PRL Modulates Cell Cycle Regulators in Mammary Tumor Epithelial Cells
Matthew D. Schroeder,
Jaime Symowicz and
Linda A. Schuler
Department of Comparative Biosciences, University of Wisconsin,
Madison, Wisconsin 53706
Address all correspondence and requests for reprints to: Dr. L. A. Schuler, Department of Comparative Biosciences, University of Wisconsin, 2015 Linden Drive West, Madison, Wisconsin 53706. E-mail:
schulerl{at}svm.vetmed.wisc.edu
 |
ABSTRACT
|
---|
PRL is essential for normal lobulo-alveolar growth of the mammary
gland and may contribute to mammary cancer development or progression.
However, analysis of the mechanism of action of PRL in these processes
is complicated by the production of PRL within mammary epithelia. To
examine PRL actions in a mammary cell-specific context, we selected
MCF-7 cells that lacked endogenous PRL synthesis, using PRL stimulation
of interferon-
-activated sequence-related PRL response elements.
Derived clones exhibited a greater proliferative response to PRL than
control cells. To understand the mechanism, we examined, by Western
analysis, levels of proteins essential for cell cycle progression as
well as phosphorylation of retinoblastoma protein. The expression of
cyclin D1, a critical regulator of the G1/S transition, was
significantly increased by PRL and was associated with
hyperphosphorylation of retinoblastoma protein at Ser780.
Cyclin B1 was also increased by PRL. In contrast, PRL decreased the
Cip/Kip family inhibitor, p21, but not p16 or p27. These studies
demonstrate that PRL can stimulate the cell cycle in mammary epithelia
and identify specific targets in this process. This model system will
enable further molecular dissection of the pathways involved in
PRL-induced proliferation, increasing our understanding of this hormone
and its interactions with other factors in normal and pathogenic
processes.
 |
INTRODUCTION
|
---|
THE POLYPEPTIDE hormone PRL is essential
for mammary gland development and function, as demonstrated in PRL and
PRL receptor (PRLR) knockout mice (1, 2, 3). Despite its
critical role in the growth of the normal gland, the role of PRL in
human breast cancer remains poorly understood. PRL treatment increases
the development of spontaneous tumors in mice and interacts with
chemical carcinogens in the induction of mammary tumors in rats
(4, 5). Recent studies of human mammary tumors show that
neoplastic tissue expresses higher levels of PRLR than normal adjacent
tissue (6, 7). However, human clinical studies correlating
circulating PRL levels to tumor incidence and disease progression are
contradictory. Furthermore, treatment with the dopamine agonist,
bromocriptine, to block transcription of pituitary PRL had
no consistent effect on tumor progression (for reviews, see Refs.
8, 9, 10, 11). One explanation for these disparate findings is
that PRL itself is expressed in a variety of extrapituitary cells,
including human mammary epithelium (for reviews, see Refs.
12 and 13). At least two promoters, one of
which may be dopamine independent, are used in many breast tumors and
mammary cell lines (14). Despite endogenous production of
PRL, exogenous PRL has been shown to modestly stimulate the
proliferation of mammary cells in multiple studies (for reviews, see
Refs. 8 and 13). However, PRL antagonists
markedly decrease proliferation (15, 16). Taken together,
these findings support an autocrine-paracrine role for PRL in the
mitogenesis of mammary epithelial cells and suggest that endogenous PRL
may contribute to the development or progression of mammary tumors.
One possible target mechanism for PRL in mammary neoplasia may be
modulation of the cell cycle. Progression through the cell cycle is
orchestrated by successive activation of cyclin-dependent kinases
(cdk), which are regulated by specific cyclins as well as inhibitors
(17, 18, 19). In the mammary gland, multiple mitogens,
including epidermal growth factor (EGF) family members and hormones,
alter the levels and activities of these complexes. Understanding the
mechanism by which PRL stimulates mitogenesis and how it interacts with
other factors important in breast cancer may lead to improved
diagnostic assays and therapeutic approaches complementary to currently
available methods.
Studies of PRL action in mammary cells are complex, as local synthesis
of PRL interferes with molecular analysis of its actions in this cell
type. This work would be facilitated by the development of a cell
system that is able to respond to exogenous PRL in the appropriate
cell-specific manner, but does not express PRL itself. In this study we
have derived cell lines from the mammary adenocarcinoma cell line,
MCF-7, that do not express PRL endogenously, but retain the ability to
respond to exogenous PRL. We have employed these lines to examine the
effects of PRL on cell cycle regulators. Our findings indicate that PRL
does indeed modulate levels of these critical proteins in a pattern
that shares some features with other mammary mitogens, but differs in
others. This system will allow examination of the targets of PRL in
mammary cells and interactions with other factors in normal and
pathological processes.
 |
RESULTS
|
---|
Approach to Develop Mammary Cell Lines That Do Not Produce PRL
To establish a sensitive experimental system for the study of
PRL-regulated events associated with cell cycle progression in mammary
cells, we developed a method for selection of cells that do not express
PRL endogenously. Our strategy is shown in Fig. 1
. The minimal promoter has low activity
when the STAT 5-preferring interferon-
-activated (GAS) enhancer
sequences are not stimulated, and consequently little thymidine kinase
(TK) is transcribed in the basal state. However, in the presence of PRL
from endogenous or exogenous sources, signal transducers and activators
of transcription (STAT) activate transcription via the GAS sequences,
and TK expression is induced. Ganciclovir (GCV), a nucleoside analog,
becomes cytotoxic after conversion to its triphosphorylated form
through phosphorylation by the induced herpes simplex virus (HSV)-TK
and host cellular kinases (20, 21). This form acts as a
chain terminator, interfering with DNA synthesis in replicating cells.
Therefore, cells that contain the GAS3TK vector and express PRL should
produce HSV-TK, and if grown in the presence of GCV will undergo arrest
or cell death. Cells that do not express endogenous PRL or are
deficient in a signaling pathway by which PRL stimulates HSV-TK
production, should survive.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 1. Diagrammatic Representation of the Strategy for
Production of PRL-Deficient Cell Lines
Cells that produce PRL should stimulate TK expression via stimulation
of the GAS sequences, and therefore die when exposed to GCV. Cells with
the desired phenotype, i.e. no endogenous PRL
production, should survive.
|
|
Endogenous PRL in MCF-7 Cells Can Signal through GAS Elements
For this selection process to work, cells must be able to respond
to endogenously produced PRL by activating the GAS elements. To
determine whether a cell line was suitable, we replaced HSV-TK with a
luciferase reporter gene. This construct (GAS3Min), or the control
vector (pGL3Min; no GAS), was transiently transfected into MCF-7 cells.
As shown in Fig. 2
, only low levels of
luciferase activity were detected in MCF-7 cells containing the control
vector in both the presence and absence of exogenous PRL, as expected.
Exogenous PRL increased luciferase activity 2-fold over the vehicle
control value in MCF-7 cells containing the GAS3Min vector.
