Shc Phosphotyrosine-Binding Domain Dominantly Interacts with Epidermal Growth Factor Receptors and Mediates Ras Activation in Intact Cells
Kazuhiko Sakaguchi,
Yoshinori Okabayashi1,
Yoshiaki Kido,
Sachiko Kimura,
Yoko Matsumura,
Koichi Inushima and
Masato Kasuga
The Second Department of Internal Medicine Kobe University
School of Medicine Chuo-ku, Kobe 650, Japan
 |
ABSTRACT
|
---|
The adaptor protein Shc contains a phosphotyrosine
binding (PTB) domain and a Src homology 2 (SH2) domain, both of which
are known to interact with phosphorylated tyrosines. We have shown
previously that tyrosine 1148 of the activated epidermal growth factor
(EGF) receptor is a major binding site for Shc while tyrosine 1173 is a
secondary binding site in intact cells. In the present study, we
investigated the interaction between the PTB and SH2 domains of Shc and
the activated human EGF receptor. Mutant 52-kDa Shc with an
arginine-to-lysine substitution at residue 175 in the PTB domain (Shc
R175K) or 397 in the SH2 domain (Shc R397K) was coexpressed in Chinese
hamster ovary cells overexpressing the wild-type or mutant EGF
receptors that retained only one of the autophosphorylation sites at
tyrosine 1148 (QM1148) or 1173 (QM1173). Shc R397K was coprecipitated
with the QM1148 and QM1173 receptors, was tyrosine-phosphorylated, and
associated with Grb2 and Sos. In contrast, coprecipitation of Shc R175K
with the mutant receptors was barely detectable. In cells expressing
the QM1173 receptor, Shc R175K was tyrosine-phosphorylated and
associated with Grb2, while association of Sos was barely detectable.
In cells expressing the QM1148 receptor, tyrosine phosphorylation of
Shc R175K was markedly reduced. When both Shc R175K and 46-kDa Shc
R397K were coexpressed with the mutant receptors, p46 Shc R397K was
dominantly tyrosine-phosphorylated. In cells expressing the wild-type
receptor, Shc R397K, but not Shc R175K, translocated to the membrane in
an EGF-dependent manner. In addition, Ras activity stimulated by the
immunoprecipitates of Shc R397K was significantly higher than that by
the immunoprecipitates of Shc R175K. The present results indicate that
tyrosine 1148 of the activated EGF receptor mainly interacts with the
Shc PTB domain in intact cells. Tyrosine 1173 interacts with both the
PTB and SH2 domains, although the interaction with the PTB domain is
dominant. In addition, Shc bound to the activated EGF receptor via the
PTB domain dominantly interacts with Grb2-Sos complex and plays a major
role in the Ras-signaling pathway.
 |
INTRODUCTION
|
---|
Growth factor receptors with intrinsic tyrosine kinase activity
undergo autophosphorylation on multiple tyrosine residues upon ligand
binding (1, 2). One of the most important consequences of
autophosphorylation is the creation of binding sites on the receptors
for proteins containing domains that specifically interact with the
phosphorylated tyrosine (1, 2, 3). Shc is an adaptor protein composed of
three overlapping proteins of 46-, 52-, and 66-kDa, which differ only
in the extent of their N-terminal sequences (4). Shc proteins share a
C-terminal Src homology 2 (SH2) domain, a central glycine/proline-rich
region that is 50% homologous to human
1 collagen, and an adjacent
phosphotyrosine binding (PTB) domain (also referred to as
phosphotyrosine interaction domain) (4, 5, 6). After stimulation of a
variety of cell surface receptors by growth factors and cytokines, Shc
binds phosphorylated tyrosines within the activated receptors or
receptor substrates, is tyrosine-phosphorylated, and subsequently
interacts with Grb2 that forms a complex with Sos, a Ras guanine
nucleotide exchange protein. Based on these findings, Shc has been
implicated in Ras activation (4, 5, 6, 7, 8, 9, 10, 11). Both the SH2 (4) and PTB domains
of Shc (5, 6) are capable of interacting with
phosphotyrosine-containing peptides and proteins. For the specific
interaction of phosphorylated tyrosines with the SH2 domain of Shc, the
C-terminal sequence to the phosphotyrosine pY(I/E/Y/L)X(I/L/M) (where p
is phosphorylation and X is any amino acid) is considered to be
important (12), whereas the N-terminal sequence, NXXpY, is shown to be
a minimal PTB domain-binding motif (13, 14, 15).
We have shown previously that tyrosine 1148 of the activated human
epidermal growth factor (EGF) receptor is a major binding site for Shc
and that tyrosine 1173 is a secondary binding site in intact cells
(16). In vitro studies indicate that the PTB domain
interacts with tyrosine 1148 of activated EGF receptors and the SH2
domain with tyrosine 1173 (17, 18). However, it is still not known
whether Shc associates with the phosphotyrosines within EGF receptors
in vivo by a distinct form of interaction between
phosphorylated tyrosines and the PTB or SH2 domain of Shc, since
interactions in vitro may not accurately reflect those
in vivo. In this regard, a recent study failed to show a
stable association of the Shc SH2 domain with the activated EGF
receptor in intact cells and suggested a low-affinity interaction
between these two molecules (19).
