1Department of Pharmaceutical Sciences and the School of Molecular Biosciences, PO Box 646534, Washington State University, Pullman, WA 99164-6534 and 2Fred Hutchinson Cancer Research Center, and the Graduate Program in Molecular and Cell Biology, University of Washington, 1100 Fairview Avenue North A3-023, Seattle, WA 98109, USA
3 To whom correspondence should be addressed. E-mail: blackm{at}mail.wsu.edu
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Keywords: cytosine deaminase/gene therapy/5-fluorocytosine/mutagenesis
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
In addition to cytosine deaminase/5-fluorouracil combined therapy, a number of additional enzyme prodrug combinations are under intense scrutiny for suicide gene therapy (Greco and Dachs, 2001). Perhaps the most advanced and widely investigated of these systems is the combination of Herpes Simplex Virus type 1 (HSV) thymidine kinase (TK) and ganciclovir, in which the prodrug is phosphorylated within the transfected cell by TK and subsequently converted into a triphosphorylated nucleoside analogue (Miller and Miller, 1980
; Moolten, 1986
). Although transfection efficiencies for this and other prodrug conversion enzymes are low, and the product molecule cannot cross cell membranes (relying instead on gap junctions and/or active transport between neighboring cells), complete tumor regression is often observed in a variety of experimental systems (Moolten, 1986
; Culver et al., 1992
; Bi et al., 1993
; Freeman et al., 1993
; Colombo et al., 1995
; Dilber et al., 1997
; Kuriyama et al., 1998
). Now known as the bystander effect, this general toxicity of suicide gene therapy to non-transfected neighboring and distal tumor cells is a key component of efficacy.
The CD/5FC system also relies on the bystander effect for tumor ablation; however this system displays the advantage that the prodrug product is freely diffusible across cell membranes, allowing localized general toxicity to be independent of gap junctions or active transport in the tumor bed (Domin et al., 1993; Kuriyama et al., 1998
). Additionally, CD/5FC therapy is amenable to delivery using antibody directed enzyme prodrug therapy (ADEPT) (Senter et al., 1991
). In situations where HSVTK/GCV combined therapy is not successful in eradicating the tumor, or where an immune response to HSVTK would preclude its use in a second round of gene therapy, the CD/5FC system offers a viable alternative, and may in fact be the preferred first gene therapy course of treatment.
The limiting factors for successful anti-tumor gene therapy are transfection efficiency and the ability of the enzyme to turn over the prodrug, which is an analogue of its natural substrate. From a kinetic perspective, 5FC is a poor substrate for bCD (Km = 3.3 mM) compared to its native substrate, cytosine (Km = 0.2 mM). Recent studies suggest the CD from Saccharomyces cerevisiae (yCD) displays a kinetic advantage towards 5FC over bCD (Kievit et al., 1999). However, yCD is considerably less thermostable than bCD, a characteristic that may make the bacterial enzyme a preferable catalyst system for gene therapy.
The crystal structure bCD has been determined in the presence and absence of a mechanism-based inhibitor. The bCD enzyme fold corresponds to an 8-stranded /ß barrel, commonly termed a TIM fold (Ireton et al., 2002). The enzyme forms an enzymatically active hexamer, in which the N- and C-terminal regions (residues 152 and 363407) form an additional domain-swapped fold that is critical for packing and stability of the enzyme hexamer. Despite its complex oligomeric structure, the enzyme does not display kinetic cooperativity and all six enzyme subunits are catalytically active and independent of one another.
