The Activating Enzyme of NEDD8 Inhibits Steroid Receptor Function
Meiyun Fan1,
Xinghua Long1,
Jason A. Bailey,
Chad A. Reed,
Elizabeth Osborne,
Edward A. Gize,
Eric A. Kirk,
Robert M. Bigsby and
Kenneth P. Nephew
Medical Sciences (M.F., X.L., J.A.B., C.A.R., E.O., E.A.K.,
K.P.N.), Indiana University School of Medicine, Bloomington, Indiana
47405; and Department of Obstetrics & Gynecology (X.L., R.M.B., K.P.N.)
and Department of Cellular and Integrative Physiology (E.A.G., R.M.B.,
K.P.N.), Indiana University School of Medicine, Indianapolis, Indiana
46202
Address all correspondence and requests for reprints to: Kenneth P. Nephew, Ph.D., Medical Sciences, Indiana University School of Medicine, 302 Jordan Hall, 1001 East Third Street, Bloomington, Indiana 47405-4401. E-mail: knephew{at}indiana.edu
 |
ABSTRACT
|
---|
Coregulator proteins, coactivators and corepressors, have a
profound influence on steroid receptor activity and play a role in
regulating receptor levels. To identify novel coregulators of nuclear
receptors, we used the ligand-binding and hinge region of ER
as bait
in a yeast two-hybrid screen of a cDNA library derived from rat uterine
luminal epithelium. We report the cloning and characterization of a
cDNA encoding a protein homologous to yeast and human
ubiquitin-activating enzyme 3 (Uba3), the catalytic subunit of the
activating enzyme of the ubiquitin-like NEDD8 (neural precursor
cellexpressed developmentally down-regulated)
conjugation pathway (known as neddylation). Sequence analysis
revealed that Uba3 contains multiple nuclear receptor (NR)-interacting
motifs (NR boxes), which are known to mediate interactions between
coregulatory proteins and ligand-activated NRs. Yeast two-hybrid and
glutathione-S-transferase pull-down assays demonstrated
that Uba3 directly interacts with ligand-occupied ER
and ERß.
Transient transfection of Uba3 in mammalian cells inhibited ER-mediated
transactivation in a time-dependent fashion; Uba3 had no effect on the
initial events of transcriptional activation by liganded ER, but it
blocked the progressive increase in target gene expression during
continuous stimulation. Uba3 also inhibited transactivation by AR and
PR in mammalian cells but had no effect on a steroid
receptor-independent transactivation pathway. An enzymatically silent
form of Uba3 did not inhibit ER-induced transcription, and a
Uba3-binding fragment of amyloid precursor protein-binding protein, the
other subunit of the NEDD8-activating enzyme, partially overcame
Uba3-mediated inhibition, demonstrating that the neddylation activity
of Uba3 is required for its inhibition of steroid receptor
transactivation. Thus, Uba3 inhibits transcription induced by steroid
hormone receptors through a novel mechanism that involves the
neddylation pathway. Understanding the mechanisms controlling hormone
responsiveness of target tissues, such as the uterus and mammary gland,
may lead to novel insights of therapeutic intervention.
 |
INTRODUCTION
|
---|
THE SEX STEROID hormones, estrogen,
progesterone, and testosterone (T) regulate diverse biological
processes by acting through their cognate nuclear hormone receptors,
ER, PR, and AR. For example, estrogenic signals are transmitted by
ER
and ERß, members of the NR superfamily related by structure and
function (1, 2). Upon ligand binding, ER binds directly to
its cognate estrogen-responsive element (ERE) and recruits coactivator
proteins to stimulate expression of target genes (3, 4).
Cellular response to estrogen is tightly controlled, and a large number
of ER-interacting proteins have been described as coactivators or
corepressors that modify ER transcriptional activity (4).
Changes in expression or activity of coregulators can contribute to
estrogen and antiestrogen responsiveness of target cells (5, 6), including breast cancer (7, 8, 9), presumably by
influencing ER activity. Receptor levels and dynamics have also been
shown to have a profound influence on target tissue responsiveness and
sensitivity to estrogen (10). The primary regulator of
cellular ER levels is the ligand itself. Estrogen induces a rapid
down-regulation of ER protein and mRNA in a variety of cells and
tissues, e.g. human breast cancer cells, rat fibroblasts,
and rat uterus (11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26). 4-Hydroxytamoxifen (Tam)
also induces ER down-regulation in rat uterus, where it is an agonist
of ER, but with much slower kinetics than E2 (27);
however, in human breast cancer MCF-7 cells, where Tam is an
antagonist, the antiestrogen had no effect on ER levels
(28). Collectively, these observations suggest that ER
transcriptional activity is related to receptor down-regulation.
Activation of NRs and other transcription factors appears to be
coupled to degradation of these proteins by the ubiquitin-proteasome
pathway (29, 30, 31, 32). Lonard et al.
(33) reported that the 26S proteasome is essential for
ER
transcription activity and degradation in response to E2.
Furthermore, several components of the ubiquitin-proteasome pathway
have been identified as NR-interacting proteins, including E6-AP, a
ubiquitin-protein ligase (34), and suppressor for
galactose (SUG1), a component of the PA700 proteasome-regulatory
complex (35). Several recent studies demonstrated that
BRCA1 interacts with ER
and suppresses ER-mediated transactivation
activity (36, 37). Interestingly, BRCA1 has also been
shown to possess intrinsic ubiquitin protein ligase activity
(38), although the contribution of the ligase activity to
BRCA1-mediated suppression on ER activity remains to be established.
Together, these observations suggest that the ubiquitin-proteasome
pathway may play an important role in regulating NR levels and
restricting the duration and magnitude of receptor activity in response
to hormones, but more than one mechanism may exist.
Components of the ubiquitin-proteasome pathway that modulate
steroid hormone receptors, including E6-AP and SUG1, interact with the
C-terminal domain region, which encompasses a ligand-dependent
activation function (AF2). The model we have been using to study
interactions of ER with ligands and coregulators (27, 39, 40) is the rat uterus, and we used the AF-2 and hinge region of
ER
as bait in a yeast two-hybrid screen of a cDNA library derived
from rat uterine luminal epithelium. Here we report the isolation and
characterization of a cDNA clone encoding rat ubiquitin-activating
enzyme 3 (Uba3). Uba3 is the catalytic subunit of the activating enzyme
in the ubiquitin-like NEDD8 (neural precursor cell-expressed
developmentally down-regulated) conjugation (neddylation) pathway
(41). Using yeast two-hybrid and in vitro
glutathione-S-transferase (GST) pull-down assays, we show
that Uba3 directly interacts with ER
and ERß. In mammalian
transfection assays, Uba3 suppresses ER-mediated transactivation in a
time-dependent manner. Uba3 also inhibits the ability of AR and PR
to transactivate reporter genes. Furthermore, we showed that
neddylation activity is required for Uba3-mediated suppression on ER.
Collectively, our observations implicate a potential role for the NEDD8
protein modification pathway in restricting steroid hormone receptor
activity.
 |
RESULTS
|
---|
Identification of Uba3 as an ER- Interacting Protein
Using ER
AF2 as the bait, we performed yeast two-hybrid
screening of a unique cDNA library made from the luminal epithelium of
the rat uterus to identify novel steroid receptor-interacting proteins.
We screened approximately 1 x 106 primary
library transformants. More than 50 ER-interacting clones were
identified by their ability to grow in the selection medium and to
produce ß-galactosidase (ß-gal) due to the activation of
HIS3 and LacZ reporter genes under the control of
GAL1 promoter. Some of the positive clones turned out to be known
NR-interacting proteins such as SUG1 and steroid receptor
coactivator 3 (SRC-3)/receptor-associated coactivator 3
(RAC3)/amplified in breast cancer 1 (AIB1). A cDNA of 2,191 bp
(Fig. 1
) encoding a predicted protein of
462 amino acids was isolated, and a BLAST search of the entire database
through the National Center for Biotechnology Information (Bethesda,
MD) showed that it was 99% identical with human and mouse Uba3, a
catalytic subunit of the NEDD8-activating enzyme, which is involved in
a ubiquitin-like conjugation pathway (41). The rat Uba3
cDNA sequence was submitted to the GenBank (accession no.
AF336829). The nucleotide and deduced amino acid sequences of
rat, mouse, and human Uba3 are highly conserved, with only one amino
acid difference between mouse and rat, and a difference of only five
amino acids between rat and human (Fig. 2
). A similar NEDD8-activating enzyme
subunit has also been identified in yeast and plants
(42, 43, 44), suggesting that Uba3 has an essential
function(s) that is conserved during evolution.

