Functional Association of PR and CCAAT/Enhancer-Binding Protein ß Isoforms: Promoter-Dependent Cooperation between PR-B and Liver-Enriched Inhibitory Protein, or Liver-Enriched Activatory Protein and PR-A in Human Endometrial Stromal Cells

Mark Christian, Yvonne Pohnke, Rita Kempf, Birgit Gellersen and Jan J. Brosens

Institute of Reproductive and Developmental Biology, Imperial College School of Medicine, Hammersmith Hospital (M.C., J.J.B.), London, United Kingdom W12 0NN; IHF Institute for Hormone and Fertility Research, University of Hamburg (Y.P., R.K., B.G.), 22529 Hamburg, Germany

Address all correspondence and requests for reprints to: Dr Jan Brosens, Institute of Reproductive and Developmental Biology, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom W12 0NN. E-mail: j.brosens{at}ic.ac.uk


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Activation of the decidual PRL (dPRL) promoter, a major differentiation marker in human endometrial stromal (ES) cells, by cAMP is effected through the induction and binding of CCAAT/enhancer-binding protein-ß (C/EBPß) to two overlapping cognate response elements in the promoter region dPRL-332/-270. Progesterone is essential for decidualization and potently enhances cAMP-dependent dPRL promoter activity. We now demonstrate that both liganded PR isoforms, PR-A and PR-B, are capable of trans-activating the dPRL-332/-270 region. The absence of a palindromic progesterone response element (PRE) within this promoter region suggested cross-coupling between C/EBPß and PR in human ES cells. Physical interaction between these distinct transcription factors was confirmed by glutathione-S-transferase pull-down assays, demonstrating that both C/EBPß isoforms, the full-length activator liver-enriched activatory protein (LAP) and the truncated inhibitor liver-enriched inhibitory protein (LIP), can bind PR-B as well as PR-A in vitro. Transient transfection studies in primary ES cells were used to examine the consequences of PR and C/EBPß interaction on activation of their respective response elements. Activation of mouse mammary tumor virus promoter or a reporter construct containing two isolated palindromic PREs by liganded PR-B was synergistically enhanced by coexpression of LIP, but not LAP. In contrast, PR-A failed to trans-activate these constructs significantly regardless of the presence of either C/EBPß isoform. Conversely, LAP-dependent activation of the dPRL-332/-270 region or a reporter construct driven by a single C/EBPß response element was greatly enhanced by PR-A, but not PR-B, in a ligand-dependent manner. These observations reveal that PR and C/EBPß isoform ratios are important determinants of the cellular response to ovarian progesterone in the reproductive tract; the predominance of PR-A and LAP favors expression of C/EBPß-dependent genes, whereas PR-B and LIP cooperate in activating PRE-driven promoters.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
THE OVARIAN HORMONE progesterone exerts pleiotropic functions in the reproductive tract. In the human uterus, the postovulatory rise in progesterone levels is associated with profound endometrial remodeling characterized by secretory transformation of the glands followed by decidualization of the stromal compartment, influx of natural killer cells, and structural modification of the spiral arteries. This orchestrated process of endometrial differentiation is thought to be essential for blastocyst implantation and successful hemochorial placentation. Expression of PRL by endometrial stromal (ES) cells coincides with decidual transformation both in vivo and in vitro and has been widely used as a paradigm for the dissection of the mechanisms underlying ES cell differentiation (1, 2, 3, 4). Decidualization is first initiated in the stromal cells surrounding the spiral arteries of the superficial endometrial layer approximately 10 d after ovulation. The highly specific temporal and spatial expression of the decidual phenotype in vivo suggests that ES cell responses to progesterone are modulated by locally expressed regulatory factors. This is further supported by in vitro studies demonstrating that PRL expression can be triggered by agents capable of activating the PKA pathway, including relaxin, PGE2, gonadotropins, and cAMP analogs (4, 5, 6, 7, 8). In contrast, progestins are very weak inducers of ES cells differentiation in vitro, but appear essential for maintaining and enhancing the decidual response, as demonstrated by their ability to synergistically enhance cAMP-induced decidual PRL (dPRL) expression (1, 5, 9).

Decidual PRL gene transcription requires activation of a tissue-specific promoter located approximately 5.7 kb upstream of the pituitary-specific PRL promoter at an additional noncoding exon 1A (2, 10). Transient transfection studies in primary ES cells have shown that the dPRL promoter is inducible upon treatment with cAMP (2, 8). After a lag period of approximately 2 d, progestins markedly enhance cAMP-induced promoter activity (1). Recently, we demonstrated that PKA activation of the dPRL promoter is mediated through the induction and binding of CCAAT/enhancer-binding protein-ß (C/EBPß) to two overlapping consensus C/EBP-binding sites in the proximal promoter region (11). C/EBPs belong to the basic region/leucine zipper (bZIP) group of transcription factors. To date, six members of the C/EBP family have been identified and are denoted C/EBP-{alpha}, -ß, -{delta}, -{epsilon}, -{gamma}, and -{zeta} (reviewed in Ref. 12), of which C/EBPß is a major isoform in human endometrial stromal cells. From a single C/EBPß mRNA, two protein isoforms can be generated by a leaky ribosomal scanning mechanism involving three methionine residues. Liver-enriched activatory protein (LAP) with a molecular mass of 33.5–36 kDa is initiated at Met1 and Met24, whereas the 16-kDa protein liver-enriched inhibitory protein (LIP) results from translational initiation at Met199. LIP lacks the trans-activation domain that is present in LAP and acts as a potent repressor of LAP-induced transcriptional activation (13). C/EBPß has been shown to regulate the differentiation and function of a variety of cells, including adipocytes (14, 15, 16) granulosa cells (17), cells of the lymphoid and hemopoietic lineages (18), and the mammary gland epithelium (19).

The mechanism underlying the synergistic cooperation between progestins and cAMP in the activation of the dPRL promoter is not understood. The PR is a member of the superfamily of ligand-activated transcription factors that bind to sequence-specific DNA-binding sites in the promoter of target genes. Two isoforms exist, PR-A and PR-B, which arise from different promoter usage in a single gene (20). PR-B differs from PR-A in that it contains an additional 164 amino acids at the N-terminus [B-upstream sequence (BUS)]. Although the PR isoforms display indistinguishable hormone and DNA binding, several studies have shown that, depending on the cell and promoter context, PR-A and PR-B have remarkably different transcriptional activities (21, 22, 23, 24). In general, the PR-A isoform is transcriptionally less active and functions as a dominant inhibitor of transcription by PR-B and various other steroid receptors. Various models exist to explain the weak trans-activation potential of PR-A compared with PR-B. PR-A shares with PR-B the activation functions activating factor-1 (AF-1) and AF-2, but lacks AF-3, which is situated in the BUS segment specific to PR-B (25). AF-1 is a constitutive activation domain N-terminal to the DNA-binding domain (DBD), while the ligand-dependent activation function AF-2 is located in the ligand-binding domain (LBD) (26). The N-terminal segment of PR-A harbors an inhibitory function, termed IF or ID, which represses AF-1 or AF-2, but not AF-3. Removal of IF/ID converts PR-A into a strong transcriptional activator. The BUS domain is thought to repress IF/ID, thereby rendering PR-B a much more potent activator of transcription than PR-A (27). The lower trans-activation potential of PR-A may also be a result of its higher affinity for the corepressor silencing mediator of retinoid and thyroid hormone receptor and its less efficient recruitment of the coactivator steroid receptor coactivator-1 (28).

In addition to direct transcriptional activation through binding of the activated receptor with its cognate DNA response element, PR and other nuclear receptors are also capable of modulating the activity of other classes of transcription factors through DNA binding-independent mechanisms. For instance, direct interaction between activated PR and the proinflammatory factor, nuclear factor-{kappa}B, has been shown to result in reciprocal transcriptional repression (29). Furthermore, a variety of nuclear receptors, including GR, ER{alpha}, AR, and RAR, have been shown to bind to C/EBPß (30). Interestingly, although ER{alpha} and RAR act to repress C/EBPß-dependent transcription (15, 31), GR enhances C/EBPß trans-activation (30, 32).

