Departament de Microbiología i Ecología, Facultat de Farmacia, Universitat de València, Vicent Andrés Estelles s/n, 46100 Burjassot, València, Spain
Correspondence
Rafael Sentandreu
Rafael.sentandreu{at}uv.es
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The cell wall is a composite of chitin fibrils immersed in an amorphous matrix made of -glucans and mannoproteins. The three components are dispersed throughout the cell wall, although the mannoproteins are mostly concentrated on the outer surface (Sentandreu et al., 2001
; Klis et al., 2002
; Kapteyn et al., 1999b
).
In C. albicans and Saccharomyces cerevisiae some wall proteins are released by hot SDS and the remaining ones are solubilized in the form of supramolecular highly polydisperse complexes, after the degradation of the structural skeleton by -glucanases and chitinase (Marcilla et al., 1991
, 1993
). Three types of proteins that are released by
-glucanases and chitinase have been detected: glycosylphosphatidylinositol proteins (GPI-dependent wall proteins), Pir proteins (proteins with internal repeats) and other proteins. The proteins of the first group are linked to 1,3-
-glucan through a 1,6-
-glucan connector whereas the proteins of the second group are highly O-glycosylated, and are attached to the 1,3-
-glucan in the cell wall by unknown alkali-labile bonds, suggesting that they are retained through an O-glycosydic linkage (Mormeneo et al., 1995
; Mr
a & Tanner, 1999
; Kapteyn et al., 2000
; Klis et al., 2001
). The third type of proteins detected in the cell walls lack signal peptide and are probably exported by a putative, non-classical export pathway: enolase, aconitase, pyruvate kinase, phosphoglycerate mutase, methionine synthase and many others have been identified (Cleves et al., 1996
; Eroles et al., 1997
; Pardo et al., 1999
, 2000
).
Pir proteins seem to be also present in C. albicans and other fungi, as immunological and Southern and Northern experiments suggested the presence of a protein related to the heat-shock-inducible product of the HSP150/PIR2 gene of S. cerevisiae (Kandasamy et al., 2000; Kapteyn et al., 2000
; Jaafar et al., 2003
).
Kapteyn et al. (1999a) published evidence that the amount of Hsp150/Pir2 in the walls of 1,6-
-glucan-deficient mutants increases and suggested that this phenomenon is part of a general compensatory mechanism in response to cell wall weakening caused by low levels of 1,6-
-glucan (Kapteyn et al., 1999a
).
This paper reports identification of a homologue of S. cerevisiae Pir4 by a BLAST search in a C. albicans genomic database (http://genolist.pasteur.fr/CandidaDB/). This new C. albicans Pir protein, CaPir1, has two alleles of different sizes. Both alleles seem to be expressed equally. After cloning, the C. albicans Pir protein was expressed in S. cerevisiae and overexpressed in C. albicans. The protein was labelled with V5 epitope and found to be linked by alkaline sensitive linkages to the wall.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
The cell walls (100 mg dry weight) were suspended in a solution of 0·01 M ammonium acetate, pH 6·3, containing 2 % (v/v) -mercaptoethanol, shaken for 3 h at 28 °C and then pelleted. The supernatant was concentrated by freeze-drying and dissolved in Laemmli solution (1970). The cell wall residue was then extracted again with 15 mM NaOH (Kapteyn et al., 1999a
).
Protein gel electrophoresis and Western blot techniques.
Proteins were separated by SDS-PAGE performed basically as described elsewhere (Laemmli, 1970) in 10 % (w/v) acrylamide gels loaded with 20 µg protein. The gels were stained with Coomassie brilliant blue or transferred onto Hybond-C nitrocellulose membranes as described by Towbin et al. (1979)
and Burnette (1981)
, and immunodetected with a polyclonal antibody preparation against the material extracted by Zymolyase from C. albicans yeast cell walls (PAbL) (1 : 1000), or anti-c-myc (1 : 500) and anti-V5 (1 : 500) monoclonal antibodies (Invitrogen). Detection was carried out by the enhanced chemiluminiscent (ECL) method from Amersham Biosciences, following the manufacturer's instructions.
Mannoproteins were stained by the protocol described by Hawkes (1982) and modified by Millete & Scott (1984)
. To remove N-glycosylated chains of mannoproteins, samples containing 15 µg protein were treated with endoglycosidase F (Endo-F; Roche) following the manufacturer's instructions.
Protoplast preparation and regeneration.
Preparation and regeneration of C. albicans CAI4 protoplasts were carried out as described by Elorza et al. (1983). Regeneration was performed for 30 min, 1 h, 2 h, 3 h and 5 h. Regenerated protoplasts in each condition were recovered by centrifugation (10 min, 2000 g) and stored at 20 °C.
Mycelium induction.
