Interactions of Estrogen- and Thyroid Hormone Receptors on a Progesterone Receptor Estrogen Response Element (ERE) Sequence: a Comparison with the Vitellogenin A2 Consensus ERE

Roderick E. M. Scott, X. Sharon Wu-Peng, Paul M. Yen, William W. Chin and Donald W. Pfaff

Neurobiology and Behavior (R.E.M.S., X.S.W-P., D.W.P.), Rockefeller University, New York, New York 10021,
Division of Genetics, Brigham and Women’s Hospital and Harvard Medical School (P.M.Y., W.W.C.), Boston, Massachusetts 02115


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
The identification of hormone response elements in the promoter regions of hormonally regulated genes has revealed a striking similarity between the half-site of the estrogen-response element (ERE) and a consensus sequence constituting the thyroid hormone-response element. Because of the potential for thyroid hormone (T3) to affect estrogen (E)- and progesterone-dependent female reproductive behavior via EREs, we have begun to investigate the activity of an ERE identified in the progesterone receptor (PR) proximal promoter and its interactions with the estrogen receptor (ER) and thyroid hormone receptors (TR). In addition, we have compared ER and TR interactions on the PR ERE construct with that of the vitellogenin A2 (vit A2) consensus ERE. Electrophoretic mobility shift assays demonstrated that TR binds to the PR ERE as well as to the consensus ERE sequence in vitro. Further, these two EREs were differentially regulated by T3 in the presence of TR. T3 in the presence of TR{alpha} increased transcription from a PR ERE construct ~5-fold and had no inhibitory effect on E induction. Similarly, T3 also activated a ß-galactosidase reporter construct containing PR promoter sequences spanning -1400 to +700. In addition, the TR isoforms ß1 and ß2 also stimulated transcription from the PR ERE construct by 5- to 6-fold. A TR{alpha} mutant lacking the ability to bind AGGTCA sequences in vitro failed to activate transcription from the PR ERE construct, demonstrating dependence on DNA binding. In contrast to its actions on the PR ERE construct, TR{alpha} did not activate transcription from the vit A2 consensus ERE but rather attenuated E-mediated transcriptional activation. Attenuation from the vit A2 consensus ERE is not necessarily dependent on DNA binding as the TR{alpha} DNA binding mutant was still able to inhibit E-dependent transactivation. In contrast to TR{alpha}, the isoforms TRß1 and TRß2 failed to inhibit E-induced activation from the vit A2 consensus ERE. These results demonstrate that the PR ERE construct differs from the vit A2 consensus ERE in its ability to respond to TRs and that divergent pathways exist for activation and inhibition by TR. Since ERs, PRs, and TRs are all present in hypothalamic neurons, these findings may be significant for endocrine integration, which is important for reproductive behavior.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Progesterone receptors (PRs) mediate the actions of the progestin hormones and act in a sex- and tissue-specific fashion to mediate a number of reproductive functions (1). These receptors are intranuclear receptor proteins, which function as ligand-modulated transcription factors and are members of a large family of related hormone-dependent nuclear proteins, including the steroid, thyroid, and retinoid receptors that share common functional domains (2, 3). These are responsible for properties such as ligand binding, dimerization, DNA binding, and transactivation (2, 4). Ligand binding is typically followed by dimerization with subsequent binding of the ligand-receptor complex to specific DNA sequences possessing a high level of dyad symmetry. Such binding sites are termed "hormone-response elements" (HRE) (5, 6) and contain perfect or imperfect palindromic or directly repeating half-sites that are normally five to six nucleotides in length. It is through these sequences that the steroid receptors exert their regulatory influence on discrete genes (7, 8).

It has been demonstrated that estrogen (E) facilitates the induction of female reproductive behavior (1). In addition, it has been demonstrated that E is also responsible for PR induction at the level of protein as well as mRNA in most target tissues (9, 10, 11) and that there is a strong correlation between this induction of PR by E and the occurrence of female reproductive behavior in rats (10, 12, 13). Further, experiments using antisense DNA against PR mRNA (14) as well as PR blockers have shown that synthesis and occupation of PR are required for normal reproductive behavior (15, 16). The E-induced increase in the number of PR mRNA-containing neurons in the ventromedial hypothalamus (VMH) and arcuate nucleus suggests an explanation for the permissive effect of E on progesterone (P)-facilitated reproductive behavior. By increasing the number of PR-containing neurons present in these hypothalamic nuclei, E increases the responsiveness of these cell groups to P.

Whereas PRs are also expressed in uterus and oviduct, PRs in the brain are produced in a highly specific pattern, with expression limited to discrete brain regions (17). Brain regions that contain large numbers of PR expressing cells include the VMH, arcuate nucleus, and the preoptic area. In addition to demonstrating tissue specificity, PR is also regulated in a sex-specific fashion. In adult females levels of PR mRNA are significantly increased in the VMH and arcuate nucleus after E treatment. In contrast, E shows little or no effect on levels of PR binding sites or mRNA in the VMH of male rats (18, 19, 20). Further, adult females show greater sensitivity to P than males, as reflected by dissimilarities in P-mediated neuroendocrine regulation (21) and differences in the capacity to display the P-facilitated behavior, lordosis (13).

The molecular mechanisms responsible for the regulation of PR gene transcription are of primary interest for two reasons. First, insight into its regulation yields information on the actions of an important steroid hormone-dependent transcription factor, and second, it would facilitate the understanding of the factors that are involved in neuronal circuits responsible for reproductive behavior at the molecular level. It has already been observed that the half-site of the estrogen-response element (ERE) is identical to the half-site of the thyroid hormone-response element (TRE) (22). Indeed, manipulations of thyroid hormone (TH) and E in vitro potentiate or mutually inhibit effects of gene expression (22, 23, 24). In addition, environmental conditions that alter levels of circulating TH, such as cold temperature, alter E-dependent female reproductive behavior (25, 26, 27, 28). Further, recent experiments demonstrated that both exogenous and endogenous TH interfered with E-induced sexual behavior (29).

