Cytochrome P450RAI(CYP26) Promoter: A Distinct Composite Retinoic Acid Response Element Underlies the Complex Regulation of Retinoic Acid Metabolism
Olivier Loudig,
Charolyn Babichuk,
Jay White,
Suzan Abu-Abed,
Chris Mueller and
Martin Petkovich
Cancer Research Laboratories (O.L., C.B., J.W., S.A.-A., C.M.,
M.P.) Departments of Biochemistry (O.L., C.M., M.P.) and Pathology
(J.W., S.A.-A., C.M., M.P.) Queens University Kingston,
Ontario, Canada K7L 3N6
 |
ABSTRACT
|
---|
The catabolism of retinoic acid (RA) is an
essential mechanism for restricting the exposure of specific tissues
and cells to RA. We recently reported the identification of a
RA-inducible cytochrome P450 [P450RAI(CYP26)], in zebrafish, mouse,
and human, which was shown to be responsible for RA catabolism. P450RAI
exhibits a complex spatiotemporal pattern of expression during
development and is highly inducible by exogenous RA treatment in
certain tissues and cell lines. Sequence analysis of the proximal
upstream region of the P450RAI promoter revealed a high degree of
conservation between zebrafish, mouse, and human. This region of the
promoter contains a canonical retinoic acid response element
(5'-AGTTCA-(n)5-AGTTCA-3'), embedded within a
32-bp region (designated R1), which is conserved among all three
species. Electrophoretic mobility shift assays using this element
demonstrated the specific binding of murine retinoic acid receptor-
(RAR
) and retinoid X receptor-
(RXR
) proteins. Transient
transfection experiments with the mouse P450RAI promoter fused to a
luciferase reporter gene showed transcriptional activation in the
presence of RA in HeLa, Cos-1, and F9 wild-type cells. This activation,
as well as basal promoter activity, was abolished upon mutation of the
RARE. Deletion and mutational analyses of the P450RAI promoter, as well
as DNase I footprinting studies, revealed potential binding sites for
several other proteins in conserved regions of the promoter. Also, two
conserved 5'-TAAT-3' sequences flanking the RARE were investigated for
their potential importance in P450RAI promoter activity. Moreover,
these studies revealed an essential requirement for a G-rich element
(designated GGRE), located just upstream of the RARE, for RA
inducibility. This element was demonstrated to form complexes with Sp1
and Sp3 using nuclear extracts from either murine F9 or P19 cells.
Together, these results indicate that the P450RAI-RARE is atypical in
that conserved flanking sequences may play a very important role in
regulating RA inducibility and expression of P450RAI(CYP26).
 |
INTRODUCTION
|
---|
Retinoic Acid (RA), the principal active metabolite of vitamin A,
is an essential regulator of pattern formation during embryonic
development and is necessary for the maintenance of epithelial tissues
in the adult (1, 2, 3). The activity of RA is determined by several
parameters including those that influence receptor activity and those
that govern ligand availability. In this regard, the effects of RA on
gene expression are principally mediated by two families of retinoid
nuclear receptors comprised of three subtypes each; retinoic acid
receptors (RARs
, ß, and
) and, retinoid X receptors (RXRs
,
ß, and
) (4). RARs and RXRs commonly participate together, in the
form of heterodimers, to regulate transcription (5, 6). Most tissues,
especially during embryonic development, express one or more of the RAR
and RXR subtypes in various combinations possibly giving rise to
different responses to RA (7, 8).
Retinoic acid response elements (RAREs) exist in various forms and can
also influence receptor activity. Typically, a RARE is comprised of two
direct repeats of the motif, 5'-PuGTTCA-3' separated by a 5-bp
spacer; however, various other polymorphic forms of RAREs have
been characterized, having 1- or 2-bp spacers. Several studies suggest
that specific forms of RAREs may preferentially bind different
heterodimeric RAR/RXR pairs (9).
The active forms of RA include all-trans RA, and
9-cis RA stereoisomers, which are ligands for these
receptors; RARs are activated by both isoforms while RXRs appear to be
activated exclusively by 9-cis RA. It is not clear at
present how interconversion between the two forms is controlled;
however, the balance of all-trans RA and 9-cis RA
may be important for RA activity. The distribution of RA is also a
critical determinant in the regulation of RA responsive genes,
especially in developing tissues. There is growing evidence that tight
spatial and temporal control of RA synthesis and catabolism are
important in establishing regional distribution patterns of RA
(10, 11, 12, 13, 14).
Control of RA tissue distribution is thought to be established by the
balanced expression of RA synthesizing and RA catabolizing enzymes.
Several retinaldehyde dehydrogenases have already been implicated in
the irreversible conversion of retinaldehyde to the active RA (10, 11).
Retinaldehyde dehydrogenase type 2 (RALDH-2) is thought to be a key
enzyme in localized production of RA during embryogenesis since it
exhibits an expression pattern consistent with that of a
retinoid-responsive LacZ reporter transgene. Moreover, RALDH-2 knockout
mice have severe developmental defects and die at midgestation;
however, knockout embryos are rescued when the mother is treated with
RA (12, 13, 14).
The metabolism of RA is initiated by hydroxylation (15) mediated by
cytochrome P450 activity, as judged by the ability of broad spectrum
P450 inhibitors such as ketoconazole and liarozole to block
4-hydroxylation (16, 17, 18, 19, 20). In certain tissues, including testis, skin,
and lung and in numerous cell lines, such as NIH3T3 fibroblasts, HL60
myelomonocytic leukemic cells, F9 and P19 murine embryonal carcinoma
cells, MCF7 human breast cancer cells, and HeLa human cervix cancer
cells, RA metabolism can be induced by RA treatment (20, 21, 22, 23).
P450RAI(CYP26) is a cytochrome P450 enzyme that specifically
metabolizes RA and is likely responsible for much of the RA-inducible
RA metabolism observed. P450RAI was first isolated from zebrafish as a
gene product induced by RA during regeneration of adult caudal fin
(24). Subsequently, homologs have been isolated from human (25), mouse
(26), chick (27), and Xenopus (28) with all the genes
exhibiting a high degree of sequence conservation. P450RAI metabolizes
all-trans RA but not the 9-cis or
13-cis RA isomers (24, 29, 30, 31, 32, 33, 34). Previous studies
demonstrated that P450RAI expression is strongly induced by RA in early
mouse and Xenopus embryos as well as in a number of normal
and tumor cell lines. Several studies have examined the spatiotemporal
expression of P450RAI during embryonic development (28, 35, 36, 37, 38).
Primary sites of P450RAI expression in mouse include neural folds
before neural tube closure, and caudal neural epithelium, although most
tissues at various stages of morphogenesis transiently express P450RAI
(35, 36, 37). Studies in mouse and Xenopus have shown that
P450RAI expression generates domains restricting RA exposure (36, 38),
possibly resulting in differential rates or timing of differentiation.
In several cases it would appear that P450RAI and RALDH-2 expression
are complementary, possibly forming boundaries defined by graded
retinoic acid distribution between RA synthesizing regions and RA
degrading regions (28, 38).
The focus of our work, guided by the sequence conservation between
human, mouse, and zebrafish in the upstream proximal promoter, was to
characterize elements necessary for RA induction and regulation. We
show that a conserved RARE and a Sp1/Sp3 binding site are essential for
the RA-regulated induction of P450RAI (39, 40, 41, 42).
 |
RESULTS
|
---|
Human, Mouse, and Zebrafish Promoter Alignment
Sequences of genomic P450RAI clones isolated from human, mouse,
and zebrafish were aligned using GeneWorks 2.0. This analysis
revealed extensive conservation in the intron/exon boundaries as well
as striking regions of conservation in the 5'-flanking region (25, 42).