These observations raise the possibility that functional interaction between liganded PR and C/EBPß could mediate the enhancement of dPRL promoter activity in response to progestin treatment. We now demonstrate that both PR isoforms physically interact with the C/EBPß isoforms, LAP and LIP, in in vitro association studies. We show that PR-A enhances LAP trans-activation of a model C/EBP-responsive reporter construct as well as the proximal dPRL promoter, and that LIP potently enhances PR-B-dependent transcription of promoters driven by palindromic progesterone response elements (PREs). Our results reveal the unique complexity of C/EBPß and PR cross-coupling and demonstrate that, dependent upon the promoter context, the supposed transcriptional repressors PR-A and LIP are functional coactivators of LAP and PR-B, respectively.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Activation of the dPRL Promoter Region -332/-270 by Liganded PR
We previously reported that dPRL expression by ES cells in response to PKA activation is effected through induction and binding of LAP to the proximal decidual PRL promoter region between positions -332 to -270 (11). The mechanism by which medroxyprogesterone acetate (MPA) synergistically enhances cAMP-dependent dPRL promoter activity is unknown. There are no consensus PREs in the dPRL promoter, although the region between positions -332 to -270 contains a PRE half-site in close proximity to two C/EBPß-binding sites (NFIL6REs; Fig. 1Go). We postulated that this particular configuration within the C/EBPß-responsive promoter region could confer the progestin response. To test this hypothesis, primary human ES cells were transiently transfected with the full-length proximal dPRL promoter (dPRL-332/luc3), the -332/-270 region fused to the minimal dPRL promoter [dPRL(-332/-270)/-32/luc3], or the minimal dPRL promoter (dPRL-32/luc3). The empty control vector pSG5 or an expression vector for either PR-A or PR-B was cotransfected. Subsequently, the cultures remained untreated or were treated with MPA. It is important to note that cells were not treated with cAMP, as activation of the PKA pathway in human ES cells is known to induce additional and potentially confounding factors, such as signal transducer and activator of transcription 5 (STAT5), capable of binding PR and modulating its trans-activation function (33).



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. Promoter-Reporter Constructs and Mutants Used in ES Cell Transfection Studies

A schematic depiction of the proximal region of the dPRL promoter carrying two overlapping C/EBP-binding sites and a PRE half-site between positions -332 to -270. The consensus binding sequences for C/EBPß (D and B) and the PRE half-site are represented by ovals and a triangle, respectively. The following reporter-promoter constructs are also depicted: dPRL-32/luc3, carrying -32/+65 of the dPRL gene fused to the luciferase gene (luc); dPRL(-332/-270wt)-32/luc3, a fusion construct containing region -332/-270 inserted in front of -32/luc3; PRE/-32/luc3, a construct containing two palindromic PREs upstream of -32/luc3; and NFIL6RE/-32/luc3, a construct containing a single consensus C/EBPß-binding site (NFIL6RE) inserted in front of -32/luc3. Mutated consensus sequences in the context of dPRL-332/-270 are crossed out, as depicted in the dPRL(-332/-270PREmut)-32/luc3 and dPRL(-332/-270DBmut)-32/luc3 constructs.

 
Figure 2Go demonstrates that liganded PR trans-activated both the proximal dPRL promoter as well as the C/EBPß-responsive promoter region. The activity of the dPRL-332/luc3 construct was increased approximately 5.5-fold by activated PR-B and 2-fold by liganded PR-A. Similarly, hormone treatment yielded a 7-fold increase in dPRL(-332/-270)/-32/luc3 activity in PR-B-transfected cells and a 3-fold increase in PR-A-transfected cells. MPA treatment did not elicit promoter activity in the absence of cotransfected PR. Notably, the minimal promoter construct dPRL-32/luc3 was also modestly activated by ligand-bound PR-B. The level and pattern of induction of the promoterless vector pGL3-Basic were identical to those observed with dPRL-32/luc3, indicating that the minimal dPRL promoter does not contain additional cryptic response elements (data not shown). No such general transcriptional effects were observed with liganded PR-A. It has also been reported that N6-methylation of adenosine residues, as a result of dam methylation of plasmids grown in dam+ strains of Escherichia coli, can lead to the artifactual creation of cryptic PREs (34). However, transfection studies with dPRL(-332/-270)/-32/luc3 and dPRL-32/luc3 constructs prepared in dam- dcm- E. coli strain GM2163 showed an identical pattern of promoter activation in response to liganded PR to that seen with the promoter-reporter gene construct prepared in dam+ E. coli DH5{alpha} (data not shown). The dPRL(-332/-270)/-32/luc3 was also activated in PR-transfected cells incubated with progesterone, demonstrating that the response to MPA was not due to its glucocorticoid-like activity (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 2. Ligand-Dependent Activation of the dPRL Promoter Region -332/-270 by Activated PR-B and PR-A

ES cells were transiently transfected with the following reporter-promoter constructs: dPRL-332/luc3, dPRL(-332/-270wt)/-32/luc3, or dPRL-32/luc3 as described in Materials and Methods. Expression vectors for either PR-B (pSG-PR-B) or PR-A (pSG-PR-A) were cotransfected. The empty vector pSG5 was used as a filler construct if needed. Cells remained untreated (control) or were incubated with 10-6 M MPA. Luciferase activity was measured after 40 h of treatment, and the results show the mean activity (±SD) of triplicate measurements.

 
Physical Interaction between PR and C/EBPß Isoforms
The ability of ligand-bound PR to trans-activate the C/EBPß-responsive dPRL promoter region suggested functional interaction between these distinct transcription factors. We postulated that C/EBPß could physically bind PR, as such interaction has been demonstrated for other members of the steroid hormone receptor family, including ER{alpha}, GR, and AR (30). This was confirmed by in vitro protein binding studies demonstrating specific interactions between glutathione-S-transferase (GST)-LAP fusion protein and both PR isoforms (Fig. 3Go). The GST-LIP fusion protein was also capable of binding both PR isoforms, indicating that interaction was mediated by the bZIP segment of C/EBPß. The binding of GR with GST-LAP was included as a positive control (Fig. 3CGo) (30), and we demonstrated, for the first time, that this nuclear receptor also interacts with LIP. In contrast, the absence of association between GST-LAP and the latent cytoplasmic transcription factor STAT5b represents a negative control. C/EBPß binding to the PR isoforms was identical in the presence or absence of MPA (Fig. 3Go).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 3. PR-B and PR-A Bind Specifically to GST-LAP and GST-LIP

In vitro translated 35S-labeled PR-B, PR-A, PR-BDBM, PR-BLBM, PR-BUS-DBD-NLS, GR, and STAT5b were incubated with GST-LAP, GST-LIP, and GST immobilized on glutathione-Sepharose, as indicated. Ligand activation of 35S-labeled was performed by preincubation with 1 µM MPA for 2 h at 4 C. Specifically bound proteins were resolved on 10% SDS-polyacrylamide gels and visualized by autoradiography.

 
To delineate the PR domains necessary for interaction, the abilities of various PR mutants to bind GST-LAP were examined. The mutants tested included a LBD mutant (PR-BLBM), in which the LBD region was truncated at position 809; a DBD mutant (PR-BDBM) with a cysteine to alanine substitution in the base of the first zinc finger (C587A), and the BUS-DBD-nuclear localization signal (NLS) construct, in which the B upstream segment of PR-B is fused to the DBD and the NLS. Disruption of the DNA-binding activity of the receptor did not interfere with the ability of PR to bind to GST-LAP in vitro. Furthermore, PR-BLBM and the BUS-DBD-NLS construct were capable of associating with GST-LAP, albeit with reduced efficiency. Together, these results indicate that physical interaction between PR and the bZIP of C/EBPß is effected by the DBD of PR.

