Institut für Mikrobiologie, ETH Zürich, Schmelzbergstr. 7, CH-8092 Zürich, Switzerland1
Author for correspondence: Stéphane Vuilleumier. Tel: +41 1 632 33 22. Fax: +41 1 632 11 48. e-mail: vuilleumier{at}micro.biol.ethz.ch
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Keywords: methylotrophy, dehalogenase, chlorinated methanes
Abbreviations: DCM, dichloromethane; H4folate, tetrahydrofolate; H4MPT, tetrahydromethanopterin; MeOH, methanol
The GenBank accession numbers for the sequences determined in this work are AJ421476 and AJ421477.
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Methylobacterium dichloromethanicum DM4 is able to use DCM as the sole source of carbon and energy (Gälli & Leisinger, 1988 ; Doronina et al., 2000
; Vuilleumier, 2002
). The first step in the degradation of DCM is catalysed by DCM dehalogenase, a bacterial representative of the glutathione S-transferase family of enzymes (Vuilleumier & Pagni, 2002
), which converts DCM to hydrochloric acid and formaldehyde, a central intermediate of methylotrophic growth (Fig. 1
). The ability of Methylobacterium strains to use DCM for growth was originally thought to only require possession of this enzyme. However, emerging evidence now suggests that additional genes and proteins may also be necessary for DCM metabolism (Vuilleumier, 2002
). In particular, the genotoxic effects associated with DCM-dehalogenase-dependent conversion of DCM (Kayser & Vuilleumier, 2001
) indicate that an efficient DNA repair system is required. Indeed, DNA polymerase I, an enzyme well known to participate in several DNA repair mechanisms, was shown to be essential for growth with DCM in strain DM4 (Kayser et al., 2000
).
|
The presence and the involvement of these two pathways for growth with halogenated methanes in strains closely related to M. extorquens AM1 such as M. dichloromethanicum strain DM4 and the chloromethane-degrading strain M. chloromethanicum CM4 (Vannelli et al., 1999 ) (9798% identity in 16S rDNA sequences) remained to be investigated. Notably, the pathway for chloromethane mineralization in M. chloromethanicum CM4 (Vannelli et al., 1999
; McDonald et al., 2001
) is unlikely to involve formaldehyde as an intermediate. Two proteins of strain CM4, CmuA and CmuB, were shown to catalyse the dehalogenation of chloromethane by a vitamin-B12-mediated methyl group transfer to H4folate (Studer et al., 2001
). Several lines of evidence also suggest that C1 units in strain CM4 are then further oxidized to formate by a series of enzymes specific to the chloromethane-degrading strain (A. Studer, C. McAnulla & S. Vuilleumier, unpublished results).
In this study, we first investigated whether the expression of the DCM dehalogenase from a plasmid was sufficient to support growth of M. extorquens AM1 or of M. chloromethanicum CM4 with DCM as the sole carbon source. We then addressed the question whether the recently described genes for C1 utilization of strain AM1 were also present in the dehalogenating strains DM4 and CM4, and if so, whether such genes were expressed during growth with DCM.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bacterial strains and growth conditions.
E. coli strains DH5 (Ausubel et al., 2001
), XL-1 Blue (Bullock et al., 1987
) and S17-1 (Simon et al., 1983
) were grown on LB medium (Ausubel et al., 2001
) at 37 °C with ampicillin (100 mg l-1) or tetracycline (25 mg l-1) as required. Methylobacterium strains were grown at 30 °C in liquid minimal medium (MM) with methanol (MeOH; 40 mM), DCM (10 mM) or succinate (10 mM) as carbon sources as described elsewhere (Kayser et al., 2000
). Bacterial growth in liquid culture was determined by monitoring the optical density of the cultures at 600 nm.
Matings.