A particularly high degree of homology was observed between mouse and
human promoter sequences with distinct motifs conserved among all three
species (Fig. 1A
). Of particular note,
each promoter contains a direct repeat of the sequence TGAACT separated
by five spacer nucleotides characteristic of a canonical retinoic acid
response element (RARE-DR5). This DR5 is embedded within a 32-bp region
that, with the exception of one nucleotide, is perfectly conserved
between zebrafish, mouse, and human (designated R1). The P450RAI-RAREs
were then aligned with different known RAREs (Fig. 1B
). It is
interesting to note the similarity between P450RAI-RAREs,
RARß2-RAREs, and Hoxa-1-RAREs, in particular with respect to the
spacer nucleotides. The significance of this conservation is not yet
known. In the mouse promoter, 39 bp downstream of this R1 region, is a
putative TATA box (represented as a TATAA motif in all three species)
which is upstream of the transcription start site, previously
identified by S1 nuclease mapping (32). While other regions of the
P450RAI promoter are less well conserved, several smaller GC-rich
elements can be identified upstream of this R1 region. The closest
upstream region is a guanine-guanine-rich element (designated GGRE)
perfectly conserved in mouse and human sequences, with the exception of
one nucleotide for the zebrafish sequence. This G-rich element in the
zebrafish (GGGCGG) can be identified as a putative Sp1 recognition site
(Fig. 1A
) (43).

View larger version (58K):
[in this window]
[in a new window]
|
Figure 1. Comparison of the Human, Mouse, and Zebrafish
P450RAI (CYP26) Proximal Upstream Promoter and Their Retinoic Acid
Response Elements
A, The starting ATG codon (M for methionine), the putative TATA box,
the R1 region, and the G-rich element (GGRE) are boxed.
The consensus sequence of the RARs are included in the R1 region,
marked by two arrows, indicating their orientation and
shadowed in gray to show their
conservation between the three species. Bars between
human, mouse, and zebrafish sequences indicate identity, 87% for human
and mouse, and 51% for mouse and zebrafish. B, RAREs (DR5) from other
promoters (gene and organism described) were aligned with the
P450RAI-RAREs. All the direct repeats are boxed, and the
sequence homology is shown in light gray. The
dark gray areas show the homology in the surrounding
nucleotides.
|
|
Characterization of a Retinoic Acid Response Element (RARE) in the
P450RAI Promoter
To demonstrate that the putative RARE in the P450RAI promoter is a
target for retinoic acid receptors and to confirm our previous findings
implicating the involvement of RAR
and RXR
(26), we performed
bandshift experiments with in vitro transcribed and
translated mouse RAR
and RXR
proteins. Oligonucleotides (Fig. 2A
) corresponding to the R1 wild-type
(WT) and mutated (MT) region that contains the P450RAI-RARE were
analyzed in gel mobility shift assays (Fig. 2B
). No
protein/oligonucleotide complexes are observed in the lysate control
lane (lane 1) and the presence of individual RAR
or RXR
proteins
is insufficient to produce a shift in mobility (lanes 13). The
addition of both RAR
and RXR
proteins in combination produced a
strong complex characteristic of a typical RARE (lane 4). Conversely,
mutations in the RARE half-sites (lanes 58) ablated the formation of
this complex in the presence of both in vitro translated
RAR
and RXR
proteins.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 2. Determination of the Migration Pattern of R1-RARE
with in Vitro Translated RAR and RXR , and Nuclear
Extracts
A, The oligonucleotides used in these experiments are shown, and the
mutation performed in the direct repeats (in light gray)
of the R1-RARE are marked by asterisks. B, Migration of
the R1-WT and R1-MT was performed on a 6% nondenaturing polyacrylamide
gel (PAGE), without, with one, or with both RAR and RXR
nuclear receptors. C, The experiments using the nuclear extracts of P19
teratocarcinomal, F9 wild-type, and F9 RAR -/-
RXR -/- cells were performed on a 6% nondenaturing
PAGE. Different complexes (C1-C4) are distinguishable on the gel and
are shown by arrows. The RXR supershifts are indicated
on the top right of the F9 wild-type and P19 panels.
|
|
Similar R1 oligonucleotides were tested using crude nuclear extracts
from P19, F9 wild-type teratocarcinoma cells and F9 cells in which the
RAR
and RXR
genes had been ablated by homologous recombination
(Fig. 2C
). A specific complex (C2) was observed to bind the R1-RARE in
extracts from F9 wild-type cells (lanes 3 and 5) but not from F9
RAR
-/- RXR
-/-
double knockout cells (lane 7). This complex was not present with
oligonucleotides carrying two different mutations in the RARE half-
sites (MT and MT2; data not shown). Supershift experiments using an
anti-RXR antibody demonstrated that the C2 complex was selectively
supershifted, confirming that RXR was part of the R1 binding complex.
We also observed several other complexes (C1, C3, and C4) formed with
this R1 oligonucleotide; however, as yet we do not know the identity of
these other components. Together, these results show that the R1-RARE
is a target for retinoic receptors in various cell types and that it is
specific for the RAR/RXR heterodimer.
Transcriptional Activity of the Proximal Region of the P450RAI
Promoter
To investigate the transcriptional activity of the mouse P450RAI
promoter and the putative RARE activity, we used cotransfection assays.
The mouse P450RAI-RARE and its flanking sequences were mutated as shown
in Fig. 3A
. A 256-bp fragment of the
wild-type or mutated mouse P450RAI promoter was amplified and subcloned
into a pGL3 basic luciferase reporter vector (Fig. 3A
). Cells were
transfected with the wild-type promoter construct (P450RAI-WT) along
with various amounts of expression vectors for mouse RAR
and RXR
,
encoding receptors previously shown to be necessary for P450RAI
induction by RA (26). Depending on the amount of both RAR
and RXR
receptors added, the transcriptional activity of P450RAI-WT promoter
increased. These analyses allowed for the optimization of the amount of
receptors required (0.2 µg of RAR
and 0.2 µg of RXR
). Using
these promoter constructs we compared proximal promoter activities in
the F9 wild-type and F9 RAR
-/-
RXR
-/- double knockout cell lines. When the
P450RAI promoter was transfected alone into F9 wild-type cells,
addition of 10-6 M
all-trans RA resulted in a 2-fold marked increase in
transcriptional activity (See Fig. 3B
, P450RAI-WT, left
panel). While some inducible promoter activity can be measured in
the F9 mutant cell line, the absolute levels of activity are much lower
(Fig. 3B
, P450RAI-WT, right panel). By comparison, both
wild-type and mutant F9 cell lines support similar levels of
transcriptional activity, when the promoter construct was cotransfected
with expression plasmids for RAR
and RXR
(Fig. 3B
, P450RAI-WT,
compare left and right panels). Similarly,
mutations in the R1-RARE abolish RA-inducible activity, and
cotransfection of both RAR
and RXR
does not compensate for this
lost activity (Fig. 3B
, P450RAI-RARE-mut, left and
right panels). Also, transfection of the wild-type promoter
construct (P450RAI-WT) in the presence of RA, in Cos-1 and HeLa cells,
shows a 3-fold increase in activity in comparison with the nontreated
cells (Fig. 3C
, Cos-1 and HeLa). Addition of RAR
and RXR
to the
transfection mix increased the transcriptional activity by 2-fold
without RA, likely due to residual RA activity in the culture media. In
the presence of both receptors and 10-6 M
all-trans RA, the transcriptional activity increased by
4-fold in HeLa and 5-fold in Cos-1. The putative RARE located in the R1
region was mutated, to the MT sequence (Fig. 3C
,
P450RAI-RARE-mut). Transient transfection analyses of P450RAI-RARE-mut
revealed a complete ablation of the retinoic acid response, in the
absence or in the presence of receptors (Fig. 3C
). This complete loss
of retinoic acid induction indicated that the mutation of the direct
repeat located in R1 ablated the functional activity of this
P450RAI-RARE.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 3. Transcriptional Analysis of P450RAI-RARE
A, The sequence of the mouse R1 region is enlarged and
the conserved motifs are boxed, named 5'-TAAT, RARE
(DR5) and 3'-TAAT, respectively, and their orientation is defined by
the arrows. The P450RAI-mutant construct motifs are
boxed, and the mutations are shown in light
gray. B, Transient transfection analyses were performed on F9
wild-type and F9 RAR -/- RXR -/- cells,
using the P450RAI-WT and P450RAI-RARE-mut constructs described above.