View larger version (63K):
[in this window]
[in a new window]
|
Figure 1. Nucleotide and Deduced Amino Acid Sequence of Rat
Uba3
The nucleotide sequence was determined on both strands by automated
sequencing. The asterisk indicates the stop codon. The
deduced amino acid sequence is given below the
nucleotide sequence in single-letter code. The
nucleotide sequence has been submitted to the GenBank with
accession no. AF322224.
|
|

View larger version (80K):
[in this window]
[in a new window]
|
Figure 2. Sequence Alignment and Conserved Structural Motifs
of Rat (r), Mouse (m), and Human (h) Uba3
The two NR boxes (LXXLL motifs) are in bold; pseudo NR
boxes are underlined; the ATP-binding region is in
bold italic; * indicates amino acid differences among
rat, mouse, and human.
|
|
The Uba3 amino acid sequence was analyzed for a structural motif that
might mediate the observed Uba3-ER interaction. Notably, the analysis
revealed that Uba3 contains two NR-interacting LXXLL motifs (referred
to as the NR box, where L is leucine and X is any amino acid), located
at amino acids 122126 and 179183, with additional
nonconserved NR boxes also present, two at the N terminus, and two at
the C terminus (Fig. 2
). It has been well documented that the
interaction of coactivators of SRC-1/p160 and CBP/p300 families with
NRs occurs through the conserved LXXLL motifs (45), which
bind to a hydrophobic cleft in the ligand-binding domain (LBD) formed
as a result of ligand-mediated conformational change (46, 47). Whether these LXXLL motifs in Uba3 are essential for the
interaction with ER is currently under investigation.
Uba3 Directly Interacts with ER
and ERß in the Presence of
E2
The interaction between Uba3 and ER was further defined using
yeast two-hybrid assays in agar plate and liquid culture. On the
selective plate containing X-Gal, yeast transformed with control
vector grew as small white colonies. Coexpression of pAD-Gal4-Uba3 and
pBD-Gal4-ER
plasmids resulted in the development of large, blue
colonies in the presence of E2 (Fig. 3A
, inset, right), but not in the presence of vehicle (Fig. 3A
, inset, top) or antiestrogen Tam (Fig. 3A
, inset,
bottom). To quantify the interaction of Uba3 with ER
, we
measured ß-gal activity in liquid yeast culture. Yeast transformed
with pBD-GAL4-ER
AF2 and pAD-GAL4 vector (negative control) produced
low levels of ß-gal (Fig. 3A
). However, yeast transformed with
pBD-GAL4-ER
and pAD-GAL4-Uba3 displayed increased (P
< 0.01) ß-gal activity in the presence of
10-8 M E2, which is 2-fold
greater than that of ER
with SUG-1, a known ER-interacting protein
(35). In contrast, Uba3 showed no interaction with ER
in the presence of 10-6 M
Tam. Furthermore, when a pBD-GAL4 construct expressing the AF2 domain
of PR (Fig. 3B
) or AR (Fig. 3C
) was used, no interaction with Uba3 was
detected in the presence or absence of progesterone or T, respectively.
In contrast, both PR and AR strongly interacted with SRC-3, a known
coactivator of NR. These observations indicated that in yeast, Uba3
preferentially interacts with ER
in an estrogen-dependent
manner.
To further investigate the direct physical interaction between Uba3 and
ER
and further examine the potential receptor specificity of Uba3,
we performed in vitro GST pull-down assays.
35S-Labeled full-length ER
, generated by
in vitro transcription and translation, was incubated with
purified GST-Uba3 or the GST control bound to glutathione-Sepharose
beads in the presence or absence of E2 or Tam. Uba3 interacted weakly
with ER
in the absence of ligand, and the interaction was strongly
stimulated by E2 but not Tam (Fig. 4A
).
No interaction between GST and ER
in the presence or absence of
ligand was detected. We have also examined the interaction of Uba3 with
full-length ERß, the recently described second ER (48)
and PR. Uba3 interacted weakly with ERß in the absence of ligand, and
the interaction was enhanced by E2, but to a lesser extent than that of
Uba3 with ER
(Fig. 4B
). No significant interaction was detected
between Uba3 and PR with or without progesterone (Fig. 4C
). These
results were consistent with those from the yeast two-hybrid assay and
suggested that Uba3 directly and perhaps preferentially interacts with
E2-bound ER
and ERß.

View larger version (55K):
[in this window]
[in a new window]
|
Figure 4. Uba3 Directly Interacts with ER and ERß, but
Not PR, in GST Pull-Down Assays
35S-Labeled full-length ER (A), ERß (B), or PR
(C) was incubated with GST-Uba3 bound to glutathione-Sepharose beads in
the absence or presence of indicated ligands. After extensive washing,
specific interacting protein was eluted and analyzed by
SDS-PAGE and autoradiography. The input lanes show the amounts of
receptor used for each reaction. E2, 10-8 M;
Tam, 10-6 M.
|
|
Uba3 Suppresses Steroid Receptor-Mediated Transactivation in
Mammalian Cells
Yeast two-hybrid and GST pull-down assays showed the
ligand-dependent interaction of Uba3 with ER
and ERß, suggesting a
potential role for Uba3 as an ER coregulator. To examine this
hypothesis and investigate whether the Uba3-ER interaction had
functional significance, transient transfection assays were carried out
in mammalian cells. HeLa cells lack steroid receptors but, when
transfected with exogenous receptor, these cells become competent for
steroid signaling, indicated by ligand-stimulated expression of
responsive reporter constructs (Fig. 5
).
In HeLa cells transfected with ER
, E2 induced ER activity
approximately by 10-fold. Coexpression of Uba3 with ER
inhibited
(P < 0.01) E2-induced transcriptional activity, and
the inhibition was dependent upon the expression level of Uba3 (Fig. 5A
). Uba3 exhibited no effect on expression of reporter gene in the
absence of E2 (Fig. 5A
). In HeLa cells transfected with ERß, E2
induced ER activity approximately by 3.5-fold. Coexpression of Uba3
also exhibited dose-dependent suppression on ERß activity (Fig. 5B
).

View larger version (25K):
[in this window]
[in a new window]
|
Figure 5. Uba3 Suppresses Steroid Receptor-Mediated Transactivation in Mammalian Cells
Uba3 suppresses ER - and ERß-mediated transactivation in HeLa
cells. Cells were cotransfected with 10 ng pSG5-hER (A) or
pCMV-ERß (B), 250 ng 2xERE-pS2-Luc, with indicated amount of
pcDNA-Uba3. The transfected cells were treated with E2 (10
nM, solid bars) or vehicle (open
bars) for 24 h. C, Uba3 inhibits ER activity in MDA-MB-231 cells. Cells were treated as described above. D, Uba3
inhibits ER -mediated transactivation in HepG2 cells. Cells were
cotransfected with 10 ng pSG5-hER , 250 ng 2xERE-pS2-Luc, or C3-Luc
promoter construct, along with or without 150 ng pcDNA-Uba3. pcDNA-REA
(150 ng) was used as control to show the suppressive effect. The
transfected cells were treated with E2 (10 nM, solid
bars) or vehicle (open bars) for 16 h. E,
Uba3 suppresses AR-mediated transactivation. HeLa cells were
cotransfected with 250 ng Rous sarcoma virus-AR and 500 ng pSA61-Luc,
along with increasing amount of pcDNA-Uba3 as indicated. Luciferase
activity was determined 24 h after T (100 nM, solid bars) or vehicle (open bars) treatment. F, Uba3 suppresses PR-mediated transactivation. HeLa cells
were cotransfected with the indicated amount of plasmid expressing human PR, 250 ng PRE-2xTK-Luc, along with or without 150 ng pcDNA-Uba3
as indicated. Luciferase activity was determined 24 h after
progesterone (100 nM, solid bars) or vehicle
(open bars) treatment. G, Uba3 had no effect on
Elk-1-mediated transactivation in response to TGF . Human
breast cancer MDA-MB-231 cells were transfected with pFA2-Elk1,
pFR-Luc, pCMV-ß-Gal, and the indicated amount of pcDNA-Uba3. After
transfection, cells were treated with 10 ng/ml TGF for 20 h.
For all assays, 10 ng pCMV-ß-gal was used as internal control, and
total plasmid amount was adjusted to 1 µg/well using pcDNA vector.
Normalized luciferase activities [relative luciferase units
(RLU)] are the means ± SD from three
independent experiments. *, P < 0.05; and **,
P < 0.01 compared with ligand-induced luciferase
activity with receptor only.
|
|
To rule out the possibility that the observed suppressive effect of
Uba3 on ER was specific to HeLa cells, the breast cancer MDA-MB-231 and
liver carcinoma HepG2 cells were used in transient transfection assays.
Consistent with the results obtained in HeLa cells, coexpression of
Uba3 inhibited ER
activity in a dose-dependent manner in MDA-MB-231
cells (Fig. 5C
). Uba3 also inhibited ER
in HepG2 cells, although to
a lesser extent, using either the pS2 promoter (2xERE-pS2-Luc) or the
complement C3 promoter (C3-Luc), another ER-responsive reporter
construct (Fig. 5D
). Together, these results suggest that the
suppression of ER
activity by Uba3 is not cell type or promoter
specific.
