Ancient SINEs from African Endemic Mammals

Masato Nikaido*, Hidenori Nishihara*, Yukio Hukumoto{dagger} and Norihiro Okada*,

* Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Japan
{dagger} Asa Zoological Park, Hiroshima, Japan


    Abstract
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussions
 Acknowledgements
 Literature Cited
 
Afrotheria is a newly recognized taxon comprising elephants, hyraxes, sea cows, aardvarks, golden moles, tenrecs, and elephant shrews, each of which originated in Africa. Although some members of this taxon were once classified into distantly related groups, recent molecular studies have demonstrated their close relationships. It was suggested that this group emerged as a result of physical isolation of the African continent during the successive breakup events of Gondowanaland. In this study, a novel family of SINEs, designated AfroSINEs, was isolated and characterized from the genomes of afrotherians. This SINE family is distributed exclusively among the afrotherian species, confirming their monophyletic relationships. Furthermore, a distinct subfamily, which shares a deletion in the middle region of the SINE, was identified. The distribution of this subfamily is apparently restricted to the genomes of hyraxes, elephants, and sea cows, suggesting monophyly of these three groups, which was previously proposed as Paenungulata. We characterized the structures of the AfroSINEs from all afrotherian representatives by PCR, and we discuss how they were generated as well as the phylogenetic relationships of their host species.

Key Words: Afrotheria • genome • monophyletic • phylogenetic • taxon • SINE


    Introduction
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussions
 Acknowledgements
 Literature Cited
 
SINEs are members of retroposons, which include retroviruses, long terminal repeat (LTR) retrotransposons, long interspersed elements (LINEs), and processed retropseudogenes. Retroposons are amplified via cDNA intermediates and are reintegrated into the host genome by retroposition (Rogers 1985; Weiner, Deininger, and Efstratiadis 1986; Kazazian 2000). SINEs are defined by the presence of a region homologous to tRNA or 7SL RNA, together with the promoter sequences designated the A and B boxes (Weiner 1980; Ullu and Tschudi 1984; Okada 1991a, 1991b; Okada and Ohshima 1995). SINEs represent nonautonomous transposable elements and exploit the enzymatic retrotranspositional machinary of LINEs (Kajikawa and Okada 2002). SINEs are widely distributed among the genomes of eukaryotes and are present at more than 104 copies per genome in multicellular animals from invertebrates to mammals and also present in plants (Okada 1991a, 1991b; Schmid and Maraia 1992; Shedlock and Okada 2000). One of the most abundant SINE families, Alu, is widely distributed in the human genome (Schmid 1996; Batzer and Deininger 2002). The human genome project recently revealed that Alus constitute more than 10% of the human genome (Hattori et al. 2000; International Human Genome Sequencing Consortium 2001), implying that retroposons have a great significance in constituting animal genomes during evolution.

Emergence of new SINEs during evolution is not well understood. Apparently, SINEs are specific to order, family, genus, or, sometimes, even to species (Kido et al. 1991; Takasaki et al. 1994; Shedlock and Okada 2000). This suggests that SINEs were newly created sporadically in a common ancestor of some lineages during evolution. For example, Alus were created in a common ancestor of primates and are thus only present in primate genomes (Schmid 1996; Batzer and Deininger 2002). CHR-1 and CHR-2 SINEs were created in a common ancestor of cetaceans, hippopotamuses, and ruminants and are thus present only in these genomes (Shimamura et al. 1997; Shimamura et al. 1999). Horizontal transfer of SINEs (Hamada et al. 1997), as well as that of LINEs (Kordis and Gubensek 1998), is believed to be very rare, so the distribution of SINEs among animals generally reflects their phylogenetic relationships. To date, more than 40 families of SINEs have been characterized, and no example was reported in which the same family of SINEs was sporadically distributed among different species, except for SmaI SINEs in salmonid species (Hamada et al. 1997). Therefore, the sporadic distribution of SINEs is informative for phylogenetic inference (Serdobova and Kramerov 1998; Shimamura et al. 1999; Nikaido et al. 2001).