In the present study, we investigated the interaction between the PTB
or SH2 domain of Shc and each of tyrosines 1148 and 1173 of the
activated EGF receptor. To this end, mutant Shc constructs were
cotransfected into Chinese hamster ovary (CHO) cells overexpressing the
wild-type mutant, lacking five autophosphorylation sites (F5), and
mutant EGF receptors that retained only one of the
autophosphorylation sites at tyrosine 1148 (QM1148) or 1173
(QM1173).
 |
RESULTS
|
---|
Interaction of Mutant Shc Having an Arginine-to-Lysine Substitution
at Residue 397 (Shc R397K) with Wild-Type and Mutant EGF Receptors
In the first step we investigated the interaction between the Shc
PTB domain and phosphorylated tyrosines at 1148 and 1173, dominant Shc
binding sites within EGF receptors. For this purpose, we coexpressed
herpes simplex virus (HSV) epitope-tagged Shc R397K in CHO cells
overexpressing the wild-type, QM1148, QM1173, or F5 EGF receptors (Fig. 1
). Parental CHO cells used are devoid of
endogenous EGF receptors as previously reported (16). The nuclear
magnetic resonance structure of the Shc SH2 domain has shown that an
arginine residue at 397 within Shc is located at the bottom of the
phosphotyrosine-binding pocket (20). This residue is strictly conserved
in the known SH2 domain, and its substitution in the Abl SH2 domain
with lysine results in a complete loss of binding activity (21). The
expression levels of Shc R397K were estimated to be several fold higher
than those of endogenous Shc (data not shown). Lysates from these cells
were immunoprecipitated with anti-EGF receptor antibodies and then
immunoblotted with anti-HSV antibodies. Anti-HSV immunoblot showed that
Shc R397K was detected just above the band of Ig heavy chain.
HSV-tagged Shc R397K was coprecipitated with wild-type, QM1148, and
QM1173 EGF receptors (Fig. 2
). The amount
of Shc R397K coprecipitated was increased by EGF stimulation, although
Shc R397K was detected in unstimulated cells. The amount of Shc R397K
coprecipitated with the QM1148 and QM1173 EGF receptors was nearly
similar to that with the wild-type EGF receptor. On the other hand,
coprecipitation of Shc R397K with the F5 EGF receptor was barely
detectable (Fig. 2
).

View larger version (34K):
[in this window]
[in a new window]
|
Figure 1. Schematic Representation of EGF Receptor and Shc
Constructs
A, EGF receptor constructs. WT, The wild-type human EGF receptor
shown with five autophosphorylation tyrosines (Y); QM1148 and QM1173,
the quadruple point mutant with tyrosine to phenylalanine (F)
substitution except tyrosine at 1148 or 1173; F5, the mutant lacking
five autophosphorylation sites. B, Shc constructs. Shc, Wild-type
52-kDa Shc showing a PTB, a glycine/proline-rich region (Gly/Pro), and
a SH2 domain (SH2); Shc R175K and R397K, HSV epitope-tagged p52 Shc
with an arginine-to-lysine substitution at residue 175 or 397,
respectively; p46 Shc R397K, T7 epitope-tagged p46 Shc with an
arginine-to-lysine substitution at residue 397; Shc PTB, T7
epitope-tagged Shc with deleted PTB domain.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 2. Interaction of Shc R397K with EGF Receptors
CHO cells coexpressing Shc R397K and wild-type, QM1148, QM1173, or F5
EGF receptors were left unstimulated or stimulated with 10
nM EGF for 2 min at 37 C. Lysates from these cells were
immunoprecipitated with anti-EGF receptor (EGFR) antibodies and
immunoblotted with anti-HSV epitope tag antibodies. Whole-cell lysates
were simultaneously immunoblotted with anti-HSV antibody. IgG, Ig heavy
chain. Representative of three separate experiments.
|
|
We then examined tyrosine phosphorylation of Shc R397K and association
of Grb2-Sos complex with Shc R397K. Immunoblotting of anti-HSV
immunoprecipitates with anti-phosphotyrosine antibodies showed that the
bands of tyrosine-phosphorylated Shc R397K were detected just above the
Ig heavy chain in cells expressing wild-type, QM1148, and QM1173, as
well as F5 EGF receptors (Fig. 3
).
Tyrosine phosphorylation of Shc R397K was EGF-dependent in these cells.
Anti-Grb2 immunoblot showed that Grb2 was coprecipitated with Shc R397K
in an EGF-dependent manner in these cells (Fig. 3
). The degree of
tyrosine phosphorylation of Shc R397K and the amount of Grb2
coprecipitated with Shc R397K were similar in these cells. Anti-Sos
immunoblot showed that coprecipitation of Sos with Shc R397K was also
detectable in cells expressing wild-type, QM1148, and QM1173 EGF
receptors, whereas coprecipitation of Sos with Shc R397K was barely
detectable in cells expressing F5 receptors (Fig. 3
). Furthermore,
antiphosphotyrosine immunoblots showed the coprecipitation of a
tyrosine-phosphorylated EGF receptors with Shc R397K in cells
expressing wild-type, QM1148, and QM1173, but not F5 EGF receptors
(data not shown). These results suggest that Shc R397K interacts with
tyrosines 1148 and 1173 of the activated EGF receptor, is
tyrosine-phosphorylated in an EGF-dependent manner, and associates with
Grb2-Sos complex. However, Shc R397K, which does not stably bind to EGF
receptors, mainly associates with Grb2, which does not form a complex
with Sos.

View larger version (60K):
[in this window]
[in a new window]
|
Figure 3. Phosphorylation of Shc R397K and Interaction of Shc
R397K with Grb2-Sos Complex
CHO cells coexpressing Shc R397K and wild-type, QM1148, QM1173, or F5
EGF receptors were left unstimulated or stimulated with 10
nM EGF for 2 min at 37 C. Cell lysates were
immunoprecipitated with anti-HSV antibodies and immunoblotted with
antibodies to phosphotyrosine (PY20), Grb2, Sos, and HSV. IgG, Ig heavy
chain. Representative of three separate experiments.
|
|
Interaction of Mutant Shc Having an Arginine-to-Lysine Substitution
at Residue 175 (Shc R175K) with Wild-Type and Mutant EGF Receptors
We then performed a binding study to examine whether the Shc SH2
domain binds to tyrosines 1148 and 1173 of the activated EGF receptor.
