* Committee on Evolutionary Biology
Department of Organismal Biology & Anatomy, The University of Chicago, Chicago, Illinois
Institute of Evolution, University of Haifa, Haifa, Israel
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: Drosophila melanogaster hsp70; heat shock proteins transposable elements regulatory evolution
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Hsp70 is the principal heat-inducible molecular chaperone in D. melanogaster, in which it confers inducible stress tolerance (Feder and Krebs 1998) but also participates in the regulation of cell growth and death, intracellular signaling, and diverse other processes (Zatsepina et al. 2001; Gabai and Sherman 2002). Elevated levels of Hsp70 are usually beneficial for inducible thermotolerance but deleterious for growth and development (Krebs and Feder 1997, 1998; Zatsepina et al. 2001). Thus, evolution at Hsp70-inducing temperatures in the absence of heat stress repeatedly results in decreased Hsp70 levels (Bettencourt, Feder, and Cavicchi 1999; Sorensen et al. 1999; Lansing, Justesen, and Loeschcke 2000; Zatsepina et al. 2001). At least five nearly identical genes at two chromosomal loci encode Hsp70 in D. melanogaster (Bettencourt and Feder 2002). Locus 87A7 contains an inverted pair, hsp70Aa and hsp70Ab, and locus 87C1 has three copies: hsp70Ba, and, approximately 40 kb away, hsp70Bb and hsp70Bc are tandemly arrayed (Moran et al. 1979; Bettencourt and Feder 2002). In view of the stringent transcriptional regulation of the hsp70 genes, their proximal promoters are obvious candidates for encoding evolutionary variation in Hsp70 protein levels. Vigorous hsp70 transcription ensues when a common transcription factor, heat-shock factor (HSF), binds to heat-shock response elements (HSEs) in the promoter of each hsp70 gene. While HSEs 1 and 2 are sufficient for some hsp70 transcription, full-strength transcription requires all four (Xiao and Lis 1988; Lee et al. 1992; Shopland et al. 1995). The spacing of the HSEs is also critical: the insertion of spacers 15 bps long between HSEs 1 and 2 reduces promoter activity by 90% (Amin et al. 1994).
These experimental insertions of sequence have a recurrent counterpart in the hsp70Ba genes of Drosophila populations. We surveyed ten populations founded from collections of Drosophila in the wild and found that three, two previously reported (Michalak et al. 2001; Zatsepina et al. 2001) and one reported here, are polymorphic for naturally occurring TE insertions in the hsp70Ba proximal promoter (fig. 1). The T32 population, originally collected in subequatorial Africa, is polymorphic for a truncated jockey element in the promoter (Zatsepina et al. 2001). This population expresses little Hsp70 and shows poor inducible thermotolerance (Zatsepina et al. 2001). Populations in Evolution Canyon, Israel, are polymorphic for a 1.2 kb P element in the hsp70Ba promoter (Michalak et al. 2001). Drosophila from the cooler, north-facing slope of the canyon accumulate less Hsp70 (Feder and Korol, unpublished data) and have a greater allelic frequency of the P elementbearing allele (Michalak et al. 2001) than those from its warmer, south-facing slope. As we describe below, a P element has independently inserted in the hsp70Ba promoter of a third population ("Arv/Zim"). Because of (1) the correlation between TEs in the hsp70Ba promoter and Hsp70 protein level in Drosophila populations (Zatsepina et al. 2001) and (2) the impact of experimental promoter disruption on hsp70 transcription (Xiao and Lis 1988; Lee et al. 1992; Amin et al. 1994; Shopland et al. 1995), we hypothesized that these TEs could reduce hsp70Ba transcription in whole Drosophila. Here we test this hypothesis with the jockey element in the T32 population, and we show that this element reduces transcription. We also created replicate lines fixed for the presence or absence of each of the three TEs and report that each of these insertions can reduce Hsp70 levels and alter inducible thermotolerance. The two P elements, moreover, affect female reproductive success. Thus, by disrupting hsp70 promoters, TEs can affect whole-organism fitness in natural populations.
|
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Transposable Element PCR Screens
Genomic DNA was isolated from mass preparations of approximately 100 flies from each population (above) by phenol/chloroform/isoamyl alcohol extraction and suspended in 50 µl water. The hsp70Ba promoter was amplified by adding 0.5 µl genomic DNA to buffer (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.1% Triton X-100) with 1.53.0 mM MgCl2, 0.2 mM each dNTP, 5 pmol each primer, and 1.25 units Taq DNA polymerase (Promega) per 25 µl reaction. Primers were: upper, 5'GCAAGCAATCATCATCCAAT3', and lower, 5'ACTGTGTTTCTGGGGTTCAT3'. This amplification yields a 900 bp (for wild-type) product that starts
467 bp upstream from the transcription start site and ends
190 bp downstream from the start of translation, depending on population. Populations with TE insertions were initially detected by gel electrophoresis as larger polymerase chain reaction (PCR) products, ranging from 2099 to 2354 bps, and identified by sequence analysis (see below).
