The Human Chorionic Gonadotropin-ß Arginine68 to Glutamic Acid Substitution Fixes the Conformation of the C-Terminal Peptide
Marie Charrel-Dennis1,
Nadia Terrazzini1,
Jeffrey D. McBride,
Paul Kaye,
Pia M. Martensen,
Just Justesen,
Peter Berger,
Adrian Lapthorn,
Charles Kelly,
Ivan M. Roitt,
Peter J. Delves and
Torben Lund
Department of Immunology and Molecular Pathology (M.C.-D., N.T., J.D.M., P.K., I.M.R., P.J.D., T.L.), University College London, London W1T 4JF, United Kingdom; School of Biosciences (N.T.), University of East London, London E15 4LZ, United Kingdom; Department of Molecular Biology (P.M.M., J.J.), University of Aarhus, DK-8000 Aarhus, Denmark; Institute for Biomedical Aging Research (P.B.), Austrian Academy of Sciences, A-6020 Innsbruck, Austria; Chemistry Department (A.L.), University of Glasgow, Glasgow GI2 8QQ, Scotland, United Kingdom; and Department of Oral Immunology (C.K.), Kings College London, London SE1 9RT, United Kingdom
Address all correspondence and requests for reprints to: Dr. Torben Lund, Department of Immunology and Molecular Pathology, University College London, 46 Cleveland Street, London W1T 4JF, United Kingdom. E-mail: t.lund{at}ucl.ac.uk.
 |
ABSTRACT
|
---|
Wild-type human chorionic gonadotropin (hCG) has been used as a contraceptive vaccine. However, extensive sequence homology with LH elicits production of cross-reactive antibodies. Substitution of arginine68 of the ß-subunit (hCGß) with glutamic acid (R68E) profoundly reduces the cross-reactivity while refocusing the immune response to the hCGß-specific C-terminal peptide (CTP). To investigate the molecular basis for this change in epitope usage, we immunized mice with a plasmid encoding a truncated hCGß-R68E chain lacking the CTP. The animals produced LH-cross-reactive antibodies, suggesting that the refocused immunogenicity of R68E is a consequence of epitope masking by a novel disposition of the CTP in the mutant rather than a structural change in the cross-reactive epitope region. This explanation was strongly supported by surface plasmon resonance analysis using a panel of anti-hCGß-specific and anti-hCGß/LH cross-reactive monoclonal antibodies (mAbs). Whereas the binding of the LH cross-reactive mAbs to hCGß-R68E was eliminated, mAbs reacting with hCGß-specific epitopes bound to hCGß and hCGß-R68E with identical affinities. In a separate series of experiments, we observed that LH cross-reactive epitopes were silent after immunization with a plasmid encoding a membrane form of hCGß-R68E, as previously observed with the soluble mutant protein itself. In contrast, the plasmid encoding the soluble secreted form of hCGß-R68E evoked LH cross-reactive antibodies, albeit of relatively low titer, suggesting that the handling and processing of the proteins produced by the two constructs differed.
 |
INTRODUCTION
|
---|
HUMAN CHORIONIC gonadotropin (hCG) is a member of the glycoprotein hormone family, which also includes LH, FSH, and TSH. The glycoprotein hormones are heterodimeric molecules consisting of a common
-chain noncovalently associated with a hormone-specific ß-chain. In a healthy woman, biologically active hCG is only present in significant concentrations during pregnancy where it stimulates the corpus luteum to produce progesterone and estrogen required for sustaining the implanted embryo. Incubation of marmoset embryos with hCG-specific antibodies prevents implantation (1), and hCG is considered an antifertility vaccine candidate (2, 3, 4, 5). Phase II trials of a heterospecies vaccine consisting of an ovine
-chain and hCG ß-chain coupled to tetanus toxoid or diphtheria toxoid resulted in only one pregnancy among 1224 cycles in those immunized women producing circulating anti-hCG antibodies above 50 ng per ml (2). However, due to the 85% sequence homology between the first 110 amino acid residues of hCGß and LHß, most of the anti-hCG antibodies produced cross-reacted with LH (3). Although no adverse effects of the LH-cross-reactive antibodies were observed in the cohort studied (3), the long-term presence of such antibodies may cause undesired side effects.
With the aim of producing a potentially safer hCG-based vaccine, we have constructed a series of hCGß mutants in which amino acid residues at presumed LH cross-reactive epitope regions have been substituted (6). One of these mutants, hCGß-R68E, with arginine68 substituted with glutamic acid, failed to bind all tested LH-cross-reactive monoclonal antibodies (mAbs) without apparently affecting the natural folding of the molecule, as judged by the ability of the conformation-dependent hCG-specific mAbs to recognize the protein (6). Baculovirus-produced hCGß-R68E elicited antibodies with minimal LH cross-reactivity in both mice and rabbits (7, 8). The antibodies produced were predominantly directed against sequences present on the hCGß-specific C-terminal peptide region (hCGßCTP; amino acids 113145), which is missing in LHß and has been generated during evolution by a read-through event. This peptide region adopts a free-floating entropy-rich conformation in hCG (9) and consequently is poorly immunogenic (7, 8). We hypothesized that glutamic acid68 in the mutant forms a salt bridge with one or more of the basic amino acid residues present in the hCGßCTP, thus providing the hCGßCTP with a defined conformation that creates a new and more immunogenic loop.
