Molecular and Cellular Biology, School of Biological Sciences, University of New England, Armidale, NSW 2351, Australia1
Author for correspondence: Brian Cheetham. Tel: +61 2 6773 3394. Fax: +61 2 6773 3267. e-mail: bcheetha{at}metz.une.edu.au
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Abbreviations: HSL, N-(3-oxohexanoyl)-L-homoserine lactone
The GenBank accession number for the intC element in strain C305 beginning at the left-most EcoRI site (Fig. 1) is Y15939.
a Present address: Roche Diagnostics Australia Pty Ltd, 31 Victoria Avenue, Castle Hill, NSW 2154, Australia.
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Multiple copies of the intA element, termed vap regions 1, 2 and 3, are present in the virulent D. nodosus strain A198 (Katz et al., 1994 ). Regions 1 and 3 form part of a contiguous 11·9 kb virulence-associated region (Fig. 1
; Cheetham et al., 1995
). Region 1 is integrated into a tRNA-serGCU gene close to the aspartokinase (askA) gene, while region 2 is integrated into a different tRNA-ser gene, tRNA-serGGA, next to the polynucleotide phosporylase (pnpA) gene (Bloomfield et al., 1997
).
The genes which have been identified in the vap regions of the virulent D. nodosus strain A198 are designated intA, vap (virulence-associated protein) AH, and toxA (Fig. 1, Katz et al., 1992
; Cheetham et al., 1995
; Bloomfield et al., 1997
). The intA gene product is an integrase belonging to the lambda family of site-specific recombinases (Cheetham et al., 1995
). VapA and ToxA show amino acid similarity to the HigA and HigB proteins from the killer plasmid Rts1 (Tian et al., 1996
), which encode a toxin and antidote molecule, respectively, and act to prevent loss of the plasmid Rts1 in Escherichia coli. VapA and ToxA may have a similar function in D. nodosus (Bloomfield et al., 1997
). The vapB and vapC genes are similar to vagC and vagD from the virulence plasmid of Salmonella dublin. The products of these genes are believed to coordinate replication of the virulence plasmid with cell division (Pullinger & Lax, 1992
). VapD and VapE have amino acid similarity to the products of plasmid-borne genes of unknown function from a variety of bacterial species (Katz et al., 1992
; Cheetham et al., 1995
). The remaining genes, vapF, vapG and vapH, have no similarity to previously identified genes.
A native plasmid which contains vap region 1 and an insertion sequence (IS1253) has been isolated from strain AC3577 of D. nodosus, and may be the progenitor of the chromosomal vap sequences found in other strains (Billington et al., 1996 ). IS1253 is not found in the vap regions of strain A198, but there is a copy near the outer-membrane protein (omp) gene cluster, which is responsible for production of the major outer-membrane protein of D. nodosus (Moses et al., 1995
).
A second genetic element, the intB element, which may be part of a prophage or a conjugative transposon, is integrated next to vap region 3 in strain A198 (Bloomfield et al., 1997 ). The end of this element contains an integrase gene, intB, a regulatory gene, regA (Fig. 1
), and three genes of unknown function, gepA, gepB and gepC.
In this paper, we describe a new genetic element, the intC element, in D. nodosus. In strain C305, the intC element is integrated into tRNA-serGCU, next to askA. We show that loss of this element from one virulent strain resulted in a concomitant loss of thermostable protease activity, a virulence factor in D. nodosus (Depiazzi et al., 1990 ). Mechanisms by which the loss of the intC element might result in the loss of thermostable protease activity are discussed.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Dichelobacter nodosus strains.
Strains A198, AC390, B1006, C305, D1172, G1220, H1204, H1215, 1469, 1493 and 3138 were obtained from Professor J. I. Rood, Monash University, Clayton, Victoria 3168, Australia, and strains 819, 1169, 1311 and 2483 from Dr J. Searson, NSW Agriculture, Private Mail Bag, Yanco, NSW 2703, Australia.
Preparation and screening of a library of genomic DNA from D. nodosus strain C305.
Genomic DNA from D. nodosus strain C305 was partially digested with the restriction endonuclease Sau3AI and fragments were ligated into the XhoI half-site arms of bacteriophage lambdaGEM-12 (Promega), packaged according to the directions of the manufacturer (Promega), and used to infect the lambda-sensitive E. coli strain LE392 (Sambrook et al., 1989 ). The library was screened by plaque-lift hybridization, on nitrocellulose membranes, using digoxigen-labelled probes and a chemiluminescent detection kit (Boehringer Mannheim), according to the manufacturers instructions. DNA was prepared from the lambda clones by the method of Ausubel et al. (1989)
.