We sought to create novel, drug specific bCD variants as a means to enhance tumor cell killing without increased toxicity. In the present study we have used molecular evolution to introduce mutations randomly throughout the entire reading frame to create thousands of bCD variants. We have established positive and negative genetic complementation in E.coli to identify mutants that confer increased sensitivity to 5FC. Crystal structure determinations of three key bCD mutants provide novel insight to the molecular mechanism of bCD and may be important for future engineering of the enzyme.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Restriction endonucleases and T4 DNA ligase were purchased from Gibco BRL (Rockville, MD) or New England Biolabs (Beverly, MA). Oligonucleotides used for polymerase chain reaction (PCR), site-directed mutagenesis and DNA sequencing were obtained from Operon (San Pablo, CA) or Genset (Boulder, CO). Nickel affinity chromatography agarose (Ni-NTA Agarose) used to purify mutant and wild-type bCDs was purchased from Qiagen (Valencia, CA). Enzyme assay reagents and other chemicals were purchased from Sigma (St Louis, MO) except where designated otherwise.
Bacterial strains
The cytosine deaminase deficient E.coli strain GIA38 strain (thr dadB3 leuB6 fhuA21 codA1 lacY1 tsx-95 glnV44(AS) pyrF101 his-108 argG6 ilvA634 thi-1 deoC1 glt-15) was obtained from the E.coli Genetic Stock Center (CGSC #5594). Escherichia coli GIA39 was lysogenized with DE3 according to the instructions from Novagen (Madison, WI). The derived strain GIA39(DE3) was used in the genetic complementation assays for cytosine deaminase activity. Escherichia coli strain NM522 [F' lacIq
(lacZ)-M15proA+B+/supE thi
(lac-proAB)
(hsdMS-mcrB)5(
)] was used as a recipient for certain cloning procedures. Escherichia coli strain CJ236 (F+ LAM, ung-1, relA1, dut-1, spoT1, thi-1) was used to produce single stranded DNA for site directed mutagenesis procedures. Escherichia coli BL21(DE3) tdk [F ompT[lon] hsdSb (
) gal dcm met (DE3)] was used for expression of wild-type and mutant bCD proteins.
Vectors
Initially, the bCD gene was amplified from pCD2 (a gift from Mike Blaese) using oligos (MB204, 5' GTTATTCGCCATGGCTAGCCT 3' and MB201, 5' ACTAAGCTTGCTGTAACCC 3') that introduced an NcoI site at the start codon and a HindIII site just 3' to the stop codon. The uncut 1.6 kb fragment was cloned into pCR2.1TOPO. The bCD gene was excised from pCR2.1TOPO:bCD as an NcoI/HindIII fragment and cloned into the bacterial expression vector, pETHT (Brady et al., 1996), restricted with the same enzymes. The resulting plasmid was designated pETHT:bCD.
Library construction
The template for the error prone PCR (epPCR) was pETHT:bCD. Two primers used to amplify the bCD gene hybridize to vector sequences flanking the open reading frame (T7 promoter primer, 5' TAATACGACTCACTATAGGG 3' and T7 terminator primer, 5' GCTAGTTATTGCTCAGCGG 3'). The 50 µl reaction mix contained the following reagents: 1x PCR buffer (Gibco BRL), 0.2 mM dATP, 0.2 mM dGTP, 1 mM dCTP, 1 mM dTTP, 7 mM MgCl2, 0.5 mM MnCl2, 5 U Taq polymerase, 0.5 pmol of T7 promoter primer, 0.5 pmol of T7 terminator primer and 0.16 ng of pETHT:bCD. Amplification was carried out in an Eppendorf thermocycler as follows: 94°C for 3 min followed by 30 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 40 s. At the end of the 30 cycles the reaction was incubated at 72°C for 3 min and then chilled to 4°C.