Single-fly DNA for TE-specific screens (for allele frequency data) was prepared by homogenizing individual flies in 50 µl buffer (10 mM Tris-HCl, pH 8.2, 1 mM EDTA, 25 mM NaCl) with 0.2 µg/µl proteinase K (Gloor et al. 1993). To screen T32 individuals for the jockey element, the foregoing primers and a jockey-specific internal primer (lower, 5'-AAGAAGACTCAAGCGACACC-3') were used in a single PCR (using 2.5 µl template DNA). To screen Arv/Zim and Evolution Canyon individuals for the P element, the hsp70Ba promoter amplification was performed along with an additional PCR that contained the same lower primer as above and a P elementspecific upper primer (5'GCCTTCTTTTATCTTTTCTGG3'). Individuals with and without TEs were distinguishable via agarose gel electrophoresis. Reaction conditions for all PCRs consisted of an initial 1.5 min at 94°C, 35 cycles of 92°C for 1 min, 54°C for 1 min, and 72°C for 2.5 min, and a final step at 72°C for 5 min.
DNA Sequencing
Promoter and TE sequences from the Evolution Canyon and T32 populations were reported previously (GenBank accession numbers: T32, AY032740; Evolution Canyon, AF377341). The GenBank accession number for the Arv/Zim Hsp70Ba promoter and P element sequence is AF377953. To amplify Arv/Zim hsp70Ba promoters for sequencing analysis, 1 µl template DNA from single-fly preparations (as above) was added to buffer [50 mM KCl, 50 mM Tris-HCl (pH 8.3)] with 1.5 mM MgCl2, 0.2 mM each dNTP, 5 pmol each primer (flanking primers as above), and 2.5 units MasterAmp Extra-Long DNA Polymerase Mix (Epicentre Technologies) per 100 µl reaction. Polymerase chain reaction products were cleaned with Qiagen spin columns, cloned into the pGEM-T Easy vector (Promega), prepared with Qiagen Miniprep spin columns, and sequenced. Sequencing reactions were performed with ABI Prism cycle sequencing kits and ABI 377 sequencers (PerkinElmer). All samples were sequenced with pUC/M13 forward and reverse vector primers. Internal sequencing primers were used to provide complete coverage.
Construction of Replicate Lines
Because each of the three populations is polymorphic for TE-disrupted hsp70Ba promoters, we were able to create replicate lines from each of these populations that were fixed for either the presence or absence of the TE-disrupted promoter. Males and virgin females from each source population were paired and allowed to mate in glass vials with 7 ml of standard medium at 25°C; 30 to 50 mated pairs were established for each of the three populations. Adults were cleared after 5 days and genotyped as described above. Progeny homozygous for TEs or their absence were used to found expanded replicate lines. Numbers of replicates were: T32 strains, 6 jockey-present and 6 jockey-absent; Evolution Canyon strains, 5 P-present and 5 P-absent; Arv/Zim, 4 P-present and 4 P-absent replicates.
Determination of Hsp70 Protein Levels
Adults from each replicate line were collected 1 day ± 4 h after eclosion and placed individually in cryotubes (humidified with 10 µl PBS) that were submerged in a thermostatted water bath at 36°C for 30 min and then at 25°C for 30 min, immediately frozen in liquid nitrogen, and stored at -80°C. Flies from the T32 lines underwent an additional 5 min heat shock at 40.7°C before freezing. Hsp70 levels in each fly were determined by ELISA (Feder et al. 1996). Samples were lysed by homogenization with a motorized pestle in ice-cold phosphate-buffered saline with Complete Protease Inhibitor (Roche) and centrifuged at 20,000xg and 4°C for 30 min. Total protein concentration was determined by BCA (Pierce) analysis, and Pro-Bind 96-well assay plates (Falcon) were coated with 20 µg protein overnight at 4°C. After blocking and washing, bound Hsp70 was detected with the Drosophila-inducible Hsp70-specific antibody 7FB (Velazquez, DiDomenico, and Lindquist 1980) coupled to alkaline phosphatase (AP) via secondary (rabbit anti-rat IgG [Cappel]) and tertiary (AP-conjugated goat anti-rabbit IgG [Sigma]) antibodies. Incubation with the phosphatase substrate yielded a colored product that was quantified with a microplate reader. Hsp70 concentration is expressed as a percentage of an Hsp70 standard included on each plate. Males and females were analyzed separately. Sample sizes were 24 to 44 flies per sex.
