, products were extracted with phenol/chloroform, passed over a G50 spun column, precipitated with ammonium acetate, and fractionated on a 1.2% agarose/formaldehyde gel. Products were visualized by drying the gel and exposing to X-OMAT film (Kodak).

 
Second-Strand Synthesis
There are several approaches that can be used for second-strand synthesis. In one set of methods, initiation of second-strand synthesis takes place within the sequence of the first strand. One of these methods involves synthesis of the second-strand with Escherichia coli DNA polymerase I or AMV RT by self-priming of the first strand, followed by digestion of the resulting loop with S1 nuclease (46, 69, 102, 129). Another approach, the second-strand synthesis method of Gubler and Hoffman (58), is the most widely utilized procedure and relies on the combined activities of E. coli RNase H and DNA polymerase I to catalyze second-strand synthesis from mRNA-cDNA hybrids by RNA-primed nick translation (115). Unfortunately, some sequence information at the mRNA 5' terminus is lost during subsequent cloning (8–50 nt), since RNA priming can never accommodate the 5' most sequences (38, 44).

In a second group of methods, initiation of second-strand synthesis takes place outside the sequence of the first strand. For that purpose, a homopolymeric tract is synthesized at the 3' end of the first-strand product with terminal deoxynucleotidyl transferase (TdT) (9, 51, 128, 129). Ligation of an oligonucleotide at the 3' end was also reported, but the efficiency of this reaction is low (153). In both cases, a complementary oligonucleotide annealed to the extension allows initiation. Another method involves addition of a homopolymeric tract to the first strand and of a complementary homopolymeric tract to the linearized plasmid vector, followed by annealing (115). Depending on the method, the second strand is synthesized with E. coli DNA polymerase I, AMV RT, or thermostable polymerases. This group of methods does not require digestion of the 3' end of the first strand, thereby allowing conservation of the sequences corresponding to the 5' end of the mRNA.

With respect to homopolymeric tailing, generally a stretch of guanosine residues are added to the 3' end of the first strand, since this reaction is self-limiting (~10–15 nt) due to secondary structure formed by poly(dG). Second-strand synthesis is then primed by oligo (dC). Recently a series of thermostable enzymes [Taq DNA polymerase, Ampligase (thermostable ligase), and Hybridase (thermostable RNase H)] have been utilized to prime the second strand with oligo (dC) (34). A lesser known approach has been to utilize TdT to tail the first-strand cDNA product with dTTP, followed by second-strand synthesis utilizing oligo (dA) and T7 DNA polymerase (20, 21), an enzyme which has a higher 3'-exonuclease activity than polymerases previously used for second-strand synthesis. This results in a higher level of fidelity (error rate is ~15 x 10-6) and allows trimming of the poly d(T) tract during the second-strand synthesis reaction. The size of the tract synthesized with terminal deoxynucleotidyl transferase is therefore not required to be within a given size range, and the resulting clones contain a tract of limited size (~40 nt; see Refs. 20 and 21). Furthermore, T7 DNA polymerase has a much higher processivity (~300 nt/s) than the polymerases previously used for second-strand synthesis, thus making it the enzyme of choice for synthesis of long molecules (120, 146). However, in our hands the efficiency of this approach can be quite low (probably due to inefficient tailing of the cDNA by TdT), resulting in low conversion of first-strand product to second-strand product.

Alternatively, an "oligo capping" approach, also known as reverse ligation-mediated PCR (RLPCR) (15) has been reported and used with some success (104, 145). In this approach, before generation of first-strand product, the 5' end m7G mRNA cap structure is removed using tobacco acid pyrophosphatase. An oligoribonucleotide is then ligated onto the mRNA 5' end using T4 RNA ligase. Following first-strand synthesis, the oligoribonucleotide at the mRNA 5' end is copied into DNA, if the polymerase makes it that far. This unique sequence at the 5' end then serves as an anchor for second-strand reaction, which incorporates an amplification step using thermostable enzymes (145). Unfortunately, T4 RNA ligase is a very inefficient enzyme, although the use of macromolecular crowding agents, such as polyethylene glycol 8000, can improve the efficiency of the reaction (64). The use of an amplification step in the generation of cDNA libraries based on oligo capping is likely the result of the low-efficiency ligation step, and is a cause for concern, given the changes in representation associated with such manipulations. A variation on this approach involves oligodeoxynucleotide ligation to first-strand product with T4 RNA ligase (45). Another method of anchoring defined sequences at the 3' end of first-strand product is based on the observation that Superscript II often adds three to four non-template-derived cytidine residues to the 3' end of cDNAs in the presence of manganese or high magnesium. The presence of these additional residues can be used to either ligate a specific DNA adaptor (132) or to add 5' end sequences during the RT process based on CapFinder technology (Clontech). In test assays utilizing flWT1/(GNRA)2, we found that nontemplate cytidine residues appeared to also be added to incomplete first-strand product, suggesting to us that minimal discrimination between FL and incomplete products is achieved with approaches relying on the addition of 3' end nontemplate residues by RTs during first strand.

We evaluated two criteria in choosing a method for second-strand synthesis. First, we avoided any procedures that required an amplification step, due to high mutation rate and alteration of transcript representation. Second, we were interested in a method that provided the highest conversion yield of first-strand into second-strand product. In our hands, the classic method of Okayama and Berg (115) and Gubler and Hoffman (58) provided the highest yield, with minimal amount of sample manipulation. As shown in Fig. 8A, Southern blotting of the second-strand product with a probe against ß-actin and PTP-1E demonstrates that the majority of second-strand product is still full length and that size fractionation of the mRNA template effectively produces fractions that are enriched for the different cDNA size classes.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 8. A: Southern blot analysis of the ß-actin and PTP-1E genes following second-strand synthesis. Following second-strand synthesis, 10% of the reaction was fractionated on a 0.8% agarose gel and processed for Southern blotting. Note that the blot was first hybridized with ß-actin, then stripped and rehybridized with a PTP-1E probe, to reduce the signal arising from the ß-actin cDNA. B: sucrose gradient fractionation of second-strand product. Following BstXI adaptor ligation and XhoI digestion, 33P-labeled second-strand product was loaded on a 10–30% sucrose gradient and centrifuged in an SW40 rotor at 20,500 rpm for 23 h. Fractions were collected by puncturing the bottom of the centrifuge tube and collecting 30 drops per fraction. These were precipitated, and an aliquot (10% of the sample) was analyzed by electrophoresis on a 0.8% agarose gel. The gel was treated with EN3HANCE, dried, and exposed to X-OMAT film (Kodak).

 
Insert Fractionation and Cloning
The method one will use to insert cDNA fragments into the propagation vector will depend on both the vector design and downstream applications. Since our main interest is in being able to rapidly evaluate clones for their full coding nature, our needs require that we directionally clone the inserts and place appropriate sequencing primer sites immediately upstream and downstream of the cloning sites. Additionally, the presence of rare restriction sites flanking the insert could be useful in helping excise interesting inserts. To achieve these ends, we 1) perform first-strand synthesis in the presence of 5-methyl-dCTP with a primer d(T)·Z2, containing an XhoI site and 2) ligate BstXI adaptors onto the products of our second-strand synthesis (Fig. 1). The nature of the BstXI recognition site


allows us to design adaptors with noncomplementary ends, thus avoiding concatenation of the adaptors (143). Subsequent cleavage of this ligation product with XhoI produces a cDNA fragment with an XhoI site at the 3' end of the gene and a BstXI site at the 5' end of the gene. 3) We then fractionate the products of second-strand synthesis on sucrose gradients (Fig. 8B) to remove unligated BstXI adaptors and BstXI dimers from the cDNA mixture. In addition, ligating different cDNA size fractions to our propagation vector minimizes the amount of competition between inserts of different sizes which may occur during transformation.

Propagation Vector, Library Maintenance, and Clone Manipulation
Many methods have been reported in the literature for inserting cDNA fragments into appropriate propagation vectors. We will not attempt to review these methods, since they often are tailored to individual needs or functional applications. In our case, our application calls for a vector that can accommodate large inserts and that can easily be manipulated in a fashion compatible with current high-throughput sequencing technologies (at least with respect to identifying the nature of the ends of the insert).

Until 1983, almost all cDNA libraries were propagated in plasmid vectors, and were usually maintained as a collection of more than 105 independently transformed bacterial colonies. Sometimes these colonies were pooled, amplified in liquid culture, and stored at -70°C; more frequently they were maintained on the surfaces of nitrocellulose filters (62). However, these libraries were difficult to maintain without loss of clone viability, and screening by hybridization to multiple radioactive probes required labor-intensive replication of colonies from one nitrocellulose filter to another.

With the advent of bacteriophage cloning vectors, it became possible to take advantage of the high efficiency and reproducibility of packaging bacteriophage {lambda} DNA in vitro into infectious virus particles. The resulting libraries could be amplified and stored indefinitely without loss of clone viability and could be screened with both nucleic acid and antibody probes. Testimony to the usefulness of the {lambda} cloning vectors is that the majority of current cDNA libraries utilize these vectors. However, even the bacteriophage propagation system suffers from serious drawbacks. 1) Amplification of bacteriophage cDNA libraries leads to loss of clone representation due to differential growth rates of different clones. 2) Plaque hybridization methods are cumbersome, labor intensive, time consuming, and thus not adaptable for larger-scale screening efforts. Filter replicas of cDNA libraries have finite lifespans and must be periodically regenerated, resulting in the rapid consumption of unique and valuable resources. 3) Up to 10 kbp in length may be propagated in {lambda}ZAP, imposing an upper size limit on the inserts that can be propagated in this system. 4) Excision of inserts from the vectors is a labor-intensive process, even for {lambda}ZAP-based libraries.

