Department of Biology, University of California at San Diego, La Jolla, CA 92093-0116, USA1
Lehrstuhl für Mikrobiologie, Institut für Mikrobiologie, Biochemie und Genetik der Friedrich-Alexander-Universität Erlangen-Nürnberg, Staudtstr. 5, D-91058 Erlangen, Germany2
Unité de Biochimie Microbienne, D épartement des Biotechnologies, Institut Pasteur, 25 rue du Dr Roux, F-75724 Paris Cedex 15, France 3
Author for correspondence: Jörg Stülke. Tel: +49 9131 8528818. Fax: +49 9131 8528082. e-mail: jstuelke{at}biologie.uni-erlangen.de
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Keywords: sugar transport, PTS, phosphorylation, gene regulation, Bacillus subtilis
Abbreviations: EI and EII, Enzymes I and II; HPr, histidine-containing phosphoprotein; PTS, phosphotransferase system; PRD, PTS regulation domain
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
In addition to its function in sugar transport, the PTS is one of the major signal transduction systems of the bacterial cell, as suggested by the multitude of regulatory functions exerted by PTS components. In both Gram-positive and Gram-negative bacteria proteins of the PTS are involved in carbon catabolite repression. They also control the induced expression of several catabolic operons in response to inducer availability by modifying the activities of transcriptional regulators, transport proteins and enzymes. Moreover, the PTS is involved in the regulation of nitrogen metabolism, chemotaxis towards carbohydrates and genetic competence (Postma et al., 1993 ; Powell et al., 1995
; Saier & Reizer, 1994
; Stülke & Hillen, 1998
). Many, but not all of these regulatory processes involve phosphotransfer between PTS proteins and the proteins whose activities are modulated by the PTS. These phosphorylation reactions link the activities of the target proteins to PTS activity and thus to the availability of PTS substrates. Glycerol kinase from low-GC Gram-positive bacteria is phosphorylated by HPr in the absence of repressing carbon sources. This phosphorylation stimulates the catalytic activity of the enzyme (Charrier et al., 1997
). Similarly, lactose transport activity in Streptococcus thermophilus is controlled by HPr-dependent phosphorylation of a IIA-like regulatory domain fused to the C-terminal end of the membrane-bound lactose:H+ symporter (Gunnewijk et al., 1999
). Moreover, several positively acting transcriptional regulators have been shown to possess conserved PTS regulation domains (PRDs) (Tortosa et al., 1997
; St ülke et al., 1998
). The activator and antiterminator proteins that contain PRDs are often subject to dual control by the PTS: in the absence of the inducer of the controlled operon, they are phosphorylated and thus inactivated, but their activity may also depend on an additional HPr-dependent phosphorylation. This latter phosphorylation occurs only in the absence of a repressing carbon source, thus providing a means for hierarchical expression of genes required for the utilization of secondary carbon sources (for review see Stülke et al. , 1998
).
The PTSs of enteric bacteria and of low-GC Gram-positive bacteria have been the subject of intensive investigation (see Saier & Reizer, 1994 ). More recently, the potential regulatory roles of PTS components of Mycoplasma spp., non-enteric Gram- negative bacteria such as Haemophilus influenzae and Alcaligenes eutrophus, and the high-GC Gram-positive bacterium Streptomyces coelicolor have been investigated (Zhu et al. , 1993
; Macfayden et al., 1996
; Pries et al., 1991
; Titgemeyer et al., 1995
). The advent of complete genome sequence analysis of the complete set of PTS proteins encoded within a given genome has resulted in the identification of several novel genes and proteins (see Reizer et al., 1996
; Reizer & Reizer, 1996
).