Our laboratory, along with others, has recently cloned a large part of the rat PR-regulatory region (30, 31) and has demonstrated that the sequence from -1400 to +700 is responsive to E (32). A number of potential EREs have been identified within this sequence, and one ERE that appears to be biologically active and is found across species is located at +617/+629 (33). Although not very frequent, intragenic regulatory elements have been described for other genes (34, 35). An homologous sequence that has been shown to bind estrogen receptor (ER) as well as being transcriptionally active is found in the rabbit, located at +698/+723 (36). The rabbit and rat PR ERE sequence is conserved in eight of the ten positions relative to the consensus ERE. Because of recent evidence demonstrating interactions between TRs and EREs (22, 37), and their implication in modulating female reproductive behavior (29), we have begun to investigate the effects of thyroid hormone receptor (TR) on the regulation of PR. Here, the properties of an ERE and its flanking sequence, identified in the PR promoter, were compared with those of the well characterized consensus ERE from the vitellogenin A2 gene. Unexpectedly, TR had distinctly different transcriptional effects on two different EREs tested, and results demonstrate different activity in response to T3-mediated effects via TR. Our results show that in the presence of T3, the TR isoforms {alpha}, ß1, and ß2 activated transcription from a PR ERE construct and that DNA binding was necessary for transcriptional activation. In contrast, TRs were unable to activate transcription from the vitellogenin A2 (vit A2) ERE. Further, TR{alpha} attenuated E-induced activation from this ERE, with DNA binding appearing not necessary for this attenuation. In addition, attenuation was isoform-specific in that TRß1 and ß2 had no effect on E-induced activation.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
TR as Well as ER Bind to a PR- and Consensus ERE
To evaluate direct DNA-protein interactions on the putative PR ERE as well as to the consensus ERE, electrophoretic mobility shift assay (EMSA) was used. Initially, rat hypothalamic nuclear protein extracts were incubated with labeled vit A2 consensus ERE (Fig. 1AGo) or with labeled PR ERE probe (Fig. 1BGo). To demonstrate specificity, protein binding to either probe could be competed out with excess amount of cold probe in a concentration-dependent manner. The lower, denser band observed with the PR ERE probe was caused by nonspecific binding; no oligomer, even in large molar excess, could reduce the signal of this band. Binding of ER from hypothalamic extracts to these probes was indirectly demonstrated by using excess cold consensus ERE to decrease levels of bound probe. Similarly, indirect evidence of TR binding to these probes was demonstrated by decreasing the levels of bound probe after addition of the TREs, F2H and DR4, in excess. No such decrease was observed when excess amounts of cold glucocorticoid response elements were added in the assay.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 1. Hypothalamic Nuclear Factors Bind to the PR ERE and vit A2 Consensus ERE

Hypothalamic nuclear extract (10 µg) from ovariectomized (OVX) female rats was incubated with either the consensus ERE probe (A) or with the PR ERE probe (B) and analyzed by EMSA as described in Materials and Methods. The arrow in A and B indicates position of specific binding. Cold probe was added in excess (10x or 50x), demonstrating specificity of the interaction. Specific binding could be competed away by addition of TR binding elements F2H and DR4. No effect on specific binding was observed with either probe when cold glucocorticoid response elements were added in excess. The first lanes in panel A and B show migration of the free probes. The control lane represents labeled probe incubated with hypothalamic extract alone. The numbers above the lanes indicate the molar excess of unlabeled oligos added.

 
Initial results demonstrated a possible interaction between the PR ERE sequence and ER and TR; thus we used purified TR{alpha} and ER to examine their binding directly (Fig. 2Go). EMSA demonstrated that both purified ER and TR bound the vit A2 ERE (Fig. 2AGo) and PR ERE sequence (Fig. 2BGo) quite efficiently. Using antibodies to ER and TR{alpha} we demonstrated that hypothalamic nuclear protein extracts bound to these probes included ER and TR (Fig. 3Go). A supershift is observed when the ER-specific antibody H222 is added to the hypothalamic extract, whereas a decrease in specific binding is seen when a TR{alpha}-specific antibody is added to the hypothalamic nuclear extract. A decrease in signal is likely caused by antibody binding to the TR and interfering with protein-DNA interactions. These results demonstrate that ER and TR have the ability to bind to a putative ERE on the PR promoter region as well as to a consensus ERE.



View larger version (77K):
[in this window]
[in a new window]
 
Figure 2. Purified TR and ER Bind to the PR ERE as Well as to the Consensus ERE

Both TR and ER bind to the vit A2 consensus ERE (A), and a supershift is observed when the purified ER is preincubated with the ER-specific antibody H222. No such shift is observed with control antibody. Purified TR (0.5 pmol) or ER (0.25 pmol) incubated with the PR ERE (B) results in a shift in mobility of the PR ERE probe. A supershift is observed when the ER protein is preincubated with the ER-specific antibody H222. No such shift is seen when ER is preincubated with the control antibody.

 


View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. Preincubation with ER-Specific or TR-Specific Antibodies Affects Binding of Nuclear Factors to the PR ERE

Hypothalamic nuclear extracts from ovariectomized (OVX) female rats (10 µg) were preincubated with the ER-specific antibody H222 and a TR{alpha}-specific antibody. A supershift is observed with addition of the ER-specific antibody H222 (upper arrow). The lower arrow indicates position of specific binding to the PR ERE. TR{alpha} antibody preincubated with hypothalamic extract from OVX female rats demonstrates a decrease in specific binding to the PR ERE sequence. Specific antibodies against ER and against TR{alpha} were added to the hypothalamic extract and preincubated at 4 C overnight before addition of labeled probe. The first lane shows preincubation of hypothalamic extracts with preimmune serum.

 
E Responsiveness of the PR ERE
We have previously demonstrated that the region -1400/+700 of the rat PR gene is responsive to E (32). To assess the ability of the putative PR ERE fragment to regulate expression, we isolated the rat sequence homologous to the rabbit sequence used in the binding studies. This fragment (+618/630) was inserted upstream of the thymidine kinase (tk) promoter and chloramphenicol acetyl transferase (CAT) coding sequence. This construct was then transfected into CV-1 cells along with 2 µg of the expression vector coding for the ER (Fig. 4AGo). Only a very small increase in transcription could be observed after addition of 10-7 M E. However, when this ERE was placed in tandem with itself, synergistic activation of transcription by E was observed. On the double PR ERE, ER showed moderate levels of activation. On the triple PR ERE construct we found a relatively high level of transcriptional activity by ER. This is similar to what has been observed by others with this element (33). That this stimulation of transcription was hormone dependent was demonstrated by adding increasing concentrations of E to the transfected CV-1 cells (Fig. 4BGo). CAT activity was assayed as a function of E concentration. At the lowest concentration (10-7 M), no effect was observed in CV-1 cells but CAT activity increased in parallel with the increase in E concentration.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 4. Effects of E on a PR ERE-tk Promoter Construct

A, Ten micrograms of a reporter construct containing zero, one, two, or three copies of the PR ERE sequence (+618/630+) of the rat PR gene inserted upstream of the tk promoter sequence were co-transfected along with 2 µg of an ER expression vector into CV-1 cells and analyzed for E responsiveness as described in Materials and Methods. B, The PR (ERE)3 construct activity was examined as a function of E concentration after cotransfection with an ER expression vector into CV-1 cells. CAT activity was determined 24 h following hormone treatment. The results represent the mean of duplicate determinations for a representative experiment.