Plasmids were mobilized into M. dichloromethanicum DM4-2cr (Gälli & Leisinger, 1988 ), M. extorquens AM1 (DSM 6343) and M. chloromethanicum CM4 (McDonald et al., 2001
) by biparental mating using E. coli S17-1 (Simon et al., 1983
) as the donor strain. Cultures of donor (OD600 0·5) and recipient (OD600 1·0) were mixed in a 1:2 ratio, spotted on nutrient agar medium (Difco) and incubated overnight at 30 °C. Bacteria were resuspended in 0·9% sodium chloride, washed, diluted and plated on selective MM agar plates containing the required antibiotics and MeOH (40 mM) or succinate (10 mM) as the carbon source.
Hybridization analysis.
Preparation of total DNA, DNA digestion and hybridization analysis were performed by standard procedures (Ausubel et al., 2001 ). Specific DNA probes for mchA, fae and mtdA genes were generated by PCR using digoxigenin (DIG)-labelling PCR mix (Roche Diagnostics), specific primers for the required genes and chromosomal DNA of M. extorquens AM1 as a template. Dimethylsulfoxide was added to all PCR reactions at a final concentration of 6% (v/v). For mchA, a 443 bp DIG-labelled DNA fragment of M. extorquens AM1 was generated using primers TACAAGGAGCTCGGCTATCG and GAAAAGATCTCGGCGAAGG (Vorholt et al., 1999
) (all primer sequences are given in the 5' to 3' direction). For fae detection, a 248 bp fragment of strain AM1 was generated using degenerate primers GGCGAGGCSCTSGTCGGSGAYGG and GCGACGCCATGYTGSGCSGGSCC (Vorholt et al., 2000
). A 850 bp mtdA probe was generated from plasmid pCH2 (Hagemeier et al., 2000
) with standard primers T7 (TAATACGACTCACTATAGGG) and T7term (GCTAGTTATTGCTCAGCGG). All probes were purified by agarose gel electrophoresis using the QIAquick gel extraction kit (Qiagen). After hybridization at 68 °C overnight, the membrane (HybondN, Amersham) was washed under stringent conditions and detection was performed according to the manufacturers instructions. The membrane was stripped with 0·2 M NaOH, 0·1% SDS at 37 °C for 10 min and stored at 4 °C for subsequent use.
Construction of DCM dehalogenase expression plasmids.
Broad-host-range plasmids were constructed for expression of the DCM dehalogenase (dcmA) of M. dichloromethanicum DM4. Plasmid pME8220 was constructed by cloning the 1·5 kb HindIIIPstI fragment containing dcmA without its negative transcriptional regulator dcmR (La Roche & Leisinger, 1991 ), from plasmid pME1540 (Schmid-Appert, 1996
), into HindIII/PstI-digested and dephosphorylated broad-host-range cloning vector pCM62 (Marx & Lidstrom, 2001
). Plasmid pME8221 was obtained by cloning the 2 kb BamHI fragment containing dcmA and its negative transcriptional regulator dcmR from plasmid pME1518 (La Roche & Leisinger, 1990
) into BamHI digested and dephosphorylated pCM62.
Cloning of C1 utilization genes from M. dichloromethanicum DM4.
The 5·8 kb BamHIEcoRV fragment hybridizing with the mchA probe was cloned into BamHI/EcoRV-digested and dephosphorylated pBluescript II KS(+) (Stratagene), yielding plasmid pME8167. For sequencing purposes, the internal 2·8 kb NcoI fragment from pME8167 was cloned into NcoI-digested and dephosphorylated pUC29 (Benes et al., 1993 ), yielding plasmid pME8168. Plasmid pME8169 was obtained by NcoI digestion and religation of plasmid pME8167. The 4·8 kb NcoI fragment hybridizing with a mchA probe was cloned into NcoI-digested and dephosphorylated pUC29, yielding plasmid pME8067. Subclones were generated by religation of BamHI- or SacII-digested pME8067, yielding pME8068 and pME8069, respectively. The 1·6 kb BamHI insert fragment of plasmid pME8067 was cloned into BamHI-digested and dephosphorylated pBluescript II KS(+), yielding plasmid pME8070. The 4·8 kb NcoI fragment hybridizing with the mtdA probe was cloned into NcoI-digested and dephosphorylated pUC29, resulting in plasmid pME8161. Subclones pME8163 and pME8164 were constructed by religation of a 3·6 kb NotI and a 2·6 kb EcoRI fragment of pME8161, respectively. Plasmids pME8165 and pME8166 were generated by subcloning a 2 kb EcoRI and a 1 kb NotI fragment, from pME8161, respectively, into pBluescript.