Importantly, MCF-7 cells that contained the GAS3Min vector also
displayed a 2-fold higher level of luciferase activity in the absence
of exogenous PRL than cells containing pGL3Min. This suggested that
endogenously produced PRL would be sufficient to stimulate HSV-TK
production and thus enable our selection process. Therefore, stable
transfectants of MCF-7 cells with either the pGL3TK or the GAS3TK
vector were generated (see Materials and Methods).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 2. GAS Activation by Endogenous and Exogenous PRL in
MCF-7 Cells
MCF-7 cells were transiently transfected with pGL3Min or GAS3Min and
cultured in serum-free medium with or without human PRL (4
nM). After 24 h samples were assayed for luciferase
activity. Activities were corrected for transfection efficiencies using
ß-galactosidase protein (RLU, relative light units). , Fold
activation in cells transfected with control vector (pGL3Min); ,
fold activation in cells containing GAS3Min. Data are the mean of four
experiments ± SEM. Bars with the
same letters are not different, and different
letters denote significant differences (P
< 0.01).
|
|
PRL-Deficient Cell Lines Retain Responsiveness to Exogenous PRL
MCF-7 cells stably transfected with either pGL3TK or GAS3TK were
selected for survival in GCV. Cell death was not obvious in the cells
containing the pGL3TK vector, whereas only 62 clones containing GAS3TK
survived. Forty-seven of these did not contain detectable PRL
transcripts by RT-PCR (Fig. 3
). The
proliferative response to exogenous PRL was examined in several of
these PRL-deficient cell lines in parallel to the MCF7-1 control cell
line, which contained pGL3TK and continued to express PRL endogenously
(Fig. 4A
). After 48 h in serum-free
medium (time zero), the MCF7-1 control cells were more numerous than
the two PRL-deficient cell lines, PRE-1 and B PRE-2. As expected, the
MCF7-1 cells treated with PRL grew modestly faster than untreated
cells. However, a significantly greater proliferative response to PRL
was observed in the two PRL-deficient cell lines compared with the
control cells at 48 h (Fig. 4B
). The effects of PRL on cell cycle
distribution were examined in the PRL-deficient cell line, PRE-1, as
well as the MCF7-1 controls. PRL treatment decreased the proportion of
PRE-1 cells in G0/G1 and
increased those in S phase over untreated controls, although not to the
extent of 10% FBS (Fig. 5
, A and B). In
contrast, PRL treatment had minimal effects on the control cell
line.

View larger version (15K):
[in this window]
[in a new window]
|
Figure 3. PRL Transcripts in Parental and Selected Cell Lines
GCV-resistant MCF-7 cell lines were screened by RT-PCR for PRL and
GAPDH (internal control) mRNAs under conditions that gave exponential
formation of both products. Products were fractionated by agarose gel
electrophoresis and visualized with SYBR Green I. The parental line is
MCF-7; MCF7-1 is a stable transfectant with pGL3TK. The control is a
PCR reaction without added cDNA. The remaining lanes represent some of
the GCV-resistant clones.
|
|

View larger version (28K):
[in this window]
[in a new window]
|
Figure 5. PRL Stimulates Cell Cycle Progression in PRE-1, But
Not MCF7-1, Cells
A, Representative analysis of cell cycle distribution after PRL
treatment. MCF7-1 and PRE-1 cells were each cultured in serum-free
medium for 48 h and then cultured for an additional 48 h in
serum-free medium ± 4 nM PRL or 10% FBS. Cells were
harvested by trypsinization, the nuclei were stained with propidium
iodide, and flow cytometry was performed as described. B, Flow
cytometric analysis of MCF7-1 and PRE-1 cells from A.
|
|
PRL Induces Cyclin D1 Expression and Retinoblastoma Protein
Phosphorylation
Because of the key role of cyclin D1 in regulating the
G1/S transition and mediating the response to
other growth factors, we examined the effect of PRL on cyclin D1
protein levels. In MCF7-1 control cells, exogenous PRL did not
appreciably alter cyclin D1 levels (Fig. 6A
). However, PRL treatment significantly
increased cyclin D1 in PRE-1 cells, which was readily detectable as
early as 3 h after addition of hormone (Fig. 6B
). A similar
response was observed in other PRL-deficient cell lines (data not
shown). In contrast, PRL did not alter levels of cyclin D3 protein,
which also serves as a loading control (Fig. 6C
). Cyclin D2 protein was
not examined because its expression is low in these cells (22, 23). These changes in cyclin D1 protein expression were
associated with an elevation in hyperphosphorylated retinoblastoma
protein (Rb) at 9 and 12 h (Fig. 7A
). This increase in hyperphosphorylated
Rb included increased phosphorylation on Ser780,
a target of cyclin D1-activated cyclin-dependent kinase-4 (cdk-4)
(24, 25, 26 ; Fig. 7B
). Minimal effects on Rb were observed in
the MCF7-1 control cell line (Fig. 7B
).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 6. PRL Stimulates Cyclin D1, But Not Cyclin D3,
Expression
A, Left, Representative Western blot analysis of cyclin
D1 in lysates from control (MCF7-1) at different times (0, 3, 6, 9, 12,
and 24 h) after treatment ± 4 nM hPRL.
Right, Fold change in cyclin D1 protein compared with
time zero from three independent experiments (mean ±
SEM). B, Left, Representative Western blot
analysis of cyclin D1 in lysates from PRL-deficient cells (PRE-1) with
or without hPRL treatment as described above. Right,
Fold change from three independent experiments as described above. ,
No treatment; , 4 nM hPRL. The asterisk
denotes significant differences (P < 0.05) between
treated and untreated cells at each time point. C, Representative
Western blot analysis of cyclin D3 in lysates from PRL-deficient cells
(PRE-1) ± hPRL treatment as described above.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Figure 7. PRL Stimulates Retinoblastoma Protein
Phosphorylation
A, Left, Representative Western blot analysis of pRb in
lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6,
9, 12, and 24 h) after treatment with or without 4 nM
hPRL. Right, Percentage of total pRb that is
hyperphosphorylated from four independent experiments (mean ±
SEM). , No treatment; , 4 nM hPRL. The
asterisk denotes significant differences
(P < 0.05) between treated and untreated cells at
each time point. B, Representative Western blot analysis of
phosphorylated Rb (Ser780) in lysates from PRL-deficient
cells (PRE-1) and the control cell line (MCF7-1) at different times (0,
3, 6, 9, 12, and 24 h) after treatment with or without 4
nM hPRL.
|
|
Cyclin D1 Antisense Oligonucleotides Block the Proliferative
Response to PRL
To assess the role of the PRL-induced increase in cyclin D1
protein levels in the elevated cell proliferation, antisense
oligonucleotides were employed to inhibit translation of cyclin D1
mRNA. As shown in Fig. 8A
, 400
nM antisense oligonucleotide decreased levels of cyclin D1
in PRL-treated cells to those in untreated, untransfected cells. Sense
oligonucleotides, in contrast, did not alter cyclin D1 levels from
those in the untransfected controls. Although PRL treatment of both
untransfected and sense oligonucleotide-transfected cultures resulted
in an increase in cell number 4453% greater than controls after
24 h, no increase in cell number in response to PRL was observed
in the cultures treated with antisense oligonucleotides (Fig. 8B
). FACS
analysis reflected these findings. The percentages of cells in
S/G2/M phase 24 h after culture in 0.1%
horse serum posttransfection were: control untransfected cells: 34.6%
human PRL (hPRL)-negative, 40.9% hPRL-positive; antisense transfected
cells: 34.8% hPRL-negative, 37.0% hPRL-positive; and sense
transfected cells: 34.9% hPRL-negative, 40.6% hPRL-positive. These
data are consistent with a key role for this cell cycle regulator in
PRL-induced proliferation.