C, Transient transfection analyses were also performed in HeLa and
Cos-1 cells. All transient transfection experiments were normalized
with the reporter plasmid containing the renilla
luciferase gene and performed in triplicate; error bars
indicate the SD.
|
|
Analysis of TAAT Motif Contributions to P450RAI Transcriptional
Activity
The striking degree of conservation around the R1-RARE prompted us
to examine the contribution of flanking regions for their influence on
the transcriptional activity of this RARE. Inspection of the RARE
flanking sequences revealed that the 5'- and the 3'-regions were
similar in that they contain conserved 5'-TAAT-3' elements (Fig. 3A
).
This characteristic element has previously been demonstrated to form
the core recognition element for homeobox proteins in other promoters
(45, 46, 47). Interestingly, introducing a change from 5'-TAAT-3' (or
"ATTA" on the upper coding strand) to a 5'-TACT-3' (Fig. 3A
, P450RAI-5'-TAAT-mut) resulted in a dramatic drop in basal
transcriptional activity, as well as a loss of 90% of the RA response
upon mutation of the 5'-motif (Fig. 3C
, P450RAI-5'-TAAT-mut, Cos-1 and
HeLa). This would suggest that the conserved 5'-TAAT-3' motif in 5' of
the RARE has a positive influence on the RARE activity. In contrast,
introducing the same change in the 3'-motif (Fig. 3A
, P450RAI-3'-TAAT-mut), resulted in an enhanced RA response in the case
of HeLa cells transient transfections, approximately 2-fold in the
presence of RA, with or without added receptors (Fig. 3C
, P450RAI-3'-TAAT-mut, HeLa). No significant change in reporter gene
activity in comparison with the wild-type promoter was observed in the
case of Cos-1 cell transient transfections (Fig. 3C
, P450RAI-3'-TAAT-mut, Cos-1). These results suggest that there may be
cell-specific factors influencing P450RAI transcription through the R1
region.
Determination of Protein/DNA Interactions by DNase I Footprinting
Analysis
To visualize protein/DNA contacts around the RARE and the rest of
the proximal P450RAI promoter, we performed in vitro DNase I
footprinting analyses. We used murine liver extracts for this study
since P450RAI was expressed and could be up-regulated by RA treatment
(32). Total RNA was extracted from liver tissue obtained from mice
treated for 2, 8, and 24 h with 100 mg/kg all-trans
retinoic acid and analyzed by Northern blotting. We observed that the
P450RAI transcript was expressed at low levels even in untreated
animals (Fig. 4A
, lane 4) and was
strongly induced by exposure to exogenous RA (lane
13). Fig 4B
shows the DNase I
footprint experiment with increasing concentrations of liver nuclear
extracts with the P450RAI coding strand encompassing sequences between
-170 and -80. Liver extracts from untreated mice were used since no
significant differences in footprint patterns were observed in liver
extracts from RA-treated and untreated mice (data not shown). Two major
areas of protection from DNase I were evident even at low protein
extract concentrations. One region of protection was coincident with
the RAR/RXR protein complex binding site between -120 and -95. A
second strong area of protection was observed upstream of the R1
element between -156 and -137, surrounding the annotated GGRE. Areas
of DNase I hypersensitivity (indicated by arrows) flank both
of these protected regions. Figure 4C
shows the DNase I footprints
obtained for both the coding and the noncoding strands of P450RAI from
-238 to -60. An additional but less distinct area of protection was
observed between -81 and -70 and several areas of hypersensitivity
were evident in the proximal promoter region. At present, we do not
know the nature of the factors influencing DNase I sensitivity at these
sites. Interestingly, areas of protection and hypersensitivity are
consistent for both the coding and the noncoding strands (Fig. 4C
, both
panels). Results for both strands are summarized in Fig. 4D
.

View larger version (65K):
[in this window]
[in a new window]
|
Figure 4. Mouse P450RAI Promoter Expression and Protein
Binding Pattern with Liver Nuclear Extracts
A, Northern blot analysis with liver extracts from mice treated
(lanes 13) or untreated (lane 4) with RA. Location of the mouse
P450RAI mRNA is indicated on the gel by the arrow,
control gene 36B4 (26 ). B, End-labeled P450RAI promoter fragments
(coding strand) were incubated with increasing amounts of liver
extracts (lanes 3 and 8) and digested with increasing amounts of DNase
I. The cleavage products of naked DNA with various concentrations of
DNase I are shown (lanes 1, 2, and 9). Hypersensitive regions are
marked with arrows. C, End-labeled P450RAI promoter
fragments (coding and noncoding strands) were incubated with 60 µg
(lanes 4 and 9) or 90 µg (lanes 5 and 10) of liver extracts and
digested with DNase I. The cleavage products of naked DNA (lanes 3 and
8) and G+A and C+T Maxam-Gilbert chemical cleavage reactions (lanes 1,
2, 6, and 7) are included. Cleavage products were separated on a 6%, 6
M urea denaturing polyacrylamide gel. Protected regions are
indicted by bars, and hypersensitive regions are marked
by arrows. D, Summary of the footprinting data with the
nucleotide sequence of the mouse P450RAI promoter in its proximal
region. Regions that were protected from DNase I cleavage are indicated
with boxes, and arrows indicate
hypersensitive nucleotides on either strand. A horizontal
arrow indicates the transcription start site. RARE and GGRE
arrows as seen in Fig. 1A .
|
|
An Upstream G-Rich Element Supports RARE Activity
The appearance of a strong DNase I footprint upstream of the R1
element (GGRE) led us to further analyze this region by transient
transfection experiments. When nucleotides from -238 to -137 were
deleted (Fig. 5A
, P450RAI-137), the
activity of the promoter was reduced by 40% (nontreated) to 85% (RA
treated) in HeLa cells when compared with the wild-type promoter
(P450RAI-WT) and was negligible in Cos-1 and F9 wild-type cells (Fig. 5B
). Interestingly, the P450RAI-137 construct, when cotransfected with
both retinoic acid receptors RAR
and RXR
, in the presence of RA,
did not give rise to RA inducibility. An extended construct
encompassing the GGRE (Fig. 5A
, P450RAI-163) restored the RA
inducibility of the promoter and approximately 25% (nontreated) to
50% (RA treated) of the transcriptional activity of the wild-type
promoter (P450RAI-WT) in all three cell lines (Fig. 5B
, HeLa, Cos-1,
and F9WT). All constructs containing both the GGRE and the RARE had
similar levels of inducibility by RA treatment although absolute levels
of luciferase activity were different (Fig. 5B
, HeLa, Cos-1, and F9WT).