Inducible Thermotolerance Measurements
Inducible thermotolerance was assayed separately for day-old male and female adults. For each assay, 20 flies from each replicate line were placed in glass vials containing 7 ml of standard Drosophila medium. Vials were submerged in thermostatted water baths to deliver the following temperature regime: 30 min at 36°C and 30 min at 25°C (termed "pretreatment"), followed by a 30 min heat shock. Heat-shock temperature varied according to population (T32, 40.7°C; Arv/Zim, 40.6°C; Evolution Canyon, 40.4°C) to produce mortality of 20% to 80%; in the absence of pretreatment, mortality was 100%. Sample sizes were 64 to 160 vials per sex, 20 flies per vial.
Ribonuclease Protection Assay
Wandering third instar larvae were collected from jockey-present and jockey-absent lines (seven larvae from each replicate line), placed in cryotubes with 10 µl water, pretreated for 30 min at 36°C, allowed to recover for 30 min at 25°C, and stored at -80°C. Control larvae were kept at 25°C for 1 h. Total RNA was isolated with RNAqueous (Ambion) by homogenizing tissue on ice with a motorized plastic pestle. RNA yield was determined by UV spectrophotometry and samples were stored at -80°C.
The extensive homogenization of the hsp70 genes (Bettencourt and Feder 2002) precluded the design of a single riboprobe that could simultaneously distinguish between hsp70Ba alleles and the other hsp70 genes. For example, in the 2.2 kb of transcribed hsp70 sequence, a single SNP and a 7 bp indel polymorphism (both in the 5' UTR) distinguish the hsp70Ba gene in jockey+ strains from the other hsp70 gene copies. These sites, however, could not be used to distinguish the hsp70Ba gene from the other hsp70 genes in jockey- flies, as the hsp70 gene copies do not vary at these sites in jockey- strains. Similarly, the pair of SNPs (located in the 3' end of the gene) that distinguishes the hsp70Ba gene from the others in the jockey- strains were not present in the hsp70Ba gene in jockey+ strains. Accordingly, we designed two probes: one that distinguishes between the hsp70Ba gene and the other hsp70 genes in hsp70Bajockey/jockey homozygotes, and another that distinguishes between the hsp70Ba and other hsp70 genes in the hsp70Ba+/+ flies. A 103-bp fragment of the transcribed region of each hsp70Ba allele and a 141-bp region of the actin5c gene (control probe) were cloned in a pGEM-T Easy vector (Promega) and prepared with a Qiagen Plasmid Maxi Kit. Plasmids were linearized with Sac2, and 3' overhangs were recessed with 2.5 U DNA Polymerase I, large (Klenow) fragment (Promega). Riboprobes were synthesized by transcription from 0.5 µg of plasmid with Sp6 RNA polymerase in the presence of [32P]CTP. Next, 2 x 105 CPM of gel-purified radiolabeled probe was hybridized at 50°C overnight to 15 µg sample RNA; hybridization reactions were treated with 500 µg Ribonuclease A (Roche) and 5000 Units of RNase T1 (Ambion), and the recovered RNA was assayed by electrophoresis on a denaturing polyacrylamide/urea gel and PhosphorImager analysis (Molecular Dynamics). Gels were analyzed with ImageQuant software (Molecular Dynamics), and mRNA levels were approximated by quantifying the average intensity of pixels within equivalent rectangles surrounding the bands. Background density was subtracted separately for each of the two probes used. To compare message levels determined in multiple assays, hsp70Ba levels were expressed as a proportion of combined hsp70Bb and hsp70Bc levels for each genotype. For both genotypes, the hsp70Bb and hsp70Bc transcripts yielded a single detectable band. Because some of the bands differed in sizeand therefore in number of 32P-labeled nucleotidesmessage levels were standardized by multiplying by a size factor (the ratio of labeled cytosine nucleotides) before comparison.
Reproductive Success Measurements
At 24 h after eclosion, individual females were placed with two males in vials containing 7 ml standard medium and transferred together to fresh vials every 24 h for 3 days. As new adults eclosed, total numbers of offspring per female were determined. Females that produced no adult offspring were equally common in each experimental group. These were excluded from the analysis on the assumption that these failures were due to erroneous sexing, poor-quality medium, and other factors unrelated to genotype. Sample sizes: 10 to 20 females per replicate for each genotype.
