Department of Microbiology and Immunology, Wake Forest University School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1064, USA1
Department of Molecular Genetics, Biochemistry and Microbiology, University of Cincinnati College of Medicine, Cincinnati, OH 45267-0524, USA2
Author for correspondence: Daniel J. Wozniak. Tel: +1 336 716 2016. Fax: +1 336 716 9928. e-mail: dwozniak{at}wfubmc.edu
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Keywords: aerotaxis, oxygen, AlgT, alginate
Abbreviations: CF, cystic fibrosis
a Present address: Division of Science and Mathematics, University of Minnesota-Morris, Morris, MN 56267, USA.
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
All P. aeruginosa strains carry the genes that encode the regulatory and biosynthetic machinery for alginate production, but these genes are normally not activated (Goldberg et al., 1993 ). Unknown conditions in the CF airway select for mutations that lead to the production of alginate. For example, the P. aeruginosa CF isolate FRD1, as well as many other mucoid CF-derived strains, is mucoid due to a mutation in mucA (Devries & Ohman, 1994
; Martin et al., 1993
). The MucA protein normally antagonizes AlgT, an alternative sigma factor essential for alginate gene expression, so mucA mutations result in constitutive alginate production in many CF isolates (Govan, 1975
; Mathee et al., 1997
). Other alterations associated with strains isolated from CF patients include a conversion from smooth to rough lipopolysaccharide structure and loss of motility (Govan & Deretic, 1996
; Luzar et al., 1985
; Mahenthiralingam et al., 1994
; Martin et al., 1993
).
When mucoid P. aeruginosa is grown aerobically in liquid culture with shaking, the alginate phenotype is quite stable. However, previous studies have shown that under certain conditions, such as static growth that results in low oxygen tension, the mucoid phenotype is unstable (Govan et al., 1979 ; Hassett, 1996
; Ohman & Chakrabarty, 1981
). Under these growth conditions, conversion from mucoid to non-mucoid occurs primarily via second-site algT mutations (Devries & Ohman, 1994
).
Our laboratory has shown that AlgT not only positively regulates alginate biosynthesis, but also directly or indirectly negatively regulates flagellum synthesis (Garrett & Wozniak, 1999 ). This led us to hypothesize that the algT mutations that convert mucoid strains to non-mucoid under low oxygen conditions also promote motility. Motility may then allow taxis toward areas of higher oxygen tension (aerotaxis), where maximal ATP production can occur. In support of this, previous studies demonstrated that the mucoid phenotype is stabilized in static growth conditions when the alternative electron acceptor nitrate is added (Hassett, 1996
).
In this paper we explore the possibility that the low oxygen environment created by static growth selects for gain of motility rather than loss of alginate. We first show that non-mucoid isolates emerging from the static growth of P. aeruginosa FRD1 are indeed motile. A complementation experiment verified that the majority of these motile variants are algT mutants. We then used a reporter gene fusion with the flagellin promoter (pfliC) to demonstrate that fliC expression begins during the first few hours of static growth, prior to the appearance of algT mutations. This effect is reversible, as pfliC expression is turned off within hours of returning the cells to shaking conditions. Finally, using isogenic wild-type and algD deletion strains, we show that the ability of the strain to produce alginate has no effect on these results. These data suggest that the first effect of static growth is to induce motility, perhaps as an adaptive measure, in the presence of wild-type algT. Subsequent algT mutations are likely to secure the motile phenotype.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
General recombinant DNA techniques.
Recombinant DNA techniques were done as described by Ausubel et al. (1992) and Maniatis et al. (1982)
. Plasmid DNA was prepared using Qiagen reagents. Restriction endonucleases, Klenow, T4 DNA ligase and shrimp alkaline phosphatase were from Promega and were used according to the manufacturers specifications. Taq polymerase was from Perkin Elmer. DNA was extracted from gels using Qiagen Qiaquick gel extraction reagents.
Plasmid and strain constructions.