 
Effects Of E and T3 on CAT Activity from the Consensus ERE Compared with the PR(ERE)3
EMSA results implied that a possible role for TR as well as ER exists in the regulation of PR expression in vivo, via the PR ERE sequence. To investigate the transcriptional response of the PR and consensus ERE to T3 as well as E, 2 µg ER and/or TR{alpha} expression vectors were cotransfected into CV-1 cells with 10 µg of a CAT construct containing the tk promoter under the control of the consensus ERE or three copies of the PR ERE. Figure 5Go shows the effects of E and/or T3 on the vit A2 consensus ERE in the presence/absence of ER and TR{alpha}. Figure 6Go shows the results obtained with the PR ERE. Treatment with E alone stimulated CAT activity from the vit A2 consensus (Fig. 5Go) both in the presence and absence of TR{alpha} (5- to 6-fold). Treatment with T3 alone had no effect on the CAT activity of the vit A2 consensus ERE even in the presence of TR{alpha}. However, addition of T3 to E-treated cells cotransfected with the vit A2 ERE construct and TR{alpha} and ER attenuated the E-dependent stimulation of CAT activity (see Fig. 5Go). As with the vit A2 consensus ERE, E alone stimulated CAT activity from the PR ERE sequence (Fig. 6Go). However, in contrast to the vit A2 consensus ERE, addition of T3 in the presence of TR{alpha} alone stimulated transcriptional activity of the PR ERE-CAT construct 5- to 6-fold (Fig. 6Go). Further, unlike the consensus ERE, T3 in the presence of TR{alpha} had no inhibitory effect on E induced stimulation via ER of the PR ERE CAT construct.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Activity of the vit A2 Consensus ERE after Treatment with E2 and/or T3 in the Presence of ER and/or TR{alpha}

The 19-bp sequence containing the vit A2 ERE was attached to the tk promoter, and 10 µg were cotransfected into CV-1 cells with 2 µg ER and/or a TR{alpha} expression vector as described in Materials and Methods. Cells were treated with E (10-7 M) and/or T3 (10-7 M), and CAT activity was measured. Values are expressed as the mean ± SEM, where n = 3–4 for each duplicate experiment. *, P < 0.01 as compared with vehicle control. #, P < 0.01 as compared with the E-treated ER + TR group (Newman-Keuls test). E2 and T3 had no effect on a tk construct lacking the ERE (data not shown).

 


View larger version (14K):
[in this window]
[in a new window]
 
Figure 6. Activity of PR(ERE)3 after Treatment with E2 and/or T3 in the Presence of ER and/or TR{alpha}

PR(ERE)3 construct (10 µg) was transfected into CV-1 cells with 2 µg ER and/or TR{alpha} and treated with E (10-7 M) and/or T3 (10-7 M) as described The values are expressed as the mean ± SEM, where n = 3–4 for each duplicate experiment. *, P < 0.01 as compared with vehicle control.

 
Effects of the TR Isoforms ß1 and ß2 on Expression from the Consensus ERE and PR(ERE)3
At least three functional isoforms of the TR, termed TR{alpha}, TRß1, and TRß2, have been identified. Each isoform has the potential for acting in a dissimilar manner on exposure to T3. We thus tested the effects of the two ß-isoforms on expression from the vit A2 consensus and PR ERE and compared them to the results obtained previously with the TR{alpha} form (see Figs. 5Go and 6Go). Our previous results demonstrated an inhibitory effect by T3 on E-induced activation from the vit A2 consensus ERE in the presence of 2 µg TR{alpha} (Fig. 5Go). In contrast, transfection with 2 µg TRß1 or TRß2 had no attenuating effect on E-induced activation from the consensus ERE after addition of T3 (Fig. 7Go, A and B). To ensure that sufficient levels of TR ß-isoforms were present, increasing amounts of DNA were added to the transfection. Despite the addition of up to 15 µg TR ß1 or ß2 expression vector in the transfection, no attenuation of E-induced activation could be detected. However, treatment of the PR ERE-CAT construct with T3 in the presence of 2 µg TRß1 or TRß2 expression vector had a similar result as when treated in the presence of TR{alpha}. All three isoforms activated the PR ERE in the presence of T3 alone (5- to 7-fold), and T3 had no attenuating effect in the presence of E (Fig. 8Go).



View larger version (17K):
[in this window]
[in a new window]
 
Figure 7. Activity of the TR Isoforms ß1 and ß2 on the vit A2 Consensus ERE-tk CAT Construct

The vit A2 consensus ERE was transfected into CV-1 cells (10 µg) along with 2 µg ER expression vector and increasing amounts of TRß1 (A) or a TRß2 expression vector as shown. Cells were treated with E (10-7 M) and/or T3 (10-7 M) for 24 h, and CAT activity was subsequently assayed. Values are expressed as the mean ± SEM, where n = 3 for a duplicate experiment. *, P < 0.01 compared with vehicle.

 


View larger version (12K):
[in this window]
[in a new window]
 
Figure 8. Activity of the TR Isoforms ß1 and ß2 on the PR(ERE)3-CAT Construct

PR(ERE)3 construct (10 µg) was transfected into CV-1 cells along with 2 µg ER expression vector and 2 µg TRß1 (A) or a TRß2 (B) expression vector. Cells were treated with E (10-7 M) and/or T3 (10-7 M). CAT activity was measured 24 h following addition of hormones. Values are expressed as the mean ± SEM where n = 3 for a duplicate experiment. *, P < 0.01 as compared with vehicle.