The possibility that afrotherian animals were related was first recognized by de Jong, Zweers, and Goodman (1981), who proposed that elephant, hyrax, aardvark, and elephant shrew form a monophyletic group by determining alpha A–crystallin protein sequences of several mammalian species. Following this study, several groups independently confirmed this hypothesis by molecular analyses (e.g., de Jong, Leunissen, and Wistow 1993; Madsen et al. 1997; Springer et al. 1997; Madsen et al. 2001; Murphy et al. 2001a, 2001b). Currently, animals such as sea cow, tenrec, and golden mole are also recognized as afrotherians, and the superorder Afrotheria is now accepted as one of the biggest assembly among the placental mammals (e.g., Hedges 2001). Accordingly, placental mammals are now divided into four large groups, namely Xenarthra (edentatans), Afrotheria, Laurasiatheria (carnivores, cetartiodactyls, chiropterans, eulipothyphlans, perissodactyls, and pholidotans), and Euarchonta (primates, dermopterans, and scandentians) plus Glires (rodents and lagomorphans) (e.g., Waddell, Okada, and Hasegawa 1999; Cao et al. 2000; Scally et al. 2001). This assembly contradicts the hypothesis suggested by morphological classifications, which failed to define the precise position of aardvarks and elephant shrews among the mammalian taxa (Novacek 1992). Based on the molecular data, it is currently proposed that Afrotheria includes species belonging to six orders, namely Hyracoidea, Sirenia, Proboscidea, Tubulidentata, Macroscelidea, and Insectiv-ora, some of which had been distantly classified previously. In particular, the monophyly of the order Insectivora was denied by the afrotherian status and it was divided into two groups, Eulipotyphla (hedgehog, mole, and sorex) and Afrosoricida (tenrec and golden mole) (Stanhope et al. 1998b). From an evolutionary point of view, the major contribution of establishing afrotherian membership is not only to recognize a novel clade, but also to connect phylogeny with plate tectonics (Hedges 2001). Although Africa is now connected to Eurasia, it was isolated from the other continents between 105 and 40 MYBP (Hedges 2001). This caused reproductive isolation that presumably gave rise to Afrotherian species. Although from a molecular point of view the afrotherian unity appears robust, its morphological synapomorphy has not been discovered, and it is now being explored extensively (e.g., Whidden 2002). Therefore, from both morphological and molecular perspectives, it is important for us to identify additional evidence that unifies the afrotherians into one clade (van Dijk et al. 2001).


    Materials and Methods
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussions
 Acknowledgements
 Literature Cited
 
There are primarily two procedures used to isolate and characterize SINEs from a given species. One is in vitro transcription of total genomic DNA (Endoh and Okada 1986), and the other is random sequencing of genomic DNA (Okada, Shedlock, and Nikaido 2003). In considering the latter method, suppose that the length of SINEs is approximately 200 nt and that they occupy 1% of the genome postulated to be 3x109 bp. In this case, if the sequence of 60 kbp of the genome can be determined, theoretically three copies of SINEs may be found in that 60-kbp sequence. Given current technology, the sequence of 60 kbp can be relatively easily determined using a high-efficiency sequencing machine such as the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems). More than 80 kbp of sequence can be determined overnight by applying 100 samples of cloned DNA to this machine.

We isolated genomic DNAs from the following species according to the procedure described by Blin and Stafford (1976): Cape hyrax (Procavia capensis), dugong (Dugong dugong), African elephant (Loxodonta africana), lesser hedgehog tenrec (Echinops telfairi), Cape golden mole (Chrysochloris asiatica), aardvark (Orycteropus afer), elephant shrew (Elephantulus sp.), common long-nosed armadillo (Dasypus novemcinctus), spotted hyena (Crocuta crocuta), Ryukyu flying fox (Pteropus dasymallus), horseshoe bat (Rhinolophus pumilus), cow (Bos taurus), hippopotamus (Hippopotamus amphibius), bottlenosed dolphin (Tursiops truncatus), house mouse (Mus musculus), and human (Homo sapiens).

The nucleotide sequence reported in this paper has been submitted to GenBank and has been assigned accession numbers AB095814 to AB095844


    Results and Discussions
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussions
 Acknowledgements
 Literature Cited
 
To search for a new family of SINEs in the genome of an Afrotherian representative, we sequenced random fragments of cloned DNA from the hyrax genome. First, hyrax genomic DNA was digested with HindIII, and the fragments were cloned into the pUC18 plasmid vector. The sequence of 63 kbp of randomly isolated hyrax DNA was determined using the ABI PRISM 3100 DNA sequencer. To find SINEs among these sequences, we aligned the overlapping sequences using DNA analysis software (GENETYX ver. 10.1) and targeted these regions to identify tRNA-related sequences as described by Okada, Shedlock, and Nikaido (2003). Using this procedure, we discovered 26 copies of SINEs having a length of 180 nucleotides belonging to the same family. An alignment is attached as an Appendix.