FRD1400 (FRD1 attB::fliC-xylE) and WFPA227 (PAO1 attB::fliC-xylE) were constructed using the mini-CTX1 system as described elsewhere (Hoang et al., 1998 ; Wyckoff & Wozniak, 2001
). Briefly, plasmid pTW13, a mini-CTX1-derived vector harbouring pfliC::xylE, was developed. We used PCR with primers fliCrev (5' - GGAGAGCTCGAGGGTGCCCCAAGAATTCGCG - 3') and fliCfwd (5'-GTTCCCAAGCTTCTCGAACGAGGCCGGTGGC-3') to amplify the -260 to +22 region of fliC based on the fliC sequence described by Stover et al. (2000)
. This fragment contains 5' regulatory sequences as well as the fliC promoter (Totten et al., 1990
). The xylE gene was obtained by cleavage of pX1918G (Schweizer & Hoang, 1995
) with XhoI and KpnI. The HindIIIXhoI fliC fragment and the XhoIKpnI fragment harbouring the promoterless xylE and the adjacent aacC1 gene (encoding gentamicin resistance) were cloned into HindIII/KpnI-cleaved mini-CTX. pTW13 was introduced into both PAO1 and FRD1 by a triparental mating of the P. aeruginosa strain, E. coli JM109(pTW13) and E. coli helper strain HB101(pRK2013) (Figurski & Helinski, 1979
). Unwanted plasmid sequences were then removed using Flp recombinase (Hoang et al., 1998
; Wyckoff & Wozniak, 2001
). Appropriate PCR controls using combinations of att, fliC or mini-CTX primers were performed as described previously (Wyckoff & Wozniak, 2001
) to confirm integration of pfliC::xylE at the attB site of the P. aeruginosa chromosome and removal of flanking plasmid sequences.
Plasmid pSW195, which contains an arabinose-inducible algT allele in the vector mini-CTX, was constructed by cloning an EcoRIHindIII fragment containing algT from pWG15 (Garrett & Wozniak, 1999 ) into EcoRI/HindIII-treated pSW161 (Woolwine et al., 2001
), resulting in pSW186. Next, a 1·9 kb KpnIHindIII fragment from pSW186 encompassing araC-PBAD-algT was cloned into KpnI/HindIII-treated mini-CTX1. Plasmid pSW195 was integrated at the neutral attB locus as described above and elsewhere (Hoang et al., 1998
; Wyckoff & Wozniak, 2001
). For complementation studies, non-mucoid variants arising from static growth were examined on LANS containing 2·5% (w/v) arabinose.
Plasmid pDJW487 (algD::
tet) was used for mutagenesis of algD in strain FRD1400 using allelic exchange techniques as described by Ma et al. (1998)
. Plasmid pDJW487 was generated by subcloning a 2·0 kb SmaI fragment containing the
tet cassette from pHP45
-tet (Fellay et al., 1987
) into a
algD allele contained in the gene replacement vector pEX100T (Schweizer & Hoang, 1995
). Plasmid pDJW487 was transformed into the E. coli helper strain SM10 (Hoang et al., 1998
) and then transferred into FRD1400 by a biparental mating of FRD1400 and SM10(pDJW487). The
algD::
tet allele of pDJW487 was used to replace the wild-type algD gene of FRD1400, resulting in strain FRD1402 (FRD1 attB::fliC-xylE
algD::
tet). All allele replacements were confirmed by either PCR or Southern blot analyses.
Static growth experiments.
For an experiment comparing shaking and static growth conditions, an overnight (shaking) culture was diluted 1:100 in LBNS and several 5 ml aliquots were transferred to 18x150 mm culture tubes. These 5 ml cultures were incubated at 37 °C either vertically in test tube racks (static growth) or placed in a roller (shaking growth). At each time point, a single tube from each treatment was removed from the incubator, briefly vortexed and portions were removed for catechol-2,3-dioxygenase assays, Western blotting and/or observation by microscopy. Each time point represents a separate culture tube, i.e. static cultures, once vortexed, were not returned to the incubator at the next time point, samples were taken from an undisturbed tube. The only exception to this was when static cultures were sampled at 4 h and then shaken for an additional 4 h.
Western blotting.
Western blot analysis was performed using whole cells or purified flagella. Whole-cell samples were prepared from P. aeruginosa strains grown in 10 ml LBNS at 37 °C to an OD580 of 0·4 or under the conditions described for the specific experiment. Cultures were centrifuged (5000 g, 10 min) and pellets (whole-cell fraction) were resuspended in 2% of the original culture volume in FB (10 mM Tris/HCl, pH 8·0, 100 mM NaCl, 1 mM MgCl2). A 10 µl sample of this preparation was analysed by Western blotting. Anti-flagellum type B antiserum (Garrett & Wozniak, 1999 ) was used in Western blots at a dilution of 1:10000 with chemiluminescent reagents by procedures outlined by the manufacturer (Amersham) and film was exposed for 30 s prior to development.