For germ tube induction, cells were cultured in modified Lee's medium as described previously (Elorza et al., 1988).
Heat-shock assay.
C. albicans CAI4 was grown overnight at 25 °C in YNB medium at 200 r.p.m. One millilitre was inoculated into a 110 ml YNB medium preheated at 25 °C and was grown at 25 °C to OD600 0·6. Two 50 ml samples were taken. One was added to 50 ml YNB medium preheated at 25 °C and incubated at 25 °C for 30 min. The other was added to 50 ml YNB medium preheated at 53 °C and incubated at 37 °C for 30 min. Cultures were harvested at room temperature by centrifugation (2000 g, 5 min) and stored frozen until RNA extraction.
Genetic constructions.
To construct the heterozygous PIR1 mutants, part of the gene (522 bp) was replaced with a hisGURA3 : : hisG cassette (Fonzi & Irwin, 1993). This cassette was made by a two-step PCR amplification procedure. In the first step, an amplicon of 512 bp was obtained from genomic DNA using primers 15-1 (TTCCGAGCTCGTTAGTATTGTTACTTTGTTAG) and 15-2 (TTCCGGTACCTTTGTTATCATTTCTAGTCAATG) containing engineered SacI and KpnI restriction sites, respectively (underlined). The amplicon obtained (15-1,2), which included the nucleotides 291 to 224, was digested with SacI and KpnI and cloned into p5921 previously digested with the same enzymes, producing plasmid p15-1,2. In a second step, a fragment of 411 bp was obtained by using primers 15-3 (TTCCGTCGACTACTGCTGAAAATGTTGCTAAAGC) and 15-4 (TTCCCTGCAGTTTAACAGTTGACAAATTCAATG), which have SalI and PstI restriction sites, respectively (underlined). This new amplicon, 15-3,4, which included nucleotides 746 to 1185, was digested with SalI and PstI and cloned into p15-1,2 digested with the same enzymes, producing plasmid p15-c.
Disruption of both alleles was attempted as described by Fonzi & Irwin (1993). C. albicans CAI4 cells were transformed with 10 µg of a SacIPstI fragment from p15-c. Cells were selected in YNB medium lacking uridine and integration was checked by PCR, RT-PCR and Southern blot analysis. Some of the heterozygous disruptants obtained from each allele (PIR115363/pir119968
and pir15363
/PIR19968) were plated on YNB medium containing uridine and 5-fluoro-orotic acid to select Ura revertants produced as a result of recombination of the flanking hisG repeats (Boeke et al., 1984
).
C. albicans CAI4/pADH-15 and S. cerevisiae pir4/pADH-15 strains with constitutive expression of CaPIR1 were obtained by transformation of S. cerevisiae pir4
mutant or C. albicans CAI4 with plasmid pADH-15. To construct this plasmid the CaPIR1 coding region was PCR-amplified. Primers designed to introduce a BglII site at position 1 with respect to the first nucleotide of the coding region and an EcoRV site in the 3' end were used. The primer sequences were ADH 15 5' (TACTTGAGATCTATGAAGTACTCTACACTTGTTAG) and ADH 15 3' (GGGCCCGATATCTTAATAGTTGACAAACTC); they include BglII and EcoRV sites respectively (underlined). The PCR product was digested with BglII and EcoRV and ligated with the 12·1 kb BglIIEcoRV fragment of pADH-pl (Bertram et al., 1996
) to generate pADH-15.
To construct pADH-15-myc the coding region of CaPIR1 was amplified by PCR using the oligonucleotides ADH 15 5' and ADH 15-myc 3' (CCTTGATATCTAAAGATCCTCTTCTGAGATGAGTTTTTGTTCACAGTTGACAAATTCAATGACAC) containing the c-myc sequence (in bold), the stop codon TAA, an EcoRV restriction site (underlined) and 23 bp of the 3' part of the CaPIR1 gene sequence. The PCR product obtained using these primers produced a 1150 bp band that was eluted and digested with BglII and EcoRV, and ligated with the 12·1 kb fragment of pADH-pl digested with the same enzymes. This new construct was called pADH-15-myc.
Plasmid pMAL-15-V5 was constructed to tag the CaPir1 protein with a V5 epitope. The CaPIR1 coding region was amplified with primers designed to introduce an EcoRV site at position 1 with respect to the first nucleotide of the coding region and an MluI site at the 3' end. The sequence corresponding to the V5 epitope was added at the 3' end. The primer sequences used were 15-V5 5' (TTAGGATATCATGAAGTATTCTACACTTGTTAGTATTGCTGC), which includes the EcoRV site (underlined), and 15-V5 3' (GACCACGCGTTTACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCACAGTTGACAAATTCAATG), which contains a MluI site (underlined), the stop codon TAA and the V5 epitope sequence (in bold). The 1162 bp PCR product was digested with EcoRV and MluI and ligated with a 5·68 kb EcoRV/MluI Clp10-MAL2p fragment to generate the plasmid pMAL-15-V5. The identity of all PCR products was confirmed by cloning and sequencing.