Oligonucleotide primers.
Primer sequences were: primer A (askA) TAGAAGCCACGCATGTTACG; primer B (intC) AGCGGTTGTTCCCACATAAA; and primer C (intB) ATAACGCTGGCTTTAGGTGA. PCR conditions have been described previously (Bloomfield et al., 1997 ).
Assay for protease thermostability.
The supernatant from liquid cultures of D. nodosus was assayed for proteolytic activity by measuring the release of a soluble blue dye from hide powder azure (Green, 1985 ). Thermostability was determined in triplicate by measuring the activity before and after heating the supernatant at 60 °C for 10 min.
![]() |
RESULTS AND DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
To investigate the hypothesis that the vap regions of strain A198 resulted from integrations of the intA element into the tRNA-serGCU gene located between the askA and intB genes (Fig. 1), we prepared a library of genomic DNA from strain C305, and screened it with probes 1, 3 and 4A (Fig. 1
). Probe 1 contained part of the askA gene, flanking the left-hand end of vap region 1 in virulent strain A198; probe 4A contained part of the intB gene flanking the right-hand end of vap region 3 in strain A198; and probe 3 contained the HindIIINruI fragment from the left-hand end of vap region 3 in strain A198. A single lambda clone to which probes 1 and 3 hybridized strongly, and probe 4A hybridized weakly, was isolated (Fig. 1
). We predicted that the askA and intB genes would be close together in this clone. However, they were found to be separated by a 6·6 kb DNA segment. The DNA sequence of an 8035 bp region from this lambda clone was determined, and several ORFs were identified (Fig. 1
).
A new genetic element is integrated into tRNA-ser in strain C305
At the left-hand end of the lambda clone from strain C305 (Fig. 1), we identified a partial ORF, designated askA, the DNA sequence of which is almost identical to that of the partially characterized ORF located upstream of the tRNA-serGCU gene at the left-hand end of vap region 1 in D. nodosus strain A198 (Bloomfield et al., 1997
). Downstream from the askA gene, we identified a 92 bp tRNA-ser gene which had 97·8% nucleotide identity to tRNA-serGCU from the left-hand end of vap region 1 of D. nodosus strain A198 (Cheetham et al., 1995
).
The predicted protein product from an ORF, designated intC, located 200 bp downstream from tRNA-serGCU, was found to have 54·2% amino acid identity with IntA from vap region 1 of D. nodosus strain A198 (Fig. 2a). The conserved residues included Arg251, His336, Arg339 and Tyr374, which are conserved in integrases from this family (Argos et al., 1986
; Abremski & Hoess, 1992
). The highest amino acid identity to other integrases from the databases was 40·4% with the integrase from retronphage
R73 (Sun et al., 1991
).
|
IS1253 is next to vapH
The insertion sequence IS1253 from D. nodosus strain AC3577 is a 1689 bp element consisting of two ORFs, orf375 and orf117, with similarity to transposase genes from a number of unusual IS elements (Billington et al., 1996 ). In strain C305, we found a copy of this element next to vapH' (Fig. 1
). The IS1253 found in strain C305 had DNA identity of 98·3% over 1649 bp with the IS1253 from strain AC3577, and consisted of two similar ORFs, orf374 and orf108. The copy of IS1253 in strain C305 appeared to be non-functional, as the coding region from orf374 had been disrupted by two frame-shift mutations, one of which was the deletion of a GTAA repeat. A related insertion sequence is found adjacent to virulence-associated genes in several pathogenic bacteria, including Salmonella typhimurium (Gulig et al., 1992
), Helicobacter pylori (Censini et al., 1996
), Vibrio cholerae (Bik et al., 1996
), Clostridium perfringens (Katayama et al., 1995
) and Yersinia pestis (Hu et al., 1998
).