View larger version (79K):
[in this window]
[in a new window]
 
APPENDIX.— An alignment of members of the AfroSINE HSP subfamily. Sequences were isolated by screening a genomic library of cape hyrax (Procavia capensis; Pca). The nucleotides identical to the consensus sequence are shown by dots, and deletions are shown by bars

 
We named this newly identified SINE family AfroSINEs, since it was subsequently determined that these SINEs are present in all Afrotherian species (see below). A schematic representation of the AfroSINEs is shown in figure 1A. AfroSINEs are a typical tRNA-derived family of SINEs as shown in figure 1B. It is valuable to provide this tRNA-like structure because ancient SINEs such as AfroSINEs have accumulated many mutations, and it can be very difficult to deduce tRNA-like structures from these sequences (Okada, Shedlock, and Nikaido 2003). Although the secondary structures in this tRNA-like structure are not well conserved, several conserved and semiconserved nucleotides specific to tRNA are present at the secondary positions corresponding to tRNA (bold, italic nucleotides in fig.1B), suggesting the tRNA origin of these SINEs. Judging from the AfroSINE isolation frequency, they constitute about 7.4% of the hyrax genome.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1. (A) Schematic representation of AfroSINE structures. The vertical gray boxes indicate A and B boxes for internal promoters of RNA polymerase III in the tRNA-related region of AfroSINE. Shaded boxes indicate tRNA-unrelated regions. Most AfroSINEs end with (TTTG) repeats. The primers used for amplifying each subfamily are shown by arrows. The deleted regions in AfroSINEs are indicated by vertical dotted lines. (B) tRNA-like structure of AfroSINE. The conserved and semiconserved nucleotides specific to tRNA are highlighted by bold italic. The numbers indicate the nucleotides according to the tRNA numbering system. Possible hydrogen bonds in the stem regions are shown

 
To determine the presence or absence of the AfroSINEs among the genomes of other eutherian mammals, PCR was performed using primers (AfroSINE F1 and R1) designed from the conserved region by reference to the sequence alignment (see fig. 1A). The electrophoretic mobilities of the PCR products are shown in panel a of figure 2, and the primer sequences are listed in the figure legend. The PCR product bands were detected in the genomes of hyrax, dugong, elephant, tenrec, golden mole, aardvark, and elephant shrew and were not detected in the genomes of other mammals. This result indicates that the members of this SINE family are exclusively distributed in the afrotherian species and suggests monophyly of this group. It should be noted that AfroSINEs are the first SINE family characterized from the genomes of afrotherians, adding a new signature that corroborates the afrotherian clade.



View larger version (54K):
[in this window]
[in a new window]
 
FIG. 2. Detection of AfroSINEs by PCR using several sets of primers. These pictures show the electrophoretic mobility of PCR products generated by the indicated primer sets. Arrowheads indicate the positions of bands of AfroSINEs

 
To investigate the structure of AfroSINEs in more detail, we designed several sets of internal primers and performed PCR (see fig. 1A) using the genomes of afrotherians as templates. When primers F2 and R1 were used, we detected an obvious difference in band length among each species as shown in panel b of figure 2. Shorter bands were detected in hyrax, dugong, and elephant, and longer bands were found in all afrotherians, although the longer bands in hyrax, dugong, and elephant are faint. We determined the sequences of these products and a sequence alignment revealed that the shorter PCR products contain a 45-bp deletion of a distinct region located just after the tRNA-related region of the SINE. These members of AfroSINE were designated as the HSP (Hyracoidea, Sirenia, Proboscidea) subfamily. We also designed a primer designated F3 containing the region specific only to the longer SINE type (see fig. 1A). Using primers F3 and R1, PCR bands were also detected in all Afrotherians (fig. 2, panel c), confirming the presence of the longer type of SINEs in the genomes of hyrax, dugong, and elephant. Indeed, we detected the longer type of SINEs in the elephant genome directly by screening DNAs from its genomic library. However, their number was quite small. Next, to determine the presence or absence of the HSP subfamily in the genomes of tenrec, golden mole, aardvark, and elephant shrew, we utilized a primer designated F4. This primer was designed to encompass the two regions flanking the deleted region so that only the shorter SINE type would be amplified by primers F4 and R1. The PCR pattern confirmed that this shorter SINE is distributed exclusively in the genomes of hyrax, dugong, and elephant (fig. 2, panel d).