Clp10-MAL2p (Backen et al., 2000) contains the inducible C. albicans MAL2 promoter, the gene CaRP10 and the C. albicans URA3 as marker.
pMAL-15-V5 was digested with NcoI and the linear 6·9 kDa fragment was used to transform C. albicans CAI4. Integration was performed in the RP10 locus. Transformants were recovered in YNB medium and grown in YNB-maltose medium to induce tagged protein expression.
Transformation of C. albicans and S. cerevisiae.
S. cerevisiae was transformed using the lithium acetate method as described by Ito et al. (1983) and modified by Gietz & Sugino (1988)
. C. albicans was transformed using the protocol described by Gietz et al. (1992)
.
Phenotypic analysis of the pir1/PIR1 heterozygous strains.
Morphological differences and alterations in growth rates were tested. Calcofluor white and Congo red sensitivity were tested by streaking cells onto YNB medium plates containing increasing concentrations of the two compounds as described Van der Vaart et al. (1995). Cells were grown in YNB liquid medium overnight and adjusted to OD600 1, serial decimal dilutions were done and drops of 3 µl were placed onto the surface of YNB plates containing increasing concentrations of Calcofluor white (0150 µg ml1) and Congo red (030 µg ml1). Plates were incubated at 28 °C and monitored after 3 days.
RT-PCR analysis.
Total RNA was prepared from C. albicans CAI4 after growth in different conditions by the method described by Langford & Gallwitz (1983).
RNA was treated with RNasefree DNase I (Amersham Biosciences) to eliminate genomic DNA contamination. The first-strand cDNA synthesis reaction was catalysed by the SuperScript First Strand Synthesis System for RT-PCR (Invitrogen) and the primers used to amplify IPF 15363 and IPF 19968 were ADH 15 5' and ADH 15 3'. PCR generated an amplicon of 1120 bp from the first allele and another of 1003 bp for IPF 19968. In a parallel experiment and as an internal control the RT-PCR was performed using new primers that amplify CaRPS0 (Baquero et al., 2001). This gene carries an intron, and genomic DNA gave a fragment of 870 bp and cDNA one of 545 bp. The oligonucleotides used in this case were YST11B (TTTGACTTAACTCCAGAAGACGG) and YST12B (ACCTCTTAATCTCAAGACTTCTCTAGC). cDNA was quantified in a GeneQuant II spectrophotometer (Amersham Pharmacia Biotech) and all samples contained the same quantity of first-strand cDNA (1 µg) for PCR amplification. In some experiments, several cycles of amplification were analysed and PCR products were run on 0·8 % agarose gels.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Expression patterns of CaPIR1
The presence of different alleles of CaPIR1 opened the possibility of finding if both alleles were expressed equally under the same environmental conditions or if they had a different expression control. The expression of CaPIR1 was examined by RT-PCR. Fig. 2(a, b) shows the RT-PCR amplification of CaPIR1-specific fragments (1120 and 1003 bp) from first-strand cDNA derived from cells growing in different conditions. Different samples, containing the same quantity of first-strand cDNA, were prepared and subjected to different cycles of amplification. Fig. 2(a, b)
shows that the quantity of CaRPS0-specific amplicon (545 bp) was approximately the same in each of the first-strand cDNA samples. The presence of one intron in the corresponding region of the CaRPS0 genomic DNA allows differentiation between bands amplified from cDNA and any contaminating genomic DNA (870 bp) (Baquero et al., 2001
). The results indicated that the two alleles of CaPIR1 were expressed in the same amount independently of the cell morphology, yeast or mycelium (Fig. 2a
). In S. cerevisiae at least one of the Pir proteins is a heat-shock protein (Hsp150/Pir2; Kapteyn et al., 1999a
); to determine if CaPir1 could be a heat-shock protein and so a functional homologue of ScPir2, a semi-quantitative RT-PCR was performed from cells growing at 25 °C and then transferred to 37 °C. As shown in Fig. 2(b)
, no differences in expression were observed, suggesting that CaPir1 is not a heat-shock protein. One interesting observation was made from protoplasts under cell wall regeneration conditions. C. albicans protoplasts were incubated in a regeneration medium, and after 30, 60, 120, 180 and 300 min, samples were taken and the CaPIR1 expression examined by RT-PCR. The results (Fig. 2c
) indicated that CaPIR1 expression increased with time of regeneration, showing a maximum after 120 min of incubation.