There are a number of requirements that a vector system designed for library maintenance should fulfill to satisfy the needs of the genomics community. The vector must be easy to manipulate, allow propagation of large inserts, allow excision or manipulation of the intact cDNA, and be compatible with current sequencing technology. A plasmid-based cDNA library has the advantage that clones can be individually manipulated utilizing picking robots and pipetting stations. Clones from a given library can be pooled, and schemes for PCR-based screening can be implemented (111). Although the initial costs and labor in setting up these arrayed libraries is significant, the library pools can be stored indefinitely at -80°C and represent enough material for >10,000 individual screens; these libraries represent an essentially permanent and maintenance-free resource. In addition, PCR screening of arrayed libraries is adaptable to high throughput, and can be completed in a few days (111). For hybridization-based screening, the clones of the libraries can be gridded onto nitrocellulose filters and microarrays.

We have modified a pUC-based vector for library propagation (Fig. 9A). pUC plasmids are high copy due to a point mutation (G to A) immediately preceding the RNA I (antisense RNA) gene in the origin of replication. This mutation alters the conformation of RNA II (RNA primer), preventing the hybridization of RNA I to RNA II and resulting in an increased rate of DNA replication from the ColEI ori. The phenotypic effects of this mutation are suppressed by lowering the growth temperature to 30°C (97). Thus the ColEI origin of replication in pUC is temperature sensitive, and its copy number can be controlled by different growth temperatures for safe propagation of large inserts. We have deleted all nonessential regions from pUC to construct the pMD1 vector. We have confirmed that the new vector is temperature sensitive (Fig. 9B) and allows propagation of inserts as large as 16.8 kbp (Fig. 9C). This vector allows the generation of directionally cloned cDNA libraries utilizing the XhoI and BstXI restriction enzyme sites.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 9. A: schematic diagram of pMD1, a pUC18-derived vector. The binding sites for the M13 reverse and T7 sequencing primers are shown. The stuffer is an ~650-bp BglII fragment derived from {lambda}. B: temperature-sensitive replication of pUC18 and pMD1. E. coli DH10ß cells were grown at the indicated temperatures to the same OD660, at which point DNA mini-preps were performed to isolate the plasmids. DNA was analyzed on a 1% agarose gel and visualized by staining with ethidium bromide. DNA from equal cell numbers are loaded in each lane. C: stable propagation of a 16.8-kbp BamHI fragment isolated from {lambda} and cloned into pMD1. E. coli DH10ß cells were grown at 30°C, and supercoiled DNA (lane 1) or BamHI-digested DNA (lane 2) was analyzed on a 1% agarose gel.

 
It is well documented that bacterial strains with different inserts do not always have the same growth rates or lag phase (138). Thus one issue with library maintenance deals with amplification and the potential for loss of clone representation during this process. We feel it is best to pick individual colonies to avoid this potential problem, and in our experience, following an initial library plating, colony size can vary by as much as 10-fold. Methods for handling large number of cDNA clones and sorting them by oligonucleotide fingerprinting have been described (32, 47, 65, 134).

Normalization and Subtraction Strategies
Reassociation-kinetic analysis indicates that the mRNAs of a typical cell are distributed into three frequency classes: a highly abundant class consisting of 10–15 mRNAs that together represent 10–20% of the total mRNA mass, a middle abundance class consisting of 1,000–2,000 mRNAs making up 30–40% of the total mRNA, and a low-abundance class consisting of 15,000–20,000 mRNAs covering ~50% of the total mRNA (18). Hence, sequencing cDNAs from standard libraries is not an efficient approach for novel gene discovery or for identifying rare cDNAs. Thus for gene identification endeavors, normalization of cDNA libraries has been an important tool (140). Reassociation kinetics has been successfully used toward this end (23, 85, 119, 139). Indeed, an evaluation of the extent of normalization has indicated that, from an extreme range of abundance of four orders of magnitude in an original library, the frequency of occurrence of any clone examined in the normalized library can be brought within the narrow range of only one order of magnitude (139). However, many normalization procedures were not developed with the aim of selecting or maintaining large cDNA coding regions and thus involve library amplification, complex in vitro manipulations, and retransformation of normalized clones. Indeed, the length of some cDNAs are noticeably shortened in some normalized libraries (23). Potentially severe problems are associated with the need to use both amplified (rather than primary) libraries and protocols involving exponential amplification of complex pools of inserts.

Recently, Carninci et al. (35) have described a different approach to gene normalization and subtraction. In their approach, they have incorporated a methodology that appears to be compatible with maintaining selection for large cDNA clones. They normalize their cDNA preparations using an aliquot of biotinylated cellular mRNA that they prepare (utilizing a Rot of 10) by removing RNA/cDNA duplexes with streptavidin-coated magnetic beads. Additionally, they have developed a subtraction approach where nonredundant clones from the RIKEN libraries are used to generate biotinylated mRNA using in vitro transcription reactions. This RNA is then hybridized to first-strand product at a Rot of 5, and duplexes are removed utilizing streptavidin-coated magnetic beads (35). They clearly demonstrated the efficacy of their normalization and subtraction approach. One concern that needs to be monitored is the nonspecific removal of rare transcripts during the normalization steps.


    AFFINITY SELECTION OF FULL-LENGTH COMPLEMENTARY DNAS
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 
A common structural feature of all cellular eukaryotic mRNAs (except for organelle mRNAs) analyzed to date is the presence of a 5'-terminal m7GpppN (where N is any nucleotide) structure, termed the cap (140). This structure is added early during RNA polymerase II-driven transcription and is required for several steps of mRNA biogenesis. Consistent with the diverse roles of the cap during gene expression, a number of cap binding proteins have been identified in the cytoplasm and nucleus (54, 140). The first-described, and best-characterized of these, is eukaryotic initiation factor-4E (eIF-4E), a 24-kDa polypeptide that has been cloned and characterized from a number of species. This protein shows strong binding specificity for methylated, cap structures of eukaryotic mRNAs (54).

We have developed an affinity chromatography procedure, called CAPture, that allows for the purification of mRNA via the cap structure (44). Previous to this, several laboratories had used antibodies directed against the cap structure to select and purify eukaryotic mRNAs via their 5' end. Schwer et al. (134) and de Magistris and Stunnenberg (42) used a polyclonal anti-m7G antibody to demonstrate that vaccinia virus late mRNAs are discontinuously synthesized. Muhlrad et al. (109) used this antibody to define an mRNA decay pathway in which polyadenylation leads to decapping. However, this antibody resource is limiting, and the efficiency of cap selection is not known. In related studies, a monoclonal antibody directed against 2,2,7-trimethylguanosine was generated and used to purify snRNAs (19) and to demonstrate the presence of a caplike structure at the 5' end of mutant ß-globin transcripts (96). Although the antibody is not limiting, its use in purifying capped mRNAs is somewhat restricted due to its 15- to 20-fold lower affinity for m7G cap structures relative to trimethylated caps (19, 96). Nonetheless, these experiments demonstrated the feasibility of selecting mRNA molecules via their cap structure. The use of a bifunctional cap binding protein, such as protein A/meIF-4E, provides a highly efficient and specific method for cap selection (44). Physical immobilization of the eIF-4E cap binding protein produces an affinity column that is capable of binding to mRNA cap structures with high affinity (44) and which has been used in several analytical procedures (50, 105). In addition, following first-strand synthesis, one can treat the cDNA/mRNA hybrids with single strand-specific nucleases (such as RNase A) to remove the cap structure from mRNA in duplexes where the cDNA has not progressed all the way to the 5' end. In FL cDNA/mRNA hybrids, the mRNA is protected, and consequently only these hybrids will retain a cap structure. Selection by affinity chromatography utilizing immobilized eIF-4E leads to enrichment of FL cDNAs (44).

One shortfall of this approach that we have noticed is that secondary structure immediately adjacent to the cap structure lowers the efficiency of selection (J. Pelletier, data not shown). This is consistent with studies on eukaryotic translation indicating that the affinity of eIF-4E is rate limiting for mRNAs with inaccessible cap structures, compared with those where the cap structure is accessible (94). Hence, the lowered efficiency of CAPture for cDNA/mRNA duplexes can partly be due to a decreased affinity of eIF-4E for the m7G group due to steric hindrance from the 3' terminal nucleotide from the DNA strand of the duplex. This possibility is based on data from the cocrystal structure of eIF-4E bound to m7GDP (103). eIF-4E is shaped like a cupped hand with the base of the m7GDP ligand buried deep in the cup and the phosphate residues oriented toward the outside of the cup (103). It is predicted from the crystal structure of eIF-4E that the last template-derived base of the cDNA would abut against the first ß-sheet of the palm of the eIF-4E structure and is likely to interfere with binding. The situation is worsened by the fact that RTs, such as Superscript II, add additional non-template-derived nucleotides to the 3' ends of cDNAs. The use of other cap binding proteins, as well as mutants of eIF-4E, in the CAPture assay is currently under evaluation.