Inclusion of the sequences between -238 and -163 further increased
the activity of the promoter, demonstrating the requirement of upstream
regions for the full restoration of the activity of the promoter. These
results suggest that the RA response mediated through the P450RAI-RARE
is dependent on direct or indirect interactions with upstream
sequences, which include the GGRE.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 5. Transcriptional Activity of the R1-RARE in the
Presence or Absence of the G-Rich Element
A, The first construct (P450RAI-WT) represents the wild-type proximal
promoter. Two different constructs either missing or containing the
GGRE are labeled P450RAI-137 and P450RAI-163, respectively. B, The
different constructs including the empty vector (pGL3B) were
transfected in the absence or presence of receptors (0.2 µg of RAR
and 0.2 µg of RXR ), in HeLa, Cos-1, and F9 wild-type cells, with
either DMSO or RA/DMSO treatment. Experiments were performed in
triplicate, and error bars indicate the SD.
|
|
Sp1/Sp3 Transcription Factors Interact with the GGRE Element
in Vitro
The DNase I footprint analyses and the transient transfection data
suggest that the GGRE is an important regulator of the P450RAI promoter
activity. Gel mobility shift assays were performed using probes
encompassing the nucleotides -163 to -137, named GGRE-WT for the
wild-type and GGRE-MT for the mutated form (Fig. 6A
),
with nuclear extracts from the murine F9 (Fig. 6B
) and P19 (Fig. 6C
)
teratocarcinoma cell lines. Two strong complexes (Fig. 6A
and 6B
,
complexes A and B) were observed in both cell lines. The G-rich nature
of this element and the configuration of the complexes formed implied
that this element bound Sp1 and Sp3 proteins. Moreover, very similar
complexes were observed using the same extracts, with oligonucleotides
containing a Sp1 consensus site (Fig. 6A
). To determine whether Sp1/Sp3
proteins were involved, Sp1 and Sp3 affinity-purified polyclonal
antibodies were used in supershift assays. Anti-Sp1-specific antibodies
reduced the appearance of complex A and a supershift was observed (Fig. 6
, B and C, see Sp1 supershift) with both CSp1 (compare lanes 5 and 8)
and GGRE-WT (compare lanes 6 and 9) oligonucleotides. Complex B (Fig. 6
, B and C) remained unchanged. Conversely, the anti-Sp3 antibodies
essentially eliminated complex B and formed a supershift in the case of
both probes (CSp1 and GCRE) using either F9 or P19 nuclear extracts. To
localize the binding site of both Sp1 and Sp3 on GGRE-WT, we generated
a mutation in the core guanine-rich region, from GGGGGG (-154 to
-149) to GCATCG (Fig. 6A
). By mutating the guanine-rich region, we
totally ablated Sp1/Sp3 complex formation (Fig. 6
, B and 6C; lane 15),
as expected. A third complex (complex C), however, was not sensitive to
the mutation in the GGRE. Together, these results indicate that Sp1/Sp3
proteins are able to complex with the GGRE region, in the guanine-rich
region, and participate in the retinoic acid response by interacting
directly or indirectly with proteins binding to the R1-RARE.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 6. Analysis and Determination of
Putative Transcription Factors Binding to the GGRE
A, Set of oligonucleotides used. The guanine-rich region is boxed in
both GGRE-WT and GGRE-MT. Mutations in the GGRE-MT oligonucleotide are
shadowed in light gray and localized by
asterisks. B, Gel mobility shift assays were performed
using radiolabeled oligonucleotides with murine F9 nuclear extracts.
Lanes 14 show the incubation of CSp1 and GGRE-WT probes with the
polyclonal antibodies directed against Sp1 or Sp3. Lanes 57
determined the pattern of migration of CSp1, GGRE-WT, and R1-WT probes.
Lanes 810 are the supershift experiments performed in presence of Sp1
polyclonal antibodies. Lanes 1113 are the supershift performed in the
presence of Sp3 antibodies. Lane 14 represents the competition between
radiolabeled 1xGGRE-WT and nonlabeled 10x GGRE-WT. Lane 15 shows the
pattern of the GGRE-MT. The different complexes (A, B, and C) observed
on the gel are indicated by the arrows to the
right of the panel. The Sp1 and Sp3 supershifted probes
are indicated to the left of the panel. C, The same gel
mobility shift assay was performed with murine P19 nuclear extracts.
The presentation of the panel follows the same organization as Fig. 6B .
|
|
 |
DISCUSSION
|
---|
P450RAI is an important regulator of RA distribution during
development. The analysis of its expression in mouse, chick, and
Xenopus embryos revealed complex, stage-specific patterns
possibly reflecting a role for this enzyme in limiting tissue exposure
to RA (28, 35, 36, 37, 38, 48). Moreover, analysis of P450RAI expression in
cultured human cells shows that exogenous RA can strongly induce the
expression of this gene (34). In our present study, we show that at
least some of the RA inducibility of P450RAI is due to regulation at
the transcriptional level, mediated by a highly conserved RARE.
Furthermore, we determined the presence of other response elements,
associated with the P450RAI-RARE, that may be important contributors in
establishing complex stage-specific patterns of P450RAI expression.
Analysis of human, mouse, and zebrafish proximal regions of the P450RAI
promoter allowed us to determine the presence of a canonical RARE
within a conserved 32-bp sequence, which was shown to be recognized by
the RAR
/RXR
heterodimer, consistent with our previous findings
demonstrating that exogenous all-trans RA induction of
P450RAI mRNA in F9 cells is mediated by RAR
and RXR
(26). A
comparison of this P450RAI-RARE with other RAREs such as the murine
RARß2-RARE and Hoxa-1-RARE reveals similarity even within the spacer
nucleotides (Fig. 3B
). Whether this reflects a subtle functional role
for the spacer region remains to be determined. In addition,
transfection experiments with wild-type and mutated promoters confirmed
that the RA inducibility was dependent on the presence of the RARE
motif. The P450RAI promoter was shown to be responsive to RA in HeLa,
Cos-1, and F9 wild-type cells. However, expression of the endogenous
P450RAI gene is not detected in Cos-1 cells treated with RA (data not
shown), indicating that additional elements in the P450RAI promoter,
not included in the constructs used in these experiments, are important
in the regulation of its expression. Because the pattern of expression
of P450RAI during embryogenesis is highly spatiotemporally
regulated, we speculated that homeodomain proteins might be involved in
the control of the transcriptional activity of P450RAI. Interestingly,
this R1 region also contained two conserved 5'-TAAT-3' motifs flanking
the RARE; such motifs are generally found in homeodomain factor DNA
binding sites (45, 46, 47). Both DNase I footprint analyses and transient
transfections suggest the presence of factor(s) binding either the 5'-
or the 3'-conserved TAAT elements. Bandshift assays using 5'- and
3'-TAAT mutants within the R1 region, however, did not reveal obvious
differences in DNA binding patterns (data not shown). The importance of
these elements in the control of P450RAI activity, and whether or not
Hox or related genes interact with this sequence, remains to be
determined.
An unexpected observation in these studies came from the apparent
dependence of the RARE activity on the presence of upstream regulatory
sites, including an Sp1/Sp3 binding site. DNase I footprint analyses
revealed the proximity of both sites, and transient transfections
confirmed the requirement of the Sp1/Sp3 binding site for RA response.
Sp1 activity has been shown previously to be essential for the activity
of adjacent response elements in other promoters. For example,
cooperativity between the sterol-regulatory element and Sp1 was
observed in transcriptional regulation of the low-density lipoprotein
(LDL) receptor gene promoter (49). Similarly, apparent physical
interactions between the estrogen receptor (ER) and Sp1 appear to be
required for the enhanced transactivation of the heat-shock protein 27
(Hsp27) promoter gene (50). Complex interactions between the orphan
nuclear receptor
(ROR
) and Sp1 were also proposed in the
promoter regulation of the murine prosaposin gene (51). Also, multiple
Sp1 sites have been identified adjacent to the RARE in the retinoic
acid receptor
isoform 2 (RAR
2) promoter gene. RAR/Sp1
cotransfection experiments suggest interdependence between Sp1 and
RAR/RXR activities (52). While it would appear that Sp1 and RARs could
participate together in the regulation of several different promoters,
the nature of these interactions remains to be explored.