PR-A Synergistically Enhances LAP- Dependent Transcription
Physical interaction between PR and C/EBPß does not necessarily imply functional cooperation. To determine whether C/EBPß-responsive promoters are modulated by PR, ES cells were transiently transfected with the reporter construct NFIL6RE/-32/luc3, carrying a single consensus C/EBP-binding site (see Fig. 1Go), and an expression vector for LAP, LIP, PR-A, or PR-B, or a combination of these. As expected, overexpression of LAP elicited an increase in NFIL6RE/-32/luc3 activity (9-fold), but LIP had no effect (Fig. 4Go). Remarkably, exogenously expressed PR-B elicited an 18-fold induction in NFIL6RE/-32/luc3 activity upon treatment with MPA. Furthermore, coexpression of LIP or LAP had little or no effect on ligand-bound PR-B trans-activation of this promoter-reporter construct. However, activated PR-B and, to a lesser extent, LAP also induced the minimal dPRL promoter (dPRL-32/luc3; Fig. 4AGo) and the promoterless vector pGL3-Basic (data not shown), resulting in a qualitative response identical, albeit less pronounced, to that observed with the NFIL6RE/-32/luc3 construct. Although PR-A also triggered NFIL6RE/-32/luc3 activity (12-fold) upon hormone binding, the response in the presence of C/EBPß isoforms was profoundly different from that observed with PR-B. First, PR-A cooperated with LAP in activating NFIL6RE/-32/luc3 in the absence of ligand, and this cooperation was further enhanced upon hormone binding, resulting in a 63-fold increase in luciferase activity. Second, PR-A trans-activation of NFIL6RE/-32/luc3 was abolished by coexpressed LIP. Finally, PR-A had no effect on dPRL-32/luc3 activity in the presence or absence of ligand. These observations indicate that PR-A enhances NFIL6RE/-32/luc3 activity when LAP, but not LIP, is bound to its cognate response element. In contrast, the response to PR-B appears largely independent of the presence of the high affinity C/EBPß-binding site.



View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. PR-A Synergistically Enhances LAP-Dependent Transcription of an NFIL6RE-Containing Promoter

A, ES cells were transiently transfected with either NFIL6RE/-32/luc3 or dPRL-32/luc3. The following expression vectors were cotransfected: pSG-LAP, pSG-LIP, pSG-PR-B, pSG-PR-A, or a combination of these, as indicated. B, Cells were transfected with the reporter construct NFIL6RE/-32/luc3 and an expression vector encoding for the wild-type PR-A, a PR-A DNA-binding mutant (PR-ADBM), or a PR-A ligand-binding mutant (PR-ALBM). In addition, either LAP or LIP was coexpressed as indicated. Cells remained untreated (control) or were treated with 10-6 M MPA. Luciferase activity was measured after 40 h of treatment, and the results show the mean ± SD of triplicate measurements, expressed relative to the activity of the respective promoter construct in the presence of pSG5.

 
To determine which PR-A domains were necessary for cooperation with LAP, ES cells were transiently transfected with NFIL6RE/-32/luc3 and expression vectors for LIP or LAP, and the wild-type PR-A, a PR-A DBD mutant (PR-ADBM), or PR-A, an LBD mutant (PR-ALBM). Figure 4BGo demonstrates that the PR-A mutants were no longer capable of inducing NFIL6RE/-32/luc3 activity upon MPA treatment. The mutant receptors also failed to modulate LAP-dependent promoter activity, indicating that the receptor requires intact ligand- and DNA-binding properties for synergy with LAP.

LIP Synergistically Enhances PR-B Trans-Activation
Next, we examined whether cross-coupling between PR and C/EBPß was reciprocated on PR-responsive promoters. ES cells were transfected with the mouse mammary tumor virus (MMTV) promoter, which possesses several consensus palindromic PREs, multiple PRE half-sites, and response elements for other transcription factors (33). Figure 5AGo demonstrates that the MMTV promoter was induced 17-fold by liganded PR-B, but only 4-fold by activated PR-A. Overexpression of LIP alone had no effect on promoter activity, but coexpression of LIP and PR-B produced a 256-fold induction in the presence of ligand. It is noteworthy that in the absence of coexpressed PR, luciferase activity was enhanced 15-fold by transfected LAP in untreated cells and 24-fold in MPA-treated cells. Coexpression of PR-B and LAP yielded 32- and 58-fold increases in promoter activity in the absence or presence of ligand, respectively. These results indicate that LAP and liganded PR-B had additive effects on MMTV/luc activity, whereas LIP synergistically enhanced PR-B trans-activation.



View larger version (18K):
[in this window]
[in a new window]
 
Figure 5. LIP Synergistically Enhances Ligand-Dependent PR-B Trans-Activation of PRE-Containing Promoters

A, ES cells were transiently transfected with the reporter-promoter construct pMMTV/luc. The following expression vectors were cotransfected: pSG-LAP, pSG-LIP, pSG-PR-B, pSG-PR-A, or a combination of these, as indicated. The pMMTV/luc reporter construct was also cotransfected with wild-type PR-B, a PR-B DNA-binding mutant (PR-BDBM), or a PR-B ligand-binding mutant (PR-BLBM). In addition, either LAP or LIP was coexpressed as indicated. B, ES cells were transiently transfected with the reporter-promoter construct PRE/-32/luc3. The following expression vectors were cotransfected: pSG-LAP, pSG-LIP, pSG-PR-B, pSG-PR-A, or a combination of these, as indicated. Cells were left untreated (control) or were treated with 10-6 M MPA. Luciferase activity was measured after 40 h of treatment, and the results show the mean ± SD of triplicate measurements, expressed relative to the activity of the respective promoter construct in the presence of pSG5.

 
PR-B mutants were used to further dissect the functional cooperation with LIP (Fig. 5AGo). As anticipated, receptors deficient in either DNA binding (PR-BDBM) or ligand binding (PR-BLBM) were no longer capable of inducing promoter activity upon treatment with MPA. Coexpression of either C/EBPß isoform did not restore the trans-activation potential of these PR-B mutants, indicating that cooperation between LIP and PR-B required ligand-dependent activation of the receptor and binding to its cognate DNA response element.

We also tested whether LIP could potentiate PR trans-activation of a synthetic promoter construct consisting of two palindromic PREs upstream of the minimal dPRL promoter region (PRE/-32/luc3; see Fig. 1Go). Figure 5BGo demonstrates that the pattern of PRE/-32/luc3 activity was comparable to that observed with the MMTV promoter. PRE/-32/luc3 activity was weakly induced by MPA in the absence of cotransfected PR, which may reflect activation of endogenous PR. Overexpression of PR-A, LAP, or LIP alone had little or no additional effect on PRE/-32/luc3 activity. However, liganded PR-B activated the promoter 9-fold, and coexpression of LIP yielded a 24-fold increase in luciferase activity. In contrast, LAP had little or no effect on PR trans-activation, confirming the unique role of LIP in selectively amplifying PR-B-dependent transcription.

Effect of Binding Site Mutations on PR- and C/EBP-Dependent Induction of dPRL-332/-270
The preceding experiments described the functional consequences of PR and C/EBPß interaction on the activation of isolated consensus response elements. Next, we investigated whether C/EBPß-PR crosscoupling could be relevant for the transcriptional control of the C/EBPß-responsive region (-332/-270) of the dPRL promoter. Directed mutation of the PRE-half site [dPRL(-332/-270PREmut)/-32/luc3] or C/EBPß-binding sites [dPRL(-332/-270DBmut)/-32/luc3] within this region allowed assessment of their relative contributions to C/EBPß-PR crosscoupling (Fig. 1Go).