Although Uba3 did not interact with PR and AR in the yeast two-hybrid
and in vitro GST pull-down assays, those systems do not
contain the same receptor-interacting protein found in mammalian cells,
some of which may be involved in the tripartite interactions between
steroid receptors, coregulators, and ligand (1, 2, 3, 4). Thus,
it was pertinent to know whether Uba3 could affect PR or AR activity in
mammalian cells, and we examined the effect of Uba3 on AR- and
PR-mediated transactivation in HeLa cells. Similar to ER, coexpression
of increasing amounts of Uba3 resulted in a gradual suppression of
AR-mediated gene expression in the presence of T (Fig. 5E
). Uba3 also
exhibited a significant inhibition of PR activity in the presence of
progesterone (Fig. 5F
). These results indicated that Uba3 might
represent a mechanism to attenuate the transcription activities of
steroid hormone receptors. In contrast to what was observed with the
steroid hormone receptors, Uba3 had no effect on the transcriptional
activity of TGF
-induced Elk-1 (Fig. 5G
), a growth factor-regulated
transcription factor (49), or expression of the control
plasmid, pCMV-ß-gal (data not shown). Collectively, these
observations suggest that Uba3 does not inhibit transcription in
general.
To further explore the effect of Uba3 on steroid receptor function, we
tested whether Uba3 could counteract the transcriptional enhancement
mediated by known steroid receptor coactivator. HeLa cells were
cotransfected with a constant amount of pcDNA-SRC-1 and increasing
amounts of pcDNA-Uba3 (Fig. 6A
) or vice
versa (Fig. 6B
). Estrogen-mediated reporter gene expression was
enhanced up to 4- to 5-fold by SRC-1, confirming its coactivator
activity and agreeing with previous reports on the effects of SRC-1 in
this type of assay (50). Coexpression of increasing
amounts of Uba3 inhibited (P < 0.01) ER
transcriptional activity in the presence of SRC-1 (Fig. 6A
). In
contrast, increasing the dose of SRC-1 did not reverse the inhibitory
effectiveness of Uba3 (Fig. 6B
), suggesting that Uba3-mediated
suppression on ER is not due to a simple competition with SRC-1 for ER
binding.

View larger version (18K):
[in this window]
[in a new window]
|
Figure 6. Uba3 Suppresses SRC-1-Mediated Enhancement of ER
Transcriptional Activity
HeLa cells were transfected with 10 ng hER , 250 ng
2xERE-pS2-Luc, and 10 ng pCMV-ß-gal, along with either a constant
amount of pc-DNA-SRC-1 (100 ng) plus increasing amount of pcDNA-Uba3 as
indicated (A) or a constant amount of Uba3 (150 ng) plus increasing
amount of pcDNA-SRC-1 as indicated (B). Total plasmid amount was
adjusted to 1 µg/well using pcDNA vector. The transfected cells were
treated with 10 nM E2 or vehicle for 24 h and
subjected to luciferase assay. Normalized luciferase activities
[relative luciferase units (RLU)] are the means ±
SD from three independent experiments. *,
P < 0.05; and **, P < 0.01
compared with SRC-1-mediated enhancement of ER activity (black
bars).
|
|
To study the dynamics of Uba3-mediated suppression of steroid receptor
transactivation function, HeLa cells were cotransfected with 150 ng
pcDNA-Uba3 in the absence or presence of 75 ng pcDNA-SRC-1, and
luciferase assays were performed at various time points after E2
treatment. Expression of Uba3 resulted in a time-dependent suppression
of ER-mediated transactivation (Fig. 7
).
At 12 h after estrogen treatment, Uba3 showed no effect on
E2-induced reporter gene expression in the presence of SRC-1; however,
at 18 and 24 h, a substantial suppressive effect of
Uba3 was observed. In the absence of SRC-1, Uba3
inhibited estrogen-induced reporter gene expression by 20% at 12
h and 50% at 24 h. The effect of the known corepressor REA
(repressor of ER) (51) was used for comparison in this
experiment. REA is a specific corepressor of ligand-activated ER and at
least partially inhibits ER transcriptional activity by competing with
SRC-1 for ER interaction (52, 53). In contrast to what was
observed for Uba3, REA completely inhibited ER
transcriptional
activity in the presence of SRC-1 12, 18, and 24 h after E2
treatment. Collectively, results of transient transfection assays
suggest that Uba3 inhibits steroid receptor-mediated gene
expression by promoting the termination of transcription
rather than interfering with the initiation of transactivation.

View larger version (21K):
[in this window]
[in a new window]
|
Figure 7. Time-Dependent Inhibition of ER Activity by Uba3
HeLa cells were cotransfected with 10 ng hER , 250 ng 2xERE-pS2-Luc,
and 10 ng pCMV-ß-gal, along with or without 75 ng SRC-1 and/or 150 ng
Uba3 as indicated. Total plasmid amount was adjusted to 1 µg/well
using pcDNA vector. Luciferase activity was determined 12 h,
18 h, and 24 h after E2 (10 nM) treatment. REA
(150 ng) was used as a positive control to show the repressive effect.
For all assays, normalized luciferase activity [relative luciferase
units (RLU)] is the means ± SD from three
independent experiments.
|
|
Neddylation Activity Is Required for Uba3-Mediated Suppression of
ER Transactivation Function
Our observations in mammalian cells established that Uba3 can
function as an inhibitor to suppress steroid receptor-mediated
transactivation. Because Uba3 is the catalytic subunit of
NEDD8-activating enzyme, we hypothesized that neddylation is involved
in restricting receptor activity. We first examined whether the enzyme
activity of Uba3 was required to suppress ER by expressing an inactive
mutant of Uba3, Uba3C216S, which has a point mutation on the active
cysteine that is essential for neddylation activity (54).
In contrast to wild-type Uba3, Uba3C216S did not inhibit
ER
mediated reporter gene expression in the absence (Fig. 8A
) or presence of SRC-1 (Fig. 8B
). To
exclude the possibility that the absence of suppressive activity of
Uba3C216S was due to the inefficient expression of the mutant protein,
the expression of Uba3C216S, which is hemagglutinin (HA) tagged, was
confirmed by immunoblotting (Fig. 8A
, inset). These results
suggested that the neddylation activity of Uba3 is required to suppress
steroid receptor-mediated transcription.

View larger version (38K):
[in this window]
[in a new window]
|
Figure 8. Neddylation Activity Is Required for Uba3 to
Suppress ER-Mediated Transactivation
HeLa cells were cotransfected with 10 ng hER , 250 ng 2xERE-pS2-Luc,
and 10 ng pCMV-ß-gal, along with indicated amount of pcDNA-Uba3,
pcDNA-HA-Uba3C216S, pcDNA-c-myc-APP-BP1,
pcDNA-c-myc-APP-BP1 (443534), or pcDNA-Ubc12. Total
plasmid amount was adjusted to 1 µg/well using pcDNA vector.
Luciferase activity was determined 24 h after E2 treatment. A,
Uba3C216S does not suppress ER activity. Inset shows the
expression of Uba3C216 by immunoblotting with anti-HA antibody. B,
Uba3C216S does not affect SRC-1-mediated transcriptional enhancement.
C, The 443534 fragment of APP-BP1 reverses Uba3-mediated suppression
of ER activity. D, Effect of Ubc12 on ER activity and Uba3 function.
For all assays, normalized luciferase activity [relative luciferase
units (RLU)] is the mean ± SD from three independent
experiments.
|
|
Uba3 dimerizes with amyloid precursor protein-binding protein
(APP-BP1) to form the heterodimeric activating enzyme of NEDD8. To
further confirm the role of the neddylation pathway in Uba3-mediated
suppression of steroid receptor activity, we performed cotransfection
assays using full-length APP-BP1 as well as a fragment of APP-BP1
containing the putative binding site for Uba3. The 443534 fragment of
APP-BP1 has been reported to inhibit NEDD8 activation by competing with
APP-BP1 to form an inactive complex with Uba3 (54). The
expression of the 443534 fragment alone had no effect on ER
activity (Fig. 8C
). However, when cotransfected with Uba3, the
443534 fragment partially reversed Uba3 suppression of ER-mediated
transactivation in a dose-dependent manner (Fig. 8C).