We have used DNA immunization and analysis by surface plasmon resonance to further probe the structure of hCGß-R68E. We show here that truncation of the CTP element of hCGß-R68E (hCGß-R68E-
CTP) restores the immunodominance of the LH-cross-reactive epitope region so that mice immunized with a plasmid expressing hCGß-R68E-
CTP produce antibodies that recognize hCG, LH, and hCGß-R68E equally well. Biosensor analysis is often used to determine the thermodynamics of antibody-antigen interactions. Even subtle changes in the structure of the antigen can have profound consequences for the kinetics of formation or dissociation of the protein-protein complexes. Optical biosensor analysis of the conformational integrity of hCGß-R68E confirmed that whereas LH-cross-reactive epitopes were inaccessible in the mutant, hCGß-specific epitopes adjacent to the cross-reactive epitope region were unaffected by the substitution. This is consistent with our proposed model postulating formation of a salt bridge between glutamic acid68 and a basic residue on the CTP, which masks the LH-cross-reacting epitopes. The identity of the charge on CTP remains to be determined, but both K122 and R133 contribute to the formation of the loop structure.
 |
RESULTS
|
---|
Immunization
BALB/c mice immunized with expression plasmids encoding either membrane-attached (pCDNA3-hCGß-TM) or soluble (pCDNA3-hCGß-His6) forms of hCGß (Fig. 1
) produced antibodies that bind equally well to holo-hCG, recombinant hCGß produced in baculovirus (Bac-hCGß-WT), and the mutant hCGß-R68E produced in baculovirus (Bac-hCGß-R68E) and cross-reacted with LH (Fig. 2
). This contrasts with the results obtained after immunization with pCDNA3-hCGß-R68E. As expected, mice immunized with DNA encoding a membrane-attached form of hCGß-R68E (pCDNA3-hCGß-R68E-TM) produced antibodies that bind well to Bac-hCGß-R68E. The sera from these mice reacted poorly with holo-hCG and the free Bac-hCGß subunit and showed no cross-reactivity with LH (Fig. 2
), consistent with the results obtained after intranasal immunization of mice with purified Bac-hCGß-R68E mixed with Escherichia coli heat-labile protein (7). This contrasts with the result obtained in mice immunized with pCDNA3-hCGß-R68E-His6 encoding a secreted form of hCGß-R68E, which resulted in antibodies that bind to Bac-hCGß but less so to holo-hCG and LH although they reacted more strongly with Bac-hCGß-R68E.

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 1. Diagram of the hCGß-Related Immunogens Used
The N-linked and the O-linked glycosylation sites are indicated with an open and a solid arrow, respectively. The numbering of amino acid residues relates to hCGß, and the positions of the mutated residues are indicated in italic.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 2. The Level of hCG-Specific Antibodies after Immunization with Plasmid DNA
Female BALB/c mice (n = 5) were immunized with 50 µg plasmid DNA expressing membrane-attached (TM) or secreted (His) hCGß or hCGß-R68E or truncated hCGß-R68E (hCGß-R68E- CTP) devoid of the CTP. Sera (dilution 1:50) were analyzed in ELISA using plates coated with proteins as indicated, and the results are expressed as optical density ± SD.
|
|
This is consistent with our proposed structure of hCGß-R68E, which envisages the normally entropy-rich hCGßCTP becoming conformationally fixed by formation of a salt bridge between glutamic acid68 and one or more of the basic residues present in the hCGßCTP (8, 10). This model predicts that mice immunized with a truncated hCGß-R68E molecule without CTP (hCGß-R68E-
CTP) would produce antibodies that bind to hCG, and notably LH, equally well as to hCGß-R68E itself. As shown in Fig. 2
, mice immunized with pCDNA3-hCGß-R68E-
CTP did elicit antibodies that bind equally well to holo-hCG, LH, and Bac-hCGß. Although the antigen-specific IgGs react stronger with Bac-hCGß-R68E, there was no statistical difference [P = 0.11, paired Students t test (LH coating vs. Bac-hCGß coating); P = 0.09, paired Students t test (LH coating vs. recombinant hCG coating)] between the results obtained with Bac-hCGß, holo-hCG, or LH. This supports the hypothesis that the CTP attains a conformation in hCGß-R68E, which blocks the accessibility of cognate B cells to the cross-reactive epitope region on the body of the hCGß molecule.
Thermodynamic Analysis
To probe further into the conformation of hCGß-R68E, we used surface plasmon resonance to determine the association and dissociation rates and affinity constants of selected hCG-reactive mAbs, because even modest structural changes in the overall conformation of the core domain of hCGß as a result of the glutamic acid68 substitution would affect the thermodynamic properties of the antibodies binding. For this analysis, a panel of mAbs directed to LH-cross-reactive and hCGß-specific epitopes (11, 12) were selected (Table 1
). INN-22 and INN-58 have specificity for the immunodominant LH-cross-reactive epitopes, ß2 and ß5 (12), respectively. As representative for the hCGß-specific mAbs, INN-2, INN-64, and INN-68, which bind to ß1, ß6, and ß7 (12), respectively, were selected. Epitope ß1 is accessible on holo-hCG and includes among its contact residues arginine10 and arginine60 close to the cystine knot (13), whereas ß6 and ß7 are both located in the interface between the
- and ß-subunit and are inaccessible on holo-hCG (12). Epitope ß6 is spatially close to lysine20, glutamic acid21, glycine22, and glycine75 (6), whereas epitope ß7 is affected by mutations of the residues in position 61 and 89 (13).