Overexpression of LAP activated the wild-type C/EBPß-responsive region [dPRL(-332/-270wt)/-32/luc3] 7-fold, whereas LIP had no discernable effect (Table 1Go). In the absence of functional C/EBPß-binding sites, LAP trans-activation was virtually abolished, but mutation of the PRE half-site had no such effect. The dPRL(-332/-270wt)/-32/luc3 construct was activated 9-fold by PR-B and 4-fold by PR-A upon MPA treatment, confirming our initial experiments (Fig. 2Go). Interestingly, both liganded PR isoforms were capable of trans-activating the dPRL(-332/-270DBmut)/-32/luc3 construct to the same extent as the wild-type construct, whereas induction of dPRL(-332/-270PREmut)/-32/luc3 activity was reduced. Coexpression of LAP and liganded PR-B had an additive effect on activation of both the dPRL(-332/-270wt)/-32/luc3 and dPRL(-332/-270PREmut)/-32/luc3 constructs. However, in the absence of functional C/EBPß-binding sites, LAP actually inhibited the response to activated PR-B. Conversely, LIP had little or no effect on PR-B-dependent trans-activation, but consistently inhibited liganddependent activation of the three constructs tested in PR-A-transfected cells. Together these data suggest that activated PR can interact with the isolated PRE half-site, although this interaction appears to be impaired when the B-isoform is tethered to LAP or when LIP is bound to the A-isoform. Furthermore, the inability of LIP to significantly enhance PR-B trans-activation indicates that the incomplete PRE is insufficient to sustain cooperation between these two factors. In contrast, cotransfection of both LAP and PR-A yielded a 26-fold increase in dPRL(-332/-270wt)/-32/luc3 activity upon treatment. The synergy between LAP and activated PR-A was abolished in the absence of functional C/EBPß-binding sites, but was reduced by approximately 40% in the presence of a mutant PRE half-site. Hence, within the context of the proximal dPRL promoter, transcriptional cooperation between C/EBPß and PR is effected predominantly by the two C/EBPß-binding sites and further modulated by the upstream PRE-half site.


View this table:
[in this window]
[in a new window]
 
Table 1. Effect of Binding Site Mutations on PR- and C/EBP-Dependent Induction of dPRL-332/-270

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
C/EBPß has been shown to bind an increasing number of nuclear factors, including the coactivator TIF1ß (35), the phosphoprotein Nopp140 (36), members of the nuclear factor-{kappa}B family (37, 38), Ets-1 (39), the basic helix-loop-helix factor E47 (40), retinoblastoma protein (41), and various members of the nuclear receptor superfamily (30, 31). We now demonstrate, by an in vitro interaction assay of bacterially expressed proteins, that C/EBPß also binds PR. This interaction was not altered by the presence or absence of hormone. Both C/EBPß isoforms interacted with both PR isoforms, indicating that the bZIP region of C/EBPß is sufficient for interaction, and the BUS of PR-B is not required. Deletion of the C-terminal 124 amino acids of PR (PR-BLBM) did not abolish binding. Furthermore, the DBD fused to BUS still exhibited interaction with LAP. These observations indicate that the DBD of PR is the interface for contact with the bZIP region of C/EBPß and explain why interaction in vitro is ligand independent. Similar observations have been made for other members of the steroid hormone family. For instance, both ER and GR have been shown to bind C/EBPß in the presence and absence of estrogen or dexamethasone, respectively (30, 31). ER binding was found to be dependent on its DBD and the bZIP of C/EBPß. In contrast, all domains of the GR, with the exception of the isolated C-terminal LBD, have been shown to interact with C/EBPß in vitro (30, 31). We have extended this observation and demonstrated that the bZIP region of C/EBPß is adequate for interaction with GR.

Interaction of PR and C/EBPß has important consequences for the transcriptional regulation of their respective promoter response elements. We demonstrated that PR-B trans-activation of the MMTV promoter, which carries several palindromic PREs (42), was greatly enhanced by the addition of exogenous LIP. PR-B mutants lacking functional DNA- or ligand-binding properties failed to induce promoter activity, and coexpression of LIP did not restore their trans-activation potential. Interestingly, LAP also triggered MMTV promoter activity, indicating the presence of C/EBP-binding sites in the complex steroid-responsive region of the MMTV promoter. Hence, we examined the regulation of a defined synthetic promoter construct driven by two palindromic PREs (PRE/-32/luc3). Although this promoter construct was no longer inducible by LAP, transcriptional activation by liganded PR-B was still markedly enhanced by coexpressed LIP, demonstrating that DNA binding of PR-B, but not of LIP, is essential for cooperation. Liganded PR-A had little effect on either MMTV or PRE promoter activity in ES cells. Overexpressed LIP alone was also without effect, and the inability of PR-A to activate transcription could not be overcome by the addition of LIP. Together these results indicate that functional interaction between LIP and PR requires not only anchoring of activated PR to its cognate DNA response element, but also a domain or configuration specific to the B-isoform.

Conversely, activation of an isolated C/EBPß response element (NFIL6RE/-32/luc3) by LAP was synergistically enhanced by PR-A in a ligand-dependent manner. Surprisingly, both liganded PR isoforms elicited promoter activity even in the absence of coexpressed LAP. Although this may reflect interaction with endogenous LAP, the activated B-isoform of the receptor also triggered reporter activity from the control reporter constructs, pGL3-Basic and dPRL-32/luc3. Furthermore, the pattern of activation of these control constructs by PR-B in the presence of coexpressed C/EBPß was identical to that seen with the NFIL6RE/-32/luc3 construct. Transcriptional stimulation in the absence of high affinity response elements may be due to interaction of the receptor with components of the general transcription machinery, such as the TATA-binding protein-associated factor dTAFII110 (43). Likewise, the trans-activation domain of C/EBP, conserved among C/EBP{alpha}, -ß, and -{delta}, has also been shown to interact with the TATA-binding protein and TFIIB (44) and may account for the discrete activation of the promoterless constructs in response to overexpressed LAP. No promoter-independent transcriptional effects were seen with either LIP or PR-A, and synergy between LAP and activated PR-A was entirely dependent upon the presence of the C/EBPß response element. Mutation of the DBD or deletion of the C-terminal part of the LBD in PR-A abrogated the synergy. The latter illustrates the ligand dependency of the phenomenon, while the former points to a conformational requirement in the DBD in vivo, which was not essential for in vitro interaction. Discrepancies in the domain requirements for protein-protein interactions derived from in vitro data and from functional tests in living cells are not uncommon. In the case of the thymidine kinase gene promoter, the LBD of GR suffices for enhancement of promoter activity in response to C/EBPß, although this region is not involved in the physical association between GR and C/EBPß in GST pull-down assays (30).

The -332/-270 region of the dPRL promoter responded to C/EBPß-PR cross-coupling in a manner similar, but not identical, to that observed with the isolated NFIL6RE. We demonstrated that the two overlapping C/EBPß-binding sites not only mediated activation by LAP, but were also essential for the amplification of this response by liganded PR-A. However, the PRE half-site immediately upstream of the C/EBPß-binding sites contributed to the functional interaction between LAP and PR-A. Directed mutation of this site not only reduced the level of synergy by approximately 40%, but also blunted trans-activation of this promoter region by either PR isoform, suggesting that PR may interact with its incomplete response element. Coexpressed PR-B and LAP had an additive effect on promoter activity in the presence of ligand, but the marked synergy between PR-B and LIP observed on PRE-driven reporters was absent. We can therefore conclude that LIP enhances PR-B transactivation only when the receptor is bound to DNA as a dimer.