Murine F9 and P19 cell lines are able to express P450RAI after RA
treatment (26). By using nuclear extracts from these cell lines, we
also identified the binding to the GGRE of Sp3, another transcription
factor member of the C2-H2
zinc-finger family. Mutations in the GGRE ablate the binding of both
Sp1 and Sp3 in gel shift mobility assays. Previous studies have
demonstrated that Sp1 and Sp3 can bind to the same site with comparable
affinity (53). Sp1 and Sp3 have been shown to be bifunctional, acting
either as activators or as repressors (39, 41, 44, 54, 55). Considering
the expression of Sp1 and Sp3, their degree of phosphorylation, and
their potential interaction with other factors, we hypothesize that the
regulation of P450RAI may be modulated by signaling pathways that
directly affect Sp1/Sp3 abundance and activity.
In vivo, there is a strong overlap between the expression of
RALDH-2 and that of a RA reporter gene comprising a RARß-RARE linked
to a ß-galactosidase gene (56) These findings imply that where
RALDH-2 is expressed, free RA is generated to regulate RA responsive
genes such as RARß. Interestingly RALDH-2 and P450RAI domains of
expression are often complementary (27, 38). This suggests that the RA
responsiveness of P450RAI can be controlled by other factors in a
tissue- or a domain-specific manner. Consistent with this, we have
previously shown that certain cell lines do not express P450RAI even in
the presence of RA, while others express P450RAI in an apparent
constitutive manner, possibly indicating the involvement of factors
capable of overriding RA control (31).
In summary, analysis of the mouse P450RAI promoter revealed the
presence of a highly conserved RARE whose activity depends on an
upstream Sp1/Sp3 element. Interestingly, Sp1 is an essential factor for
normal embryogenesis (57). Furthermore, the presence of several
conserved elements including possible homeodomain protein binding sites
may help to explain how the complex spatio-temporal patterns of P450RAI
expression are generated during embryogenesis.
 |
MATERIALS AND METHODS
|
---|
Isolation of the Zebrafish, Mouse, and Human Promoter
Sequences
The zebrafish P450RAI(CYP26) gene was first isolated from a
zebrafish genomic library (30, 42). Mouse genomic clones were isolated
by screening 106 plaques of a mouse genomic
library with the mouse P450RAI cDNA probe (mouse genomic library 129SV,
generously donated by Dr. Janet Rossant). Sequencing of the 5'-region
of the genomic DNA allowed for the identification of the promoter
region. Human genomic clones were obtained from the Canadian Genome
Analysis and Technology Program by screening a P1-artificial chromosome
library with human P450RAI cDNA. Four individual PAC clones (245C7,
48I5, 223I8, and 250L19) encompassing the human P450RAI(CYP26) gene
were characterized. PAC 245C7 was selected for analysis of the
5'-promoter region. Sequence analyses were performed using the
GeneWorks (Intellegenetics, Inc., Mountain View, CA)
software package.
DNA Plasmids
The reporter plasmids contain different segments or mutants of a
minimal upstream region of the mouse P450RAI cloned in the pGL3
luciferase reporter vector (Promega Corp., Madison,
WI).
The P450RAI-WT, -163, and -137 constructs were generated by PCR
amplification (30 cycles) of the upstream region (nucleotides -238 to
+18) of the mouse P450RAI promoter, using the forward primers,
P450RAI-WT, 5'-CCAGATCTGCGCGCTCAGAGGGAAGCCGC-3'; P450RAI-163,
5'-GATCAGAT CTGCGCCTCGAGGGGGGAGGAGCCAGG-3'; P450RAI-137, 5'-GATCAGATCT
GCCCGATCCGCAATTAAAGATGAACTTTGGGTGAACTAATTTGTCTG-3'; and the reverse
primer 5'-GAAAGCTTGGCACGCTTCAGCCTCCCGCG-3'. After digestion of the PCR
products with BglII and HindIII, the fragments
were isolated and ligated into the pGL3 Basic Luciferase reporter
vector (Promega Corp.), digested with the same restriction
enzymes. The mutant promoter constructs were generated by replacing the
ApaI (-139)/HindIII (pGL3B) fragment of the
wild-type reporter plasmid with PCR fragments containing the selected
mutations. The oligonucleotides used to generate these mutations
are the forward primers: P450-RARE-mut,
5'-CAGGGGCCCGATCCGCAATTAAAGAGCTACTTTGGG ACTACTAATTTGTCTG-3';
P450RAI-5'-TAAT-mut, 5'-CAGGGGCCCGATCC
GCAAGTAAAGATGAACTTTGGGTGAACTAATTTGTCTGTTGTCTG-3';
P450RAI-3'-TAAT-mut, 5'-CAGGGGCCCGATCCGCAATTAAAGATGAACTT
TGGGTGAACTACTTTGTCTG; and the same reverse primer indicated above. All
constructs used in transfection experiments were confirmed by
sequencing and purified using cesium chloride gradient
separation.
Cell Culture and Transient Transfection
The human cervical carcinoma cell line HeLa, the
SV40-transformed African green monkey kidney Cos-1 cell line, and the
murine embryonical carcinoma F9 wild-type cells and F9 cells in which
the RAR
and RXR
genes had been ablated by homologous
recombination, were cultured in an atmosphere of 5%
CO2 at 37 C. HeLa and Cos-1 cells were cultured
in MEM, pH 7.3, supplemented with 0.22% sodium hydrogen carbonate,10%
FCS, 0.5% penicillin-streptomycin, 0.1% gentamicin, and 0.1%
fungizone (Life Technologies, Inc., Gaithersburg, MD).
Both F9 cell lines were cultured in DMEM, pH 7.3, supplemented with
0.37% NaHCO3 (sodium hydrogen carbonate), 0.35%
dextrose, 10% FCS, 0.5% penicillin-streptomycin, 0.1% gentamicin,
and 0.1% fungizone (Life Technologies, Inc.).
F9 wild-type and F9 cells in which the RAR
and RXR
genes had been
ablated by homologous recombination were generously donated by Dr.
Pierre Chambon. One day before transfection, F9 wild-type cells and F9
RAR
--/- RXR
-/- double
knockout cells, were split and 12 x 105
cells were seeded in 24-well plates coated with 0.1% gelatin. Cells
were transfected with 2 µg of DNA using the polyethylenimine reagent
(PEI; Aldrich Chemical Co., Inc., Milwaukee, WI). We
incubated 1 µl of PEI (3.5 µg/µl) in 49 µl of sodium chloride
(NaCl) at a concentration of 150 mM, and separately 2 µg
of DNA (1 µg/µl) with 48 µl of NaCl 150 mM, for 5 min
at room temperature. The PEI/NaCl mix was added to the DNA/NaCl mix and
incubated for 15 min at room temperature. Transfections were performed
by addition of the 100 µl mix to 200 µl of freshly replaced medium
for 5 h. Cells were washed with 1xPBS and 500 µl of medium were
added for 19 h. After transfection, cells were treated either with
0.1% of dimethylsulfoxide (DMSO) vehicle or with
10-6 M final all-trans
retinoic acid in DMSO (RA, Sigma, St. Louis, MO) for
24 h, and proteins were extracted using the passive lysis buffer
(Promega Corp.). To normalize the Firefly
luciferase activity, cells were cotransfected with 0.2 µg of pRL-SV40
per well, a vector expressing the Renilla luciferase gene
(Promega Corp.). Cell extract (20 µl) was read using
both dual luciferase reagents (Promega Corp.) in a 96-well
plate in a Berthold Luminometer. All transfections were performed in
triplicate, and experiments were repeated three times.