In contrast, full-length APP-BP1, which slightly inhibited
ER activity when expressed alone, had no effect on
Uba3-mediated suppression of ER (Fig. 8C). The expression of
full-length APP-BP1 and the 443534 fragment, both of which were
c-myc tagged, was confirmed by immunoblotting (Fig. 8C
, inset). We also tested the effect of Ubc12, the only known
conjugating enzyme for NEDD8 pathway (41), on ER-mediated
transactivation. Expression of Ubc12 alone in HeLa cells inhibited ER
activity in a dose-dependent manner (Fig. 8D
), but to a lesser extent
compared with Uba3, perhaps due to enhancement of the enzymatic
activity of endogenous Uba3. When coexpressed with Uba3, Ubc12 had no
effect on Uba3-mediated suppression of ER transactivation. Together,
these results suggest that neddylation is involved in restricting
steroid receptor activity, and receptor-Uba3 interactions appear to be
a limiting factor.
Expression of Uba3 and NEDD8 in Tissues and Cell Lines
Expression of Uba3 and NEDD8 in various tissues was examined
using Northern blot analysis. Uba3 was expressed as a single mRNA of
2.3 kb in all tissues examined; however, a differential expression
pattern of Uba3 was observed among the tissues examined (Fig. 9
, top), Uba3 mRNA levels
varied, with higher expression in uterus, ovary, skeletal muscle, and
neural tissues, and lower expression in kidney, intestine, stomach, and
liver. NEDD8 mRNA was detected as a single 1.2-kb band in all
tissues examined, with higher expression in ovary, skeletal muscle, and
neural tissues and lower expression in intestine and stomach (Fig. 9
, middle). We cloned Uba3 from the uterus, and it was of
interest to investigate the cell type pattern of Uba3 expression in
this tissue. In situ hybridization analysis showed silver
grains corresponding to Uba3 mRNA in all three uterine compartments
(epithelia, stroma, and myometrium); however, silver grains for Uba3
were more abundant in the luminal and glandular epithelial cells
compared with the stroma and myometrium, indicating that Uba3 mRNA
levels vary among the uterine compartments (Fig. 9
, inset).

View larger version (68K):
[in this window]
[in a new window]
|
Figure 9. Expression of Uba3 and NEDD8 in Rat Tissues
Total RNA (20 µg) from indicated rat tissues was run on a denaturing
gel, transferred to a nylon membrane, and hybridized with
32P-labeled cDNA fragments of rat Uba3 (top)
and human NEDD8 (middle). Total RNA was visualized by
staining with ethidium bromide (bottom panel).
Inset (right) shows the localization of
Uba3 mRNA in rat uterus using in situ hybridization.
Distinct expression of Uba3 mRNA can be seen in the luminal and
glandular epithelial endometrium.
|
|
Northern blotting was also used to examine Uba3 and NEDD8 expression in
normal and cancer cell lines (Fig. 10
).
High expression of Uba3 mRNA levels was observed in the uterine cancer
Ishikawa and HEC-1A cell lines and cervical cancer HeLa cells. Moderate
expression of Uba3 was observed in normal human mammary epithelium
MCF-10A, breast cancer MCF-7 and MDA-MB-231 cells, and liver cancer
HepG2 cells. Low or no Uba3 expression was detected in breast cancer
MDA-MB-435 and MDA-MB-468 cells. Interestingly, NEDD8 mRNA levels
tended to follow a similar pattern as those of Uba3 in these cell
lines.

View larger version (54K):
[in this window]
[in a new window]
|
Figure 10. Expression of Uba3 and NEDD8 in Human Cell
Lines
Total RNA (20 µg) from indicated human cell lines was run on a
denaturing gel, transferred to a nylon membrane, and hybridized with
32P-labeled cDNA fragments of rat Uba3 (top)
and human NEDD8 (middle). 36B4 probe was used as a
loading control (bottom). The bar graph
shows the relative expression levels of Uba3 and NEDD8 in different
tumor cell lines compared with normal MCF-10A cells.
|
|
 |
DISCUSSION
|
---|
Proteins that interact with and decrease the transcriptional
activity of agonist-activated steroid receptors have only recently been
discovered (36, 51, 55, 56, 57). We have identified a new
inhibitor of steroid receptor transactivation function, Uba3.
Coexpression of Uba3 in mammalian cells significantly represses
reporter gene expression mediated by steroid receptors, including ER,
AR, and PR. In contrast, Uba3 had no effect on a growth
factor-inducible transcription factor, Elk-1, or the expression of
pCMV-ß-gal, thereby excluding the possibility that Uba3 inhibits
transcription in general. Our observations on ER demonstrate that Uba3
does not interfere with the initiation of receptor-mediated
transcriptional activity; rather, it inhibits receptor activity in
a time-dependent fashion. Thus, we propose that Uba3 suppresses steroid
receptor activity by promoting the termination of receptor-mediated
gene transcription rather than interfering with the initial events,
which would include receptor binding to the steroid hormone response
element and subsequent functional interactions of activated
receptor with necessary adapter and coactivator proteins
(3).
Most known corepressors inhibit steroid receptor activity by blocking
the initiation of receptor-mediated transactivation. For example, REA
and FKHR inhibit the assembly of active ER transcription complex by
competing with SRC-1 coactivators for ER binding (51, 53, 57), and MAT1 has been shown to silence ERE by recruiting
histone deacetylases (56). The novel feature of Uba3,
i.e. that it affects the duration but not the initiation of
ER-mediated transactivation, indicates a distinct inhibitory mechanism.
Uba3 possesses intrinsic enzyme activity involved in neddylation, a
protein modification pathway that plays an important role in
ubiquitin-mediated proteolysis (58, 59, 60). Our results show
that neddylation activity is essential for Uba3-mediated suppression of
ER, and we hypothesize that Uba3 and the neddylation pathway in general
play a role in restricting steroid receptor action by promoting
receptor turnover.
Like Uba3, several other steroid receptor-interacting proteins have
enzymatic activities related to the ubiquitin-proteasome pathway,
including E6-AP (34), SUG1 (61), and BRCA1
(36, 37, 38); however, the precise role of their
ubiquitin-proteasome-related activities in regulation of steroid
receptor function remains to be established. Both E6-AP and SUG1 have
multiple separable functions and may regulate steroid receptor activity
through nonproteolytic mechanisms. Studies with mutant forms of E6-AP
showed that the ubiquitin-protein ligase activity is not required for
E6-AP to coactivate PR (34). SUG1 has been shown to be an
integral component of the polymerase II holoenzyme (62)
and possess DNA helicase activity (35) that might mediate
its coactivation activity. To date, the only established function of
Uba3 is to activate NEDD8, and the targets of NEDD8, other than cullin
family proteins, are unknown. Cullins are essential components of a
group of E3 ubiquitin-protein ligases, including SCF (Skp1-Cdc53-F-box
protein) (63, 64, 65) and von Hippel-Lindau tumor suppressor
protein-elongin B-elongin C complex (66).
Accumulated evidence suggests that NEDD8 modification of the cullin
subunit plays a crucial role in regulating the ligase activity of
cullin-based ubiquitin protein ligase complexes (58, 59, 60, 67, 68). Our results in HeLa cells (Figs. 5
and 8
) indicate that the
level of Uba3 is the limiting factor in neddylation-associated
suppression of receptor activity. We therefore hypothesize that, upon
binding to ligand-activated steroid receptor, Uba3, together with
APP-BP1 and Ubc12, recruits and activates a cullin-based
ubiquitin-protein ligase, which, in turn, targets receptor for
ubiquitin/proteasome degradation. Alternatively, Uba3, together with
APP-BP1 and Ubc12, may catalyze the direct neddylation of
ligand-activated steroid receptors, leading to a rapid attenuation of
receptor transcriptional activity. An analogous finding that AR can be
covalently modified by ubiquitin-like SUMO-1 and the sumoylation
appears to inhibit the AR activity (69) supports the
hypothesis. Ubiquitin-associated pathways (neddylation, sumoylation)
may represent a general mechanism to attenuate steroid hormone receptor
activity.
Lonard et al. (33) has reported that the
coactivator-binding surface of ER is important for ligand-mediated
degradation of the receptor. Consistent with this observation, two
distinct NR-interacting domains or LXXLL motifs are found in Uba3,
which could mediate the ligand-dependent interaction with ER. However,
it seems likely that the binding site(s) for Uba3 in the LBD of ER is
distinct from that used by SRC-1, because Uba3 has no apparent effect
on the ER-SRC-1 interaction. Further studies are required to identify
the sequences in both ER and Uba3 that are essential for Uba3-mediated
suppression. Interestingly, although transient transfection experiments
demonstrated that Uba3 also inhibited gene expression mediated by AR
and PR, the results from yeast two-hybrid and in vitro GST
pull-down assays did not suggest that Uba3 physically interacts with AR
or PR. One possible explanation is that additional integrating proteins
are required that are absent when using yeast or GST pull-down systems.
Further experiments to determine whether Uba3 directly interacts with
AR and PR in mammalian cells are necessary.
We observed Uba3 expression in several different rat tissue types; this
observation is in agreement with the broad tissue distribution of human
Uba3 (41). In the uterus, in situ
hybridization analysis revealed distinct Uba3 expression in the uterine
luminal epithelial cells, the same cell type in which ER
is rapidly
degraded in response to estrogen stimulation (39).