Statistical Analysis
Strains and sexes were analyzed separately. After checking for among-group variance homogeneity (Levene's test) and normality (Kolmogorov-Smirnov-Lilliefors test), a simple hierarchical ANOVA with fixed factors was used to analyze differences in Hsp70 expression levels and thermotolerance, in which "line replicates" were nested within "genotypes" (TE-presence vs. TE-absence).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Effect of jockey Insertion on hsp70Ba Transcription in the T32 Population
In control (non-stressed) larvae, hsp70 mRNA was not detectable. The actin5c control probe hybridized equally to samples from both control and heat-shocked larvae (fig. 2A). By contrast, hsp70Ba mRNA levels were lower in hsp70Bajockey/jockey larvae than in hsp70Ba+/+ larvae (fig. 2A). Indeed, this effect is repeatable in multiple replicate lines (fig. 2B). Standardized hsp70Ba message levels (i.e., the ratio of hsp70Ba-specific signal to that for the adjacent hsp70 genes, hsp70Bb and hsp70Bc) ± SE are 1.372 ± 0.100 in the hsp70Ba+/+ replicates and 0.135 ± 0.003 in the hsp70Bajockey/jockey replicates. Thus, hsp70Ba message abundance is approximately 90% lower in the hsp70Bajockey/jockey lines than in the wild-type, a significant difference (t = 12.41; P < 0.0001).
|
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Because hsp70Ba is but one of at least five Hsp70-encoding genes in D. melanogaster, its mutation by transposition might not have an impact on overall Hsp70 protein levels. As measurements of Hsp70 protein levels demonstrate, however, the effect of TE insertions in hsp70Ba is repeatedly evident even against the background of the other hsp70 genes. In this and other sets of duplicate genes, TE insertions in one copy may afford an opportunity to fine tune protein levels without abolishing overall transcription. Indeed, the hsp70 genes at 87A7 and 87C1 have different morphological and developmental expression domains (Lakhotia and Prasanth 2002), so the phenotypic impact of TEs in hsp70Ba may be even greater than is evident from bulk Hsp70 levels.
These TE insertions can affect inducible thermotolerance, and thus one component of whole-organism fitness. Hsp70 is sufficient for increased inducible thermotolerance, which is critical for survival of natural heat stress (Feder et al. 1996; Roberts and Feder 2000). Interestingly, the TE-associated decreases in Hsp70 levels corresponded to less inducible thermotolerance in the T32 and Evolution Canyon lines but more inducible thermotolerance in the Arv/Zim lines (fig. 2). Clearly genetic background can affect the relationship between Hsp70 expression and thermotolerance, which may not always be straightforward. Indeed, while the overall TE effect on inducible thermotolerance was significant, so too was the replicate line effecti.e., that of genetic background within population. Hsp70 is not the only mechanism of inducible thermotolerance (Feder et al. 2002), and extremely high Hsp70 levels actually decrease inducible thermotolerance (Krebs and Feder 1998). The present results also indicate that TEs in the hsp70 promoter are not always omnipotent in their impact, and the genetic or epigenetic factors that modify their impact (e.g., Hsp70 co-chaperones and others [Feder et al. 2002]) are worthy of study.
Furthermore, the TEs are not the only ways in which the regions flanking the hsp70Ba coding sequences vary. For example, in hsp70Bajockey/jockey flies, the hsp70Ba 5'-untranslated region (UTR) has a 7 bp deletion that is not present in hsp70Ba+/+ flies. Because the hsp70 UTRs regulate hsp70 translational efficiency and message stability (Lindquist 1993) this deletion could in principle affect message and protein levels. We suggest that this UTR polymorphism does not contribute to such phenotypic differences for two reasons. First, this polymorphism, which is common in Drosophila, does not covary with Hsp70 expression in other populations (Bettencourt and Feder 2002), and Hsp70 levels differ in the Evolution Canyon and Arv/Zim populations, neither of which has this deletion in the hsp70Ba 5'UTR. Second, in Drosophila S2 cells hsp70Ba promoter-luciferase constructs differing in only the presence or absence of the jockey TE in the promoter exhibit the same differences in expression as the native alleles do (D. N. Lerman, unpublished data). Nonetheless, we cannot exclude that other, unknown variation linked to the TE insertions contributes to variation in hsp70 expression and/or protein levels.