The resulting PCR fragments were restricted with NcoI and HindIII and ligated to pETHT digested with NcoI and HindIII. Ligation mixtures were used to transform GIA39(DE3) competent cells by electroporation. Following electroporation, a small fraction of cells was plated onto uracil-containing plates to determine the total number of transformants and the remainder of the transformation was plated onto cytosine-containing plates to select functional clones. The plates were incubated at 37°C for 36 h prior to scoring. Colonies that grew on cytosine plates were picked and streaked onto fresh cytosine plates to confirm the phenotype. Positive selection was based on the genetic complementation of a functional bCD mutant in the codA GIA39(DE3) strain. The CD selection medium contains 1.96 g of yeast synthetic dropout without uracil, 0.1 mM CaCl2, 0.24 mM (or 0.267 mg/ml) cytosine, 111 ml of M9 cocktail [100 ml of 10x M9 salts (30 g of KH2PO4, 67.8 g of Na2HPO4, 5 g of NaCl, 10 g of NH4Cl per liter), 1 ml of 1 M MgSO4, 5 ml of 20% glucose per liter] and 50 mg carbenicillin per liter. For uracil-containing medium (nonselective), cytosine was omitted and the yeast synthetic dropout minus uracil was replaced by 0.78 g yeast synthetic dropout minus leucine and supplemented with 2 ml of 2% leucine per liter. For plates, 17 g of Bactoagar per liter was included in the media described above.
Selection of 5FC-sensitive mutants
Functional clones were subjected to a secondary selection to determine 5FC sensitivity. Secondary selection media contained 5FC concentrations ranging from 2 to 20 µg/ml. The 5FC selection medium is the same as CD selection medium with the addition of 5FC.
Real-time PCR
Real-time PCR was used to establish the cloning frequency of the error prone bCD fragments. The SYBR Green PCR Core Reagent kit was used (PE Applied Biosystems, Foster City, CA) with oligonucleotides MB264, 5' CGGCACAAACCACCGTATATC 3' and MB265, 5' CAACTCAGCTTCCTTTCGGG 3' as follows. For each 25 µl reaction, 2 mM MgCl2, 1x SYBR Green Buffer, 1 mM dNTPs, 0.25 pmol of MB264, 0.25 pmol of MB265, 0.625 U ATAQ Gold Polymerase, 0.25 U AMP ERASE UNG, 3 µl of template and H2O to 25 µl were mixed. Eighty-seven colonies from uracil plates were individually resuspended in 250 µl of H20 and 3 µl used as template. In addition, colonies of pETHT and pETHT:bCD were resuspended in the same fashion for use as negative and positive controls, respectively. The starting temperature for the PCR was 60°C followed by 55 cycles of 55°C for 30 s and 72°C for 30 s. The PCR and analysis were performed using a PE Applied Biosystems GeneAmp 5700 Sequence Detection System Version 3.1.
Sequencing
Plasmid DNA was isolated from cultures of individual colonies using the Wizard mini-prep kit according to the manufacturer's instructions (Promega, Madison, WI). Sequencing reactions were performed at the core sequencing facility at Washington State University.
Site-directed mutagenesis
Site-directed mutagenesis (Kunkel, 1985) was used to individually introduce the following substitutions: Q102R, D314G, D314A, D314S, D314H, D314R and D314K. The oligonucleotide MB286 (5' CCATGCGCGCCGTTTCACATC 3') was used to introduce the Q102R mutations as well as to introduce a new BssHII restriction site. The following oligonucleotides were used to introduce the D314 codon changes as well as a silent mutation to introduce a MscI restriction site to facilitate identification of mutated sequences. The following oligonucleotides were used for site-directed mutagenesis: for D314G, MB287, 5' GAAGACACCATCGTGGCCAAAG 3'; D314K, MB288, 5' GAAGACTTTATCGTGCCAAAG 3'; D314R, MB289, GAAGACACGATCGTGGCCAAAG 3'; D314H, MB290, 5' GAAGACATGATCGTGGCCAAAG 3'; D314S, MB291, 5' GAAGACACTATCGTGGCCAAAG 3'; and D314A, MB292, 5' GAAGACAGCATCGTGGCCAAAG 3'. After transformation of E.coli NM522, plasmid DNA was isolated from individual clones, restricted with BssHI or MscI and the fragments separated by agarose gel electrophoresis. DNA sequencing was used to confirm the mutations. Plasmid DNA of each site-directed mutant was then used to transform E.coli GIA39(DE3). All seven mutants and the wild-type bCD construct (pETHT:bCD) were then tested for genetic complementation on cytosine-containing selection plates. Clones scored as positive for cytosine deaminase activity were streaked onto plates containing various concentrations of 5FC to evaluate the degree of prodrug sensitivity.