Recently, a variation on CAPture, called cap trapper, has been described in which a biotin group is introduced into the diol residue of the cap structure (after oxidation of the ribose moiety with NaIO4). Following treatment of the cDNA/mRNA duplex with RNase ONE (a single-strand-specific nuclease), selection of FL cDNAs is undertaken utilizing streptavidin-coated magnetic beads (33). Although this method overcomes the limitations described above for CAPture, in our hands, this method has not proven to be specific. That is, if we compare the ability of cap trapper to discriminate between cDNA duplex with capped mRNA (generated in vitro) or duplexed with uncapped mRNA (generated in vitro), then we are unable to obtain specific selection of capped over uncapped transcripts (J. Pelletier, data not shown). This is likely due to the fact that biotin-hydrazide can also react with unoxidized RNA due to incipient reaction of cytosine residues (66, 142). Hence, addition of biotin is not solely directed toward the cap structure. Also, it is important to note that the oxidation reaction with NaIO4 is difficult to control, and the molar ratio of periodate to substrate is important, otherwise one gets destruction of base rings (142, 151).

Many libraries have been generated with the cap trapper procedure, indicating that this technique has been well adopted to a cDNA cloning program currently in place at RIKEN (35). It is difficult for us to assess whether this approach is truly enriching for FL sequences. A perusal of the average cDNA insert size of cap trapper libraries suggests that many of the clones in these libraries are of the same size as clones from commercially available libraries. An additional concern with these 5' end affinity approaches is that they may actually select against certain genes. Thus genes with exceptionally difficult 5' ends (high GC content, abundant secondary structure) that will block RT processivity should not be present in cap trapper libraries. Hence, our experience with procedures aimed at enriching for FL cDNAs indicate that these shortcomings first need to be addressed and resolved before they are integrated into cDNA library synthesis protocols.


    AUTOMATION AND MINIATURIZATION OF THE PROCESS
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 
Considering the number of complex steps involved in cDNA synthesis and the number of libraries one would like to generate from different tissues and cell lines, the integration of this technology into a microfluidics platform where some of the reactions could be performed in a closed, miniaturized, and integrated system would greatly accelerate the generation of cDNA libraries. In addition, a closed platform would minimize the introduction of nucleases by the experimenter. We feel that size fractionation of RNA, oligo (dT) selection of mRNA, synthesis of first strand, synthesis of second strand, polishing of cDNA ends, fractionation of double-stranded cDNA, and ligation into the appropriate cloning vector are all amenable to miniaturization and microfluidics technology. Indeed, several years ago we approached a microfluidics group and presented this concept to them (82). They have utilized poly-T-coated dynal beads and demonstrated that selection of mRNA from total RNA is feasible utilizing microfluidics, suggesting that it would be possible to perform cDNA library construction in microfluidic devices. There is still room for improvement here, however, since the efficiency of poly(A)+ mRNA selection appeared to be poor and the authors did not perform an extensive analysis of their selected material to demonstrate that there was no change in RNA representation or quality (across different size groups) during the selection process (82). With more sophisticated approaches and better chip designs (31), one should be able to achieve respectable yields and throughput. Indeed, it should also be possible to link up mRNA isolation, cDNA synthesis, and amplification by PCR utilizing microfluidics technology (161).


    INFORMATION CONTENT OF COMPLEMENTARY DNAS
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 
Problems Associated with ORF Prediction in Eukaryotic mRNAs
Most interest in cDNAs is aimed at being able to identify the major open reading frame (ORF) of eukaryotic genes to pursue functional studies. Unfortunately, to date, there are no absolute sets of rules by which this can be done with certainty, and one can only be guided by generalities learnt from studies on translation. In many cases, one can predict in silico the largest ORF of an mRNA from cDNA sequence, based on the presence of an AUG codon and one of three termination codons. However, this oversimplified approach does not always yield all the polypeptides that can be potentially encoded by a eukaryotic mRNA.

It is generally accepted that eukaryotic mRNAs engage small ribosomal units (actually a 43S preinitiation complex consisting of a 40S ribosome and associated initiation factors) for translation by one of two ways: 1) via recruitment to the cap structure (m7GpppN) present at the 5' end of eukaryotic cellular mRNAs, followed by threading to the appropriate initiation codon, or 2) by binding to internal ribosome entry sites (121). However, until mRNA primary/secondary structural features for internal initiation are known and defined, one cannot predict ORFs that utilize this mechanism of initiation on cellular mRNAs. These ORFs can be identified only by functional assays (for example, see Ref. 121) and hence will not be predicted by in silico approaches (Fig. 10A).



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 10. Schematic representation of ways in which protein diversity that can be generated by eukaryotic mRNAs. A: there are two mechanisms by which eukaryotic ribosomes can initiate translation on mRNA templates, either a scanning mechanism or by internal initiation of translation (see text for details). B: situations in which several polypeptides can be produced from a single eukaryotic mRNA species. Although most eukaryotic mRNAs are structurally monocistronic, there are many situations in which they can be functionally polycistronic. See text for details.

 
The presence of upstream AUG codons that are in a different reading frames than the AUG of the major ORF can act to shunt ribosomes past the AUG codon of the major ORF (Fig. 10B). In the event that there is a second AUG codon in frame and downstream of the first AUG of the major ORF, this event would produce a polypeptide that is shorter than predicted by in silico approaches (Fig. 10B).

It has been shown that the presence of upstream ORFs (uORFs) can decrease, or eliminate, the number of ribosomes that initiate at a downstream AUG (88), especially if the downstream AUG is in close proximity to the termination codon of a translated uORF (88) (Fig. 10B). It appears that a threading ribosome, after having terminated translation of an uORF, requires some time (and hence intercistronic distance) before it can become competent again for reinitiation (this probably reflects a requirement on the part of the ribosome to recruit an initiator Met-tRNA). Thus this mRNA configuration is predicted to produce a polypeptide that is shorter than predicted by in silico approaches, since the ribosomes would "miss" the first AUG of the major ORF and initiate at a downstream AUG.

Sequences flanking the AUG can contribute to the efficiency with which that codon is recognized as an initiation codon (87). An optimal context for an AUG is (A/G)ccAUGg, with the greatest contribution being from the purine at the -3 position relative to the A of the AUG codon (87). Thus mRNAs where the first AUG of the major ORF is in a "suboptimal" context, would be predicted to produce more that one polypeptide.

The presence of secondary structure surrounding an AUG codon can influence the efficiency with which that initiation codon is recognized. Secondary structure immediately downstream of an AUG codon can "pause" scanning ribosomes sufficiently long to allow recognition of the initiation codon (86). Hence, a predicted AUG codon may not be efficiently used because of lack of local secondary structure, thus allowing a certain percentage of ribosomes to bypass the first AUG codon and initiate at downstream AUGs.

Although AUG codons are generally used as initiation codons for eukaryotic mRNAs, there are examples of cellular mRNAs that utilize other codons (GUG, ACG, and CUG) for this purpose. Examples include some protooncogenes (myc, int-2, pim-1, and lyl-1) (1, 63, 107, 131), the basic fibroblast growth factor gene (124), retinoic acid receptor ß4 (112), Krox-24 (also a member of the EGR family) (95), the ltk receptor (14), and the WT1 tumor suppressor gene (29). The nature of the signals that dictate the use of a CUG codon as an initiation codon is not well understood, although immediate downstream sequences can influence the efficiency with which CUG codons are selected (22, 56). These non-AUG codons are difficult to accurately predict by in silico approaches, since little is understood regarding the criteria that need to be met for their selection as initiation codons.

From these examples, it should be clear that bioinformatic approaches that simply rely on defining the longest ORF, or defining the initiation codon based on context sequences, are oversimplifying a complex biological process (i.e., the selection of the initiator codon). Such predictions should be supplemented with careful functional studies to provide true guidance as to the identity of the protein(s) potentially encoded by a given mRNA transcript.

The Untranslated Regions
Posttranscriptional regulation of gene expression is an important determinant of the final protein concentration produced from a particular transcript. The significance of such controls is evident from studies in Xenopus laevis, Drosophila melanogaster, and Caenorhabditis elegans, where early patterning in development is largely determined by regulating the distribution, stability, and translation of inherited maternal transcripts (135). In mammals, posttranscriptional regulation has been well described under conditions of heat shock (137) in response to iron availability (67) or oxygen deprivation (106) or in response to growth factors (3). Two well-established posttranscriptional control mechanisms are alterations in mRNA stability and mRNA translation efficiency. The cis-acting mRNA sequences that are involved in these processes generally reside within the mRNA 5'-UTR and/or 3'-UTR. Thus a thorough characterization of mRNA UTRs will likely provide tremendous insight into these regulatory mechanisms. An example is the description of conserved RNA sequences within 3'-UTRs that act as sensors to environmental stress (141).

Since specific RNA-binding proteins are generally the mediators of such posttranscriptional effects, knowledge about the primary sequence of the UTRs is necessary to identify the mediators of these responses. This is most evident in the case of insulin-like growth factor II (IGF-II), a fetal growth factor with autocrine and paracrine modes of action, where several mRNA isoforms are produced; one is the 4.8-kb leader 4 mRNA with a 5'-UTR of 100 nucleotides, and another is the abundant 6.0-kb leader 3 mRNA comprising a 1,170-nt cytidine-rich (48%) 5'-UTR. The IGF-II leader 3 mRNA switches from a translated to a repressed state between embryonic days 11.5 and 12.5 in the mouse (114). Implicated in this regulation are specific cytoplasmic 5'-UTR binding proteins that recognize the leader 3 isoform, but not the leader 4 IGF-II mRNA isoform (114).