Catechol-2,3-dioxygenase assays.
The assay of XylE activity was performed as described previously (Wyckoff & Wozniak, 2001 ). Briefly, an appropriate amount of cell culture (usually 1 ml) was centrifuged and resuspended in 1 ml 50 mM potassium phosphate (pH 7·5) and 10% (v/v) acetone. An aliquot (990 µl) of this sample was combined with 10 µl freshly made 100 mM catechol in water. The A375 was recorded for 2 min. Enzyme activity was calculated using the extinction coefficient of the reaction product 2-hydroxymuconic semialdehyde (
375=4·4x104 M-1) and corrected for the number of cells by dividing by the OD540 of the sample.
Motility assays.
Motility assays were performed by inoculating a single colony into 0·3% (w/v) LANS. Following overnight growth at 37 °C, motility was assessed qualitatively by examining colonies which spread beyond the point of inoculation (Arora et al., 1998 ).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
Using FRD1400 we monitored pfliC activity during 48 h of shaking or static growth. As expected, the mucoid and non-motile phenotypes of FRD1400 were stable for 48 h under shaking conditions. The results for pfliC expression in static conditions were somewhat surprising. While non-mucoid colonies did not appear until the 48 h static culture, pfliC activity was increased much earlier, even while all the cells were mucoid (100% mucoid; pfliC expression=6·6 nmol min-1 per 109 cells). However, we tested numerous mucoid colonies from the 24 h statically grown culture and found no individual mucoid variants with pfliC activity. This suggested that growth under static conditions enhanced fliC expression and motility. As no non-mucoid colonies could be detected in this experiment, fliC expression was occurring even in the presence of active AlgT.
The above result led us to hypothesize that the increase in pfliC activity was due to an adaptive response rather than a mutation in algT. We tested this hypothesis by examining the time course and reversibility of the increase in pfliC activity. We grew two cultures, each of FRD1400, under static and shaking conditions. After 4 h, we assayed the pfliC activity of one culture of each treatment (FRD1400 static, FRD1400 shaking). We then placed the two 4 h static cultures under shaking conditions. After 4 h, we assayed the cultures that had been growing for a total of 8 h under the same treatment, as well as the 4 h static cultures that had then been shaking for 4 h. As expected, the AlgT+ strain FRD1400 had very little pfliC activity under shaking conditions (Fig. 4a). However, when FRD1400 was cultured statically for as little as 4 h, pfliC activity was detected. Most importantly, the pfliC activity observed under static growth conditions was completely reversible when the statically grown cultures were transferred back to shaking conditions (Fig. 4a
).
|
For the experiments described in Fig. 4(a), at each time point that we assayed for pfliC activity, we also examined each culture for flagellum expression via Western blotting. This provides an independent assay for the observed differences in static versus shaken cultures. A representative Western blot from the samples examined in Fig. 4(a)
is depicted in Fig. 4(b)
. The results from the Western blot correlated with the fliC-xylE activity assay results. In addition, we observed a droplet of each culture by microscopy and observed no motility in cultures with low pfliC activity or flagellum expression, but active motility in cultures with high pfliC activity. These results taken together suggest that FRD1400 is able to adapt to static growth within hours by inducing flagellum synthesis, but is able to turn off flagellum synthesis rapidly when it is no longer needed, i.e. during growth with high oxygen tensions (shaken cultures). The short time course and reversibility of this change argues against selection for mutations under these conditions and in favour of an AlgT-independent method of flagellum regulation.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Our laboratory recently reported a link between alginate and flagellum synthesis. AlgT, a positive regulator of alginate biosynthesis, also negatively regulates flagellum synthesis (Garrett & Wozniak, 1999 ). It had previously been suggested that the algT mutations that accumulate in mucoid strains during static growth were selected for by the cells need to reduce their alginate production to better utilize the low levels of oxygen present under this growth condition (Hassett, 1996
). The initial goal of this study was to determine if, rather, the algT mutations were selected for by the cells need to become motile to move to areas of higher oxygen tension where maximal ATP generation could occur.