To reduce cross-linking by the bivalent IgGs, Fab fragments of each mAb were generated by papain digestion. The Fab fragments obtained from the individual Igs contained limited but varying amounts of undigested Igs in the samples. Although the calculated equilibrium constant therefore cannot be interpreted as an absolute value, the data obtained for wild-type mutant hCGß can nevertheless be compared, because the same Fab/antibody ratio was used for both proteins.
Figure 3
shows the sensorgrams for the binding of INN-2, INN-22, INN-58, INN-64, and INN-68 to Bac-hCGß-WT and Bac-hCGß-R68E, and the resulting association rate constant (ka), dissociation rate constant (kd), and apparent dissociation equilibrium constant KD are summarized in Table 2
. The five Fabs recognized Bac-hCGß-WT with a dissociation equilibrium constant varying between 8.2 x 108 M for INN-2 and 0.7 x 108 M for INN-68 Fab. This compares with the affinities of the mAbs determined by saturation or competitive RIA (14, 15). This demonstrates that the recognition of the five spatially distinct antigenic sites on Bac-hCGß-WT by these antibodies has not been affected dramatically by production of the hCGß subunit in insect cells, indicating that differences in posttranslational modifications, such as glycosylation, in insect cells do not substantially modify the overall three-dimensional structure of the protein.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3. Sensorgram Showing the Binding of Fabs to Bac-hCGß or Bac-hCGß-R68E
Recombinant Bac-hCGß or Bac-hCGß-R68E was bound to Ni2+-charged nitrilotriacetic acid sensor chips at a concentration equivalent to 500 RU. A solution (50 µl) containing a predetermined dilution of the appropriate Fab (INN-2; INN-22; INN-58; INN-64; and INN-68) was passed onto the chip at a rate of 20 µl/min. The sensorgrams were corrected for the constant release of His-tagged recombinant protein, normalized, and overlaid. *, Sensorgrams obtained with Bac-hCGß; #, sensorgrams obtained with Bac-hCGß-R68E.
|
|
View this table:
[in this window]
[in a new window]
|
Table 2. Kinetic Parameters for Reaction of Fab Fragments of the INN-2, INN-22, INN-58, INN-64, and INN-68 Antibodies with Bac-hCGß-WT and Bac-hCGß-R68E
|
|
The glutamic acid68 substitution in Bac-hCGß-R68E abrogates the binding of the LH-cross-reactive Fabs INN-22 and INN-58, whereas binding of the Fabs to the hCG-specific epitopes, ß1, ß6, and ß7, was unaffected by the mutation (Fig. 3
and Table 2
) in agreement with the results obtained by flow cytometric analysis of transiently transfected COS-7 cells (6). At the same concentration at which the cross-reactive Fabs (INN-22 and INN-58) reacted with Bac-hCGß-WT, minimal binding to Bac-hCGß-R68E was observed. Indeed, the association rates of the two cross-reactive Fabs were very similar to that obtained for the isotype-matched control antibody (data not shown). In contrast, the ß6 (INN-64) and ß7 (INN-68) epitopes located at the interface between the
- and ß-subunit remained unchanged by the mutation. The association and dissociation rate constants for the binding of each of these antibodies to Bac-hCGß-WT and Bac-hCGß-R68E were not statistically different (Table 2
). Both ß6 and ß7 are spatially relatively adjacent to the cross-reactive epitope region recognized by INN-22 and INN-58. Thus the fact that the binding affinities of INN-64 and INN-68 are unaffected by the glutamic acid68 substitution implies that the overall structure of hCGß is maintained.
The ß1-specific INN-2 antibody was previously thought to recognize the wild-type and mutant protein equally well (6). The biosensor analysis showed, however, a slightly higher association rate (ka = 2.5 x 104 M1 sec1) for INN-2 binding to the mutant protein than that observed for the binding to Bac-hCGß-WT (ka = 1.5 x 104 M1 sec1). Nonetheless, the complex formed with the mutant protein appeared to be less stable with a kd = 2.7 x 103 sec1 for Bac-hCGß-R68E compared with kd = 1.8 x 103 sec1 for the wild-type form of hCGß (Table 2
). Overall, the affinity of binding was significantly greater for the wild-type protein (KD = 8.2 x 108 M) compared with that of the mutant (KD = 11.1 x 108 M; P < 0.001). Nevertheless, the difference in free energy changes between INN-2 binding to the mutant and the wild-type protein was minimal (
G = 0.163 kcal/mol). The binding of INN-2 to hCG involves residues arginine10 and arginine60 (13). It seems unlikely, however, that an amino acid substitution localized more than 30Å away from the ß1 epitope, which does not modify the conformation of more proximal epitopes, could affect the recognition pattern of this epitope. However, the formation of a salt bridge between the glutamic acid68 and the basic residues of the hCGßCTP could affect the spatial orientation of the oligosaccharide antennae, resulting in an increase in the association rate of INN-2. The increased instability of the complex formed with the mutant protein could be related to some steric hindrance of the antibody by the fixed CTP of hCGß-R68E.