To this end, we coexpressed HSV epitope-tagged Shc R175K in CHO cells
overexpressing the wild-type, QM1148, or QM1173 EGF receptor. The
nuclear magnetic resonance structure of the Shc PTB domain has shown
that an arginine residue at 175 within Shc interacts with the
phosphotyrosine (22). Mutation of arginine to glutamine or lysine has
completely eliminated binding of phosphorylated protein, which binds
specifically to the Shc PTB domain (22). The expression levels of Shc
R175K were estimated to be several fold higher than those of endogenous
Shc (data not shown). Lysates prepared from these cells were
immunoprecipitated with anti-EGF receptor antibodies and immunoblotted
with anti-HSV antibodies. The bands of Shc R175K were barely detectable
just above the Ig heavy chain in cells expressing the wild-type,
QM1148, and QM1173 EGF receptors (Fig. 4
). However, the very faint band of Shc
R175K was detectable in the QM1173 EGF receptor immunoprecipitates when
the scale of the assay was increased. To examine the interaction of
mutant Shc lacking an intact PTB domain with EGF receptors more
precisely, we used anti-Shc antibodies to detect mutant Shc in anti-EGF
receptor immunoprecipitates. Anti-Shc antibodies are several times more
efficient than anti-HSV antibodies. Since it is impossible, using
anti-Shc antibodies, to distinguish point-mutated Shc from endogenous
Shc, we transiently expressed the T7 epitope-tagged deletion mutant of
Shc lacking the PTB domain (Shc
PTB) in CHO cells overexpressing
wild-type, QM1148, or QM1173 EGF receptors. Lysates prepared from these
cells were immunoprecipitated with anti-EGF receptor antibodies and
immunoblotted with anti-Shc antibodies. The band of Shc
PTB was
detectable in cells expressing QM1173, but not wild-type or QM1148, EGF
receptors in an EGF-dependent manner (Fig. 4
). When anti-T7 antibodies
were used for immunoblotting, Shc
PTB was undetectable in QM1173 EGF
receptor immunoprecipitates (data not shown).

View larger version (55K):
[in this window]
[in a new window]
|
Figure 4. Interaction of Shc R175K and Shc PTB with EGF
Receptors
CHO cells coexpressing Shc R175K (top panel) or
Shc PTB (bottom panel) and wild-type, QM1148, or
QM1173 EGF receptors were left unstimulated or stimulated with 10
nM EGF for 2 min at 37 C. Lysates from these cells were
immunoprecipitated with anti-EGF receptor (EGFR) antibodies and
immunoblotted with antibodies against HSV (top panel) or
Shc (bottom panel). Whole-cell lysates were
simultaneously immunoblotted with antibodies against HSV (top
panel) or Shc (bottom panel). IgG, Ig heavy
chain. Representative of three separate experiments.
|
|
We then examined tyrosine phosphorylation of Shc R175K and association
of Grb2-Sos complex with Shc R175K. Immunoblot analysis of anti-HSV
immunoprecipitates with anti-phosphotyrosine antibodies showed that
similar amounts of tyrosine-phosphorylated HSV-tagged Shc R175K were
observed just above the Ig heavy chain in cells expressing wild-type
and QM1173 EGF receptors in an EGF-dependent manner (Fig. 5
). However, tyrosine phosphorylation of
Shc R175K in response to EGF was markedly reduced in cells expressing
QM1148 receptors (Fig. 5
). Anti-Grb2 immunoblot showed that the bands
of Grb2 were detected below the Ig light chain. The amount of Grb2
coprecipitated with Shc R175K was similar in cells expressing wild-type
and QM1173 receptors but was markedly reduced in cells expressing
QM1148 receptors (Fig. 5
). However, anti-Sos immunoblot showed that the
bands of Sos coprecipitated with Shc R175K were barely detectable,
irrespective of the EGF receptor constructs expressed (Fig. 5
). These
results suggest that Shc R175K dominantly interacts with tyrosine
1173 of the activated EGF receptor, is tyrosine-phosphorylated in an
EGF-dependent manner, and associates with Grb2 that does not form a
complex with Sos.

View larger version (53K):
[in this window]
[in a new window]
|
Figure 5. Phosphorylation of Shc R175K and Interaction of Shc
R175K with Grb2-Sos Complex
CHO cells coexpressing Shc R175K and wild-type, QM1148, or QM1173 EGF
receptors were left unstimulated or stimulated with 10 nM
EGF for 2 min at 37 C. Cell lysates were immunoprecipitated with
anti-HSV antibodies and immunoblotted with antibodies to
phosphotyrosine (PY20), Grb2, Sos, and HSV. IgG, Ig heavy or light
chain. Representative of three separate experiments.
|
|
Coexpression of Both 52-kDa Shc R175K and 46-kDa Shc R397K with
Mutant EGF Receptors
We performed a third set of experiments in which both HSV-tagged
52-kDa Shc R175K and T7-tagged 46-kDa Shc R397K were coexpressed with
QM1148 or QM1173 EGF receptors. Expression levels of both mutants were
estimated to be almost similar (data not shown). After stimulation with
EGF, cell lysates were immunoprecipitated with either anti-HSV or
anti-T7 antibodies and then immunoblotted with anti-phosphotyrosine
antibodies. Since interaction of Shc R175K with the EGF receptor was
barely detectable, we assessed the interaction by tyrosine
phosphorylation of mutant Shc. In anti-HSV immunoprecipitates the band
of tyrosine-phosphorylated Shc R175K, migrated just above the Ig heavy
chain, was faint in both cells expressing QM1148 or QM1173 EGF
receptors (Fig. 6
). On the other hand, in
anti-T7 immunoprecipitates, p46 Shc R397K was dominantly
tyrosine-phosphorylated in both cells (Fig. 6
). In these cells,
antibodies to HSV and T7 brought down a similar amount of mutant Shc
proteins. These results emphasize that both tyrosines 1148 and 1173 of
the activated EGF receptor dominantly interact with the Shc PTB domain
in intact cells.