Sequence analysis.
Clones and subclones were sequenced using standard primers T7, T3 (ATTAACCCTCACTAAAGG) and M13rev (CAGGAAACAGCTATGACC) and by primer walking using Dye-Terminator chemistry and an ABI 377 Automated Sequencer or an ABI 310 Genetic Analyser (Perkin-Elmer). Sequences were analysed with the Genetics Computer Group sequence analysis package (version 10). Similarity searches against public protein and gene databases were performed using gapped BLAST (Altschul et al., 1997 ). The sequences obtained and analysed here were submitted to the EMBL database under accession numbers AJ421476 and AJ421477.
Construction of plasmids with transcriptional xylE fusions.
The broad-host-range promoter probe vector pCM130 (Marx & Lidstrom, 2001 ) was used to construct plasmid derivatives with DNA sequences from M. dichloromethanicum DM4 found upstream of the genes hprA (292 nt, plasmid pME8230), mtdA (157 nt, pME8231), sgaA (746 nt, pME8232), mchA (799 nt, pME8233) and dcmA (689 nt, pME8226) fused to a promoterless xylE gene. DNA sequences upstream of genes of interest were amplified from suitable plasmids. PCR products digested with either EcoRI (hprA, mtdA) or BamHI (sgaA and mchA, using BamHI sites present in the amplified products, see Fig. 3) and HindIII were cloned into vector pCM130 digested with the same enzymes. This afforded gene fusions displaying the gene-upstream DNA sequence of interest fused 6 nt upstream of the RBS sequence (GGAGG) and 18 nt (in frame) upstream of the start ATG codon of the promoterless xylE reporter gene. The sequences of the primers were (5' to 3' direction, introduced restriction site in bold): GACCCCGAATTCGGGTGTTGCCGCCGCCTC and TCGTGTAAGCTTCAAACCCCCTGCCGCCCCGT for hprA, CGCAGGAATTCGTCGAGGCGTAAGAAACGCA and GCTTCTAAGCTTTGATTCCTCTGGCCGGTTG for mtdA, GATGCAGATCGGACAGGAAG and TCGTTGAAGCTTTGAGAATTTCCTCCAATTAA for sgaA, CGCAAGATGCTGGAGGCG and TGTTGGAAGCTTTGATTGTTCTCCGTTTCC for mchA, TTTCTTAAGCTTTCCGTTTCTTCCTCGCAAGG and GATTCGAAGCTTCGTTATCCTCCCTTACTGTG for dcmA, respectively. The resulting plasmids, as well as pCM137, a pCM130 derivative with the DNA region upstream of fae from M. extorquens AM1 fused to the xylE gene (C. J. Marx & M. E. Lidstrom, personal communication), were transferred from E. coli S17-1 into M. dichloromethanicum DM4 by conjugation.
Preparation of cell extracts.
Bacterial cultures (50 ml) were harvested at early stationary phase by centrifugation at 12000 g for 15 min at 4 °C, resuspended in 3 ml ice-cold extraction buffer (50 mM Tris/HCl pH 7·5, 1 mM GSH, 2 mM DTT, 0·5 mM EDTA, 25%, v/v, glycerol) and cells disrupted by three passages through a French pressure cell (55 MPa). After centrifugation to remove cell debris (35000 g, 45 min, 4 °C), protein concentration in cell-free extracts was determined using a commercial Bradford reagent (Bio-Rad) and bovine serum albumin (Sigma) as a standard.