In analyzing the PCR products generated using primers F3 and R1, we detected two bands with slightly different mobilities (fig. 2, panel c). We sequenced these bands, and the sequence alignment revealed that the upper band was the AfroSINE we had already characterized, whereas the shorter band contains a small 25-bp deletion at the 3' end (see fig. 1A). This deletion type is found in all afrotherian species. An alignment of the consensus sequences of each subfamily of AfroSINEs from all afrotherian species is shown in figure 3. In this alignment, both the sequences isolated by screening the genomic library and those of the PCR products are included. Consensus sequences were deduced from at least more than three sequences for each subfamily. The diagnostic deletions shared among subfamilies in the alignment are obvious, but no distinct diagnostic nucleotide changes were found in these sequences.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3. An alignment of the consensus sequences of each subfamily of AfroSINEs in Afrotherian species. The species names whose sequences were isolated by screening genomic libraries are indicated in bold. Other sequences were obtained by PCR using AfroSINE primers. Sequences designed for primers are excluded from this alignment. The diagnostic deletions of Ad and HSP subfamilies are highlighted. The putative A and B boxes for RNA polymerase III internal promoters are indicated. The sequences of primers are AFroSINE F1: 5'–TGGAAACTCTATGGGGCAGT–3', F2: 5'–GCTAACCAAAAGGTCAGCAGT–3', F3: 5'–CGCGGGAGAAAGATGAGGC–3', F4: 5'–CAGGTGCTCCTTGGAAACT–3', and R1: 5'–AATTCCGACTCATAGTGACCCT–3'

 
Taking the patterns of distribution of the AfroSINE subfamilies and the sequence analyses of these subfamilies into account, we can deduce the evolutionary history of the AfroSINEs and the possible phylogenetic relationships of the host taxa. Since the longest type of AfroSINE and the subfamily with a small deletion near the 3' end were distributed in the genomes of all afrotherians and not in the other eutherians, these types might have emerged in a common ancestor of all extant afrotherians. Thus, we named the longest type and the subfamily with a small deletion near the 3' end as the Anc (Ancestral) subfamily and the Ad (Ancestral with a deletion) subfamily, respectively. The distribution of the shortest type, which shares a diagnostic deletion in the middle region, suggests that hyrax, dugong, and elephant might very likely be monophyletic. Thus, we named this variant the HSP subfamily. Nucleotide divergences of each member of the HSP subfamily are relatively few compared with the Anc subfamily, so it is likely that they are recent or still active among these genomes. Although some morphological analyses have positioned Hyracoidea as a sister group of perissodactyls (Fischer 1989; Fischer and Tassy 1993), other morphological as well as molecular analyses have suggested that hyrax is closely related to tethytherians (e.g., Shoshani 1993; Lavergne et al. 1996; Shoshani and McKenna 1998; Amrine and Springer 1999). Thus, the DNA sequence comparison and SINE distributions support monophyly of afrotherians and paenungulates, respectively, providing a novel signature that confirms their groupings.

As described, monophyly of species belonging to Afrotheria and Paenungulata, respectively, has already been established by DNA sequence comparison. However, the interrelationships among these species have not been resolved. For example, phylogenetic relationships among Paenungulata (hyraxes, sea cows, and elephants), Afrosoricida (tenrecs and golden moles), Tubulidentata (aardvarks), and Macroscelidea (elephant shrews) are now in controversy (Madsen et al. 2001; Murphy et al. 2001a, 2001b). An intrarelationship of paenungulates is also still unresolved (Amrine and Springer 1999; Madsen et al. 2001; Murphy et al. 2001a, 2001b), which concerns the issue of tethytherian monophyly or paraphyly. The latter issue is very important in that rejection of tethytherian monopyhly challenges the traditional hypothesis that connects Sirenia and Proboscidea. If this is the case, the phylogenetic position of extinct Desmostylia (tethytheria relatives, see Shoshani 1998) will become much more uncertain (e.g., Porter, Goodman, and Stanhope 1996; Ozawa, Hayashi, and Mikhelson 1997; Springer et al. 1997; Stanhope et al. 1998a). Recently, this problem was extensively discussed by Amrine and Springer (1999). The AfroSINEs characterized in this study might be very useful as phylogenetic markers to resolve the phylogenetic relationships of afrotherians. In particular, insertion analyses of members of the HSP subfamily may be instrumental in settling the long-standing dispute regarding tethytherian phylogeny.