 
Inhibition by T3 on the Consensus ERE Not Affected by a DNA-Binding Mutant of TR{alpha}, but Loss of Activation by T3 is observed on the PR ERE
Two possible mechanisms of repression by TRs have been suggested. In one mechanism, direct binding of the TR to the ERE is necessary to prevent DNA access of related proteins or to act as a silencer protein. A second possibility is that TR interacts through protein-protein interactions to inhibit expression and is not dependent on direct contact with DNA. To explore possible mechanisms of inhibition on the consensus ERE, as well as to determine whether direct interaction of the TR{alpha} with the PR ERE is necessary for the activation by T3, cotransfection experiments with 2 µg of a mutated TR{alpha} were performed. The TR{alpha} construct used here contains the ligand-binding and dimerization domain as well as a portion of the hinge region but contains a mutation in the p-box, affecting its ability to bind DNA (38). After cotransfection of the TR{alpha}p' mutation construct and ER expression construct with the vit A2 consensus ERE, inhibition of E-dependent CAT activity was still observed after addition of T3 (Fig. 9AGo). In contrast, no stimulation of the PR ERE construct was detected by T3 after cotransfection with the TR{alpha}p' (Fig. 9BGo). Further, no effects of T3 were observed on the PR ERE on addition of E after cotransfection of the ER expression construct along with the TR{alpha}p' construct.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 9. Activity of a TR{alpha} DNA-Binding Mutant on E Responsiveness of the PR (ERE)3 and Consensus ERE-tk Promoter Construct

The PR (ERE)3 and consensus ERE reporter vectors were transfected into CV-1 cells as described in Materials and Methods along with 2 µg ER expression vector and 2 µg TR{alpha} DNA-binding mutant expression vector. After transfection, cells were treated for 24 h with 10-7 M E, 10-7 M T3, or vehicle. The activity of the constructs was assessed by CAT assays as described in Materials and Methods. Values are expressed as the mean ± SEM where n = 3–4. *, P < 0.01 as compared with vehicle. #, P < 0.01 compared with E2 treatment group.

 
Activation by T3 of PR Promoter Sequences
The endogenous PR promoter does not contain three identical copies of an ERE arranged in tandem, and therefore the PR (ERE)3 construct used in these studies is somewhat artificial. We therefore tested the responsiveness of a single PR ERE copy to T3 (Fig. 10AGo). After cotransfection of 10 µg of a CAT construct containing a single copy of the PR ERE attached to a tk promoter and 2 µg of a TR{alpha} expression vector, CAT activity was increased ~2-fold after treatment with T3. In addition, we tested the responsiveness of the PR promoter sequence from -1400 to +700 attached to a ß-galactosidase reporter gene, which we have previously demonstrated to be responsive to E (32). Upon transfection and after addition of 10-7 M T3, the PR promoter sequence was able to initiate transcription of the ß-galactosidase gene, and ß-galactosidase activity was observed (Fig. 10BGo). This activity was hormone dependent, and little activity was observed when treated with vehicle. No activity was observed in the absence of the PR promoter sequence.



View larger version (30K):
[in this window]
[in a new window]
 
Figure 10. Effects of T3 on PR Promoter Sequences

A, Ten micrograms of a CAT reporter construct containing a single copy of the PR ERE sequence (+618/+630) were cotransfected along with 2 µg of a TR{alpha} expression vector into CV-1 cells and examined for T3 responsiveness. Values are expressed as the mean ± SEM where n = 3. B, CV-1 cells were cotransfected with 10 µg of a PR reporter construct containing the ß-galactosidase gene under the regulation of a PR promoter fragment spanning -1400/+700, along with 2 µg of a TR{alpha} expression vector. After treatment with either T3 (10-7 M) or vehicle for 24 h, cells were fixed and stained for ß-galactosidase activity.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Accumulated evidence has demonstrated that control of E-responsive gene regulation can be quite complex (39). Several lines of evidence indicate that gene regulation by E and EREs involve not only ER but also other transcription factors and DNA-binding proteins. For example, other members of the nuclear hormone receptor family such as TR, retinoid X receptor and retinoic acid receptor have been shown to interact with EREs in addition to their cognate response elements (22, 37, 40). Recently, it has been proposed that T3 and its receptor play a role in the inhibition of E-dependent reproductive behavior (29). PR, along with ER, plays a central role in this specific behavior; this suggests that TR could be playing a direct role on PR by down-regulating its promoter activity. Thus, we began to examine the effects of TR and its ligand T3 on binding and transcriptional activities of E-induced activation from a PR ERE and its flanking sequence. Our experiments compare and contrast the results obtained with the consensus vit A2 ERE with those obtained with an ERE and adjacent flanking sequences found on the PR gene.

ER and TR interact on the PR ERE
Initially, to identify some of the hypothalamic factors that could associate with these EREs, interactions of a PR-ERE and a consensus ERE from the vit A2 gene with nuclear protein extracts from rat hypothalamus were examined. The results from both the competition assays and supershift assays suggest that ER was present in these extracts and could bind to the PR ERE. The presence of ER in rat hypothalamic extract is consistent with ligand binding, immunocytochemical, and in situ hybridization assays (41, 42, 43). However, what is perhaps of greater interest is that TREs were able to compete for specific binding with the PR ERE and vit A2 ERE probes and that preincubation of the hypothalamic nuclear extract with a TR antibody was able to diminish binding to the PR ERE probe. Further, purified TR{alpha} protein was able to bind to the PR ERE as well as the vit A2 ERE. In addition, it has recently been shown that TRß1 and TRß2 can also interact with the consensus ERE (44). These results demonstrate that hypothalamic TR as well as ER can potentially interact on the PR ERE and its adjacent flanking sequence. The rat medial hypothalamus has both ER- and TR-containing neurons in overlapping regions, including the VMN (45, 46, 47). These results therefore suggest that TRs can interact with E-responsive genes in the hypothalamus, such as PR, with the potential to affect behavioral systems.

Transcriptional Regulation of the PR and vit A2 EREs by ER and TR
Our results demonstrate that the imperfect ERE located at +617/+629 of the rat PR first exon has endogenous responsiveness to E as well as an ability to bind ER. In addition, the homologous sequence found in the rabbit gene has shown a similar responsiveness to E (36). However, it is clear from a number of studies that natural HREs rarely conform to the idealized consensus sequence. Such deviations from the consensus sequence can affect binding and transcriptional activity of the cognate receptor. It appears that the change of two bases within the core PR ERE and the different flanking sequences are sufficient to result in a weaker responsiveness to E when compared with the strong activational activity observed with the vit A2 ERE. It is likely that together, the different imperfect EREs identified within the endogenous PR promoter can synergize to result in a strong response to E.

In addition to E, liganded TR also resulted in activation from the PR ERE construct, and this activation was observed with all isoforms of TR examined. Liganded TR{alpha} also activated a ß-galactosidase reporter gene attached to a -1400/+700 bp PR promoter sequence in CV-1 cells. The TR{alpha} DNA-binding mutant failed to activate transcription from the PR ERE construct, demonstrating that transcriptional activation by TR was DNA dependent, supporting our EMSA analysis. Activation by liganded TR was observed from a single PR ERE element, thereby discounting the possibility that an artificial TRE had been created during subcloning of the multiple construct. However, it remains possible that transcriptional activation by TRs from the PR ERE construct is via an imperfect TRE that might exist adjacent to, or even overlapping, the ERE identified in the PR promoter and that is contained within the flanking region of the ERE itself.