The most salient finding of our study is that PR-A and LIP, which are both considered transcriptionally inactive and even antagonistic to other members of their respective families (13, 23), assume a coactivator role for active members of the opposite family. The mechanisms underlying such a functional switch are not clear. Possibly, interaction between liganded PR-A and DNA-bound LAP could facilitate the recruitment of other intermediate factors, resulting in the formation of a more productive transcriptional complex. An alternative possibility is that LAP might inactivate the inhibitory function (IF/ID) in the N-terminal segment of PR-A, promote interaction between the activation functions AF-1 and AF-2 in the receptor, and/or facilitate receptor-corepressor dissociation or coactivator recruitment. This model implies that LAP, when bound to DNA, can convert the A-isoform into a strong transcriptional activator. There was, however, no evidence that LAP could modulate the trans-activation potential of PR-A bound to its cognate response element. In contrast, LIP potently enhanced ligand-dependent trans-activation of dimerized DNA-bound PR-B. In a reconstituted cell-free expression system Klotzbücher et al. (45) identified a repressor domain in the Cterminal region of PR-B (comprising the hinge region plus LBD). Interestingly, repression could be relieved by the addition of an activity from rat liver, which the authors termed COPRA (cofactor of PR activation). COPRA resided in a partially purified column fraction obtained during isolation of general transcription factors from rat liver extracts and has not been further characterized (45). As rat liver is a very rich source of C/EBPs, including LAP and LIP (13), it is tempting to speculate that COPRA is LIP or a related factor. A final possibility is that cross-talk between these nuclear factors is effected by a nongenomic mechanism. We previously demonstrated that the dPRL-332/-270 region forms a specific complex with nuclear proteins from differentiated ES cells (11). However, additional EMSA with supershift analysis failed to demonstrate PR within this nucleoprotein complex (data not shown). This may be due to the PR-C/EBPß-DNA complex being stable in vivo, but less stable than the C/EBPß-DNA complex in vitro, under EMSA conditions. Alternatively, other processes, such as nuclear targeting or intranuclear compartmentalization, may mediate cooperation between PR and C/EBPß.

Transcriptional cross-coupling between C/EBPß and PR could explain the overlap in reproductive phenotypes observed in knockout mice. Both PR- and C/EBPß-deficient mice fail to ovulate and have impaired mammary gland development (17, 19, 46, 47). Recently, the distinct functions of PR-A and PR-B have been defined by selective ablations. In the mammary gland, PR-B is sufficient for normal proliferation and differentiation of the epithelium in response to progesterone, whereas both receptor isoforms are essential for ovulation (46, 48). In the mouse uterus, PR-A not only mediates the antiproliferative effect of progesterone on the epithelium, but is also essential for the decidualization of the stromal compartment. In human endometrium, decidual transformation also coincides with a marked down-regulation of PR-B, but not PR-A (49), rendering PR-A the predominant isoform in decidualized stromal cells (50). Although endometrial C/EBPß expression has not yet been studied in vivo, we previously demonstrated that LAP is induced in human ES cell cultures upon treatment with a decidualizing stimulus (11). Hence, the necessary components for coordinated activation of the dPRL gene are likely to be present in differentiating ES cells (1, 11). Notably, another marker gene of decidualization, IGF-binding protein-1, has recently been reported to be more effectively activated by PR-A than by PR-B in response to progestin (51).

Our results imply that the relative ratios of C/EBPß and PR isoforms are important determinants of the cellular responses to ovarian progesterone. Within this model, the high level of circulating progesterone in the secretory phase of the cycle and during pregnancy, instead of eliciting expression of PRE-driven genes, could be of critical importance for enhancing C/EBPß-dependent transcription through activation of PR-A. However, recent evidence from our laboratory indicates that other transcription factors, such as STAT5 and FKHR (forkhead homolog in rhabdomyosarcoma), are also mediators of the PKA response in differentiating ES cells (Mak, I., J. Brosens, M. Christian, F. Hills, L. Regan, and J. White, manuscript in preparation). Both STAT5 and FKHR have been shown to associate with PR (33, 52). Hence, it appears likely that coordinated and sustained expression of the decidual phenotype is effected by diverse interactions between activated PR and decidua-specific nuclear proteins.

Activation of the dPRL promoter is highly cell specific, and therefore we have limited this study to human ES cells. Conceivably, PR-C/EBPß cross-talk may be relevant to the pathophysiology of hormone-dependent disorders of the reproductive tract that are characterized by aberrant expression of either transcription factor. For instance, altered isoforms ratios have been described for PR and C/EBPß in human breast cancers where a significant proportion of tumors have elevated levels of PR-A or LIP (53, 54). Another example is endometriosis, a common and debilitating disease during reproductive years. This disease is defined by the presence of ectopic endometrial implants and a low grade sterile inflammatory response (55). PR-A is thought to be the only receptor isoform expressed in the ectopic lesions (56), which may contribute to the aberrant expression of C/EBPß-dependent proinflammatory genes, such as IL-6 and IL-8 (57, 58).

In conclusion, we have defined novel functions for PR-A and LIP by demonstrating their ability to assume the role of transcriptional coactivators of LAP and PR-B, respectively, and provided a mechanistic basis for the progesterone-dependent enhancement of cAMP-induced dPRL gene expression in endometrial stromal cells.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 
Plasmids
Complementary DNAs to LAP (C/EBPß with mutated Met199 to Leu) and LIP were cloned into pSG5 (11). Expression vectors containing hPR-A and hPR-B, cloned into pSG5, were gifts from Dr. Pierre Chambon (Institut de Genetique et de Biologie Moleculaire et Cellulaire, Strasbourg, France). The PR-A and PR-B DNA-binding mutants (PR-ADBM and PR-BDBM, respectively), in which cysteine 587 was mutated to alanine, and the BUS-DBD-NLS, a mutant in which the BUS domain is fused to the DBD and a nuclear localization signal, were gifts from Dr. Kathryn Horwitz (University of Colorado Health Sciences Center, Denver, CO). The hPR-A LBD mutant (PR-ALBM) was constructed using the method described previously for hPR-BLBM (1). The expression vector pcDNA/GR{alpha} was constructed by excising the cDNA for human GR{alpha} from pRS-hGR (a gift from Ron Evans, Howard Hughes Medical Institute, San Diego, CA) with Acc65I/XhoI and inserting it into the corresponding sites in pcDNA3.1+ (Invitrogen, Groningen, The Netherlands). The STAT5b expression vector was constructed by excising STAT5b cDNA from hSTAT5b-pEFplink (a gift from James Herrington, University of Michigan Medical School, Ann Arbor, MI) with XhoI and ligation into pcDNA3.1+ digested with XhoI.

Cloning cDNAs into the vector pGEX-6P2 (Amersham Pharmacia Biotech, Little Chalfont, UK) generated GST fusion protein constructs. To construct pGEX/LAP, LAP cDNA was generated by PCR with Pfx polymerase (Life Technologies, Inc., Uxbridge, UK) using pSG/LAP as the template. Primers were: LAP-BAM-5, 5'-CAATTGGATCCCAACGCCTGGTGGCCTGGG-3' [sense; annealing to positions 3–22 relative to the ATG start codon, which was mutated to introduce a BamHI site (underlined)]; and C/EBPß-XHO-3, 5'-CATTGCTCGAGGCAGTGGCCGGAGGAGGCGAG-3' [antisense; annealing to positions 1015–1035, mutating the stop codon to introduce an XhoI site (underlined)]. The PCR product was cleaved with BamHI and XhoI and ligated into BamHI/XhoI-digested pGEX-6P2. To construct pGEX/LIP, LIP cDNA was generated by PCR with pSG/LIP as the template. The primer used was LIP-BAM-5, 5'-CAATTGGATCCGCGGCGGGCTTCCCGTACG-3' (sense; annealing to positions 598–616 relative to the ATG start codon of LAP). The ATG of LIP (position 596 relative to LAP ATG) was mutated to introduce a BamHI site (underlined). The antisense primer used was C/EBPß-XHO-3 as described above. The resulting PCR product was cleaved with BamHI and XhoI, and ligated into BamHI/XhoI-digested pGEX-6P2. Sequencing confirmed that the inserts had been cloned in-frame with the GST gene.

pMMTV/luc, carrying the MMTV long terminal repeat upstream of the luciferase reporter gene, has been described previously (2).

All luciferase reporter constructs, with the exception of pMMTV/luc, are in pGL3-Basic (Promega Corp., Southampton, UK; Fig. 1Go). The reporter constructs dPRL-332/luc3, dPRL(-332/-270)/-32/luc3, dPRL-32/luc3, and NFIL6RE/-32/luc3 have been described previously (11).