Expression of NEDD8 was also observed in all rat tissues examined, but
NEDD8 mRNA levels varied and appeared to follow a similar pattern as
Uba3. We also examined hormone-dependent human cancer cell lines for
steady-state Uba3 and NEDD8 mRNA expression, and a further association
of Uba3 and NEDD8 was evident. Interestingly, low to no Uba3 and NEDD8
expression was seen in two of the ER-negative breast cancer cells,
whereas relatively higher expression was detected in ER-positive
MCF-10, MCF-7, Hec-1A, and Ishikawa cells. Further studies on the
correlation between the dynamics of steroid turnover and expression
levels of Uba3 and NEDD8 will provide insights into the mechanism of
neddylation in restricting steroid receptor activity.
In summary, our results suggest a potential role for ubiquitin-like
NEDD8 pathway in restricting steroid receptor activity and thus steroid
hormone action. Further studies on the biological relevance of Uba3 in
hormone-dependent cell proliferation may reveal a role of Uba3 in the
development and progression of cancers, including uterine and breast
cancer. In addition, better understanding of neddylation in hormone
action may lead to novel insights of therapeutic intervention.
 |
MATERIALS AND METHODS
|
---|
Animals, Tissues, and Cell Lines
The local animal care and use committee approved use of and
procedures performed on animals. Mature Sprague Dawley rats (n =
30) were ovariectomized under general anesthesia. Two weeks later,
uterine horns were collected and trimmed of fat and mesentery.
Epithelial RNA of the uterine horns was isolated as described
previously (70). Polyadenylated RNA
[poly(A)+] was enriched by using a Poly(A)
Quick mRNA isolation kit (Stratagene, La Jolla, CA).
Northern analysis confirmed that the RNA was highly enriched for
epithelial transcripts, as indicated by its content of cytokeratin
mRNA. The human cervical carcinoma cell line, HeLa, and the breast
cancer cell lines, MCF-7 and MDA-MB-231, were purchased from
ATCC (Manassas, VA). The MCF-10A cells, derived from
fibrocystic neoplasia-free breast tissue from a donor with no familial
history of breast cancer (71), were obtained from Dr. G.
Sledge (Indiana University School of Medicine, Indianapolis, IN). The
HepG2 liver carcinoma cells, Ishikawa, and HEC-1A uterine cancer cell
lines were obtained from Dr. S. Hyder (University of Texas Health
Sciences Center, Houston, TX). The breast cancer MDA-MB-435 and
MDA-MB-468 cell lines were obtained from Dr. H. Nakshatri (Department
of Surgery, Indiana University School of Medicine, Indianapolis, IN),
and their growth conditions have been described previously
(72). The remaining cell lines were maintained in DMEM
supplemented with 10% FBS.
Plasmid Construction
A cDNA library was constructed from the uterine luminal
epithelial poly (A)+ RNA and ligated into
pAD-GAL4 phagemid of the HybridZAP Two-Hybrid cDNA Gigapack Cloning Kit
(Stratagene) to generate the primary
library for
amplification and screening. The Hybrid ZAP
library was converted to
a pAD-GAL4 phagemid library by in vivo mass excision. The
bait plasmid for the yeast two-hybrid system (pBD-GAL4-ER
AF2) was
constructed by inserting rat ER
AF2 DNA fragment, corresponding to
amino acids 290600, into pBD-GAL4 Cam phagemid vector. The cDNA
encoding the bait ER
AF2 was prepared by PCR (sequence from
9441,876; GenBank accession no. X61098) with the following primer
pair: RERARI944 5'-CGGAATTCATGAGAGCTGCCAACCTTTGG-3' (upper strand) and
RERAXHO1876 5'-CCGCTCGAGCGGTCAGATGGTGTTGGGGAAGC-3' (lower strand). The
plasmid was sequenced to confirm it was in the correct reading
frame.
To generate the estrogen-responsive luciferase reporter construct
for transient transfection assays in mammalian cells, a synthesized
minimal promoter region of the pS2 gene, nucleotides -91 to +10
(73), was ligated into the HindIII site
(blunted by Klenow reaction) of the pGL3 luciferase reporter vector
(Promega Corp., Madison, WI). A double-stranded
oligonucleotide containing two consensus ERE sites
(GTACCAGGTCACAGTGACCTGATCAGCTAGTCAGGTCACAGTGACCTTCGTAC)
was then ligated into the blunted KpnI site of the pS2-luc
to make a 2xERE-pS2-luc reporter gene. The Uba3 expression plasmid was
constructed by inserting full-length Uba3 cDNA into the
EcoRI and XhoI sites of pcDNA3+
(Invitrogen, Carlsbad, CA). pCMV-ERß was generated using
full-length cDNA cloned from rat prostate library (CLONTECH Laboratories, Inc., Palo Alto, CA). The ER-responsive C3
promoter construct (C3-Luc) and PR-responsive construct (PRE-2xTK-Luc)
was obtained from Dr. D. P. McDonnell (Duke University Medical
School, Durham, NC). The AR-responsive construct (pSA61-Luc) was from
Dr. S. Khan (University of Cincinnati, Cincinnati, OH). The ER
(HEGO)- and human PRB-expressing plasmids were obtained from Dr. P.
Chambon (Institut de Génétique et de Biologie
Moléculaire et Cellulaire, Strasbourg, France). Rous
sarcoma virus-AR was from Dr. C. Kao (Indiana University). pcDNA-SRC-1
was obtained from Dr. T-P. Yao (Dana-Farber Cancer Institute, Boston,
MA). pcDNA-HA-Uba3C216S, pcDNA-c-myc-APP-BP1 and
pcDNA-c-myc-APP-BP1443534 were obtained from Dr. R. Neve
(Harvard Medical School, Boston, MA). pcDNA-REA was obtained from Dr.
B. Katzenellenbogen (University of Illinois, Champagne-Urbana, IL).
Elk-response constructs (PathDetect Trans-Reporter,
Stratagene) and pCMV-ß-gal (Promega Corp.)
were purchased.
Yeast Two-Hybrid Reporter Assays
The yeast two-hybrid screening was conducted according to the
manufacturers instructions (Hybrid cDNA Gigapack Cloning Kit,
Stratagene). Briefly, the yeast strain J694A (Mat;
trp1901; leu23, 112; ura352; his3200; gal4; gal80;
Ade2::GAL2p-ADE2; LYS2::GAL1p-HIS3;
met2::GAL7p-Lacz)was cotransformed with the pBD-GAL4-ER
AF2 and
the cDNA pAD-Gal4 library plasmids by using the lithium acetate method.
Approximately 1 x 106 yeast transformants
were plated on synthetic minimal medium agar lacking leucine,
tryptophan, histidine, and adenine for 6 d at 30 C. ER-interacting
clones were identified by their ability to grow in the selective plates
and to activate LacZ reporter gene as indicated by the
expression of ß-gal.
To investigate ligand-dependent and -independent interaction between
wild-type Uba3 with the AF2 domain of ER, AR, and PR, we used the yeast
two-hybrid system, similar to what we described previously
(74), except that vectors pAD-GAL4- and
pBD-GAL4-(HybridZAP Two-Hybrid cDNA Gigapack Cloning Kit,
Stratagene) were used. The full-length Uba3 cDNA was
inserted into pAD-GAL4 vector. The yeast strain J694A was transformed
with pBD-GAL4-ER
AF2 and pAD-GAL4-Uba3 and plated on
SC/Leu,Trp,His,Ade/X-Gal agar plates containing
10-8 M E2,
10-6 M Tam, or vehicle. To measure
the interaction of Uba3 with AR or PR, pBD-GAL4 construct expressing
the AF2 domain of AR or PR was used instead of pBD-GAL4-ER
AF2 in
J694A cells. cDNA of AR AF2 domain was cloned from a rat prostate
library (CLONTECH Laboratories, Inc.) and that of the PR
AF2 domain was cloned from the construct expressing the human
full-length PR (Dr. P. Chambon). To measure the strength of the
interaction of Uba3 with the receptors, the ß-gal expression levels
in liquid yeast cultures from three independent transformants were
determined using a chemiluminescent reporter assay (PE Applied Biosystems, Foster City, CA).
