Somatostatin Activation of Mitogen-Activated Protein Kinase via Somatostatin Receptor 1 (SSTR1)

Tullio Florio, Hong Yao, Kendall D. Carey, Tara J. Dillon and Philip J. S. Stork

Vollum Institute (H.Y., K.D.C., T.D., P.J.S.S.) Oregon Health Sciences University Portland, Oregon 97201
Institute of Pharmacology (T.F.) School of Medicine University of Genoa and Service of Pharmacology National Institute for Cancer Research (IST), 16132 Genoa, Italy


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Hormones and growth factors regulate cell growth via the mitogen-activated protein (MAP) kinase cascade. Here we examine the actions of the hormone somatostatin on the MAP kinase cascade through one of its two major receptor subtypes, the somatostatin receptor 1 (SSTR1) stably expressed in CHO-K1 cells. Somatostatin antagonizes the proliferative effects of fibroblast growth factor in CHO-SSTR1 cells via the SSTR1 receptor. However, in these cells, somatostatin robustly activates MAP kinase (also called extracellular signal regulated kinase; ERK) and augments fibroblast growth factor-stimulated ERK activity. We show that the activation of ERK via SSTR1 is pertussis toxin sensitive and requires the small G protein Ras, phosphatidylinositol 3-kinase, the serine/threonine kinase Raf-1, and the protein tyrosine phosphatase SHP-2. The activation of ERK by SSTR1 increased the expression of the cyclin-dependent protein kinase inhibitor p21cip1/WAF1. Previous studies have suggested that somatostatin-stimulated protein tyrosine phosphatase activity mediates the growth effects of somatostatin. Our data suggest that SHP-2 stimulation by SSTR1 may mediate some of these effects through the activation of the MAP kinase cascade and the expression of p21cip1/WAF1.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Somatostatin is a circulating peptide hormone that displays a range of biological actions including inhibition of hormone secretion, modulation of neuronal transmission, and regulation of cell growth (1). Somatostatin acts through a family of related G protein-coupled receptors that are variably expressed in a wide variety of tissues and tumors (2), including the central and peripheral nervous system, the endocrine system, and the gut (3). Upon activation of these receptors, somatostatin exerts well characterized growth- inhibitory effects in a wide variety of epithelial (4, 5, 6, 7) and endocrine cells (8).

Somatostatin binds to and activates at least five distinct receptor subtypes that are expressed in overlapping tissue distributions within many tissues (9, 10). The molecular subtypes of the somatostatin receptor are organized pharmacologically into at least two groups that are distinguished both by their coupling to distinct effector pathways and by their ability to bind to distinct cyclic somatostatin analogs (11, 12, 13, 14). While somatostatin receptor (SSTR)1 and 4 are insensitive to the cyclic somatostatin analogs, octreotide, lanreotide, and RC160, these compounds are the best known ligands for SSTR2, 3, and 5 (3, 12, 15).

Somatostatin directly antagonizes the mitogenic action of epidermal growth factor in pancreatic tumor cells (16) and antagonizes additional tyrosine kinases in other cell types (17, 18). This antagonism of tyrosine kinase-signaling pathways is thought to be a consequence of the ability of somatostatin to stimulate a phosphotyrosine phosphatase (PTP) activity in responsive cells (1, 7, 19, 20, 21, 22). Many of the studies of the antiproliferative actions of somatostatin have been focused on SSTR2, principally because most of the clinical experience with somatostatin involves the somatostatin agonist octreotide (23), which is a well known ligand for SSTR2, but not SSTR1 (15). SSTR1, like SSTR2, is widely expressed in human tissues and tumors (23). Both SSTR1 and SSTR2 inhibit adenylyl cyclase when expressed in heterologous CHO-K1 cells (24). In these cells, only SSTR1 couples to PTP activity (25). However, somatostatin can couple to PTP activity in other cell types via SSTR2 (19, 26, 27). Recently, it has been shown that hormones as well as growth factors can regulate cell growth via their actions on the mitogen-activated protein (MAP) kinase cascade (28, 29, 30). In this study, we examine the ability of SSTR1 to activate intracellular signaling pathways that converge on the MAP kinase cascade.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Somatostatin Inhibits Proliferation Stimulated by Serum and Basic Fibroblast Growth Factor (FGF) in CHO Cells Stably Expressing SSTR1
Basic FGF activates proliferation in Chinese Hamster Ovary cells (CHO-K1). To examine somatostatin’s effects on FGF signaling in CHO cells, we used CHO-K1 cells that stably express somatostatin receptor SSTR1 (Bmax = 1664 fmol/mg) (1, 24). These cells have been extensively characterized and used as model systems for the study of somatostatin signaling via SSTR1 receptor (1, 24, 31). The cell line used in this and prior studies (1, 24, 31) expresses comparable levels of recombinant receptors and responds to the physiological somatostatin agonist, somatostatin-14 (SS-14), via pertussis toxin (PTX)-sensitive pathways to inhibit adenylyl cyclase with pharmacological features identical to native receptors (1, 24, 31). Initial studies demonstrate that SS-14 significantly reduced the rate of proliferation stimulated by serum in this cell line (Fig. 1AGo), as evidenced by a delay in serum-stimulated growth initiation. This cytostatic action of somatostatin is similar to that seen in other cell types (7, 32).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 1. Effect of Somatostatin on MTT Activity in CHO-SSTR1 Cells

A, Time course of proliferation of CHO-SSTR1 cells maintained in serum, incubated with SS-14 (1 µM) ({diamondsuit}) or without SS-14 ({square}) for the indicated times, as measured by MTT assay. B, MTT activity of FGF-stimulated CHO-SSTR1 cells in the presence or absence of varying doses of SS-14 (0.1 µM – 10 µM) as indicated was measured 48 h after treatment with FGF (50 ng/ml) or FCS (10%). Data are presented as percent of increase in absorbance at 570 nm over basal (unstimulated) cells at 48 h.

 
Somatostatin Activates MAP Kinase via SSTR1
Growth factors like FGF are thought to activate proliferative pathways via activation of the MAP kinase cascade (33). SS-14 also inhibited FGF-induced proliferation in these cell lines (Fig. 1BGo). This inhibition showed a dose dependence that was similar to SS-14’s antiproliferative actions in other cell types (7, 19, 20). Our studies showed that the activation of cell growth by FGF in these cells was inhibited by 73% (compared with stimulated levels) by the MAP kinase kinase (MEK) inhibitor PD98059 (34) (data not shown), suggesting that FGF-induced proliferation of CHO cells required activation of extracellular signal-regulated kinase (ERK). These results raised the possibility that somatostatin’s actions on FGF-stimulated proliferation might be mediated via its actions on ERK as well. We examined the actions of SS-14 on ERK phosphorylation as well as activation. ERK phosphorylation at threonine-183 and tyrosine-185 are widely used indices of ERK activation by the ERK kinase MEK. We examined the phosphorylation of both ERK 1 (pERK1) and ERK2 (pERK2), using antibodies recognizing phosphotyrosine-185 (pTyr-185) in both pERK1 and pERK2. This antibody recognizes pERK2 with greater affinity than pERK1, but is specific for the "phospho" form in both cases (New England Biolabs, Beverly, MA). Initial experiments show that SS-14 increased the phosphorylation of both ERK1 and ERK2 in CHO-SSTR1 cells, but not in wild-type CHO (CHO-K1) cells. Maximal phosphorylation of both ERK1 and ERK2 was seen after 10 min of SS-14 incubation (Fig. 2AGo).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 2. Time Course of ERK1 Activation after Somatostatin Treatment

A, Wild type CHO-K1 cells (upper panel) and CHO-SSTR1 cells (lower panel) were treated with SS-14 (1 µM) for the indicated times. Lysates were harvested and phospho-ERK (pERK) was detected by Western blotting, using pERK-specific antibodies. A representative Western blot is shown (n = 3). The positions of pERK1 and pERK2 are indicated. B, CHO-SSTR1 cells were treated with SS-14 (1 µM) for several time periods as indicated, and the lysates were immunoprecipitated using ERK1-specific antisera. Kinase assays were performed as described, and phosphorylated MBP was separated by SDS-PAGE. The results of a representative autoradiogram are shown with the position of MBP indicated (upper panel). Phosphorylated MBP was then quantitated by PhosphorImager analysis, and the fold stimulation over basal levels is presented as an average of three independent experiments (lower graph). SE is shown.

 
We next examined the actions of SS-14 on ERK1 activation using in vitro kinase assays after immunoprecipitation of ERK1 from treated cell lysates. SS-14 strongly activated ERK1 in CHO-SSTR1 cells, reaching maximum levels within 10–20 min (Fig. 2BGo). This is in contrast to results in SSTR2-expressing cells, obtained by our laboratory and others, where somatostatin does not activate MAP kinase (data not shown) (35, 36).