View larger version (31K):
[in this window]
[in a new window]
|
Figure 6. Coexpression of p46 Shc R397K and p52 Shc R175K
with Mutant EGF Receptors
CHO cells coexpressing p46 Shc R397K and p52 Shc R175K with QM1148 or
QM1173 EGF receptors were left unstimulated or stimulated with 10
nM EGF for 2 min at 37 C. Lysates from these cells were
immunoprecipitated with anti-HSV or anti-T7 antibodies and
immunoblotted with antibodies to phosphotyrosine antibodies (PY20) and
Shc. IgG, Ig heavy chain. Representative of three separate
experiments.
|
|
EGF-Dependent Membrane Translocation of Shc Mutants
To verify the dominant association of Shc R397K with EGF receptors
rather than Shc R175K, we expressed a similar amount of mutant Shc
proteins in cells expressing wild-type or F5 EGF receptors. Cell
lysates were fractionated, and the cytosol and membrane fractions were
immunoprecipitated with anti-HSV antibodies. By anti-HSV immunoblot,
mutant Shc proteins were detected just above the Ig heavy chain. Shc
R397K, but not Shc R175K, was detected in a membrane fraction in
an EGF-dependent manner (Fig. 7
). In
addition, Shc R397K was undetectable in a membrane fraction in cells
expressing the F5 EGF receptor, which lacked all five
autophosphorylation sites (Fig. 7
). Given that Shc R397K interacts with
Grb2-Sos complex and Shc R175K associates with Grb2, which does not
form a complex with Sos in cells expressing wild-type EGF receptors,
these results suggest that membrane translocation of Shc is necessary
for the association of Grb2-Sos complex with tyrosine-phosphorylated
Shc.

View larger version (30K):
[in this window]
[in a new window]
|
Figure 7. Subcellular Localization of Shc R175K and Shc R397K
in Cells Expressing Wild-Type and F5 EGF Receptors
CHO cells coexpressing Shc R175K or Shc R397K with wild-type or F5 EGF
receptors were left unstimulated or stimulated with 10 nM
EGF for 2 min at 37 C. Lysates fractionated into soluble (S) and
particulate fractions (P) were immunoprecipitated with anti-HSV
antibodies and immunoblotted with anti-HSV antibodies. IgG, Ig heavy
chain. Representative of two separate experiments.
|
|
In Vitro Ras Assay
To verify the preferable association of Grb2-Sos complex with Shc
R397K rather than Shc R175K, we determined Ras activity in anti-HSV
immunoprecipitates. CHO cells coexpressing Shc R175K or Shc R397K with
the wild-type EGF receptor were left unstimulated or stimulated with
EGF. HSV-tagged mutant Shc proteins were immunoprecipitated, and an
ability of the immune complexes to stimulate [
-32P]GTP
binding to recombinant H-Ras expressed as a fusion protein with
glutathione S-transferase (GST) was assessed. With the complexes
including Shc R175K and Shc R397K, the rate of binding of
[
-32P]GTP to GST-H-Ras was significantly stimulated
(Fig. 8
). Ras activity stimulated by the
complex containing Shc R397K was significantly higher than that by the
complex including Shc R175K. Given that Shc R397K more stably
associates with the activated EGF receptor than does Shc R175K and
translocates to plasma membrane in an EGF-dependent manner, these
results suggest that Shc translocated to plasma membrane plays an
important role in Ras activation signaling.

View larger version (14K):
[in this window]
[in a new window]
|
Figure 8. In Vitro Ras Activity Stimulated
with Immunoprecipitates of Shc R175K or Shc R397K
CHO cells coexpressing Shc R175K or Shc R397K with wild-type EGF
receptors were left unstimulated or stimulated with 10 nM
EGF for 2 min at 37 C. Lysates were immunoprecipitated with anti-HSV
antibodies, and an ability of immune complex to phosphorylate GST-H-Ras
was determined. Results were expressed as the percentage of
radioactivity stimulated with protein G-Sepharose beads alone. Results
shown are mean ± SEM of five separate experiments. *,
Significant difference vs. respective control; **,
significant difference vs. Shc R175K.
|
|
 |
DISCUSSION
|
---|
To clarify the interaction between the PTB or SH2 domain of Shc
and activated EGF receptors in intact cells, we carried out three sets
of experiments. Either Shc R175K, Shc R397K, or both were coexpressed
in CHO cells overexpressing the wild-type mutant lacking five
autophosphorylation sites and mutant EGF receptors that retain only one
of the autophosphorylation sites at tyrosine 1148 or 1173, the
dominant Shc binding sites. Mutation of arginine at 175 in the PTB
domain or 397 in the SH2 domain to lysine is shown to result in a
complete loss of binding activity of the PTB or SH2 domains,
respectively (21, 22). The expression levels of these Shc mutants were
several fold higher than those of endogenous Shc. The present results
indicate that the PTB domain of Shc interacts with both tyrosines 1148
and 1173 of activated EGF receptors with higher affinity than does the
Shc SH2 domain, and that binding of the Shc PTB domain to the EGF
receptor plays an important role in regulating the association of
Grb2-Sos complex with Shc and Ras activation signaling.