We first showed that the algT mutations that lead to the non-mucoid phenotype do indeed also allow flagellum synthesis and motility (Fig. 1). At this point we could not distinguish between the possibilities that selection was for loss of alginate or gain of motility either was equally likely. In the process of investigating our hypothesis further, however, we discovered a new regulation of flagellum synthesis.
When the mucoid strain FRD1 is grown statically, algT mutations begin to appear between 24 and 48 h (Hassett, 1996 ; this study). However, flagellum synthesis is evident much earlier (Fig. 4
). Thus, under these conditions, a flagellum is synthesized in the presence of wild-type AlgT, which is normally an inhibitor of the process. It is unlikely that under these conditions flagellum synthesis is bypassing AlgT repression via a mutation since synthesis begins in such a short time span and is reversible (Fig. 4
). Thus, we suggest that flagellum synthesis can be expressed in an AlgT-independent manner to adapt to static growth conditions. Taken together, our results support a model in which non-motile, mucoid P. aeruginosa strains, when grown statically, are able to sense an oxygen gradient and rapidly turn on the synthesis of a flagellum (within minutes to hours of static growth). This would provide this population with the ability to swim towards areas where maximum ATP can be generated. This adaptive mechanism apparently occurs independent of normal AlgT inhibition. During prolonged exposure to low oxygen tension, there is a selection for algT mutations and the population eventually becomes predominated by motile, non-mucoid, algT mutants.
Of notable interest is the observation that the AlgT-independent induction of flagellum synthesis, seen during early static growth periods, does not affect the entire bacterial population. When observed by microscopy, a typical mucoid culture (e.g. strain FRD1) grown under shaking conditions has no motile cells. After 4 or 8 h of static growth, this culture shows significant pfliC activity (Fig. 4), yet only about 3050% of the cells appear motile via microscopy. This may indicate that the AlgT-independent pathway is part of a phase-variable system of flagellum synthesis. In this regard, Deziel et al. (2001)
reported that small (S) colony variants of P. aeruginosa strain 57RP that emerge during biofilm growth or under static growth conditions also have altered motility phenotypes. They concluded that these S variants result from phase variation and are selectively enriched when P. aeruginosa 57RP is grown as a biofilm or in static liquid cultures.
What is the signal that triggers flagellum biosynthesis during static growth? At the moment, the answer is unknown, yet important clues have surfaced during this study. We believe that flagellum biosynthesis in mucoid bacteria is triggered by an ability to sense and move toward an oxygen gradient, often referred to as aerotaxis. When mucoid bacteria are dispersed into static broth, they can sense an oxygen gradient where the highest levels are at the meniscus and the lowest are at the base of the tube. When the gradient is recognized, the bacteria synthesize a flagellum to swim toward the meniscus (highest pO2). This is likely to be why there is often a thick pellicle of organisms at the top of the tube after static growth. Conversely, they remain mucoid and non-motile when the oxygen gradient is dissipated, such as during static growth in the presence of nitrate. Similarly, the mucoid/non-motile phenotype is stable when mucoid bacteria are grown with shaking, since oxygen levels are essentially at equilibrium. Aerotaxis systems have been described in E. coli and P. putida (Nichols & Harwood, 2000 ; Rebbapragada et al., 1997
; Taylor et al., 1999
) and P. aeruginosa has a previously uncharacterized aer gene (PA1561) (Stover et al., 2000
). We are in the process of disrupting this locus to determine if oxygen sensing is linked to aerotaxis and mucoid to non-mucoid conversion in P. aeruginosa. Alternative mechanisms, including energy taxis, chemotaxis or quorum sensing, may be involved in this process.