To confirm the pattern of activation of MAP kinase by somatostatin in cells expressing endogenous receptors, we examined ERK activation in the pituitary cell line, GH4C1. These lacto-somatotrophic cells express predominantly SSTR1 receptors, but also express SSTR2 receptors (1). Because SSTR1 represents the predominant somatostatin receptor subtype, SS-14 action should be mediated, in large part, via SSTR1 in these cells. After incubation of these cells with SS-14, the time course of ERK activation was similar to that seen in the CHO-SSTR1 cells (data not shown). In GH4C1 cells, as in other cell types, the somatostatin agonist octreotide selectively stimulates SSTR2 and the related SSTR3 and SSTR5 receptors (32). After incubation of these cells with octreotide, very little activation of ERK1 was detected (data not shown). These results in GH4C1 cells are consistent with those seen in CHO cells and suggest that SSTR1 is a strong activator of ERK whether expressed endogenously or in stably transfected cells.

SSTR1 Potentiates FGF Stimulation of ERK1
FGF can induce phosphorylation of ERK1 and ERK2 on Tyr-185 via endogenous receptors on wild-type CHO cells (CHO-K1). This action is faithfully reproduced in the CHO-SSTR1 cells (Fig. 3AGo). As with SS-14, this phosphorylation was maximal at 10 min. The activation of ERK1 by FGF in CHO-SSTR1 cells was confirmed by immune complex kinase assay (Fig. 3BGo). SS-14 augmented FGF’s activation of ERK1 in CHO-SSTR1 cells. This is in contrast to results in SSTR2-expressing cells, where somatostatin inhibits growth factor activation of MAP kinase (data not shown) (35, 36).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 3. Effect of Somatostatin Treatment on FGF-Stimulated ERK1 Activity in CHO-SSTR1 Cells

A, Wild-type CHO-K1 cells (upper panel) and CHO-SSTR1 cells (lower panel) were treated with FGF (50 ng/ml) for the indicated times. Lysates were harvested and pERK detected by Western blotting, using pERK antibodies. A representative Western blot is shown (n + 3). The positions of pERK1 and pERK2 are indicated. Cells were treated with SS-14 (1 µM) and FGF for 10 min, and lysates were immunoprecipitated using ERK1 antisera. Kinase assays were performed as described, and phosphorylated MBP was separated by 12% SDS-PAGE. B, The results of two representative autoradiograms and the position of MBP are shown (upper panel). Phosphorylated MBP was quantitated by PhosphorImager analysis, and the ERK1 activity is reported as fold stimulation over basal levels and presented as an average of four independent experiments (lower graph). SE is shown.

 
SSTR1 and FGF Induce the Expression of p21cip1/WAF1
It has been proposed that high levels of ERK acti-vation can cause growth arrest via the induction of p21cip1/WAF1 (37, 38, 39). To examine this possibility, we examined p21cip1/WAF1 protein levels by Western blot (Fig. 4AGo). The basal level of p21cip1/WAF1 expression was not increased by SS-14 or FGF alone, but was increased when the hormone and growth factor were applied together. This synergistic action was seen more clearly after the immunofluorescent examination of p21cip1/WAF1 protein. Strong nuclear staining of p21cip1/WAF1 protein was detectable only with the combined treatment with SS-14 and FGF (Fig. 4BGo). In lysates prepared from CHO-SSTR1 cells, the increase in the levels of p21cip1/WAF1 protein seen after treatment with SS-14 and FGF was reduced after treatment with the MEK inhibitor PD98059 (34), suggesting that ERK activity was required for this action (Fig. 4CGo).



View larger version (51K):
[in this window]
[in a new window]
 
Figure 4. p21cip1/WAF1 Protein Levels Are Induced by the Combined Treatment of SS-14 and FGF

A, CHO-SSTR1 cells were untreated (control, C) or treated with FGF (F) (50 ng/ml) and/or SS-14 (S) (1 µM) for 24 h as indicated. After treatment, cells were lysed, transferred to immobilon paper, and probed with anti-p21cip1/WAF1 antisera (upper panel). Coomassie staining is shown in lower panel to confirm equivalent loading of protein. A representative Western blot is shown (n = 3). B, CHO-SSTR1 cells were treated with FGF (50 ng/ml) and/or SS-14 (1 µM) for 24 h as indicated (1, untreated; 2, SS-14; 3, FGF; 4, SS-14 and FGF). After treatment, cells were fixed and permeabilized with acetone and labeled with anti-p21cip1/WAF1 antisera. Immune complexes were detected using fluorescein isothiocyanate-coupled anti-IgG antibodies. C, CHO-SSTR1 cells were treated with FGF (F) and/or SS-14 (S) for 16 h, as in panel A, in the absence (-PD) or presence of PD98059 (+PD), as indicated. After treatment, cells were lysed, transferred to immobilon paper, and probed with anti-p21cip1/WAF1 antisera. A representative Western blot is shown.

 
SSTR1 Activation of ERK1 Requires Ras
To examine the requirement of specific proteins within the MAP kinase cascade in SS-14’s activation of ERK1, we transiently transfected specific interfering mutants of upstream components of the MAP kinase cascade, including Ras, Raf, and MEK (mitogen and extracellular regulated kinase) into CHO-SSTR1 cells and examined their effects on somatostatin signaling. MEK K79R and Raf-301 are kinase-deficient mutants of MEK and Raf, respectively, that sequester endogenous downstream substrates (40, 41, 42), and RasN17 interferes with endogenous Ras function by binding to specific Ras exchange proteins (43). The expression of all three interfering mutants blocked myc-ERK activation by SS-14 (Fig. 5Go, A and B), suggesting that MEK, Raf, and Ras were required for SS-14 activation of ERK.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 5. Requirement of Ras, Raf, and MEK for Somatostatin Activation of ERK in CHO-SSTR1 Cells

CHO-SSTR1 cells were transfected with cDNAs encoding RasN17, Raf-301, or MEK K97R along with myc-ERK2, and cells were treated with (+) or without (-) SS-14 as indicated. Cells were lysed and immune complex kinase assays were performed on cell lysates after immunoprecipitation with anti-myc antibodies, using MBP as a substrate, and phosphorylated MBP was separated by 12% SDS-PAGE. A, A representative autoradiogram showing phosphorylated MBP is presented. B, Phosphorylated MBP was quantitated by PhosphorImager analysis and the fold stimulation over basal levels is presented as an average of four independent experiments.

 
SS-14 Activation of ERK1 Is Mediated by a PTX-Sensitive G Protein and a c-src-Like Tyrosine Kinase
The mechanisms by which G protein-coupled receptors activate the MAP kinase cascade are not fully understood. To evaluate the involvement of specific G proteins in the SSTR1-mediated activation of ERK, we pretreated CHO-SSTR1 cells with PTX. Like other known actions of SSTR1, the activation of ERK by SSTR1 was PTX sensitive (Fig. 6AGo). SS-14’s activation of ERK1 was also completely blocked by wortmannin, an inhibitor of phosphatidylinositol 3-kinase (PI3 kinase) (Fig. 6Go, B and C). This activation of ERK1 was also completely blocked by LY294002, a second inhibitor of PI3 kinase that utilizes an independent mechanism of inhibition (Fig. 6BGo). SS-14’s activation of ERK1 was partially blocked by herbimycin A, an inhibitor of cytoplasmic tyrosine kinases of the c-src family (Fig. 6CGo). The action of these agents on FGF signaling was also examined. Herbimycin A nearly completely inhibited FGF’s activation of ERK1, while wortmannin only partially reduced FGF’s effect (Fig. 6CGo), suggesting that while PI3 kinase was not absolutely necessary for FGF’s activation of ERKs, it was necessary for that of somatostatin.