In light of recent findings showing an inhibitory effect of T3 on E- and P-stimulated reproductive behavior (29), these results demonstrating activation of the PR ERE construct by liganded TR were somewhat unexpected. However, we cannot rule out the possibility that T3 inhibits PR expression within the context of the cellular environment of the hypothalamus or that other neuronal circuits interact with T3 to alter levels of the PR gene in an inhibitory fashion. We are examining this question in vivo by in situ hybridization for PR mRNA after treatment with E and T3 in brain sections, as well as by solution hybridization with pituitary and hypothalamic RNA extracts.

In contrast to the effects of liganded TR on the PR ERE, however, we have demonstrated that addition of T3 in the presence of TR{alpha} leads to attenuation of E-induced activation of the vit A2 consensus ERE-reporter gene. This is consistent with previous reports examining the effects of TR on E-induced activation from the vit A2 ERE (22). Many nuclear receptors, including TR, have been shown to exert transcriptional control by both inductive and inhibitory mechanisms, depending on the cell context, hormone status, and DNA-binding site, including flanking sequences of the HRE (48). Our findings have demonstrated that liganded TR{alpha} both activates transcription from one ERE (PR ERE) and also inhibits E-induced activation from another ERE (vit A2 consensus ERE), both within the context of the same cell type. In addition, attenuation of E-induced activation from the vit A2 consensus ERE by liganded TR appears to be isoform-specific as under these conditions, in contrast to the {alpha}-form, the ß-forms of TR have no effect on E-induced activation. Higher amounts of TR plasmids were tested to ensure that sufficient TR ß-isoform were present. Despite this, addition of up to 15 µg TR ß1 or ß2 expression plasmid was still insufficient to detect attenuation of E-induced activation from the vit A2 consensus ERE. However, under identical conditions, 2 µg of the ß-forms were sufficient to activate transcription from the PR ERE construct, and further that a F2H-reporter fusion gene is induced by both the {alpha}- and ß1-form in CV-1 cells (our unpublished observation). A similar result was observed when T3 regulation of TR responsive genes was examined (49). In addition, TR isoform-specific action has been reported for the repression of glucocorticoid receptor-mediated transcriptional activation (50).

Inhibitory regulation of gene transcription has been reported in a number of systems (for review see 51 . For example, the formation of inactive dimers may block transcriptional activity (52, 53), while in some cases it appears that the mechanism of inhibition involves competition of the inhibitory and activating factors for binding to the appropriate DNA-regulatory sequence (37, 54). Negative regulation may also result as a consequence of protein-protein interactions and does not require DNA binding (55, 56). Our results demonstrate that a TR{alpha} DNA-binding mutant retains the ability to attenuate the E-induced activation from the vit A2 consensus ERE. This indicates that the inhbitory function of TR{alpha} can be mediated through protein-protein interactions, and that TR binding to the ERE alone is not necessary for this inhibition. For example, a "squelching" mechanism may be occurring whereby ER and TR share common transcription factors or coactivators. Such a model has been reported to be in operation in other systems (57). In contrast, transcriptional activation from the PR ERE construct by TR was strictly DNA-dependent, suggesting that divergent pathways exist for transcriptional activation and inhibition by TR. A similar study demonstrated that ER and glucocorticoid receptor could block T3-mediated transcriptional activity but had little if any effect on repression of basal transcription by unliganded TR (58). In addition, TR binding to the HRE is enhanced by association with TR auxiliary proteins, and it is clear that these proteins play an important role in T3 mediated transcription (59, 60).

Our results demonstrate that liganded TR can interact with a sequence present in the PR promoter and regulate transactivation from that promoter. That the hypothalamus has neurons containing ER, PR, and TR further raises the possibility that TR can directly interact with the PR promoter to regulate its activity. Such interactions among hormonal systems are biologically relevant given the implications that circulating TH can have on reproductive behavior.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
All general reagents were of molecular biology grade and were purchased from Sigma Chemical Co. (St. Louis, MO), Fisher Scientific (Houston, TX), and Promega (Madison, WI). Custom oligonucleotides were purchased from Oligos Etc Inc (Wilsonville, OR). DNA restriction and modifying enzymes were obtained from Boeringer Mannheim (Indianapolis, IN). 32P-radiolabeled nucleotides and [14C]chloramphenicol were from DuPont/New England Nuclear Corp (Boston, MA). Sera, antibiotics, and other cell culture reagents were from Sigma and GIBCO/BRL (Gaithersberg, MD).

Electrophoretic Mobility Shift Assays
All animal studies were conducted in accord with the principles and procedures outlined in "Guidelines for care and use of experimental animals." Sprague-Dawley rats used for EMSA experiments were maintained in a 12-h light, 12-h dark cycle and fed water and chow ad libitum. Ovariectomy and gonadectomy were performed by the supplier (Charles River, Wilmington, MA) and hormone treatments were carried out 10 days after surgery. Estradiol benzoate (Sigma Co, St Louis, MO) was dissolved in vehicle (sesame oil). Three hours after hormone treatment, rats were treated by CO2 narcosis and decapitated.

Due to its availability at the outset of these studies, initial DNA-binding analysis was carried out using the rabbit PR ERE (+698/723) as probe. Subsequent studies involving transcriptional regulation were done using the equivalent sequence identified from the rat PR promoter, after cloning in our laboratory. Nuclear extracts from the hypothalamus of male and female rats were prepared as described previously (61). Ten picomoles of double-stranded oligonucleotide, which had been annealed previously, were labeled by T4 polynucleotide kinase with [{gamma}-32P]ATP, and 20,000 cpm (5–10 fmol) were incubated together with 10 µg nuclear extract for 30 min at room temperature along with 1 µg poly(deoxyinosinic-deoxycytidylic)acid in a final reaction volume of 20 µl of a buffer consisting of 10 mM HEPES (pH 7.8), 10% glycerol, 50 mM KCl, 0.1 mM EDTA, and 5 mM phenylmethylsulfonyl fluoride. Where appropriate, double-stranded cold competitor oligonucleotide was added to the extract for 15 min at room temperature before addition of labeled probe. The entire reaction mixture was electrophoresed through a 5% polyacrylamide gel in 0.5x Tris-borate-EDTA for 2–3 h at ~150 V. Gels were dried and subjected to autoradiography at -70 C. For experiments involving antibodies, the reaction mixture was incubated with antibodies (1 µl) at 4 C overnight before addition of labeled probe. Where indicated, purified protein was used instead of hypothalamic extracts and treated under similar conditions as described above. The rat TR{alpha} protein was from a crude extract from a baculovirus-expressed TR in Sf9 cells. The human ER was prepared from a Sf9 cell extract and purified by ERE-affinity chromatography, and the purity was estimated at greater than 90%.