CTP Mutations
Our model predicts that the presence of an acidic residue (glutamic acid) at position 68 of hCGß changes the chemical characteristic of this region of the protein structure. Normally this region of the structure is flat with two protruding amino acid residues, R68 and R74, approximately 10Å apart, both with a net positive charge. The substitution R68E changes both the shape and charge of this area of hCGß, which is part of the cross-reactive epitope, although it is unlikely to greatly modify the folded structure of the protein that is tethered by the disulfide C23-C72. A working hypothesis for the masking of the cross-reactive epitopes is that R68E forms a salt bridge with one or more of the basic amino acid residues in the CTP. There are three possible candidate residues, R114, K122, and R133 (Fig. 4
). Both R114 and R133 have negatively charged residues in relative close proximity within the peptide, which could form additional charged interactions with R74 on the same surface. R133 is an unlikely candidate as it forms part of the epitope for mAb OT3A (amino acids 133139) the binding of which has been shown to be unaffected in the R68E mutant (6). R114 is also in doubt if the ß-subunit disulfide C26-C110 is formed as this would tether the CTP on the opposite side of the ß-subunit and R114 would be too far away from R68E to form a salt bridge. However if this disulfide were not formed (due to the absence of the
-subunit), then the flexibility of the "seat belt" region of the ß-subunit would probably permit R114 to form a salt bridge. In an attempt to identify the putative donor residue for the postulated salt bridge with R68E, we selectively substituted K122 and R133 on hCGß-R68E with glutamine individually or together (Fig. 1
) and immunized groups of BALB/c mice with plasmids precipitated onto gold particles. As shown in Fig. 5
, the strongly CTP-focused and reduced hLH cross-reactive antibody response obtained with pCDNA3-hCGß-R68E-TM was not obtained after immunization with any of the three CTP mutants: pCDNA3-hCGß-R68E-K122Q-TM, pDNA3-hCGß-R68E-R133Q-TM, or pCDNA3-hCGß-R68E-K122Q-R133Q-TM. The immune response with each of the CTP mutants was similar to that obtained after immunization with pCDNA3-hCGß-TM. This confirmed that the conformation of CTP is fixed in hCGß-R68E but that both K122 and R133 contribute to establish this conformational change.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4. A Ribbon Representation of a Molecular Model of hCG (Based on Protein Data Base Entry 1 HRP) with the -Subunit (Cyan), ß-Subunit (Magenta), and Disulfide Bridges (Shown in Yellow)
A chemically sensible conformation of the CTP (not seen in the x-ray structure) is modeled with O-linked carbohydrates shown in green. The CTP is able to wrap around the ß-subunit in the R68E mutant forming an interaction that blocks the LH cross-reactive epitope. Charged amino acid residues of the CTP are labeled.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5. The Relative Levels of Specific Antibodies after Particle-Mediated DNA Immunization with hCGß-R68E that Contained CTP Substitutions
Female BALB/c mice (n = 5) were primed and boosted 4 wk later with 2 µg plasmid DNA coated onto 2 mg gold particles. Sera (dilution 1:50) were analyzed in ELISA using plates coated with recombinant hCG, LH, and CTP, and the ratio of mean optical density values for CTP and hCG (upper panel) and for LH and hCG (lower panel) were plotted.
|
|
 |
DISCUSSION
|
---|
A single arginine68 to glutamic acid substitution in hCGß dramatically alters the antigenicity and immunogenicity of the mutant molecule. The immunodominant LH cross-reactive epitope cluster on hCG has been defined by several mAbs and comprises several epitopes (ß2, ß3, ß4, and ß5) (12) that may share one or more contact residues as we have previously suggested (16). Representative mAbs defining each of these epitopes fail to bind to recombinant hCGß-R68E expressed in either COS7 cells (6) or insect cells (Table 2
). We have identified, however, one CTP-reactive mAb (2F4/3) that reacts more avidly with hCGß-R68E than with hCG or hCGß (7), suggesting that the glutamic acid68 substitution affects the conformation of the normally entropy-rich, free-floating CTP. Indeed, immunogenicity studies with baculovirus-derived hCGß-R68E in both mice (7) and rabbits (8) show that the immune response is refocused toward epitope(s) present on the CTP at the expense of the major LH cross-reactive epitope normally used by hCG/hCGß as also demonstrated in the present study after DNA immunization of mice with pCDNA3-hCGß-R68E-TM or pCDNA3-hCGß-R68E-His6 (Figs. 2
and 5
).
