1 University of Melbourne Departments of Medicine at St Vincent's Hospital, Fitzroy, 2 Austin and Repatriation Medical Centre, Heidelberg, Australia and 3 The Haartman Institute, Division of Bacteriology and Immunology, University of Helsinki, Finland
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Methods. Nephrin gene expression and localization were examined in rats with streptozotocin-induced diabetes at 6 months duration (proteinuric phase) and at 7 days (pre-proteinuric phase). In addition, the effects of anti-proteinuric drug therapies were also assessed in long-term diabetic rats, treated with either the angiotensin-converting enzyme inhibitor perindopril, or the blocker of advanced glycation end-product formation, aminoguanidine. Nephrin expression was determined using quantitative real-time PCR and in situ hybridization.
Results. When compared with control animals, nephrin expression was reduced in the late proteinuric phase (45% reduction vs controls, P<0.01) but not in the early, pre-proteinuric phase of experimental diabetic nephropathy. While ACE inhibition and aminoguanidine both reduced proteinuria, only the former attenuated the diabetes-associated reduction in nephrin expression.
Conclusions. These findings suggests that reduction in nephrin may be a determinant of glomerular hyperpermeability in diabetic nephropathy. Attenuation of these changes with ACE inhibition suggest that this mechanism may contribute to the anti-proteinuric effects of this, but not all classes of drug which reduce urinary protein in diabetic nephropathy.
Keywords: advanced glycation end products; angiotensin II; diabetes; nephrin; podocyte; proteinuria
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Agents that block the reninangiotensin system (RAS), such as angiotensin-converting enzyme (ACE) inhibitors, reduce proteinuria to a greater extent than would be expected by blood pressure reduction alone. Indeed, the reduction in proteinuria by RAS blockade may also account for the effectiveness of this strategy in reducing the attendant decline in glomerular filtration rate (GFR) [5], with proteinuria strongly implicated in the pathogenesis of secondary tubulointerstitial disease [6]. However, while there has been a presumption that the anti-proteinuric effects of ACE inhibitors reflect changes in intraglomerular haemodynamics, the podocyte may also contribute to the effectiveness of this class of drug.
Long-lived non-enzymatically glycated proteins referred to as advanced glycation end-products (AGEs) have also been implicated in the pathogenesis of diabetic nephropathy. For instance, the administration of AGEs to non-diabetic animals leads to albuminuria [7], and inhibition of advanced glycation with aminoguanidine reduces proteinuria in experimental diabetes [8]. In addition, these findings raise the possibility that AGEs may also induce proteinuria by alterations in podocyte structure and function.
The aims of the present study were twofold. Firstly, we sought to examine whether nephrin gene expression was altered in experimental diabetes before or after the development of proteinuria. Secondly, the study sought to examine the effects on nephrin expression of two different anti-proteinuric therapies: ACE inhibition and aminoguanidine.
![]() |
Subjects and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In study 1, 14 male SpragueDawley rats aged 13 weeks were randomly assigned to control and diabetic groups. Diabetes was induced in seven rats by the intravenous administration of streptozotocin (STZ) 45 mg/kg body weight. Rats were given ad libitum access to water and standard chow containing 20% protein (Clark, King & Co, Melbourne, Australia). Only STZ-treated animals with plasma glucose levels >15 mmol/l were considered diabetic and included in the study. Animals were sacrificed at 7 days following STZ injection. At sacrifice, the left kidney was decapsulated and glomeruli isolated by serial sieving as previously described with specimens >90% pure glomeruli [9]. Glomeruli were then frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction and gene expression analysis.
To assess the expression of nephrin in proteinuric diabetic rats, study 2 was performed. As in study 1, rats (n=32) were randomly assigned to receive STZ (n=24) at a dose of 45 mg/kg (diabetic) or citrate buffer alone (control, n=8). Diabetic rats were further randomized to receive either the ACE inhibitor, perindopril (Servier, Neuilly, France) 2 mg/l in drinking water, aminoguanidine hydrogen carbonate (Fluka Chemica AG, Buchs, Switzerland) 1 g/l in drinking water, or untreated drinking water. Diabetic animals received 4 units of long-acting insulin daily (Ultralente, Novo-Nordisk, Bagsvaerd, Denmark) to maintain body weight and prevent ketoacidosis. Control rats were injected with citrate buffer. Seven days prior to their sacrifice at 24 weeks, animals were housed in metabolic cages for 24 h to obtain urine for the measurement of albumin by radioimmunoassay. At 24 weeks rats were killed by decapitation. The right kidney was excised, decapsulated, and bisected sagittally. The anterior half-kidney was immersion fixed in 10% neutral buffered formalin for in situ hybridization studies. The left kidney was then also excised, decapsulated, and glomeruli extracted and stored as in study 1.