Here, we present an analysis of the complete set of genes encoding PTS and PTS-associated proteins in the model Gram-positive bacterium Bacillus subtilis. We show that B. subtilis encodes 15 complete PTS permeases of which only seven have been characterized previously. Sequence and functional analyses have allowed us to propose substrates for seven of the eight novel permeases. Moreover, 13 PTS- associated proteins are also encoded in the B. subtilis genome. The significance of these findings is discussed.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
gamP (ybfS) was disrupted as follows. A fragment of 977 bp internal to gamP was amplified by PCR using the oligonucleotides X1 (5'-GGGCGAGGGAATTCCGATTAT) and X2 (5'- CTGGTTCAGAAGCTTTGCCG). The PCR product was cut with EcoRI (generated by PCR) and HindIII and cloned into the integrative plasmid pHT181 (Lereclus & Arantè s, 1992 ) to give pX1. B. subtilis 168 was transformed with pX1 and the plasmid was integrated into the chromosome. The DNA of the B. subtilis strain harbouring pX1 was extracted, hydrolysed by EcoRI and religated. E. coli TGI was transformed with the ligation mixture, yielding plasmid pHT181::X1 carrying a 3 kb EcoRI fragment. This fragment contained the PCR-amplified region and about 2 kb upstream of that region. A StuI digestion of pHT181::X1 provided a fragment of 947 bp corresponding to the last 677 bp of gamP, the first 93 bp of gltP and 147 bp of the gamP/gltP intergenic region. This StuI fragment was then replaced by an aphA3 cassette (Trieu-Cuot & Courvalin, 1983
) located on a 1·5 kb ClaI fragment, leading to plasmid pHT181::X1::aphA3.
ypqE was disrupted by the following approach. A fragment of 594 bp, carrying ypqE and 90 bp downstream of the stop codon of this gene was amplified by PCR using the primers ypq-1 (5'-GAAGAATTCATATGCTGAAAAAATTATTCGGAAT) and ypq-2 (5'- CCCCCCGGGTCGACTACAGT TTACCGAATATTTG). The amplified fragment was cloned into pUC19 at the EcoRI and SalI sites (sites were introduced with the PCR primers), to yield plasmid pXX1. A 1·5 kb ClaI fragment carrying aphA3 was inserted into pXX1 at the unique AvaI site, yielding plasmid pXX1::aphA3. The 2·1 kb EcoRISalI fragment carrying ypqE interrupted by aphA3 from pXX1::aphA3 was inserted into plasmid pHT181 between the EcoRI and SalI sites, giving pHT181::XX1::aphA3.
E. coli was grown in LB medium (Sambrook et al., 1989 ) whereas B. subtilis was grown in SP medium or C minimal medium (Martin-Verstraete et al., 1990
). The minimal media were supplemented with auxotrophic requirements (at 50 mg l-1) and carbon sources as indicated. CSE is C medium supplemented with potassium succinate (6 g l-1) and potassium glutamate (8 g l-1). Doubling times were determined by growing the bacteria in C minimal medium supplemented with 0·2% (w/v) of the carbon source indicated. CSE containing 0·2% (w/v) glucitol was used for precultures. Agar plates were prepared by the addition of 17 g Bacto agar l-1 (Difco) to LB, SP or C medium.
DNA manipulation, transformation and phenotypic characterization.
DNA extraction and manipulation were performed using standard procedures (Sambrook et al., 1989 ). Restriction enzymes and T4 DNA ligase were used as recommended by the manufacturers.
Standard procedures were used to transform E. coli and transformants were selected on LB plates containing ampicillin (100 µg ml-1) or spectinomycin (100 µg ml-1) (Sambrook et al., 1989 ). B. subtilis was transformed with chromosomal or plasmid DNA according to the two-step protocol described by Kunst & Rapoport (1995)
. Transformants were selected on SP plates containing spectinomycin (100 µg ml -1), chloramphenicol (5 µg ml-1 ) or kanamycin (5 µg ml-1).
Computer-aided analyses.
Database searches were performed using the BLAST 2.0 program (Altschul et al., 1990 ) on the NCBI server (http://www.ncbi.nlm.nih.gov/blast/). The organization of B. subtilis gene clusters was determined using the SubtiList database (Moszer et al., 1995
).