Enzyme purification
Expression of the wild-type and mutant cytosine deaminases was performed in BL21 (DE3) tdk cells without induction as described previously (Mahan et al., 2004). Fractions containing a single band corresponding to the molecular mass of bCD were pooled and dialyzed against a large volume of dialysis buffer (50 mM NaCl and 50 mM Tris, pH 7.5) at 4°C. After dialysis, the samples were collected and stored at 20°C. The enzyme concentration of the dialyzed sample was determined using the BCA kit from Pierce according to the manufacturer's instructions (Rockford, IL).
Enzyme assays with cytosine as the substrate
CD assays were carried out with varying substrate concentrations. Enzyme assays were performed as described by Ipata and Cercignani (1978). Kinetic values for the wild-type and D314 mutants were obtained using a spectrophotometer based assay (Pharmacia Biotech Ultrospec 2000). A stock of 1020 mM cytosine was made in 50 mM TrisHCl, pH 7.5 and diluted 1:1 with enzyme. OD286 readings were taken immediately upon mixing every 10 s for a total of 6.5 min (390 s). This was repeated using the same amount of enzyme for every cytosine concentration within the optimal range. Double reciprocal plots were used to determine Km values for each mutant and wild-type bCD enzyme. The turnover number (kcat = Vmax[E], where [E] is the total enzyme amount) was also determined for each mutant and wild-type bCD. Assays were performed five to seven times for each substrate concentration.
Enzyme assays with 5FC as the substrate
Kinetic values for the wild-type and D314 mutants (G, A and S) were obtained using a protocol similar to that described above (Hayden et al., 1998) with 5FC substituted for cytosine as the substrate. A stock of 30 mM 5FC was made in 50 mM TrisHCl, pH 7.5. A 1 ml reaction was containing the desired concentration of 5FC, enzyme and 50 mM TrisHCl, pH 7.5 was placed at 37°C. Aliquots (50 µl) of the reaction were taken every 90 s over a 15 min time period and immediately quenched in 0.1 N HCl. Readings were then taken at OD290 (OD at which 5FC absorbs) and OD255 (OD at which 5FU absorbs). Assays were repeated five to eight times. Kinetic parameters were determined as above.
Determination of mutant enzyme thermostability
The stabilities of the wild-type enzyme and the three point mutants described in this work were measured by chemical denaturation using circular dichroism. Circular dichroism spectra were collected on an Aviv 62A DS spectrometer. Far UV circular dichroism wavelength scans (200260 nm) at varying protein concentrations (520 µM) were collected in a 1 mm pathlength cuvette. Protein denaturation due to thermal melting was followed by change in ellipticity at 220 nm.
Crystallography
The expression, purification and crystallization of bCD and bCD variants were carried out as previously described (Ireton et al., 2002). X-ray diffraction data were collected at beamlines 5.0.1 and 5.0.2 at the ALS (Advanced Light Source, Lawrence Berkeley Laboratory, Berkeley, CA) using a four panel ADSC CCD area detector. Data were processed and scaled using the DENZO/SCALEPACK program packages (Otwinowski, 1993
; Otwinowski and Minor, 1997
). The structures were refined using CNS with a random 5% of the data excluded for the purpose of cross-validation (Brunger, 1993
). Crystals containing the enzyme in complex with a mechanism based inhibitor [5-fluoro-4-(S)-hydroxyl-3,4-dihydropyrimidine or 5FDHP] were prepared by soaking in cryo-buffer containing 510 mM 5-fluoro-2-hydroxypyrimidine (Aldrich, Milwaukee, WI). Unbiased (Fobs 2FDHP Fcalc apo)
apo maps were examined and used for rebuilding. All structures were refined using CNS, as described above for the uncomplexed enzymes.