Oligomers and Plasmid Construction
The following oligonucleotides were used as either nuclear protein-binding sites or competitors in gel retardation assays.

PR ERE: 5'GTTCAGGTCGACATGACTGAGGTGAAGGC-A3'

Consensus ERE: 5'AATTCGTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTT3'

DR4: 5'ACTTATTGAGGTCACACTAGGTCAAGTTACG3'

Fig 2HGo: 5'TTATTGACCCCAGCTGAGGTCAAGTTACG3'

PR ERE constructs containing one, two, or three copies of the rat ERE sequence were made by annealing the following combinations of single-stranded oligomers and ligating the resultant double-stranded oligomers via their compatible overhangs into the vector digested with the appropriate restriction enzymes. All cloning was done using standard techniques (62). Thus, oligos 1 and 2 were annealed and ligated via their compatible ends into the CAT vector previously digested with HindIII and SalI. Oligos 3 and 4 were then annealed and ligated via their compatible ends into the CAT vector already containing one copy of the PR ERE previously digested with SalI and XbaI. Finally, oligos 5 and 6 were annealed and ligated via their compatible ends into the CAT vector already containing two copies of the PR ERE previously digested with XbaI and BamHI. Correct orientation of the inserted DNA fragments was confirmed by sequencing and restriction digest analysis.

1. 5'AGCTTAAAAGGGGATCTCGGGTCGTCATGACTGA-GCTGCAGGCAAATG3' and

2. 5'TCGACCTTTGCCTGCAGCTCAGTCATGACGACCC-GAGATCCCCTTTTA3'.

3. 5'TCGACAAAAGGGGATCTCGGGTCGTCATGACTGA-GCTGCAGGCAAAGT3' and

4. 5'CTAGACTTTGCCTGCAGCTCAGTCATGACGACCC-GAGATCCCCTTTTG3'.

5. 5'CTAGAAAAAGGGGATCTCGGGTCGTCATGACTGA-GCTGCAGGCAAAGG3' and

6. 5'GATCCCTTTGCCTGCAGCTCAGTCATGACGACCC-GAGATCCCCTTTTT3'.

Cell Culture and CAT Assays
For transfection and subsequent CAT assays the African Green Monkey kidney cell line CV-1 was used and maintained in DMEM supplemented with 10% FBS, 100 µg/ml glutamine. Before transfection, cells were plated on 60-mm plates and grown to 60–80% confluency in phenol red-free DMEM supplemented with 5% charcoal-stripped FBS. All media included penicillin (100 U/ml) and streptomycin (100 µg/ml). Transfection studies were carried out using the calcium phosphate procedure described previously (63). Each plate received 10 µg CAT reporter plasmid and 2 µg receptor expression plasmid. When the dose response of TRß expression plasmids was tested, 5 µg, 10 µg, or 15 µg receptor expression plasmid were added to each 60-mm plate. Supercoiled plasmid DNA was prepared using plasmid DNA preparation kits (Qiagen, Chatsworth, CA). A ß-galactosidase reporter plasmid (Promega, Madison, WI) was included in the transfection for normalization between samples. Bluescript SK-plasmid was added to the transfection mixture, so that 20 µg DNA were applied to each plate. Media were removed 12–14 h after addition of DNA and replaced with 5% stripped FBS medium supplemented with vehicle, 17-ß-estradiol (E2), T3, or both, after a 30-min incubation in medium containing 5% stripped serum. Cells were harvested after 24 h and lysed by repeated freeze-thawing in 0.25 M Tris, pH 7.8. CAT assays were carried out as previously described (63). CAT assays were normalized by either protein content via the Bradford procedure (64) or by ß-galactosidase activity for each sample. All assays were visualized by autoradiography using [14C]chloramphenicol (50 Ci/mmol), and the conversion of chloramphenicol to acetylated forms was quantified by liquid scintillation counting of TLC-separated material.

Staining for ß-Galactosidase Activity
CV-1 cells were plated on 60-mm plates and grown to 60–80% confluency and transfected with 2 µg TR{alpha} and 10 µg of the PR promoter sequence spanning -1400 to +700 attached to a ß-galactosidase reporter gene. Cells were then treated with T3 or vehicle for 24 h. Cells were fixed in a 2% formaldehyde, 0.2% gluteraldehyde solution and stained in a solution containing X-gal (40 mg/ml in dimethyl formamide) to give a final concentration of 1 mg/ml. In addition, the staining solution contained 5 mM K ferricyanide, 5 mM K ferrocyanide, and 2 mM MgCL2. This solution was used to detect ß-galactosidase activity.

Statistics
The data are expressed as the mean ± SEM and were analyzed by ANOVA, with multiple comparisons by the method of Newman-Keuls when ANOVA was significant (P < 0.01).


    ACKNOWLEDGMENTS
 
We are thankful to Dr. A. Notides for the purified ER and to Dr. G. Greene for the ER-specific antibody H222.


    FOOTNOTES
 
Address requests for reprints to: Dr. Roderick E. M. Scott, Department of Neurobiology and Behavior, Rockefeller University, 1230 York Avenue, New York, New York 10021.

This work was supported by NIH Grant HD-0571 (to D.W.P.) and Endocrine Research Training Grant 2T32DK07313 (to R.E.M.S.).