View larger version (20K):
[in this window]
[in a new window]
|
Figure 8. Cyclin D1 Antisense Oligonucleotides Inhibit
PRL-Induced Proliferation
A, Representative Western analysis of cyclin D1 in lysates from PRE-1
cells untransfected (C) or transfected with 400 nM
antisense cyclin D1 oligonucleotides (AS) or 400 nM sense
cyclin D1 oligonucleotide (S) 6 h after treatment with or without
4 nM hPRL. Cells were plated at equal densities, cultured
in serum-free medium for 24 h, and then transfected with
oligonucleotides as described in Materials and Methods.
After washing, cells were cultured in medium containing 0.1% horse
serum for an additional 6 h with or without 4 nM PRL.
B, Growth response to PRL in cells transfected with cyclin D1
oligonucleotides averaged from two independent experiments. Cells were
transfected as described in A, then cultured in medium containing 0.1%
horse serum without ( ) or with ( ) 4 nM hPRL for an
additional 24 h. The number of cells was quantitated using a
hemocytometer. Results between experiments varied less than 10%.
|
|
PRL and EGF Do Not Additively Stimulate Cyclin D1
MAPK pathways mediate part of the proliferative responses to many
mitogens, including growth factors and cytokines. PRL has been shown to
activate the p44/42, p38, as well as c-Jun N-terminal
kinase/stress-activated protein kinase (JNK/SAPK) pathways in various
cell types (27, 28, 29). To examine the contribution of these
pathways to PRL induction of cyclin D1, we used the inhibitors PD98059
(for p44/42 MAPK) and SB203580 (at 10 µM SB203580, may
inhibit both p38 and JNK) (28). As shown in Fig. 9A
, PD98059 lowered basal cyclin D1
levels by about half, and PRL was unable to overcome this suppression.
In contrast, SB203580 had no effect on basal cyclin D1 levels, but
prevented the increase in cyclin D1 expression after PRL treatment.

View larger version (24K):
[in this window]
[in a new window]
|
Figure 9. Inhibitors PD98059 and SB20358 Inhibit PRL
Induction of Cyclin D1 Expression, and EGF Does Not Synergize with PRL
A, Left, Representative Western blot analysis of
cyclin D1 in lysates from PRL-deficient cells (PRE-1) at 6 h after
treatment with PD98059 (20 µM), SB203580 (10
µM), or dimethylsulfoxide (DMSO) vehicle control with or
without 4 nM PRL. Right, Fold change in
cyclin D1 protein compared with DMSO vehicle control from three
independent experiments (mean ± SEM). , No
treatment; , 4 nM hPRL. B, Left,
Representative Western blot analysis of cyclin D1 in lysates from
PRL-deficient cells (PRE-1) at 6 h after treatment with either PRL
(4 nM), EGF (30 ng/ml), PRL (4 nM) and EGF (30
ng/ml), or DMSO vehicle control. Right, Fold
PRL/EGF-induced increase in cyclin D1 protein compared with vehicle
control from three independent experiments (mean ±
SEM). C, Left, Representative Western blot
analysis of cyclin D1 in lysates of PRL-deficient cells (PRE-1) at
6 h after treatment with PD98059 (20 µM), SB203580
(10 µM), or DMSO vehicle control with or without 30 ng/ml
EGF. Right, Fold change in cyclin D1 protein compared
with DMSO vehicle control from three independent experiments (mean
± SEM). , No treatment; , 30 ng/ml EGF.
Different letters denote significantly different values
analyzed by one-way ANOVA, followed by Tukeys multiple comparison
test (P < 0.05).
|
|
EGF family members are important for normal mammary gland development
as well as tumorigenesis. They share some signaling pathways with PRL
(23, 27), and cross-talk between PRL and ErbB-2 results in
synergistic activation of the MAPK pathway (30). MCF-7
cells express ErbB-1, but have only low levels of the other receptors
for EGF family ligands (31). To examine potential
interactions between PRL-PRLR and EGF-ErbB-1 pathways in these cells,
we examined cyclin D1 protein expression. As shown in Fig. 9B
, although
EGF increased cyclin D1 protein to about the same level as PRL, the
addition of both factors together did not further increase expression.
To examine the basis of this observation, the ability of PD98059 and
SB203580 to inhibit EGF effects was also investigated. As shown in Fig. 9C
, EGF was able to overcome the effect of PD98059. However, SB203580
also prevented the EGF response.
PRL Inhibits p21 Expression
Multiple mammary mitogens alter the expression of cdk inhibitors.
PRL treatment significantly decreased p21 protein levels at 9 and
12 h after the addition of hormone (Fig. 10B
). In some, but not all, experiments
PRL induced a slight increase in p21 protein at 3 h. Neither p27
nor p16, a member of the inhibitor of cdk (4)
family, was affected by PRL in these cells (Fig. 10A
). As expected, PRL
did not alter p21 expression in the MCF7-1 control cell line (Fig. 10C
).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 10. PRL Inhibits p21 Expression, But Causes No Change
in Either p16 or p27
A, Representative Western blot analysis of p16 and p27 in lysates from
PRL-deficient cells (PRE-1) at different times (0, 3, 6, 9, 12,and
24 h) after treatment with or without 4 nM hPRL. B,
Left, Representative Western blot analysis of p21 in
lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6,
9, 12, and 24 h) after treatment with or without 4 nM
hPRL as described above. Right, Fold change in p21
protein compared with time zero from three independent experiments
(mean ± SEM). , No treatment; , 4
nM hPRL. The asterisk denotes significant
differences (P < 0.05) between treated and
untreated cells at each time point. C, Representative Western blot of
p21 in lysates from control cell line (MCF7-1) similarly treated.
|
|
PRL Induces Cyclin B1 Expression
As shown in Fig. 11A
, PRL
induced slight increases in cyclin A (evident at 9 and 12 h), as
well as cyclin E (through 24 h). These modest changes in cyclin E
may be due to the overexpression of cyclin E in the parental MCF-7
cells (32). In contrast, PRL treatment increased cyclin B1
expression approximately 2-fold at 9 and 12 h after addition of
hormone (Fig. 11B
). Only a very slight increase in response to PRL at
these same time points was observed in the MCF7-1 control line (Fig. 11C
).