To explain these findings we have proposed that the presence of an acidic residue (glutamic acid) at position 68 of hCGß changes the chemical characteristic of this region of the protein structure. The mutation R68E could potentially permit the formation of an internal salt bridge between the glutamic acid and a positive charge associated with the CTP, thereby fixing the structure of the CTP by forming a new loop structure. Elimination of the CTP on the hCGß-R68E immunogen (hCGß-R68E-
CTP) elicited antibodies that reacted equally well with hCG, LH, and Bac-hCGß-R68E in contrast to antibodies produced after immunization with pCDNA3-hCGß-R68E-TM or pCDNA3-hCGß-R68E-His6. The presence of a new loop structure is further supported by real-time binding kinetics of mAbs to wild-type and mutant Bac-hCGß using surface plasmon resonance. Whereas the ß2- and ß5-specific LH cross-reactive mAbs fail to bind Bac-hCGß-R68E, the mAbs INN-64 and INN-68, specific for epitopes ß6 and ß7, which include residues located both on loop 1 and loop 3 of the ß-subunit (6), bind to the wild-type and the mutant subunit with nearly identical association and dissociation rates (Table 2
). This demonstrates that glutamic acid68 does not introduce major structural changes that affect the relative spatial arrangement of loops 1 and 3, which present these two epitopes. Rather, it seems more probable that a salt bridge might be formed between glutamic acid68 and one or more of the basic residues on CTP (K122 and R133), thereby masking the entire cross-reactive epitope cluster and eliminating their accessibility for both isolated LH-cross-reactive mAbs and potential B cell receptors with specificity for this region of hCG. However, both K122 and R133 appear important for establishing this additional loop structure, because selectively substituting either of these residues with a noncharged glutamine abolished the CTP-loop structure of hCGß-R68E. It is surprising that both these mutants have an effect, ruling out a simple salt bridge between E68 and one of the residues. Both K122 and R133 occupy rather similar positions in sequence (i.e. both follow a serine that is O-linked glycosylated in the CTP), so substituting either of these residues with the neutral glutamine may alter the O-linked glycans on the CTP. Equally, these residues may be important in fixing the CTP structure in hCGß-R68E but not directly via an interaction with residue 68. Clearly, a more detailed structural analysis of hCGß-R68E is required to determine the structure of the CTP in this mutant protein and the role of the individual amino acids in interactions with the main body of hCGß.
Regarding antibody recognition of the other, non-CTP but hCGß-specific, epitopes we noted less binding (at a molar basis) of the panel of mAbs to Bac-hCGß-R68E than to wild-type Bac-hCGß. Although it is unclear why this should occur, given that hCGß and Bac-hCGß have a tendency to form aggregates, it is possible that the constrained conformation of the CTP in hCGß-R68E favors structures that make the other ß-specific epitopes less accessible on the mutant molecule than on the wild-type Bac-hCGß molecule.
Depending on the antigen, mice DNA-immunized with a membrane-attached molecule can produce a greater antibody response compared with mice immunized with plasmids encoding soluble forms of the antigen, as shown, for example, with influenza virus hemagglutinin (17). This is not apparent for relatively weak antigens such as hCGß, as shown in Fig. 2
, where the membrane-attached (pCDNA3-hCGß-R68E-TM) and soluble (pCDNA3-hCGß-R68E-His6) forms of the immunogen produce comparable R68E mutant-specific antibodies. However, immunization of mice with these two immunogens resulted in differences in both the magnitude and complexity of the antibodies reacting with related antigens (Fig. 2
). Whereas mice immunized with pCDNA3-hCGß-R68E-TM predominantly used epitopes specific to hCGß-R68E, consistent with the results obtained after intranasal immunization of mice with Bac-hCGßR68E (7), immunization with pCDNA3-hCGß-R68E-His6 produced a higher level of antibodies reacting with hCG and hCGß and, to a lesser extent, LH (Fig. 2
). The difference in the response to immunization with the soluble mutant plasmid, as compared with the membranous form and indeed the soluble mutant protein itself, presumably reflects differences in the accessibility of the LH cross-reacting epitopes to the cognate B cell receptors as a result of some variation in the handling or processing of these immunogens by antigen-presenting cells.
 |
MATERIALS AND METHODS
|
---|
Immunization
Plasmid pCDNA3 (Invitrogen, Paisley, Scotland, UK) was used as the backbone plasmid into which the majority of the hCGß fragments were subcloned. Fragments encoding hCGß and hCGß-R68E fused with the transmembrane and cytoplasmic tail of H2-Db (6) were subcloned as HindIII-NotI fragments to generate pCDNA3-hCGß-TM. pCDNA3-hCGß-His6 and pCDNA3-hCGß-R68E-His6 were constructed by subcloning of a HindIII-NotI hCGß-His6 fragment from pBac-hCGß-WT and pBac-hCGß-R68E-His6 (7). pCDNA3-hCGß-R68E-
CTP was made by a PCR amplification using the 5'-T7 primer (5'-TAATACGACTCACTATAGGG-3') and 3'-primer (5'-TGCTCTAGATTAGTGGTGGTGGTGGTGGTGGTCGACCAAGGGGTGGTCCTTGGG-3') and subcloning the PCR product digested with HindIII and SalI into the HindIII-SalI-digested pLitmus-hCGß-His6 and subsequently subcloned into pCDNA3 as a HindIII-NotI fragment (Fig. 1
).