Twenty four hours before transfection, HeLa and Cos-1 cells were split
and 34 x 105 cells were seeded in each
well of a six-well plate in 2 ml of culture medium. Two hours before
transfection the culture medium was replaced. Transfections of these
two cell lines were performed with the FuGENE transfection reagent,
according to the manufacturers instructions (Roche Molecular Biochemicals, Indianapolis, IN). Twenty four hours after
transfection, cells were treated either with DMSO or with RA. After
24 h of treatment, cells were washed twice in PBS and harvested in
250 µl of passive lysis buffer at 4 C (Promega Corp.).
Reading and normalization of the data were performed as described for
F9 wild-type cells and F9 RAR
-/-
RXR
-/- double knockout cells. All
transfections were performed in triplicate and repeated three
times.
Nuclear Extract Preparation
Nuclear extracts from HeLa cells, Cos-1 cells, F9 wild-type
cells, F9 RAR
-/-
RXR
-/- double knockout cells, and P19 cells
were prepared as described by Leggett et al. (43).
Gel Mobility Shift and Supershift Assays
Gel mobility shift assays corresponding to R1 (see
oligonucleotides R1-WT and R1-MT, Fig. 2
, A and B), and for the
identification of the Sp1 site, were performed as described by
Lichtsteiner et al. (58), except that the binding reactions
were incubated for 15 min on ice before separation on a 6%
nondenaturing polyacrylamide gel. Oligonucleotides used in the
experiments are shown in the corresponding figures. Double-stranded
oligonucleotides (100 ng/µl) were separated from single-stranded
oligonucleotides by electrophoresis on a 15% nondenaturing
polyacrylamide gel. The oligonucleotides corresponding to R1 were end
labeled by T4 polynucleotide kinase using 3 µl of 10 µCi/µl
(
-32P) dATP and purified on a G-50 Sephadex
column. Oligonucleotides corresponding to GGRE (guanine-guanine-rich
element) were annealed and radiolabeled (300 ng) by the fill-in
reaction with Klenow DNA polymerase and
(
-32P) dATP (New England Biolabs, Inc., Beverly, MA). The sequence of the CSp1 oligonucleotide
corresponds to the Sp1-SV40 consensus described by Leggett et
al. (43).
Supershift experiments were carried out using monoclonal RXR (m-
,
ß,
) (59) and purified polyclonal Sp1 (PEP) and Sp3 (D20)-G rabbit
antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz,
CA). For each reaction, 1 µl of antibody anti-RXR and 1.5 µl of
antibody anti-Sp1 and -Sp3 were preincubated with 5 µl of the F9 and
P19 protein extracts in the bandshift binding reaction for 20 min on
ice. Oligonucleotides (200,000 cpm) were added to the reaction and
incubated for 15 min on ice before separation on a nondenaturing 6%,
0.25xTBE polyacrylamide gel.
In Vitro Transcription and Translation
Twenty micrograms of each of the expression plasmids containing
RAR
and RXR
were linearized by digestion at 37 C using the
XhoI restriction enzyme. The DNA was precipitated by
addition of 0.3 volumes of 3 M sodium acetate, pH
7.0, and 2 volumes of ethanol. Pellets were dried and resuspended in 20
µl nuclease free water. The in vitro transcription and
translation were performed using the TNT T7/T3 Coupled Reticulocyte
Lysate System kit (Promega Corp.) according to procedures
suggested by the manufacturer.
Northern Blot Analysis
To determine P450RAI inducibility by RA in mouse liver, C-57
black mice were treated with 100 mg/kg RA in a DMSO/corn-oil carrier
mixture. Control mice were treated with the DMSO/corn-oil carrier
mixture alone. After 2, 8, and 24 h of treatment, mice were killed
by cervical dislocation and livers were immediately excised. Livers
were first snap-frozen in liquid nitrogen and then homogenized in 15 ml
of TRIzol (Life Technologies, Inc.) for 20 min. Samples
were spun down at 6,000 rpm for 20 min at 4 C, and the supernatants
were then used to extract RNA as described by Abu-Abed et
al. (26). Northern blot analyses were also performed using probes
for P450RAI and the control probe 36B4 as described by Abu-Abed
et al. (26).
DNase I Footprint Analysis
Liver tissue nuclear extracts were prepared from 6- to
12-week-old C-57 black mice as described by Sierra et al.
(60). Tissue was homogenized (1.5 g/10 ml) using a machine-driven
Teflon pestle homogenizer in 10 mM HEPES, pH 7.6,
12 mM KCl, 0.15 mM
spermine, 0.5 mM spermidine, 1
mM EDTA, 2.2 M sucrose, 5%
glycerol, 1% skim milk, 0.5 mM dithiothreitol
(DTT), 0.1 mM phenylmethylsulfonyl fluoride
(PMSF), 14 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin
A, and 1 mM benzamidine. The homogenate was
layered onto 10-ml pads of the same buffer (without milk), and the
nuclei were pelleted by centrifugation at 24,000 rpm for 60 min in a
SW-28 rotor. The clean nuclei were resuspended in 10 ml nuclear lysis
buffer (10 mM HEPES, pH 7.6, 100
mM KCl, 0.1 mM EDTA, 10%
glycerol, 3 mM MgCl2, 1
mM DTT, 0.1 mM PMSF, and 14
µg/ml aprotinin). Nuclei were lysed with KCl (0.55
M final) and were centrifuged at 40,000 rpm in a
Ti-50 rotor for 60 min. The supernatant was then transferred to a clean
tube. Solid
(NH4)2SO4
was added to 0.3 g/ml. The mixture was incubated in ice water for 60
min and then centrifuged at 40,000 rpm in a Ti-50 rotor for 20 min. The
pellet was resuspended in nuclear dialysis buffer (25
mM HEPES, pH 7.6, 40 mM
KCl, 0.1 mM EDTA, 10% glycerol, and 1
mM DTT) and dialyzed twice against the same
buffer for 2 h each time. The DNase I footprinting
reactions were performed as described by Sierra et al. (61).
P450RAI promoter fragment were directionally end labeled after
digestion by either AvrII (noncoding strand) or
NcoI (coding strand) and filled-in by Klenow DNA polymerase
(New England Biolabs, Inc.) with dCTP, dGTP, dTTP, and
(
-32P) dATP. The labeled DNA was digested
with second enzymes to generate approximately 300-bp fragments that
spanned the proximal promoter region. The binding reactions (in 40
µl) were performed in footprinting buffer (37.5
mM HEPES, pH 7.6, 54 mM
KCl, 0.05 mM EDTA, 5% glycerol, 5
mM MgCl2, and 0.5
mM DTT) containing 40,000 cpm of probe, 2 µg
poly dI·dC, and between 5 and 90 µg of liver or testes nuclear
extracts or 10 µg BSA for control DNA. The reactions were incubated
on ice for 15 min. Three microliters of DNase I (Roche Molecular Biochemicals, Indianapolis, IN) were added (1:40 to 1:30
dilution of 3.3 mg/ml stock solution), and the reactions were allowed
to digest on ice for 5 min. Five volumes of stop buffer (20
mM Tris-HCl, pH 8.0, 20 mM
EDTA, 250 mM NaCl, 0.5% SDS, 1 mg/ml Proteinase
K, and 0.0025 mg/ml sheared salmon sperm DNA) were added, and the
reactions were incubated at 50 C for 60 min. The DNA was extracted
twice with phenol-chloroform and ethanol precipitated. Chemical
cleavage reactions were performed as described by Sambrook et
al. (62). Products were dissolved in formamide loading buffer,
separated on a denaturing 6 M urea 6%
polyacrylamide gel, and visualized by autoradiography.
 |
ACKNOWLEDGMENTS
|
---|
We thank Dr. Barb Beatty for screening and isolation of the
human PAC clones and Dr. Janet Rossant for the mouse genomic library.
