Unité de Microbiologie et Génétique, UMR5122 CNRS-INSA-UCBL, Université Claude Bernard Lyon1, bât A. Lwoff, 10, rue Dubois, 69622 Villeurbanne cedex, France
Correspondence
Jean Claude Lazzaroni
lazzaroni{at}biomserv.univ-lyon1.fr
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Regulation of curli synthesis is carried out through a complex network of interactions between the transcription factors and the csg regulatory region. Nine regulators have been identified that allow for finely tuned regulation based on environmental conditions such as osmolarity, temperature and starvation. The ability to adapt rapidly to changing environmental conditions is crucial for the growth and pathogenicity of bacteria in their natural environments. In E. coli K-12, this complex regulatory network controls initial adhesion and biofilm formation via regulation of the csgD gene (Prigent-Combaret et al., 2001). It involves H-NS (Arnqvist et al., 1992
; Olsen et al., 1993
), IHF (Gerstel et al., 2003
), Crl (Arnqvist et al., 1994
; Bougdour et al., 2004
; Hammar et al., 1995
) and MlrA (Brown et al., 2001
). The OmpR/EnvZ (Prigent-Combaret et al., 2001
; Romling et al., 1998
) and CpxR/A (Dorel et al., 1999
; Otto & Silhavy, 2002
; Prigent-Combaret et al., 2001
) phosphorelays also control curli expression. Using microarray analysis, the RcsC sensor kinase of the RcsB/CD phosphorelay has recently also been found to control csgD expression (Ferrieres & Clarke, 2003
). The RcsB/CD His-Asp phosphorelay was initially identified as a positive regulator of the capsular exopolysaccharide biosynthesis gene cluster (wzawca) in E. coli in association with RcsA (Gottesman & Stout, 1991
; Stout, 1994
). The response regulator RcsB is activated upon the transfer of a phosphate group from its cognate sensor, RcsC, via a histidine-containing phosphotransmitter domain protein, RcsD. RcsF, a putative outer-membrane lipoprotein, is also involved in this regulatory network (Hagiwara et al., 2003
). In addition to the wzawca gene cluster, targets regulated by the Rcs system with its cofactor RcsA include the motility master operon fhlDC (Francez-Charlot et al., 2003
), rcsA and, in Salmonella, the gene ugd, which is required for the incorporation of 4-aminoarabinose into the lipopolysaccharide (Mouslim & Groisman, 2003
). The cell division fts genes (Carballes et al., 1999
), the osmoregulated osmC gene (Davalos-Garcia et al., 2001
) and rprA, encoding a small RNA which stimulates the translation of the general stress-response sigma factor RpoS (Majdalani et al., 2002
), are also controlled by RcsB, but independently of RcsA. Although RcsB acts preferentially as an activator, it negatively controls flhDC expression (Francez-Charlot et al., 2003
). rcsA is repressed by the global regulator H-NS, and dsrA, a gene located upstream of rcsA, encodes a small RNA that controls H-NS synthesis by interfering with the hns mRNA (Sledjeski & Gottesman, 1995
). RcsA is also degraded by Lon (Stout et al., 1991
) and ClpYQ (Kuo et al., 2004
) proteases. The specific signal triggering the activation of the Rcs system remains unknown. However, many reports suggest that the Rcs system might sense alterations of the cell envelope. The Rcs system has been reported to be activated by environmental signals, such as desiccation, osmotic shock and Zn2+ concentration (Hagiwara et al., 2003
; Ophir & Gutnick, 1994
; Sledjeski & Gottesman, 1996
), in the presence of mutations affecting cell envelope components, such as tol (Clavel et al., 1996
; Mouslim & Groisman, 2003
), rfa (Parker et al., 1992
), mdoH (Ebel et al., 1997
), dsbA and dsbB (El-Kazzaz et al., 2004
), or after overproduction of envelope proteins, such as TolB/Pal (Majdalani et al., 2002
), RcsF (Gervais & Drapeau, 1992
), DjlA (Toutain et al., 2003
), LolA and OmpG (Chen et al., 2001
).