|
Fourteen of the resulting Ura+ transformants were analysed and eleven of them contained the desired insert at the CaPIR1 locus (data not shown). Southern blot analysis of different isolates, after digestion with SacI, revealed that the cassette had integrated into one of the two CaPIR1 alleles (Fig. 3a), giving rise to a 13·8 kb fragment; this is consistent with the replacement of one allele of CaPIR1 with the transforming DNA. The 10 kb SacI fragment corresponds to the other allele which was still present in the Ura+ transformants. To determine which of the two alleles had been disrupted, an RT-PCR assay was performed. As shown in Fig. 3(b)
, disruptants of the two alleles were obtained. A representative isolate of each mutant was chosen; these isolates were named C. albicans CAPIR15 and C. albicans CAPIR19, heterozygous mutants for allele IPF 15363 and IPF 19968, respectively. Ura segregants were selected on medium containing 5-fluoro-orotic acid (Boeke et al., 1984
) and examined by Southern blot analysis. More than 60 independent segregants were examined and all of them had experienced an interchromosomal recombination event, reverting to the C. albicans CAI4 genotype (data not shown). By this method of disruption only heterozygous mutants in one or other of the two CaPIR1 alleles were obtained (Fig. 3b
) so we tried to obtain null mutants by the technique of Wilson et al. (1999)
. By this technique again only heterozygous mutants were obtained (data not shown). By using this technique it is not necessary to obtain any Ura segregants to disrupt the second allele, and the fact that no homozygous mutants were obtained with both techniques could indicate that CaPIR1 is an essential gene for cell viability.
|
|
Overexpression and cellular localization of CaPir1 in C. albicans
Overexpression of CaPIR1 was achieved by subcloning an amplicon containing the IPF 15363 allele of CaPIR1 in a pADH episomal vector (Bertram et al., 1996) under the control of the ADH1 promoter. The new plasmid was named pADH-15 and it was used to transform C. albicans CAI4. To determine in which cell wall fraction the overexpressed material was located, a Western blot analysis of
-mercaptoethanol and alkaline cell wall extracts, and also the spent medium, using PAbL antibodies, was performed. An increased amount of the material released by alkaline solutions, but not in the material released by
-mercaptoethanol or present in the spent medium, was observed in the strain that overexpressed CaPIR1 when compared with C. albicans CAI4 (Fig. 5a
). No change in morphology or growth rate of cells was observed in the overexpressing C. albicans strain.
|
The difference between the predicted size of CaPir1 (about 40 kDa in the case of the allele IPF 15363) and that deduced from the mobility in SDS-PAGE (about 180 kDa, Fig. 5b) could be accounted for by N- and/or O-glycosylation. To determine if CaPir1 was modified postranslationally by N-glycosylation, the material released to the spent medium by C. albicans expressing CaPir1 tagged with V5 was treated with Endo-F. Western blot analysis with anti-V5 antibodies showed that the 180 kDa species disappeared after Endo-F treatment, and a new species of 110 kDa appeared (Fig. 5c
), indicating that CaPir1 was N-glycosylated. There is a substantial difference between the molecular mass of CaPir1 (IPF 15363) treated with Endo-F (110 kDa) as determined by SDS-PAGE, and its predicted molecular mass (40·5 kDa) calculated from the deduced amino acid sequence. This discrepancy could be accounted for by the potential O-glycosylation, as 20 % of its amino acids are Ser/Thr, which is known to increase the apparent size in the Laemmli gel system.
Expression of CaPIR1 in S. cerevisiae
To analyse whether CaPir1 could be incorporated into the walls of S. cerevisiae, cells of S. cerevisiae pir4 transformed with plasmid pADH-15 were grown and their cell walls isolated. Cell walls were treated with
-mercaptoethanol or alkaline solutions; the spent medium was also analysed. The solubilized material was analysed by Western blotting using PAbL antibodies and ConA-peroxidase. A main band with an apparent molecular mass of 110 kDa was detected in
-mercaptoethanol extracts (Fig. 6a
). A band with a similar mobility was also detected in the spent medium and in the material extracted by alkaline solutions from the isolated cell walls of the S. cerevisiae CaPIR1-expressing strain (data not shown). No changes in either morphology or growth rate of cells were observed in S. cerevisiae pir4
expressing CaPIR1.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
S. cerevisiae Pir4 was identified from the material released from isolated walls with -mercaptoethanol (Castillo et al., 2003
). New potential C. albicans cell wall proteins related to S. cerevisiae Pir4 were identified by an in silico search of a C. albicans database. Only two ORFs were found (IPF 15363 and 19968; Fig. 1
). Additional BLAST searches in the C. albicans database for other homologues of the Pir family of S. cerevisiae (Pir1, Pir2 and Pir3) gave negative results (Toh-e et al., 1993
). Due to the similarity in the homology percentages, CaPir1 can not be designated as the functional homologue of a specific Pir protein.