Enzyme assays.
Specific DCM dehalogenase activity was measured in triplicate (standard error <15% of the mean) in cell extracts (220 µg protein) using a previously described coupled enzyme assay with formaldehyde dehydrogenase (Vuilleumier & Leisinger, 1996 ). The reaction was performed at 30 °C in gas-tight spectrophotometric cuvettes in 100 mM sodium/potassium phosphate pH 8. For measurement of catechol dioxygenase activity, cultures were grown in 60 ml minimal medium containing 25 mg tetracycline l-1 in 300 ml flasks with gas-tight screw-caps (Supelco) at 30 °C under shaking (160 r.p.m.) with 10 mM succinate, 10 mM DCM or 40 mM MeOH as the carbon source. Samples (1 ml late-exponential culture; OD600 0·40·8) were centrifuged, resuspended in 1 ml cold catechol-2,3-dioxygenase (XylE) assay buffer (50 mM potassium phosphate pH 7·5, 10% acetone) and changes in absorbance upon addition of 10 µl 0·1 M 1,2-dihydroxybenzene were recorded at 375 nm and 25 °C. Specific activity of XylE was expressed as nmol product formed per min per 108 cells, using an absorption coefficient (
375) of 104 M-1 cm-1 for the reaction product (Rotmel et al., 1991
) and a value of 108 cells per ml culture of OD600 1 (unpublished observations).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
As expected from previous work (La Roche & Leisinger, 1991 ), expression of DCM dehalogenase was regulated by DCM and dcmR. DCM dehalogenase expression in transconjugants with plasmid pME8221 carrying dcmA and its transcriptional regulator dcmR was dependent on the presence of DCM (Fig. 2c
). A tenfold increase in DCM dehalogenase activity was observed in transconjugants from all strains when DCM was added to MeOH-grown cultures. Transconjugants growing with DCM alone showed an even higher induction of DCM dehalogenase expression. In pME8220 transconjugants which lacked dcmR, in contrast, DCM dehalogenase was constitutively expressed in MeOH- and MeOH/DCM-grown cultures (Fig. 2b
). This was expected from previous investigations (La Roche & Leisinger, 1991
; Schmid-Appert, 1996
) and confirmed that the dcmR gene is involved in the repression of DCM dehalogenase expression in the absence of DCM. Strikingly, however, the constitutively expressed DCM dehalogenase activity of the DM4-2cr(pME8220) transconjugant observed with MeOH was increased when DCM was used as the sole source of carbon and energy (Fig. 2d
). This suggests the existence in strain DM4 of an additional level of regulational control to that described previously (La Roche & Leisinger, 1991
) which involves the DCM-dependent induction of dcmA.
Surprisingly, expression of the DCM dehalogenase in strain AM1 did not support growth of this strain with DCM (Fig. 2). On the contrary, the mere presence of DCM in MeOH-grown cultures of strain AM1 transconjugants was detrimental to growth (Fig. 2
). Such cultures grew very slowly (µmax<0·01) and to only a low final optical density (OD600
0·1). Slower and poorer growth was only observed in M. extorquens AM1 expressing active DCM dehalogenase, since the maximal growth rate of the wild-type M. extorquens AM1 lacking a dcmA-containing plasmid was only slightly reduced in the presence of DCM (Fig. 2a
).
Taken together, these data suggested that the ability of Methylobacterium strains to utilize DCM as the sole source of carbon and energy was not solely dependent on the reaction catalysed by DCM dehalogenase. The possibility that pathways of C1 utilization may differ in Methylobacterium strains other than AM1 was therefore investigated by probing the dehalogenating strains DM4 and CM4 for the presence of the genes encoding enzymes of the C1 utilization pathways recently characterized in M. extorquens AM1 (Chistoserdova et al., 1998 ).