The tolpal genes play a fundamental role in maintaining outer-membrane integrity. Mutations in any of the tolpal genes result in hypersensitivity to deleterious agents, release of periplasmic content, formation of outer-membrane vesicles at the cell surface and induction of capsule synthesis, which results in a mucoid phenotype (Lazzaroni et al., 1999). A survey of gene expression in Pseudomonas aeruginosa biofilms using DNA microarrays has identified tolA as a gene activated in biofilms (Whiteley et al., 2001
). In addition, the expression of both tolQRA and csgDEFG is modulated by RcsC (Clavel et al., 1996
; Ferrieres & Clarke, 2003
), suggesting a potential link between TolPal, Rcs and curli expression. This led us to investigate the potential roles of the tol genes in biofilm formation in laboratory and clinical isolates of E. coli, and of the Rcs system in the regulation of curli synthesis.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Enzyme assays.
-Glucuronidase and
-galactosidase activities were assayed as described previously (Prigent-Combaret et al., 2001
). M63/2 medium supplemented with 0·2 % glucose was inoculated with 7x107 bacteria ml1 and grown at 30 °C. Samples were recovered at intervals during the culture and used to assay enzyme activity (A).
Visualization and quantification of biofilm formation.
Cells were grown at 30 °C in 24-well polystyrene plates (Nunc) containing 2 ml M63/2 medium. Biofilm formation was visualized after 24 h of culture as follows: planktonic cells were discarded, and the biofilm that had developed on the bottom of the plate was washed twice with M63. For each well, the two washes were pooled with the initial supernatant and referred to as the swimming cells. The biofilm was recovered in 1 ml M63 by scraping and pipetting up and down. The number of surface-attached and swimming bacteria was estimated from the OD600 to give the percentage adherence for each bacterial strain. A minimum of three independent assays was performed and the mean calculated.
Construction of ompRlac and cpxRlac fusions.
cpxR and ompR operon fusions to lac were constructed by PCR amplification of a 715 bp fragment containing a 370 bp fragment upstream of the cpxR start codon, and of a 659 bp fragment containing a 305 bp fragment upstream of the ompR start codon. The following primers were used: WB1, 5'ATTAACAGGAGGGAATTCGTGCCGGGCCTG; WB2, 5'GCGCAGGATCCCGCGAATACGTG; WB3, 5'CACGCCAGAGAGAATTCAGCTCTTGTTTG; WB4, 5'CCGCACGGATCCGGGCCAGCA. The PCR products were then restricted with EcoRI and BamHI, recognition sites of which had been introduced into the primers (underlined), and ligated into the EcoRI/BamHI sites of pRS551 (Simons et al., 1987). The corresponding plasmids were linearized and used to transform the strain TE2680 (Elliott, 1992
). This generated the insertion of a single-copy fusion in the trp region of the chromosome, creating a merodiploid. The fusion was then transferred to AV11814 by P1 transduction.
Electron microscopy.
Bacteria were grown at 30 °C on M63/2 plates. Bacteria were suspended in 0·2 M cacodylate and allowed to adhere to a carbon-coated copper grid for 5 min. Negative staining was carried out for 30 s with 0·7 % ammonium molybdate.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
The tolpal mutations affect the expression of the two csg operons independently of CpxR
To check at what level the tol mutation influenced curli formation, we introduced the mutation into MG1655 carrying csgDuidA or csgAuidA transcriptional fusions. The expression of a csgDuidA fusion was slightly increased (exponential phase) or increased threefold (stationary phase) (Fig. 3a
). Under the same conditions, the synthesis of
-glucuronidase was lowered by a factor of 2 (stationary phase) to 4 (exponential phase) in
tol strains carrying a csgAuidA fusion (Fig. 3b
). Despite the upshift observed in csgDuidA expression, the consequence was a decrease in curlin expression, leading to a lower adhesion capacity of the
tol mutant. Therefore, it appears that the tol mutation results in the uncoupling of the two csg operon transcriptions. For the subsequent studies,
-glucuronidase activities were assayed in exponential (csgA : : uidAkan) or stationary (csgD : : uidAkan) phases of growth, where the differences in enzyme activities between wild-type and tol mutants were optimal.
