1 Department of Internal Medicine, Clinical Haematology, 2 Department of Clinical Epidemiology and Biostatistics, Academic Medical Center, Amsterdam, 3 Department of Clinical Epidemiology, Leiden University Medical Center, Leiden, 4 Department of Biochemistry, Academic Medical Center and 5 Dianet Dialysis Center, Academic Medical Center, Amsterdam, The Netherlands
Correspondence and offprint requests to: G. E. Linthorst, Academic Medical Center, Department of Internal Medicine, Clinical Haematology, F4-224, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. Email: g.e.linthorst{at}amc.uva.nl
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Methods. Activity of -Gal A in whole blood was measured in a group of 508 male Dutch dialysis patients.
Results. Of the 508 patients studied only one patient, already known with Fabry disease, had a -Gal A deficiency, a prevalence of 0.22% (95 CI 01.1%).
Conclusions. No undiagnosed Fabry patients were found, indicating that in our studied cohort there is no large-scale underestimation of its prevalence. Even though screening of dialysis patients for Fabry disease might identify patients who remain otherwise unrecognized, screening of high-risk populations for -Gal A deficiency should be carried out with caution since long-term efficacy of treatment is currently unknown.
Keywords: Fabry disease; -galactosidase A; lysosomal storage disorder; prevalence; screening
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
It is possible that due to its variability in clinical expression, the above-mentioned symptoms are not always recognized as Fabry disease, resulting in underdiagnosis and consequently underestimation of its prevalence. The prevalence of Fabry disease in large dialysis registry programmes was shown to be 0.019 and 0.017%, in Europe and the US, respectively [2,3]. Reports on the prevalence of Fabry disease in such registries depend on a correct diagnosis. In contrast, Utsumi et al. [4] diagnosed Fabry disease in two of 440 males (0.45%) with renal failure in Japan. Given 2700 male dialysis patients in The Netherlands [5], such prevalence indicates that there could be around 12 Fabry patients on dialysis. Currently only one dialysis patient is known to have Fabry disease. Therefore, there is reason to believe that an underestimation of the actual number of patients is made in dialysis registries.
Studying the prevalence of Fabry disease in The Netherlands may be relevant, as enzyme supplementation therapy for Fabry disease is currently available in the EU [6,7]. Whether dialysis patients can benefit from enzyme therapy is unknown. The aim of the present study was to screen the number of Fabry patients by detection of -Gal A deficiency in a Dutch cohort of dialysis patients (Netherlands Cooperative Study on the Adequacy of Dialysis). In addition, conditions for successful and beneficial screening for Fabry disease in high-risk groups will be discussed.
![]() |
Subjects and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Determination of -Gal A activity
EDTA blood tubes were thawed and 25 µl of EDTA whole blood was incubated for 2 h in tubes containing 100 µl 1.5 mg/ml 4-MU -galactosylpyranoside and 100 mmol N-acetyl-galactosamine (both Sigma) in pH 4.5 McIlvain buffer. Samples were measured in duplicate. The reaction was stopped by adding 2.3 ml 0.3 M glycine Na-OH, pH 10.6. Fluorescence was measured using a fluorometer (exciting 360 nm reading 445 nm). Results were expressed as means ± SD.
Role of quenching
To exclude the possibility that haemoglobin from thawed samples could mask fluorescence (so-called quenching) and subsequently give false-negative fluorescence, an EDTA anticoagulated whole blood sample from one known Fabry patient on haemodialysis was frozen. Upon thawing this sample was mixed with known concentrations of 4-MU and fluorescence was measured as described above.