![]() |
RESULTS AND DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
|
|
The Fru family (Table 2, section 6) includes the following three permeases, each containing three domains (IIA, IIB and IIC) that reside on a single polypeptide chain: (i) MtlA with a CBA domain order homologous to the E. coli mannitol permease; (ii) FruA with an ABC domain sequence homologous to the fructose-1-phosphate-forming fructose-specific PTS permease of mycoplasmas (Reizer et al., 1996
); and (iii) ManP (YjdD) with a BCA domain order. All three domains of FruA and the putative mannose permease (ManP) exhibit significant sequence similarity with protein domains of the fructose- specific permease (IIABCFru; fructose-1-phosphate-forming) of mycoplasmas (Reizer et al., 1996
). mtlA , encoding EIIMtl, is the first gene in a bicistronic operon which also encodes mannitol-1-phosphate dehydrogenase (Fig. 4a
). manP is the first gene in a putative tricistronic operon. The second gene encodes a mannose-6- phosphate isomerase, whereas the function of the third gene is unknown (Fig. 4b
). fruA, encoding the fructose permease, is the distal gene in a tricistronic operon. The first gene of this putative operon, fruR, encodes a repressor of the DeoR family and the second gene, fruB, encodes an orthologue of the E. coli fructose-1-phosphate kinase (Fig. 4c
).
|
PTS-associated proteins
Expression of several catabolic operons in B. subtilis is controlled by PTS-dependent phosphorylation of inducer-generating enzymes or transcriptional regulators (Deutscher et al., 1997 ; Stülke et al., 1998
).
Glycerol utilization in B. subtilis depends on a functional PTS, although glycerol is transported into cells by a non-PTS permease (Reizer et al., 1984 ; Beijer & Rutberg, 1992
). Mutations that bypass this dependency were isolated and found to be in glpK, the gene encoding glycerol kinase which generates glycerol 3-phosphate, the internal inducer of the glp regulon in B. subtilis (Wehtje et al., 1995
). Subsequently, direct phosphorylation of glycerol kinase by EI and HPr was demonstrated (Charrier et al., 1997
).
A protein domain, PRD, is found in transcriptional regulators such as RNA-binding antiterminators and DNA-binding activators that serves as a target of PTS-dependent phosphorylation (Tortosa et al., 1997 ; Reizer & Saier, 1997
; Stülke et al., 1998
). PRD- containing regulators are found primarily in Gram-positive bacteria. Eight PRD-containing regulators are encoded within the B. subtilis chromosome (see Table 3
). All eight proteins regulate the expression of genes encoding PTS permeases and associated catabolic enzymes. PRD-containing transcriptional antiterminators and the activator protein LevR have been studied extensively (Deutscher et al., 1997
; Martin-Verstraete et al., 1998
; Stülke et al., 1998
). Four antiterminators of this type are present in B. subtilis (see Table 3
). They control the expression of genes required for glucose, sucrose and ß-glucoside utilization (St ülke et al., 1997
; Steinmetz et al., 1989
; Schnetz et al., 1996
). In addition, PRD-containing transcriptional activators, LevR and LicR, control expression of the levanase and licBCAH operons, respectively (Débarbouill é et al., 1991
; Tobisch et al., 1997
). The LevR activator contains two PRDs. LicR contains two PRDs and a C-terminal domain homologous to EIIAFru. The phosphorylation site in this domain is conserved and a mutation of this site was shown to result in constitutive LicR activity (Tobisch et al., 1999
). The complete nucleotide sequence of the B. subtilis genome revealed the presence of two novel putative transcriptional activators that are similar to LicR. Since yjdC is located just upstream of the operon involved in mannose utilization (see Fig. 4b
), the designation ManR was proposed (Stülke et al., 1998
). YdaA is homologous to the regulators of mannitol catabolism of B. stearothermophilus (Henstra et al., 1999
) and Clostridium acetobutylicum (accession no. U53868). The designation MtlR was thus proposed for YdaA (Stülke et al. , 1998
).
Phenotypes of B. subtilis strains defective in EII components
The functional role of the GlvC and YbfS permeases was determined. glvC was identified in the framework of the B. subtilis sequencing project and proposed to encode a ß-glucoside- specific EII (Yamamoto et al., 1996 ). However, the functional characterization of genes encoding a maltose-specific EII and a phospho-
-glucosidase from Fusobacterium mortiferum revealed that the homologous GlvA of B. subtilis, encoded in the same operon as GlvC, is in fact a phospho-
-glucosidase rather than a phospho-ß-glucosidase (Bouma et al., 1997
; Thompson et al., 1998
). In addition, GlvC exhibits higher sequence similarity to PTS permeases of the glucose/maltose family than to the sucrose/ß-glucoside-specific PTS permeases. To study the functional role of glvC we constructed a glvC mutant of B. subtilis. We additionally constructed strains containing ypqE and ybfS mutations (Kunst et al., 1997
; see Table 2
). To obtain a comprehensive set of mutants we used strain GP113 in which the part of ptsG encoding the IIB and IIA domains of the glucose permease was deleted. The IIA domain of the glucose permease has been shown to phosphorylate IIB domains of the sucrose- and trehalose-specific PTS permeases that lack a IIA domain (Sutrina et al., 1990
; Dahl, 1997
).