With respect to the interaction of the Shc PTB domain with tyrosines
1148 and 1173 of the activated EGF receptor, the amount of Shc R397K
associated with the QM1148 and QM1173 EGF receptor is nearly similar to
that with the wild-type EGF receptor. We have previously shown the
amount of endogenous Shc bound to mutant EGF receptors retaining only
one of the autophosphorylation sites at tyrosines 1148 or 1173 was
80% or
40% of the wild-type level, respectively (16). The
present result with the QM1148 EGF receptor is in agreement with our
previous results, while that with the QM1173 receptor seems
conflicting. This conflict may result from the increased levels of
mutant Shc proteins expressed. Excess amount of mutant Shc proteins may
inhibit the binding of other molecules, such as phospholipase C-
1,
to tyrosine 1173 of the activated EGF receptor. The Shc PTB domain is
known to recognize amino acids N-terminal to the phosphotyrosine
consisting of core NXXpY motif (13, 14, 15). In vitro binding
studies using synthetic phosphopeptides and GST fusion proteins (12, 13, 23, 24) and a study using the yeast two-hybrid system (25) have
shown that proline at position -2 to the phosphotyrosine increases the
binding affinity of the Shc PTB domain. Several studies of in
vitro binding assay using phosphopeptides (14, 15, 26, 27, 28) have
shown that, in addition to the NXXpY sequence, a leucine or hydrophobic
amino acid at position -5 to the phosphotyrosine, which contacts a
hydrophobic pocket formed by the PTB domain (22), is critical for the
tight binding of the Shc PTB domain. In addition, a ß-turn within the
phosphopeptide has been suggested integral for the interaction of the
Shc PTB domain with the phosphopeptide (26, 27, 28). These results suggest
that the amino acid sequence
XNPXpY (where
is
hydrophobic) is critical for tight binding. Since the
amino acid sequences surrounding tyrosines 1148 and 1173
of EGF receptors are LDNPDpY and AENAEpY, respectively, it seems likely
that the Shc PTB domain interacts with tyrosine 1148 more tightly than
with tyrosine 1173. In addition, the Shc PTB domain binds to a
phosphopeptide corresponding to tyrosine 1148 of the EGF receptor with
high affinity and to that corresponding to tyrosine 1173 with low
affinity (23).
Using the nuclear magnetic resonance and surface plasmon resonance
techniques, Zhou et al. (23) have shown that the
tyrosine-phosphorylated peptide corresponding to tyrosine 1173 of the
EGF receptor binds preferentially to the Shc SH2 domain rather than to
the Shc PTB domain. In addition, Batzer et al. (18) have
shown that phosphopeptide corresponding to tyrosine 1173 of the EGF
receptor inhibits the binding of GST-Shc SH2 domain to EGF receptors
more efficiently than it does that of GST-Shc PTB domain. These results
suggest that the Shc SH2 domain interacts with tyrosine 1173 with a
higher affinity than does the Shc PTB domain. In contrast to these
in vitro results, the present in vivo results
clearly indicate that the PTB domain binds to tyrosine 1173 of the
activated EGF receptor with higher affinity than does the SH2 domain.
In support of this finding, we have also observed that GST-Shc PTB
domain dominantly interacts with phosphorylated QM1173 EGF receptors by
in vitro binding assay using an excess of equimolar GST-Shc
PTB and GST-Shc SH2 domains (our unpublished observations).
A recent study of the transient expression of mutant Shc in HeLa cells
has shown that association of mutant Shc lacking an intact PTB domain
with EGF receptors is diminished (19), indicating that the Shc SH2
domain does not form a stable complex with the wild-type EGF receptors.
Consistent with this finding, the present results show that the
association of mutant Shc lacking an intact PTB domain with the
wild-type EGF receptor is hardly detectable. However, our results also
reveal that the Shc SH2 domain is able to interact with tyrosine 1173
of EGF receptors in intact cells, since the mutant Shc lacking an
intact PTB domain is tyrosine phosphorylated in cells expressing the
QM1173 EGF receptor. It seems unlikely that other ErbB families are
implicated in this process, since EGF-induced tyrosine phosphorylation
of the mutant Shc is dependent on the mutant EGF receptor construct
expressed. Actually, EGF-dependent tyrosine phosphorylation of the
mutant Shc is abolished in cells expressing the F5 EGF receptor (our
unpublished observation). The reason why the interaction between Shc
R175K and the QM1173 EGF receptor was hardly detectable is probably due
to the low-affinity interaction of Shc R175K with the receptor.
In the present study we have shown that Shc having an intact PTB domain
dominantly interacts with Grb2-Sos complex, while the interaction of
Grb2-Sos complex with Shc lacking an intact PTB domain is markedly
reduced. In addition, interaction of Grb2-Sos complex with Shc
retaining an intact PTB domain is also markedly reduced when this
mutant Shc is coexpressed in cells expressing the mutant EGF receptor
lacking five autophosphorylation sites. This suggests that plasma
membrane targeting is necessary for Grb2-Sos complex binding to
tyrosine-phosphorylated Shc. Alternatively, the stable interaction
of Shc with EGF receptors may cause conformational changes of Shc
molecules, which results in a high-affinity binding of Grb2-Sos complex
to receptor-associated and tyrosine-phosphorylated Shc. Further
studies are needed to address this issue.