|
RcsB/CD and RcsA control the expression of the two csg operons
The expression of both tolQRA and csgDEFG is modulated by RcsC (Clavel et al., 1996; Ferrieres & Clarke, 2003
). It has been suggested that the Rcs system is able to sense cell envelope alterations (Clavel et al., 1996
). The expression of the two csg operons was tested in MG1655 using different rcs backgrounds. We used an rcsB11 : : Tn10 mutation, in which RcsB is not functional, an rcsC338 mutation postulated to confer an enhanced activation of RcsB (Clavel et al., 1996
), and a
lon-510 mutation, leading to the presence of higher concentrations of RcsA, which is normally degraded by the Lon protease (Stout et al., 1991
). Plasmid pHRcsA was also used to increase RcsA synthesis after induction by IPTG (see Methods). Under our experimental conditions, RcsB and RcsA were moderate repressors of the csgDEFG operon (Fig. 4a
) but strong repressors of the csgBA operon (Fig. 4b
). Thus, we confirmed earlier results obtained with macroarrays that show that RcsB represses the csgDEFG operon (Ferrieres & Clarke, 2003
), and demonstrated that RcsA is involved in this mechanism. We also demonstrated for the first time that RcsB and RcsA are strong repressors of the csgBA operon.
|
In the tolrcsB : : Tn10 background, we observed a cumulative effect of
tol and rcsB : : Tn10 mutations on the expression of the csgDEFG operon (Fig. 5
). In addition, the activator effect of the
tol mutation was more important than the repressor activity of RcsB (Fig. 5
). These data demonstrate that the activator effect of a
tol mutation on csgDEFG was independent of the Rcs system.
|
Stimulation of RcsB is responsible for csgBA repression in the tol mutant
Expression of the csgAuidA fusion was measured in a tol rcsB : : Tn10 double mutant. The repressor effect of the
tol mutation on the expression of the csgBA operon (A=378±111, compared to 1511±299 for the wild-type) was abolished in the
tol rcsB : : Tn10 double mutant (A=9238±2500), showing that the decrease in CsgA expression in the
tol mutant could be explained by an increase in the repressor activity of RcsB. Hence, the Rcs system was activated in the
tol mutants, leading to a strong repression of csgBA, the result being a decrease in curli synthesis. This repressor effect on csgBA synthesis was dominant following activation by CsgD. csgA was expressed to a greater extent in the
tol rcsB : : Tn10 double mutant (A=9238±2500) than in the rcsB : : Tn10 mutant (A=5685±1000). This could be explained by the increase in csgD expression under such conditions (Fig. 5
).
Activation of the Rcs system in the tol mutants is responsible for their mucoid phenotype, lack of motility and poor adherence
The Rcs system is stimulated in the tol mutants (Clavel et al., 1996), and this results in a mucoid phenotype due to an RcsB-dependent activation of exopolysacccharide gene expression. We show, in this paper, that the activation of the Rcs system leads to a decreased expression of csgA. The possibility that the Rcs system plays a role in the decrease in adherence of the
tol mutant was investigated. As expected, the adherence of a rcsB : : Tn10 derivative (67·8±3·9 %) was higher than that of the wild-type strain (39·8±6·3 %). Under such conditions, the percentage adherence of the
tol derivative was 20·4±5·6 %. The adherence of the
tol rcsB : : Tn10 double mutant was similar to that of the rcsB : : Tn10 derivative (75·2±11·0 %), indicating that stimulation of the Rcs system in the tol mutants was responsible for their lowered adherence.
The impact of the stimulation of the Rcs system on the motility of the tol strains was also determined. RcsB is a repressor of the master operon flhDC involved in the control of flagella expression (Francez-Charlot et al., 2003
). Consistent with this finding,
tol mutants are impaired in their cell motility (12±1 mm, compared to 64±5 mm for the wild-type strain). Under such conditions, the rcsB : : Tn10 derivative was slightly more motile than the wild-type strain (80±3 mm), and the
tol rcsB : : Tn10 double mutant recovered a motility comparable to that of the wild-type (47±7 mm), taking into account its reduced growth rate. Therefore, the pleiotropic phenotype of the tol mutants results partially from the activation of the Rcs system, leading to increased capsule synthesis and decreased motility and adherence. However, other tol phenotypes, such as defects in outer-membrane integrity and the entry of biomolecules (group A colicins and filamentous phage DNA), were still present in the
tol rcsB : : Tn10 double mutant (data not shown).