Finally, how might these results relate to mucoid P. aeruginosa in the CF airway? Although it is believed that the initial insult leading to alginate production and mucoidy is oxidative-stress-mediated mutations (Govan & Deretic, 1996 ; Hassett et al., 1993
; Mathee et al., 1999
), it is unknown why mucoid bacteria prevail and increase in population during the course of CF airway disease. P. aeruginosa can grow via anaerobic respiration if nitrate, nitrite or nitrous oxide is available as a terminal electron acceptor. Anaerobic growth using these compounds in vitro did not allow for mucoid to non-mucoid conversion, unlike the rapid conversion observed during aerobic static growth (Fig. 3
; Hassett, 1996
). Because copious amounts of nitrate and nitrite have been found in sputa of CF patients (Hassett, 1996
), we postulate that strict anaerobiosis is one signal that stabilizes the mucoid phenotype and prevents mucoid to non-mucoid conversion. As mucoid populations increase with progression of CF airway disease (Govan & Deretic, 1996
) and anaerobic pockets are likely to exist in the thick mucus lining the airways (Worlitzsch et al., 2002
), this condition may serve to maintain the mucoid phenotype for the remainder of the disease.
![]() |
ACKNOWLEDGEMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1992). Short Protocols in Molecular Biology. New York: Greene Publishing and Wiley.
Davies, D. G., Chakrabarty, A. M. & Geesey, G. G. (1993). Exopolysaccharide production in biofilms: substratum activation of alginate gene expression by Pseudomonas aeruginosa. Appl Environ Microbiol 59, 1181-1186.[Abstract]
Devries, C. A. & Ohman, D. E. (1994). Mucoid-to-nonmucoid conversion in alginate-producing Pseudomonas aeruginosa often results from spontaneous mutations in algT, encoding a putative alternative sigma factor, and shows evidence for autoregulation. J Bacteriol 176, 6677-6687.[Abstract]
Deziel, E., Comeau, Y. & Villemur, R. (2001). Initiation of biofilm formation by Pseudomonas aeruginosa 57RP correlates with emergence of hyperpiliated and highly adherent phenotypic variants deficient in swimming, swarming, and twitching motilities. J Bacteriol 183, 1195-1204.
Fellay, R., Frey, J. & Krisch, H. (1987). Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of Gram-negative bacteria. Gene 52, 147-154.[Medline]
Figurski, D. & Helinski, D. R. (1979). Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci USA 76, 1648-1652.[Abstract]
Flynn, J. L. & Ohman, D. E. (1988). Cloning of genes from mucoid Pseudomonas aeruginosa which control spontaneous conversion to the alginate production phenotype. J Bacteriol 170, 1452-1460.[Medline]
Garrett, E. & Wozniak, D. J. (1999). Negative control of flagellum synthesis in Pseudomonas aeruginosa is modulated by the alternative sigma factor AlgT (AlgU). J Bacteriol 181, 7401-7404.
Goldberg, J. B., Gorman, W. L., Flynn, J. L. & Ohman, D. E. (1993). A mutation in algN permits trans activation of alginate production by algT in Pseudomonas species. J Bacteriol 175, 1303-1308.[Abstract]
Govan, J. R. W. (1975). Mucoid strains of Pseudomonas aeruginosa: the influence of culture medium on the stability of mucus production. J Med Microbiol 8, 513-522.[Abstract]
Govan, J. R. W. & Deretic, V. (1996). Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev 60, 539-574.[Abstract]
Govan, J. W. R., Fyfe, J. A. M. & McMillan, C. (1979). The instability of mucoid Pseudomonas aeruginosa: fluctuation test and improved stability of the mucoid form with shaken culture. J Gen Microbiol 110, 229-232.[Medline]
Hassett, D. (1996). Anaerobic production of alginate by Pseudomonas aeruginosa: alginate restricts diffusion of oxygen. J Bacteriol 178, 7322-7325.[Abstract]
Hassett, D. J., Woodruff, W., Wozniak, D. J., Vasil, M. L., Cohen, M. S. & Ohman, D. E. (1993). Cloning and characterization of the Pseudomonas aeruginosa sodA and sodB genes encoding iron- and manganese-cofactored superoxide dismutase: Demonstration of increased manganese superoxide dismutase activity in alginate-producing bacteria. J Bacteriol 175, 7658-7665.[Abstract]
Hoang, T. T., Karkhoff-Schweizer, R. R., Kutchma, A. J. & Schweizer, H. (1998). A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: applications for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212, 77-86.[Medline]
Luzar, M. A., Thomassen, M. J. & Montie, T. C. (1985). Flagella and motility alterations in Pseudomonas aeruginosa strains from patients with cystic fibrosis: relationship to patient clinical conditions. Infect Immun 50, 577-582.[Medline]
Ma, S., Selvaraj, U., Ohman, D. E., Quarless, R., Hassett, D. J. & Wozniak, D. J. (1998). Phosphorylation-independent activity of the response regulators AlgB and AlgR in promoting alginate biosynthesis in mucoid Pseudomonas aeruginosa. J Bacteriol 180, 956-968.