![]() |
Results and discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
CD plays an essential role in activation of 5FC and the yeast and bacterial CD are both being explored for use as suicide genes for cancer gene therapy. Despite the ability of these two enzymes to catalyze the same reaction, there is no identifiable primary sequence homology or conserved motifs that might reveal important regions (Ireton et al., 2003). At the time this study was initiated, the crystal structure of bCD was not yet available to model potential active site amino acid interactions with substrates. In the absence of a clear region to target, we used epPCR to introduce random nucleotide changes throughout the bCD coding region in combination with both positive and negative selections to create and identify novel bCD mutants that enhance 5FC sensitivity to cells (Figure 1).
|
All 1400 CD-positive clones were picked and streaked onto plates containing 5FC at a concentration determined to be sublethal to wild-type bCD (20 µg/ml 5FC). Starting at 20 µg/ml 5FC, where 70 clones or 0.05% were more sensitive than wild-type bCD, the concentration was progressively reduced until a single remaining mutant, #550 was determined to be most sensitive to the lowest experimental concentration of 5FC (2 µg/ml). Fourteen additional clones displayed sensitivity at a slightly higher concentration of 5FC (10 µg/ml) and were also included for subsequent analyses.
Plasmid DNA from mutant 550 and other mutants with sensitivity to 10 µg/ml 5FC was isolated and the entire bCD open reading frame sequenced. Sequence results show that the 5FC-sensitive clones contain at least two and up to eight amino acid substitutions. The spectrum of amino acid substitutions that lead to increased 5FC sensitivity show a uniform distribution of mutations throughout the open reading frame as shown in Figure 2. One mutant contained four point mutations and a mutation at the stop codon that resulted in the fusion of an additional 23 amino acids at the C-terminus. Four amino acid positions were observed to contain two different amino acid substitutions, e.g. T42 was substituted by A and S in two independently isolated clones. The same substitution was found independently twice for two different positions (T248A and Q339L). Of particular note is the occurrence of D314G in three of the mutant sequences, including mutant 550 (Figure 2). The mutation at codon D314 in all three clones occurs at nucleotide 944 and reflects an A to G transition. Because it is the only nucleotide alteration in common between mutant 550 (three changes), 1456 (three changes) and 1491 (eight changes), it is possible that the mutation at nucleotide 944 occurred early during the PCR cycle and all other mutations observed in these clones occurred after the initial mutational event.
|
To further investigate the role of the aspartic acid at position 314, several other substitutions were made at that position: D314K, D314R, D314H, D314S and D314A. The basic side chain substitutions (K, R and H) yielded inactive enzymes as assessed by complementation. However, D314S and D314A were both functional towards cytosine and conferred sensitivity to 5FC at 4 and 2.5 µg/ml, respectively. In a separate study, alanine scanning mutagenesis was used to substitute residues 310320 with alanine. Surprisingly, only D314A was shown to confer increased 5FC sensitivity to GIA39 (DE3) cells (Mahan et al., 2004).
Enzyme behavior and kinetics
Purification of wild-type bCD, D314G, D314A and D314S enzymes for kinetic analysis was achieved using batch nickel affinity chromatography. All enzymes displayed non-cooperative, saturable MichaelisMenten profiles. The kinetic parameters determined for the wild-type bCD and the three D314 mutants are shown in Table I. The kinetic values determined for the wild-type bCD correspond to values previously reported in the literature by Porter (2000). All three enzyme point mutants displayed thermal melting points (Tm) that were unchanged from the wild-type enzyme (85 ± 2°C).
|
Fluorocytosine is a relatively poor substrate for bCD, primarily because it binds the wild-type enzyme with a Km increased by 16.5-fold relative to cytosine (Table I). This effect is presumed to be caused by electrostatic repulsion of the fluorine atom by the side chain carboxylate oxygens of D314. Evaluation of the 5FC kinetic profiles for point mutants at residue 314 indicates that the mutations have minor effects on the binding of 5FC (ranging from a 15% reduction in Km for D314A to a 3-fold increase for D314G) and consistent increases in kcat (as much as 3-fold higher for D314S). As a result, the catalytic efficiency of the mutants towards 5FC is slightly decreased for one mutant (D314G) but improved for the remaining two mutants (D314S and D314A). Taken together, the 5FC kinetics, with a kcat/Km value twice that of wild-type bCD indicates that D314A displays the most significant shift in specificity towards 5FC.