The intB and regA genes are disrupted in strain C305
The intB and regA genes from strain A198 are located immediately to the right of vap region 3, and form part of the intB genetic element, separate from the intA element (Bloomfield et al., 1997 ). In strain C305, an internal fragment of the intB coding region was located immediately following IS1253 (Fig. 3a
) a 100 bp DNA segment with 98% identity to nucleotides 410510 of the 1203 bp coding region of the intB gene next to region 3 of strain A198 (Fig. 3b
). At this position in the intB gene seven nucleotides from the 19 bp attachment (att) site found at the ends of the vap regions were absolutely conserved (Fig. 3b
). Thus, this deletion may have been catalysed by intC.
|
Detection of the intC element in other strains of D. nodosus
To determine whether the genes intC, orf242, orf171, vapG' and vapH' were part of an integrated genetic element, 15 strains of D. nodosus were analysed in Southern blot experiments using probes 6, 7, 8 and 2 (Fig. 1), which detect intC, orf242, orf171 and vapG'H', respectively. The strains included five virulent strains, one intermediate strain, seven benign strains lacking the intA element, and two benign strains which contain the intA element. The results (data not shown) showed that, in ten of these strains, these five genes were present and found on the same-sized restriction fragment. The virulent strain A198 and the benign strain AC390 contained none of these genes. Since these genes included an integrase gene, were all located together in most strains, and were all absent from both strains A198 and AC390, these data suggest that they are part of an integrated genetic element, which we have designated the intC element. The virulent strain H1215 contained two copies of intC and one copy of orf242, but lacked orf171, vapG' and vapH', while benign strains H1204 and 1169 contained only intC, suggesting that integration of this new genetic element may have been followed by deletion of some of the genes.
Site of integration of the intC element
The intC element in strain C305 was integrated into the tRNA-serGCU gene downstream from askA (Fig. 1). In the virulent strain A198, vap region 1 is integrated into this tRNA-ser gene, while vap region 2 is integrated into tRNA-serGGA, downstream from the pnpA gene (Bloomfield et al., 1997
). Probes specific for askA and pnpA were used in Southern blot experiments to determine the site of integration of the intC element in 13 strains of D. nodosus known to contain intC (Table 1
: all strains except A198, AC390 and 1311A). In 10 of these strains, the intC element was located next to the askA gene. None of the strains tested had the intC element located next to pnpA. In strains H1215, H1204 and 1169, the intC element was not located next to askA, and its site of integration is unknown. These three strains did not have all of the genes so far recognized as being part of the intC element, perhaps suggesting that the intC element was unstable in the alternative position.
|
intB is next to askA in strain 1311A
If in strain 1311 the intB element were located next to the intC element, as in strain C305, then excision of the intC element in strain 1311 would place intB next to askA. Southern blot analysis of strains 1311 and 1311A using an intB probe showed that this was indeed the case (Fig. 4). Both strains contained two copies of intB, one of which is located in a different position in the two strains. In strain 1311, the intB probe hybridized to a 2·5 kb EcoRI fragment, while in strain 1311A a 3·3 kb EcoRI fragment was detected (Fig. 4
, lanes C and D). In strain 1311A, the askA probe also hybridized to a 3·3 kb EcoRI fragment. These results indicated that in strain 1311, intC was located next to askA and intB was located at the right-hand end of the intC element. The loss of the intC element from 1311 has resulted in the relocation of the intB gene such that it was adjacent to askA in strain 1311A.
|
To confirm that intC was adjacent to askA in D. nodosus strain 1311, and that intB was adjacent to askA in strain 1311A, PCR products were amplified using primer sets specific for askAintC (primers A and B), and askAintB (primers A and C). As expected, a 1·1 kb askAintB product was detected in strain 1311A whilst no askAintC product was observed. In strain 1311, a 2·6 kb askAintC product was observed, as expected.
Continuing loss of the intC element from strain 1311
Contrary to expectations, a 1·1 kb askAintB product was also obtained in strain 1311, suggesting that intB was also located next to askA in this strain. However, when serial dilutions of 1311 template and 1311A template were used, the amount of the askAintB product was much lower in 1311 than in 1311A (data not shown). This suggested that a subpopulation of cells from D. nodosus strain 1311 was undergoing loss of the intC element frequently enough to be detected. This was supported by Southern blot analysis (Fig. 4), where a faint band was detected in genomic DNA of strain 1311 by the intB probe at 3·3 kb. The loss of the intC element may be favoured under laboratory conditions.
Excision of the intC element does not disrupt tRNA-serGCU
The askA-intB PCR product from strain 1311A was subcloned, and the DNA sequence determined and aligned to the left end and right end of vap region 1/3 in D. nodosus virulent strain A198. Analysis of this junction region showed that the left-hand side of the att site was identical to attL, as would be expected if the intC element were excised by homologous recombination or an integrase-catalysed reaction. Analysis of the DNA sequence also showed that the tRNA gene was not disrupted by the loss of the intC element. Disruption of the leuX tRNA gene by the deletion of a pathogenicity island has been shown to have a major effect on virulence in uropathogenic E. coli (Ritter et al., 1995 ).