Cloning and sequence analysis of formaldehyde utilization genes in M. dichloromethanicum DM4
Hybridization analysis demonstrated that genes of H4folate-linked and H4MPT-linked C1 utilization pathways were also present in M. dichloromethanicum DM4 and M. chloromethanicum CM4, although the sizes of the hybridizing fragments often differed (Table 1 and data not shown). The 4·6 kb NcoI fragment of M. dichloromethanicum DM4 containing the methylene H4folate/H4MPT dehydrogenase gene mtdA was cloned and sequenced (Fig. 3a
). As in M. extorquens AM1, mtdA from strain DM4 is clustered together with the genes for serine glyoxylate aminotransferase (sgaA) and hydroxypyruvate reductase (hprA), encoding enzymes of the serine cycle (Chistoserdova & Lidstrom, 1994
). The genes encoding methenyl-H4MPT cyclohydrolase (mchA) and formaldehyde-activating enzyme (fae) were also cloned from strain DM4. Again, these genes are organized as in strain AM1 (Chistoserdova et al., 1998
) (Fig. 3b
). Analysis of the cloned genes revealed a high sequence identity of 96·5% to 99·7% to the corresponding genes of M. extorquens AM1 (Fig. 3
). Interestingly, similar levels of sequence conservation were also observed in putative intergenic regions (98·9%), suggesting that these genes represent a major metabolic module in a dehalogenating Methylobacterium strain as well.
|
|
|
In contrast, the sequence upstream of the serine glyoxylate aminotransferase gene sgaA caused significantly higher expression of the reporter gene during growth with MeOH than with DCM (Fig. 4). Further, DNA sequences upstream of fae and dcmA genes led to similar xylE expression with MeOH and DCM as the C1 growth substrate, but also with succinate (Fig. 4
). Constitutive expression of the fae''xylE fusion was somewhat unexpected considering the key role of the H4MPT-dependent formaldehyde-activating enzyme Fae for processing formaldehyde during growth of strain AM1 with MeOH (Vorholt et al., 2000
). However, the observed constitutive expression of xylE under the control of the dcmA promoter was in keeping with previous observations with plasmid-borne transcriptional lacZ fusions of sequences upstream of dcmA (Schmid-Appert, 1996
) that also lacked the dcmR regulator gene (La Roche & Leisinger, 1991
).
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The results reported here indicate that expression of active DCM dehalogenase from a plasmid supports growth with DCM of M. dichloromethanicum DM4-2cr and M. chloromethanicum CM4 but not of M. extorquens AM1. For reasons still unknown, therefore, M. extorquens AM1 appears ill-suited to cope with the metabolic consequences of DCM metabolism. The existence of pathways for energy generation and C1 assimilation from DCM in dehalogenating Methylobacterium strains that differed from those of strain AM1 represented one possibility that could help to rationalize this finding. The work presented here, however, clearly shows that many of the genes implicated in both pathways of C1 oxidation and assimilation recently discovered in M. extorquens AM1 (Chistoserdova et al., 1998 ; Vorholt et al., 1999
) are conserved with very high sequence identity in strain DM4 (Fig. 3
). It of course remains to be excluded that dehalogenating strains employ additional pathways for formaldehyde detoxification, such as the linear glutathione-dependent formaldehyde dehydrogenase/formyl-glutathione hydrolase pathway found in Paracoccus denitrificans for example (van Spanning et al., 2000
; Goenrich et al., 2002
). In our view, however, the most attractive hypothesis for the lack of growth of strain AM1 expressing DCM dehalogenase with DCM would be a lesser resistance of this strain to intracellular acid production compared to dehalogenating Methylobacterium strains. This idea is currently under investigation. Alternatively, strain AM1 could express some proteins absent from dehalogenating strains which could lead to deleterious toxic effects in the presence of DCM. Such proteins would not be unheard of: for example, some methane monooxygenases from methanotrophic bacteria were shown to accept DCM as a substrate, leading to the formation of reactive and therefore toxic products (see e.g. Murrell, 1994
). Bacteria of the Methylobacterium genus, however, are unable to grow with methane and lack methane monooxygenase. Yet another possibility worth investigating in the future would be that strain AM1 is optimized for coping with formaldehyde production in the periplasm by methanol dehydrogenase (Fassel et al., 1992
) rather than in the cytoplasm by DCM dehalogenase (Leisinger et al., 1994
).