    TOWARD A HUMAN GENE SET
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 
If current estimates of the total gene number are accurate, based on recent published analysis of the human draft sequence (91, 158), then the biological community will require ~30,000–40,000 cDNAs to represent one form of every gene encoded by the genome. This is certainly an attainable goal. However, since gene diversity can be increased by a number of posttranscriptional processes (alternate promoter usage, alternative splicing, alternate polyadenylation, and RNA editing), in reality a much larger set will be required to obtain functional cDNA copies of all mRNA isoforms.

Recently, a number of cDNA libraries have been characterized to isolate cDNAs with complete ORFs (35, 73, 144, 145, 165, 166). It is clear from these studies that a large effort will be necessary to achieve this task and that different approaches currently underway are likely to complement each other. The approaches described herein should be useful in providing a framework by which good quality cDNA libraries can be generated and subsequently used to identify important cDNA reagents.


    ACKNOWLEDGMENTS
 
J. Pelletier is a Canadian Institutes of Health Research Senior Investigator. This work was supported by the Merck Genome Research Initiative and by National Institutes of Health Grant CA-85174 to J. Pelletier.


    FOOTNOTES
 
Article published online before print. See web site for date of publication (http://physiolgenomics.physiology.org).

Address for reprint requests and other correspondence: J. Pelletier, Dept. of Biochemistry, McIntyre Medical Sciences Bldg., McGill Univ., Rm 810, 3655 Drummond St., Montreal, Quebec, Canada H3G 1Y6 (E-mail: jerry{at}med.mcgill.ca).


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 COMPLEMENTARY DNA CLONING
 AFFINITY SELECTION OF FULL...
 AUTOMATION AND MINIATURIZATION...
 INFORMATION CONTENT OF...
 TOWARD A HUMAN GENE...
 REFERENCES
 