View larger version (25K):
[in this window]
[in a new window]
 
Figure 6. Fig. 6. Requirement of a PTX-Sensitive G Protein, PI3 Kinase, and Tyrosine Kinase in Somatostatin Stimulation of ERK

A, Somatostatin’s activation of ERK1 in CHO-SSTR1 cells is PTX-sensitive. Cells were left untreated (basal, B) or treated with SS-14 (SS) with or without pretreatment with PTX (18 h, 200 ng/ml), as indicated. The cells were lysed and immune complex kinase assays were performed using MBP as a substrate after immunoprecipitation with anti-myc antibodies. Phosphorylated MBP was separated by 12% SDS-PAGE. The results of a representative autoradiogram are shown (upper panel). Phosphorylated MBP was quantitated by PhosphorImager analysis, and the average of the results derived from four independent experiments are shown (lower panel). B, Somatostatin’s activation of ERK1 in CHO-SSTR1 cells requires PI3 kinase. Cells were left untreated (basal, B) or treated with SS-14 (SS) with or without pretreatment with wortmannin (100 nM), or LY294002 (LY, 25 nM) as indicated. The cells were lysed and immune complex kinase assays were performed using MBP as a substrate after immunoprecipitation with anti-ERK1 antibodies. Phosphorylated MBP was separated by 12% SDS-PAGE. The results of a representative autoradiogram are shown. C, Inhibition of somatostatin’s and FGF’s stimulation of ERK1 activity by wortmannin and herbimycin A. Cells were pretreated for 10 min with either wortmannin (1 µM), herbimycin A (1 µM), or left untreated (basal, B) and 10 min later exposed to either SS-14 (SS) or FGF. Immune complex kinase assays were performed using MBP as a substrate as described in panel A. A representative autoradiogram is shown (upper panel). The position of MBP is shown. Phosphorylated MBP was quantitated by PhosphorImager analysis, and the fold stimulation of ERK1 activity over basal levels is presented as an average of four independent experiments (lower panel).

 
The involvement of specific G proteins in the SS-14 effects was further demonstrated by the transfection of the carboxyl-terminal domain of the ß-adrenergic receptor kinase (ßARKct) into CHO-SSTR1 cells. Because ßARKct can specifically bind to ß{gamma}-subunits, it has been used to demonstrate the involvement of the ß{gamma}-subunits in other G protein-coupled pathways (44). The expression of ßARKct blocked myc-ERK activation by SS-14, confirming the involvement of the G protein ß{gamma}-subunits in the SSTR1 signaling to the MAP kinase cascade (Fig. 7Go, A and B). A role for src-like kinases in somatostatin signaling was examined after transfection of the cDNA encoding the c-src kinase (CSK). CSK phosphorylates c-src at inhibitory sites and is the major physiological inactivator of these kinases (45). The expression of CSK blocked SS-14 activation of myc-ERK (Fig. 7Go, A and B), suggesting that a cytoplasmic kinase of the src family was required for maximal activation of ERK by somatostatin.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 7. Involvement of the ß{gamma}-Subunit of G Protein and Src-Like Kinases in Somatostatin’s Stimulation of ERK Activity

CHO-SSTR1 cells were transfected with cDNAs encoding ßARKct or the c-src kinase (CSK) along with myc-ERK2. The cells were treated with SS-14 (1 µM) (+) or without SS-14 (-) as indicated, and immune complex kinase assays were performed as described in Fig. 5Go. A, The results of a representative autoradiogram and the position of MBP are shown. B, Phosphorylated MBP was quantitated by PhosphorImager analysis, and the fold stimulation over basal levels is presented as an average of four independent experiments.

 
SSTR1 Is Coupled to Raf-1 Activation
Ras-dependent activation of ERK requires members of the Raf family of serine/threonine kinases (46, 47). Here, we examined the effects of SS-14 on Raf-1 activity, the major Raf isoform expressed in CHO cells (data not shown). SS-14 induced a significant activation of Raf-1 with a time course that mirrored ERK activation (Fig. 8Go, A and B). Moreover, herbimycin A inhibited SS-14 activation of Raf-1 in these cells (Fig. 8CGo), suggesting that the activation of a tyrosine kinase was required to stimulate Raf-1 as well as ERK. This is consistent with the results of other laboratories that suggest that src-like kinases are required for full activation of Raf-1 by Ras-dependent signals (47, 48).



View larger version (46K):
[in this window]
[in a new window]
 
Figure 8. Effect of Somatostatin Treatment of CHO-SSTR1 Cells on Raf-1 Activity

Cells were treated with SS-14 (1 µM) for the indicated times, lysed, and immunoprecipitated with anti Raf-1 antisera (A and C) or myc antibodies (B). Raf-1 kinase assays were performed using MEK-1 as a substrate, and phosphorylated MEK-1 was separated by 10% SDS-PAGE. A, Time course of somatostatin activation of Raf-1. A representative autoradiogram and the position of MEK1 are shown (n = 3). B, Somatostatin activation of myc-Raf-1. Cells were transfected with cDNA encoding myc-Raf-1 (5 µM) as described and treated with SS-14 or FGF, as indicated, and Raf-1 activities were measured by in vitro kinase assay after immunoprecipitation with myc antibodies. A representative autoradiogram and the position of MEK1 are shown (n = 2). C, Inhibition of somatostatin activation of Raf-1 by herbimycin A, assayed 10 min after the addition of SS-14. Cont, Unstimulated cells; SS, somatostatin-treated cells; H, herbimycin-pretreated cells; SS + H, herbimycin-pretreated and somatostatin-treated cells. A representative autoradiogram and the position of MEK1 are shown (n = 2). Fold increases in Raf-1 kinase activity over control (unstimulated) levels are provided at the top of the figure.

 
SSTR1 Stimulates the Activity of SH-PTP2 (SHP-2)
Somatostatin’s growth effects are associated with the stimulation of a specific PTP activity (16, 22). Previous reports have suggested that this PTP might be a member of a small family of PTPs that contain src-homology (SH2) domains, including SHP-1 (SHPTP-1, syp, PTP1D) and SHP-2 (SHPTP-2, syp, PTP1C). Src homology 2 (SH2) domains mediate protein/protein interaction via their association with specific phospho-tyrosine residues. SHP-1 is expressed primarily in hematopoietic cells (49) but was not detected in CHO-SSTR1 or CHO-SSTR2 cells (Fig. 9AGo). SHP-2 is widely expressed in many cell types (49), including both CHO-SSTR1 and CHO-SSTR2 cells (Fig. 9AGo). To determine whether somatostatin can stimulate SHP-2 activity in CHO-SSTR1 cells, we treated these cells with SS-14 and measured PTP activity after immunoprecipitation with an antisera directed against SHP-2, in an immune complex assay using p-nitrophenylphosphate (pNPP) as a substrate. pNPP has been previously reported to be a good substrate for SHP-2 (50). The results demonstrate that SS-14 can rapidly stimulate SHP-2 activity within 1 min, reaching a maximum at 10 min, and returning to basal levels after longer treatments (Fig. 9BGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 9. SHP-2 Is Activated by Somatostatin

A, Expression pattern of SHP-1 and SHP-2 in CHO-SSTR1 (CHO-1) and CHO-SSTR2 (CHO-2) cells. Protein (10 µg) from unstimulated cells was separated by SDS-PAGE and Western blotted with antisera to SHP-1 (anti-SHP-1) or SHP-2 (anti-SHP-2). B, Time course of SHP-2 activity after somatostatin treatment. SHP-2 activity was measured after immunoprecipitation with anti-SHP-2 antibodies from 100 µg of total cell lysate. Phosphatase activity was evaluated using the synthetic substrate pNPP using a spectrophotometric assay and is reported as the percent of basal activity. C, Coimmunoprecipitation of SHP-2 and c-src in CHO-SSTR1 cells. Cells were transfected with either control vector (pCDNA3), myc-tagged SHP-2 (SHP-2 wt), or myc-tagged SHP-2(CS) [SHP-2(CS)] and either treated for 5 min with SS-14 (+) or left untreated (-). Cell lysates were immunoprecipitated with c-src antibody and Western blotted with myc antibody. The retarded migration of SHP-2 and SHP-2(CS) proteins compared with that seen in Fig. 9AGo is due to the increased size of the myc-tagged (Fig. 9CGo) compared with endogenous SHP-2 protein (Fig. 9AGo). The position of the IgG heavy chain is indicated.

 
SHP-2 Coprecipitates with c-src in Both SS-14-Treated and Untreated Cells
The involvement of src family kinases and SHP-2 in somatostatin signaling suggests the possibility that c-src or related kinases and SHP-2 may both participate within the same signaling complex. To test this hypothesis, we examined the interaction of c-src with SHP-2 in CHO-SSTR1 cells by coimmunoprecipitation. We transfected myc-tagged SHP-2 (myc-SHP-2) and myc-SHP-2(CS) into CHO-SSTR1 cells and examined whether they could associate with endogenous c-src. SHP-2(CS) encodes a catalytically inactive protein where the essential cysteine has been replaced by a serine. This mutant phosphatase binds tightly to physiological substrates without dephosphorylating them, thereby interfering with access of these substrates to endogenous wild-type SHP-2. Endogenous c-src protein was immunoprecipitated using c-src antibodies and assayed for the presence of SHP-2(CS) within the immunoprecipitates by Western blot using myc antibodies (Fig. 9CGo). The results demonstrate that both SHP-2 and SHP-2(CS) can bind c-src in these cells and raise the possibility that c-src is a direct substrate of SHP-2 in these cells, as has been suggested for SHP-1 (51, 52). The association of SHP-2 was not modulated by SS-14 treatment (Fig. 9CGo), suggesting that the two proteins may be constitutively associated under basal conditions.