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The expression of the CpxR repressor was slightly enhanced in the tol mutant. In addition, our results suggest a decrease in the phosphorylated form of CpxR in the tol background. These results might explain the changes in csgA and csgD expression. However, analysis of the
tol
cpxR mutant showed that the effects of the tol mutation are dominant over
cpxR as regards csg expression (Fig. 3
). Thus, the effect of a tol mutation on the expression of the csg genes was unlikely to involve CpxR.
Our data suggest that OmpR orchestrates activation of curli at csgD, but the multiple repressions at csgBA offer numerous possibilities of regulation. In tol mutants, the main control occurs via RcsB/A repression of the csgBA operon. The activator effect of OmpR is absolutely necessary for csgD expression (Prigent-Combaret et al., 2001). Expression of an ompRlacZ fusion was slightly increased in a
tol mutant, but two-dimensional electrophoretic analysis of the OmpR profile did not reveal any significant modification, since our OmpR antibody detected only one spot for OmpR (data not shown). This could be due to a low content of the phosphorylated form of OmpR (Cai & Inouye, 2002
). A transcriptional fusion to csgD was inactive in both
tol ompR : : Tn10 and ompR : : Tn10 backgrounds, while the effects of
tol and ompR334, an allele that increases the activation of csgD by OmpR, were cumulative in the stationary phase. The increase in ompR expression in tol mutants is consistent with previous results that show that the porin content is modified in tolpal mutants (Bernadac et al., 1998
; Lazzaroni et al., 1986
), and this could explain the increase in csgD expression.
Under our experimental conditions, the RcsB and RcsA proteins repressed the activity of the two csg operons. This is in agreement with previous findings on the control of csgD by RcsC (Ferrieres & Clarke, 2003). The Rcs system has also been shown to be stimulated in tol mutants, as seen by the rcsB-dependent activation of capsule synthesis in such mutants (Clavel et al., 1996
). Here again, we were unable to detect a difference in the RcsB pattern of a
tol mutant after two-dimensional electrophoresis (data not shown). In addition, we showed that the most dramatic effect of the Rcs phosphorelay is on csgAB and that it also involves RcsA (Fig. 4
). It remains to be seen whether these two regulators are able to bind the csg promoters. Although RcsB and RcsA are mainly known as activator proteins, they are repressors of the flhCD operon that is involved in flagella synthesis (Francez-Charlot et al., 2003
; Wehland & Bernhard, 2000
). The csg operons would be another example of negative control by these proteins, thus confirming their ambivalent character. The RcsAB box (Francez-Charlot et al., 2003
; Wehland & Bernhard, 2000
) does not appear to be well conserved in several genes regulated by RcsAB (Hagiwara et al., 2003
). The minimum consensus is GA(N)5C, a sequence frequently found in the E. coli genome, which does not facilitate the search for a potential Rcs box in promoter sequences. The repressor effects of tol mutations on csgBA occurred via RcsB, since they were abolished in the tolrcsB background.
We have previously shown that the tolpal mutations affect the expression of the cps genes involved in colanic acid capsular polysaccharide synthesis (Clavel et al., 1996), and we demonstrate in this study that they also affect flagella synthesis as the result of an activation of RcsB/A repressor activity. This is also in agreement with our finding that, in the tolpal mutants, an increase in the repressor activity of RcsB/A leads to a reduction in curlin production. Our results are summarized in the model presented in Fig. 6
. We propose that cell envelope alterations, like those observed in the tolpal and rfa mutants (data not shown), lead to an increase in csgDEFG and a decrease in csgAB expression. Under such conditions, the activation of csgDEFG probably occurs via OmpR, which is dominant upon repression by RcsAB, while RcsB and RcsA could repress csgAB through a dominant negative effect on CsgD. The consequence is a reduced amount of curli at the surface of the tolpal mutants.