  1. Acland P, Dixon M, Peters G, and Dickson C. Subcellular fate of the int-2 oncoprotein is determined by choice of initiation codon. Nature 343: 662–665, 1990.[ISI][Medline]
  2. Althaus IW, Franks KM, Langley KB, Kezdy FJ, Peterson T, Buxser SE, Decker DE, Dolak LA, Ulrich RG, and Reusser F. The amphiphilic properties of novenamines determine their activity as inhibitors of HIV-1 RNase H. Experientia 52: 329–335, 1996.[ISI][Medline]
  3. Amara FM, Chen FY, and Wright JA. A novel transforming growth factor-beta 1 responsive cytoplasmic trans-acting factor binds selectively to the 3'-untranslated region of mammalian ribonucleotide reductase R2 mRNA: role in message stability. Nucleic Acids Res 21: 4803–4809, 1993.[Abstract]
  4. Antao VP, Lai SY, and Tinoco I. A thermodynamic study of unusually stable RNA and DNA hairpins. Nucleic Acids Res 19: 5901–5905, 1991.[Abstract]
  5. Baird NR, Orlowski J, Szabo EZ, Zaun HC, Schultheis PJ, Menon AG, and Shull GE. Molecular cloning, genomic organization, and functional expression of Na+/H+ exchanger isoform 5 (NHE5) from human brain. J Biol Chem 274: 4377–4382, 1999.[Abstract/Free Full Text]
  6. Bakhanashvili M and Hizi A. Fidelity of the reverse transcriptase of human immunodeficiency virus type 2. FEBS Lett 306: 151–156, 1992.[ISI][Medline]
  7. Bakhanashvili M and Hizi A. Fidelity of the RNA-dependent DNA synthesis exhibited by the reverse transcriptases of human immunodeficiency virus types 1 and 2 and of murine leukemia virus: mispair extension frequencies. Biochemistry 31: 9393–8398, 1992.[ISI][Medline]
  8. Bassett JH, Rashbass P, Harding B, Forbes SA, Pannett AA, and Thakker RV. Studies of the murine homolog of the multiple endocrine neoplasia type 1 (MEN1) gene, men1. J Bone Miner Res 14: 3–10, 1999.
  9. Belyavsky A, Vinogradova T, and Rajewsky K. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells. Nucleic Acids Res 17: 2919–2932, 1989.[Abstract]
  10. Berger SL. Isolation of cytoplasmic RNA: ribonucleoside-vanadyl complexes. Methods Enzymol 152: 227–234, 1987.[ISI][Medline]
  11. Berger SL. Preparation and characterization of RNA: overview. Methods Enzymol 152: 215–219, 1987.[ISI][Medline]
  12. Berger SL and Chirgwin JM. Isolation of RNA. Methods Enzymol 180: 3–13, 1989.[ISI][Medline]
  13. Berget SM. Exon recognition in vertebrate splicing. J Biol Chem 270: 2411–2414, 1995.[Free Full Text]
  14. Bernards A and de la Monte SM. The ltk receptor tyrosine kinase is expressed in pre-B lymphocytes and cerebral neurons and uses a non-AUG translational initiator. EMBO J 9: 2279–2287, 1990.[Abstract]
  15. Bertrand E, Fromont-Racine M, Pictet R, and Grange T. Visualization of the interaction of a regulatory protein with RNA in vivo. Proc Natl Acad Sci USA 90: 3496–500, 1993.[Abstract]
  16. Bertrand EL and Rossi JJ. Facilitation of hammerhead ribozyme catalysis by the nucleocapsid protein of HIV-1 and the heterogeneous nuclear ribonucleoprotein A1. EMBO J 13: 2904–2912, 1994.[Abstract]
  17. Birney E and Durbin R. Using GeneWise in the Drosophila annotation experiment. Genome Res 10: 547–548, 2000.[Abstract/Free Full Text]
  18. Bishop JO, Morton JG, Rosbash M, and Richardson M. Three abundance classes in HeLa cell messenger RNA. Nature 250: 199–204, 1974.[ISI][Medline]
  19. Bochnig P, Reuter R, Bringmann P, and Luhrmann R. A monoclonal antibody against 2,2,7-trimethylguanosine that reacts with intact, class U, small nuclear ribonucleoproteins as well as with 7-methylguanosine-capped RNAs. Eur J Biochem 168: 461–467, 1987.[Abstract]
  20. Bodescot M and Brison O. Efficient second-strand cDNA synthesis using T7 DNA polymerase. DNA Cell Biol 13: 977–985, 1994.[ISI][Medline]
  21. Bodescot M and Brison O. T7 DNA polymerase requires unusual reaction conditions for blunt-ending activity. Anal Biochem 216: 234–235, 1994.[ISI][Medline]
  22. Boeck R and Kolakofsky D. Positions +5 and +6 can be major determinants of the efficiency of non- AUG initiation codons for protein synthesis. EMBO J 13: 3608–3617, 1994.[Abstract]
  23. Bonaldo MF, Lennon G, and Soares MB. Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res 6: 791–806, 1996.[Abstract]
  24. Brandhorst BP and McConkey EH. Relationship between nuclear and cytoplasmic poly(adenylic acid). Proc Natl Acad Sci USA 72: 3580–3584, 1975.[Abstract]
  25. Bray M, Prasad S, Dubay JW, Hunter E, Jeang KT, Rekosh D, and Hammarskjold ML. A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent. Proc Natl Acad Sci USA 91: 1256–1260, 1994.[Abstract]
  26. Brockdorff N, Ashworth A, Kay GF, McCabe VM, Norris DP, Cooper PJ, Swift S, and Rastan S. The product of the mouse Xist gene is a 15 kb inactive X-specific transcript containing no conserved ORF and located in the nucleus. Cell 71: 515–526, 1992.[ISI][Medline]
  27. Brown CJ, Flenniken AM, Williams BR, and Willard HF. X chromosome inactivation of the human TIMP gene. Nucleic Acids Res 18: 4191–4195, 1990.[Abstract]
  28. Brown CJ, Hendrich BD, Rupert JL, Lafreniere RG, Xing Y, Lawrence J, and Willard HF. The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell 71: 527–542, 1992.[ISI][Medline]
  29. Bruening W and Pelletier J. A non-AUG translational initiation event generates novel WT1 isoforms. J Biol Chem 271: 8646–8654, 1996.[Abstract/Free Full Text]
  30. Burge C and Karlin S. Prediction of complete gene structures in human genomic DNA. J Mol Biol 268: 78–94, 1997.[ISI][Medline]
  31. Burns MA, Johnson BN, Brahmasandra SN, Handique K, Webster JR, Krishnan M, Sammarco TS, Man PM, Jones D, Heldsinger D, Mastrangelo CH, and Burke DT. An integrated nanoliter DNA analysis device. Science 282: 484–487, 1998.[Abstract/Free Full Text]
  32. Bussow K, Nordhoff E, Lubbert C, Lehrach H, and Walter G. A human cDNA library for high-throughput protein expression screening. Genomics 65: 1–8, 2000.[ISI][Medline]
  33. Carninci P, Kvam C, Kitamura A, Ohsumi T, Okazaki Y, Itoh M, Kamiya M, Shibata K, Sasaki N, Izawa M, Muramatsu M, Hayashizaki Y, and Schneider C. High-efficiency full-length cDNA cloning by biotinylated CAP trapper. Genomics 37: 327–336, 1996.[ISI][Medline]
  34. Carninci P, Nishiyama Y, Westover A, Itoh M, Nagaoka S, Sasaki N, Okazaki Y, Muramatsu M, and Hayashizaki Y. Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of full length cDNA. Proc Natl Acad Sci USA 95: 520–524, 1998.[Abstract/Free Full Text]
  35. Carninci P, Shibata Y, Hayatsu N, Sugahara Y, Shibata K, Itoh M, Konno H, Okazaki Y, Muramatsu M, and Hayashizaki Y. Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes. Genome Res 10: 1617–1630, 2000.[Abstract/Free Full Text]
  36. Chang DD and Sharp PA. Regulation by HIV Rev depends upon recognition of splice sites. Cell 59: 789–795, 1989.[ISI][Medline]
  37. Chikaraishi DM. Complexity of cytoplasmic polyadenylated and nonpolyadenylated rat brain ribonucleic acids. Biochemistry 18: 3249–3256, 1979.[ISI][Medline]
  38. D’Alessio JM and Gerard GF. Second-strand cDNA synthesis with E. coli DNA polymerase I and RNase H: the fate of information at the mRNA 5' terminus and the effect of E. coli DNA ligase. Nucleic Acids Res 16: 1999–2014, 1988.[Abstract]
  39. Danielson KG, Pillarisetti J, Cohen IR, Sholehvar B, Huebner K, Ng LJ, Nicholls JM, Cheah KS, and Iozzo RV. Characterization of the complete genomic structure of the human WNT-5A gene, functional analysis of its promoter, chromosomal mapping, and expression in early human embryogenesis. J Biol Chem 270: 31225–31234, 1995.[Abstract/Free Full Text]
  40. Darlix JL, Lapadat-Tapolsky M, de Rocquigny H, and Roques BP. First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses. J Mol Biol 254: 523–537, 1995.[ISI][Medline]
  41. Das Gupta J, Gu H, Chernokalskaya E, Gao X, and Schoenberg DR. Identification of two cis-acting elements that independently regulate the length of poly(A) on Xenopus albumin pre-mRNA. RNA 4: 766–776, 1998.[Abstract/Free Full Text]
  42. de Magistris L and Stunnenberg HG. Cis-acting sequences affecting the length of the poly(A) head of vaccinia virus late transcripts. Nucleic Acids Res 16: 3141–3156, 1988.[Abstract]
  43. Dib-Hajj F, Khan R, and Giedroc DP. Retroviral nucleocapsid proteins possess potent nucleic acid strand renaturation activity. Protein Sci 2: 231–243, 1993.[Abstract/Free Full Text]
  44. Edery I, Chu LL, Sonenberg N, and Pelletier J. An efficient strategy to isolate full-length cDNAs based on an mRNA cap retention procedure (CAPture). Mol Cell Biol 15: 3363–331, 1995.[Abstract]
  45. Edwards JB, Delort J, and Mallet J. Oligodeoxyribonucleotide ligation to single-stranded cDNAs: a new tool for cloning 5' ends of mRNAs and for constructing cDNA libraries by in vitro amplification. Nucleic Acids Res 19: 5227–5232, 1991.[Abstract]
  46. Efstratiadis A, Kafatos FC, Maxam AM, and Maniatis T. Enzymatic in vitro synthesis of globin genes. Cell 7: 279–288, 1976.[ISI][Medline]