Maximal Activation of Raf-1 and ERK by SSTR1 Requires SHP-2
To determine whether the activation of SHP-2 was required for SSTR1 signaling to ERK, we used the interfering mutant SHP-2(CS). The interference with endogenous SHP-2 after the expression of SHP-2(CS) is specific and does not interfere with the actions of the closely related PTP, SHP-1 (53). The expression of SHP-2(CS) in CHO-SSTR1 cells blocked SS-14’s activation of both Raf-1 (Fig. 10AGo) and myc-ERK (Fig. 10Go, B and C), suggesting that SHP-2 was necessary for maximal activation of the MAP kinase cascade by somatostatin in these cells. In contrast, overexpression of wild-type SHP-2 did not inhibit SS-14’s activation of Raf-1 (Fig. 10AGo) or ERK (Fig. 10Go, B and C). Similar results were obtained after measurement of the transcriptional activity of Elk-1, a direct target of ERK kinase activity (54). Using a transcription-coupled luciferase assay that reflects MAP kinase activity (55, 56), we showed a complete inhibition of SS-14-induced Elk-1 activity after expression of SHP-2(CS) and a modest potentiation of SS-14-induced Elk-1 activity after the expression of wild-type SHP-2 (Fig. 10DGo). These studies strongly suggest that endogenous SHP-2 may provide a positive signal from SSTR1 to the MAP kinase cascade.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 10. Somatostatin Activation of the MAP Kinase Cascade Requires SHP-2

A, Inhibition of somatostatin-stimulated Raf-1 activity after expression of SHP-2(CS). CHO-SSTR1 cells were transfected with cDNAs encoding myc-Raf-1, along with vector DNA (control), wild-type SHP-2 (SHP-2 wt), or phosphatase-dead SHP-2 (SHP-2-CS), and treated with (+) or without (-) SS-14, as indicated. Raf-1 kinase assays were performed after immunoprecipitation with anti-myc antibodies. The position of the substrate MEK-1 is shown (n = 3). Fold activation is indicated above each lane, and the levels of myc-Raf-1 expressed in each condition were determined by Western blot, using myc antibody (lower panel). B, Inhibition of somatostatin-stimulated myc-ERK activity after expression of SHP-2(CS). CHO-SSTR1 cells were transfected with cDNAs encoding myc-ERK2 and SHP-2 wt or SHP-2(CS) and treated with SS-14 (+) or left untreated (-) as indicated. In vitro ERK assays were performed after immunoprecipitation with myc antibodies, using MBP as a substrate. A representative autoradiogram is shown, with the position of phosphorylated MBP indicated. C, Quantitation of ERK kinase assays depicted in panel B (above) after transfection of SHP-2. Data are represented as the mean ± SE; n = 4. D, The effects of the expression of SHP-2 wt or SHP-2(CS) on somatostatin’s activation of Elk-1. Cells were transfected with 5 µg of cDNAs encoding Elk-1/Gal 4 and 5XGal4-E1b/luciferase and either 5 µg of pCDNA3 or SHP-2wt or SHP-2(CS) as indicated. Activation of Elk-1 was measured by luciferase activity, as described (41 ), and reported as fold over basal levels.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
In many cell types, the growth-promoting actions of extracellular growth factors and hormones are thought to require the activation of MAP kinase (28, 29, 30). However, in some cells, differentiation and the accompanying growth inhibition are also associated with MAP kinase activation (33, 57). For example, the expression of markers of differentiation in pituitary somatotrophs (58) and in pituitary gonadotrophs (56) requires activation of the MAP kinase cascade, as does the neuronal differentiation of cultured adrenal medullary PC12 cells (33, 41). In this study, we examined the ability of somatostatin to activate the MAP kinase cascade via SSTR1. We and others have used stably transfected cell lines to study the biochemical action of the somatostatin receptor subtype SSTR1 (1, 19). In any study utilizing transfected cell lines, the possibility that clonal variations arising during the selection process may influence the interpretation of the results. In this study, we utilize a well characterized SSTR1-expressing cell line (1, 24) that we have previously shown express these receptors at physiological levels and functionally couple to relevant somatostatin-signaling pathways (24). Previous studies have demonstrated that somatostatin activation of a PTPase activity accounts, in part, for its antiproliferative effects (1, 22, 25). Because activation of PTPase activity by somatostatin has been demonstrated in CHO-SSTR1 cells (1), we have used these cells to study the regulation of proliferation and MAP kinase signaling in these cells. In the absence of additional growth factor stimulation, somatostatin activated ERK1 robustly and augmented FGF’s activation of ERK1. Thus, despite inhibiting FGF-induced cellular proliferation in FGF-treated CHO-SSTR1 cells, SS-14 potentiates FGF’s activation of ERKs.

The induction of growth arrest in the face of increased stimulation of MAP kinase appears to be an unlikely mechanism for growth control. However, recent studies have demonstrated that the induction of high levels of ERK activation leads to cell cycle arrest via the induction of the cell cycle inhibitor, p21cip1/WAF1 (37, 38, 39). p21cip1/WAF1 is a member of a growing family of inhibitors of cyclin-dependent protein kinases (37) and is associated with the growth arrest induced by sustained activation of ERK in endocrine cells (59). It is possible that the antiproliferative actions of SSTR1 are, in part, triggered by its stimulation of ERK activity to levels higher than that achieved by FGF alone. This is suggested by the synergistic actions of SS-14 and FGF on p21cip1/WAF1 and the requirement of MEK for this action (Fig. 4Go); however, other mechanisms may also contribute (60).

We show here that somatostatin’s actions on MAP kinase via SSTR1 were PTX sensitive and required the activity of the ß{gamma}-subunits of the G proteins, like other hormones that are known to be coupled to the Gi and Go subfamily of receptors [including {alpha}2A adrenergic receptors (61) and M2 muscarinic receptors (44)]. The role of ß{gamma}-subunits in SSTR1 signaling to MAP kinase was demonstrated here by the ability of the ßARKct cDNA to block SS-14’s activation of MAP kinase in CHO-SSTR1 cells. ßARKct acts as an interfering mutant of ß{gamma} signaling via the overexpression of the plekstrin homology (PH) domain of ßARK that functions within the full-length ßARK protein to permit the association of ßARK to ß{gamma}, and has been widely used to demonstrate the requirement of ß{gamma} in other signaling cascades (62, 63). ß{gamma}-subunits have previously been implicated in other actions of somatostatin through SSTR1, including the activation of GIRK potassium channels (64), and the data presented here suggest that ß{gamma} is required for somatostatin’s activation of MAP kinase, as well.

Somatostatin’s activation of ERK in CHO-SSTR1 cells was dependent on the activation of MEK, the MAP kinase kinase kinase, Raf-1, and the small G protein Ras. In addition, this action of somatostatin was blocked by wortmannin and LY294002, suggesting the involvement of PI3 kinase. These results are similar to those identified for other Gi-coupled receptors, including the stimulations of MAP kinase via SSTR4 (65), serotonin1A (66), and the lysophosphatidic acid receptor (67, 68, 69, 70). The activation of PI3 kinase by G protein ß{gamma}- subunits has also been reported (63). PI3 kinase may be required for activation of MAP kinase by multiple hormones including somatostatin, as well as certain growth factors (71).

We have previously reported somatostatin coupling to PTP activity in CHO-SSTR1 cells (1). This stimulation of PTP activity in CHO-SSTR1 cells by somatostatin was G protein coupled and PTX sensitive, and correlated with somatostatin’s growth effects (Fig. 1AGo) (1). Studies by other laboratories have suggested that the PTP stimulated by somatostatin might be an intrinsic membrane protein capable of associating with the somatostatin receptor/G protein complex (1, 25, 72, 73, 74, 75). Here we report that SS-14 stimulation of SSTR1 increases SHP-2 activity and interfering mutants of SHP-2 activity block SS-14 activation of the MAP kinase cascade. In other cells, SHP-2 has been shown to be recruited to the plasma membranes upon somatostatin stimulation (27). A related phosphatase, SHP-1, has been implicated in somatostatin signaling (73, 75). However, SHP-1 is principally expressed in hematopoeitic cells (76) and is not expressed in CHO-SSTR1 cells.