The reporter construct dPRL(-332/-270wt)/-32/luc3 carries the wild-type sequence between positions -332/-270 of the dPRL promoter in front of the minimal dPRL promoter element between positions -32/+65 and was constructed as follows. Oligonucleotides WT-s and WT-as, corresponding to -332/-270 in the sense and antisense directions, were designed and annealed such that a 5'-blunt end and a 3'-BglII-compatible overhang were created: WT-s, 5'-ATTATGTTCTGAGGGCTGCTCTGTGTGTTGTAAGATGTTTAGCAACATGTCTGGTCTCTGCTC-A-3'; and WT-as, 5'GATCT-GAGCAGAGACCAGACATGTTGCTAAACATCTTACAACACACAGAGCAG CCCTCAGAACATAAT-3'. The PRE half-site is underlined (coordinates -328/-323), two overlapping C/EBP binding sites, D and B (-310/-297 and -298/-285) are doubly underlined (11), and nucleotides forming the BglII overhang are italicized. The double-stranded oligonucleotide was inserted into the Ecl136 II/BglII sites of dPRL-32/luc3. Correspondingly, based on WT-s and WT-as, oligonucleotides PREmut-s and PREmut-as were designed to mutate the PRE half-site to TGgcCa (mutated bases are in lowercase letters), and oligonucleotides DBmut-s and DBmut-as were used to mutate C/EBP-binding sites D and B to GTGTGTcGTAcGATGcTgAGCAtCAT. The resultant reporter constructs dPRL(-332/-270PREmut)/-32/luc3 and dPRL(-332/-270DBmut)/-32/luc3 are shown in Fig. 1Go. The progesterone-responsive reporter PRE/-32/luc3, containing two palindromic PREs, has been described previously (59).

GST Pulldown Assays
The BL21-Trx E. coli strain expressing the protein thioredoxin (60) was transformed with the appropriate pGEX expression construct. GST or GST fusion proteins were induced with 0.1 mM isopropyl-1-thio-ß-D-galactopyranoside added to the bacterial culture when the OD600 was 0.6–0.8. After 1 h of isopropyl-1-thio-ß-D-galactopyranoside stimulation at 30 C, the proteins were extracted using the reagent B-Per (Pierce Chemical Co., Rockford, IL) according to the manufacturer’s protocol.

35S-Labeled proteins were prepared by the in vitro transcription-translation method, using the TNT T7-coupled reticulocyte lysate system according to the manufacturer’s protocol (Promega Corp.). The presence of [35S]methionine (>1000 Ci/mmol; Amersham Pharmacia Biotech) in the incubation mixture was used to produce labeled GR{alpha}, human PR-B, and human PR-A proteins (from the plasmids, pcDNA/GR{alpha}, pSG/hPR-B, and pSG/hPR-A, respectively).

GST fusion proteins were immobilized on glutathione-Sepharose beads (Amersham Pharmacia Biotech). Before use, the beads were washed four times with GST buffer [20 mM Tris (pH 7), 100 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 0.5% Nonidet P-40, and 0.5% fat-free dried milk] including Complete Protease Inhibitor (Roche, East Sussex, UK). The amount of GST, GST-LAP, or GST-LIP that was added to the beads was quantified using the 1-chloro-2, 4-dinitrobenzene (CDNB) assay (Amersham Pharmacia Biotech). This assay uses the GST enzyme catalysis of the conjugation of CDNB with glutathione and results in a CDNB-glutathione product with a strong molar absorption measured at 340 nm. Thus, the results of the CDNB assay were used to calculate the relative levels of GST activity in GST and the GST fusion proteins, and equal amounts were loaded on the beads. GST buffer was added to each sample, up to 1 ml, and incubated with gentle rocking for 1 h at room temperature. The immobilized GST proteins on the glutathione-Sepharose beads were washed six times with 1 ml GST buffer. For PR binding assays, 35S-labeled proteins were preincubated with 1 µM MPA for 2 h at 4 C where indicated. Fifty microliters of 35S-labeled in vitro transcription-translation product was added to the beads and made up to 1 ml with GST buffer. The beads were incubated for 1 h at room temperature, then washed six times with 1 ml GST buffer. Fifty microliters of Laemmli buffer were added, and the samples were boiled and then electrophoresed in a 10% SDS-polyacrylamide gel. Five microliters of the in vitro transcription-translation product were loaded on the gel as the input of 35S signal. The gel was dried, and proteins were visualized by autoradiography.

Primary ES Cell Culture
ES cells were isolated from normal proliferative endometrial tissues obtained from cycling women, by endometrial biopsy, at the time of diagnostic laparoscopy and hysteroscopy. Hammersmith and Queen Charlotte’s Hospital research and ethics committee approved the study, and patient consent was obtained before biopsy. Samples were collected in Earle’s buffered saline containing 100 U/ml penicillin and 100 µg/ml streptomycin. The tissues were washed twice in a 1:1 mixture of DMEM and Ham’s F-12 (Sigma, Poole, UK), finely minced, and enzymatically digested with collagenase (134 U/ml) and deoxyribonuclease type I (156 U/ml; Sigma) for 1 h at 37 C. After centrifugation at 400 x g for 4 min, the pellet was resuspended in maintenance medium of DMEM/F-12 containing 10% dextran-coated charcoal-treated FBS (DCC-FBS), 1% L-glutamine, and 1% antibiotic-antimycotic solution. ES cells were separated from epithelial cells and passed into culture as previously described (1, 9). Proliferating ES cells were cultured in maintenance medium until confluence. Confluent monolayers were treated in DMEM/F-12 containing 2% DCC-FBS with 10-6 M MPA (Sigma). The progestin MPA was used in this study due to its greater stability in culture relative to progesterone. All experiments were carried out before the fourth cell passage.

Transfections
Transient transfections of ES cells plated at a density of 2.5 x 105 cells/well in 24-well plates were performed by the calcium phosphate precipitation in medium supplemented with 2% DCC-FBS. Reporter-promoter constructs and expression constructs were transfected at concentrations of 0.5 µg/well and 125 ng/well, respectively. The empty expression vector pSG5 was included as a filler construct when required. Details of the transfection protocol and the treatments are indicated in the figure legends. Cell extracts were harvested, and luciferase activity was measured with the luciferase reagent kit (Promega Corp.) and expressed as relative light units or fold induction. Transfections were performed in triplicate and were repeated at least three times. Representative experiments are shown (mean ± SD).


    ACKNOWLEDGMENTS
 
We thank John White for his valuable support, and Katherine Horwitz, Ron Evans, Pierre Chambon, and James Herrington for providing expression constructs. We are grateful to the clinicians at Hammersmith Hospital for providing endometrial biopsies.


    FOOTNOTES
 
This work was supported by Wellcome Trust Clinician Scientist Fellowship 54043 (to J.J.B.), Deutsche Forschungsgemeinschaft Grant GE 748/7-1 (to B.G.), and a Royal Society Joint Project Grant.

Abbreviations: AF-1, Activating factor-1; BUS, B-upstream sequence; bZIP, basic region/leucine zipper; CDNB, 1-chloro-2, 4-dinitrobenzene; C/EBPß, CCAAT/enhancer-binding protein-ß; COPRA, cofactor of PR activation; DBD, DNA-binding domain; DCC-FBS, dextran-coated charcoal-treated FBS; dPRL, decidual PRL; ES, endometrial stromal; FKHR, forkhead homolog in rhabdomyosarcoma; GST, glutathione-S-transferase; LAP, liver-enriched activatory protein; LBD, ligand-binding domain; LIP, liver-enriched inhibitory protein; MMTV, mouse mammary tumor virus; MPA, medroxyprogesterone acetate; NLS, nuclear localization signal; PRE, progesterone response element; STAT5, signal transducer and activator of transcription 5.