  47. Eickhoff H, Schuchhardt J, Ivanov I, Meier-Ewert S, O’Brien J, Malik A, Tandon N, Wolski EW, Rohlfs E, Nyarsik L, Reinhardt R, Nietfeld W, and Lehrach H. Tissue gene expression analysis using arrayed normalized cDNA libraries. Genome Res 10: 1230–1240, 2000.[Abstract/Free Full Text]
  48. Emerman M, Vazeux R, and Penden K. The rev gene product of the human immunodeficiency virus affects envelope-specific RNA localization. Cell 57: 1155–1165, 1989.[ISI][Medline]
  49. Fremont P, Dionne FT, and Rogers PA. Recovery of biologically functional messenger RNA from agarose gels by passive elution. Anal Biochem 156: 508–514, 1986.[ISI][Medline]
  50. Fresco LD and Buratowski S. Conditional mutants of the yeast mRNA capping enzyme show that the cap enhances, but is not required for, mRNA splicing. RNA 2: 584–596, 1996.[Abstract]
  51. Fukuoka S and Scheele GA. Novel strategy for synthesis of full-length double-stranded cDNA transcripts without dC-dG tails. Nucleic Acids Res 19: 6961–6962, 1991.[ISI][Medline]
  52. Gedamu L, Iatrou K, and Dixon GH. Isolation and characterization of trout testis protamine mRNAs lacking poly (A). Cell 10: 443–451, 1977.[ISI][Medline]
  53. Gerard GF, Fox DK, Nathan M, and D’Alessio JM. Reverse transcriptase. The use of cloned Moloney murine leukemia virus reverse transcriptase to synthesize DNA from RNA. Mol Biotechnol 8: 61–77, 1997.[ISI][Medline]
  54. Gingras AC, Raught B, and Sonenberg N. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68: 913–963, 1999.[ISI][Medline]
  55. Glos M, Kreienkamp HJ, Hausmann H, and Richter D. Characterization of the 5'-flanking promoter region of the rat somatostatin receptor subtype 3 gene. FEBS Lett 440: 33–37, 1998.[ISI][Medline]
  56. Grunert S and Jackson RJ. The immediate downstream codon strongly influences the efficiency of utilization of eukaryotic translation initiation codons. EMBO J 13: 3618–3630, 1994.[Abstract]
  57. Gruter P, Tabernero C, von Kobbe C, Schmitt C, Saavedra C, Bachi A, Wilm M, Felber BK, and Izaurralde E. TAP, the human homolog of Mex67p, mediates CTE-dependent RNA export from the nucleus. Mol Cell 1: 649–659, 1998.[ISI][Medline]
  58. Gubler U and Hoffman BJ. A simple and very efficient method for generating cDNA libraries. Gene 25: 263–269, 1983.[ISI][Medline]
  59. Guo Z, Liu Q, and Smith LM. Enhanced discrimination of single nucleotide polymorphisms by artificial mismatch hybridization. Nat Biotechnol 15: 331–335, 1997.[ISI][Medline]
  60. Hadzopoulou-Cladaras M, Felber BK, Cladaras C, Athanassopoulos A, Tse A, and Pavlakis GN. The rev (trs/art) protein of human immunodeficiency virus type 1 affects viral mRNA and protein expression via a cis-acting sequence in the env region. J Virol 63: 1265–1274, 1989.[ISI][Medline]
  61. Hagenbuch B, Lubbert H, Stieger B, and Meier PJ. Expression of the hepatocyte Na+/bile acid cotransporter in Xenopus laevis oocytes. J Biol Chem 265: 5357–5360, 1990.[Abstract/Free Full Text]
  62. Hanahan D and Meselson M. Plasmid screening at high colony density. Methods Enzymol 100: 333–342, 1983.[ISI][Medline]
  63. Hann SR, King MW, Bentley DL, Anderson CW, and Eisenman RN. A non-AUG translational initiation in c-myc exon 1 generates an N-terminally distinct protein whose synthesis is disrupted in Burkitt’s lymphomas. Cell 52: 185–195, 1988.[ISI][Medline]
  64. Harrison B and Zimmerman SB. Polymer-stimulated ligation: enhanced ligation of oligo- and polynucleotides by T4 RNA ligase in polymer solutions. Nucleic Acids Res 12: 8235–8251, 1984.[Abstract]
  65. Hartuv E, Schmitt AO, Lange J, Meier-Ewert S, Lehrach H, and Shamir R. An algorithm for clustering cDNA fingerprints. Genomics 66: 249–256, 2000.[ISI][Medline]
  66. Hayatsu H and Ukita T. Selective modification of cytidine residue in ribonucleic acid by semicarbazide. Biochem Biophys Res Commun 14: 198–203, 1964.[ISI][Medline]
  67. Hentze MW and Kuhn LC. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc Natl Acad Sci USA 93: 8175–8182, 1996.[Abstract/Free Full Text]
  68. Herschlag D, Khosla M, Tsuchihashi Z, and Karpel R. An RNA chaperone activity of non-specific RNA binding proteins in hammerhead ribozyme catalysis. EMBO J 13: 2913–2924, 1994.[Abstract]
  69. Higuchi R, Paddock GV, Wall R, and Salser W. A general method for cloning eukaryotic structural gene sequences. Proc Natl Acad Sci USA 73: 3146–3150, 1976.[Abstract]
  70. Hilton AA, Slavin AJ, Hilton DJ, and Bernard CC. Characterization of cDNA and genomic clones encoding human myelin oligodendrocyte glycoprotein. J Neurochem 65: 309–318, 1995.[ISI][Medline]
  71. Hizi A, Leis JP, and Joklik WK. The RNA-dependent DNA polymerase of avian sarcoma virus B77. Binding of viral and nonviral ribonucleic acids to the {alpha}, ß2, and {alpha}ß forms of the enzyme. J Biol Chem 252: 6878–6884, 1977.[Abstract]
  72. Houdebine LM. Absence of poly (A) in a large part of newly synthesized casein mRNAs. FEBS Lett 66: 110–113, 1976.[ISI][Medline]
  73. Hu RM, Han ZG, Song HD, Peng YD, Huang QH, Ren SX, Gu YJ, Huang CH, Li YB, Jiang CL, Fu G, Zhang QH, Gu BW, Dai M, Mao YF, Gao GF, Rong R, Ye M, Zhou J, Xu SH, Gu J, Shi JX, Jin WR, Zhang CK, Wu TM, Huang GY, Chen Z, Chen MD, and Chen JL. Gene expression profiling in the human hypothalamus-pituitary-adrenal axis and full-length cDNA cloning. Proc Natl Acad Sci USA 97: 9543–9548, 2000.[Abstract/Free Full Text]
  74. Huang J and Liang TJ. A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products. Mol Cell Biol 13: 7476–7486, 1993.[Abstract]
  75. Huang Y, Wimler KM, and Carmichael GG. Intronless mRNA transport elements may affect multiple steps of pre-mRNA processing. EMBO J 18: 1642–1652, 1999.[Abstract/Free Full Text]
  76. Huang ZM and Yen TS. Role of the hepatitis B virus posttranscriptional regulatory element in export of intronless transcripts. Mol Cell Biol 15: 3864–3869, 1995.[Abstract]
  77. Huber HE, McCoy JM, Seehra JS, and Richardson CC. Human immunodeficiency virus 1 reverse transcriptase. Template binding, processivity, strand displacement synthesis, and template switching. J Biol Chem 264: 4669–4678, 1989.[Abstract/Free Full Text]
  78. Hubner A, Kruhoffer M, Grosse F, and Krauss G. Fidelity of human immunodeficiency virus type I reverse transcriptase in copying natural RNA. J Mol Biol 223: 595–600, 1992.[ISI][Medline]
  79. Inoue K, Ohno M, Sakamoto H, and Shimura Y. Effect of the cap structure on pre-mRNA splicing in Xenopus oocyte nuclei. Genes Dev 3: 1472–1479, 1989.[Abstract]
  80. Ji J and Loeb LA. Fidelity of HIV-1 reverse transcriptase copying a hypervariable region of the HIV-1 env gene. Virology 199: 323–330, 1994.[ISI][Medline]
  81. Ji JP and Loeb LA. Fidelity of HIV-1 reverse transcriptase copying RNA in vitro. Biochemistry 31: 954–958, 1992.[ISI][Medline]
  82. Jiang G and Harrison DJ. mRNA isolation in a microfluidic device for eventual integration of cDNA library construction. Analyst 125: 2176–2179, 2000.[ISI][Medline]
  83. Khan R and Giedroc DP. Recombinant human immunodeficiency virus type 1 nucleocapsid (NCp7) protein unwinds tRNA. J Biol Chem 267: 6689–6695, 1992.[Abstract/Free Full Text]
  84. Kienzle N, Young DB, Liaskou D, Buck M, Greco S, and Sculley TB. Intron retention may regulate expression of Epstein-Barr virus nuclear antigen 3 family genes. J Virol 73: 1195–1204, 1999.[Abstract/Free Full Text]
  85. Ko MS. An "equalized cDNA library" by the reassociation of short double-stranded cDNAs. Nucleic Acids Res 18: 5705–5711, 1990.[Abstract]
  86. Kozak M. Influences of mRNA secondary structure on initiation by eukaryotic ribosomes. Proc Natl Acad Sci USA 83: 2850–2854, 1986.[Abstract]
  87. Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res 15: 8125–8148, 1987.[Abstract]
  88. Kozak M. Effects of intercistronic length on the efficiency of reinitiation by eucaryotic ribosomes. Mol Cell Biol 7: 3438–3445, 1987.[ISI][Medline]
  89. Kozak M. Interpreting cDNA sequences: some insights from studies on translation. Mamm Genome 7: 563–574, 1996.[ISI][Medline]
  90. Kullak-Ublick GA, Gerloff T, Hagenbuch B, Berr F, Meier PJ, and Stieger B. Expression of a rat liver phosphatidylcholine translocator in Xenopus laevis oocytes. Hepatology 23: 1254–1259, 1996.[ISI][Medline]