DNA-mutation analysis
From 400 µl of whole blood DNA was isolated. All 7 exons of the -Gal A gene were sequenced using the following primers. Exon 1, GGTGATTGGTTAGCGGAACGTCTT (sense, sequence-reaction exon 1) and GAGCTCTCCCTC GGGCTCAACT (antisense). Exon 2, ACTACCACAC TATTACTGGGTTGGA (sense, sequence-reaction exon 2) and TGTTCAGATAACAGCCAGCTATTCTA (antisense). Exons 34, CAATACCTGGTGAAGTAACC TTGTC (sense, sequence reaction exon 3) and GGAACC TGGGAGAGATGGTAGGAT (antisense, sequence-reaction exon 4). Exon 57, GACCTCCTTATGGA GACGTTCAATC (sense, sequence-reaction exon 5) and CGGAAAATTTTATTCAAGGAAATAGAAC (antisense), TGTTTCTAGCAAGAAGCTTTATTACTG (sequence-reaction exon 6) and GAGCCACCTAGCC TTGAG (sequence-reaction exon 7).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Quenching
Incubation of 4-MU with increasing amounts of whole blood from one Fabry-patient on dialysis reduced fluorescence with a maximum of 40% when 25 µl of blood was incubated. Even if a reduced fluorescence of 40% were taken into account in the patient with reduced -Gal A activity, no overlap existed between the
-Gal A deficient patient and other subjects. Therefore, the risk of detecting false-positive results (no fluorescence due to the quenching phenomenon) was be negligible.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Assessment of -Gal A activity is preferably performed in leukocytes. However, sometimes other sources are used, such as dried whole blood spots, serum or plasma [9,10]. As it is unclear whether these sources are as reliable as leukocytes, enzymatic results must be confirmed by genotyping. For our study only frozen whole blood samples were available. We showed that absorbance of fluorescence by haemoglobin (quenching) when using whole blood as source did not influence the test results. In addition, mutation analysis confirmed test outcome by confirmation with mutation analysis.
The observed prevalence in this study is in accordance with previous reports. Utsumi et al. [4] found two patients out of 406 Japanese male (0.49%) and 0/282 female dialysis patients using plasma as source. From one patient DNA was available and diagnosis was confirmed by mutation analysis of the -Gal A gene. In addition, Walter and co-workers [11] detected nine deficient
-Gal A plasma levels taken from 1903 randomly chosen male dialysis patients in the US (0.47%). Spada and Pagliardini [12] identified
-Gal A deficiency in dried whole blood spots in 4/1765 (0.22%) Italian males and 0/1226 female patients on dialysis. Deficiency of
-Gal A was confirmed by mutation analysis in all patients in both studies.
These results indicate that Fabry disease may be much more common among male dialysis patients than previously recognized through dialysis registries [2,3]. Apparently, Fabry disease is seldom recognized as a cause of renal failure and is subsequently possibly under-diagnosed. Subsequently, Fabry disease should be considered in every patient with unexplained renal disease, especially when cardiac or cerebral complications suggest an underlying multi-systemic disorder. In males Fabry disease can reliably be diagnosed by -Gal A activity determination. This could then be followed by screening of family members for Fabry disease, in whom progression of renal failure or other organ failure due to the disease may be detected at an earlier stage, enabling appropriate intervention. These arguments are in favour of screening all patients with unexplained renal failure for
-Gal A deficiency.
However, it is important for successful and beneficial screening to meet well-defined criteria [13]. These are a well-defined and understood disease with known natural history and effective treatment, a reliable test and finally an agreement on the action taken following a positive result. In Fabry disease, these criteria are not currently met. First of all, enzymatic analysis fails to detect all female carriers of the disease. It is now well recognized that females can also exhibit symptoms due to Fabry disease [14]. This is confirmed by the observation that 12% of the Fabry patients on dialysis are female [2,3]. Detection of female carriers can only be reliably performed with DNA-mutation analysis. Reports on enzymatic screening dialysis patients that fail to detect female carriers of Fabry disease may lead to the false assumption that -Gal A deficiency does not occur in female dialysis patients. Second, the positive outcome of long-term therapeutic intervention for patients with Fabry disease still has to be substantiated. Studies with recombinant
-Gal A enzyme supplementation therapy have shown a stabilization of renal function during 3 years of therapy, the longest period studied. It is unclear if patients on dialysis have a more favourable outcome whether treated or not, although it is anticipated that enzyme supplementation therapy will reduce co-morbidity arising from other involved organs. At last, mass screening patients routinely for
-Gal A deficiency places a moral dilemma for screened individuals and family members, given the inheritable nature of the disorder. Therefore, it is our view that screening of high-risk populations should be used with caution until further insight into the nature of and treatment for Fabry disease has progressed.
![]() |
Conclusion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Acknowledgments |
---|
Conflict of interest statement. None declared.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|