View larger version (27K):
[in this window]
[in a new window]
|
Figure 11. PRL Stimulates Cyclin B1, and Slight Increases in
Cyclin A or Cyclin E Expression
A, Representative Western blot analysis of cyclin A and cyclin E in
lysates from PRL-deficient cells (PRE-1) at different times (0, 3, 6,
9, 12, and 24 h) after treatment with or without 4 nM
hPRL. B, Left, Representative Western blot analysis of
cyclin B1 in lysates from PRL-deficient cells (PRE-1) at different
times (0, 3, 6, 9, 12, and 24 h) after treatment with or without 4
nM hPRL as described above. Right, Fold
change in cyclin B1 protein compared with time zero from four
independent experiments (mean ± SEM). , No
treatment; , 4 nM hPRL. The asterisk
denotes significant differences (P < 0.05) between
treated and untreated cells at each time point. C, Representative
Western blot of cyclin B1 in lysates from a control cell line (MCF7-1)
similarly treated.
|
|
 |
DISCUSSION
|
---|
By coupling stimulation of an enhancer activated by STAT 5 to
production of a toxic metabolite, we were able to derive mammary
epithelial tumor cell lines that no longer express endogenous PRL. As
predicted, such cell lines are more sensitive to exogenous PRL and have
permitted identification of target genes and signaling pathways
employing PRL in this cell type. In theory, this method should also
select for defects in the PRL signaling pathway upstream of the
enhancer as well as cells that may no longer express other
cytokines/growth factors that stimulate this pathway. Curiously, the
majority of the selected clones appeared to be deficient in the
production of PRL itself, and behaved similarly in proliferation
assays.
Our studies have demonstrated that PRL increases the proliferation of
these cells by altering the expression of multiple regulators of cell
cycle progression, which would facilitate the
G1/S and G2/M phase
transitions. The rate of transit through G1 is
coordinated by successive actions of the cyclin-dependent kinases,
cdk-4, -6, and -2, which are regulated by specific cyclins, the cyclin
D family (cdk-4 and -6), and cyclin E (cdk-2). Multiple cdk inhibitors
are able to reduce the activities of these kinases. These include the
Ink4 family (such p16Ink4a), which specifically
inhibits the catalytic subunits of cdk4 and cdk6, as well as the
Cip/Kip family (including p21 and p27), which can inhibit the
activities of all cyclin D-, E-, and A-dependent kinases (for
reviews, see Refs. 17, 18, 19). PRL treatment of the
PRL-deficient mammary cell lines increased cyclin D1, but not cyclin
D3, protein expression and reduced the expression of the
multifunctional Cip inhibitor, p21, but not p27 or p16. Together, the
elevated cyclin D1 and reduced p21 levels would be predicted to
increase cdk4 activity, resulting in phosphorylation of pRb at
Ser780 (24, 25, 26), as observed here.
One effect of hyperphosphorylation of pRb is the release of sequestered
E2F, allowing transcription of genes required for progression
through S phase, including cyclins A and E. As predicted, in our
studies protein levels of cyclins E and A were slightly up-regulated by
PRL. Initiation of DNA condensation and entry into mitosis at the
G2/M transition is coordinated in part by cyclin
B1 regulation of Cdc2 activity. In our cells PRL also increased the
expression of cyclin B1, indicating another mechanism by which PRL
augments mitogenesis. These effects of PRL on regulation of the cell
cycle as well as the effects of PRL on apoptosis of mammary epithelial
cells (Ref. 33 and our unpublished observations) increase
our understanding of the mechanisms by which PRL may stimulate growth
during mammary development. Furthermore, in an abnormal genetic or
environmental context, these actions may contribute to mammary
carcinogenesis and may point toward potential targets for
pharmacological intervention in this process.
The D family of cyclins are key in initiating progress through the
G1 phase of the cell cycle. Cyclin D1 is the
primary member of this family expressed in the mammary gland. Genetic
deletion of this gene in mice results in normal ductal branching, but a
marked reduction in alveolar development (34). Conversely,
increased expression of cyclin D1 has been shown to be sufficient to
decrease G1 in some mammary tumor cell lines
in vitro (35), although this is dependent on
the functional status of other cell cycle regulators. Many growth
factors stimulate cell cycle progression of numerous cell types via
increased expression of this cyclin, and it is not surprising that PRL
exerts effects here as well. Our studies demonstrate that cyclin D1
plays a key role in PRL stimulation of the cell cycle in these mammary
tumor cells; preventing this increase with antisense oligonucleotides
inhibited PRL-induced proliferation. Cyclin D1 may be a major target
through which PRL and related hormones stimulate lobuloalveolar
proliferation during pregnancy, as shown by the similarities among the
mammary glands of the cyclin D1, PRL, and PRLR knockout mice (1, 3, 34, 36). PRL action on this regulator may also contribute to
mammary cancer development or progression, as cyclin D1 is elevated in
many human mammary tumors (37, 38), and overexpression of
cyclin D1 in transgenic mice leads to mammary tumor formation
(39). Cyclin D1 expression is controlled at multiple
levels, including transcription, RNA stability, translation, and
protein degradation (for reviews, see Refs. 18 and
40). The level(s) at which PRL modulates the activity of
cell cycle regulators, including cyclin D1, and the signaling pathways
employed, are not yet completely understood. Like human breast tissue
and other mammary cell lines (41, 42), MCF-7 cells express
distinct PRLR isoforms, differing in their cytoplasmic domains and
signaling
capacities.1 The
inhibitor studies presented here suggest that both the p44/42 MAPK and
p38MAPK and/or JNK/SAPK pathways mediate PRL actions at some level.
Other work in our laboratory has shown that PRL can augment
transcription of cyclin D1 via the JAK2 activation of
STATs.2 This is
consistent with the importance of STAT5A in mammary alveolar
proliferation, demonstrated by the STAT5A knockout mouse
(43), and points toward another pathway involved in PRL
action at this target. Interestingly, the current study demonstrated no
additive effect of PRL and EGF on cyclin D1 protein levels. The
distinct inhibitor profile of EGF suggests that this is a result of a
limiting necessary regulatory component(s) in these cells rather than a
shared signaling pathway(s). Further investigation will demonstrate the
applicability of these findings to a broader range of mammary cell
phenotypes as well as other cell types.
In the PRL-deficient MCF-7 cells in the present study, PRL also
increased levels of cyclin B1, which are critical for initiation of
mitosis. Cyclin B1, like cyclin D1, is overexpressed in many breast
cancers (44, 45). In the normal cell it accumulates during
G2 and peaks at the G2/M
transition. Cyclin B1 activity also is controlled at multiple levels,
including transcription, mRNA stability, as well as nuclear
translocation (for reviews, see Refs. 46, 47, 48). Whether PRL
directly alters cyclin B1 expression or secondarily increases protein
levels through other mediators remains to be determined. The complex
control of nuclear trafficking of this cyclin (48, 49),
including modulation by another target of PRL, p21 (50),
suggests that additional studies of the effects of PRL on this process
are needed.
Recent studies have demonstrated a complex role for p21 in the cell
cycle, not only as an inhibitor of cdks, but also as a facilitator of
the assembly of cdk-cyclin complexes and a regulator of cyclin B1
function at the G2/M transition, resulting in
accumulation of active complexes in the nucleus as well as increased
stability (for reviews, see Refs. 17, 18, 19). Like other cell
cycle regulators, p21 activity is controlled at multiple levels.
However, transcriptional controls have received the most attention (for
review, see Ref. 51). Multiple mitogens as well as growth
inhibitors alter levels of this protein in various cell types,
including mammary epithelial cells. In contrast to the effects of PRL
observed in the present studies, many mitogens, such as v-Src
(52), IGF-I (53), and EGF (54),
increase p21 transcription, perhaps consistent with its role in the
assembly of active cdk complexes. In contrast, some agents that inhibit
the proliferation of mammary cells also increase p21 transcription.