From a comparison of wild-type and D314A kinetics for 5FC, one might not predict that D314A would provide a significantly enhanced prodrug sensitivity to cells. However, because endogenous cytosine within the cell competes with 5FC for the active site, it is important to consider the ratio of specificity constants for the prodrug and cytosine. We used the equation [kcat/Km (5FC)]/[kcat/Km (cytosine)] + [kcat/Km (5FC)] to take this into account (Table I). D314G and D314S display moderate shifts in their relative specificities when they are compared to the wild-type bCD at 2.5- and 4.2-fold, respectively. In comparison, the D314A mutant is shifted 19-fold in favor of 5FC.
Structural studies
To determine the effect of each amino acid substitution on the bCD structure and substrate binding, each mutant (D314G, D314A and D314S) was crystallized in the absence and presence of a fluorinated mechanism based inhibitor, 5-fluoro-2-hydroxypyrimidine (5FDHP). The six structures (D314G, D314A, D314S, with and without 5FDHP) were all refined between 1.6 and 1.1 Å resolution. Crystallographic statistics are listed in Table II.
|
|
Unbiased Fourier difference maps calculated with diffraction data from bCD mutant crystals soaked with the mechanism-based inhibitor 5-fluoro-2-hydroxypyrimidine display clear electron density for the bound compound adjacent to the active site metal ion (Figure 4). Occupancy refinement on the bound inhibitor leads to a values of 7090% for the different mutant data sets.
|
Effects of mutations at residue 314 on binding and deamination of cytosine and 5FC
A comparison of high-resolution crystallographic analyses of wild-type enzyme bound to a DHP (a transition state analogue of cytosine) and of the mutants bound to 5FDHP (a corresponding 5' fluorinated version of the same compound) indicates that binding interactions of these compounds to the active sites are similar with the exception of the distance from the 5' position of the pyrimidine ring to residue 314 and the chemical structure of the side chain at that position. The primary effect of the mutations that cause increased cellular sensitivity towards 5FC is not simply a significant improvement in the affinity of the prodrug, but rather a mixture of effects on relative substrate binding affinities, transition-state contacts and the resulting turnover rate for cytosine and 5FC. While two of the mutants (D314G, D314S) display decreased affinity towards 5FC (3.3- and 2-fold higher Km, respectively), this effect is less than the corresponding decrease in affinity towards cytosine. In contrast, the point mutant with the most significant shift in specificity in favor of 5FC (D314A), displays a slightly improved affinity towards 5FC and at the same time also displays the largest decrease in affinity towards cytosine (11-fold higher Km). This point mutant is the only one with roughly equivalent Km values towards the two substrates.
The observed trends in 5FC binding affinity for the three mutants appear to be well correlated with their crystal structures bound to the fluorinated transition-state analog. The two mutants with poor 5FC Km values display inappropriate van der Waals contact distances to the fluorine atom: either too long for effective favorable interactions (D314G; 5.1 Å) or somewhat short, leading to unfavorable crowding of electronegative oxygen and fluorine atoms (D314S, 3.0 Å). Only the D314A methyl group displays a distance to the prodrug fluorine atom that is clearly within a favorable van der Waals contact range (4.2 Å).
Other trends in the kinetic behavior of the substitutions at residue 314 are more difficult to correlate confidently with the crystallographic structures. For example, one mutant (D314S) displays an improved turnover rate (kcat), relative to wild-type enzyme, for both cytosine (up 2-fold) and 5FC (up 3-fold, the largest increase of the mutants). In contrast, the other two mutants (D314G and D314A) display reduced turnover rates towards cytosine, but slightly elevated turnover rates with 5FC. Structural analyses of the mutants in the absence of bound inhibitor indicate that the D314S mutant displays the largest shift of D313 away from the active site iron atom, as described above (Figure 4). It is possible that the movement of active site atoms in the mutants, particularly for D314S, alters either the electrostatic potential of the bound iron atom and the pKa of its bound nucleophilic water, and/or the dynamics of lid movement across the active site during product binding and release.