We thank Dr. Pierre Chambon and Dr. Cecile Rochette-Egly for generously
sharing their cell lines and antibodies. Thanks also to Luong Luu,
Glenn Maclean, and Caroline Wood for critical reading and comments on
the manuscript. Thanks also to the Fire Department of the city of
Kingston for saving important experiments.
 |
FOOTNOTES
|
---|
Address requests for reprints to: Dr. Martin Petkovich, Cancer Research Laboratories, Room 355, Botterell Hall, Queens University, Kingston, Ontario, Canada, K7L 3N6. E-mail: petkovic{at}post.queensu.ca
Dr. Charolyn Babichuk was supported by fellowships from the Leukemia
Research fund of Canada and the Medical Research Council of Canada.
This work was supported by grants from the National Cancer Institute of
Canada and the Medical Research Council of Canada to Dr. Martin
Petkovich.
Received for publication November 16, 1999.
Revision received May 4, 2000.
Accepted for publication May 30, 2000.
 |
REFERENCES
|
---|
-
Maden M 1995 The participation of retinoic acid in
embryonic and postembryonic development. Ontogenez 26:419429[Medline]
-
Mangelsdorf DJ, Evans RM 1995 The RXR heterodimers and orphan
receptors. Cell 83:841850[Medline]
-
Petkovich M 1992 Regulation of gene expression by vitamin A:
the role of nuclear retinoic acid receptors. Annu Rev Nutr 12:443471[CrossRef][Medline]
-
Chambon P 1996 A decade of molecular biology of retinoic acid
receptors. FASEB J 10:940954[Abstract/Free Full Text]
-
Leroy P, Nakshatri H, Chambon P 1991 Mouse retinoic acid
receptor
2 isoform is transcribed from a promoter that contains a
retinoic response element. Proc Natl Acad Sci USA 88:1013810142[Abstract]
-
Smith W, Nakshatri H, Leroy P, Rees J, Chambon P 1991 A
retinoic acid response element is present in the mouse cellular retinol
binding protein I (mCRBPI) promoter. EMBO J 10:22232230[Abstract]
-
Leid M, Kastner P, Chambon P 1992 Multiplicity generates
diversity in the retinoic acid signalling pathways. Trends Biochem Sci 17:42733[CrossRef][Medline]
-
Leid M, Kastner P, Durand B, Krust A, Leroy P, Lyons R,
Mendelsohn C, Nagpal S, Nakshatri, H, Reibel, C, Saunders M, Chambon P 1993 Retinoic acid signal transduction pathways. Ann NY Acad Sci 684:1934[Abstract]
-
Gronemeyer H, Laudet V 1995 Nuclear receptors. Protein
Profile 2:11731236[Medline]
-
Duester G 1998 Alcohol dehydrogenase is a critical mediator of
RA synthesis from vitamin A in the mouse embryo. J Nutr 128:45984624
-
Bhat PV, Poissant L, Falardeau P, Lacroix A 1988 Enzymatic
oxidation of all trans retinal to retinoic acid in rat tissues. Biochem
Cell Biol 66:73540[Medline]
-
Niederreither K, McCaffery P, Drager U, Chambon P, Dolle P 1997 Restricted expression and retinoic acid-induced down-regulation of
the retinaldehyde dehydrogenase type 2 (RALDH-2) gene during mouse
development. Mech Dev 62: 6778
-
Sapin V, Ward S, Bronner S, Chambon P, Dolle P 1997 Differential expression of transcripts encoding retinoid binding
proteins and retinoic acid receptors during placentation of the mouse.
Dev Dynam 208:199210[CrossRef][Medline]
-
Zhao D, McCaffery P, Ivins K, Neve R, Hogan P, Chin W, Drager
U 1996 Molecular identification of a major retinoic-acid-synthesizing
enzyme, a retinaldehyde-specific dehydrogenase. Eur J Biochem 240:1522[Abstract]
-
Napoli J 1996 Retinoic acid biosynthesis and metabolism. FASEB
J 10:9931001[Abstract/Free Full Text]
-
Williams JB, Napoli J 1985 Metabolism of retinoic acid and
retinol during differentiation of F9 embryonal carcinoma cells. Proc
Natl Acad Sci USA 82:46584662[Abstract]
-
Van Wauwe JP, Coene M-C, Goossens J, Van Nijen G, Cools W,
Lauwers W 1988 Ketoconazole inhibits the in vitro and
in vivo metabolism of all-trans-retinoic acid. J
Pharmacol Exp Ther 245:718722[Abstract]
-
Van Wauwe JP, Coene M-C, Goossens J, Cools W, Monbaliu J 1990 Effects of cytochrome P-450 inhibitors on the in vivo
metabolism of all-trans-retinoic acid in rats. J Pharmacol Exp
Ther 252:365369[Abstract]
-
Van Wauwe J, Van Nyen G, Coene M, Stoppie P, Cools W, Goossens
J, Borghgraef P, Janssen PAJ 1992 Liarozole, an inhibitor of retinoic
acid metabolism, exerts retinoid-mimetic effects in vivo.
J Pharmacol Exp Ther 261:773779[Abstract]
-
Wouters W, van DJ, Dillen A, Coene MC, Cools W, De CR 1992 Effects of liarozole, a new antitumoral compound, on retinoic acid
metabolism in MCF-7 human breast cancer cells. Cancer Res
52:28412846
-
Frolik CA, Roberts AB, Tavela TE, Roller PP, Newton DL, Sporn
MB 1979 Isolation and identification of 4-hydroxy- and 4-oxoretinoic
acid. In vitro metabolites of all-trans-retinoic acid in
hamster trachea and liver. Biochemistry 18:20922097[Medline]
-
Roberts AB, Nichols MD, Newton DL, Sporn MB 1979 In
vitro metabolism of retinoic acid in hamster intestine and liver.
J Biol Chem 254:62966302[Medline]
-
Duell EA, Astrom A, Griffiths CE, Chambon P, Voorhees JJ 1992 Human skin levels of retinoic acid and cytochrome p-450-derived
4-hydroxyretinoic acid after topical application of retinoci acid
in vivo compared to concentrations required to stimulate
retinoic acid receptor-mediated transcription in vitro.
J Clin Invest 90:12691274[Medline]
-
White JA, Boffa MB, Jones B, Petkovich M 1994 A zebrafish
retinoic acid receptor expressed in the regenerating caudal fin.
Development 120:18611872[Abstract/Free Full Text]
-
White J, Beckett B, Scherer S, Hebrick J, Petkovich M 1998 P450RAI(CYP26A1) maps to human chromosome 10q23q24 and mouse
chromosome 19C23. Genomics 48:270272[CrossRef][Medline]
-
Abu-Abed SS, Beckett BR, Chiba H, Chithalen JV, Jones G,
Metzger D, Chambon P, Petkovich M 1998 Mouse P450RAI (CYP26) expression
and retinoic acid-inducible retinoic acid metabolism in F9 cells are
regulated by retinoic acid receptor
and retinoid X receptor
.
J Biol Chem 273:24092415[Abstract/Free Full Text]
-
Swindell EC, Thaller C, Sockanathan S, Petkovich M, Jessell
TM, Eichele G 1999 Complementary domains of retinoic acid production
and degradation in the early chick embryo. Dev Biol 216:282296[CrossRef][Medline]
-
Hollemann T, Chen Y, Grunz H, Pieler T 1998 Regionalized
metabolic activity established boundaries of retinoic acid signalling.