We and others have hypothesized that the magnitude of Hsp70 expression results from a trade-off of the context-specific phenotypes of hsp70 (Krebs and Feder 1998; Lansing, Justesen, and Loeschcke 2000; Zatsepina et al. 2001), which include inducible tolerance of heat and other stresses, deterrence of protein aggregation, protein quality control, intracellular and extracellular signaling, and regulation of growth (Gabai et al. 1997; Mosser et al. 2000; Tang et al. 2001). In environments in which thermal stress is frequent and unpredictable, increases in stress-induced Hsp70 expression should be beneficial (Krebs and Feder 1998) and selection results in increased Hsp70 levels (Feder et al. 2002). In such environments, TE-bearing alleles that reduce inducible thermotolerance should not be favored. Indeed, the dramatic reduction in hsp70BaP allele frequency on the hotter and more variable south-facing slope (SFS) of Evolution Canyon (1.2%) compared with the NFS (33.9%; Michalak et al. 2001) suggests that the non-TE bearing hsp70Ba allele is favored in SFS populations. These differences in allele frequency are consistent with increased Hsp70 levels in SFS populations (Feder and Korol, unpublished data). By contrast, in environments with infrequent extreme stress and/or chronic mild hyperthermia, elevated Hsp70 levels can be deleterious because enhanced stress tolerance is irrelevant and excessive amounts of Hsp70 can harm cells (see Introduction). Indeed, laboratory and wild Drosophila populations at moderately high but nonlethal temperatures repeatedly evolve reduced inducible thermotolerance and Hsp70 expression (Bettencourt, Feder, and Cavicchi 1999; Sorensen et al. 1999; Lansing, Justesen, and Loeschcke 2000; Zatsepina et al. 2001).
Our determinations of female reproductive success in replicate lines with TEs present or absent in the hsp70 promoter suggest that such a trade-off can contribute to the maintenance of these TEs in natural populations. In lines founded from both the Evolution Canyon and Arv/Zim populations, the P element was correlated with a large increase in reproductive success in nonstressful environments. Thus, natural selection may favor these P elements in some environments and explain the high allelic frequency of the P element in the NFS strain (33.9%). Given that the P element in the Arv/Zim strains is also correlated with an increase in thermotolerance, its high frequency in this line (60%) is not surprising. The high frequency (60%) of the jockey element in the T32 population may be due to its suppression of Hsp70 expression at its distinctively warm culture temperature (31° to 32°) or to other causes, including drift or neutrality. These suggestions should be falsifiable in laboratory evolution or artificial selection experiments. We expect that TEs in hsp70 promoters should be favored in selection for high reproductive rate (Silbermann and Tatar 2000) and/or in warm environments that are not acutely lethal (< 37°C), but that they will be disfavored in environments with periodic exposure to acutely lethal temperatures.
Multiple Insertions in the hsp70Ba Promoter
All three TEs discussed above have inserted within the same 87-bp region of the promoter, suggesting that this region may be a "lightning rod" for TE insertion. Many TEs demonstrate bias in genome distribution, whether due to target site selectivity (Craig 1997), purifying selection against deleterious transposition, or other causes. P elements in particular are more prevalent in the 5' ends of genes than in coding regions (Spradling et al. 1995). The clustering of the TE insertions in the hsp70Ba promoter, however, is also consistent with the promoter's distinctive chromatin conformation: uninduced hsp70 genes have an open chromatin configuration (Costlow and Lis 1984), which facilitates the constitutive recruitment of components of the transcriptional apparatus and poises the gene for immediate transcription upon heat shock. P elements can insert preferentially in or near DNase I hypersensitive (DH) sites, suggesting that an open chromatin configuration favors TE insertion (Voelker et al. 1990). Indeed, high-resolution mapping of DH sites in the hsp70 promoter (Costlow and Lis 1984; Weber et al. 1997) shows that two DH regions coincide almost precisely with the insertion sites of the TEs reported here, and the promoters of other Drosophila hsp genes are a preferred target of local P element insertions (Timakov et al. 2002). Taken together, these data suggest that the unique chromatin configuration of hsp70 promoters contributes to the repeated presence of TEs in this region.
Although the insertions described here are all in the hsp70Ba gene, transposition events have been frequent at both hsp70 gene clusters, located at 87A7 and 87C1. D. melanogaster is polymorphic for several TE-derived insertions or deletions in the region between hsp70Aa and hsp70Ab at 87A7 (Zatsepina et al. 2001; Bettencourt et al. 2002), and the 40 kb between the hsp70Ba and hsp70Bb genes contains 16 to 21 tandemly arrayed heat-inducible repetitive elements of heterochromatic origin that transposed independently into 87C1 and subsequently spread through the locus (Mason et al. 1982). Analysis of the sequences flanking both hsp70 gene clusters suggests that the 87A7-to-87C1 cluster duplication was likely a retrotransposition (Bettencourt and Feder 2001). Further, S element fragments have inserted upstream of hsp70Aa, hsp70Ab and Hsp70Bb in D. melanogaster. These insertions appear to be fixed in the species, and analysis of sequence variation at the hsp70Bb insertion site suggests that selection favors this insertion (Maside, Bartolome, and Charlesworth 2002).