pCDNA3-hCGß-R68E-K122Q-TM and pCDNA3-hCGß-R68E-R133Q-TM were made by PCR amplifications using 5'-M13-reverse sequence primer (5'-AGCGGATAACAATTTCACACAGGA) and for the 3'-primers (for the K122E substitution: 5'-GATGGGCTTGGAAGGCTGGGGGGAGGGGCTTGTGAGGAAGAGGAGTCCTGGAAG followed by a second PCR using the 3'-primer: 5'-CCAGCGTCCTCGAGTTGTGGGAGGATCGGG), (for the R133Q substitution: 5'-TAACGCCAGCTGTTGTGGGAGGATCGGGGTGTCTGAGGGCCCCGGGAGTTGGGATGGACTTGGAAGGCTG followed by a second PCR with the 3'-primer 5'-CCAGCGTCCTCGAGTTGTGGGAGGATCGGG) using pLitmus-hCGß-R68E-His6 as template. pCDNA3-hCGß-R68E-K122Q-R133Q-TM was made from hCGß-R68E-K133Q with the same 3'-primers used to make hCGß-R68E-R133Q. The final PCR products were digested with EcoRI and XhoI and subcloned into pLitmus containing the H2-Kb TM region used previously (6). The recombinant gene was finally subcloned into pCDNA3 as a HindIII-NotI fragment. All plasmids used to immunize mice were purified using a QIAGEN endotoxin-free purification kit (QIAGEN, Crawley, West Sussex, UK).
Female BALB/c mice (6 wk old) in groups of five were immunized one to three times. For DNA immunization the recipient animals were injected im with 6.8 µg cardiotoxin (Sigma, Poole, Dorset, UK) in 100 µl of 0.15 M PBS (pH 7.4) 6 d before being primed (wk 0) with 50 µg plasmid DNA injected into the cardiotoxin-treated muscles, and an additional boost of 50 µg plasmid DNA was given 2 wk later. After the injection of the plasmid DNA into the quadriceps, the muscles were stimulated electrically as described by Mathiesen (18). Briefly, silver rod electrodes were placed on the skin at the site of DNA injection, and the muscles were subjected to eight trains of 1000 pulses delivered at a frequency of 1000 Hz using a Hear 6-bp stimulator (Frederick Hear, Bowdoinham, ME). Each pulse lasted 400 µsec. The electric field strength was approximately 50 V over 34 mm, and each train was delivered at 2-sec intervals with each train lasting 1 sec.
For particle-mediated DNA delivery the plasmids (2 µg/mg gold) were precipitated onto 2-µm diameter gold particles (DeGussa Metals Group, South Plainfield, NJ) in the presence of 0.05 M spermidine (Sigma) and 1 M calcium chloride. The gold particles were washed three times in absolute alcohol containing 0.15 M polyvinylpyrrolidone (Sigma), and then adsorbed to the inner surface of Tefzel tubing (TFX Medical, Inc., Jaffrey, NH) by centrifugal force. The Tefzel tubes were subsequently cut into 1.27-cm long cartridges and stored desiccated at 4 C. A cartridge contains 0.50.75 µg plasmid DNA/0.5 mg gold particles. The DNA-coated gold particles were delivered from cassettes at 500 pounds/square inch of pressure at two sites of shaved abdomen (1.01.5 µg total DNA) by particle-mediated DNA delivery using the Helious Gene Gun (Bio-Rad, Hemel Hempstead, Hertfordshire, UK). Mice were immunized at wk 0 and received a boost 4 wk later.
At the end of the experiment, the animals were killed by exsanguination. All animal experiments were carried out according to United Kingdom Home Office guidelines.
Immunoassays
MaxisorpC plates were coated at 4 C overnight with recombinant hCG (Sigma), hLH purified from pituitary (a kind gift from Dr. A. F. Parlow, Harbor-UCLA Medical Center, Torrance, CA), and Bac-hCGß and Bac-hCGß-R68E purified as described (7), at 1.0 µg/ml with 50 µl/well in 0.05 M carbonate-bicarbonate buffer, pH 9.6 (CBB). The plates were washed three times in PBS containing 0.05% Tween 20 (PBS-T), followed by blocking with 2% dried skimmed milk powder in CBB overnight at 4 C. After washing three times with PBS-T, 50 µl serum (from the immunized or nonimmunized mice) diluted 100 times in PBS-T was added and incubated for 2 h at 37 C. The plates were washed three times with PBS-T before goat antimouse IgG alkaline phosphatase-conjugated polyclonal antibodies (Sigma) were added for 2 h at 37 C. The substrate p-nitrophenylphosphate in CBB containing 2 mM MgCl2 was added, for 15 min, and the plates were read at A405 using an MR5000 ELISA plate reader (Dynatech Laboratories Ltd., Billinghurst, Sussex, UK).
