The sequence of Loc14R should read: TCACGGCGGTCAGGTTACTTC
p. 2188, left column, PCR reaction conditions, lines 25.
The text should read: ...The PCR mix consisted of a 50 µl reaction volume containing a final concentration of 2 pmol of each Loc primer µl-1, 10 pmol of each IS900 primer µl-1, 10% (v/v) DMSO, 1.5 mM MgCl2, 200 µM dNTP...
Microbiology (2000), 146, 21852197