B. subtilis 168 and the mutant strains were grown in C minimal medium with either glucose, maltose, glucosamine or N- acetylglucosamine as a single source of carbon and energy and their doubling times were determined (Table 4 ). All four sugars were readily utilized by the wild-type strain, although the generation time of cultures grown on N-acetylglucosamine was longer than the generation time of cells grown on either glucose, maltose or glucosamine. The PTS is required for efficient catabolism of all the carbon sources tested as is evident from the slow growth rate (or the lack of growth) of the ptsH mutant strain. As observed previously, the ptsH mutant strain grew slowly on glucose, suggesting the presence of a non-PTS system for glucose transport and phosphorylation (Stülke et al., 1995
). The recently identified glucose transporter, GlcP, is presumably responsible for this residual growth (Paulsen et al., 1998
). Similarly, slow growth of the ptsH mutant was observed with glucosamine, whereas maltose and N-acetylglucosamine were not utilized by this strain. The IIA and IIB domains of the glucose permease were required for efficient growth on glucose and maltose while the ptsG mutation did not affect growth on glucosamine or N- acetylglucosamine. Four conclusions can be drawn from these results. (i) PTS permeases distinct from PtsG may transport and phosphorylate glucose, albeit with low efficiency. (ii) Phosphotransfer via the IIA Glc domain appears to be necessary for efficient utilization of maltose. (iii) The glvC mutant strain GP110 grew normally on all the carbon sources tested with the exception of maltose. We propose, therefore, that glvC encodes a maltose-specific PTS permease and we redesignate the gene malP. This finding is in agreement with the presence of a phospho-
-glucosidase-encoding gene within the malP operon (see Fig. 1b
) and with the strong sequence conservation of MalP with other maltose- and glucose-specific PTS permeases. (iv) The ybfS mutation resulted in impaired growth in the presence of glucosamine, suggesting that the EII encoded by ybfS catalyses the transport and phosphorylation of this sugar. This observation is reinforced by the genetic arrangement. ybfT, which precedes ybfS, exhibits a high degree of sequence similarity to the characterized (deaminating) glucosamine-6- phosphate isomerase of E. coli (Fig. 1c
). Therefore, we propose to designate the ybfT and ybfS genes as gamA and gamP, respectively. The ypqE mutation did not yield a recognizable phenotype under the conditions tested here and the function of the encoded protein therefore remains unknown.
|
![]() |
ACKNOWLEDGEMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bachem, S. & Stülke, J. (1998). Regulation of the Bacillus subtilis GlcT antiterminator protein by components of the phosphotransferase system. J Bacteriol 180, 5319-5326 .
Beijer, L. & Rutberg, L. (1992). Utilisation of glycerol and glycerol-3-phosphate is differently affected by the phosphotransferase system in Bacillus subtilis.FEMS Microbiol Lett 100, 217-220.
Blattner, F. R., Plunkett, G. I., Bloch, C. A. & 14 other authors (1997). The complete genome sequence of Escherichia coli K12. Science 277, 14531474.
Bouma, C. L. , Reizer, J. , Reizer, A. , Robrish, S. A. & Thompson, J. (1997). 6-Phospho--D-glucosidase from Fusobacterium mortiferum: cloning, expression, and assignment to family 4 of the glycosylhydrolases.J Bacteriol 179, 4129-4137 .[Abstract]
Branny, P. , De La Torre, F. & Garel, J. R. (1996). The genes for phosphofructokinase and pyruvate kinase of Lactobacillus delbrueckii subsp. bulgaricus constitute an operon.J Bacteriol 178, 4727-4730 .[Abstract]
Charrier, V. , Buckley, E. , Parsonage, D. , Galinier, A. , Darbon, E. , Jaquinod, M. , Forest, E. , Deutscher, J. & Claiborne, A. (1997). Cloning and sequencing of two enterococcal glpK genes and regulation of the encoded glycerol kinases by phosphoenolpyruvate-dependent, phosphotransferase system- catalyzed phosphorylation of a single histidyl residue. J Biol Chem 272, 14166-14174 .