Whatever the reason behind the lack of growth of strain AM1 with DCM, the xylE gene fusions investigated so far (Fig. 4) could not pinpoint C1 utilization genes displaying higher expression levels during growth with DCM compared to MeOH-driven growth. Indeed, the reverse was observed in the case of sgaA, which encodes an enzyme of the serine cycle of carbon assimilation. Of course, deducing expression patterns from experiments with plasmid-borne gene fusions can be a risky undertaking. In the absence of any information on transcriptional initiation, however, the precise placement of the gene fusion of the start codon of the gene of interest directly upstream of the RBS of the xylE reporter, as performed here, ensured that spurious effects arising from altered stability of the reporter mRNA (Haas, 2001
) would be kept to a minimum. The titration of regulator proteins by high-copy plasmids containing regulatory DNA sequences is another potential problem associated with plasmid-based reporters of gene expression. In the present case, however, DNA hybridization data suggested that the promoter-probe plasmid used, pCM130, was reproducibly and stably present in four to six copies in the cell (unpublished observations). Unfortunately, satisfactory gene integration systems remain to be developed for strain DM4. Indeed, preliminary experiments aiming at the insertional inactivation of genes in strain DM4 by using non-replicating plasmids derived from pAYC61 (Chistoserdov et al., 1994
), as commonly performed in the background of M. extorquens AM1 (Chistoserdova et al., 1998
; Vorholt et al., 2000
), have been unsuccessful.
In conclusion, the present study confirms previous indications (Kayser et al., 2000 ) that factors other than DCM dehalogenase are required for growth of Methylobacterium strains with DCM. The analysis of the expression of genes involved in C1 utilization now emerges as an attractive aspect of research on this subject.
![]() |
ACKNOWLEDGEMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Anthony, C. (1982). The Biochemistry of Methylotrophs. London: Academic Press.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (2001). Current Protocols in Molecular Biology. New York: Wiley.
Benes, V., Hostomsky, Z., Arnold, L. & Paces, V. (1993). M13 and pUC vectors with new unique restriction sites for cloning. Gene 130, 151-152.[Medline]
Bullock, W. O., Fernandez, J. M. & Short, J. M. (1987). XL1-Blue a high-efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. Biotechniques 5, 376-378.
Chistoserdov, A. Y., Chistoserdova, L. V., McIntire, W. S. & Lidstrom, M. E. (1994). Genetic organization of the mau gene cluster in Methylobacterium extorquens AM1: complete nucleotide sequence and generation and characteristics of mau mutants. J Bacteriol 176, 4052-4065.[Abstract]
Chistoserdova, L. V. & Lidstrom, M. E. (1992). Cloning, mutagenesis and physiological effect of a hydroxypyruvate reductase gene from Methylobacterium extorquens AM1. J Bacteriol 174, 71-77.[Abstract]
Chistoserdova, L. V. & Lidstrom, M. E. (1994). Genetics of the serine cycle in Methylobacterium extorquens AM1: identification of sgaA and mtdA and sequences of sgaA, hprA and mtdA. J Bacteriol 176, 1957-1968.[Abstract]
Chistoserdova, L., Vorholt, J. A., Thauer, R. K. & Lidstrom, M. E. (1998). C-1 transfer enzymes and coenzymes linking methylotrophic bacteria and methanogenic archaea. Science 281, 99-102.