The time course of SHP-2 activation by somatostatin in CHO-SSTR1 cells is consistent with data from recent studies using Ras-transformed NIH3T3 after transient transfection of somatostatin receptors (26) and CHO cells stably expressing somatostatin receptors (73). The studies presented here differ from those of Reardon and co-workers (26) who showed that SSTR2, 3, and 4, but not SSTR1 or SSTR5, could activate PTP activity when transiently expressed in v-Ras-transformed NIH 3T3 cells. In those cells, the activation of PTP was blocked by SHP-2(CS), suggesting that SHP-2 was involved. Their inability to detect coupling of SSTR1 to PTP activation in those studies may reflect the inability of transiently expressed SSTR1 to couple efficiently to downstream effectors. However, it may also point to differences in the mechanisms by which distinct somatostatin receptors couple to SHP-2. The pathway described here for SSTR1 differs from that identified for SSTR2 and SSTR3 (26) in that SSTR1 in CHO-SSTR1 cells appears to couple to cytoplasmic tyrosine kinases and utilizes Gß{gamma} rather than G{alpha}i/o (77). It is possible that SSTR1 utilizes a signaling pathway in whole cells that is distinct from the membrane-delimited pathways identified by others in vitro (26).

The MAP kinase kinase kinase, Raf-1, is recruited to the membrane after Ras activation and represents the last membrane-delimited protein in the growth factor/MAP kinase cascade. Its activation by Ras is greatly potentiated by the actions of c-src (38, 48) and src-family tyrosine kinases (47) via two tyrosine phosphorylation sites within the Raf-1 protein at amino acids 340 and 341 (78). The induction of PTP activity by somatostatin has been shown to dephosphorylate this site in vitro, resulting in decreased Raf-1 activity in vitro (74, 79). We show here that somatostatin can activate both ERK and Raf-1 via SSTR1 in vivo and can augment the activation of ERK by FGF. Both the activations of ERK and Raf-1 by SS-14 can be blocked by the interfering mutant SHP-2(CS), suggesting that, at least for SSTR1, SHP-2 may be required for maximal activation of ERK. These studies suggest a role for SHP-2 in the activation of components of the MAP kinase cascade including Raf-1 and ERK.

This requirement of SHP-2 for somatostatin’s activation of Raf-1 and ERK may be similar to the role of SHP-2 in signaling via many growth factors, where the activation of ERK requires the phosphatase activity of SHP-2 (80, 81, 82, 83, 84). These studies suggest that SHP-2 may function both as adaptors, via their SH2 domains, and as enzymes that stimulate signaling to ERKs. In PC12 cells, SHP-2 and not SHP-1 is required for sustained ERK activation by FGF (53, 85). In these cells, prolonged ERK activation is required for cessation of cell growth and neuronal differentiation and is accompanied by an induction of p21cip1/WAF1 (59). We show here that somatostatin also requires SHP-2 for the activation of ERKs via SSTR1, and this activation of ERKs by somatostatin is associated with cessation of cell growth and the induction of p21cip1/WAF1 in growth factor-treated cells.

We show that SHP-2 is required for full activation of Raf-1 by somatostatin. One potential target of SHP-2 is c-src, a cytoplasmic tyrosine kinase that is physically associated with SHP-2 in CHO-SSTR1 cells and in other cell types (86). Dephosphorylation of c-src at a single phosphotyrosine (tyrosine 529 in the mouse) is required for full activity (87, 88) and, in lymphocytes, is accomplished by the related phosphatase, SHP-1 (52, 89). The involvement of c-src in the activation of ERKs by SS-14 in CHO-SSTR1 cells is further supported by the ability of both herbimycin A and CSK to block ERK activation via SSTR1 (Fig. 11Go). However, we have not completely ruled out the role of other herbimycin A- and CSK-sensitive kinases in ERK activation, nor have we ruled out the possibility that SHP-2 may be acting on additional proteins.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 11. Schematic Representation of the Proposed Signal Transduction Pathway Used by Somatostatin to Stimulate the MAP Kinase Cascade via SSTR1

The plasma membrane is depicted by parallel dotted lines, with SSTR1 drawn as a heptahelical transmembrane protein. At this time, neither can we propose a specific mechanism by which PI3 kinase (PI3 K) cooperates with SHP-2, nor can we rule out the possibility that c-src may be acting at additional sites upstream of Raf-1.

 
In conclusion, we propose that the activation of SSTR1 is coupled positively to the MAP kinase cascade. Somatostatin’s ability to potentiate growth factor stimulation of the MAP kinase cascade via SSTR1 may limit proliferative signals generated by growth factor receptors by increasing the expression of proteins like p21cip1/WAF1 that inhibit cell cycle progression in these cells (37).


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Materials
PTX and basic FGF were purchased from Sigma Chemical Co. (St. Louis, MO). Octreotide was provided by Sandoz Pharmaceuticals (Basel, Switzerland). Somatostatin-14 (SS-14) was purchase from American Peptides (Sunnyvale, CA). Herbimycin A, wortmannin, and LY294002 were purchased from CalBiochem (La Jolla, CA). Antisera directed toward ERK1, ERK2, Raf-1, SHP-1, and myc antibody 9E10 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antisera directed toward p21cip1/WAF1 was purchased from Pharmingen (San Diego, CA) and used at 1:1000. Antibodies directed to SHP-2 and c-src were purchased from Upstate Biotechnology Inc. (Lake Placid, NY). Antibodies directed to phospho-ERK (pThe-183,pTyr-185) were purchased from New England Biolabs, Inc. (Beverly, MA.). Radioisotopes were from NEN-DuPont (Boston, MA). All other reagents were from Sigma.

Cell Culture and Treatments
CHO-SSTR1 and GH4C1 cells were maintained as previously described (1). Before immune complex, luciferase, and immunofluorescence assays, the cells were deprived of serum and maintained in DMEM for 16 h at 37 C in 5% CO2 before treatment with SS-14 at 1 µM, for 10 min unless otherwise indicated. Basic FGF was used at 50 ng/ml. For studies examining FGF’s activation of ERKs, cells were lysed after 10 min of FGF treatment. Herbimycin A was used at 1 µM concentration, wortmannin was used at 100 nM to 1 µM, and LY294002 was used at 25 nM. All compounds were added 10 min before SS-14 or FGF.

Proliferation Assay
Cell number was determined through the assay of mitochondrial function, using 3(4, 5-dimethythiazol-2-yl)-2,5diphenyl tetrazolium bromide (MTT) as a substrate. MTT is reduced by mitochondrial dehydrogenases to form an insoluble purple precipitate that can be solublized with dimethylsulfoxide and absorbance at 570 nm quantitated as an index of cell number.

Plasmids and Transfection
The plasmids encoding RasN17, MEK K97R, Raf301, myc-ERK2, and Elk-1/Gal-4, 5xGal4-E1b/luciferase have been previously described (41). The plasmids encoding myc-SH-PTP2 and myc-SH-PTP2(CS) were kindly provided by Dr. J. Pessin (University of Iowa, Iowa City, IA). The plasmid encoding CSK was provided by Dr. K. Rodland (Oregon Health Sciences University). The plasmid encoding myc-Raf-1 was provided by Dr. A. Shaw (Washington University, St. Louis, MO). All cell lines were grown to 50% confluence before transfection. Transfections were performed using lipofectamine per the manufacturer’s instructions (GIBCO-BRL). In all experiments, total DNA transfected was kept constant with addition of pcDNA3 vector (Invitrogen, San Diego, CA). For luciferase assays, the plasmids 5xGal4-E1b/luciferase and Gal4-Elk1 were used in combination with other plasmids as indicated (41, 51, 52, 55). For all experiments, cells were allowed to recover for 24–36 h and serum starved for 6–12 h before treatment. The C-terminal fragment of ßARKct was cloned by PCR from a rat brain cDNA library using specific primers to the published ßARK sequence (sense oligo, ATAGAATTCGCCGCCACCATGGGAATCAAGTTACTGGAC; antisense oligo, ATATCTAGAGAATCAGAGGCCGTTGGCAC-TGCCACGCTG) and subcloned into pcDNA3. To facilitate translation, the sense oligo included a ribosomal binding cassette and a ATG start codon.

Luciferase Assay
Luciferase assays were carried out as described (41, 51, 52, 55). Cells were transfected with 5xGal4-E1b/luciferase and Gal4-Elk1 as described and treated with somatostatin (SS-14) (1 µM) or left untreated. After 6 h of treatment, cell lysates were prepared and luciferase activity was assayed as described (55). Luciferase activity was reported as fold increase above basal levels determined from untreated serum-starved cells.