GST Pull-Down Assay
GST pull-down assays were performed as described by Shibata
et al. (75). To fuse Uba3 with GST, the
EcoRI-SalI fragment of Uba3 from pAD-GAL4-Uba3
was subcloned into plasmid pGEX-6P-1 (Amersham Pharmacia Biotech, Piscataway, NJ) and subjected to DNA sequencing to
confirm it was in the correct reading frame. The GST-tagged Uba3 was
expressed in DH5
cells and purified as described by Cavailles
et al. (76). Briefly, overnight cultures of
DH5
cells containing the plasmid pGEX-6P-1-GST-Uba3 were diluted
(1:20), cultured in fresh medium for 2 h, and treated with 0.1
mM isopropyl
ß-D-thiogalactoside for 3 h. The bacteria
were collected by centrifugation and lysed in NETN buffer containing
0.5% Nonidet P-40, 1 mM EDTA, 20
mM Tris (pH 8.0), 100 mM
NaCl, and protease inhibitors. GST-Uba3 was purified on
glutathione-Sepharose beads (Amersham Pharmacia Biotech).
The cDNAs for full-length ER
, ERß, and PR were subcloned into
pGEM-7Z (Promega Corp.), and these were used in an
in vitro translation kit (Promega Corp.) to
produce protein labeled with [35S]methionine.
The [35S]-labeled ER
, ERß, or PR was
incubated with the glutathione-bound GST-Uba3 in binding buffer in the
absence or presence of corresponding ligands, or vehicle overnight at 4
C. After intensive washing, Uba3-bound protein was eluted and separated
on a 10% SDS-polyacrylamide gel. The
[35S]-labeled proteins in the gel were
visualized by autoradiography.
Transient Transfection Assays
HeLa, MDA-MB-231, and HepG2 cells were maintained in DMEM with
10% FBS. Two days before transfection, approximately 1 x
105 cells per well were seeded in 12-well dishes
in phenol red-free DMEM containing 5% dextran-coated charcoal-stripped
serum (HyClone Laboratories, Inc., Logan, UT).
Cells were transfected with equal amount of total plasmid DNA (adjusted
by corresponding empty vectors) by using LipofectAMINE Plus Reagent
(Life Technologies, Inc., Gaithersburg, MD) according to
the manufacturers guidelines. Five hours later, the DNA/LipofectAMINE
mixture was removed, and cells were placed in phenol red-free media
containing 5% stripped serum and appropriate hormone or vehicle. Cell
lysates were prepared 1224 h after hormone treatment using reporter
lysis buffer (Promega Corp.). Luciferase activity was
determined using the Promega Corp. Luciferase Assay System
and the T20/20 Luminometer (Turner Designs, Sunnyvale, CA). All cells
were cotransfected with pCMV-ß-gal and normalized using ß-gal
activity to correct for transfection efficiency. All experiments were
performed in triplicate and repeated at least twice.
Northern Blot Analysis
Total cellular RNA was isolated from various rat organs and
cultured cells using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH). Northern blot analysis for Uba3 and NEDD8
was performed as described previously (27) and repeated on
two separate membranes. The 36B4 cDNA, a constitutively expressed gene
encoding a ribosomal protein (77), was used to assess
loading differences between samples.
In Situ Hybridization Analysis
Cryosections (10 µm) form rat uteri were mounted on slides,
fixed in 4% paraformaldehyde in 1x PBS, dehydrated, dried, and stored
at -80 C, as described previously (27, 78, 79, 80).
35S-Labeled antisense and sense cRNA (1 x
104 to 1 x 105
cpm/µl) probes in hybridization buffer were heat denatured and added
to tissue sections (15 µl/coverslip). After incubation at a
hybridization temperature of 55 C for 16 h, tissue sections were
washed and treated with RNases to remove unhybridized cRNA probe,
dried, dipped in Ilford Nuclear Research Emulsion K5 (Polysciences,
Inc., Warrington, PA), and then stored at 4 C for 6 d.
Statistical Analyses
Assays were done in triplicate, and quantitation of three
independent experiments was performed. Statistical analysis was done
using ANOVA. When a significant P value (P
< 0.01) was found, t tests assuming unequal variance were
performed to compare individual treatment groups. All error bars
represent SD from the mean.
 |
FOOTNOTES
|
---|
This work was supported by NIH Grants CA-74748 (K.P.N.) and
HD-37025 (R.M.B.), The Walther Cancer Institute, and funding for
Students in Academic Medicine (2T35HL07584-16).
1 M.F. and X.L. contributed equally to this work. 
Abbreviations: AF2, Activation function 2; AIB1, amplified in
breast cancer 1; APP-BP1, amyloid precursor protein-binding
protein; ERE, estrogen-responsive element; ß-gal, ß-galactosidase;
GST, glutathione-S-transferase; HA, hemagglutinin; NEDD,
neural precursor cell-expressed developmentally down-regulated; NR,
nuclear receptor; RAC3, receptor-associated coactivator 3;
REA, repressor of ER activity; SRC, steroid receptor coactivator;
SUG, suppressor for galactose; T, testosterone; Tam,
4-hydroxytamoxifen; Uba, ubiquitin-activating enzyme.
Received for publication June 18, 2001.
Accepted for publication October 22, 2001.
 |
REFERENCES
|
---|
-
Ham J, Parker MG 1989 Regulation of gene expression by
nuclear hormone receptors. Curr Opin Cell Biol 1:503511[Medline]
-
Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G,
Umesono K, Blumberg B, Kastner P, Mark M, Chambon P 1995 The nuclear
receptor superfamily: the second decade. Cell 83:835839[Medline]
-
Tsai MJ, OMalley BW 1994 Molecular mechanisms of action of
steroid/thyroid receptor superfamily members. Annu Rev Biochem 63:451486[CrossRef][Medline]
-
Klinge CM 2000 Estrogen receptor interaction with
co-activators and co-repressors. Steroids 65:227251[CrossRef][Medline]
-
Xu J, Qiu Y, DeMayo FJ, Tsai SY, Tsai MJ, OMalley BW 1998 Partial hormone resistance in mice with disruption of the steroid
receptor coactivator-1 (SRC-1) gene. Science 279:19221925[Abstract/Free Full Text]
-
Jackson TA, Richer JK, Bain DL, Takimoto GS, Tung L, Horwitz
KB 1997 The partial agonist activity of antagonist-occupied steroid
receptors is controlled by a novel hinge domain-binding coactivator
L7/SPA and the corepressors N-CoR or SMRT. Mol Endocrinol 11:693705[Abstract/Free Full Text]
-
Kurebayashi J, Otsuki T, Kunisue H, Tanaka K, Yamamoto S,
Sonoo H 2000 Expression levels of estrogen receptor-
, estrogen
receptor-ß, coactivators, and corepressors in breast cancer. Clin
Cancer Res 6:512518[Abstract/Free Full Text]
-
Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan
XY, Sauter, G, Kallioniemi OP, Trent JM, Meltzer PS 1997 AIB1, a
steroid receptor coactivator amplified in breast and ovarian cancer.
Science 277:965968[Abstract/Free Full Text]
-
List H-J, Lauritsen KJ, Reiter R, Powers C, Wellstein A,
Riegel AT 2001 Ribozyme-targeting demonstrates that the nuclear
receptor coactivator AIB1 is a rate limiting factor for
estrogen-dependent growth of human MCF-7 breast cancer cells. J
Biol Chem 276:2376323768[Abstract/Free Full Text]
-
Webb P, Lopez GN, Greene GL, Baxter JD, Kushner PJ 1992 The
limits of the cellular capacity to mediate an estrogen response. Mol
Endocrinol 6:157167[Abstract]
-
Cidlowski JA, Muldoon T 1974 Estrogenic regulation of
cytoplasmic receptor populations in estrogen-responsive tissues of the
rat. Endocrinology 95:16211629[Medline]
-
Cidlowski JA, Muldoon TG 1978 The dynamics of intracellular
estrogen receptor regulation as influenced by 17ß-estradiol. Biol
Reprod 18:234246[Medline]
-
Horwitz KB, McGuire WL 1978 Nuclear mechanisms of estrogen
action. Effects of estradiol and anti-estrogens on estrogen receptors
and nuclear receptor processing. J Biol Chem 253:81858191[Medline]
-
Copland JA, Smanik EJ, Muldoon TG 1987 Discrete early changes
in cellular subpopulations of rat uterine and anterior pituitary
estrogen receptors in response to acute exposure to exogenous
estradiol. J Steroid Biochem 26:723731[CrossRef][Medline]
-
Saceda M, Lippman ME, Chambon P, Lindsey RL, Ponglikitmongkol
M, Puente M, Martin MB 1988 Regulation of the estrogen receptor in
MCF-7 cells by estradiol. Mol Endocrinol 2:11571162[Abstract]
-
Saceda M, Lippman ME, Lindsey RK, Puente M, Martin MB 1989 Role of an estrogen receptor-dependent mechanism in the regulation of
estrogen receptor mRNA in MCF-7 cells. Mol Endocrinol 3:17821787[Abstract]
-
Read LD, Greene GL, Katzenellenbogen BS 1989 Regulation of
estrogen receptor messenger ribonucleic acid and protein levels in
human breast cancer cell lines by sex steroid hormones, their
antagonists, and growth factors. Mol Endocrinol 3:295304[Abstract]
-
Ree AH, Landmark BF, Eskild W, Levy FO, Lahooti H, Jahnsen T,
Aakvaag A, Hansson V 1989 Autologous down-regulation of messenger
ribonucleic acid and protein levels for estrogen receptors in MCF-7
cells: an inverse correlation to progesterone receptor levels.
