Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing

Tim J. Bull, John Hermon-Taylor, Ivo Pavlik, Fouad El-Zaatari and Mark Tizard
p. 2186, right column, lines 31–32.

The sequence of Loc14R should read: TCACGGCGGTCAGGTTACTTC

p. 2188, left column, PCR reaction conditions, lines 2–5.

The text should read: ...The PCR mix consisted of a 50 µl reaction volume containing a final concentration of 2 pmol of each Loc primer µl-1, 10 pmol of each IS900 primer µl-1, 10% (v/v) DMSO, 1.5 mM MgCl2, 200 µM dNTP...

Microbiology (2000), 146, 2185–2197