Phosphatase Assay
Cells were grown to 50% confluency, serum starved, and treated with SS-14 (1 µM). At the indicated times, the cells were washed twice in PBS and lysed in a buffer containing 50 mM Tris (pH 7.4), 100 mM NaCl, 1 mM EDTA, 1% NP40, 0.1 mM phenylmethylsulfonyl fluoride, 1 mM leupeptin, and 10 µg/ml aprotinin. Total proteins (100 µg) were immunoprecipitated in the same buffer using 3 µg of anti-SHP-2 antibody for 4 h at 4 C. The immunoprecipitate was resuspended in 15 µl of 50% protein G sepharose (Pharmacia, Piscataway, NJ) in 10 mM Tris. The entire immunoprecipitate was washed and resuspended in 100 µl containing 20 µl 5x phosphatase buffer (25 mM EDTA, 250 mM HEPES, pH 7.2, 50 mM dithiothreitol) in the presence of the serine/threonine phosphatase inhibitor microcystin ML-R (20 nM) and ZnCl2 (10 µM), and the reaction was initiated by the addition of p-Npp substrate (10 mM, final concentration) at 30 C and incubated for 30 min. The PTPase reaction was terminated by the addition of 0.9 ml of 0.2 N NaOH, and the absorbance of the sample was measured at 410 nm, as previously reported (22).

Immune Complex Kinase Assay
Cells were grown to 50% confluence, serum-starved for 16 h, and treated with the specific agents for defined time points as indicated. Lysates were normalized for total protein, and ERK assays were performed with agarose-conjugated antisera to ERK1 (or antibodies to myc for cells transfected with myc-tagged ERK2) as indicated, using myelin basic protein (MBP) and [32P]-{gamma}ATP as substrates (22, 41). For Raf-1 assays, untreated and treated cells were lysed in 1% NP-40 buffer containing 10 mM Tris, pH 7.4, 5 mM EDTA, 50 mM NaCl, and 1 mM phenylmethylsulfonyl fluoride. Immune complex kinase assays were performed as described using recombinant wild-type MEK-1 (Santa Cruz) and [32P]-{gamma}-ATP as substrates (90). The reaction products of ERK and Raf-1 assays were resolved by 12% and 10% SDS-PAGE, respectively, and were analyzed with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Immunofluorescence
CHO-SSTR1 cells were plated on two-chambered slides and treated with 1 µM SS-14 for the indicated times. Cells were fixed in 4% paraformaldehyde and permeabilized with acetone at -20 C for 1 min. The cells were incubated with p21cip1/WAF1 antisera (1:1000 dilution) in PBS-0.1% BSA and fluorescein isothiocyanate-coupled antirabbit IgG and were visualized using a Leitz DMRB microscope (Leica, Inc., Deerfield, IL).


    ACKNOWLEDGMENTS
 
We thank R. Goodman, C. Marshall, R. Maurer, J. Pessin, K. Rodland, and A. Shaw for cDNAs, C. Ellig for technical assistance, and Chris Fenner for secretarial assistance.


    FOOTNOTES
 
Address requests for reprints to: Philip J. S. Stork, The Vollum Institute, L-474, Oregon Health Sciences University, 3181 SW Sam Jackson Park Road, Portland, Oregon 97201-3098.