In accordance with the results of immunoblot experiments, the ability
of Shc R397K immunoprecipitates to activate Ras is greater than that of
Shc R175K immunoprecipitates. Shc R175K immunoprecipitates retain the
ability to stimulate Ras activity in vitro, since Shc R175K
interacts with the EGF receptor, is tyrosine-phosphorylated, and
associates with small amounts of Grb2-Sos complex. Thus, the present
results suggest that tight association of Shc with EGF receptors might
mediate stable interaction of Grb2-Sos complex with Shc and Ras
activation signaling. Alternatively, Grb2 complexed with molecules
other than Sos might bind to Shc, which associates the EGF receptor via
the SH2 domain, with higher affinity than does Grb2-Sos complex. Recent
reports have shown that various molecules associate with Grb2,
including a putative nucleotide exchange protein Vav (29), a
protooncogene product Cbl (30), the 85-kDa subunit of
phosphatidylinositol 3-kinase (31), dynamin (32), and dystroglycan
(33), as well as Sos. This suggests that Shc, as well as Grb2, may play
some role in addition to that of regulating the Ras activation pathway.
We have examined which molecules form a complex with Grb2 that
associates with Shc R175K. However, we could not detect Cbl, the 85-kDa
subunit of phosphatidylinositol 3-kinase, and dynamin in the anti-Shc
R175K immunoprecipitates (our unpublished observation).
In conclusion, the Shc PTB domain interacts with the EGF receptor with
higher affinity than does the Shc SH2 domain, and Grb2-Sos complex
dominantly interacts with tyrosine-phosphorylated Shc that associates
the EGF receptor via the PTB domain, resulting in the activation of
Ras-signaling pathway.
 |
MATERIALS AND METHODS
|
---|
Tissue Culture
CHO cells overexpressing the wild-type, QM1148, QM1173, or F5
EGF receptors (16) were maintained in Hams F-12 medium supplemented
with 10% FBS.
Construction and Transfection of Expression Plasmids Carrying
Mutant Shc cDNA
A full-length human p52 Shc cDNA was isolated as described
previously (34). cDNA of mutant p52 Shc, Shc R175K, or Shc R397K,
tagged with a HSV epitope (YTDIEMNRLGK), was prepared by site-directed
mutagenesis and sequential PCR. Oligonucleotides
5'>GGCAGGCTTTCTGATTC<3' and 5'>GTGCTCTCCTTTACCAAGAAG<3' were used
for Shc R175K and Shc R397K mutagenesis, respectively. Oligonucleotides
used for PCR were the sense primer 5'>CATGCGGCCGCGGACATGAACAAGCTG<3',
the first round antisense primer
5'>CCTCTGGAGCGAGTTCAGGCTGCAGTTTCCGCTCCA-CAGG<3', and the
second round antisense primer
5'>ATTGCGGCCGCTTAATCTTCCGGATCCTCTGGAGCGAG-TTCAGG<3'.
cDNA of 46-kDa Shc R397K tagged with a T7 epitope (MASMTGGQQMG) was
prepared by sequential PCR, using the first-round sense primer
5'>ATGGCTAGCATGACTGGTGGACAGCAAATGGGACCCGGGGTTTCC<3', the second-round
sense primer 5'>GCGGAATTCACCATGGCTAGCATGACTGG<3', and antisense
primer 5'>AAGAGAATT-CTAGGGCAGATCACAGTTTCCGC<3'.
cDNAs of these mutants were subcloned into pcDNAI (Invitrogen, San
Diego, CA). The expression plasmids were introduced into CHO cells with
pHph (Boehringer Mannheim, Tokyo, Japan), which encodes hygromycin
resistance, using lipofectAMINE (Life Technologies, Gaithersburg, MD),
and appropriate transfectants were isolated using hygromycin (0.5
mg/ml).
Immunoprecipitation and Immunoblot Analysis
CHO cells expressing mutant Shc were serum-starved for 12 h
and then left unstimulated or stimulated with mouse EGF (Takara Shuzo,
Kyoto, Japan). The cells were immediately frozen in liquid nitrogen and
lysed in a buffer containing 20 mM Tris-HCl (pH 8.0), 137
mM NaCl, 10% glycerol, 1.0% Nonidet P-40, 2
mM EDTA, 1.0 mM Na3VO4,
1.0 mM phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin,
and 10 µM leupeptin. For the fractionation experiments,
CHO cells were homogenized in a buffer containing 50 mM
HEPES (pH 7.4), 150 mM NaCl, 1.5 mM
MgCl2, 1 mM EGTA, 100 mM NaF, 10
mM sodium pyrophosphate, 1 mM
Na3VO4, 1 mM phenylmethylsulfonyl
fluoride, 10 µg/ml aprotinin, and 10 µM leupeptin
(homogenization buffer). After centrifugation at 15,000 rpm for 5 min
at 4 C, the supernatants were saved as the cytosol fraction and the
pellets were solubilized in the homogenization buffer containing 1%
Triton X-100 and 10% glycerol. Clarified lysates were used as the
membrane fraction. Lysates were incubated with antibodies to EGF
receptor (Ab-1; Oncogene Science, Uniondale, NY), HSV epitope-tag
(Novagen, Madison, WI), or T7 epitope-tag (Novagen) coupled with
protein G-Sepharose (Pharmacia Biotech, Uppsala, Sweden) for 90 min at
4 C. Immunoprecipitates were washed three times with a solution
containing 20 mM HEPES (pH 7.5), 150 mM NaCl,
10% glycerol, 0.1% Triton X-100, and 1.0 mM
Na3VO4, and then boiled for 3 min in SDS sample
buffer. The samples were subjected to SDS-PAGE and transferred onto
nitrocellulose. Blots were blocked in 5% skim milk in Tris-buffered
saline and then probed with antibodies to phosphotyrosine (PY20; ICN
Biomedical, Costa Mesa, CA), Grb2 (Transduction Laboratories,
Lexington, KY), mSos1 (Transduction), Shc (16), HSV, and T7. Bound
antibodies were detected with horseradish peroxidase-conjugated
antibodies to mouse or rabbit IgG (Promega, Madison, WI) using the ECL
detection system (Amersham, Buckinghamshire, U.K.).