Three main differences have been detected in the C. albicans proteins in comparison to ScPir4: (i) absence of a potential Kex2 site (Lys-Arg, Arg-Arg and Pro-Arg) close to the N-terminal part of the proteins (cleavages occur at the carboxyl side of pairs of basic residues: Brenner et al., 1994; Mizuno et al., 1989
; Goller et al., 1998
); (ii) the C. albicans protein encoded by IPF 15363 has nine tandem repeats of 11 aa (QITDGQVQHQT) and IPF 19968 seven tandem repeats, whereas the ScPir4 has only one repeat (SQIGDGQVQA); and (iii) a point mutation (Leu281/Ser242) that could be a real point mutation. A homologue of S. cerevisiae Hsp150/Pir2 has been reported in C. albicans (Kapteyn et al., 2000
; Kandasamy et al., 2000
) but the results obtained in silico and by mass spectrometry (unpublished results) indicated that the product of a single PIR gene (CaPIR1) is found in C. albicans cell wall. Therefore it is possible that the protein previously reported is the same as the one described in this paper which we have named CaPir1.
It is interesting that both IPF 15363 and IPF 19968 are expressed under normal laboratory growth conditions, after heat shock and in both yeast and mycelial forms. The codon bias index (CBI) for IPF 15363 is 0·345, suggesting that it is a poorly expressed gene. The low expression of CaPIR1 contrasts with the situation of the PIR genes in S. cerevisiae because PIR1, PIR2 and PIR3 are among those expressed abundantly (Toh-e et al., 1993).
To define the cellular function of PIR1, we attempted to contstruct a null mutant to search for informative phenotypes. However, we were unable to obtain a null mutant even though both the Fonzi & Irwin (1993) and Wilson et al. (1999)
techniques were used. We have no explanation for these results, but the phenotype of the heterozygous mutants, independently of the allele interrupted (specific growth rates, clump formation and hypersensitivity to cell-wall-perturbing agents such as Calcofluor white and Congo red) (Elorza et al., 1983
; Ram et al., 1994
; Mr
a et al., 1999
), and the fact that in S. cerevisiae there are four PIR genes instead of one, indicated the possibility that the null mutant is lethal. In the case of S. cerevisiae, sequential disruption of PIR genes brings increasingly irregular shape, clumping of the cells and a pronounced destabilization in the presence of Calcofluor white and Congo red (Mr
a & Tanner, 1999
); therefore C. albicans PIR1 may be an essential gene.
The haploinsufficiency phenotypes indicate that both PIR1 alleles contribute to maintaining the correct cell wall organization in wild-type strains. This situation is in some respects similar to that in S. cerevisiae, as the phenotype shown by this species is progressively more apparent as the number of PIR genes disrupted increases (Mra & Tanner, 1999
).
CaPir1 was found as a new cell wall band when expressed in S. cerevisiae. This band reacted with ConA, demonstrating that it was a glycoprotein, but it could not be detected in C. albicans as the material released from the wall was highly polydisperse and no specific antibodies were available. A recombinant CaPir1 tagged with the V5 epitope was found linked only to the 1,3--glucan through an alkali-sensitive bond. MALDI-TOF analysis of the materials released by
-mercaptoethanol also failed to detect CaPir1 (unpublished). Therefore it is possible that CaPir1 is only attached to the 1,3-
-glucan of the wall. This result is surprising, as a fraction of S. cerevisiae Pir4 molecules and CaPir1 expressed in this species are retained in the wall by disulphide bridges and as a consequence released by reducing agents.
Nothing is known about the function of CaPir1. Toh-e et al. (1993) isolated in S. cerevisiae three highly homologous genes of the PIR family (PIR1, PIR2 and PIR3), and genes homologous to PIR have been also found in Kluyveromyces lactis and Zygosaccharomyces rouxii but not in Schizosaccharomyces pombe, suggesting that the PIR genes play a role in budding yeast. In addition, null mutants of each gene are viable, indicating that none of them is essential, but they are required for tolerance to heat shock (PIR2/HSP150) (Toh-e et al., 1993
) and determine resistance to the plant protein osmotin (Yun et al., 1997
; Ibeas et al., 2001
). By functional genomics it has been found that ScPir4 interacts with Yjr030 and Bur2 (Ito et al., 2001
) and it was suggested that it might strengthen the regenerating cell wall of protoplasts (Pardo et al., 1999
). In this context it is important to emphasize that the S. cerevisiae Pir family is formed by four proteins (Pir1, Pir2, Pir3 and Pir4) whereas in C. albicans only one Pir homologue has been found. BLAST searches to find other members in the C. albicans genomic database have given negative results. Recently it has been reported that ScPir2 is more efficiently retained in the wall of S. cerevisiae growing at low pH and it was suggested that this is also the case for other Pir proteins (Kapteyn et al., 2001
) and that probably all members of this protein family are at least functionally equivalent in the cell wall.