Received for publication December 30, 1996. Revision received June 25, 1997. Accepted for publication July 7, 1997.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Pfaff DW, Schwartz-Giblin S 1994 In: Knobil E, Neill J (eds) The Physiology of Reproduction, ed 2. Raven Press, New York, pp 107–220
  2. Evans RM 1988 The steroid and thyroid hormone receptor superfamily. Science 240:889–895[Medline]
  3. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Kazuhiko U, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[Medline]
  4. Glass CK 1994 Differential recognition of target genes by nuclear receptor monomers, dimers, and heterodimers. Endocr Rev 15:391–407[Medline]
  5. Yamamoto KR, 1985 Steroid receptor regulated transcription of specific genes and gene networks. Annu Rev Genet 19:209–252[CrossRef][Medline]
  6. Beato M 1989 Gene regulation by steroid hormones. Cell 56:335–344[Medline]
  7. Landers JP, Spelsberg TC, 1992 New concepts in steroid hormone action: transcription factors, proto-oncogenes, and the cascade model for steroid regulation of gene expression. Crit Rev Eukar Gene Exp 2:19–63[Medline]
  8. Freedman LP, Luisi BF 1993 On the mechanism of DNA binding by nuclear hormone receptors: a structural and functional perspective. J Cell Biochem 51:140–150[Medline]
  9. MacLusky NJ, McEwen BS 1980 Progestin receptors in rat brain: distribution and properties of cytoplasmic progestin binding sites. Endocrinology 106:192–201[Abstract]
  10. Parsons B, MacLusky, NJ, Krey, L, Pfaff DW, McEwen BS 1980 The temporal relationship between estrogen-inducible progestin receptors in the female rat brain and the time course of estrogen activation of mating behavior. Endocrinology 107:774–779[Medline]
  11. Romano GJ, Krust A, Pfaff DW 1989 Expression and estrogen regulation of progesterone receptor mRNA in neurons of the mediobasal hypothalamus: an in situ hybridization study. Mol Endocrinol 3:1295–1300[Abstract]
  12. Whalen RE 1974 Estrogen-progesterone induction of mating in female rats. Horm Behav 5:157–162[Medline]
  13. Olster DH, Blaustein JD 1988 Progesterone facilitation of lordosis in male and female rats following priming with estradiol pulses. Horm Behav 22:294–304[Medline]
  14. Ogawa S, Olazabal UE, Parhar IS, Pfaff DW 1994 Effects of intrahypothalamic administration of antisense DNA for progesterone receptor mRNA on repoductive behavior and progesterone receptor immunoreactivity in female rat. J Neurosci 14:1766–1774[Abstract]
  15. Brown TJ, Blaustein JD 1984 Inhibition of sexual behavior in female guinea pigs by a progestin receptor antagonist. Brain Res 301:343–349[CrossRef][Medline]
  16. Vathy IU, Etgen AM, Barfield RJ 1989 Actions of RU 38486 on progesterone facilitation and sequential inhibition of rat estrous behavior: correlation with neural progestin receptor levels. Horm Behav 23:43–56[Medline]
  17. Parsons B, Rainbow TC, Maclusky NJ, McEwen BS 1982 Progestin receptors in rat hypothalamic and limbic nuclei. J Neurosci 2:1446–452[Abstract]
  18. Rainbow TC, Parsons B, McEwen BS, 1982 Sex differences in rat oestrogen and progestin receptors. Nature 300:648–649[Medline]
  19. Brown TJ, Clark AS, MacLusky NJ 1987 Regional sex differences in progesterone receptor induction in the rat hypothalamus: effects of various doses of estradiol benzoate. J Neurosci 7:2529–2536[Abstract]
  20. Lauber AH, Romano GJ, Pfaff DW 1991 Sex difference in estradiol regulation of progestin receptor mRNA in rat mediobasal hypothalamus as demonstrated by in situ hybridization. Neuroendocrinology 53:608–613[Medline]
  21. Negro-Vilar A, Tesone M, Johnston CA, Depaolo L, Justin SN 1984 Sex differences in regulation of gonadotropin secretion: involvement of central monoaminergic and peptidergic systems and brain steroid receptors. In: Sexual Differentiation: Basic and Clinical Aspects. Raven Press, New York, pp 107–118
  22. Glass CK, Holloway JM, Devary OV, Rosenfeld MG 1988 The thyroid hormone receptor binds with opposite transcriptional effects to a common sequence motif in thyroid hormone and estrogen response elements. Cell 54:313–323[Medline]
  23. Zhou-Li F, 1992 Antiestrogens prevent the stimulatory effects of L-triiodothyronine on cell proliferation. Endocrinology 130:1145–1152[Abstract]
  24. Zhou-Li F 1993 Interference between estradiol and L-triiodothryonine in the control of proliferaton of a pituitary tumor cell line. J Steroid Biochem Mol Biol 45:275–279[CrossRef][Medline]
  25. Hoar RM, Goy RW, Young WC 1957 Loci of action of thyroid hormone on reproduction in the female guinea pig. Endocrinology 60:337–346
  26. Piacsek BE, Nazian SJ, Thermal influences on sexual maturation in the rat. In: Gilmore D, Cooke B (eds) Environmental Factors in Mammalian Reproduction. McMillan, London, pp 215–231
  27. Bronson FH 1985 Mammalian reproduction: an ecological perspective. Biol Reprod 31:1–26[Abstract]
  28. Schneider JE, Wade GN 1990 Effects of diet and body fat on cold-induced anestrus in syrian hamsters. Am J Physiol 259:R1198–R1204
  29. Dellovade TL, Zhu Y-S, Krey L, Pfaff DW 1996 Thyroid hormone and estrogen interact to regulate behavior. Proc Natl Acad Sci USA 93:12581–12586[Abstract/Free Full Text]
  30. Kraus WL, Montano MM, Katzenellenbogen BS 1993 Cloning of the rat progesterone receptor gene 5'-region and identification of two functionally distinct promoters. Mol Endocrinol 7:1603–1616[Abstract]
  31. Wu-Peng XS, Pfaff DW, Estrogen regulation of the rat progesterone receptor (PR) gene. Program of the 24th Annual Meeting of the Society for Neuroscience, Miami Beach, FL, 1994, p 56 (Abstract 30.20)
  32. Scott REM, Wu-Peng XS, Yen PM, Chin WW, Pfaff DW, Hypothalamic nuclear DNA binding, activity of a progesterone receptor promoter estrogen response element. Program of the 10th International Congress of Endocrinology, San Francisco, 1996, p 139 (Abstract P1–17)
  33. Kraus WL, Montano MM, Katzenellenbogen 1994 Identification of multiple, widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Mol Endocrinol 8:952–969[Abstract]
  34. Queen C, Baltimore D 1983 Immunoglobulin gene transcription is activated by downstream sequence elements. Cell 33:741–748[Medline]