Inhibition by the cytokine, interferon-
, appears to involve STAT1
binding to one of the three GAS enhancer elements in the p21 promoter
(55, 56). The inhibitory effect of PRL on p21 protein
levels in the present studies and the reported ability of PRL to
activate STAT1, -3, and -5 in mammary cells (16, 57)
suggest the possibility of cross-talk among these transcription factors
and coactivators at this promoter. Additional studies of the
association of components and location of cdk complexes will further
clarify the role of p21 in PRL action on the cell cycle.
In vivo, mammary proliferation is regulated by complex
interactions among hormones, including PRL, estrogens, and progestins,
as well as local growth factors, such as EGF family members and IGFs.
These factors can amplify or inhibit one anothers signals to the
epithelial cells by several mechanisms, including altering the
expression of their receptors, influencing the level or activities of
signaling pathways, as well as activating paracrine modulators via
action on different cell types (for reviews, see Refs.
58, 59, 60). In addition, these agents have distinct target
genes, with synergistic or inhibitory consequences. In simplified
in vitro mammary cell systems, including the MCF-7 cell line
examined here, the effects of many of these agents on cell cycle
regulators have been extensively studied. Interestingly, PRL shares
some targets with these other mammary mitogens and differs in others.
Predictably, because of its central role in cell cycle progression,
cyclin D1 is a common target of estrogens, EGF, IGF, and possibly
progesterone as well (for review, see Ref. 40). In
contrast, diverse effects on the cdk inhibitors have been observed.
Estrogen decreases both p27 and p21 levels (22, 53, 61).
IGF-I also decreases p27 protein levels, but increases p21 levels, the
latter in part by stimulating transcription in MCF-7 cells (40, 53). EGF decreases p27 protein levels in several cell types (for
review, see Ref. 40) and synergizes with progesterone to
increase p21 in mammary T47D cells (54). The multiple
mechanisms through which the level and subcellular location of each of
these cell cycle regulators can be modulated and the breadth of
signaling pathways potentially employed by each ligand present multiple
opportunities for cross-talk and synergistic actions in the normal
and carcinogenic gland in vivo.
These studies have demonstrated that PRL is able to stimulate the cell
cycle in mammary epithelial tumor cells and have identified specific
targets in this process. This model system will enable molecular
dissection of the pathways involved in PRL-induced proliferation,
increasing our understanding of the role of this hormone and its
interaction with other factors in normal and pathogenic processes in
the mammary gland.
 |
MATERIALS AND METHODS
|
---|
Materials
Moloney murine leukemia virus reverse transcriptase was
purchased from Life Technologies, Inc. (Gaithersburg, MD).
The random hexamer pd(N)6 was purchased from
Pharmacia Biotech (Piscataway, NJ). SYBR Green I was
obtained from Molecular Probes, Inc. (Eugene, OR).
Antibodies used in Western blot analyses were as follows: cyclin A
(CC17) from Oncogene Research Products (Cambridge, MA); cyclin D3
(C-16), cyclin B1 (GNS1), cyclin E (HE12), p16 (F-12), and p27 (C-19)
from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA);
cyclin D1 (MS-210-P1) from NeoMarkers (Fremont, CA); p21 (C24420;
Cip1/WAF1) from Transduction Laboratories, Inc. (San
Diego, CA); Rb (14001A) from PharMingen (San Diego, CA),
and Phospho-RbSer780 from NEB Cell Signaling
(Beverly, MA). The enhanced chemiluminescence kit was purchased from
Amersham Pharmacia Biotech (Arlington Heights, IL). The
inhibitor PD98059 was purchased from Calbiochem (La Jolla,
CA). All of the remaining reagents were purchased from
Sigma-Aldrich Corp. (St. Louis, MO) except NaCl, which was
purchased from Mallinckrodt, Inc. (Paris, KY). The vector
that contains the HSV-TK gene (pHSV-106) was purchased from Life Technologies, Inc. (Gaithersburg, MD). Human PRL (lot AFP9042)
was obtained through National Hormone and Pituitary Program, NIDDK, and
Dr. Parlow.
Plasmid Constructions
The pGL3Min vector containing the PRL minimal
promoter
(GATCTCGAAGGTTTATAAAGTCAATGTCTGCAGATGAGAAAGCAGTGGTTCTCTTAGGACTTCTTGGGGAAGTGAAGCT)
driving luciferase expression in the pGL3-Basic vector
(Promega Corp.) was obtained from Dr. Thaddeus Golos
(University of Wisconsin). Three copies of the STAT5-binding site
(GAS-like sequences) from the
PRE3-chloramphenicol acetyltransferase vector
(62) were excised with EcoRV and
BamHI and inserted upstream of the minimal promoter in the
pGL3Min vector to produce the GAS3Min vector. To construct both the
pGL3TK and GAS3TK vectors, the luciferase gene was removed from pGL3Min
and GAS3Min by cutting with HindIII, followed by creation of
blunt ends with Klenow, and then cleavage with BamHI. The TK
gene was excised from the pHSV-106 vector with BglII, blunt
ends were created with Klenow, followed by cleavage with
BamHI, and the fragment replaced with the luciferase gene,
producing MinTK and GAS3TK.
Transfections and Reporter Gene Assays
Plasmid transfections were performed with LipofectAMINE
(Life Technologies, Inc.). For transient transfections,
MCF-7 cells were plated at 1.6 x 105
cells/well (12-well plates) and grown for 18 h. The cells were
washed once in serum-free medium, and the LipofectAMINE/DNA mixture was
added to the cells. The cells were incubated at 37 C for 68 h,
followed by removal of the LipofectAMINE/DNA mixture and replacement
with fresh medium with or without PRL (4 nM). After 24
h, cells were lysed, and luciferase activity and ß-galactosidase
(transfection control) were measured as previously described
(63).
Production of Stable PRL-Deficient Cell Lines
MCF-7 cells were grown in RPMI 1640 medium containing 10% horse
serum, which does not contain appreciable levels of lactogenic hormones
(64). They were transfected with either the MinTK or
GAS3TK vector, and the pcDNA3 vector in a 10:1 ratio, and stable
transfectants were selected in 400 µg/ml geneticin (G418). Clones
containing the MinTK or GAS3TK vector and surviving in 50
µM GCV (gift from Roche) were screened for
PRL mRNA. Identified PRL-deficient cell lines, passaged continuously
GCV, were found to be PRL responsive for about 20 passages. However,
thereafter the cells displayed a greatly increased growth rate and
became PRL insensitive, although PRL mRNA remained
undetectable.
RNA Extraction and RT-PCR Analysis
RT-PCR analysis was performed essentially as previously
described (65). Reactions containing cDNA and no cDNA
controls were incubated with 0.5 µM PRL primers (forward
primer, ACATGAACATCAAAGGATCGCCATG; reverse primer,
CCGCTCGAGGCTTAGCAGTTGTTGTTGTGGAT) and 0.035 µM GAPDH
primers (forward primer, TGAAGGTCGGAGTCAACGGATTTGGT; reverse primer,
CATGTGGGCCATGAGGTCCACCAC), and products were amplified as described
for 30 cycles.