    Acknowledgements
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussions
 Acknowledgements
 Literature Cited
 
The authors thank B. van Vuuren and S. Maree for providing the tissue samples and DNAs of aardvark, golden moles, and elephant shrew. We also thank F. Catzeflis for providing tissue samples of armadillo. This work was supported by research grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to N.O.)


    Footnotes
 
E-mail: nokada{at}bio.titech.ac.jp. Back


    Literature Cited
 TOP
 Abstract
 Introduction
 Materials and Methods
 Results and Discussions
 Acknowledgements
 Literature Cited
 

    Amrine, H. M., and M. S. Springer. 1999. Maximum-likelihood analysis of the Tethythere hypothesis based on a multigene data set and a comparison of different models of sequence evolution. J. Mammal. Evol. 6:161-176.[CrossRef]

    Batzer, M. A., and P. L. Deininger. 2002. Alu repeats and human genomic diversity. Nat. Rev. Genet. 3:370-379.[CrossRef][ISI][Medline]

    Blin, N., and D. W. Stafford. 1976. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res. 3:2303-2308.[Abstract]

    Cao, Y., M. Fujiwara, M. Nikaido, N. Okada, and M. Hasegawa. 2000. Interordinal relationships and timescale of eutherian evolution as inferred from mitochondrial genome data. Gene 259:149-158.[CrossRef][ISI][Medline]

    de Jong W. W., J. A. M. Leunissen, and G. J. Wistow. 1993. Eye lens crystallins and the phylogeny of placental orders: evidence for a macroscelid-paenungulate clade? Pp. 5–12 in F. S. Szalay, M. J. Novacek, and M. C. McKenna, eds. Mammal phylogeny: placentals. Springer Verlag, New York.

    de Jong, W. W., A. Zweers, and M. Goodman. 1981. Relationship of aardvark to elephants, hyraxes and sea cows from alpha-crystallin sequences. Nature 292:538-540.[CrossRef][ISI][Medline]

    Endoh, H., and N. Okada. 1986. Total DNA transcription in vitro: a procedure to detect highly repetitive and transcribable sequences with tRNA-like structures. Proc. Natl. Acad. Sci. USA 83:251-255.[Abstract]

    Fischer, M. S. 1989. Hyracoids, the sister-group of perissodactyls. Pp. 37–56 in D. R. Prothero, and R. M. Schoch, eds. The evolution of perissodactyls. Oxford University Press, New York.

    Fischer, M. S., and P. Tassy. 1993. The interrelation between Proboscidea, Sirenia, Hyracoidea, and Mesaxonia. The morphological evidence. Pp. 217–234 in F. S. Szalay., M. J. Novacek, and M. C. McKenna, eds. Mammal phylogeny: placentals. Springer Verlag, New York.

    Hamada, M., Y. Kido, M. Himberg, J. D. Reist, C. Ying, M. Hasegawa, and N. Okada. 1997. A newly isolated family of short interspersed repetitive elements (SINEs) in coregonid fishes (whitefish) with sequences that are almost identical to those of the SmaI family of repeats: possible evidence for the horizontal transfer of SINEs. Genetics 146:355-67.[Abstract/Free Full Text]

    Hattori, M., A. Fujiyama, and T. D. Taylor, et al. (60 co-authors). 2000. The DNA sequence of human chromosome 21. Nature 405:311-320.[CrossRef][ISI][Medline]

    Hedges, S. B. 2001. Afrotheria: plate tectonics meets genomics. Proc. Natl. Acad. Sci. USA 98:1-2.[Free Full Text]

    International Human Genome Sequencing Consortium. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921.[CrossRef][ISI][Medline]

    Kajikawa, M., and N. Okada. 2002. LINEs mobilizes SINEs in the eel through a shared 3' sequence. Cell 111:433-444.[ISI][Medline]

    Kazazian, H. H., Jr. 2000. L1 retrotransposons shape the mammalian genome. Science 289:1152-1153.[Free Full Text]