In Vitro Ras Assay
Cells were serum-starved for 12 h and then left
unstimulated or stimulated with 10 nM EGF for 2 min.
Immunoprecipitation was done as described above using anti-HSV
antibody. The immunoprecipitates were washed and resuspended in 10 µl
of a buffer containing 20 mM Tris-HCl (pH 7.4), 1
mM MgCl2, 1 mM dithiothreitol, 10
mM NaCl, and 50 µg/ml BSA in the presence of purified
H-ras (5 µg/ml). H-ras protein was expressed as a GST-fusion protein
in bacteria and purified by glutathione-agarose column (Pharmacia). The
reaction was started at 32 C by the addition of 1 µCi
[
-32P]GTP (
3000 Ci/mmol, Amersham). After 30 min,
the reaction mixtures were centrifuged and the supernatants were
filtered through nitrocellulose. Radioactivity associated with the
filters was quantified. In parallel, assay with protein G-Sepharose
beads alone was run as a control. Results are expressed as the
percentage of radioactivity obtained with beads alone.
 |
ACKNOWLEDGMENTS
|
---|
We thank Dr. M. Shibuya for donating human EGF receptor
cDNA.
 |
FOOTNOTES
|
---|
Address requests for reprints to: Dr. Yoshinori Okabayashi, The Second Department of Internal Medicine, Kobe University School of Medicine, Chuo-ku, Kobe 650, Japan.
1 This work was supported by a grant to Y. O. and a grant-in-aid for
Cancer Research to M. K. from the Ministry of Education, Science,
and Culture of Japan. 
Received for publication October 23, 1997.
Revision received January 2, 1998.
Accepted for publication January 9, 1998.
 |
REFERENCES
|
---|
-
Ullrich A, Schlessinger J 1990 Signal transduction by
receptors with tyrosine kinase activity. Cell 61:203212[Medline]
-
Carpenter G, Cohen S 1990 Epidermal growth factor. J
Biol Chem 265:77097712[Free Full Text]
-
Pawson T 1995 Protein modules and signalling networks. Nature 37:573580
-
Pelicci G, Lanfrancone L, Grignami F, McGlade J,
Cavallo F, Forni G, Nicoletti I, Grignami F, Pawson T, Pelicci PG 1992 A novel transforming protein (SHC) with an SH2 domain is implicated in
mitogenic signal transduction. Cell 70:93104[Medline]
-
Kavanaugh WM, Williams LT 1994 An alternative to SH2 domains
for binding tyrosine-phosphorylated proteins. Science 266:18621865[Medline]
-
Blaikie P, Immanuel D, Wu J, Li N, Yajnik V, Margolis B 1994 A region in Shc distinct from the SH2 domain can bind
tyrosine-phosphorylated growth factor receptors. J Biol Chem 269:3203132034[Abstract/Free Full Text]
-
Rozakis-Adcock M, McGlade J, Mbmalu G, Pelicci G,
Daly R, Li W, Batzer A, Thomas S, Brugge J, Pelicci PG,
Schlessinger J, Pawson T 1992 Association of the Shc and Grb2/Sem5
SH2-containing proteins is implicated in activation of the Ras pathway
by tyrosine kinases. Nature 360:689692[CrossRef][Medline]
-
Cutler RL, Liu L, Damen JE, Krystal G 1993 Multiple cytokines
induce the tyrosine phosphorylation of Shc and its association with
Grb2 in hemopoietic cells. J Biol Chem 268:2146321465[Abstract/Free Full Text]
-
Pronk GJ, deVries-Smits MM, Buday L, Downward J, Maassen JA,
Madema R, Bos JL 1994 Involvement of Shc in insulin- and epidermal
growth factor-induced activation of p21ras. Mol Cell Biol 14:15751581[Abstract]
-
Ravichandran KS, Lee KK, Songyang Z, Cantley LC, Burn P,
Burakoff SJ 1993 Interaction of Shc with the zeta chain of the T cell
receptor upon T cell activation. Science 262:902905[Medline]
-
Egan SE, Giddings BW, Brooks MW, Buday L, Sizeland AM,
Weinberg RA 1993 Association of Sos Ras exchange protein with Grb2 is
implicated in tyrosine kinase signal transduction and transformation.
Nature 363:4551[CrossRef][Medline]
-
Songyang Z, Margolis B, Chaudhuri M, Shoelson SE, Cantley LC 1995 The phosphotyrosine interaction domain of SHC recognizes
tyrosine-phosphorylated NPXY motif. J Biol Chem 270:1486314866[Abstract/Free Full Text]
-
Kavanaugh WM, Turck CW, Williams LT 1995 PTB domain
binding to signaling proteins through a se-quence motif containing
phosphotyrosine. Science 268:11771179[Medline]
-
Laminet AA, Apell G, Conroy L, Kavanaugh WM 1996 Affinity,
specificity, and kinetics of the interaction of the SHC phosphotyrosine
binding domain with asparagine-X-X-phosphotyrosine motifs of growth
factor receptors. J Biol Chem 271:264269[Abstract/Free Full Text]
-
van der Geer P, Wiley S, Gish GD, Lai VK-M, Stephens R, White
MF, Kaplan D, Pawson T 1996 Identification of residues that control
specific binding of the Shc phosphotyrosine-binding domain to
phosphotyrosine sites. Proc Natl Acad Sci USA 93:963968[Abstract/Free Full Text]
-
Okabayashi Y, Kido Y, Okutani T, Sugimoto Y, Sakaguchi K,
Kasuga M 1994 Tyrosines 1148 and 1173 of activated human epidermal
growth factor receptors are binding sites of Shc in intact cells.