PRL Stimulation of Cellular Growth
Each cell line was plated at 5 x 105
cells/60-mm tissue culture dish. After seeding, the cells were washed
once with PBS and cultured in serum-free RPMI 1640 for 48 h before
treatment with vehicle or 4 nM PRL. The cells were
harvested with trypsin at the indicated times, stained with trypan
blue, and counted using a hemocytometer. To analyze the effects of PRL
on cell cycle distribution, cells were plated at 2 x
106 cells/100-mm tissue culture dish, cultured in
serum-free RPMI 1640 for 48 h, and then treated with vehicle, 4
nM PRL, or 10% FBS for an additional 48 h. Cells were
harvested by trypsinization, fixed in 95% ethanol, and stored at -20
C for 24 h. The cells were then pelleted, washed once in PBS, and
incubated in propidium iodine stain (200 ng/ml ribonuclease A, 0.1%
Triton X-100, and 20 µg/ml propidium iodine in PBS) in the dark at
room temperature for 30 min. The samples were stored at 4 C until
cell cycle analysis was performed with a FACSCalibur sorter
(Becton Dickinson and Co., San Jose, CA).
Western Analysis
Each cell line was plated as described for FACS analysis before
treatment with vehicle or 4 nM PRL. Cells were harvested
into 100 µl lysis buffer (25 mM Tris (pH 8.0), 2
mM EDTA, 10% glycerol, 1% Triton X-100, 2 mM
sodium orthovanadate, and 20 mM sodium fluoride). The
cellular debris was removed by centrifugation at 10,000 rpm at 4 C for
10 min, and the protein concentration in the supernatant was determined
using the bicinchoninic acid kit (Pierce Chemical Co.,
Rockford IL). Lysates (30 µg protein) from each time point were
electrophoresed through standard Laemmli SDS-polyacrylamide gels (8%,
10%, 12%, or 15%), transferred to polyvinylidene fluoride membranes,
and then probed with appropriate antibodies. Membranes were blocked for
14 h in 0.25% gelatin in 100 mM Tris-HCl (pH 7.5), 150
mM sodium chloride, and 0.1% Tween 20; washed once with
100 mM Tris-HCl (pH 7.5), 150 mM sodium
chloride, and 0.1% Tween 20; and incubated in primary antibody
overnight at 4 C (cyclin D1, 1:500; cyclin A, 1:100; cyclin E, 1:100;
cyclin D3, 1:800; cyclin B1, 1:333; p16, 1:200; p27, 1:800; p21, 1:200;
Rb, 1:250; Phospho-RbSer 780, 1:1000). Proteins
were visualized using enhanced chemiluminescence as previously
described (65). Quantification of the signals was
performed using a densitometer and ImageQuant (version 4.2a) software
(Molecular Dynamics, Inc., Sunnyvale, CA).
Cyclin D1 Antisense Oligonucleotides
20-Mer sense and antisense oligonucleotides, modified at both
termini with phosphorothioates, were synthesized to the region around
the translation start site of cyclin D1 based on the report by Carroll
et al. (61) (sense, CCCAGCCATGGAACACCAGC;
antisense, GCTGGTGTTCCATGGCTGGG). For Western analyses, cells were
plated at 2 x 105 cells/well of a six-well
plate, cultured for 24 h in serum-free medium, and then
transfected with 200800 nM oligonucleotide in
424 µl CellFECTIN (Life Technologies, Inc.) for 2
h according to the manufacturers directions. Cells were then washed,
cultured in medium containing 0.1% horse serum for an additional
6 h in the presence or absence of 4 nM PRL,
and then lysates were harvested as described above for Western
analyses. Based on these experiments, 400 nM
antisense oligonucleotide was found to decrease the cyclin D1 level to
that in untransfected cells without PRL stimulation. For proliferation
assays, cells were plated at the same density in 60-mm dishes,
transfected with 400 nM oligonucleotides in 24
µl CellFECTIN, and otherwise treated as described above, except that
cells were harvested 24 h after PRL treatment. Cell numbers were
determined as described for untransfected cells.
 |
ACKNOWLEDGMENTS
|
---|
We thank Dr. Thaddeus Golos (University of Wisconsin, Madison,
WI), Dr. Nelson Horseman (University of Cincinnati, Cincinnati, OH),
and Roche Discover Welwyn (London, UK) for their generous
gifts of reagents.
 |
FOOTNOTES
|
---|
This work was supported in part by NIH Grant R01-CA-78312, Grant
IRG-58-011-41-6 from the American Cancer Society, the University of
Wisconsin Environmental Health Science Center (NIH Grant P30-ES-09090),
and the University of Wisconsin Center for Womens Health and Womens
Health Research. Some of this work was presented at the 82nd Annual
Meeting of The Endocrine Society, 2000, Toronto, Canada, in abstract
form.
Abbreviations: cdk, Cyclin-dependent kinase; EGF, epidermal
growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GAS,
interferon-
-activated sequence; GCV, ganciclovir; hPRL, human PRL;
HSV-TK, herpes simplex virus-thymidine kinase; JNK/SAPK, c-Jun
N-terminal kinase/stress-activated protein kinase; PRLR, PRL
receptor; Rb, retinoblastoma protein; RLU, relative light units; STAT,
signal transducers and activators of transcription; TK, thymidine
kinase.
Received for publication May 31, 2001.
Accepted for publication September 25, 2001.