T. Florio was supported by a "Short-term mobility grant" by Consiglio Nazionale delle Ricerche (Italy).

Received for publication January 8, 1998. Revision received October 1, 1998. Accepted for publication October 8, 1998.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Florio T, Rim C, Hershberger RE, Loda M, Stork PJS 1994 The somatostatin receptor SSTR1 is coupled to phosphotyrosine phosphatase activity in CHO-K1 cells. Mol Endocrinol 8:1289–1297[Abstract]
  2. Reubi JC, Maurer R, von Werder K, Torhorst J, Klijn JGM, Lamberts SWJ 1987 Somatostatin receptors in human endocrine tumors. Cancer Res 47:551–558[Abstract]
  3. Bell GI, Reisine T 1993 Molecular biology of somatostatin receptors. Trends Neurosci 16:34–38[CrossRef][Medline]
  4. Dy DY, Whitehead RH, Morris DL 1992 SMS 201.995 inhibits in vitro and in vivo growth of human colon cancer. Cancer Res 52:917–923[Abstract]
  5. Prévost G, Foehrlé E, Thomas F, Pihan I, Veber N, Starzec A, Israël L 1991 Growth of human breast cancer cell lines is inhibited by the somatostatin analog BIM23014. Endocrinology 29:323–329
  6. Qin Y, Schally AV, Willems G 1991 Somatostatin analogues RC-160 inhibits the growth of transplanted colon cancer in rats. Int J Cancer 47:765–770[Medline]
  7. Florio T, Scorziello A, Fattore M, D’Alto V, Salzano S, Rossi G, Berlingieri MT, Fusco A, Schettini G 1996 Somatostatin inhibits PC C13 thyroid cell differentiation through the modulation of phosphotyrosine activity. J Biol Chem 271:6129–6136[Abstract/Free Full Text]
  8. Taylor JE, Moreau J-P, Baptiste L, Moody TW 1990 Octapeptide analogues of somatostatin inhibit the clonal growth and vasoactive intestinal peptide-stimulated cyclic AMP formation in human small cell lung cancer cells. Peptides 12:839–843[CrossRef]
  9. Kluxen FW, Bruns C, Lubbert H 1992 Expression cloning of a rat brain somatostatin receptor cDNA. Proc Natl Acad Sci USA 89:4618–4622[Abstract]
  10. Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino S 1992 Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract, and kidney. Proc Natl Acad Sci USA 89:251–255[Abstract]
  11. Hoyer D, Bell GI, Berelowitz M, Epelbaum J, Feniuk W, Humphrey PP, O’Carroll AM, Patel YC, Schonbrunn A, Taylor JE 1995 Classification and nomenclature of somatostatin receptors. Trends Pharmacol 16:86–88[CrossRef][Medline]
  12. Kaupman K 1993 Distribution and second messenger coupling of four somatostatin receptor subtypes expressed in brain. FEBS Lett 331:53–59[CrossRef][Medline]
  13. Schonbrun D, Tashjian AB 1978 Characterization of functional receptors for somatostatin in rat pituitary cells in culture. J Biol Chem 253:6473–6483[Abstract]
  14. Chen L, Fitzpatrick VD, Vandlen RL, Tashjian AHJ 1997 Both overlapping and distinct signaling pathways for somatostatin receptor subtypes SSTR1 and SSTR2 in pituitary cells. J Biol Chem 272:18666–18672[Abstract/Free Full Text]
  15. Rens-Domiano S, Reisine T 1992 Biochemical and functional properties of somatostatin receptors. J Neurochem 58:1987–1996[Medline]
  16. Liebow C, Lee MT, Kamer AR, Schally AV 1991 Regulation of luteinizing hormone-releasing hormone receptor binding by heterologous and autologous receptor-stimulated tyrosine phosphorylation. Proc Natl Acad Sci USA 88:2244–2248[Abstract]
  17. Grant MB, Wargovich TJ, Ellis EA, Caballero S, Mansour M, Pepine CJ 1994 Localization of insulin-like growth factor I and inhibition of coronary smooth muscle cell growth by somatostatin analogues in human coronary smooth muscle cells. A potential treatment for restenosis. Circulation 89:1511–1517[Abstract]
  18. Tsuzaki S, Moses AC 1990 Somatostatin inhibits deoxyribonucleic acid synthesis induced by both thyrotropin and insulin-like growth factor-I in FRTL5 cells. Endocrinology 126:3131–3138[Abstract]
  19. Buscail L, Delesque N, Estéve J-P, Saint-Laurent N, Prats H, Clerc P, Robberecht P, Bell GI, Liebow C, Schally AV, Vaysse N, Susini C 1994 Stimulation of tyrosine phosphatase and inhibition of cell proliferation by somatostatin analogues: mediation by human somatostatin receptor subtypes SSTR1 and SSTR2. Proc Natl Acad Sci USA 91:2315–2319[Abstract]
  20. Hierowski MT, Liebow C, du Sapin K, Schally AV 1985 Stimulation by somatostatin of dephosphorylation of membrane proteins in pancreatic cancer MIA PaCa-2 cells line. FEBS Lett 179:252–256[CrossRef][Medline]
  21. Lee MT, Liebow C, Kamer AR, Schally AV 1991 Effects of epidermal growth factor and analogues of luteinizing hormone-releasing hormone and somatostatin on phosphorylation and dephosphorylation of tyrosine residues of specific protein substrates in various tumors. Proc Natl Acad Sci USA 88:1656–1660[Abstract]
  22. Pan MG, Florio T, Stork PJS 1992 G protein activation of a hormone-stimulated protein-tyrosine phosphatase in human tumor cells. Science 256:1215–1217[Medline]
  23. Lamberts SWJ, Krenning EP, Reubi JC 1991 The role of somatostatin and its analogs in the diagnosis and treatment of tumors. Endocr Rev 12:450–482[Medline]
  24. Hershberger RE, Newman BL, Florio T, Bunzow J, Civelli O, Li X-J, Forte M, Stork PJS 1994 The somatostatin receptors SSTR1 and SSTR2 are coupled to inhibition of adenylyl cyclase in CHO cells via pertussis toxin sensitive pathways. Endocrinology 134:1277–1285[Abstract]
  25. Florio T, Scorziello A, Thellung S, Salzano S, Berlingieri MT, Fusco A, Schettini G 1997 Oncogene transformation of PC C13 clonal thyroid cell line that induces an autonomous pattern of proliferation that correlates with loss of basal and stimulated phosphotyrosine phosphatase activity. Endocrinology 138:3756–3763[Abstract/Free Full Text]
  26. Reardon DR, Dent P, Wood SL, Kong T, Sturgill TW 1997 Activation in vitro of somatostatin receptor subtypes 2, 3, or 4 stimulates protein tyrosine phosphatase activity in membranes from ras-transformed NIH3T3 cells: coexpression with catalytically inactive SHP-2 blocks responsiveness. Mol Endocrinol 11:1062–1069[Abstract/Free Full Text]
  27. Srikant CB, Shen SH 1996 Octapeptide somatostatin analog SMS 201–995 induces translocation of intracellular PTP1C to membranes in MCF-7 human breast adenocarcinoma cells. Endocrinology 137:3461–3468[Abstract]
  28. Dhanasekaran N, Heasley LE, Johnson GL 1995 G protein-coupled receptor systems involved in cell growth and oncogenesis. Endocr Rev 16:259–270[Medline]
  29. Schlessinger J, Ullrich A 1992 Growth factor signaling by receptor tyrosine kinases. Neuron 9:383–391[Medline]
  30. Ullrich A, Schlessinger J 1990 Signal transduction by receptors with tyrosine kinase activity. Cell 60:203–212
  31. Gu YZ, Brown PJ, Loose-Mitchell DS, Stork PJS, Schonbrunn A 1995 Development and use of a receptor antibody to characterize the interaction between somatostatin receptor subtype 1 and G proteins. Mol Pharmacol 48:1004–1014[Abstract]
  32. Cheung NW, Boyages SC 1995 Somatostatin-14 and its analog octreotide exert a cytostatic effect on GH3 rat pituitary tumor cell proliferation via a transient G0/G1 cell cycle block. Endocrinology 136:4174–4181[Abstract]
  33. Cowley S, Paterson H, Kemp P, Marshall CJ 1994 Activation of MAP kinase kinase is necessary and sufficient for PC12 differentiation and for transformation of NIH3T3 cells. Cell 77:841–852[Medline]
  34. Dudley DT, Pang L, Decker SJ, Bridges AJ, Saltiel AR 1995 A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA 92:7686–7689[Abstract]
  35. Cattaneo MG, Amoroso D, Gussoni G, Sanguini AM, Vicentini LM 1996 A somatostatin analogue inhibits MAP kinase activation and cell proliferation in human neuroblastoma and in human small cell lung carcinoma cell lines. FEBS Lett 397:164–168[CrossRef][Medline]
  36. Tentler JJ, Hadcock JR, Guetierrez-Hartmann A 1997 Somatostatin act by inhibiting the cyclic 3',5'-adenosine monophosphate (cAMP)/protein kinase A pathway, cAMP response element-binding protein (CREB) phosphorylation and CREB transcriptional potency. Mol Endocrinol 11:859–866[Abstract/Free Full Text]
  37. Xiong Y, Hannon GJ, Zhang H, Kobayashi R, Beach D 1993 p21 is a universal inhibitor of cyclin kinases. Nature 366:701–704[CrossRef][Medline]
  38. Woods D, Parry D, Cherwinski H, Bosch E, Lees E, McMahon M 1997 Raf-induced proliferation or cell cycle arrest is determined by the level of Raf activity with arrest mediated by p21Cip1. Mol Cell Biol 17:5598–5611[Abstract]
  39. Sewing A, Wiseman B, Lloyd AC, Land H 1997 High-intensity Raf signal causes cell cycle arrest mediated by p21Cip1. Mol Cell Biol 17:5588–5597[Abstract]
  40. Bruder JT, Heidecker G, Rapp UR 1992 Serum-, TPA-, and Ras-induced expression from Ap-1/Ets-driven promoters requires Raf-1 kinase. Genes Dev 6:545–556[Abstract]
  41. Vossler M, Yao H, York R, Rim C, Pan M-G, Stork PJS 1997 cAMP activates MAP kinase and Elk-1 through a B-Raf- and Rap1-dependent pathway. Cell 89:73–82[Medline]
  42. Zheng C-F, Guan K-L 1993 Dephosphorylation and inactivation of the mitogen-activated protein kinase by a mitogen-induced Thr/Tyr protein phosphatase. J Biol Chem 268:16116–16119[Abstract/Free Full Text]
  43. Stacy DW, Feig LA, Gibbs JB 1991 Dominant inhibitory ras mutants selectively inhibit the activity of either cellular or oncogenic ras. Mol Cell Biol 11:4053–4064[Medline]
  44. Koch WJ, Hawes BE, Allen LF, Lefkowitz RJ 1994 Direct evidence that Gi-coupled receptor stimulation of mitogen-activated protein kinase is mediated by Gß{gamma} activation of p21ras. Proc Natl Acad Sci USA 91:12706–12710[Abstract/Free Full Text]
  45. Imamoto A, Soriano P 1993 Disruption of the csk gene, encoding a negative regulator of Src family tyrosine kinases, leads to neural tube defects and embryonic lethality in mice. Cell 73:1117–1124[Medline]