EMBO J 17:73617372[Abstract/Free Full Text]
-
White JA, Petkovich M 1996 identification and cloning of
RA-regulated genes by mRNA differential display. Met Mol Biol 89:389404
-
White JA, Guo Y, Baetz K, Beckett-Jones B, Bonasoro J, Hsu K,
Dilworth J, Jones G, Petkovich M 1996 Identification of the retinoic
acid-inducible all-trans-retinoic acid 4-hydroxylase. J Biol
Chem 271:2992229927[Abstract/Free Full Text]
-
White JA, Beckett-Jones B, Guo YD, Dilworth FJ, Bonasoro J,
Jones G, Petkovich M 1997 cDNA cloning of human retinoic
acid-metabolizing enzyme (hP450RAI) identifies a novel family of
cytochromes P450. J Biol Chem 272:1853818541[Abstract/Free Full Text]
-
Ray WJ, Bain G, Yao M, Gottlieb DI 1997 CYP26, a novel
mammalian cytochrome P450, is induced by retinoic acid and defines a
new family. J Biol Chem 272:1870218708[Abstract/Free Full Text]
-
Van der Leede B, van den Brink C, Pijnappel W, Sonneveld E,
van der Saag P, van der Burg B 1997 Autoinduction of retinoic acid
metabolism to polar derivatives with decreased biological activity in
retinoic acid-sensitive, but not in retinoic acid resistant human
breast cancer cells. J Biol Chem 272:1792117928[Abstract/Free Full Text]
-
Sonneveld E, van den Brink C, van der Leede B, Schulkes
R, Petkovich M, van der Burg B, van der Saag P 1998 Human retinoic acid
(RA) 4-hydroxylase (CYP26) is highly specific for all-trans-RA and can
be induced through RA receptors in human breast and colon carcinoma
cells. Cell Growth Differ 9:629637[Abstract]
-
Fujii H, Sato T, Kaneko S, Gotoh O, Fujii-Kuriyama Y, Osawa K,
Kato S, Hamada H 1997 Metabolic inactivation of retinoic acid by a
novel P450 differentially expressed in developing mouse embryos. EMBO
J 16:41634173[Abstract/Free Full Text]
-
Iulianella A, Beckett B, Petkovich M, Lohnes D 1999 A
molecular basis for retinoic acid-induced axial truncation. Dev
Biol 205:3348[CrossRef][Medline]
-
De Roos K, Sonneveld E, Compaan B, Ten Berge D, Durston AJ,
Van der Saag PT 1999 Expression of retinoic acid 4-hydroxylase (CYP26)
during mouse and Xenopus laevis embryogenesis.
Mech Dev 82:205211[CrossRef][Medline]
-
McCaffery P, Wagner E, ONeil J, Petkovich M, Drager UC 1999 Dorsal and ventral retinal territories defined by retinoic acid
synthesis, breakdown and nuclear receptor expression. Mech Dev 82:
119130
-
Kennett S, Udvadia A, Horowitz J 1997 Sp3 encodes multiple
proteins that differ in their capacity to stimulate or repress
transcription. Nucleic Acids Res 25:31103117[Abstract/Free Full Text]
-
De Luca P, Majello B, Lania L 1996 Sp3 represses transcription
when tethered to promote DNA or targeted to promoter proximal RNA.
J Biol Chem 271:85338536[Abstract/Free Full Text]
-
Majello B, De Luca P, Lania L 1997 Sp3 is a bifunctional
transcription regulator with modular independent activation and
repression domains. J Biol Chem 272:40214026[Abstract/Free Full Text]
-
Beckett B 1999 Evolutionary conservation in retinoid
signalling and metabolism. Am Zool 39:783796
-
Leggett R, Armstrong S, Barry D, Mueller CR 1995 Sp1 is
phosphorylated and its DNA binding activity downregulated upon
terminal differentiation of the liver. J Biol Chem 270:2587925884[Abstract/Free Full Text]
-
Kwon H, Kim M, Edenberg H, Hur M 1999 Sp3 and Sp4 can repress
transcription by competing with Sp1 for the core cis-elements on the
human ADH5/FDH minimal promoter. J Biol Chem 274:2028[Abstract/Free Full Text]
-
Gehring W, Qian Y, Billeter M, Furukubo-Tokunaga K,
Schier A, Resendez-Perez D, Affolter M, Otting G, Wuthrich K 1994 Homeodomain-DNA recognition. Cell 78:211223[Medline]
-
Gehring W, Affolter M, Burglin T 1994 Homeodomain proteins.
Annu Rev Biochem 63:487526[CrossRef][Medline]
-
Krumlauf R 1994 Hox genes in vertebrate development. Cell 78:191201[Medline]
-
McCaffery P, Drager UC 1995 Retinoic acid synthesizing enzymes
in the embryonic and adult vertebrate. Adv Exp Med Biol 372:173183[Medline]
-
Sanchez HB, Yieh L, Osborne TF 1995 Cooperation by sterol
regulatory element-binding protein and Sp1 in sterol regulation of low
density lipoprotein receptor gene. J Biol Chem 270:11611169[Abstract/Free Full Text]
-
Porter W, Saville B, Hoivik D, Safe S 1997 Functional synergy
between the transcription factor Sp1 and the estrogen receptor. Mol
Endocrinol 11:15691580[Abstract/Free Full Text]
-
Jin P, Sun Y, Grabovski GA 1998 Role of Sp proteins and ROR
in transcription regulation of murine prosaposin. J Biol Chem 273:1320813216[Abstract/Free Full Text]
-
Lehman J, Zhang X-K, Pfhal M 1992 RARg2 is regulated through a
retinoic acid response element embedded in Sp1 sites. Mol Cell
Biol 12:29762985[Abstract]
-
Hagen G, Müller S, Beato M, Suske G 1994 Sp1-mediated
transcriptional activation is repressed by Sp3. EMBO J 13:38433851[Abstract]
-
Birnbaum M, van Wijnen A, Odgren P, Last T, Suske G, Stein G,
Stein J 1995 Sp1trans-activation of cell cycle regulated promoters is
selectively repressed by Sp3. Biochemistry 34:1650316508[Medline]
-
Shou Y, Baron S, Poncz M 1998 An Sp1-binding silencer is a
critical negative regulator of the megakaryocyte-specific aIIb gene.
J Biol Chem 273:57165726[Abstract/Free Full Text]
-
Rossant J, Zirngibl R, Cado D, Shago M, Giguere V 1991 Expression of a retinoic acid response element-hsplacz transgene
defines specific domains of transcriptional activity during mouse
embryogenesis. Genes Dev 5:13331344
-
Marin M, Karis A, Visser P, Grosveld F, Philipsen S 1997 Transcription factor Sp1 is essential for early embryonic development
but dispensable for cell growth and differentiation. Cell 89:619628[Medline]
-
Lichtsteiner S, Wuarin J, Schibler U 1987 The interplay of
DNA-binding proteins on the promoter of the mouse albumin gene.
Cell 51:963973[Medline]
-
Bortell R, Owen TA, Shalhoub V, Heinrichs A, Aronow MA,
Rochette-Egly C, Lutz Y, Stein JL, Lian JB, Stein GS 1993 Constitutive
transcription of the osteocalcin gene in osteosarcoma cells is
reflected by altered protein-DNA interactions at promoter regulatory
elements. Proc Natl Acad Sci USA 90:23002304[Abstract]
-
Sierra F, Tamone F, Mueller CR, Schibler U 1990 Differential
in vitro transcription from the promoter of a rat
2u
globulin gene in liver and spleen nuclear extracts. Mol Biol Med 7:13146[Medline]
-
Sierra F 1990 A laboratory guide to in vitro
transcription. BioMethods 2:1148
-
Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A
Laboratory Manual, ed 2