Production and Purification of Baculovirus-Produced hCGß
The construction of pBac2-hCGß-WT and pBac2-hCGß-R68E encoding wild-type hCGß (Bac-hCGß-WT) and mutant hCGß-R68E (Bac-hCGß-R68E) and their viruses has been described previously (7). Briefly, Bac-hCGß-WT and Bac-hCGß-R68E were both extended at the carboxy terminus with a His6-tag that can be used to capture the proteins on the sensor chip by chelating to nickel ions. The recombinant proteins were purified as previously reported (7). The media from virus-infected High Five cultures infected at a multiplicity of infection of 10 were harvested by centrifugation at 24, 48, and 72 h post infection and analyzed by PAGE and Western blotting. The concentrations of the recombinant proteins in the supernatants harvested 72 h post infection were determined using an ELISA and rabbit polyclonal serum directed against the hCGßCTP (kindly provided by Dr. Vernon C. Stevens, Ohio State University, Columbus, OH). The concentrations of Bac-hCGß-WT and Bac-hCGß-R68E supernatants were 12 µg/ml and 23 µg/ml, respectively, based on a comparison with hCGß (Zymed Laboratories, Inc., South San Francisco, CA). To determine whether the ß-subunits were aggregated in the supernatant, the nondenatured proteins were analyzed by size exclusion chromatography using the SMART system (Amersham Pharmacia Biotechnology Ltd., Little Chalfont, Buckinghamshire, UK). Baculovirus supernatants (50 µl) were separated on a Sepharose 12 PC 3.2/30 column (bed volume of 2.3 ml) (Amersham Pharmacia Biotechnology Ltd.) at a speed of 50 µl/min. Twenty fractions of 50 µl were collected, and 10% SDS-PAGE and Western blotting using an hCGßCTP-specific rabbit polyclonal serum were used to determine the presence of recombinant protein in the fractions. The molecular weight of the hCGß subunits was assessed using a High and a Low Molecular Weight Calibration kit (Amersham Pharmacia Biotechnology Ltd.) containing catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa), ovalbumin (43 kDa), chymotrypsinogen A (25 kDa), and ribonuclease (13.7 kDa).
Antibodies
The INN-2 mAb (ß1), INN-22 mAb (ß2), INN-58 mAb (ß5), INN-64 mAb (ß6), and INN-68 mAb (ß7) (12) were HPLC-purified IgG1. Fab fragments of the mAbs were generated using the Pierce Immunopure Fab kit following the manufacturers instructions (Pierce Chemical Co., Cheshire, UK). The mouse IgGs were digested by immobilized papain for 5 h before the Fc fragment, together with undigested Igs, was removed by passage over a Protein A column. The composition of the Fab fractions was examined using SMART size exclusion chromatography as described above, PAGE, and Western blotting. The concentration of each Fab/antibody solution was determined using the Bradford protein assay following the manufacturers instructions (Bradford assay protein quantification kit; Pierce Chemical Co.).
Surface Plasmon Resonance
Antigen/antibody complex formation was recorded using a Biacore X biosensor (Biacore, Uppsala, Sweden) and analyzed using the BIAevaluation 2.1 software. All solutions were prepared in HEPES-buffered saline (HBS) at pH 7.5 and passed through the flow cell at a speed of 20 µl/min. The His6-tagged recombinant hCGß proteins, as well as all the Fab fragments, were extensively dialyzed against HBS, pH 7.5, before use. Each binding cycle was composed of four events. First, the nitrilotriacetic acid chip was cleaned using 20 µl of 10% sodium dodecyl sulfate followed by 20 µl of 0.1M NaOH. Second, 20 µl of 25 mM NiCl was passed through the flow cell, resulting in an increase of 80 resonance units (RU) due to the noncovalent binding of the nickel ions. Third, 50 µl of the dialyzed baculovirus-derived protein was injected at a concentration selected to give an increase of 500 RU. Finally, 50 µl of a solution containing the appropriately diluted Fab fragments was injected into the flow cell. Once the antibody had passed the surface, the formed complex was washed with HBS at pH 7.5 for an additional 1000 sec to dissociate bound antibody. A minimum of 15 sensorgrams was used for the determination of the association and dissociation constants of each antigen/Fab pair. To obtain an accurate calculation of the kinetic constants, triplicate sensorgrams of five different concentrations for each Fab fragment were obtained. INN-2 was used at concentrations varying between 8.76 x 107 M and 8.76 x 108 M; INN-22 was used at range between 11.67 x 107 M and 1.167 x 107 M; the concentrations of INN-58 Fab varied between 19 x 107 M and 1.58 x 107 M; only five concentrations of INN-64 Fab (8.84 x 107 M to 1.77 x 107 M) were necessary to establish the association and dissociation rates for the binding of this antibody to Bac-hCGß-WT; and INN-68 was used at concentrations ranging between 11.2 x 107 M and 2.24 x 107 M. All experiments were performed at 25 C. Both the association and dissociation curves were recorded. Before each analysis, the slow release of the His6-tagged protein was recorded and subtracted from the sensorgrams showing the binding characteristics of the antibodies. The sensorgrams were finally normalized and overlaid before analysis in a 1:1 Langmuir model using the BIAevaluation 2.1 program. This program uses nonlinear regression analysis for the determination of rate binding constants for macromolecular interactions.
 |
ACKNOWLEDGMENTS
|
---|
We thank Inger Bjørndal for skilful technical support. We are grateful to Dr. Jacob Mathiesen for valuable advice and help with electroporation.
 |
FOOTNOTES
|
---|
This work was supported by The Wellcome Trust and The Cleveland General and Immunological Trust.