 |
REFERENCES
|
---|
-
Horseman ND, Zhao WZ, Montecino-Rodriguez E, Tanaka M,
Nakashima K, Engle SJ, Smith F, Markoff E, Dorshkind K 1997 Defective
mammopoiesis, but normal hematopoiesis, in mice with a targeted
disruption of the prolactin gene. EMBO J 16:69266935[Abstract/Free Full Text]
-
Ormandy CJ, Camus A, Barra J, Damotte D, Lucas B, Buteau H,
Edery M, Brousse N, Babinet C, Binart N, Kelly PA 1997 Null mutation of
the prolactin receptor gene produces multiple reproductive defects in
the mouse. Genes Dev 11:167178[Abstract]
-
Brisken C, Kaur S, Chavarria TE, Binart N, Sutherland RL,
Weinberg RA, Kelly PA, Ormandy CJ 1999 Prolactin controls mammary gland
development via direct and indirect mechanisms. Dev Biol 210:96106[CrossRef][Medline]
-
Welsch CW, Nagasawa H 1977 Prolactin and murine mammary
tumorigenesis: a review. Cancer Res 37:951963[Abstract]
-
Boot LM, Muhlbock O, Ropcke G 1962 Prolactin and the
induction of mammary tumors in mice. Gen Comp Endocrinol 2:601603
-
Reynolds C, Montone KT, Powell CM, Tomaszewski JE, Clevenger
CV 1997 Expression of prolactin and its receptor in human breast
carcinoma. Endocrinology 138:55555560[Abstract/Free Full Text]
-
Touraine P, Martini JF, Zafrani B, Durand JC, Labaille F,
Malet C, Nicolas A, Trivin C, Postel-Vinay MC, Kuttenn F, Kelly PA 1998 Increased expression of prolactin receptor gene assessed by
quantitative polymerase chain reaction in human breast tumors
vs. normal breast tissues. J Clin Endocrinol Metab 83:667674[Abstract/Free Full Text]
-
Vonderhaar BK 2000 Prolactin in human breast cancer
development. In: Ethier SP, ed. Endocrine oncology. Totowa: Humana
Press; 101120
-
Goffin V, Touraine P, Pichard C, Bernichtein S, Kelly PA 1999 Should prolactin be reconsidered as a therapeutic target in human
breast cancer. Mol Cell Endocrinol 151:7987[CrossRef][Medline]
-
Hankinson SE, Willett WC, Michaud S, Manson JE, Colditz GA,
Longcope C, Rosner B, Speizer FE 1999 Plasma prolactin levels and
subsequent risk of breast cancer in postmenopausal women. J Natl
Cancer Inst 91:629634[Abstract/Free Full Text]
-
Wennbo H, Törnell J 2000 The role of prolactin and
growth hormone in breast cancer. Oncogene 19:10721076[CrossRef][Medline]
-
Ben-Jonathan N, Mershon JL, Allen DL, Steinmetz RW 1996 Extrapituitary prolactin: distribution, regulation, functions, and
clinical aspects. Endocr Rev 17:639669[Medline]
-
Clevenger CV, Plank TL 1997 Prolactin as an
autocrine/paracrine factor in breast cancer. J Mammary Gland Biol Neopl 2:5968[Medline]
-
Shaw-Bruha CM, Pirrucello SJ, Shull JD 1997 Expression of the
prolactin gene in normal and neoplastic human breast tissues and human
breast cell lines: promoter usage and alternative mRNA splicing. Breast
Cancer Res Treat 44:243253[CrossRef][Medline]
-
Fuh G, Wells JA 1995 Prolactin receptor antagonists that
inhibit the growth of breast cancer cell lines. J Biol Chem 270:1313313137[Abstract/Free Full Text]
-
Llovera M, Pichard C, Bernichtein S, Jeay S, Touraine P, Kelly
PA, Goffin V 2000 Human prolactin (hPRL) antagonists inhibit
hPRL-activated signaling pathways involved in breast cancer cell
proliferation. Oncogene 19:46954705[CrossRef][Medline]
-
Sherr CJ, Roberts JM 1999 CDK inhibitors: positive and
negative regulators of G1-phase progression. Genes Dev 13:15011512[Free Full Text]
-
Ekholm SV, Reed SI 2000 Regulation of G1
cyclin dependent kinases in the mammalian cell cycle. Curr Opin Cell
Biol 12:676684[CrossRef][Medline]
-
Vidal A, Koff A 2000 Cell-cycle inhibitors: three families
united by a common cause. Gene 247:115[CrossRef][Medline]
-
Borrelli E, Heyman R, Hsi M, Evans RM 1988 Targeting of an
inducible toxic phenotype in animal cells. Proc Natl Acad Sci USA 85:75727576[Abstract]
-
Matthews T, Boehme R 1988 Antiviral activity and mechanism of
action of ganciclovir. Rev Infect Dis 10(Suppl 3):S490S494
-
Prall OWJ, Sarcevic B, Musgrove EA, Watts CKW, Sutherland RL 1997 Estrogen-induced activation of cdk4 and cdk2 during G1-S phase
progression is accompanied by increased cyclin D1 expression and
decreased cyclin-dependent kinase inhibitor association with cyclin
E-cdk2. J Biol Chem 272:1088210894[Abstract/Free Full Text]
-
Cicatiello L, Addeo R, Altucci L, Belsito PV, Boccia V,
Cancemi M, Germano D, Pacilio C, Salzano S, Bresciani F, Weisz A 2000 The antiestrogen ICI 182,780 inhibits proliferation of human breast
cancer cells by interfering with multiple, sequential
estrogen-regulated processes required for cell cycle completion. Mol
Cell Endocrinol 165:199209[CrossRef][Medline]
-
Kitagawa M, Higashi H, Jung HK, Suzuki-Takahashi I, Ikeda M,
Tamai K, Kato J, Segawa K, Yoshida E, Nishimura S, Taya Y 1996 The
consensus motif for phosphorylation by cyclin D1-Cdk4 is different from
that for phosphorylation by cyclin A/E-Cdk2. EMBO J 15:70607069[Abstract]
-
Connell-Crowley L, Harper JW, Goodrich DW 1997 Cyclin D1/Cdk4
regulates retinoblastoma protein-mediated cell cycle arrest by
site-specific phosphorylation. Mol Biol Cell 8:287301[Abstract]
-
Grafstrom RH, Pan W, Hoess RH 1999 Defining the substrate
specificity of cdk4 kinase-cyclin D1 complex. Carcinogenesis 20:193198[Abstract/Free Full Text]
-
Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA 1998 Prolactin (PRL) and its receptor: actions, signal transduction pathways
and phenotypes observed in PRL receptor knockout mice. Endocr Rev 19:225268[Abstract/Free Full Text]
-
Cheng Y, Zhizhin I, Perlman R L, Mangoura D 2000 Prolactin-induced cell proliferation in PC12 cells depends on JNK but
not ERK activation. J Biol Chem 275:2332623332[Abstract/Free Full Text]
-
Olazabal I, Munoz J, Ogueta S, Obregon E, Garcia-Ruiz JP 2000 Prolactin (PRL)-PRL receptor system increases cell proliferation
involving JNK (c-Jun amino terminal kinase) and AP-1 activation:
inhibition by glucocorticoids. Mol Endocrinol 14:564575[Abstract/Free Full Text]
-
Yamauchi T, Yamauchi N, Ueki K, Sugiyama T, Waki H, Miki H,
Tobe K, Matsuda S, Tsushima T, Yamamoto T, Fujita T, Taketani Y,
Fukayama M, Kimura S, Yazaki Y, Nagai R, Kadowaki T 2000 Constitutive
tyrosine phosphorylation of ErbB-2 via Jak2 by autocrine secretion of
prolactin in human breast cancer. J Biol Chem 275:3393733944[Abstract/Free Full Text]
-
Saceda M, Grunt TW, Colomer R, Lippman ME, Lupu R, Martin MB 1996 Regulation of estrogen receptor concentration and activity by an
erbB/HER ligand in breast carcinoma cell lines. Endocrinology 137:43224330[Abstract]
-
Bablin-Gray J, Zalvide J, Fox MP, Knickerbocker CJ, DeCaprio
JA, Keyomarsi K 1996 Cyclin E, a redundant cyclin in breast cancer.