RNA extraction and cDNA synthesis
Frozen glomeruli, stored at -80°C were homogenized (Ultra-Turrax, Janke and Kunkel, Staufen, Germany) and total RNA was isolated by the acid guanidinium thiocyanate-phenol-chloroform extraction method [10]. The purified RNA was dissolved in sterile water, quantified spectrophotometrically and its concentration adjusted to 1 µg/µl. Four micrograms of total RNA in 10 µl of water was mixed with 1 µl (0.05 µg) random hexamers (Life Technologies, Rockville, MD) and incubated for 10 min at 70°C. After cooling on ice for 2 min, 2 µl of 10xPCR buffer, 2 µl of 25 mmol/l MgCl2, 1 µl of 10 mmol/l dNTP mix, and 2 µl of 0.1 mol/l DTT were added in order. Tubes were incubated at 25°C for 5 min, after which 1 µl of SuperScript II reverse transcriptase was added (200U; Life Technologies, Rockville, MD) and incubated at 25°C for 10 min and at 42°C for 50 min. Reactions were terminated at 70°C for 15 min before chilling on ice. One microlitre of RNase H was added to each sample at incubated at 37°C after which samples were stored at -40°C for future use. Parallel reactions for each RNA sample were run in the absence of SuperScript II (genomic controls) to assess the degree of any contaminating genomic DNA.
Quantitative real-time RT-PCR
Nephrin gene expression was quantified by real-time RT-PCR using sequence specific primers as previously reported by our group, with forward primer (5' to 3'): TAATGTGTCTGCGGCCCAG, reverse primer (5' to 3'): TTGGTGTGGTCAGAGCCAAG, and probe: FAM-CCCTCTTCAAATGCACGGCCACCA-TAMRA [11]. A commercial, pre-developed 18S control kit labelled with the fluorescent reporter dye (VIC) on the 5' end and the quencher (TAMRA) on the 3' end (PE Biosystems, Foster City, CA, USA) was used as the housekeeping gene to control for inequalities of loading. Primers and probes for target genes were obtained from PE Biosystems. The probe for nephrin included a fluorescence reporter (6-carboxyfluorescein (FAM)) at the 5'-end and a fluorescent quencher (6-carboxytetramethylrhodamine (TAMRA)) at the 3' end. For the relative quantification of the target gene and the endogenous reference 18S ribosomal RNA (18S), real-time quantitative RT-PCR was performed using a GeneAmp 5700 Sequence Detector (PE Biosystems) according to the manufacturer's instructions. The derived normalized values are the averages of four runs.
In situ hybridization
An anti-sense riboprobe was generated as previously described [12]. In brief, a 293 base pair cDNA coding for rat nephrin was cloned into pGEM-T (Promega), linearized with Not I and an anti-sense riboprobe was produced using T7 RNA polymerase. Purified riboprobe length was adjusted to approximately 150 bases by alkaline hydrolysis. Four-µm-thick sections were cut onto slides precoated with 3-aminopropyltriethoxysilane and baked overnight at 37°C. Tissue sections were dewaxed and rehydrated, and in situ hybridization was performed using radiolabelled riboprobe as previously described [12]. Following hybridization, slides were washed in 2xSSC for 45 min at 55°C, dehydrated in graded ethanol, air dried, and exposed to Kodak X-Omat autoradiographic film for 3 days. Slides were then dipped in Ilford K5 nuclear emulsion (Ilford, Mobberley, Cheshire, UK), stored in a light-free box with desiccant at 4°C for 21 days, immersed in Kodak D19 developer, fixed in Ilford Hypan, and stained with haematoxylin and eosin.
Statistics
Because of its highly skewed distribution, albumin excretion rate (AER) was logarithmically transformed before statistical analysis and expressed as the geometric meanx/÷ tolerance factor. Between group differences were analysed by ANOVA with correction for multiple comparisons using the Fisher's least significant difference test. Linear regression analysis was used to determine the correlation between the magnitude of nephrin gene expression and proteinuria. Analyses were performed using the Statview SE+ Graphics package (Abacus Concepts, Calabasas, CA, USA) on an Apple Macintosh G4 (Apple Computer Inc, Cupertino, CA, USA). A P value <0.05 was considered statistically significant.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
Real time and RT-PCR
In study 1, short-term diabetes was not associated with altered nephrin gene expression (Table 1). However, in study 2, glomerular nephrin gene expression, as assessed by quantitative real time RT-PCR, was reduced in long-term diabetic rats compared with control animals (Figure 1
). Nephrin mRNA in perindopril-treated diabetic rats was greater than that of untreated diabetic animals and similar to that in glomeruli from non-diabetic controls. In contrast, in aminoguanidine-treated rats, nephrin expression was similar to untreated diabetic animals. No correlation was noted between nephrin expression and AER.