In summary, we have used an approach of directed evolution, combining random mutagenesis and genetic complementation, to create novel cytosine deaminase variants that impart enhanced sensitivity to 5-fluorocytosine in transformed cells. While we have made substantial improvements to HSVTK with respect to prodrug activation using a regiospecific randomized approach (Black et al., 1996, 2001
; Kokoris et al., 1999
, 2002
), this is the first demonstration that the substrate preference of cytosine deaminase can be significantly improved for prodrug gene therapy using a randomized approach. Surprisingly, an alanine scanning mutagenesis study carried out at the same time to investigate the role of residues 310320 in the structure to function relationship of bCD also revealed the importance of D314 in 5FC activity (Mahan et al., 2004
). The study presented here demonstrates a direct correlation between the observed changes in kinetic profiles for cytosine and 5-fluorocytosine and the effect on cell viability in the presence of the prodrug. Despite the thermolability of yCD, others have suggested that yCD is superior to bCD in gene therapy settings due to a 23-fold relative substrate preference for 5FC displayed by yCD (Kievit et al., 1999
). However, given the thermostability of bCD and the 19-fold relative substrate preference the bCD mutant D314A displays towards 5FC, bCD D314A may be a superior suicide gene to yCD. The results indicate that the best bCD mutant described here (D314A) is an excellent candidate for subsequent preclinical comparisons with wild-type bCD and yCD, and is the obvious starting construct for further mutagenesis and selection of variants with larger shifts in substrate preference towards 5FC.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bi,W.L., Parysek,L.M., Warnick,R. and Stambrook,P.J. (1993) Hum. Gene Ther., 4, 725731.[ISI][Medline]
Black,M.E., Newcomb,T.G., Wilson,H-M.P. and Loeb,L.A. (1996) Proc. Natl Acad. Sci. USA, 93, 35253529.
Black,M.E., Kokoris,M.S. and Sabo,P. (2001) Cancer Res., 61, 30223026.
Brady,W.A., Kokoris,M.S., Fitzgibbon,M. and Black,M.E. (1996) J. Biol. Chem., 271, 1673416740.
Brunger,A.T. (1993) Acta Crystallogr. D, 49, 2436.[CrossRef][ISI]
Cadwell,R.C. and Joyce,G.F. (1992) PCR Methods Appl., 2, 2833.[Medline]
Colombo,B.M., Benedetti,S., Ottolenghi,S., Mora,M., Pollo,B., Poli,G. and Finocchiaro,G. (1995) Hum. Gene Ther., 6, 763772.[ISI][Medline]
Culver,K.W., Ram,Z, Wallbridge,S., Ishii,H, Oldfield,E.H. and Blaese,R.M. (1992) Science, 256, 95759579.
Cunningham,C. and Nemunaitis,J. (2001) Hum. Gene Ther., 12, 15941596.[Medline]
Dilber,M.S., Abedi,M.R., Christensson,B., Bjorkstrand,B., Kidder,G., Naus,C.C.G., Gahrton,G. and Smith,C.I.E. (1997) Cancer Res., 57, 15231528.[Abstract]
Domin,B.A., Mahony,W.B. and Zimmerman,T.P. (1993) Biochem. Pharmacol., 46, 503510.[CrossRef][ISI][Medline]
Freeman,S.M., Abboud C.N., Whatenby,K.A., Packman,C.H., Koeplin,D.S., Moolten,F.L. and Abraham,G.N. (1993) Cancer Res., 53, 52745283.[Abstract]
Freytag,S.O. et al. (2002) Cancer Res., 62, 49684976.