Dahl, M. K. (1997). Enzyme IIGlc contributes to trehalose metabolism in Bacillus subtilis. FEMS Microbiol Lett 148, 233-238.
Débarbouillé, M. , Fouet, A. , Arnaud, M. , Klier, A. & Rapoport, G. (1990). The sacT gene regulating the sacPA operon in Bacillus subtilis shares strong homology with transcriptional antiterminators.J Bacteriol 172, 3966-3973 .[Medline]
Débarbouillé, M. , Martin-Verstraete, I. , Klier, A. & Rapoport, G. (1991). The transcriptional regulator LevR of Bacillus subtilis has domains homologous to both 54- and phosphotransferase system-dependent regulators. Proc Natl Acad Sci USA 88, 2212-2216 .[Abstract]
Deutscher, J. , Fischer, C. , Charrier, V. , Galinier, A. , Lindner, C. , Darbon, E. & Dossonet, V. (1997). Regulation of carbon metabolism in Gram-positive bacteria by protein phosphorylation.Folia Microbiol 42, 171-178.
Fischer, C. , Geourjon, C. , Bourson, C. & Deutscher, J. (1996). Cloning and characterization of the Bacillus subtilis prkA gene encoding a novel serine protein kinase.Gene 168, 55-60.[Medline]
Fouet, A. , Arnaud, M. , Klier, A. & Rapoport, G. (1987). Bacillus subtilis sucrose- specific enzyme II of the phosphotransferase system: expression in Escherichia coli and homology to enzymes II from enteric bacteria. Proc Natl Acad Sci USA 84, 8773-8777 .[Abstract]
Galinier, A. , Haiech, J. , Kilhoffer, M.-C. , Jaquinod, M. , Stülke, J. , Deutscher, J. & Martin-Verstraete, I. (1997). The Bacillus subtilis crh gene encodes a HPr-like protein involved in carbon catabolite repression. Proc Natl Acad Sci USA 94, 8439-8444 .
Galinier, A. , Kravanja, M. , Engelmann, R. , Hengstenberg, W. , Kilhoffer, M. C. , Deutscher, J. & Haiech, J. (1998). New protein kinase and protein phosphatase families mediate signal transduction in bacterial catabolite repression. Proc Natl Acad Sci USA 95, 1823-1828 .
Gibson, T. G. (1984). Studies on the EpsteinBarr virus genome. PhD thesis, University of Cambridge, Cambridge, UK.
Glaser, P., Kunst, F., Arnaud, M. & 14 other authors (1993). Bacillus subtilis genome project: cloning and sequencing of the 97 kb region from 325° to 333°. Mol Microbiol 10, 371384.[Medline]
Gonzy-Tréboul, G. , Zagorec, M. , Rain-Guion, M. C. & Steinmetz, M. (1989). Phosphoenolpyruvate:sugar phosphotransferase system of Bacillus subtilis: nucleotide sequence of ptsX, ptsH and the 5'-end of ptsI and evidence for a ptsHI operon. Mol Microbiol 3, 103-112.[Medline]
Gunnewijk, M. G. W. , Postma, P. W. & Poolman, B. (1999). Phosphorylation and functional properties of the IIA domain of the lactose transport protein of Streptococcus thermophilus. J Bacteriol 181, 632-641.
Henstra, S. A. , Tuinhof, M. , Duurkens, R. H. & Robillard, G. T. (1999). The Bacillus stearothermophilus mannitol regulator, MtlR, of the phosphotransferase system. J Biol Chem 274, 4754-4763 .