Although the actual function of CaPir1 is unknown, it may be critical in the organization of the wall because during the initial steps of protoplast regeneration (23 h) the levels of expression are significantly high.
Two interesting differences have been detected between CaPir1 and ScPir4 from the structural and functional points of view: (i) ScPir4 is retained in the wall by two types of bonds (disulphide bridges and covalently bound to the 1,3--glucan) whereas CaPir1 seems to be only attached to the 1,3-
-glucan (the protein is not detected in the material extracted by
-mercaptoethanol by immunological or mass spectrometry techniques; unpublished observations); and (ii) four proteins are found in the S. cerevisiae Pir family whereas in C. albicans only one member of this family (CaPir1, as determined in silico) has been found. CaPir1 has an N-glycosylation sequon in its sequence (NXaaS/T) at positions 233235 and the protein moves with an apparent molecular mass of 180 kDa that is reduced to 110 kDa after treatment with Endo-F. But it seems that it is not N-glycosylated when expressed by S. cerevisiae. This result is of interest but its reason is unknown; it could be due to the different specificity of the oligosaccharyltransferase (the enzyme complex that transfers the inner core of the carbohydrate moiety) in the two organisms, or to steric hindrance as occurs with S. cerevisiae invertase; this enzyme contains 14 sequons but only eight or nine are glycosylated (Reddy et al., 1988
).
Finally, the cell wall of S. cerevisiae cells has been engineered using Pir1 or Pir2 to anchor proteins by fusion of the corresponding genes with PIR1 or PIR2 and the enzymic activities produced by fusion proteins on their surface detected (Abe et al., 2004), opening the possibility to express C. albicans heterologous proteins by fusion of the corresponding genes with CaPIR1.
![]() |
ACKNOWLEDGEMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alani, E., Cao, L. & Kleckner, N. (1987). A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116, 541545.
Backen, A. C., Broadbent, I. D., Fetherston, R. W., Rosamond, J. D. C., Schnell, N. F. & Stark, M. J. R. (2000). Evaluation of the CaMAL2 promoter for regulated expression of genes in Candida albicans. Yeast 16, 11211129.[CrossRef][Medline]
Baquero, C., Montero, M., Sentandreu, R. & Valentín, E. (2001). Molecular cloning of the RPS0 gene from Candida tropicalis. Yeast 18, 971980.[CrossRef][Medline]
Berman, J. & Sudbery, P. E. (2002). Candida albicans: a molecular revolution built on lessons from budding yeast. Nat Rev Genet 12, 918930.[CrossRef]
Bertram, G., Swoboda, R. K., Gooday, G. W., Gow, N. A. & Brown, A. J. (1996). Structure regulation of the Candida albicans ADH1 gene encoding an immunogenic alcohol dehydrogenase. Yeast 12, 115127.[CrossRef][Medline]
Boeke, J. D., LaCroute, F. & Fink, G. R. (1984). A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol Gen Genet 197, 345346.[Medline]
Brenner, C., Bevan, A. & Fuller, R. S. (1994). Biochemical and genetic methods for analyzing specificity and activity of a precursor-processing enzyme: yeast Kex2 protease, kexin. Methods Enzymol 244, 152167.[Medline]
Burnette, W. N. (1981). "Western blotting": electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal Biochem 112, 195203.[Medline]
Calderone, R. A. & Fonzi, W. A. (2001). Virulence factors of Candida albicans. Trends Microbiol 19, 327335.[CrossRef]
Castillo, L., Martínez, A. I., Garcerá, A., Elorza, M. V., Valentín, E. & Sentandreu, R. (2003). Functional analysis of cysteine residues and the repetitive sequences of ScPir4: the first repetitive sequence is needed to binding the cell wall -1,3-glucan. Yeast 20, 973983.[CrossRef][Medline]
Cleves, A. E., Cooper, D. N., Barondes, S. H. & Kelly, R. B. (1996). A new pathway for protein export in Saccharomyces cerevisiae. J Cell Biol 133, 10171026.[Abstract]
Elorza, M. V., Rico, H. & Sentandreu, R. (1983). Calcofluor white alters the assembly of chitin fibrils in Saccharomyces cerevisiae and Candida albicans cells. J Gen Microbiol 129, 15771582.[Medline]
Elorza, M. V., Marcilla, A. & Sentandreu, R. (1988). Wall mannoproteins of the yeast and mycelial cells of Candida albicans: nature of the glycosidic bonds and polydispersity of their mannan moieties. J Gen Microbiol 134, 23932403.[Medline]
Eroles, P., Sentandreu, M., Elorza, M. V. & Sentandreu, R. (1997). The highly immunogenic proteins enolase and Hsp70 are adventitious Candida albicans cell wall proteins that act as virulence factors. Microbiology 143, 313320.[Medline]
Fonzi, W. A. & Irwin, M. Y. (1993). Isogenic strain construction and gene mapping in Candida albicans. Genetics 134, 717728.