Endocrinology 124:25772583[Abstract]
-
Berthois Y, Dong XF, Roux-Dossetto M, Martin PM 1990 Expression of estrogen receptor and its messenger ribonucleic acid in
the MCF-7 cell line: multiparametric analysis of its processing and
regulation by estrogen. Mol Cell Endocrinol 74:1120[Medline]
-
Kaneko KJ, Furlow JD, Gorski J 1993 Involvement of the coding
sequence for the estrogen receptor gene in autologous ligand-dependent
down-regulation. Mol Endocrinol 7:879888[Abstract]
-
Rosser M, Chorich L, Howard E, Zamorano P, Mahesh VB 1993 Changes in rat uterine estrogen receptor messenger ribonucleic acid
levels during estrogen- and progesterone-induced estrogen receptor
depletion and subsequent replenishment. Biol Reprod 48:8998[Abstract]
-
Zhou Y, Chorich LP, Mahesh VB, Ogle TF 1993 Regulation of
estrogen receptor protein and messenger ribonucleic acid by estradiol
and progesterone in rat uterus. J Steroid Biochem Mol Biol 46:687698[CrossRef][Medline]
-
Borras, M, Hardy L, Lempereur F, el Khissiin AH, Legros N,
Gol-Winkler R, Leclercq G 1994 Estradiol-induced down-regulation of
estrogen receptor. Effect of various modulators of protein synthesis
and expression. J Steroid Biochem Mol Biol 48:325336[CrossRef][Medline]
-
Pink JJ, Jordan VC 1996 Models of estrogen receptor regulation
by estrogens and antiestrogens in breast cancer cell lines. Cancer Res 56:23212330[Abstract]
-
Santagati S, Gianazza E, Agrati P, Vegeto E, Patrone C, Pollio
G, Maggi A 1997 Oligonucleotide squelching reveals the mechanism of
estrogen receptor autologous down-regulation. Mol Endocrinol 11:938949[Abstract/Free Full Text]
-
Lee YJ, Gorski J 1998 Estrogen receptor down-regulation is
regulated noncooperatively by estrogen at the transcription level. Mol
Cell Endocrinol 137:8592[CrossRef][Medline]
-
Nephew KP, Ray S, Hlaing M, Ahluwalia A, Wu SD, Long X, Hyder
SM, Bigsby RM 2000 Expression of estrogen receptor coactivators in the
rat uterus. Biol Reprod 63:361367[Abstract/Free Full Text]
-
Stenoien DL, Patel K, Mancini MG, Dutertre M, Smith CL,
OMalley BW, Mancini MA 2001 FRAP reveals that mobility of oestrogen
receptor-
is ligand- and proteasome-dependent. Nat Cell Biol 3:1523[CrossRef][Medline]
-
Molinari E, Gilman M, Natesan S 1999 Proteasomemediated
degradation of transcriptional activators correlates with activation
domain potency in vivo. EMBO J 18:64396447[Abstract/Free Full Text]
-
Lange CA, Shen T, Horwitz KB 2000 Phosphorylation of human
progesterone receptors at serine-294 by mitogen-activated protein
kinase signals their degradation by the 26S proteasome. Proc Natl Acad
Sci USA 97:10321037[Abstract/Free Full Text]
-
Kopf E, Plassat JL, Vivat V, de The H, Chambon P,
Rochette-Egly C 2000 Dimerization with retinoid X receptors and
phosphorylation modulate the retinoic acidinduced degradation of
retinoic acid receptors
and
through the ubiquitin-proteasome
pathway. J Biol Chem 275:3328033288[Abstract/Free Full Text]
-
Nawaz Z, Lonard DM, Dennis AP, Smith CL, OMalley BW 1999 Proteasome-dependent degradation of the human estrogen receptor. Proc
Natl Acad Sci USA 96:18581862[Abstract/Free Full Text]
-
Lonard DM, Nawaz Z, Smith CL, OMalley BW 2000 The 26S
proteasome is required for estrogen receptor-
and coactivator
turnover and for efficient estrogen receptor-
transactivation. Mol
Cell 5:939948[Medline]
-
Nawaz Z, Lonard DM, Smith CL, Lev-Lehman E, Tsai SY, Tsai MJ,
OMalley BW 1999 The Angelman syndrome-associated protein, E6-AP, is a
coactivator for the nuclear hormone receptor superfamily. Mol Cell Biol 19:11821189[Abstract/Free Full Text]
-
Fraser RA, Rossignol M, Heard DJ, Egly JM, Chambon P 1997 SUG1, a putative transcriptional mediator and subunit of the PA700
proteasome regulatory complex, is a DNA helicase. J Biol Chem 272:71227126[Abstract/Free Full Text]
-
Fan S, Wang J, Yuan R, Ma Y, Meng Q, Erdos MR, Pestell RG,
Yuan F, Auborn KJ, Goldberg ID, Rosen EM 1999 BRCA1 inhibition of
estrogen receptor signaling in transfected cells. Science 284:13541356[Abstract/Free Full Text]
-
Fan S, Ma YX, Wang C, Yuan RQ, Meng Q, Wang JA, Erdos M,
Goldberg ID, Webb P, Kushner PJ, Pestell RG, Rosen EM 2001 Role of
direct interaction in BRCA1 inhibition of estrogen receptor activity.
Oncogene 20:7787[CrossRef][Medline]
-
Ruffner H, Joazeiro CA, Hemmati D, Hunter T, Verma IM 2001 Cancer-predisposing mutations within the RING domain of BRCA1: loss of
ubiquitin protein ligase activity and protection from radiation
hypersensitivity. Proc Natl Acad Sci USA 98:51345139[Abstract/Free Full Text]
-
Nephew KP, Long X, Osborne E, Burke KA, Ahluwalia A, Bigsby RM 2000 Effect of estradiol on estrogen receptor expression in rat uterine
cell types. Biol Reprod 62:168177[Abstract/Free Full Text]
-
Nephew KP, Osborne E, Lubet RA, Grubbs CJ, Khan SA 2000 Effects of oral administration of tamoxifen, toremifene,
dehydroepiandrosterone, and vorozole on uterine histomorphology in the
rat. Proc Soc Exp Biol Med 223:288294[Abstract/Free Full Text]
-
Gong L, Yeh ET 1999 Identification of the activating and
conjugating enzymes of the NEDD8 conjugation pathway. J Biol Chem 274:1203612041[Abstract/Free Full Text]
-
Lammer D, Mathias N, Laplaza JM, Jiang W, Liu Y, Callis J,
Goebl M, Estelle M 1998 Modification of yeast Cdc53p by the
ubiquitin-related protein rub1p affects function of the SCFCdc4
complex. Genes Dev 12:914926[Abstract/Free Full Text]
-
Liakopoulos D, Doenges G, Matuschewski K, Jentsch S 1998 A
novel protein modification pathway related to the ubiquitin system.
EMBO J 17:22082214[Abstract/Free Full Text]
-
Pozo JC, Timpte C, Tan S, Callis J, Estelle M 1998 The
ubiquitin-related protein RUB1 and auxin response in Arabidopsis.
Science 280:17601763[Abstract/Free Full Text]
-
Heery DM, Kalkhoven E, Hoare S, Parker MG 1997 A signature
motif in transcriptional co-activators mediates binding to nuclear
receptors. Nature 387:733736[CrossRef][Medline]
-
Darimont BD, Wagner RL, Apriletti JW, Stallcup MR, Kushner PJ,
Baxter JD, Fletterick RJ, Yamamoto KR 1998 Structure and specificity of
nuclear receptor-coactivator interactions. Genes Dev 12:33433356[Abstract/Free Full Text]
-
Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW,
Fletterick RJ, Baxter JD, Kushner PJ, West BL 1998 Hormone-dependent
coactivator binding to a hydrophobic cleft on nuclear receptors.