Conclusion
TEs constitute approximately half of the human genome (Lander et al. 2001) and 10% of the Drosophila genome (Charlesworth and Langley 1989), and are key agents of genome-wide reorganization and large-scale evolution (Shapiro 1992; Brosius 1999a, 1999b). We show here that TEs can also play an adaptive role in microevolution within natural populations by manipulating the expression of genes critical for fitness, and suggest that this may be an additional factor (Rizzon et al. 2002) shaping TE abundance and distribution. The distinctive organization and regulation of the hsp70 promoter may make it an accessible target for transposition and thus the origin of novel alleles, which selection may then maintain or purge as circumstances dictate.
![]() |
Acknowledgements |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Footnotes |
---|
2 Present address: Department of Biological Sciences, Louisiana State University, Baton Rouge, Louisiana.
3 Present address: Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts.
E-mail: m-feder{at}uchicago.edu.
![]() |
Literature Cited |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Amin, J., M. Fernandez, J. Ananthan, J. T. Lis, and R. Voellmy. 1994. Cooperative binding of heat shock transcription factor to the hsp70 promoter in vivo and in vitro. J. Biol. Chem 269:4804-4811.
Bettencourt, B. R., and M. E. Feder. 2001. hsp70 duplication in the Drosophila melanogaster species group: how and when did two become five?. Mol. Biol. Evol 18:1272-1282.
Bettencourt, B. R., and 2002. Rapid concerted evolution via gene conversion at the Drosophila hsp70 genes. J. Mol. Evol 54:569-586.[CrossRef][ISI][Medline]
Bettencourt, B. R., M. E. Feder, and S. Cavicchi. 1999. Experimental evolution of Hsp70 expression and thermotolerance in Drosophila melanogaster. Evolution 53:484-492.[ISI]
Bettencourt, B. R., I. Kim, A. A. Hoffmann, and M. E. Feder. 2002. Response to natural and laboratory selection at the Drosophila hsp70 genes. Evolution 56:1796-1801.[ISI][Medline]
Brosius, J. 1999a. RNAs from all categories generate retrosequences that may be exapted as novel genes or regulatory elements. Gene 238:115-134.[CrossRef][ISI][Medline]
Brosius, J. 1999b. Genomes were forged by massive bombardments with retroelements and retrosequences. Genetica 107:209-238.[CrossRef][ISI][Medline]
Capy, P., G. Gasperi, C. Biemont, and C. Bazin. 2000. Stress and transposable elements: co-evolution or useful parasites?. Heredity 85:101-106.[CrossRef][ISI][Medline]
Charlesworth, B., and C. H. Langley. 1989. The population genetics of Drosophila transposable elements. Annu. Rev. Genet 23:251-287.[CrossRef][ISI][Medline]
Charlesworth, B., P. Sniegowski, and W. Stephan. 1994. The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 371:215-220.[CrossRef][ISI][Medline]
Costlow, N., and J. T. Lis. 1984. High-resolution mapping of DNase I-hypersensitive sites of Drosophila heat shock genes in Drosophila melanogaster and Saccharomyces cerevisiae. Mol. Cell. Biol 4:1853-1863.[ISI][Medline]
Craig, N. L. 1997. Target site selection in transposition. Annu. Rev. Biochem 66:437-474.[CrossRef][ISI][Medline]
Dahlgaard, J., V. Loeschcke, P. Michalak, and J. Justesen. 1998. Induced thermotolerance and associated expression of the heat-shock protein HSP70 in adult Drosophila melanogaster. Funct. Ecol 12:786-793.[CrossRef][ISI]
Dickinson, W. J. 1991. The evolution of regulatory genes and patterns in Drosophila. Evol. Biol 25:127-173.[ISI]
Dunn, R. C., and C. C. Laurie. 1995. Effects of a transposable element insertion on alcohol dehydrogenase expression in Drosophila melanogaster. Genetics 140:667-677.
Feder, M. E., T. B. C. Bedford, D. R. Albright, and P. Michalak. 2002. Evolvability of Hsp70 expression under artificial selection for inducible thermotolerance in independent populations of Drosophila melanogaster. Physiol. Biochem. Zool 75:325-334.[CrossRef][ISI][Medline]
Feder, M. E., N. V. Cartaño, L. Milos, R. A. Krebs, and S. L. Lindquist. 1996. Effect of engineering hsp70 copy number on Hsp70 expression and tolerance of ecologically relevant heat shock in larvae and pupae of Drosophila melanogaster. J. Exp. Biol 199:1837-1844.