|
In situ hybridization
Emulsion-dipped, haematoxylin and eosin counterstained sections localized nephrin mRNA exclusively to the glomerulus. Nephrin mRNA was detected in a predominantly peripheral distribution consistent with expression in visceral epithelial cells in both control and diabetic rat kidneys (Figure 2). Fewer autoradiographic grains were detected in glomeruli of diabetic rats and diabetic animals treated with aminoguanidine. In perindopril-treated diabetic rats, nephrin gene expression was similar to control animals. There was no evidence of extraglomerular expression in animals from either group. No hybridization was noted in sections incubated with nephrin sense riboprobe.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The normal glomerulus rigorously restricts the transcapillary passage of large-molecular-weight proteins whilst permitting the permeation of smaller molecules, electrolytes, and water. Disruption of this barrier function results in excessive transcapillary passage of protein and proteinuria. The complexities of the glomerular barrier are only beginning to be unravelled, with recent studies suggesting a key role for the podocyte slit-pore protein, nephrin [3], mutations of which are responsible for the Finnish-type congenital nephrotic syndrome [3]. More recently, the role of nephrin in the pathogenesis of acquired proteinuric disease has also been explored, with variable changes in expression documented in a range of human glomerulopathies [4] and experimental models [14]. In the present study, nephrin expression was reduced in glomeruli of rats with long-term, proteinuric diabetes but not in animals with short-term diabetes, studied prior to the development of proteinuria. These findings suggest that the reduction in nephrin expression is not the result of hyperglycaemia per se.
As in humans, renal hypertrophy is also a characteristic feature of experimental diabetes. The glomerulus in particular undergoes a rapid increase in size, such that glomerular volume increases by 30% of experimental diabetes [15]. However, in the present study, nephrin expression during this early phase of diabetic glomerulopathy remained unchanged, suggesting that slit-pore composition remained constant and its barrier function is unperturbed by hyperglycaemia per se. In contrast, in long-term, proteinuric, diabetic rats, nephrin gene expression was significantly reduced. This reduction in nephrin expression may be either a primary or a secondary phenomenon. For instance, it is possible that nephrin expression may be reduced as a consequence of podocyte loss, as documented in micro- and macroalbuminuric diabetic subjects, but not those with normoalbuminuria [16]. However, it is also possible that a primary reduction in nephrin may destabilize and consequently disrupt the slit-membrane structure, thereby leading to podocyte loss and proteinuria.
In addition to reducing proteinuria, in the present study, ACE inhibitor treatment was associated with normalization of nephrin gene expression. ACE inhibitors have long been recognized as potent anti-proteinuric agents, reducing urinary protein excretion beyond that expected due to blood pressure reduction alone. Indeed, the anti-proteinuric effect of this class of drugs is viewed as an important factor in their renoprotective effects in both diabetic and non-diabetic kidney diseases [5,6]. However, the mechanisms underlying the anti-proteinuric effects of blockade of the RAS are not completely understood. Angiotensin II is known to regulate glomerular function by modulation of arteriolar tone and ultrafiltration co-efficient Kf [17]. More recently, functioning receptors for angiotensin II have been identified in the podocyte in freshly isolated intact glomeruli [18]. Furthermore, in contrast to other classes of anti-hypertensive agents, blockade of the RAS preserves podocyte structure following renal mass reduction [19], suggesting a direct effect of angiotensin II on podocyte integrity. Similarly, in experimental diabetic nephropathy, both ACE inhibitor and angiotensin-receptor blocker attenuated the accompanying decrease in the number of podocyte slit pores per unit length of GBM [20]. Together with the present study, these findings suggest that the renoprotective effects of blockade of the RAS may include preservation of podocyte number, structure, and molecular composition, with nephrin a key component of this structurefunction relationship [3]. However, in addition to blockade of the RAS, it is possible that the hypotensive effects of perindopril, as demonstrated in the present study, will have also contributed to the described changes, by reducing podocyte barotrauma.
As a consequence of increased substrate (glucose) availability, AGEs accumulate at an accelerated rate in patients with diabetes where they have been postulated to play a major role in the pathogenesis of diabetic nephropathy. Inhibition of AGE formation with aminoguanidine, reduces proteinuria in diabetic animals [8], although the mechanisms underlying this effect are not well understood and while this agent has been shown to reduce fractional mesangial volume [8], in contrast to ACE inhibition, it does not affect diabetes-induced GBM thickening [8]. These findings, in conjunction with those of the present study in which aminoguanidine did not attenuate the diabetes-associated reduction in nephrin expression, suggest that the anti-proteinuric effects of this agent may be mediated by non-podocyte-related mechanisms such as modulation of lysosomal processing [21]. However, whether aminoguanidine might also affect podocyte number and morphological parameters such as foot-process dimensions, remains uncertain in the absence of detailed stereological analyses.
In summary, the reduction in nephrin expression in experimental diabetes as demonstrated in the present study suggests that modulation of this podocyte slit-membrane protein may be a determinant of glomerular hyperpermeability in diabetic nephropathy and possibly other renal diseases characterized by heavy proteinuria. Attenuation of these changes with ACE inhibition suggest that this mechanism may contribute to the anti-proteinuric effects of this but not all classes of drug which reduce proteinuria in diabetic nephropathy.
![]() |
Acknowledgments |
---|
![]() |
Notes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|