|
![]() |
ACKNOWLEDGEMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Arnqvist, A., Olsen, A., Pfeifer, J., Russell, D. G. & Normark, S. (1992). The Crl protein activates cryptic genes for curli formation and fibronectin binding in Escherichia coli HB101. Mol Microbiol 6, 24432452.[Medline]
Arnqvist, A., Olsen, A. & Normark, S. (1994). Sigma S-dependent growth-phase induction of the csgBA promoter in Escherichia coli can be achieved in vivo by sigma 70 in the absence of the nucleoid-associated protein H-NS. Mol Microbiol 13, 10211032.[Medline]
Bernadac, A., Gavioli, M., Lazzaroni, J. C., Raina, S. & Lloubes, R. (1998). Escherichia coli tol-pal mutants form outer membrane vesicles. J Bacteriol 180, 48724878.
Bian, Z. & Normark, S. (1997). Nucleator function of CsgB for the assembly of adhesive surface organelles in Escherichia coli. EMBO J 16, 58275836.
Bougdour, A., Lelong, C. & Geiselmann, J. (2004). Crl, a low temperature induced protein in Escherichia coli that binds directly to the stationary phase sigma subunit of RNA polymerase. J Biol Chem 279, 1954019550.
Brill, J. A., Quinlan-Walshe, C. & Gottesman, S. (1988). Fine-structure mapping and identification of two regulators of capsule synthesis in Escherichia coli K-12. J Bacteriol 170, 25992611.[Medline]
Brown, P. K., Dozois, C. M., Nickerson, C. A., Zuppardo, A., Terlonge, J. & Curtiss, R., 3rd (2001). MlrA, a novel regulator of curli (AgF) and extracellular matrix synthesis by Escherichia coli and Salmonella enterica serovar Typhimurium. Mol Microbiol 41, 349363.[CrossRef][Medline]
Cai, S. J. & Inouye, M. (2002). EnvZ-OmpR interaction and osmoregulation in Escherichia coli. J Biol Chem 277, 2415524161.
Carballes, F., Bertrand, C., Bouche, J. P. & Cam, K. (1999). Regulation of Escherichia coli cell division genes ftsA and ftsZ by the two-component system rcsC-rcsB. Mol Microbiol 34, 442450.[CrossRef][Medline]
Chapman, M. R., Robinson, L. S., Pinkner, J. S., Roth, R., Heuser, J., Hammar, M., Normark, S. & Hultgren, S. J. (2002). Role of Escherichia coli curli operons in directing amyloid fiber formation. Science 295, 851855.
Chen, M. H., Takeda, S., Yamada, H., Ishii, Y., Yamashino, T. & Mizuno, T. (2001). Characterization of the RcsCYojN
RcsB phosphorelay signaling pathway involved in capsular synthesis in Escherichia coli. Biosci Biotechnol Biochem 65, 23642367.[CrossRef][Medline]
Clavel, T., Lazzaroni, J. C., Vianney, A. & Portalier, R. (1996). Expression of the tolQRA genes of Escherichia coli K-12 is controlled by the RcsC sensor protein involved in capsule synthesis. Mol Microbiol 19, 1925.[CrossRef][Medline]
Collinson, S. K., Emody, L., Muller, K. H., Trust, T. J. & Kay, W. W. (1991). Purification and characterization of thin, aggregative fimbriae from Salmonella enteritidis. J Bacteriol 173, 47734781.[Medline]
Davalos-Garcia, M., Conter, A., Toesca, I., Gutierrez, C. & Cam, K. (2001). Regulation of osmC gene expression by the two-component system rcsB-rcsC in Escherichia coli. J Bacteriol 183, 58705876.
Dorel, C., Vidal, O., Prigent-Combaret, C., Vallet, I. & Lejeune, P. (1999). Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol Lett 178, 169175.[CrossRef][Medline]
Ebel, W., Vaughn, G. J., Peters, H. K., 3rd & Trempy, J. E. (1997). Inactivation of mdoH leads to increased expression of colanic acid capsular polysaccharide in Escherichia coli. J Bacteriol 179, 68586861.