Holmberg, C. , Beijer, L. , Rutberg, B. & Rutberg, L. (1990). Glycerol catabolism in Bacillus subtilis: nucleotide sequence of the genes encoding glycerol kinase (glpK) and glycerol-3-phosphate dehydrogenase ( glpD). J Gen Microbiol 136, 2367-2375 .[Medline]
Kravanja, M. , Engelmann, R. , Dossonnet, V. , Blüggel, M. , Meyer, H. E. , Frank, R. , Galinier, A. , Deutscher, J. , Schnell, N. & Hengstenberg, W. (1999). The hprK gene of Enterococcus faecalis encodes a novel bifunctional enzyme: the HPr kinase/phosphatase. Mol Microbiol 31, 59-66.[Medline]
Kunst, F. & Rapoport, G. (1995). Salt stress is an environmental signal affecting degradative enzyme synthesis in Bacillus subtilis . J Bacteriol 177, 2403-2407 .[Abstract]
Kunst, F., Ogasawara, N., Moszer, I. & 148 others (1997). The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390, 249256.
Lapidus, A. , Galleron, N. , Sorokin, A. & Ehrlich, S. D. (1997). Sequencing and functional annotation of the Bacillus subtilis genes in the 200 kb rrnBdnaB region. Microbiology 143, 3431-3441 .[Abstract]
Le Coq, D. , Lindner, C. , Krüger, S. , Steinmetz, M. & Stülke, J. (1995). New ß-glucoside (bgl) genes in Bacillus subtilis: the bglP gene product has both transport and regulatory functions, similar to those of BglF, its Escherichia coli homolog. J Bacteriol 177, 1527-1535 .[Abstract]
Lengeler, J. W. , Jahreis, K. & Wehmeier, U. F. (1994). Enzymes II of the phosphoenolpyruvate-dependent phosphotransferase systems: their structure and function in carbohydrate transport. Biochim Biophys Acta 1188, 1-28.[Medline]
Lereclus, D. & Arantès, O. (1992). spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol Microbiol 6, 35-46.[Medline]
Macfayden, L. P. , Dorocicz, I. R. , Reizer, J. , Saier, M. H.Jr & Redfield, R. J. (1996). Regulation of competence development and sugar utilization in Haemophilus influenzae Rd by a phosphoenolpyruvate:fructose phosphotransferase system. Mol Microbiol 21, 941-952.[Medline]
Martin-Verstraete, I. , Débarbouillé, M. , Klier, A. & Rapoport, G. (1990). Levanase operon of Bacillus subtilis includes a fructose-specific phosphotransferase system regulating the expression of the operon. J Mol Biol 214, 657-671.[Medline]
Martin-Verstraete, I. , Charrier, V. , Stülke, J. , Galinier, A. , Erni, B. , Rapoport, G. & Deutscher, J. (1998). Antagonistic effects of dual PTS- catalysed phosphorylation on the Bacillus subtilis transcriptional activator LevR. Mol Microbiol 28, 293-303.[Medline]
Moszer, I. , Glaser, P. & Danchin, A. (1995). SubtiList: a relational database for the Bacillus subtilis genome. Microbiology 141, 261-268.[Abstract]
Nelson, S. O. , Schuitema, A. R. J. , Benne, R. , van der Ploeg, L. H. T. , Plijter, J. S. , Aan, F. & Postma, P. W. (1984). Molecular cloning, sequencing, and expression of the crr gene: the structural gene for IIIGlc of the bacterial PEP:glucose phosphotransferase system. EMBO J 3, 1587-1593.[Abstract]
Nguyen, C. C. & Saier, M. H.Jr (1995). Phylogenetic analysis of the putative phosphorylation domain in the pyruvate kinase of Bacillus stearothermophilus. Res Microbiol 146, 713-719.[Medline]
Nobelmann, B. & Lengeler, J. W. (1995). Sequence of the gat operon for galactitol utilization from a wild-type strain EC3132 of Escherichia coli. Biochim Biophys Acta 1262, 69-72.[Medline]
Paulsen, I. T. , Chauvaux, S. , Choi, P. & Saier, M. H.Jr (1998). Characterization of glucose-specific catabolite repression-resistant mutants of Bacillus subtilis: identification of a novel hexose:H+ symporter. J Bacteriol 180, 498-504.
Postma, P. W. , Lengeler, J. W. & Jacobson, G. R. (1993). Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol Rev 57, 543-594.[Abstract]
Powell, B. S. , Court, D. L. , Inada, T. , Nakamura, Y. , Michotey, V. , Cui, X. , Reizer, A. , Saier, M. H.Jr & Reizer, J. (1995). Novel proteins of the phosphotransferase system encoded within the rpoN operon of Escherichia coli. Enzyme IIANtr affects growth on organic nitrogen and the conditional lethality of an erats mutant. J Biol Chem 270, 4822-4839 .