Feder, M. E., and R. A. Krebs. 1998. Natural and genetic engineering of thermotolerance in Drosophila melanogaster. Am. Zool 38:503-517.[ISI]
Gabai, V. L., A. B. Meriin, D. D. Mosser, A. W. Caron, S. Rits, V. I. Shifrin, and M. Y. Sherman. 1997. Hsp70 prevents activation of stress kinases. A novel pathway of cellular thermotolerance. J. Biol. Chem 272:18033-18037.
Gabai, V. L., and M. Y. Sherman. 2002. Interplay between molecular chaperones and signaling pathways in survival of heat shock. J. Appl. Physiol 92:1743-1748.
Gloor, G. B., C. R. Preston, D. M. Johnson-Schlitz, N. A. Nassif, R. W. Phillis, W. K. Benz, H. M. Robertson, and W. R. Engels. 1993. Type I repressors of P element mobility. Genetics 135:81-95.
Gray, Y. H. M. 2000. It takes two transposons to tangotransposable-element-mediated chromosomal rearrangements. Trends Genet 16:461-468.[CrossRef][ISI][Medline]
Kidwell, M. G., and D. R. Lisch. 2001. Perspective: transposable elements, parasitic DNA, and genome evolution. Evolution 55:1-24.[ISI][Medline]
Krebs, R. A., and M. E. Feder. 1997. Deleterious consequences of Hsp70 overexpression in Drosophila melanogaster larvae. Cell Stress Chaperones 2:60-71.[ISI][Medline]
Krebs, R. A., and 1998. Hsp70 and larval thermotolerance in Drosophila melanogaster: how much is enough and when is more too much?. J. Insect Physiol 44:1091-1101.[CrossRef][ISI][Medline]
Krebs, R. A., M. E. Feder, and J. Lee. 1998. Heritability of expression of the 70-kD heat-shock protein in Drosophila melanogaster and its relevance to the evolution of thermotolerance. Evolution 52:841-847.[ISI]
Lakhotia, S. C., and K. V. Prasanth. 2002. Tissue- and development-specific induction and turnover of hsp70 transcripts from loci 87A and 87C after heat shock and during recovery in Drosophila melanogaster. J. Exp. Biol 205:345-358.
Lander, E. S., L. M. Linton, and B. Birren. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921.[CrossRef][ISI][Medline]
Lansing, I., J. Justesen, and V. Loeschcke. 2000. Variation in the expression of HSP70, the major heat-shock protein, and thermotolerance in larval and adult selection lines of Drosophila melanogaster. J. Therm. Biol 25:443-450.[CrossRef][ISI][Medline]
Lee, H., K. W. Kraus, M. F. Wolfner, and J. T. Lis. 1992. DNA sequence requirements for generating paused polymerase at the start of hsp70.. Genes. Dev 6:284-295.[Abstract]
Lindquist, S. 1993. Autoregulation of the heat-shock response. Pp. 279320 in J. Ilan, ed. Translational regulation of gene expression 2. Plenum Press, New York.
Maside, X., C. Bartolome, and B. Charlesworth. 2002. S-element insertions are associated with the evolution of the hsp70 genes in Drosophila melanogaster. Curr. Biol 12:1686-1691.[CrossRef][ISI][Medline]
Mason, P. I., I. Torok, I. Kiss, F. Karch, and A. Udvardy. 1982. Evolutionary implications of a complex pattern of DNA sequence homology extending far upstream of the hsp70 genes at loci 87A7 and 87C1 in Drosophila melanogaster. J. Mol. Biol 156:21-35.[CrossRef][ISI][Medline]
McCollum, A., E. Ganko, P. Barrass, J. Rodriguez, and J. McDonald. 2002. Evidence for the adaptive significance of an LTR retrotransposon sequence in a Drosophila heterochromatic gene. BMC Evol. Biol 2:5.[CrossRef][Medline]
McDonald, J. F. 1995. Transposable elementspossible catalysts of organismic evolution. Trends Ecol. Evol 10:123-126.[CrossRef][ISI]
Michalak, P., I. Minkov, A. Helin, D. N. Lerman, B. R. Bettencourt, M. E. Feder, A. B. Korol, and E. Nevo. 2001. Genetic evidence for adaptation-driven incipient speciation of Drosophila melanogaster along a microclimatic contrast in "Evolution Canyon," Israel. Proc. Natl. Acad. Sci. U.S.A 98:13195-13200.
Moran, L., M. E. Mirault, A. Tissieres, J. Lis, P. Schedl, S. Artavanis-Tsakonas, and W. J. Gehring. 1979. Physical map of two D. melanogaster DNA segments containing sequences coding for the 70,000 dalton heat shock protein. Cell 17:1-8.[ISI][Medline]
Mosser, D. D., A. W. Caron, L. Bourget, A. B. Meriin, M. Y. Sherman, R. I. Morimoto, and B. Massie. 2000. The chaperone function of Hsp70 is required for protection against stress-induced apoptosis. Mol. Cell Biol 20:7146-7159.