Doronina, N. V., Trotsenko, Y. A., Tourova, T. P., Kuznetzov, B. B. & Leisinger, T. (2000). Methylopila helvetica sp. nov. and Methylobacterium dichloromethanicum sp. nov. novel aerobic facultatively methylotrophic bacteria utilizing dichloromethane. Syst Appl Microbiol 23, 210-218.[Medline]
Fassel, T. A., Buchholz, L. A., Collins, M. L. P. & Remsen, C. C. (1992). Localization of methanol dehydrogenase in two strains of methylotrophic bacteria detected by immunogold labeling. Appl Environ Microbiol 58, 2302-2307.[Abstract]
Gälli, R. & Leisinger, T. (1988). Plasmid analysis and cloning of the dichloromethane-utilization genes of Methylobacterium sp. DM4. J Gen Microbiol 134, 943-952.[Medline]
Goenrich, M., Bartoschek, S., Hagemeier, C. H., Griesinger, C. & Vorholt, J. A. (2002). A glutathione-dependent formaldehyde activating enzyme (Gfa) from Paracoccus denitrificans detected and purified via 2D proton exchange spectroscopy. J Biol Chem 277, 3069-3072.
Haas, D. (2001). lacZ fusions report gene expression, dont they? Microbiology 147, 1993-1995.
Hagemeier, C., Chistoserdova, L., Lidstrom, M., Thauer, R. K. & Vorholt, J. (2000). Characterization of a second methylene tetrahydromethanopterin dehydrogenase from Methylobacterium extorquens AM1. Eur J Biochem 267, 3762-3769.
Hagemeier, C. H., Bartoschek, S., Griesinger, C., Thauer, R. K. & Vorholt, J. A. (2001). Re-face stereospecificity of NADP dependent methylenetetrahydromethanopterin dehydrogenase from Methylobacterium extorquens AM1 as determined by NMR spectroscopy. FEBS Lett 494, 95-98.[Medline]
Kayser, M. F. & Vuilleumier, S. (2001). Dehalogenation of dichloromethane by dichloromethane dehalogenase/glutathione S-transferase leads to the formation of DNA adducts. J Bacteriol 183, 5209-5212.
Kayser, M. F., Stumpp, M. T. & Vuilleumier, S. (2000). DNA polymerase I is essential for growth of Methylobacterium dichloromethanicum DM4 with dichloromethane. J Bacteriol 182, 5433-5439.
La Roche, S. D. & Leisinger, T. (1990). Sequence analysis and expression of the bacterial dichloromethane dehalogenase structural gene, a member of the glutathione S-transferase supergene family. J Bacteriol 172, 164-171.[Medline]
La Roche, S. D. & Leisinger, T. (1991). Identification of dcmR, the regulatory gene governing expression of dichloromethane dehalogenase in Methylobacterium sp. DM4. J Bacteriol 173, 6714-6721.[Medline]
Landi, S. (2000). Mammalian class theta GST and differential susceptibility to carcinogens: a review. Mutat Res 463, 247-283.[Medline]
Leisinger, T., Bader, R., Hermann, R., Schmid-Appert, M. & Vuilleumier, S. (1994). Microbes, enzymes and genes involved in dichloromethane utilization. Biodegradation 5, 237-248.[Medline]
Marx, C. J. & Lidstrom, M. E. (2001). Development of versatile broad-host-range vectors for use in methylotrophs and other Gram-negative bacteria. Microbiology 147, 2065-2075.
McDonald, I. R., Doronina, N. V., Trotsenko, Y. A., McAnulla, C. & Murrell, J. C. (2001). Hyphomicrobium chloromethanicum sp. nov. and Methylobacterium chloromethanicum sp. nov., chloromethane-utilizing bacteria isolated from a polluted environment. Int J Syst Evol Microbiol 51, 119-122.[Abstract]
McKay, D., Shiu, W. Y. & Ma, K. C. (1993). Volatile Organic Chemicals. Boca Raton, FL: Lewis Publishers.