  46. Avruch J, Zhang X-F, Kyriakis JM 1994 Raf meets Ras: completing the framework of a signal transduction pathway. Trends Biochem Sci 19:279–283[CrossRef][Medline]
  47. Morrison DK, Cutler Jr RE 1997 The complexity of Raf-1 regulation. Curr Opin Cell Biol 9:174–179[CrossRef][Medline]
  48. Marais R, Light Y, Paterson HF, Marshall CJ 1995 Ras recruits Raf-1 to the plasma membrane for activation by tyrosine phosphorylation. EMBO J 14:3136–3145[Abstract]
  49. Neel B 1993 Structure and function of SH2-domain containing tyrosine phosphatase. Semin Cell Biol 4:419–432[CrossRef][Medline]
  50. Rivard N, McKenzie FR, Brondello J-M, Pouysségur J 1995 The phosphotyrosine phosphatase PTP1D, but not PTP1C, is an essential mediator of fibroblast proliferation induced by tyrosine kinase and G protein-coupled receptors. J Biol Chem 270:11017–11024[Abstract/Free Full Text]
  51. Lorenz U, Ravichandran KS, Burakoff SJ, Neel BG 1996 Lack of SHPT1 results in src-family kinase hyperactivation and thymocyte hyperresponsiveness. Proc Natl Acad Sci USA 93:9624–9629[Abstract/Free Full Text]
  52. Somani A-K, Bignon JS, Mills GB, Siminovitch KA, Branch DR 1997 Src kinase activity is regulated by the SHP-1 protein-tyrosine phosphatase. J Biol Chem 272:21113–21119[Abstract/Free Full Text]
  53. Wright JH, Drueckes P, Bartoe J, Zhao Z, Shen SH, Krebs EG 1997 A role for the SHP-2 tyrosine phosphatase in nerve growth-induced PC12 cell differentiation. Mol Biol Cell 8:1575–1585[Abstract]
  54. Marais R, Wynne J, Treisman R 1993 The SRF accessory protein Elk-1 contains a growth factor-regulated transcriptional activation domain. Cell 73:381–393[Medline]
  55. Misra-Press A, Rim CS, Yao H, Roberson MS, Stork PJS 1995 A novel mitogen-activated protein kinase phosphatase: structure, expression and regulation. J Biol Chem 270:14587–14596[Abstract/Free Full Text]
  56. Roberson MS, Misra-Press A, Laurance ME, Stork PJS, Maurer RA 1995 A role for mitogen activated protein kinase in mediating the ability of gonadotropin-releasing hormone to activate the glycoprotein hormone {alpha}-subunit promoter. Mol Cell Biol 15:3531–3539[Abstract]
  57. Hazlerigg DG, Thompson M, Hastings MH, Morgan PJ 1996 Regulation of mitogen-activated protein kinase in the pars tuberalis of the ovine pituitary: interactions between melatonin, insulin-like growth factor-1, and forskolin. Endocrinology 137:210–218[Abstract]
  58. Conrad KE, Oberwetter JM, Vaillancourt R, Johnson GL, Gutierrez-Hartmann A 1994 Identification of the functional components of the ras signaling pathway regulating pituitary cell-specific gene expression. Mol Cell Biol 14:1553–1565[Abstract]
  59. Yan G-Z, Ziff EB 1997 Nerve growth factor induces transcription of the p21 WAF1/CIP1 and cyclin D1 genes in PC12 cells by activating the Sp1 transcription factor. J Neurosci 17:6122–6132[Abstract/Free Full Text]
  60. Olson MF, Paterson HF, Marshall CJ 1988 Signals from Ras and Rho GTPases interact to regulate expression of p21Waf1/Cip1. Nature 394:295–299[CrossRef]
  61. Della Rocca GJ, van Biesen T, Daaka Y, Luttrell KK, Luttrell LM, Lefkowitz RJ 1997 Ras-dependent mitogen-activated protein kinase activation by G protein-coupled receptors. J Biol Chem 272:19125–19132[Abstract/Free Full Text]
  62. Inglese J, Koch WJ, Touhara K, Lefkowitz RJ 1995 ß{gamma} interactions with PH domains and Ras-MAPK signaling pathways. Trends Biochem Sci 20:151–156[CrossRef][Medline]
  63. Lopez-Llasaca M, Crespo P, Pellicci PG, Gutkind JS, Wetzker R 1997 Linkage of G protein-coupled receptors to the MAPK signaling pathway through PI 3-kinase {gamma}. Science 275:394–397[Abstract/Free Full Text]
  64. Cohen NA, Sha Q, Makhina EN, Lopatin AN, Linder ME, Snyder SH, Nichols CG 1996 Inhibition of an inward rectifier potassium channel (Kir2.3) by G-protein beta gamma subunits. J Biol Chem 271:32301–32305[Abstract/Free Full Text]
  65. Sakanaka C, Ferby I, Waga I, Bito H, Shimizu T 1994 On the mechanism of cytosolic phosholipase A2 activation in CHO cells carrying somatostatin receptor: wortmannin-sensitive pathway to activate mitogen-activated protein kinase. Biochem Biophys Res Commun 205:18–23[CrossRef][Medline]
  66. Garnovskaya MN, van Biesen T, Hawe B, Casanas Ramos S, Lefkowitz RJ, Raymond JR 1996 Ras-dependent activation of fibroblast mitogen-activated protein kinase by 5-HT1A receptor via a G protein beta gamma-subunit-initiated pathway. Biochemistry 35:13716–13722[CrossRef][Medline]
  67. Crespo P, Xu N, Simonds WF, Gutkind JS 1994 Ras-dependent activation of MAP kinase pathway mediated by G-protein beta gamma subunits. Nature 369:418–420[CrossRef][Medline]
  68. Ptasznik A, Traynor-Kaplan A, Bokoch GM 1995 G protein-coupled chemoattractant receptors regulate lyn tyrosine kinase-shc adapter protein signaling complexes. J Biol Chem 270:19969–19973[Abstract/Free Full Text]
  69. van Biesen T, Hawes BE, Luttrell DK, Krueger KM, Touhara K, Porfiri E, Sakaue M, Luttrell LM, Lefkowitz RJ 1995 Receptor-tyrosine-kinase- and Gß{gamma}-mediated MAP kinase activation by a common signalling pathway. Nature 376:781–784[CrossRef][Medline]
  70. Hawes BE, Luttrell LM, van Biesen T, Lefkowitz RJ 1996 Phosphatidylinositol 3-kinase is an early intermediate in the G ß{gamma}-mediated mitogen-activated protein kinase signaling pathway. J Biol Chem 271:12133–12136[Abstract/Free Full Text]
  71. Duckworth BC, Cantley LC 1997 Conditional inhibition of the mitogen-activated protein kinase cascade by wortmannin. J Biol Chem 272:27665–27670[Abstract/Free Full Text]
  72. Dent P, Jelinek T, Morrison DK, Weber MJ, Sturgill TW 1995 Reversal of Raf-1 activation by purified and membrane-associated protein phosphatases. Science 268:1902–1906[Medline]
  73. Lopez F, Esteve J-P, Buscail L, Delesque N, Saint-Laurent N, Theveniau M, Nahmias C, Vaysse N, Susini C 1997 The tyrosine phosphatase SHP-1 associates with the sst2 somatostatin receptor and is an essential component of sst2-mediated inhibitory growth signaling. J Biol Chem 272:24448–24454[Abstract/Free Full Text]
  74. Reardon DB, Wood SL, Brautigan DL, Bell GI, Dent P, Sturgill TW 1996 Activation of a protein tyrosine phosphatase and inactivation of Raf-1 by somatostatin. Biochem J 314:401–404[Medline]
  75. Zeggari J, Exteve J-P, Rauly I, Cambillau C, Mazarguil H, Dufresne M, Pradayrol L, Chayvialle J-A, Vaysse N, Susini C 1994 Co-purification of a protein tyrosine phosphatase with activated somatostatin receptors from rat pancreatic acinar membranes. Biochem J 303:441–448[Medline]
  76. Matthews RJ, Bowne DB, Flores E, Thomas ML 1992 Characterization of hematopoietic intracellular protein tyrosine phosphatases: description of a phosphatase containing an SH2 domain and another enriched in proline-, glutamic acid-, serine-, and threonine-rich sequences. Mol Cell Biol 12:2396–2405[Abstract]
  77. Dent P, Reardon DB, Wood SL, Lindorfer MA, Graber SG, Garrison JC, Brautigan DL, Sturgill TW 1996 Inactivation of Raf-1 by a protein tyrosine phosphatase stimulated by GTP and reconstituted by G{alpha}i/o. J Biol Chem 271:3119–3123[Abstract/Free Full Text]
  78. Diaz B, Barnard D, Filson A, Macdonal S, King A, Marshall M 1997 Phosphorylation of Raf-1 serine 338-serine 339 is an essential regulatory event for Ras-dependent activation and biological signaling. Mol Cell Biol 17:4509–4516[Abstract]
  79. Jelinek T, Dent P, Sturgill TW, Weber MJ 1996 Ras-induced activation of Raf-1 is dependent on tyrosine phosphorylation. Mol Cell Biol 16:1027–1034[Abstract]
  80. Milarski KL, Saltiel AR 1994 Expression of catalytically inactive Syp phosphatase in 3T3 cells blocks stimulation of mitogen-activated protein kinase by insulin. J Biol Chem 269:21239–21243[Abstract/Free Full Text]
  81. Xiao S, Rose DW, Sasaoka T, Maegawa H, Burke Jr TR 1994 Syp (SH-PTP2) is a positive mediator of growth factor-stimulated mitogenic signal transduction. J Biol Chem 269:21244–21248[Abstract/Free Full Text]
  82. Yamaguchi K, Shirakabe K, Shibuya H, Irie K, Oishi I, Ueno N, Taniguchi T, Nishida E, Matsumoto K 1995 Identification of a member of the MAPKKK family as a potential mediator of TGF-ß signal transduction. Science 270:2008–2011[Abstract]
  83. Saxton TM, Henkemeyer M, Gasco S, Shen R, Rossi DJ, Shalaby F, Feng G-S, Pawson T 1997 Abnormal mesoderm patterning in mouse embryos mutant for the SH2 tyrosine phosphatase Shp-2. EMBO J 19:2352–2364[CrossRef]
  84. Bennett AM, Tang TL, Sugimoto S, Walsh CT, Neel BG 1994 Protein-tyrosine-phosphatase SHPTP2 couples platelet-derived growth factor receptor ß to Ras. Proc Natl Acad Sci USA 91:7335–7339[Abstract]
  85. Hadari YR, Douhara H, Lax I, Schlessinger J 1998 Binding of Shp2 tyrosine phosphatase to FRS2 is essential for fibroblast growth factor-induced PC12 cell differentiation. Mol Cell Biol 18:3966–3973[Abstract/Free Full Text]
  86. Peng Z-Y, Cartwright CA 1995 Regulation of Src tyrosine kinase and Syp tyrosine phosphatase by their cellular association. Oncogene 11:1955–1962[Medline]
  87. McCarley DJ, Parsons SJ 1987 Reduced tyrosine kinase specific activity is associated with hypophosphorylation of pp60c-src in cells infected with avian erythroblastosis virus. Proc Natl Acad Sci USA 84:5793–5797[Abstract]
  88. Zheng XM, Wang Y, Pallen CJ 1992 Cell transformation and activation of pp60c-src by overexpression of a protein tyrosine phosphatase. Nature 359:336–339[CrossRef][Medline]
  89. Tsui HW, Simovitch KA, deSouza L, Tsui FWL 1993 Motheaten and viable motheaten mice have mutations in the haematopoietic cell phosphatase gene. Nat Genet 4:124–129[Medline]
  90. Vaillancourt RR, Gardner AM, Johnson GL 1994 B-Raf dependent regulation of the MEK-1/MAP kinase pathway in PC12 cells and regulation by cAMP. Mol Cell Biol 14:6522–6530[Abstract]