Pries, A. , Priefert, H. , Krüger, N. & Steinbüchel, A. (1991). Identification and characterization of two Alcaligenes eutrophus gene loci relevant to the poly(ß-hydroxybutyric acid)-leaky phenotype which exhibit homology to ptsH and ptsI of Escherichia coli. J Bacteriol 173, 5843-5853 .[Medline]
Reizer, J. & Reizer, A. (1996). A voyage along the bases: novel phosphotransferase genes revealed by in silico analyses of the Escherichia coli genome. Res Microbiol 147, 458-471.[Medline]
Reizer, J. & Saier, M. H.Jr (1997). Modular multidomain phosphoryl transfer proteins of bacteria. Curr Opin Struct Biol 7, 407-415.[Medline]
Reizer, J. , Novotny, M. J. , Stuiver, I. & Saier, M. H.Jr (1984). Regulation of glycerol uptake by the phosphoenolpyruvate-sugar phosphotransferase system in Bacillus subtilis. J Bacteriol 159, 243-250.[Medline]
Reizer, J. , Paulsen, I. T. , Reizer, A. , Titgemeyer, F. & Saier, M. H.Jr (1996). Novel phosphotransferase system genes revealed by bacterial genome analysis: the complete complement of pts genes in Mycoplasma genitalium. Microb Comp Genomics 1, 151-164.[Medline]
Reizer, J. , Hoischen, C. , Titgemeyer, F. , Rivolta, C. , Rabus, R. , Stülke, J. , Karamata, D. , Saier, M. H.Jr & Hillen, W. (1998). A novel protein kinase that controls carbon catabolite repression in bacteria. Mol Microbiol 27, 1157-1169 .[Medline]
Sadaie, Y. & Yata, K. (1998). Functional analysis of the phoB/cotA region of the Bacillus subtilis chromosome containing the konjac glucomannan utilization operon. In Abstracts of the International Conference on Bacilli, Japan, abstract P78.
Saier, M. H.Jr & Reizer, J. (1992). Proposed uniform nomenclature for the proteins and protein domains of the bacterial phosphoenolpyruvate:sugar phosphotransferase system. J Bacteriol 174, 1433-1438 .[Medline]
Saier, M. H.Jr & Reizer, J. (1994). The bacterial phosphotransferase system: new frontiers 30 years later. Mol Microbiol 13, 755-764.[Medline]
Sakai, H. & Ohta, T. (1993). Molecular cloning and nucleotide sequence of the gene for pyruvate kinase of Bacillus stearothermophilus and the production of the enzyme in Escherichia coli. Evidence that the genes for phosphofructokinase and pyruvate kinase constitute an operon. Eur J Biochem 211, 851-859.[Abstract]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schnetz, K. , Stülke, J. , Gertz, S. , Krüger, S. , Krieg, M. , Hecker, M. & Rak, B. (1996). LicT, a Bacillus subtilis transcriptional antiterminator protein of the BglG family. J Bacteriol 178, 1971-1979 .[Abstract]
Schöck, F. & Dahl, M. K. (1996). Analysis of DNA flanking the treA gene of Bacillus subtilis reveals genes encoding a putative specific enzyme IITre and a potential regulator of the trehalose operon. Gene 175, 59-63.[Medline]
Steinmetz, M. , Le Coq, D. & Aymerich, S. (1989). Induction of saccharolytic enzymes by sucrose in Bacillus subtilis: evidence for two partially interchangeable regulatory pathways. J Bacteriol 171, 1519-1523 .[Medline]
Stülke, J. & Hillen, W. (1998). Coupling physiology and gene regulation in bacteria: the phosphotransferase sugar uptake system delivers the signals. Naturwissenschaften 85, 583-592.[Medline]
Stülke, J. , Martin-Verstraete, I. , Charrier, V. , Klier, A. , Deutscher, J. & Rapoport, G. (1995). The HPr protein of the phosphotransferase system links induction and catabolite repression of the Bacillus subtilis levanase operon. J Bacteriol 177, 6928-6936 .[Abstract]
Stülke, J. , Martin-Verstraete, I. , Zagorec, M. , Rose, M. , Klier, A. & Rapoport, G. (1997). Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT. Mol Microbiol 25, 65-78.[Medline]
Stülke, J. , Arnaud, M. , Rapoport, G. & Martin-Verstraete, I. (1998). PRD a protein domain involved in PTS-dependent induction and carbon catabolite repression of catabolic operons in bacteria. Mol Microbiol 28, 865-874.[Medline]
Sutrina, S. L. , Reddy, P. , Saier, M. H.Jr & Reizer, J. (1990). The glucose permease of Bacillus subtilis is a single polypeptide chain that functions to energize the sucrose permease. J Biol Chem 265, 18581-18589 .