  91. Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, Devon K, Dewar K, Doyle M, FitzHugh W, Funke R, Gage D, Harris K, Heaford A, Howland J, Kann L, Lehoczky J, LeVine R, McEwan P, McKernan K, Meldrim J, Mesirov JP, Miranda C, Morris W, Naylor J, Raymond C, Rosetti M, Santos R, Sheridan A, Sougnez C, Stange-Thomann N, Stojanovic N, Subramanian A, Wyman D, Rogers J, Sulston J, Ainscough R, Beck S, Bentley D, Burton J, Clee C, Carter N, Coulson A, Deadman R, Deloukas P, Dunham A, Dunham I, Durbin R, French L, Grafham D, Gregory S, Hubbard T, Humphray S, Hunt A, Jones M, Lloyd C, McMurray A, Matthews L, Mercer S, Milne S, Mullikin JC, Mungall A, Plumb R, Ross M, Shownkeen R, Sims S, Waterston RH, Wilson RK, Hillier LW, McPherson JD, Marra MA, Mardis ER, Fulton LA, Chinwalla AT, Pepin KH, Gish WR, Chissoe SL, Wendl MC, Delehaunty KD, Miner TL, Delehaunty A, Kramer JB, Cook LL, Fulton RS, Johnson DL, Minx PJ, Clifton SW, Hawkins T, Branscomb E, Predki P, Richardson P, Wenning S, Slezak T, Doggett N, Cheng JF, Olsen A, Lucas S, Elkin C, Uberbacher E, Frazier M, Gibbs RA, Muzny DM, Scherer SE, Bouck JB, Sodergren EJ, Worley KC, Rives CM, Gorrell JH, Metzker ML, Naylor SL, Kucherlapati RS, Nelson DL, Weinstock GM, Sakaki Y, Fujiyama A, Hattori M, Yada T, Toyoda A, Itoh T, Kawagoe C, Watanabe H, Totoki Y, Taylor T, Weissenbach J, Heilig R, Saurin W, Artiguenave F, Brottier P, Bruls T, Pelletier E, Robert C, Wincker P, Smith DR, Doucette-Stamm L, Rubenfield M, Weinstock K, Lee HM, Dubois J, Rosenthal A, Platzer M, Nyakatura G, Taudien S, Rump A, Yang H, Yu J, Wang J, Huang G, Gu J, Hood L, Rowen L, Madan A, Qin S, Davis RW, Federspiel NA, Abola AP, Proctor MJ, Myers RM, Schmutz J, Dickson M, Grimwood J, Cox DR, Olson MV, Kaul R, Raymond C, Shimizu N, Kawasaki K, Minoshima S, Evans GA, Athanasiou M, Schultz R, Roe BA, Chen F, Pan H, Ramser J, Lehrach H, Reinhardt R, McCombie WR, de la Bastide M, Dedhia N, Blocker H, Hornischer K, Nordsiek G, Agarwala R, Aravind L, Bailey JA, Bateman A, Batzoglou S, Birney E, Bork P, Brown DG, Burge CB, Cerutti L, Chen HC, Church D, Clamp M, Copley RR, Doerks T, Eddy SR, Eichler EE, Furey TS, Galagan J, Gilbert JG, Harmon C, Hayashizaki Y, Haussler D, Hermjakob H, Hokamp K, Jang W, Johnson LS, Jones TA, Kasif S, Kaspryzk A, Kennedy S, Kent WJ, Kitts P, Koonin EV, Korf I, Kulp D, Lancet D, Lowe TM, McLysaght A, Mikkelsen T, Moran JV, Mulder N, Pollara VJ, Ponting CP, Schuler G, Schultz J, Slater G, Smit AF, Stupka E, Szustakowki J, Thierry-Mieg D, Thierry-Mieg J, Wagner L, Wallis J, Wheeler R, Williams A, Wolf YI, Wolfe KH, Yang SP, Yeh RF, Collins F, Guyer MS, Peterson J, Felsenfeld A, Wetterstrand KA, Patrinos A, and Morgan MJ. Initial sequencing and analysis of the human genome. Nature 409: 860–921, 2001.[ISI][Medline]
  92. Lapadat-Tapolsky M, De Rocquigny H, Van Gent D, Roques B, Plasterk R, and Darlix JL. Interactions between HIV-1 nucleocapsid protein and viral DNA may have important functions in the viral life cycle. Nucleic Acids Res 21: 831–839, 1993.[Abstract]
  93. Lapadat-Tapolsky M, Pernelle C, Borie C, and Darlix JL. Analysis of the nucleic acid annealing activities of nucleocapsid protein from HIV-1. Nucleic Acids Res 23: 2434–2441, 1995.[Abstract]
  94. Lawson TG, Cladaras MH, Ray BK, Lee KA, Abramson RD, Merrick WC, and Thach RE. Discriminatory interaction of purified eukaryotic initiation factors 4F plus 4A with the 5' ends of reovirus messenger RNAs. J Biol Chem 263: 7266–7276, 1988.[Abstract/Free Full Text]
  95. Lemaire P, Vesque C, Schmitt J, Stunnenberg H, Frank R, and Charnay P. The serum-inducible mouse gene Krox-24 encodes a sequence-specific transcriptional activator. Mol Cell Biol 10: 3456–3467, 1990.[ISI][Medline]
  96. Lim S, Mullins JJ, Chen CM, Gross KW, and Maquat LE. Novel metabolism of several beta zero-thalassemic beta-globin mRNAs in the erythroid tissues of transgenic mice. EMBO J 8: 2613–2619, 1989.[Abstract]
  97. Lin-Chao S, Chen WT, and Wong TT. High copy number of the pUC plasmid results from a Rom/Rop-suppressible point mutation in RNA II. Mol Microbiol 6: 3385–3393, 1992.[ISI][Medline]
  98. Liu X and Mertz JE. HnRNP L binds a cis-acting RNA sequence element that enables intron-dependent gene expression. Genes Dev 9: 1766–1780, 1995.[Abstract]
  99. Loya S, Tal R, Kashman Y, and Hizi A. Illimaquinone, a selective inhibitor of the RNase H activity of human immunodeficiency virus type 1 reverse transcriptase. Antimicrob Agents Chemother 34: 2009–2012, 1990.[ISI][Medline]
  100. Majumdar C, Abbotts J, Broder S, and Wilson SH. Studies on the mechanism of human immunodeficiency virus reverse transcriptase. Steady-state kinetics, processivity, and polynucleotide inhibition. J Biol Chem 263: 15657–65, 1988.[Abstract/Free Full Text]
  101. Malim MH, Hauber J, Le SY, Maizel JV, and Cullen BR. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature 338: 254–257, 1989.[ISI][Medline]
  102. Maniatis T, Kee SG, Efstratiadis A, and Kafatos FC. Amplification and characterization of a beta-globin gene synthesized in vitro. Cell 8: 163–182, 1976.[Medline]
  103. Marcotrigiano J, Gingras AC, Sonenberg N, and Burley SK. Cocrystal structure of the messenger RNA 5' cap-binding protein (eIF4E) bound to 7-methyl-GDP. Cell 89: 951–961, 1997.[ISI][Medline]
  104. Maruyama K and Sugano S. Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138: 171–174, 1994.[ISI][Medline]
  105. McCracken S, Fong N, Rosonina E, Yankulov K, Brothers G, Siderovski D, Hessel A, Foster S, Shuman S, and Bentley DL. 5'-Capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev 11: 3306–3318, 1997.[Abstract/Free Full Text]
  106. McGary EC, Rondon IJ, and Beckman BS. Post-transcriptional regulation of erythropoietin mRNA stability by erythropoietin mRNA-binding protein. J Biol Chem 272: 8628–8634, 1997.[Abstract/Free Full Text]
  107. Mellentin JD, Smith SD, and Cleary ML. lyl-1, a novel gene altered by chromosomal translocation in T cell leukemia, codes for a protein with a helix-loop-helix DNA binding motif. Cell 58: 77–83, 1989.[ISI][Medline]
  108. Morrow JR. Hydrolytic cleavage of RNA catalyzed by metal ion complexes. Met Ions Biol Syst 33: 561–592, 1996.[ISI][Medline]
  109. Muhlrad D, Decker CJ, and Parker R. Deadenylation of the unstable mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5'->3' digestion of the transcript. Genes Dev 8: 855–866, 1994.[Abstract]
  110. Muller G, Strack B, Dannull J, Sproat BS, Surovoy A, Jung G, and Moelling K. Amino acid requirements of the nucleocapsid protein of HIV-1 for increasing catalytic activity of a Ki-ras ribozyme in vitro. J Mol Biol 242: 422–429, 1994.[ISI][Medline]
  111. Munroe DJ, Loebbert R, Bric E, Whitton T, Prawitt D, Vu D, Buckler A, Winterpacht A, Zabel B, and Housman DE. Systematic screening of an arrayed cDNA library by PCR. Proc Natl Acad Sci USA 92: 2209–2213, 1995.[Abstract]
  112. Nagpal S, Zelent A, and Chambon P. RAR-beta 4, a retinoic acid receptor isoform is generated from RAR-ß2 by alternative splicing and usage of a CUG initiator codon. Proc Natl Acad Sci USA 89: 2718–2722, 1992.[Abstract]
  113. Nakashima H, Kido Y, Kobayashi N, Motoki Y, Neushul M, and Yamamoto N. Purification and characterization of an avian myeloblastosis and human immunodeficiency virus reverse transcriptase inhibitor, sulfated polysaccharides extracted from sea algae. Antimicrob Agents Chemother 31: 1524–1528, 1987.[ISI][Medline]
  114. Nielsen J, Christiansen J, Lykke-Andersen J, Johnsen AH, Wewer UM, and Nielsen FC. A family of insulin-like growth factor II mRNA-binding proteins represses translation in late development. Mol Cell Biol 19: 1262–1270, 1999.[Abstract/Free Full Text]
  115. Okayama H and Berg P. High-efficiency cloning of full-length cDNA. Mol Cell Biol 2: 161–170, 1982.[ISI][Medline]
  116. Ouellette AJ and Ordahl CP. Extensive homology between poly(A)-containing mRNA and purified nominal poly(A)-lacking mRNA in mouse kidney. J Biol Chem 256: 5104–5108, 1981.[Abstract]
  117. Parker MS, Larroque ML, Campbell JM, Bobbin RP, and Deininger PL. Novel variant of the P2X2 ATP receptor from the guinea pig organ of Corti. Hear Res 121: 62–70, 1998.[ISI][Medline]
  118. Pasquinelli AE, Ernst RK, Lund E, Grimm C, Zapp ML, Rekosh D, Hammarskjold ML, and Dahlberg JE. The constitutive transport element (CTE) of Mason-Pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway. EMBO J 16: 7500–7510, 1997.[Abstract/Free Full Text]
  119. Patanjali SR, Parimoo S, and Weissman SM. Construction of a uniform-abundance (normalized) cDNA library. Proc Natl Acad Sci USA 88: 1943–1947, 1991.[Abstract]
  120. Patel SS, Wong I, and Johnson KA. Pre-steady-state kinetic analysis of processive DNA replication including complete characterization of an exonuclease-deficient mutant. Biochemistry 30: 511–525, 1991.[ISI][Medline]
  121. Pelletier J and Sonenberg N. Internal initiation of translation of eukaryotic mRNA directed by a sequence derived from poliovirus RNA. Nature 334: 320–325, 1988.[ISI][Medline]
  122. Peytavi R, Hong SS, Gay B, d’Angeac AC, Selig L, Benichou S, Benarous R, and Boulanger P. HEED, the product of the human homolog of the murine eed gene, binds to the matrix protein of HIV-1. J Biol Chem 274: 1635–1645, 1999.[Abstract/Free Full Text]
  123. Pollard AJ, Flanagan BF, Newton DJ, and Johnson PM. A novel isoform of human membrane cofactor protein (CD46) mRNA generated by intron retention. Gene 212: 39–47, 1998.[ISI][Medline]
  124. Prats H, Kaghad M, Prats AC, Klagsbrun M, Lelias JM, Liauzun P, Chalon P, Tauber JP, Amalric F, Smith JA, and Caput, D. High molecular mass forms of basic fibroblast growth factor are initiated by alternative CUG codons. Proc Natl Acad Sci USA 86: 1836–1840, 1989.[Abstract]
  125. Robbins PF, El-Gamil M, Li YF, Fitzgerald EB, Kawakami Y, and Rosenberg SA. The intronic region of an incompletely spliced gp100 gene transcript encodes an epitope recognized by melanoma-reactive tumor-infiltrating lymphocytes. J Immunol 159: 303–308, 1997.[Abstract]