  35. Sap J, De Magistris L, Stunnenberg H, Vennstrom B 1990 A major thyroid hormone response element in the third intron of the rat growth hormone gene. EMBO J 9:887–896[Abstract]
  36. Savouret, JF, Bailly A, Misrahi M, Rauch M, Redeuilh G, Chauchereau A, Milgrom E 1991 Characterization of the hormone responsive element involved in the regulation of the progesterone receptor gene. EMBO J 10:1875–1883[Abstract]
  37. Segars JH, Marks MS, HirschfeldS, Driggers PH, Martinez E, Grippo JF, Wahli W, Ozato K 1993 Inhibition of estrogen-responsive gene activation by the retinoic x receptor ß: evidence for multiple inhibitory pathways. Mol Cell Biol 13:2258–2268[Abstract]
  38. Yen PM, Ikeda M, Wilcox EC, Brubaker JH, Spanjaard RA, Sugawara A, Chin WW 1994 Half site arrangement of hybrid glucocorticoid and thyroid hormone response elements specifies thyroid hormone receptor complex binding to DNA and transcriptional activity. J Biol Chem 269:12704–12709[Abstract/Free Full Text]
  39. Gronemeyer H 1991 Transcription activation by estrogen and progesterone receptors. Annu Rev Genet 25:89–123[CrossRef][Medline]
  40. Savouret J-F, Rauch M, Redeuilh G, Sokhavuth S, Chauchereau A, Woodruff K, Parker MG, Milgrom E 1994 Interplay between estrogens, progestins, retinoic acid and AP-1 on a single regulatory site in the progesterone receptor gene. J Biol Chem 269:28955–28962[Abstract/Free Full Text]
  41. Lauber AH, Romano GJ, Mobbs CV, Pfaff DW 1990 Estradiol regulation of estrogen receptor messenger ribonucleic acid in rat mediobasal hypothalamus: an in situ hybridization study. J Neuroendocrinol 2:605–611
  42. Blaustein JD, Lehman MN, Turcotte JC, Greene G 1992 Estrogen receptors in dendrites and axon terminals in the guinea pig hypothalamus. Endocrinology 131:281–290[Abstract]
  43. Simerly RB, Chang C, Muramutsa M, Swanson LW 1990 Distribution of androgen and estrogen receptor mRNA-containing cells in the rat brain: an in situ hybridization study. J Comp Neurol 294:76–95[Medline]
  44. Zhu, Y-S, Yen PM, Chin WW, Pfaff DW 1996 Estrogen and thyroid hormone interaction on regulation of gene expression. Proc Natl Acad Sci USA 93:12587–12592[Abstract/Free Full Text]
  45. Cook CB, Kakucska I, Lechan RM, Koenig RJ 1992 Expression of thyroid hormone receptor ß2 in rat hypothalamus. Endocrinology 130:1077–1079[Abstract]
  46. Bradley DJ, Towle HC, Young S 1992 Spatial and temporal expression of {alpha}- and ß-thyroid hormone receptor mRNAs, including the ß2-subtype, in the developing mammalian nervous system. J Neurosci 12:2288–2302[Abstract]
  47. Lechan RM, QIY, Berrodin TJ, Davis KD, Schwartz HL, Strait KA, Oppenheimer JH, Lazar MA 1993 Immunocytochemical delineation of thyroid hormone receptor ß2-like immunoreactivity in the rat central nervous system. Endocrinology 132:2461–2469[Abstract]
  48. Mader S, Leroy P, Chen J-Y, Chambon P 1993 Multiple parameters control the selectivity of nuclear receptors for their response elements. J Biol Chem 268:591–600[Abstract/Free Full Text]
  49. Forman BS, Marc B, Yang C-R, Stanley F, Casenova J, Samuals HH 1988 c-erbA protooncogenes mediate thyroid hormone-dependent and independant regulation of the rat growth hormone and prolactin genes. Mol Endocrinol 2:902–911[Abstract]
  50. Spanjaard RA, Nyugen VYP, Chin WW 1995 Repression of glucocorticoid receptor-mediated transcriptional activation by unliganded thyroid hormone receptor (TR) is TR isoform-specific. Endocrinology 136:5084–5092[Abstract]
  51. Yen PM, Chin WW 1994 Molecular mechanisms of dominant negative activity by nuclear hormone receptors. Mol Endocrinol 8:1450–1454[Medline]
  52. Tung L, Mohamed MK, Hoeffler JP, Takimoto GS, Horwitz KB 1990 Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors. Mol Endocrinol 7:1256–1265[Abstract]
  53. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O’Malley BW, McDonnell DP 1993 Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol 7:1244–1255[Abstract]
  54. Sakai DD, Helms S, Carlsted-Duke J, Gustafsson JA, Rottman FM, Yamamoto KR 1988 Hormone-mediated repression: a negative glucocorticoid response element from the bovine prolactin gene. Genes Dev 2:1144–1154[Abstract]
  55. Yang-Yen HF, Chambard JL, Sun YL, Smeal T, Schmidt, TJ, Drouin J, Karin M 1990 Transcriptional interference between c-Jun and the glucocorticoid receptor: mutual inhibition of the DNA binding due to direct protein-protein interactions. Cell 62:1205–1215[Medline]
  56. Konig H, Ponta H, Rahmsdorf HJ, Herrlich P 1992 Interference between pathway-specific transcription factors: glucocorticoids antagonize phorbol ester-induced AP-1 activity without altering AP-1 site occupation in vivo. EMBO J 11:2241–2246[Abstract]
  57. Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS, Tung L 1996 Nuclear receptor coactivators and corepressors. Mol Endocrinol 10:1167–1177[Abstract]
  58. Yen PM, Wilcox EC, Chin WW 1995 Steroid hormone receptors selectively affect transcriptional activation but not basal repression by thyroid hormone receptors. Endocrinology 136:440–445[Abstract]
  59. Yen PM, Darling DS, Cater RL, Forgione M, Umeda PK, Chin WW 1992 Triiodothryonine (T3) decreases binding to DNA by T3-receptor homodimers but not receptor- auxiliary protein heterodimers. J Biol Chem 267:3565–3568[Abstract/Free Full Text]
  60. Sande S, Privalsky ML 1996 Identification of TRACs (T3 receptor associated cofactors), a family of cofactors that associate with and modulate the activity of nuclear hormone receptors. Mol Endocrinol 10:813–829[Abstract]
  61. Zhu Y-S, Pfaff DW 1994 Protein-DNA binding assay for analysis of steroid sensitive neurons in mammalian brain. Methods Neurosci 22:245–264
  62. Sambrook J, Fritsch EF, Maniatis T 1989 Molecular Cloning: A Laboratory Manual, ed 2. Cold Spring Harbor Press, Cold Spring Harbor, NY
  63. Gorman C 1985 High efficiency gene transfer into mammalian cells. In: Glover DM (ed) DNA Cloning: A Practical Approach. IRL Press, Washington DC, vol 3:143–190
  64. Bradford MM 1976 A rapid and sensitive method for the quantification of microgram quantites of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254[CrossRef][Medline]