Thompson, J. , Pikis, A. , Ruvinov, S. B. , Henrissat, B. , Yamamoto, H. & Sekiguchi, J. (1998). The gene glvA of Bacillus subtilis 168 encodes a metal-requiring, NAD(H)-dependent 6-phospho--glucosidase. J Biol Chem 273, 27347-27356 .
Titgemeyer, F. , Walkenhorst, J. , Reizer, J. , Stuiver, M. H. , Cui, X. & Saier, M. H.Jr (1995). Identification and characterization of phosphoenolpyruvate:fructose phosphotransferase systems in three Streptomyces species. Microbiology 141, 51-58.[Abstract]
Tobisch, S. , Glaser, P. , Krüger, S. & Hecker, M. (1997). Identification and characterization of a new ß-glucoside utilization system in Bacillus subtilis . J Bacteriol 179, 496-506.[Abstract]
Tobisch, S. , Stülke, J. & Hecker, M. (1999). Regulation of the lic operon of Bacillus subtilis and characterization of potential phosphorylation sites of the LicR regulator protein by site-directed mutagenesis. J Bacteriol 181, 4995-5003 .
Tortosa, P. , Aymerich, S. , Lindner, C. , Saier, M. H.Jr , Reizer, J. & Le Coq, D. (1997). Multiple phosphorylation of SacY, a Bacillus subtilis antiterminator negatively controlled by the phosphotransferase system. J Biol Chem 272, 17230-17237 .
Trieu-Cuot, P. & Courvalin, P. (1983). Nucleotide sequence of Streptococcus faecalis plasmid gene encoding the 3'5''-aminoglycoside phosphotransferase type III. Gene 23, 331-341.[Medline]
Wehtje, C. , Beijer, L. , Nilsson, R. P. & Rutberg, B. (1995). Mutations in the glycerol kinase gene restore the ability of a ptsGHI mutant of Bacillus subtilis to grow on glycerol. Microbiology 141, 1193-1198 .[Abstract]
Yamamoto, H. , Uchiyama, S. , Fajar, A. N. , Ogasawara, N. & Sekiguchi, J. (1996). Determination of a 12 kb nucleotide sequence around the 76° region of the Bacillus subtilis chromosome. Microbiology 142, 1417-1421 .[Abstract]
Zagorec, M. & Postma, P. (1992). Cloning and nucleotide sequence of the ptsG gene of Bacillus subtilis. Mol Gen Genet 234, 325-328.[Medline]
Zhang, J. K. & Aronson, A. (1994). A Bacillus subtilis bglA gene encoding phospho-ß-glucosidase is inducible and closely linked to a NADH dehydrogenase-encoding gene. Gene 140, 85-90.[Medline]
Zhu, P.-P. , Reizer, J. , Reizer, A. & Peterkofsky, A. (1993). Unique monocistronic operon ( ptsH) in Mycoplasma capricolum encoding the phosphocarrier protein, HPr, of the phosphoenolpyruvate:sugar phosphotransferase system. J Biol Chem 268, 26531-26540 .
Zukowski, M. M. , Miller, L. , Cogswell, P. , Chen, K. , Aymerich, S. & Steinmetz, M. (1990). Nucleotide sequence of the sacS locus of Bacillus subtilis reveals the presence of two regulatory genes. Gene 90, 153-155.[Medline]
Received 13 July 1999;
revised 31 August 1999;
accepted 3 September 1999.