  126. Roberts JD, Preston BD, Johnston LA, Soni A, Loeb LA, and Kunkel TA. Fidelity of two retroviral reverse transcriptases during DNA-dependent DNA synthesis in vitro. Mol Cell Biol 9: 469–476, 1989.[ISI][Medline]
  127. Roest Crollius H, Jaillon O, Bernot A, Dasilva C, Bouneau L, Fischer C, Fizames C, Wincker P, Brottier P, Quetier F, Saurin W, and Weissenbach J. Estimate of human gene number provided by genome-wide analysis using Tetraodon nigroviridis DNA sequence. Nat Genet 25: 235–238, 2000.[ISI][Medline]
  128. Rougeon F, Kourilsky P, and Mach B. Insertion of a rabbit beta-globin gene sequence into an E. coli plasmid. Nucleic Acids Res 2: 2365–2378, 1975.[Abstract]
  129. Rougeon F and Mach B. Stepwise biosynthesis in vitro of globin genes from globin mRNA by DNA polymerase of avian myeloblastosis virus. Proc Natl Acad Sci USA 73: 3418–3422, 1976.[Abstract]
  130. Ruderman JV and Pardue ML. Cell-free translation analysis of messenger RNA in echinoderm and amphibian early development. Dev Biol 60: 48–68, 1977.[ISI][Medline]
  131. Saris CJ, Domen J, and Berns A. The pim-1 oncogene encodes two related protein-serine/threonine kinases by alternative initiation at AUG and CUG. EMBO J 10: 655–664, 1991.[Abstract]
  132. Schmidt WM and Mueller MW. CapSelect: a highly sensitive method for 5' CAP-dependent enrichment of full-length cDNA in PCR-mediated analysis of mRNAs. Nucleic Acids Res 27: e31, 1999.[Abstract/Free Full Text]
  133. Schuchhardt J, Beule D, Malik A, Wolski E, Eickhoff H, Lehrach H, and Herzel H. Normalization strategies for cDNA microarrays. Nucleic Acids Res 28: E47, 2000.[Medline]
  134. Schwer B, Visca P, Vos JC, and Stunnenberg HG. Discontinuous transcription or RNA processing of vaccinia virus late messengers results in a 5' poly(A) leader. Cell 50: 163–169, 1987.[ISI][Medline]
  135. Seydoux G. Mechanisms of translational control in early development. Curr Opin Genet Dev 6: 555–561, 1996.[ISI][Medline]
  136. Shoemaker DD, Schadt EE, Armour CD, He YD, Garrett-Engele P, McDonagh PD, Loerch PM, Leonardson A, Lum PY, Cavet G, Wu LF, Altschuler SJ, Edwards S, King J, Tsang JS, Schimmack G, Schelter JM, Koch J, Ziman M, Marton MJ, Li B, Cundiff P, Ward T, Castle J, Krolewski M, Meyer MR, Mao M, Burchard J, Kidd MJ, Dai H, Phillips JW, Linsley PS, Stoughton R, Scherer S, and Boguski MS. Experimental annotation of the human genome using microarray technology. Nature 409: 922–927, 2001.[ISI][Medline]
  137. Sierra JM and Zapata JM. Translational regulation of the heat shock response. Mol Biol Rep 19: 211–220, 1994.[ISI][Medline]
  138. Smith MA and Bidochka MJ. Bacterial fitness and plasmid loss: the importance of culture conditions and plasmid size. Can J Microbiol 44: 351–355, 1998.[ISI][Medline]
  139. Soares MB, Bonaldo MF, Jelene P, Su L, Lawton L, and Efstratiadis A. Construction and characterization of a normalized cDNA library. Proc Natl Acad Sci USA 91: 9228–9232, 1994.[Abstract/Free Full Text]
  140. Sonenberg N. Cap-binding proteins of eukaryotic messenger RNA: functions in initiation and control of translation. Prog Nucleic Acid Res Mol Biol 35: 173–207, 1988.[ISI][Medline]
  141. Spicher A, Guicherit OM, Duret L, Aslanian A, Sanjines EM, Denko NC, Giaccia AJ, and Blau HM. Highly conserved RNA sequences that are sensors of environmental stress. Mol Cell Biol 18: 7371–7382, 1998.[Abstract/Free Full Text]
  142. Steinschneider A and Fraenkel-Conrat H. Studies of nucleotide sequences in tobacco mosaic virus ribonucleic acid. 3. Periodate oxidation and semicarbazone formation. Biochemistry 5: 2729–2734, 1966.[ISI][Medline]
  143. Stover CK, Vodkin MH, and Oaks EV. Use of conversion adaptors to clone antigen genes in lambda gt11. Anal Biochem 163: 398–407, 1987.[ISI][Medline]
  144. Sugahara Y, Carninci P, Itoh M, Shibata K, Konno H, Endo T, Muramatsu M, and Hayashizaki Y. Comparative evaluation of 5'-end-sequence quality of clones in CAP trapper and other full-length-cDNA libraries. Gene 263: 93–102, 2001.[ISI][Medline]
  145. Suzuki Y, Ishihara D, Sasaki M, Nakagawa H, Hata H, Tsunoda T, Watanabe M, Komatsu T, Ota T, Isogai T, Suyama A, and Sugano S. Statistical analysis of the 5' untranslated region of human mRNA using "Oligo-Capped" cDNA libraries. Genomics 64: 286–297, 2000.[ISI][Medline]
  146. Tabor S and Richardson CC. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci USA 84: 4767–4771, 1987.[Abstract]
  147. Take Y, Inouye Y, Nakamura S, Allaudeen HS, and Kubo A. Comparative studies of the inhibitory properties of antibiotics on human immunodeficiency virus and avian myeloblastosis virus reverse transcriptases and cellular DNA polymerases. J Antibiot (Tokyo) 42: 107–115, 1989.[ISI][Medline]
  148. Tanchou V, Delaunay T, De Rocquigny H, Bodeus M, Darlix JL, Roques B, and Benarous R. Monoclonal antibody-mediated inhibition of RNA binding and annealing activities of HIV type 1 nucleocapsid protein. AIDS Res Hum Retroviruses 10: 983–993, 1994.[ISI][Medline]
  149. Tanese N and Goff SP. Domain structure of the Moloney murine leukemia virus reverse transcriptase: mutational analysis and separate expression of the DNA polymerase and RNase H activities. Proc Natl Acad Sci USA 85: 1777–1781, 1988.[Abstract]
  150. Tang H, Xu Y, and Wong-Staal F. Identification and purification of cellular proteins that specifically interact with the RNA constitutive transport elements from retrovirus D. Virology 228: 333–339, 1997.[ISI][Medline]
  151. Tomasz M and Chambers RW. Periodate oxidation of pseudouridine. Biochim Biophys Acta 108: 510–512, 1965.[ISI][Medline]
  152. Troutt AB, McHeyzer-Williams MG, Pulendran B, and Nossal GJ. Ligation-anchored PCR: a simple amplification technique with single- sided specificity. Proc Natl Acad Sci USA 89: 9823–9825, 1992.[Abstract]
  153. Tsuchihashi Z and Brown PO. DNA strand exchange and selective DNA annealing promoted by the human immunodeficiency virus type 1 nucleocapsid protein. J Virol 68: 5863–5870, 1994.[Abstract]
  154. Tuerk C, Gauss P, Thermes C, Groebe DR, Gayle M, Guild N, Stormo G, d’Aubenton-Carafa Y, Uhlenbeck OC, Tinoco I Jr, Brody EN, and Gold L. CUUCGG hairpins: extraordinarily stable RNA secondary structures associated with various biochemical processes. Proc Natl Acad Sci USA 85: 1364–1368, 1988.[Abstract]
  155. van Leusden MR, Kuikman I, and Sonnenberg A. The unique cytoplasmic domain of the human integrin variant ß4E is produced by partial retention of intronic sequences. Biochem Biophys Res Commun 235: 826–830, 1997.[ISI][Medline]
  156. Van Ness J, Maxwell IH, and Hahn WE. Complex population of nonpolyadenylated messenger RNA in mouse brain. Cell 18: 1341–1349, 1979.[ISI][Medline]
  157. Varanasi R, Bardeesy N, Ghahremani M, Petruzzi MJ, Nowak N, Adam MA, Grundy P, Shows TB, and Pelletier J. Fine structure analysis of the WT1 gene in sporadic Wilms tumors. Proc Natl Acad Sci USA 91: 3554–3558, 1994.[Abstract]
  158. Venter JC, et al. The sequence of the human genome. Science 291: 1304–1351, 2001.[Abstract/Free Full Text]
  159. Verma IM. Studies on reverse transcriptase of RNA tumor viruses. I. Localization of thermolabile DNA polymerase and RNase H activities on one polypeptide. J Virol 15: 121–126, 1975.[ISI][Medline]
  160. Wang SM, Fears SC, Zhang L, Chen JJ, and Rowley JD. Screening poly(dA/dT)-cDNAs for gene identification. Proc Natl Acad Sci USA 97: 4162–4167, 2000.[Abstract/Free Full Text]
  161. Wilding P, Kricka LJ, Cheng J, Hvichia G, Shoffner MA, and Fortina P. Integrated cell isolation and polymerase chain reaction analysis using silicon microfilter chambers. Anal Biochem 257: 95–100, 1998.[ISI][Medline]
  162. Wu W, Henderson LE, Copeland TD, Gorelick RJ, Bosche WJ, Rein A, and Levin JG. Human immunodeficiency virus type 1 nucleocapsid protein reduces reverse transcriptase pausing at a secondary structure near the murine leukemia virus polypurine tract. J Virol 70: 7132–7142, 1996.[Abstract]
  163. You JC and McHenry CS. Human immunodeficiency virus nucleocapsid protein accelerates strand transfer of the terminally redundant sequences involved in reverse transcription. J Biol Chem 269: 31491–31495, 1994.[Abstract/Free Full Text]
  164. Zhang JS and Longo FM. LAR tyrosine phosphatase receptor: alternative splicing is preferential to the nervous system, coordinated with cell growth and generates novel isoforms containing extensive CAG repeats. J Cell Biol 128: 415–431, 1995.[Abstract]
  165. Zhang QH, Ye M, Wu XY, Ren SX, Zhao M, Zhao CJ, Fu G, Shen Y, Fan HY, Lu G, Zhong M, Xu XR, Han ZG, Zhang JW, Tao J, Huang QH, Zhou J, Hu GX, Gu J, Chen SJ, and Chen Z. Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. Genome Res 10: 1546–1560, 2000.[Abstract/Free Full Text]
  166. Zhumabayeva B, Chang C, McKinley J, Diatchenko L, and Siebert PD. Generation of full-length cDNA libraries enriched for differentially expressed genes for functional genomics. Biotechniques 30: 512–516, 518–520, 2001.