Murrell, J. (1994). Molecular genetics of methane oxidation. Biodegradation 5, 145-159.[Medline]
Pomper, B. K. & Vorholt, J. A. (2001). Characterization of the formyltransferase from Methylobacterium extorquens AM1. Eur J Biochem 268, 4769-4775.
Pomper, B. K., Vorholt, J. A., Chistoserdova, L., Lidstrom, M. E. & Thauer, R. K. (1999). A methenyl tetrahydromethanopterin cyclohydrolase and a methenyl tetrahydrofolate cyclohydrolase in Methylobacterium extorquens AM1. Eur J Biochem 261, 475-480.
Rotmel, R. K., Chakrabarty, A. M., Berry, A. & Darzins, A. (1991). Genetic systems in Pseudomonas. Methods Enzymol 204, 485-514.[Medline]
Schmid-Appert, M. (1996). Untersuchungen zur Regulation des Dichlormethan-Dehalogenase Gens aus Methylobacterium sp. Stamm DM4 und Struktur der angrenzenden DNA-Region. Zürich: ETH Dissertation Nr. 11646.
Simon, R., Priefer, U. & Pühler, A. (1983). A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1, 784-790.
Studer, A., Stupperich, E., Vuilleumier, S. & Leisinger, T. (2001). Chloromethane:tetrahydrofolate methyl transfer by two proteins from Methylobacterium chloromethanicum strain CM4. Eur J Biochem 268, 2931-2938.
van Agteren, M. H., Keuning, S. & Janssen, D. B. (1998). Handbook on Biodegradation and Biological Treatment of Hazardous Organic Compounds, pp. 7991. Dordrecht: Kluwer.
van Spanning, R. J. M., de Vries, S. & Harms, N. (2000). Coping with formaldehyde during C1 metabolism of Paracoccus denitrificans. J Mol Catal B 8, 37-50.
Vannelli, T., Messmer, M., Studer, A., Vuilleumier, S. & Leisinger, T. (1999). A corrinoid-dependent catabolic pathway for growth of a Methylobacterium strain with chloromethane. Proc Natl Acad Sci USA 96, 4615-4620.
Vorholt, J. A., Chistoserdova, L., Lidstrom, M. E. & Thauer, R. K. (1998). The NADP-dependent methylene tetrahydromethanopterin dehydrogenase in Methylobacterium extorquens AM1. J Bacteriol 180, 5351-5356.
Vorholt, J. A., Chistoserdova, L., Stolyar, S. M., Thauer, R. K. & Lidstrom, M. E. (1999). Distribution of tetrahydromethanopterin-dependent enzymes in methylotrophic bacteria and phylogeny of methenyl tetrahydromethanopterin cyclohydrolases. J Bacteriol 181, 5750-5757.
Vorholt, J. A., Marx, C. J., Lidstrom, M. E. & Thauer, R. K. (2000). Novel formaldehyde-activating enzyme in Methylobacterium extorquens AM1 required for growth on methanol. J Bacteriol 182, 6645-6650.
Vuilleumier, S. (2002). Coping with a halogenated one-carbon diet: aerobic dichloromethane-mineralising bacteria. In Biotechnology for the Environment, Focus on Biotechnology Series , pp. 105-131. Edited by W. Reineke & S. Agathos. Dordrecht:Kluwer.
Vuilleumier, S. & Leisinger, T. (1996). Protein engineering studies of dichloromethane dehalogenase/glutathione S-transferase from Methylophilus sp. strain DM11. Ser12 but not Tyr6 is required for enzyme activity. Eur J Biochem 239, 410-417.[Abstract]
Vuilleumier, S. & Pagni, M. (2002). Bacterial glutathione S-transferases: new lessons from bacterial genomes. Appl Microbiol Biotechnol 58, 138-146.[Medline]
Received 11 December 2001;
revised 18 January 2002;
accepted 31 January 2002.