El-Kazzaz, W., Morita, T., Tagami, H., Inada, T. & Aiba, H. (2004). Metabolic block at early stages of the glycolytic pathway activates the Rcs phosphorelay system via increased synthesis of dTDP-glucose in Escherichia coli. Mol Microbiol 51, 11171128.[CrossRef][Medline]
Elliott, T. (1992). A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon. J Bacteriol 174, 245253.[Abstract]
Evans, D. G., Evans, D. J., Jr & Tjoa, W. (1977). Hemagglutination of human group A erythrocytes by enterotoxigenic Escherichia coli isolated from adults with diarrhea: correlation with colonization factor. Infect Immun 18, 330337.[Medline]
Ferrieres, L. & Clarke, D. J. (2003). The RcsC sensor kinase is required for normal biofilm formation in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid surface. Mol Microbiol 50, 16651682.[CrossRef][Medline]
Francez-Charlot, A., Laugel, B., Van Gemert, A., Dubarry, N., Wiorowski, F., Castanie-Cornet, M. P., Gutierrez, C. & Cam, K. (2003). RcsCDB His-Asp phosphorelay system negatively regulates the flhDC operon in Escherichia coli. Mol Microbiol 49, 823832.[CrossRef][Medline]
Germon, P., Clavel, T., Vianney, A., Portalier, R. & Lazzaroni, J. C. (1998). Mutational analysis of the Escherichia coli K-12 TolA N-terminal region and characterization of its TolQ-interacting domain by genetic suppression. J Bacteriol 180, 64336439.
Gerstel, U., Park, C. & Romling, U. (2003). Complex regulation of csgD promoter activity by global regulatory proteins. Mol Microbiol 49, 639654.[CrossRef][Medline]
Gervais, F. G. & Drapeau, G. R. (1992). Identification, cloning, and characterization of rcsF, a new regulator gene for exopolysaccharide synthesis that suppresses the division mutation ftsZ84 in Escherichia coli K-12. J Bacteriol 174, 80168022.[Abstract]
Gottesman, S. & Stout, V. (1991). Regulation of capsular polysaccharide synthesis in Escherichia coli K12. Mol Microbiol 5, 15991606.[Medline]
Hagiwara, D., Sugiura, M., Oshima, T., Mori, H., Aiba, H., Yamashino, T. & Mizuno, T. (2003). Genome-wide analyses revealing a signaling network of the RcsC-YojN-RcsB phosphorelay system in Escherichia coli. J Bacteriol 185, 57355746.
Hammar, M., Arnqvist, A., Bian, Z., Olsen, A. & Normark, S. (1995). Expression of two csg operons is required for production of fibronectin- and congo red-binding curli polymers in Escherichia coli K-12. Mol Microbiol 18, 661670.[CrossRef][Medline]
Hedblom, M. L. & Adler, J. (1980). Genetic and biochemical properties of Escherichia coli mutants with defects in serine chemotaxis. J Bacteriol 144, 10481060.[Medline]
Kuo, M. S., Chen, K. P. & Wu, W. F. (2004). Regulation of RcsA by the ClpYQ (HslUV) protease in Escherichia coli. Microbiology 150, 437446.[CrossRef][Medline]
Lazzaroni, J. C., Fognini-Lefebvre, N. & Portalier, R. (1986). Effects of lkyB mutations on the expression of ompF, ompC and lamB porin structural genes in E. coli K-12. FEMS Microbiol Lett 33, 235239.[CrossRef]
Lazzaroni, J. C., Germon, P., Ray, M. C. & Vianney, A. (1999). The Tol proteins of Escherichia coli and their involvement in the uptake of biomolecules and outer membrane stability. FEMS Microbiol Lett 177, 191197.[CrossRef][Medline]
Lejeune, P. (2003). Contamination of abiotic surfaces: what a colonizing bacterium sees and how to blur it. Trends Microbiol 11, 179184.[CrossRef][Medline]
Loferer, H., Hammar, M. & Normark, S. (1997). Availability of the fibre subunit CsgA and the nucleator protein CsgB during assembly of fibronectin-binding curli is limited by the intracellular concentration of the novel lipoprotein CsgG. Mol Microbiol 26, 1123.[CrossRef][Medline]
Majdalani, N., Hernandez, D. & Gottesman, S. (2002). Regulation and mode of action of the second small RNA activator of RpoS translation, RprA. Mol Microbiol 46, 813826.[CrossRef][Medline]
Miller, J. H. (1992). A Short Course in Bacterial Genetics: a Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Mouslim, C. & Groisman, E. A. (2003). Control of the Salmonella ugd gene by three two-component regulatory systems. Mol Microbiol 47, 335344.[CrossRef][Medline]
Olsen, A., Arnqvist, A., Hammar, M., Sukupolvi, S. & Normark, S. (1993). The RpoS sigma factor relieves H-NS-mediated transcriptional repression of csgA, the subunit gene of fibronectin-binding curli in Escherichia coli. Mol Microbiol 7, 523536.[Medline]
Ophir, T. & Gutnick, D. L. (1994). A role for exopolysaccharides in the protection of microorganisms from dessication. Appl Environ Microbiol 60, 740745.[Abstract]
Otto, K. & Silhavy, T. J. (2002). Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc Natl Acad Sci U S A 99, 22872292.