Science 280:17471749[Abstract/Free Full Text]
-
Kuiper GJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson J 1996 Cloning of a novel estrogen receptor expressed in rat prostate and
ovary. Proc Natl Acad Sci USA 93:59255930[Abstract/Free Full Text]
-
Marais R, Wynne J, Treisman R 1993 The SRF accessory protein
Elk-1 contains a growth factor-regulated transcriptional activation
domain. Cell 73:381393[Medline]
-
McInerney EM, Tsai MJ, OMalley BW, Katzenellenbogen BS 1996 Analysis of estrogen receptor transcriptional enhancement by a nuclear
hormone receptor coactivator. Proc Natl Acad Sci USA 93:1006910073[Abstract/Free Full Text]
-
Montano MM, Ekena K, Delage-Mourroux R, Chang W, Martini P,
Katzenellenbogen BS 1999 An estrogen receptor-selective coregulator
that potentiates the effectiveness of antiestrogens and represses the
activity of estrogens. Proc Natl Acad Sci USA 96:69476952[Abstract/Free Full Text]
-
Martini PG, Delage-Mourroux R, Kraichely DM, Katzenellenbogen
BS 2000 Prothymosin
selectively enhances estrogen receptor
transcriptional activity by interacting with a repressor of estrogen
receptor activity. Mol Cell Biol 20:62246232[Abstract/Free Full Text]
-
Delage-Mourroux R, Martini PG, Choi I, Kraichely DM, Hoeksema
J, Katzenellenbogen BS 2000 Analysis of estrogen receptor interaction
with a repressor of estrogen receptor activity (REA) and the regulation
of estrogen receptor transcriptional activity by REA. J Biol Chem 275:3584835856[Abstract/Free Full Text]
-
Chen Y, McPhie DL, Hirschberg J, Neve RL 2000 The amyloid
precursor protein-binding protein APP-BP1 drives the cell cycle through
the S-M checkpoint and causes apoptosis in neurons. J Biol Chem 275:89298935[Abstract/Free Full Text]
-
Oesterreich S, Zhang Q, Hopp T, Fuqua SA, Michaelis M, Zhao
HH, Davie JR, Osborne CK, Lee AV 2000 Tamoxifen-bound estrogen receptor
(ER) strongly interacts with the nuclear matrix protein HET/SAF-B, a
novel inhibitor of ER-mediated transactivation. Mol Endocrinol 14:369381[Abstract/Free Full Text]
-
Mazumdar A, Wang RA, Mishra SK, Adam L, Bagheri-Yarmand R,
Mandal M, Vadlamudi RK, Kumar R 2001 Transcriptional repression of
oestrogen receptor by metastasis-associated protein 1 corepressor.
Nat Cell Biol 3:3037[CrossRef][Medline]
-
Zhao HH, Herrera RE, Coronado-Heinsohn E, Yang MC,
Judes-Meyers JH, Seybold-Tilson KJ, Nawaz Z, Yee D, Barr FG, Diab SG,
Brown PH, Fuqua SAW, Osborne CK 2001 FKHR functions as a bifunctional
nuclear receptor interacting protein with both coactivator and
corepressor functions. J Biol Chem 276:2790727912[Abstract/Free Full Text]
-
Wu K, Chen A, Pan ZQ 2000 Conjugation of Nedd8 to CUL1
enhances the ability of the ROC1-CUL1 complex to promote ubiquitin
polymerization. J Biol Chem 275:3231732324[Abstract/Free Full Text]
-
Read MA, Brownell JE, Gladysheva TB, Hottelet M, Parent LA,
Coggins MB, Pierce JW, Podust VN, Luo RS, Chau V, Palombella VJ 2000 Nedd8 modification of cul-1 activates SCF(ß(TrCP))-dependent
ubiquitination of I
B
. Mol Cell Biol 20:23262333[Abstract/Free Full Text]
-
Podust VN, Brownell JE, Gladysheva TB, Luo RS, Wang C, Coggins
MB, Pierce JW, Lightcap ES, Chau V 2000 A Nedd8 conjugation pathway is
essential for proteolytic targeting of p27Kip1 by ubiquitination. Proc
Natl Acad Sci USA 97:45794584[Abstract/Free Full Text]
-
vom Baur E, Zechel C, Heery D, Heine MJ, Garnier JM, Vivat V,
Le Douarin B, Gronemeyer H, Chambon P, Losson R 1996 Differential
ligand-dependent interactions between the AF-2 activating domain of
nuclear receptors and the putative transcriptional intermediary factors
mSUG1 and TIF1. EMBO J 15:110124[Abstract]
-
Kim YJ, Bjorklund S, Li Y, Sayre MH, Kornberg RD 1994 A
multiprotein mediator of transcriptional activation and its interaction
with the C-terminal repeat domain of RNA polymerase II. Cell 77:599608[Medline]
-
Lyapina SA, Correll CC, Kipreos ET, Deshaies RJ 1998 Human
CUL1 forms an evolutionarily conserved ubiquitin ligase complex (SCF)
with SKP1 and an F-box protein. Proc Natl Acad Sci USA 95:74517456[Abstract/Free Full Text]
-
Singer JD, Gurian-West M, Clurman B, Roberts JM 1999 Cullin-3
targets cyclin E for ubiquitination and controls S phase in mammalian
cells. Genes Dev 13:23752387[Abstract/Free Full Text]
-
Tan P, Fuchs SY, Chen A, Wu K, Gomez C, Ronai Z, Pan ZQ 1999 Recruitment of a ROC1-CUL1 ubiquitin ligase by Skp1 and HOS to catalyze
the ubiquitination of I
B
. Mol Cell 3:527533[Medline]
-
Pause A, Peterson B, Schaffar G, Stearman R, Klausner RD 1999 Studying interactions of four proteins in the yeast two-hybrid system:
structural resemblance of the pVHL/elongin BC/hCUL-2 complex with the
ubiquitin ligase complex SKP1/cullin/F-box protein. Proc Natl Acad Sci
USA 96:95339538[Abstract/Free Full Text]
-
Lyapina S, Cope G, Shevchenko A, Serino G, Tsuge T, Zhou C,
Wolf DA, Wei N, Deshaies RJ 2001 Promotion of NEDD-CUL1 conjugate
cleavage by COP9 signalosome. Science 292:13821385[Abstract/Free Full Text]
-
Schwechheimer C, Serino G, Callis J, Crosby WL, Lyapina S,
Deshaies RJ, Gray WM, Estelle M, Deng XW 2001 Interactions of the COP9
signalosome with the E3 ubiquitin ligase SCFTIRI in mediating auxin
response. Science 292:13791382[Abstract/Free Full Text]
-
Poukka H, Karvonen U, Janne OA, Palvimo JJ 2000 Covalent
modification of the androgen receptor by small ubiquitin-like modifier
1 (SUMO-1). Proc Natl Acad Sci USA 97:1414514150[Abstract/Free Full Text]
-
Bigsby RM, Li A 1994 Differentially regulated immediate
early genes in the rat uterus. Endocrinology 134:18201826[Abstract]
-
Soule HD, Maloney TM, Wolman SR, Peterson Jr WD, Brenz R,
McGrath CM, Russo J, Pauley RJ, Jones RF, Brooks SC 1990 Isolation and
characterization of a spontaneously immortalized human breast
epithelial cell line, MCF-10. Cancer Res 50:60756086[Abstract]
-
Bhat-Nakshatri P, Newton TR, Goulet Jr R, Nakshatri H 1998 NF-
B activation and interleukin 6 production in fibroblasts by
estrogen receptor-negative breast cancer cell-derived interleukin 1
.
Proc Natl Acad Sci USA 95:69716976[Abstract/Free Full Text]
-
Nunez AM, Berry M, Imler JL, Chambon P 1989 The 5' flanking
region of the pS2 gene contains a complex enhancer region responsive to
oestrogens, epidermal growth factor, a tumour promoter (TPA), the
c-Ha-ras oncoprotein and the c-jun protein. EMBO J 8:823829[Abstract]
-
Nephew KP, Sheeler CQ, Dudley MD, Gordon S, Nayfield SG, Khan
SA 1998 Studies of dehydroepiandrosterone (DHEA) with the human
estrogen receptor in yeast. Mol Cell Endocrinol 143:133142[CrossRef][Medline]
-
Shibata H, Spencer TE, Onate SA, Jenster G, Tsai SY, Tsai MJ,
OMalley BW 1997 Role of co-activators and co-repressors in the
mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 52:141164[Medline]
-
Cavailles V, Dauvois S, Danielian PS and Parker MG 1994 Interaction of proteins with transcriptionally active estrogen
receptors. Proc Natl Acad Sci USA 91:1000910013[Abstract/Free Full Text]
-
Laborda J 1991 36B4 cDNA used as an
estradiol-independent mRNA control is the cDNA for human acidic
ribosomal phosphoprotein PO. Nucleic Acids Res 19:3998[Medline]
-
Nephew KP, Peters GA, Khan SA 1995 Cellular localization of
estradiol-induced c-fos messenger ribonucleic acid in the
rat uterus: c-fos expression and uterine cell proliferation
do not correlate strictly. Endocrinology 136:30073015[Abstract]
-
Nephew KP, Polek TC, Khan SA 1996 Tamoxifeninduced
proto-oncogene expression persists in uterine endometrial epithelium.
Endocrinology 137:219224[Abstract]
-
Nephew KP, Tang M, Khan SA 1994 Estrogen differentially
affects c-jun expression in uterine tissue compartments. Endocrinology 134:18271834[Abstract]