Mahenthiralingam, E., Campbell, M. E. & Speert, D. P. (1994). Nonmotility and phagocytic resistance of Pseudomonas aeruginosa isolates from chronically colonized patients with cystic fibrosis. Infect Immun 62, 596-605.[Abstract]
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Martin, D. W., Schurr, M. J., Mudd, M. H., Govan, J. R. W., Holloway, B. W. & Deretic, V. (1993). Mechanism of conversion to mucoidy in Pseudomonas aeruginosa infecting cystic fibrosis patients. Proc Natl Acad Sci USA 90, 8377-8381.
Mathee, K., McPherson, C. J. & Ohman, D. E. (1997). Posttranslational control of the algT (algU)-encoded 22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN). J Bacteriol 179, 3711-3720.[Abstract]
Mathee, K., Ciofu, O., Sternberg, C. & 9 other authors (1999). Mucoid conversion of Pseudomonas aeruginosa by hydrogen peroxide: a mechanism for virulence activation in the cystic fibrosis lung. Microbiology 145, 13491357.[Abstract]
Nichols, N. N. & Harwood, C. S. (2000). An aerotaxis transducer gene from Pseudomonas putida. FEMS Microbiol Lett 182, 177-183.[Medline]
Ohman, D. E. & Chakrabarty, A. M. (1981). Genetic mapping of chromosomal determinants for the production of the exopolysaccharide alginate in a Pseudomonas aeruginosa cystic fibrosis isolate. Infect Immun 33, 142-148.[Medline]
OToole, G. A. & Kolter, R. (1998). Flagellar and twitching motility are necessary for Pseudomonas aeruginosa biofilm development. Mol Microbiol 30, 295-304.[Medline]
Rebbapragada, A., Johnson, M. S., Harding, G. P., Zuccarelli, A. J., Fletcher, H. M., Zhulin, I. B. & Taylor, B. L. (1997). The Aer protein and the serine chemoreceptor Tsr independently sense intracellular energy levels and transduce oxygen, redox, and energy signals for Escherichia coli behavior. Proc Natl Acad Sci USA 94, 10541-10546.
Schweizer, H. P. & Hoang, T. T. (1995). An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene 158, 15-22.[Medline]
Stover, C. K., Pham, X. Q., Erwin, A. L. & 28 other authors (2000). Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406, 959964.[Medline]
Taylor, B. L., Zhulin, I. B. & Johnson, M. S. (1999). Aerotaxis and other energy-sensing behavior in bacteria. Annu Rev Microbiology 53, 103-128.[Medline]
Totten, P. A., Lara, J. C. & Lory, S. (1990). The rpoN gene product of Pseudomonas aeruginosa is required for expression of diverse genes, including the flagellin gene. J Bacteriol 172, 389-396.[Medline]
Woolwine, S. & Wozniak, D. J. (1999). Identification of an Escherichia coli pepA homolog and its involvement in suppression of the algB phenotype in mucoid Pseudomonas aeruginosa. J Bacteriol 181, 107-116.
Woolwine, S., Sprinkle, A. B. & Wozniak, D. J. (2001). Loss of Pseudomonas aeruginosa PhpA aminopeptidase activity results in increased algD transcription. J Bacteriol 183, 4674-4679.
Worlitzsch, D., Tarran, R., Ulrich, M. & 12 other authors. (2002). Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients. J Clin Invest 109, 317325.
Wozniak, D. J. & Ohman, D. E. (1994). Transcriptional analysis of the Pseudomonas aeruginosa genes algR, algB and algD reveals a hierarchy of alginate gene expression which is modulated by algT. J Bacteriol 176, 6007-6014.[Abstract]
Wyckoff, T. J. O. & Wozniak, D. J. (2001). Transcriptional analysis of genes involved in Pseudomonas aeruginosa biofilms. Methods Enzymol 336, 144-151.[Medline]
Received 29 April 2002;
revised 29 July 2002;
accepted 2 August 2002.