Gietz, R. D. & Sugino, A. (1988). New yeastEscherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74, 527534.[CrossRef][Medline]
Gietz, D., St Jean, A., Woods, R. A. & Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res 20, 1425.[Medline]
Gillum, A. M., Tsay, E. Y. & Kirsch, D. R. (1984). Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198, 179182.[Medline]
Goller, S. P., Schoisswohl, D., Baron, M., Parriche, M. & Kubicek, C. P. (1998). Role of endoproteolytic dibasic proprotein processing in maturation of secretory proteins in Trichoderma reesei. Appl Environ Microbiol 64, 32023208.
Hanahan, D. (1985). Techniques for transformation of Escherichia coli. In DNA Cloning: a Practical Approach, p. 109. Edited by D. M. Glover. Oxford: IRL Press.
Hawkes, R. (1982). Identification of concanavalin A-binding proteins after sodium dodecyl sulfate-gel electrophoresis and protein blotting. Anal Biochem 80, 348355.
Ibeas, J. I., Yun, D. J., Damsz, B. & 7 other authors (2001). Resistance to the plant PR-5 protein osmotin in the model fungus Saccharomyces cerevisiae is mediated by the regulatory effects of SSD1 on cell wall composition. Plant J 25, 271280.[CrossRef][Medline]
Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983). Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153, 163168.[Medline]
Ito, T., Chiba, T., Ozawa, R., Yoshida, M., Hattori, M. & Sakaki, Y. (2001). A comprehensive two-hybrid analysis to explore the yeast protein interactome. Proc Natl Acad Sci U S A 98, 45694574.
Jaafar, L., Moukadiri, I. & Zueco, J. (2003). Characterization of a disulphide-bound Pir-cell wall protein (Pir-CWP) of Yarrowia lipolytica. Yeast 20, 417426.[CrossRef][Medline]
Kandasamy, R., Vediyappan, G. & Chaffin, W. L. (2000). Evidence for the presence of Pir-like proteins in Candida albicans. FEMS Microbiol Lett 186, 239243.[CrossRef][Medline]
Kapteyn, J. C., Van Egmond, P., Van Den Ende, H., Makarow, M. & Klis, F. M. (1999a). The contribution of the O-glycosylated protein Pir2p/Hsp150 to the construction of the yeast cell wall in wild-type cells and beta 1,6-glucan-deficient mutants. Mol Microbiol 31, 18351844.[CrossRef][Medline]
Kapteyn, J. C., Van Den Ende, H. & Klis, F. M. (1999b). The contribution of cell wall proteins to the organization of the yeast cell wall. Biochim Biophys Acta 1426, 373383.[Medline]
Kapteyn, J. C., Hoyer, L. L., Hecht, J. E., Muller, W. H., Andel, A., Verjleij, A. J., Makarow, M., Van Den Ende, H. & Klis, F. M. (2000). The cell wall architecture of Candida albicans wild-type cells and cell wall-defective mutants. Mol Microbiol 35, 601611.[CrossRef][Medline]
Kapteyn, J. C., ter Riet, B., Vink, E., Blad, S., De Nobel, H., Van Den Ende, H. & Klis, F. M. (2001). Low external pH induces HOG1-dependent changes in the organization of the Saccharomyces cerevisiae cell wall. Mol Microbiol 39, 469479.[CrossRef][Medline]
Klis, F. M., de Groot, P. & Hellingwerf, K. (2001). Molecular organization of the cell wall of Candida albicans. Med Mycol 39, 18.
Klis, F. M., Mol, P., Hellingwerf, K. & Brul, S. (2002). Dynamics of cell wall structure in Saccharomyces cerevisiae. FEMS Microbiol Rev 3, 239256.[CrossRef]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680685.[Medline]
Langford, C. J. & Gallwitz, D. (1983). Evidence for an intron-contained sequence required for the splicing of yeast RNA polymerase II transcripts. Cell 33, 519527.[CrossRef][Medline]
Marcilla, A., Elorza, M. V., Mormeneo, S., Rico, H. & Sentandreu, R. (1991). Candida albicans mycelial wall structure: supramolecular complexes released by zymolyase, chitinase and -mercaptoethanol. Arch Microbiol 155, 312319.[CrossRef][Medline]
Marcilla, A., Mormeneo, S., Elorza, M. V., Manclus, J. J. & Sentandreu, R. (1993). Wall formation by Candida albicans yeast cells: secretion and incorporation of two types of mannoproteins. J Gen Microbiol 139, 29852993.[Medline]
Millete, C. F. & Scott, B. K. (1984). Identification of spermatogenic cell plasma membrane glycoproteins by two dimensional electrophoresis and lectin blotting. J Cell Sci 65, 233248.[Abstract]
Mizuno, K., Nakamura, T., Ohshima, T., Tanaka, S. & Matsuo, H. (1989). Characterization of KEX2-encoded endopeptidase from yeast Saccharomyces cerevisiae. Biochem Biophys Res Commun 159, 305311.[Medline]
Mormeneo, S., Marcilla, A., Iranzo, M. & Sentandreu, R. (1995). Structural mannoproteins released by -elimination from Candida albicans cell walls. FEMS Microbiol Lett 123, 131136.[CrossRef]
Moukadiri, I., Jaafar, L. & Zueco, J. (1999). Identification of two mannoproteins released from cell walls of a Saccharomyces cerevisiae mnn1 mnn9 double mutant by reducing agents. J Bacteriol 181, 47414745.