    Kido, Y., M. Aono, T. Yamaki, K. Matsumoto, S. Murata, M. Saneyoshi, and N. Okada. 1991. Shaping and reshaping of salmonid genomes by amplification of tRNA-derived retroposons during evolution. Proc. Natl. Acad. Sci. USA 88:2326-2330.[Abstract]

    Kordis, D., and F. Gubensek. 1998. Unusual horizontal transfer of a long interspersed nuclear element between distant vertebrate classes. Proc. Natl. Acad. Sci. USA 95:10704-10709.[Abstract/Free Full Text]

    Lavergne, A., E. Douzery, T. Stichler, F. M. Catzeflis, and M. S. Springer. 1996. Interordinal mammalian relationships: evidence for paenungulate monophyly is provided by complete mitochondrial 12S rRNA sequences. Mol. Phylogenet. Evol. 6:245-258.[CrossRef][ISI][Medline]

    Madsen, O., P. M. Deen, G. Pesole, C. Saccone, and W. W. de Jong. 1997. Molecular evolution of mammalian aquaporin-2: further evidence that elephant shrew and aardvark join the paenungulate clade. Mol. Biol. Evol. 14:363-371.[Abstract]

    Madsen, O., M. Scally, C. J. Douady, D. J. Kao, R. W. DeBry, R. Adkins, H. M. Amrine, M. J. Stanhope, W. W. de Jong, and M. S. Springer. 2001. Parallel adaptive radiations in two major clades of placental mammals. Nature. 409:610-614.[CrossRef][ISI][Medline]

    Murphy, W. J., E. Eizirik, W. E. Johnson, Y. P. Zhang, O. A. Ryder, and S. J. O'Brien. 2001a. Molecular phylogenetics and the origins of placental mammals. Nature 409:614-618.[CrossRef][ISI][Medline]

    Murphy, W. J., E. Eizirik, and S. J. O'Brien, et al. (11 co-authors). 2001b. Resolution of the early placental mammal radiation using Bayesian phylogenetics. Science 294:2348-2351.[Abstract/Free Full Text]

    Nikaido, M., F. Matsuno, H. Abe, M. Shimamura, H. Hamilton, H. Matsubayasi, and N. Okada. 2001. Evolution of CHR-2 SINEs in cetartiodactyl genomes: possible evidence for the monophyletic origin of toothed whales. Mammal. Genome 12:909-915.[CrossRef][ISI][Medline]

    Novacek, M. J. 1992. Mammalian phylogeny: shaking the tree. Nature 356:121-125.[CrossRef][ISI][Medline]

    Okada, N. 1991a. SINEs. Curr. Opin. Genet. Dev. 1:498-504.[Medline]

    1991b. SINEs: short interspersed repeated elements of the eukaryotic genome. Trends Ecol. Evol. 6:358-361.[ISI]

    Okada, N., and K. Ohshima. 1995. Evolution of tRNA-derived SINEs. Pp. 61–79 in R. J. Maraia, ed. The impact of short interspersed repetitive elements (SINEs) on the host genome. R. G. Landes Company, Austin, Tex.

    Okada, N., A. M. Shedlock, and M. Nikaido. 2002. TE mapping in molecular systematics. in P. Capy, ed. Mobile genetic elements and their application in genomics. Humana Press, USA (in press).

    Ozawa, T., S. Hayashi, and V. M. Mikhelson. 1997. Phylogenetic position of mammoth and Steller's sea cow within Tethytheria demonstrated by mitochondrial DNA sequences. J. Mol. Evol. 44:406-413.[ISI][Medline]

    Porter, C. A., M. Goodman, and M. J. Stanhope. 1996. Evidence on mammalian phylogeny from sequences of exon 28 of the von Willebrand factor gene. Mol. Phylogenet. Evol. 5:89-101.[CrossRef][ISI][Medline]

    Rogers, J. 1985. Origins of repeated DNA. Nature 317:765-766.[CrossRef][ISI][Medline]

    Scally, M., O. Madsen, C. J. Douady, W. W. de Jong, M. J. Stanhope, and M. S. Springer. 2001. Molecular evidence for the major clade of placental mammals. J. Mammal. Evol. 8:239-277.[CrossRef]

    Schmid, C. W. 1996. Alu: structure, origin, evolution, significance and function of one-tenth of human DNA. Prog. Nucleic. Acid. Res. Mol. Biol. 53:283-319.[ISI][Medline]