First Published Online February 17, 2005
1 M.C.-D. and N.T. contributed equally to this work. 
Abbreviations: CBB, Carbonate-bicarbonate buffer; CTP, C-terminal peptide; HBS, HEPES-buffered saline; hCG, human chorionic gonadotropin; mAb, monoclonal antibody; PBS-T, PBS containing 0.05% Tween 20; RU, resonance unit.
Received for publication March 16, 2004.
Accepted for publication February 9, 2005.
 |
REFERENCES
|
---|
- Hearn JP, Gidley-Baird AA, Hodges JK, Summers PM, Webley GE 1988 Embryonic signals during the peri-implantation period in primates. J Reprod Fertil Suppl 36:4958[Medline]
- Talwar GP, Singh O, Pal R, Chatterjee M, Sahai P, Dhall K, Kaur J, Das SK, Suri S, Buckshee K, Saraya L, Saxena BN 1994 A vaccine that prevents pregnancy in women. Proc Natl Acad Sci USA 91:85328536[Abstract/Free Full Text]
- Talwar GP, Singh OM, Gupta SK, Hasnain SE, Pal R, Majumbar SS, Vrati S, Mukhopadhay A, Srinivasan J, Deshmukh U, Gonga S, Mandokhot A, Gupta A 1997 The HSD-hCG vaccine prevents pregnancy in women: feasibility study of a reversible safe contraceptive vaccine. Am J Reprod Immunol 37:153161[Medline]
- Talwar GP 1999 Vaccines and passive immunological approaches for the control of fertility and hormone-dependent cancers. Immunol Rev 171:173192[Medline]
- Stevens VC 1999 Antifertility vaccine. In: Perlmann P, Wigzell H, eds. Handbook of experimental pharmacology. New York: Springer-Verlag; 443461
- Jackson AM, Klonisch T, Lapthorn AJ, Berger P, Isaacs NW, Delves PJ, Lund T, Roitt IM 1996 Identification and selective destruction of shared epitopes in human chorionic gonadotropin ß subunit. J Reprod Immunol 31:2136[CrossRef][Medline]
- Chiesa MD, Martensen PM, Simmons C, Porakishvili N, Justesen J, Dougan G, Roitt IM, Delves PJ, Lund T 2001 Refocusing of B-cell responses following a single amino acid substitution in an antigen. Immunology 103:172178[CrossRef][Medline]
- Porakishvili N, Chiesa MD, Chikadze N, Martenson P, Justesen J, Lund T, Delves PJ, Roitt IM 2002 Elimination of luteinizing hormone cross-reactive epitopes from human chorionic gonadotropin. Vaccine 20:20532059[CrossRef][Medline]
- Lapthorn AJ, Harris DC, Littlejohn A, Lustbader JW, Canfield RE, Machin KJ, Morgan FJ, Isaacs NW 1994 Crystal structure of human chorionic gonadotropin. Nature 369:455461[CrossRef][Medline]
- Laylor R, Porakishvili N, De Souza JB, Playfair JH, Delves PJ, Lund T 1999 DNA vaccination favours memory rather than effector B cell responses. Clin Exp Immunol 117:106112[CrossRef][Medline]
- Berger P, Panmoung W, Khaschabi D, Mayregger B, Wick G 1988 Antigenic features of human follicle stimulating hormone delineated by monoclonal antibodies and construction of an immunoradiometric assay. Endocrinology 123:23512359[Abstract]
- Berger P, Klieber R, Panmoung W, Madersbacher S, Wolf H, Wick G 1990 Monoclonal antibodies against the free subunits of human chorionic gonadotropin. J Endocrinol 125:301309[Abstract]
- Charrel-Dennis M, Jackson AM, Lund T, Lapthorn AJ, Berger P, Roitt IM, Delves PJ 2004 The major hormone-specific discontinuous epitopes on human chorionic gonadotropin. J Mol Endocrinol 32:571581[Abstract/Free Full Text]
- Berger P, Kofler R, Wick G 1984 Monoclonal antibodies against human chorionic gonadotropin (hCG). II. Affinity and ability to neutralize the biological activity of hCG. Am J Reprod Immunol 5:157160[Medline]
- Berger P, Sturgeon C, Bidart JM, Paus E, Gerth R, Niang M, Bristow A, Birken S, Stenman UH 2002 The ISOBM TD-7 Workshop on hCG and related molecules. Towards user-oriented standardization of pregnancy and tumor diagnosis: assignment of epitopes to the three-dimensional structure of diagnostically and commercially relevant monoclonal antibodies directed against human chorionic gonadotropin and derivatives. Tumour Biol 23:138[CrossRef][Medline]
- Lund T, Delves PJ 1998 Immunological analysis of epitopes on hCG. Rev Reprod 3:7176[Abstract/Free Full Text]
- Ross TM, Xu Y, Bright RA, Robinson HL 2000 C3d enhancement of antibodies to hemagglutinin accelerates protection against influenza virus challenge. Nat Immunol 1:127131[CrossRef][Medline]
- Mathiesen I 1999 Electropermeabilisation of skeletal muscle enhances gene transfer in vivo. Gene Ther 6:508514[CrossRef][Medline]