Parker, C. T., Kloser, A. W., Schnaitman, C. A., Stein, M. A., Gottesman, S. & Gibson, B. W. (1992). Role of the rfaG and rfaP genes in determining the lipopolysaccharide core structure and cell surface properties of Escherichia coli K-12. J Bacteriol 174, 25252538.[Abstract]
Prigent-Combaret, C., Prensier, G., Le Thi, T. T., Vidal, O., Lejeune, P. & Dorel, C. (2000). Developmental pathway for biofilm formation in curli-producing Escherichia coli strains: role of flagella, curli and colanic acid. Environ Microbiol 2, 450464.[CrossRef][Medline]
Prigent-Combaret, C., Brombacher, E., Vidal, O., Ambert, A., Lejeune, P., Landini, P. & Dorel, C. (2001). Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene. J Bacteriol 183, 72137223.
Romling, U., Bian, Z., Hammar, M., Sierralta, W. D. & Normark, S. (1998). Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J Bacteriol 180, 722731.
Simons, R. W., Houman, F. & Kleckner, N. (1987). Improved single and multicopy lac-based cloning vectors for protein and operon fusions. Gene 53, 8596.[CrossRef][Medline]
Sledjeski, D. & Gottesman, S. (1995). A small RNA acts as an antisilencer of the H-NS-silenced rcsA gene of Escherichia coli. Proc Natl Acad Sci U S A 92, 20032007.
Sledjeski, D. D. & Gottesman, S. (1996). Osmotic shock induction of capsule synthesis in Escherichia coli K-12. J Bacteriol 178, 12041206.
Stout, V. (1994). Regulation of capsule synthesis includes interactions of the RcsC/RcsB regulatory pair. Res Microbiol 145, 389392.[CrossRef][Medline]
Stout, V., Torres-Cabassa, A., Maurizi, M. R., Gutnick, D. & Gottesman, S. (1991). RcsA, an unstable positive regulator of capsular polysaccharide synthesis. J Bacteriol 173, 17381747.[Medline]
Toutain, C. M., Clarke, D. J., Leeds, J. A., Kuhn, J., Beckwith, J., Holland, I. B. & Jacq, A. (2003). The transmembrane domain of the DnaJ-like protein DjlA is a dimerisation domain. Mol Genet Genomics 268, 761770.[Medline]
Vidal, O., Longin, R., Prigent-Combaret, C., Dorel, C., Hooreman, M. & Lejeune, P. (1998). Isolation of an Escherichia coli K-12 mutant strain able to form biofilms on inert surfaces: involvement of a new ompR allele that increases curli expression. J Bacteriol 180, 24422449.
Wehland, M. & Bernhard, F. (2000). The RcsAB box. Characterization of a new operator essential for the regulation of exopolysaccharide biosynthesis in enteric bacteria. J Biol Chem 275, 70137020.
Whiteley, M., Bangera, M. G., Bumgarner, R. E., Parsek, M. R., Teitzel, G. M., Lory, S. & Greenberg, E. P. (2001). Gene expression in Pseudomonas aeruginosa biofilms. Nature 413, 860864.[CrossRef][Medline]
Received 25 January 2005;
revised 30 March 2005;
accepted 7 April 2005.
HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
J MED MICROBIOL | ALL SGM JOURNALS |