    Schmid, C., and R. Maraia. 1992. Transcriptional regulation and transpositional selection of active SINE sequences. Curr. Opin. Genet. Develop. 2:874-882.[Medline]

    Serdobova, I. M., and D. A. Kramerov. 1998. Short retroposons of the B2 superfamily: evolution and application for the study of rodent phylogeny. J. Mol. Evol. 46:202-214.[ISI][Medline]

    Shedlock, A. M., and N. Okada. 2000. SINE insertions: powerful tools for molecular systematics. BioEssays 22:148-160.[CrossRef][ISI][Medline]

    Shimamura, M., H. Abe, M. Nikaido, K. Ohshima, and N. Okada. 1999. Genealogy of families of SINEs in cetaceans and artiodactyls: the presence of a huge superfamily of tRNAGlu-derived families of SINEs. Mol. Biol. Evol. 16:1046-1060.[Abstract]

    Shimamura, M., H. Yasue, K. Ohshima, H. Abe, H. Kato, T. Kishiro, M. Goto, I. Munechika, and N. Okada. 1997. Molecular evidence from retroposons that whales form a clade within even-toed ungulates. Nature 388:666-670.[CrossRef][ISI][Medline]

    Shoshani, J. 1993. Hyracoidea-Tethytheria affinity based on myological data. Pp. 235–256 in F. S. Szalay, M. J. Novacek, and M. C. MacKenna, eds. Mammal phylogeny: placentals. Springer Verlag, New York.

    1998. Understanding proboscidean evolution: a formidable task. TREE 13:480-487.

    Shoshani, J., and M. C. McKenna. 1998. Higher taxonomic relationships among extant mammals based on morphology, with selected comparisons of results from molecular data. Mol. Phylogenet. Evol. 9:572-584.[CrossRef][ISI][Medline]

    Springer, M. S., G. C. Cleven, O. Madsen, W. W. de Jong, V. G. Waddell, H. M. Amrine, and M. J. Stanhope. 1997. Endemic African mammals shake the phylogenetic tree. Nature. 388:61-64.[CrossRef][ISI][Medline]

    Stanhope, M. J., O. Madsen, V. G. Waddell, G. C. Cleven, W. W. de Jong, and M. S. Springer. 1998a. Highly congruent molecular support for a diverse superordinal clade of endemic African mammals. Mol. Phylogenet. Evol. 9:501-508.[CrossRef][ISI][Medline]

    Stanhope, M. J., V. G. Waddell, O. Madsen, W. W. de Jong, S. B. Hedges, G. C. Cleven, D. Kao, and M. S. Springer. 1998b. Molecular evidence for multiple origins of Insectivora and for a new order of endemic African insectivore mammals. Proc. Natl. Acad. Sci. USA 95:9967-9972.[Abstract/Free Full Text]

    Takasaki, N., S. Murata, M. Saitoh, T. Kobayashi, L. Park, and N. Okada. 1994. Species-specific amplification of tRNA-derived short interspersed repetitive elements (SINEs) by retroposition: a process of parasitization of entire genomes during the evolution of salmonids. Proc. Natl. Acad. Sci. USA 91:10153-10157.[Abstract/Free Full Text]

    Ullu, E., and C. Tschudi. 1984. Alu sequences are processed 7SL RNA genes. Nature 312:171-172.[ISI][Medline]

    van Dijk, M. A. M., O. Madsen, F. Catzeflis, M. J. Stanhope, W. W. de Jong, and M. Pagel. 2001. Protein sequence signatures support the African clade of mammals. Proc. Natl. Acad. Sci. USA 98:188-193.[Abstract/Free Full Text]

    Waddell, P., N. Okada, and M. Hasegawa. 1999. Towards resolving the interordinal relationships of placental mammals. Syst. Biol. 48:1-5.[CrossRef][ISI][Medline]

    Weiner, A. M. 1980. An abundant cytoplasmic 7SRNA is complementary to the dominant interspersed middle repetitive DNA sequence family in the human genome. Cell 22:209-218.[ISI][Medline]

    Weiner, A. M., P. L. Deininger, and A. Efstratiadis. 1986. Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information. Annu. Rev. Biochem. 55:631-661.[CrossRef][ISI][Medline]

    Whidden, H. P. 2002. Extrinsic snout musculature in Afrotheria and Lipotyphla. J. Mammal. Evol. 9:165-187.

Accepted for publication November 8, 2002.