Received for publication April 16, 2001. Accepted for publication September 27, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESULTS
 DISCUSSION
 MATERIALS AND METHODS
 REFERENCES
 

  1. Brosens JJ, Hayashi N, White JO 1999 Progesterone receptor regulates decidual prolactin expression in differentiating human endometrial stromal cells. Endocrinology 140:4809–4820[Abstract/Free Full Text]
  2. Gellersen B, Kempf R, Telgmann R, DiMattia GE 1994 Nonpituitary human prolactin gene transcription is independent of Pit-1 and differentially controlled in lymphocytes and in endometrial stroma. Mol Endocrinol 8:356–373[Abstract]
  3. Maslar IA, Riddick DH 1979 Prolactin production by human endometrium during the normal menstrual cycle. Am J Obstet Gynecol 135:751–754[Medline]
  4. Tang B, Gurpide E 1993 Direct effect of gonadotropins on decidualization of human endometrial stroma cells. J Steroid Biochem Mol Biol 47:115–121[CrossRef][Medline]
  5. Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S 1997 Progesterone-dependent decidualization of the human endometrium is mediated by cAMP. Endocrine 6:301–307[Medline]
  6. Ferrari A, Petraglia F, Gurpide E 1995 Corticotropin releasing factor decidualizes human endometrial stromal cells in vitro: interaction with progestin. J Steroid Biochem Mol Biol 54:251–255[CrossRef][Medline]
  7. Moy E, Kimzey LM, Nelson LM, Blithe DL 1996 Glycoprotein hormone {alpha}-subunit functions synergistically with progesterone to stimulate differentiation of cultured human endometrial stromal cells to decidualized cells: a novel role for free {alpha}-subunit in reproduction. Endocrinology 137:1332–1339[Abstract]
  8. Telgmann R, Maronde E, Taskén K, Gellersen B 1997 Activated protein kinase A is required for differentiation-dependent transcription of the decidual prolactin gene in human endometrial stromal cells. Endocrinology 138:929–937[Abstract/Free Full Text]
  9. Brosens JJ, Takeda S, Acevedo CH, Lewis MP, Kirby PL, Symes EK, Krausz T, Purohit A, Gellersen B, White JO 1996 Human endometrial fibroblasts immortalized by simian virus 40 large T antigen differentiate in response to a decidualization stimulus. Endocrinology 137:2225–2231[Abstract]
  10. Berwaer M, Martial JA, Davis JR 1994 Characterization of an up-stream promoter directing extrapituitary expression of the human prolactin gene. Mol Endocrinol 8:635–642[Abstract]
  11. Pohnke Y, Kempf R, Gellersen B 1999 CCAAT/enhancer-binding proteins are mediators in the protein kinase A-dependent activation of the decidual prolactin promoter. J Biol Chem 274:24808–24818[Abstract/Free Full Text]
  12. Lekstrom-Himes J, Xanthopoulos KG 1998 Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J Biol Chem 273:28545–28548[Abstract/Free Full Text]
  13. Descombes P, Schibler U 1991 A liver-enriched transcriptional activator protein, LAP, and a transcriptional inhibitory protein, LIP, are translated from the same mRNA. Cell 67:569–579[Medline]
  14. Mandrup S, Lane MD 1997 Regulating adipogenesis. J Biol Chem 272:5367–5370[Free Full Text]
  15. Schwarz EJ, Reginato MJ, Shao D, Krakow SL, Lazar MA 1997 Retinoic acid blocks adipogenesis by inhibiting C/EBPß-mediated transcription. Mol Cell Biol 17:1552–1561[Abstract]
  16. Tanaka T, Yoshida N, Kishimoto T, Akira S 1997 Defective adipocyte differentiation in mice lacking the C/EBPß and/or C/EBP{delta} gene. EMBO J 16:7432–7443[Abstract/Free Full Text]
  17. Sterneck E, Tessarollo L, Johnson PF 1997 An essential role for C/EBPß in female reproduction. Genes Dev 11:2153–2162[Abstract/Free Full Text]
  18. Screpanti I, Romani L, Musiani P, Modesti A, Fattori E, Lazzaro D, Sellitto C, Scarpa S, Bellavia D, Lattanzio G, Bistoni F, Frati L, Cortese R, Gulino A, Ciliberto G, Costantini F, Poli V 1995 Lymphoproliferative disorder and imbalanced T-helper response in C/EBPß-deficient mice. EMBO J 14:1932–1941[Abstract]
  19. Seagroves TN, Krnacik S, Raught B, Gay J, Burgess-Beusse B, Darlington GJ, Rosen JM 1998 C/EBPß, but not C/EBP{alpha}, is essential for ductal morphogenesis, lobuloalveolar proliferation, and functional differentiation in the mouse mammary gland. Genes Dev 12:1917–1928[Abstract/Free Full Text]
  20. Kastner P, Krust A, Turcotte B, Stropp U, Tora L, Gronemeyer H, Chambon P 1990 Two distinct estrogen-regulated promoters generate transcripts encoding the two functionally different human progesterone receptor forms A and B. EMBO J 9:1603–1614[Abstract]
  21. Sartorius CA, Groshong SD, Miller LA, Powell RL, Tung L, Takimoto GS, Horwitz KB 1994 New T47D breast cancer cell lines for the independent study of progesterone B- and A-receptors: only antiprogestin-occupied B-receptors are switched to transcriptional agonists by cAMP. Cancer Res 54:3868–3877[Abstract]
  22. Tung L, Mohamed MK, Hoeffler JP, Takimoto GS, Horwitz KB 1993 Antagonist-occupied human progesterone B-receptors activate transcription without binding to progesterone response elements and are dominantly inhibited by A-receptors. Mol Endocrinol 7:1256–1265[Abstract]
  23. Vegeto E, Shahbaz MM, Wen DX, Goldman ME, O’Malley BW, McDonnell DP 1993 Human progesterone receptor A form is a cell- and promoter-specific repressor of human progesterone receptor B function. Mol Endocrinol 7:1244–1255[Abstract]
  24. Wen DX, Xu YF, Mais DE, Goldman ME, McDonnell DP 1994 The A and B isoforms of the human progesterone receptor operate through distinct signaling pathways within target cells. Mol Cell Biol 14:8356–8364[Abstract]
  25. Sartorius CA, Melville MY, Hovland AR, Tung L, Takimoto GS, Horwitz KB 1994 A third transactivation function (AF3) of human progesterone receptors located in the unique N-terminal segment of the B-isoform. Mol Endocrinol 8:1347–1360[Abstract]
  26. Meyer ME, Quirin-Stricker C, Lerouge T, Bocquel MT, Gronemeyer H 1992 A limiting factor mediates the differential activation of promoters by the human progesterone receptor isoforms. J Biol Chem 267:10882–10887[Abstract/Free Full Text]
  27. Hovland AR, Powell RL, Takimoto GS, Tung L, Horwitz KB 1998 An N-terminal inhibitory function, IF, suppresses transcription by the A-isoform but not the B-isoform of human progesterone receptors. J Biol Chem 273:5455–5460[Abstract/Free Full Text]
  28. Giangrande PH, Kimbrel EA, Edwards DP, McDonnell DP 2000 The opposing transcriptional activities of the two isoforms of the human progesterone receptor are due to differential cofactor binding. Mol Cell Biol 20:3102–3115[Abstract/Free Full Text]
  29. Kalkhoven E, Wissink S, van der Saag PT, van der Burg B 1996 Negative interaction between the RelA(p65) subunit of NF-{kappa}B and the progesterone receptor. J Biol Chem 271:6217–6224[Abstract/Free Full Text]
  30. Boruk M, Savory JG, Hache RJ 1998 AF-2-dependent potentiation of CCAAT enhancer binding protein ßmediated transcriptional activation by glucocorticoid receptor. Mol Endocrinol 12:1749–1763[Abstract/Free Full Text]