J Biol Chem 269:1867418678[Abstract/Free Full Text]
-
Batzer AG, Rotin D, Urena JM, Skolnik EY, Schlessinger J 1994 Hierarchy of binding sites for Grb2 and Shc on the epidermal
growth factor receptor. Mol Cell Biol 14:51925201[Abstract]
-
Batzer AG, Blaikie P, Nelson K, Schlessinger J, Margolis B 1995 The phosphotyrosine interaction domain of Shc binds an LXNPXY
motif on the epidermal growth factor receptor. Mol Cell Biol 15:44034409[Abstract]
-
Yajnik V, Blaikie P, Bork P, Margolis B 1996 Identification of
residues within the SHC phosphotyrosine binding/phosphotyrosine
interaction domain crucial for phosphopeptide interaction. J Biol
Chem 271:18131816[Abstract/Free Full Text]
-
Zhou M-M, Meadows RP, Logan TM, Yoon HS, Wade WS, Ravichandran
KS, Burakoff SJ, Fesik SW 1995 Solution structure of the Shc SH2 domain
complexed with a tyrosine-phosphorylated peptide from the T-cell
receptor. Proc Natl Acad Sci USA 92:77847788[Abstract]
-
Mayer BJ, Jackson PK, Van Etten RA, Baltimore D 1992 Point
mutations in the abl SH2 domain coordinately impair phosphotyrosine
binding in vitro and transforming activity in
vivo. Mol Cell Biol 12:609618[Abstract]
-
Zhou M-M, Ravichandran KS, Olejniczak ET, Petros AM,
Meadows RP, Sattler M, Harlan JE, Wade WS, Burakoff SJ, Fesik SW 1995 Structure and ligand recognition of the phosphotyrosine binding domain
of Shc. Nature 378:584592[CrossRef][Medline]
-
Zhou M-M, Harlan JE, Wade WS, Crosby S, Ravichandran KS,
Burakoff SJ, Fesik SW 1995 Binding affinities of
tyrosine-phosphorylated peptides to the COOH-terminal SH2 and
NH2-terminal phosphotyrosine binding domains of Shc. J Biol Chem 270:3111931123[Abstract/Free Full Text]
-
Prigent SA, Pillay TS, Ravichandran KS, Gullick WJ 1995 Binding of Shc to the NPXY motif is mediated by its N-terminal domain.
J Biol Chem 270:2209722100[Abstract/Free Full Text]
-
Gustafson TA, He W, Craparo A, Schaub CD, ONeill TJ 1995 Phosphotyrosine-dependent interaction of SHC and insulin receptor
substrate 1 with the NPEY motif of the insulin receptor via a novel
non-SH2 domain. Mol Cell Biol 15:25002508[Abstract]
-
Dikic I, Batzer AG, Blaikie P, Obermeier A, Ullrich A,
Schlessinger J, Margolis B 1995 Shc binding to nerve growth factor
receptor is mediated by the phosphotyrosine interaction domain. J
Biol Chem 270:1512515129[Abstract/Free Full Text]
-
Trub T, Choi WE, Wolf G, Ottinger E, Chen Y, Weiss M, Shoelson
S 1995 Specificity of the PTB domain of Shc for ß turn-forming
pentapeptide motifs amino-terminal to phosphotyrosine. J Biol Chem 270:1820518208[Abstract/Free Full Text]
-
Wolf G, Trub T, Ottinger E, Groninga L, Lynch A, White MF,
Miyazaki M, Lee J, Shoelson SE 1995 PTB domains of IRS-1 and Shc have
distinct but overlapping binding specificities. J Biol Chem 270:2740727410[Abstract/Free Full Text]
-
Ye ZS, Baltimore D 1994 Binding of Vav to Grb2 through
dimerization of Src homology 3 domains. Proc Natl Acad Sci USA 91:1262912633[Abstract/Free Full Text]
-
Meisner H, Conway BR, Hartley D, Czech MP 1995 Interactions of Cbl with Grb2 and phosphatidylinositol 3'-kinase in
activated Jurkat cells. Mol Cell Biol 15:35713578[Abstract]
-
Wang J, Auger KR, Jarvis L, Shi Y, Roberts TM 1995 Direct
association of Grb2 with the p85 subunit of phosphatidylinositol
3-kinase. J Biol Chem 270:1277412780[Abstract/Free Full Text]
-
Ando A, Yonezawa K, Gout I, Nakata T, Ueda H, Hara K, Kitamura
Y, Noda Y, Takenawa T, Hirokawa N, Waterfield MD, Kasuga M 1994 A
complex of Grb2-dynamin binds to tyrosine-phosphorylated insulin
receptor substrate-1 after insulin treatment. EMBO J 13:30333038[Abstract]
-
Yang B, Jung D, Motto D, Meyer J, Koretzky G, Campbell KP 1995 SH3 domain-mediated interaction of dystroglycan and Grb2. J Biol
Chem 270:1171111714[Abstract/Free Full Text]
-
Okabayashi Y, Sugimoto Y, Totty NF, Hsuan J, Kido Y, Sakaguchi
K, Gout I, Waterfield MD, Kasuga M 1996 Interaction of Shc with adaptor
protein adaptins. J Biol Chem 271:52655269[Abstract/Free Full Text]