Proc Natl Acad Sci USA 93:1521515220[Abstract/Free Full Text]
-
Chen WY, Ramamoorthy P, Chen N, Sticca R, Wagner TE 1999 A
human prolactin antagonist, hPRL-G129R, inhibits breast cancer cell
proliferation through induction of apoptosis. Clin Cancer Res 5:35833593[Abstract/Free Full Text]
-
Dickson C, Creer A, Fantl V 2000 Mammary gland oncogenes as
indicators of pathways important in mammary gland development. Oncogene 19:10971101[CrossRef][Medline]
-
Musgrove EA, Lee CS, Buckley MF, Sutherland RL 1994 Cyclin D1
induction in breast cancer cells shortens G1 and is sufficient for
cells arrested in G1 to complete the cell cycle. Proc Natl Acad Sci USA 91:80228026[Abstract]
-
Sicinski P, Weinberg RA 1997 A specific role for cyclin D1 in
mammary gland development. J Mammary Gland Biol Neopl 2:335342[Medline]
-
Van Diest PJ, Michalides RJAM, Jannink I, Van der Valk P,
Peterse HL, De Jong JS, Meijer CJLM, Baak JPA 1997 Cyclin D1 expression
in invasive breast cancer: correlations and prognostic value. Am J
Pathol 150:705711[Abstract]
-
Barnes DM 1997 Cyclin D1 in mammary carcinoma. J Pathol 181:267269[CrossRef][Medline]
-
Wang TC, Cardiff RD, Zukerberg L, Lees M, Arnold A, Schmidt EV 1994 Mammary hyperplasia and carcinoma in MMTV-cyclin D1 transgenic
mice. Nature 369:669671[CrossRef][Medline]
-
Pestell RG, Albanese C, Reutens AT, Segall JE, Lee RJ, Arnold
A 1999 The cyclins and cyclin-dependent kinase inhibitors in hormonal
regulation of proliferation and differentiation. Endocr Rev 20:501534[Abstract/Free Full Text]
-
Clevenger CV, Chang W-P, Ngo W, Pasha TLM, Montone KT,
Tomaszewski JE 1995 Expression of prolactin and prolactin receptor in
human breast carcinoma: evidence for an autocrine/paracrine loop.
Am J Pathol 146:695705[Abstract]
-
Kline JB, Roehrs H, Clevenger CV 1999 Functional
characterization of the intermediate isoform of the human prolactin
receptor. J Biol Chem 274:3546135468[Abstract/Free Full Text]
-
Hennighausen L, Robinson GW, Wagner K-U, Liu XW 1997 Prolactin
signaling in mammary gland development. J Biol Chem 272:75677569[Free Full Text]
-
Keyomarsi K, Pardee AB 1993 Redundant cyclin overexpression
and gene amplification in breast cancer cells. Proc Natl Acad Sci USA 90:11121116[Abstract]
-
Megha T, Lazzi S, Ferrari F, Vatti R, Howard CM, Cevenini G,
Leoncini L, Luzi P, Giordano A, Tosi P 1999 Expression of the G2-M
checkpoint regulators cyclin B1 and P34CDC2 in breast cancer: a
correlation with cellular kinetics. Anticancer Res 19:163169[Medline]
-
Ohi R, Gould KL 1999 Regulating the onset of mitosis. Curr
Opin Cell Biol 11:267273[CrossRef][Medline]
-
Hershko A 1996 Mechanisms and regulation of ubiquitin-mediated
cyclin degradation. Adv Exp Med Biol 389:221227[Medline]
-
Pines J 1999 Four-dimensional control of the cell cycle. Nat
Cell Biol 1:E73E79
-
Yang J, Song H, Walsh S, Bardes ES, Kornbluth S 2000 Combinatorial control of cyclin B1 nuclear trafficking through
phosphorylation at multiple sites. J Biol Chem 276:36043609[Abstract/Free Full Text]
-
McShea A, Samuel T, Eppel JT, Galloway DA, Funk JO 2000 Identification of CIP-1-associated regulator of cyclin B (CARB), a
novel p21-binding protein acting in the G2 phase of the cell cycle.
J Biol Chem 275:2318123186[Abstract/Free Full Text]
-
Gartel AL, Tyner AL 1999 Transcriptional regulation of the
p21(WAF1/CIP1) gene. Exp Cell Res 246:280289[CrossRef][Medline]
-
Sinibaldi D, Wharton W, Turkson J, Bowman T, Pledger WJ, Jove
R 2000 Induction of p21WAF1/CIP1 and cyclin D1
expression by the Src oncoprotein in mouse fibroblasts: role of
activated STAT3 signaling. Oncogene 19:54195427[CrossRef][Medline]
-
Dupont J, Karas M, LeRoith D 2000 The potentiation of estrogen
on insulin-like growth factor I action in MCF-7 human breast cancer
cells includes cell cycle components. J Biol Chem 275:3589335901[Abstract/Free Full Text]
-
Richer JK, Lange CA, Manning NG, Owen G, Powell R, Horwitz KB 1998 Convergence of progesterone with growth factor and cytokine
signaling in breast cancer: progesterone receptors regulate signal
transducers and activators of transcription expression and activity.
J Biol Chem 273:3131731326[Abstract/Free Full Text]
-
Gooch JL, Herrera RE, Yee D 2000 The role of p21 in interferon
gamma-mediated growth inhibition of human breast cancer cells. Cell
Growth Differ 11:335342[Abstract/Free Full Text]
-
Chin YE, Kitagawa M, Su WCS, You ZH, Iwamoto Y, Fu XY 1996 Cell growth arrest and induction of cyclindependent kinase
inhibitor p21 (WAF1/CIP1) mediated by Stat 1. Science 272:719722[Abstract]
-
DaSilva L, Rui H, Erwin RA, Howard OM, Kirken RA, Malabarba
MG, Hackett RH, Larner AC, Farrar WL 1996 Prolactin recruits STAT1,
STAT3 and STAT5 independent of conserved receptor tyrosines TYR402,
TYR479, TYR515 and TYR580. Mol Cell Endocrinol 117:131140[CrossRef][Medline]
-
Ormandy CJ, Hall RE, Manning DL, Robertson JFR, Blamey RW,
Kelly PA, Nicholson RI, Sutherland RL 1997 Coexpression and
cross-regulation of the prolactin receptor and sex steroid hormone
receptors in breast cancer. J Clin Endocrinol Metab 82:36923699[Abstract/Free Full Text]
-
Yee D, Lee AV 2000 Crosstalk between the insulin-like growth
factors and estrogens in breast cancer. J Mammary Gland Biol Neopl 5:107115[CrossRef][Medline]
-
Lange CA, Richer JK, Horwitz KB 1999 Hypothesis: progesterone
primes breast cancer cells for cross-talk with proliferative or
antiproliferative signals. Mol Endocrinol 13:829836[Free Full Text]
-
Carroll JS, Prall OWJ, Musgrove EA, Sutherland RL 2000 A pure
enstrogen antagonist inhibits cyclin E-cdk2 activity in MCF-7 breast
cancer cells and induces accumulation of p130E2F4 complexes
characteristic of quiescence. J Biol Chem 275:38221338229[Abstract/Free Full Text]
-
Gao J, Hughes JP, Auperin B, Buteau H, Edery M, Zhuang HM,
Wojchowski DM, Horseman ND 1996 Interactions among JANUS kinases and
the prolactin (PRL) receptor in the regulation of a PRL response
element. Mol Endocrinol 10:847856[Abstract]
-
Tseng YH, Schuler LA 1998 Transcriptional regulation of
interleukin-1ß gene by interleukin- 1ß itself is mediated in part
by Oct-1 in thymic stromal cells. J Biol Chem 273:1263312641[Abstract/Free Full Text]
-
Gout PW, Beer CT, Noble RL 1980 Prolactin-stimulated growth of
cell cultures established from malignant Nb rat lymphomas. Cancer Res 40:24332436[Abstract]
-
Schroeder MD, Rose-Hellekant T, Sandgren EP, Schuler LA 2001 Dysregulation of signal transducers and activators of transcription 1,
3, and 5 and prolactin receptors by overexpression of mammary TGF
.
Mol Cell Endocrinol 175:173183[CrossRef][Medline]