Mra, V. & Tanner, W. (1999). Role of NaOH-extractable cell wall proteins Ccw5p, Ccw6p, Ccw7p and Ccw8p (members of the Pir protein family) in stability of the Saccharomyces cerevisiae cell wall. Yeast 15, 813820.[CrossRef][Medline]
Mra, V., Ecker, M., Strahl-Bolsinger, S., Nimtz, M., Lehle, L. & Tanner, W. (1999). Deletion of new covalently linked cell wall glycoproteins alters the electrophoretic mobility of phosphorylated wall components of Saccharomyces cerevisiae. J Bacteriol 181, 30763086.
Pardo, M., Monteoliva, L., Plá, J., Sánchez, M., Gil, C. & Nombela, C. (1999). Two-dimensional analysis of proteins secreted by Saccharomyces cerevisiae regenerating protoplasts: a novel approach to study the cell wall. Yeast 15, 459472.[CrossRef][Medline]
Pardo, M., Ward, M., Bains, S., Molina, M., Blackstock, W., Gil, C. & Nombela, C. (2000). A proteomic approach for the study of Saccharomyces cerevisiae cell wall biogenesis. Electrophoresis 21, 33963410.[CrossRef][Medline]
Ram, A. F., Wolters, A., Ten Hoopen, R. & Klis, F. M. (1994). A new approach for isolating cell wall mutants in Saccharomyces cerevisiae by screening for hypersensitivity to calcofluor white. Yeast 10, 10191030.[Medline]
Reddy, V. A., Johnson, R. S., Biemann, K., Williams, R. S., Ziegler, F. D., Trimble, R. B. & Maley, F. (1988). Characterization of the glycosylation sites in yeast external invertase. I. N-linked oligosaccharide content of the individual sequons. J Biol Chem 263, 69786985.
Sentandreu, R., Elorza, M. V. & Ruiz-Herrera, J. (2001). Structure, synthesis and assembly of fungal cell wall glycoproteins. In Recent Research Developments in Microbiology, pp. 2333. Edited by S. G. Pandalai. Trivandrum, India: Research Signpost.
Spreghini, E., Davis, D. A., Subaran, R., Kim, M. & Mitchell, A. P. (2003). Roles of Candida albicans Dfg5p and Dcw1p cell surface proteins in growth and hypha formation. Eukaryot Cell 2, 746755.
Sundstrom, P. (2002). Adhesion in Candida spp. Cell Microbiol 8, 461469.[CrossRef]
Toh-e, A., Yasunaga, S., Nisogi, H., Tanaka, K., Oguchi, T. & Matsui, Y. (1993). Three yeast genes, PIR1, PIR2 and PIR3, containing internal tandem repeats, are related to each other, and PIR1 and PIR2 are required for tolerance to heat shock. Yeast 9, 481494.[Medline]
Towbin, H., Staehelin, T. & Gordon, J. (1979). Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A 76, 43504354.[Abstract]
Van der Vaart, J. M., Caro, L. H., Chapman, J. W., Klis, F. M. & Verrips, C. T. (1995). Identification of three mannoproteins in the cell wall of Saccharomyces cerevisiae. J Bacteriol 177, 31043110.[Abstract]
Von Heijne, G. (1986). New method for predicting signal sequence cleavage sites. Nucleic Acids Res 11, 46834690.
Wilson, R. B., Davis, D. & Mitchell, A. P. (1999). Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J Bacteriol 181, 18681874.
Yun, D. J., Zhao, Y., Pardo, J. M. & 7 other authors (1997). Stress proteins on the yeast cell surface determine resistance to osmotin, a plant antifungal protein. Proc Natl Acad Sci U S A 94, 70827087.
Received 7 April 2004;
revised 16 June 2004;
accepted 25 June 2004.
HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
J MED MICROBIOL | ALL SGM JOURNALS |