Rizzon, C., G. Marais, M. Gouy, and C. Biemont. 2002. Recombination rate and the distribution of transposable elements in the Drosophila melanogaster genome. Genome Res 12:400-407.
Roberts, S. P., and M. E. Feder. 2000. Changing fitness consequences of hsp70 copy number in transgenic Drosophila larvae undergoing natural thermal stress. Funct. Ecol 14:353-357.[CrossRef][ISI]
Shapiro, J. A. 1992. Natural genetic engineering in evolution. Genetica 86:99-111.[ISI][Medline]
Shopland, L. S., K. Hirayoshi, M. Fernandes, and J. T. Lis. 1995. HSF access to heat-shock elements in vivo depends critically on promoter architecture defined by GAGA factor, TFIID and RNA polymerase II binding sites. Genes Dev 9:2756-2769.[Abstract]
Silbermann, R., and M. Tatar. 2000. Reproductive costs of heat shock protein in transgenic Drosophila melanogaster. Evolution 54:2038-2045.[ISI][Medline]
Sorensen, J. G., P. Michalak, J. Justesen, and V. Loeschcke. 1999. Expression of the heat-shock protein HSP70 in Drosophila buzzatii lines selected for thermal resistance. Hereditas 131:155-164.[CrossRef][ISI][Medline]
Spradling, A. C., D. M. Stern, I. Kiss, J. Roote, T. Laverty, and G. M. Rubin. 1995. Gene disruptions using P transposable elementsan integral component of the Drosophila Genome Project. Proc. Natl. Acad. Sci. USA 92:10824-10830.[Abstract]
Tang, D., Y. Xie, M. J. Zhao, M. A. Stevenson, and S. K. Calderwood. 2001. Repression of the HSP70B promoter by NFIL6, Ku70, and MAPK involves three complementary mechanisms. Biochem. Biophys. Res. Commun 280:280-285.[CrossRef][ISI][Medline]
Timakov, B., X. Liu, I. Turgut, and P. Zhang. 2002. Timing and targeting of P element local transposition in the male germline cells of Drosophila melanogaster. Genetics 160:1011-1022.
Velazquez, J. M., B. J. DiDomenico, and S. Lindquist. 1980. Intracellular localization of heat shock proteins in Drosophila. Cell 20:679-689.[ISI][Medline]
Voelker, R. A., J. Graves, W. Gibson, and M. Eisenberg. 1990. Mobile element insertions causing mutations in the Drosophila suppressor of sable locus occur in DNase I hypersensitive subregions of 5'-transcribed nontranslated sequences. Genetics 126:1071-1082.
Weber, J. A., D. J. Taxman, Q. Lu, and D. S. Gilmour. 1997. Molecular architecture of the hsp70 promoter after deletion of the TATA box or the upstream regulation region. Mol. Cell Biol 17:3799-3808.[Abstract]
Wendel, J. F., and S. R. Wessler. 2000. Retrotransposon-mediated genome evolution on a local ecological scale. Proc. Natl. Acad. Sci. USA 97:6250-6252.
White, L. D., and J. W. Jacobson. 1996. Insertion of the retroposable element, jockey, near the Adh gene of Drosophila melanogaster is associated with altered gene expression. Genet. Res 68:203-209.[ISI][Medline]
Wilkins, R. C., and J. T. Lis. 1997. Dynamics of potentiation and activation: GAGA factor and its role in heat shock gene regulation. Nucleic Acids Res 25:3963-3968.
Wilson, A. C., S. S. Carlson, and T. J. White. 1977. Biochemical evolution. Ann. Rev. Biochem 46:573-639.[CrossRef][ISI][Medline]
Wu, Y. H., A. V. Wilks, and J. B. Gibson. 1998. A KP element inserted between the two promoters of the alcohol dehydrogenase gene of Drosophila melanogaster differentially affects expression in larvae and adults. Biochem. Genet 36:363-379.[CrossRef][ISI][Medline]
Xiao, H., and J. T. Lis. 1988. Germline transformation used to define key features of heat-shock response elements. Science 239:1139-1142.[ISI][Medline]
Zatsepina, O. G., V. V. Velikodvorskaia, V. B. Molodtsov, D. Garbuz, D. N. Lerman, B. R. Bettencourt, M. E. Feder, and M. B. Evgenev. 2001. A Drosophila melanogaster strain from sub-equatorial Africa has exceptional thermotolerance but decreased Hsp70 expression. J. Exp. Biol 204:1869-1881.