Greco,O. and Dachs,G.U. (2001) J. Cell Physiol., 187, 2236.[CrossRef][ISI][Medline]
Hayden,M.S., Linsley,P.S., Wallace,A.R., Marquardt,H. and Kerr,D.E. (1998) Protein Exp. Purif., 12, 173184.[CrossRef][ISI][Medline]
Hirschowitz,E.A., Ohwada,A., Pascal,W.R., Russi,T.J. and Crystal,R.G. (1995) Hum. Gene Ther., 6, 10551063.[ISI][Medline]
Huber,B.E., Austin,E.A., Good,S.S., Knick,V.C., Tibbels,S. and Richards,C.A. (1993) Cancer Res., 53, 46194626.[Abstract]
Ipata,P.L. and Cercignani,G. (1978) Methods Enzymol., 51, 395400.
Ireton,G.C., McDermitt,G., Black,M.E. and Stoddard,B.L. (2002) J. Mol. Biol., 315, 687697.[CrossRef][ISI][Medline]
Ireton,G.C., Black,M.E. and Stoddard,B.L. (2003) Structure, 11, 961972.[CrossRef][ISI][Medline]
Katsuragi,T., Sakai,T. and Tonomura,K. (1987) Appl. Biochem. Biotechnol., 16, 6169.[ISI][Medline]
Kawate,H., Landis,D.M. and Loeb,L.A. (2002) J. Biol. Chem., 277, 3630436411.
Kievit,E., Bershad,E., Ng,E., Sethna,P., Dev,I., Lawrence,T.S. and Rehemtulla,A. (1999) Cancer Res., 59, 14171421.
Kokoris,M.S. and Black,M.E. (2002) Protein Sci., 11, 22672272.
Kokoris,M.S., Sabo,P., Adman,E.T. and Black,M.E. (1999) Gene Ther., 6, 14151426.[CrossRef][ISI][Medline]
Kunkel,T.A. (1985) Proc. Natl Acad. Sci. USA, 82, 488492.[Abstract]
Kuriyama,S. et al. (1998) Anticancer Res., 18, 33993406.[ISI][Medline]
Mahan,S.D., Ireton,G.C., Stoddard,B.L. and Black,M.E. (2004) Biochemistry, 43, 89578964.[CrossRef][ISI][Medline]
Miller,W.H. and Miller,R.L. (1980) J. Biol. Chem., 255, 72047207.
Moolten,F.L. (1986) Cancer Res., 46, 52765281.[Abstract]
Mullen,C.A., Kilstrup,M. and Blaese,R.M. (1992) Proc. Natl Acad. Sci. USA, 89, 3337.[Abstract]
Nishiyama,T., Kawamura,Y., Kawamoto,K., Matsumura,H., Yamamoto,N., Ito,T., Ohyama,A., Katsugari,T. and Sakai,T. (1985) Cancer Res., 45, 17531761.[Abstract]
Ohwada,A., Hirschowitz,E.A. and Crystal,R.G. (1996) Hum. Gene Ther., 7, 15671576.[ISI][Medline]
Otwinowski,Z. (1993) In: Sawyer,L. Issacs,N. and Bailey,S. (eds), Proceedings of the CCP4 Study Weekend. DERC Daresbury Laboratory Press, Warrington, pp. 5662.
Otwinowski,Z. and Minor,W. (1997) Methods Enzymol., 276, 307326.[ISI]
Porter,D.J.T. (2000) Biochem. Biophys. Acta, 1476, 239252.[ISI][Medline]
Senter,P.D., Su,P.C.D., Katsuragi,T., Sakai,T., Cosand,W.L., Hellstrom,I. and Hellstrom,K.E. (1991) Bioconjug. Chem., 2, 447451.[ISI][Medline]
Stemmer,W.P.C. (1994) Proc. Natl Acad. Sci. USA, 91, 1074710751.
Received June 10, 2004; revised August 31, 2004; accepted September 6, 2004.
Edited by Dan Tawfik
|