  31. Stein B, Yang MX 1995 Repression of the interleukin-6 promoter by estrogen receptor is mediated by NF-{kappa}B and C/EBPß. Mol Cell Biol 15:4971–4979[Abstract]
  32. Savoldi G, Fenaroli A, Ferrari F, Rigaud G, Albertini A, Di Lorenzo D 1997 The glucocorticoid receptor regulates the binding of C/EPBß on the {alpha}1-acid glycoprotein promoter in vivo. DNA Cell Biol 16:1467–1476[Medline]
  33. Richer JK, Lange CA, Manning NG, Owen G, Powell R, Horwitz KB 1998 Convergence of progesterone with growth factor and cytokine signaling in breast cancer. Progesterone receptors regulate signal transducers and activators of transcription expression and activity. J Biol Chem 273:31317–31326[Abstract/Free Full Text]
  34. Truss M, Bartsch J, Chalepakis G, Beato M 1992 Artificial steroid hormone response element generated by dam-methylation. Nucleic Acids Res 20:1483–1486[Abstract]
  35. Chang CJ, Chen YL, Lee SC 1998 Coactivator TIF1ß interacts with transcription factor C/EBPß and glucocorticoid receptor to induce {alpha}1-acid glycoprotein gene expression. Mol Cell Biol 18:5880–5887[Abstract/Free Full Text]
  36. Miau LH, Chang CJ, Tsai WH, Lee SC 1997 Identification and characterization of a nucleolar phosphoprotein, Nopp140, as a transcription factor. Mol Cell Biol 17:230–239[Abstract]
  37. Lee YM, Miau LH, Chang CJ, Lee SC 1996 Transcriptional induction of the {alpha}-1 acid glycoprotein (AGP) gene by synergistic interaction of two alternative activator forms of AGP/enhancer-binding protein (C/EBPß) and NF-{kappa}B or Nopp140. Mol Cell Biol 16:4257–4263[Abstract]
  38. Stein B, Cogswell PC, Baldwin AS 1993 Functional and physical associations between NF-{kappa}B and C/EBP family members: a Rel domain-bZIP interaction. Mol Cell Biol 13:3964–3974[Abstract]
  39. McNagny KM, Sieweke MH, Doderlein G, Graf T, Nerlov C 1998 Regulation of eosinophil-specific gene expression by a C/EBP-Ets complex and GATA-1. EMBO J 17:3669–3680[Abstract/Free Full Text]
  40. Lu M, Seufert J, Habener JF 1997 Pancreatic ß-cell-specific repression of insulin gene transcription by CCAAT/enhancer-binding protein ß. Inhibitory interactions with basic helix-loop-helix transcription factor E47. J Biol Chem 272:28349–28359[Abstract/Free Full Text]
  41. Chen PL, Riley DJ, Chen-Kiang S, Lee WH 1996 Retinoblastoma protein directly interacts with and activates the transcription factor NF-IL6. Proc Natl Acad Sci USA 93:465–469[Abstract/Free Full Text]
  42. Cato ACB, Miksicek R, Schütz G, Arnemann J, Beato M 1986 The hormone regulatory element of mouse mammary tumor virus mediates progesterone induction. EMBO J 5:2237–2240[Abstract]
  43. Schwerk C, Klotzbücher M, Sachs M, Ulber V, Klein-Hitpass L 1995 Identification of a transactivation function in the progesterone receptor that interacts with the TAFII110 subunit of the TFIID complex. J Biol Chem 270:21331–21338[Abstract/Free Full Text]
  44. Nerlov C, Ziff EB 1995 CCAAT/enhancer binding protein-{alpha} amino acid motifs with dual TBP and TFIIB binding ability co-operate to activate transcription in both yeast and mammalian cells. EMBO J 14:4318–4328[Abstract]
  45. Klotzbücher M, Schwerk C, Holewa B, Klein-Hitpass L 1997 Activation of transcription by progesterone receptor involves derepression of activation functions by a cofactor. Mol Endocrinol 11:768–778[Abstract/Free Full Text]
  46. Conneely OM, Lydon JP 2000 Progesterone receptors in reproduction: functional impact of the A and B isoforms. Steroids 65:571–577[CrossRef][Medline]
  47. Robinson GW, Johnson PF, Hennighausen L, Sterneck E 1998 The C/EBPß transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland. Genes Dev 12:1907–1916[Abstract/Free Full Text]
  48. Mulac-Jericevic B, Mullinax RA, DeMayo FJ, Lydon JP, Conneely OM 2000 Subgroup of reproductive functions of progesterone mediated by progesterone receptor-B isoform. Science 289:1751–1754[Abstract/Free Full Text]
  49. Wang H, Critchley HO, Kelly RW, Shen D, Baird DT 1998 Progesterone receptor subtype B is differentially regulated in human endometrial stroma. Mol Hum Reprod 4:407–412[Abstract]
  50. Mote PA, Balleine RL, McGowan EM, Clarke CL 1999 Colocalization of progesterone receptors A and B by dual immunofluorescent histochemistry in human endometrium during the menstrual cycle. J Clin Endocrinol Metab 84:2963–2971[Abstract/Free Full Text]
  51. Gao J, Mazella J, Tang M, Tseng L 2000 Ligand-activated progesterone receptor isoform hPR-A is a stronger transactivator than hPR-B for the expression of IGFBP-1 (insulin-like growth factor binding protein-1) in human endometrial stromal cells. Mol Endocrinol 14:1954–1961[Abstract/Free Full Text]
  52. Zhao HH, Herrera RE, Coronado-Heinsohn E, Yang MC, Ludes-Meyers JH, Seybold-Tilson KJ, Nawaz Z, Yee D, Barr FG, Diab SG, Brown PH, Fuqua SA, Osborne CK 2001 Forkhead homologue in rhabdomyosarcoma functions as a bifunctional nuclear receptor-interacting protein with both coactivator and corepressor functions. J Biol Chem 276:27907–12[Abstract/Free Full Text]
  53. Graham JD, Yeates C, Balleine RL, Harvey SS, Milliken JS, Bilous AM, Clarke CL 1995 Characterization of progesterone receptor A and B expression in human breast cancer. Cancer Res 55:5063–5068[Abstract]
  54. Zahnow CA, Younes P, Laucirica R, Rosen JM 1997 Overexpression of C/EBPß-LIP, a naturally occurring, dominant-negative transcription factor, in human breast cancer. J Natl Cancer Inst 89:1887–1891[Abstract/Free Full Text]
  55. Brosens IA, Brosens JJ 2000 Redefining endometriosis: is deep endometriosis a progressive disease? Hum Reprod 15:1–3[Free Full Text]
  56. Attia GR, Zeitoun K, Edwards D, Johns A, Carr BR, Bulun SE 2000 Progesterone receptor isoform A but not B is expressed in endometriosis. J Clin Endocrinol Metab 85:2897–2902[Abstract/Free Full Text]
  57. Bergqvist A, Bruse C, Carlberg M, Carlstrom K 2001 Interleukin 1ß, interleukin-6, and tumor necrosis factor-{alpha} in endometriotic tissue and in endometrium. Fertil Steril 75:489–495[CrossRef][Medline]
  58. Fasciani A, D’Ambrogio G, Bocci G, Monti M, Genazzani AR, Artini PG 2000 High concentrations of the vascular endothelial growth factor and interleukin-8 in ovarian endometriomata. Mol Hum Reprod 6:50–54[Abstract/Free Full Text]
  59. Greenland KJ, Jantke I, Jenatschke S, Bracken KE, Vinson C, Gellersen B 2000 The human NAD+-dependent 15-hydroxyprostaglandin dehydrogenase gene promoter is controlled by Ets and activating protein-1 transcription factors and progesterone. Endocrinology 141:581–597[Abstract/Free Full Text]
  60. Yasukawa T, Kanei-Ishii C, Maekawa T, Fujimoto J, Yamamoto T, Ishii S 1995 Increase of solubility of foreign proteins in Escherichia coli by coproduction of the bacterial thioredoxin. J Biol Chem 270:25328–25331[Abstract/Free Full Text]