The intC element in strain C305 may be truncated
Southern blot analysis (summarized in Fig. 5) showed that the distance between askA and intB in strain 1311 was greater than 14 kb, and that all of the sequences between tRNA-serGCU and intB were lost together from strain 1311 to form strain 1311A. By contrast, in strain C305, the distance between askA and intB was 6·6 kb (Fig. 1
). These results suggested that in strain C305 part of the intC element had been deleted, perhaps due to the insertion of IS1253, which was located at the right-hand end of the intC element in strain C305.
|
Loss of pDN1 may occur without loss of the intC element
In an effort to determine whether the loss of intC occurred concomitantly with the loss of pDN1, the size difference between colonies of strains 1311 and 1311A was utilized to select colonies of strain 1311 that had potentially lost pDN1 and/or the intC element. Three small colonies were selected, and analysed. All three had lost pDN1 but still contained the intC element, and retained protease thermostability (data not shown). Of the 55 colonies screened, none which had lost the intC element were isolated. These results indicated that the loss of pDN1 may occur without loss of the intC element and that the loss of protease thermostability was not related to the loss of the native plasmid, pDN1, from strain 1311. However, since three colonies of reduced size were found to have lost pDN1, but not the intC element, the reduced size of 1311A colonies may have been due to loss of pDN1.
Sites of integration of the intA and intC elements in virulent and benign strains
There was no direct correlation between the presence of the intC element and virulence, since the virulent strain A198 does not contain the intC element, while most benign strains do contain it. Southern blot analysis of the integration sites of the intC and intA elements in 16 strains of D. nodosus showed that most virulent strains had the intC element next to askA and the intA element next to pnpA (Table 1). The virulent strain A198 had two copies of intA, one next to askA and one next to pnpA. By contrast, most benign strains had intC next to askA, but neither intC nor intA next to pnpA. We propose that virulent strains have the intA element next to pnpA and either the intA element or intC element next to askA. Strains which lack the intA element next to pnpA, or have neither the intA nor the intC element next to askA, would be benign if our model were correct.
Of the 16 strains studied, the only exception to the above pattern was virulent strain H1215, which has intB next to askA. Strain H1215 was atypical in several ways. Unlike all other strains studied, it contained two copies of pnpA, one of which had intA next to it. It is not known what is next to the other copy of pnpA. This strain also had two copies of intC, and their integration sites are unknown. However, it lacked orf171, vapG' and vapH', suggesting that deletions had occurred. Strain H1215 also contains a complete integrated prophage (G. A. Bloomfield, unpublished), but the integration site is also unknown.
A putative global repressor (glpA) gene between askA and tRNA-serGCU
Between the askA and tRNA-serGCU genes we identified an ORF, designated glpA (Fig. 1), encoding a putative product of 64 aa which had 74% aa identity over the first 50 aa with RsmA (Fig. 2b
) from the plant pathogen Erwinia carotovora (Cui et al., 1995
). In Er. carotovora, RsmA acts as a global repressor of virulence. The rsmA gene product reduces the transcript level of hslI, a luxI homologue required for N-(3-oxohexanoyl)-L-homoserine lactone (HSL) synthesis (Cui et al., 1995
), and thereby represses extracellular enzyme production, reduces motility and colony size, and so attenuates virulence (Mukherjee et al., 1996
). It is interesting that D. nodosus strain 1311A exhibits a similar phenotype to cells expressing rsmA in Er. carotovora, given the similarity between GlpA and RsmA. CsrA from E. coli, which is also very similar to RsmA, modulates glycogen biosynthesis by effects on mRNA stability (Liu et al., 1995
). CsrA belongs to a family of proteins containing KH domains, which are involved in RNA binding. The E. coli pnp gene belongs to the same family (Liu et al., 1995
), affects mRNA processing and decay (Alifano et al., 1994
), and is one of the two principal enzymes involved in the degradation of bacterial mRNA to nucleotides (Li & Deutscher, 1994
). Thus, in D. nodosus, the intA and the intC elements are integrated next to two genes whose products may be involved in gene regulation by the alteration of mRNA stability. The integration of these genetic elements may affect levels of glpA and pnpA transcripts, resulting in increased production of thermostable extracellular proteases.
Comparison of DNA sequences at the beginning of the intA, intB and intC elements
Analysis of the DNA sequences at the beginning of the intA, intB and intC elements identified several features which may be important in differential gene expression in D. nodosus strains containing different integrated genetic elements. These are discussed below.
Termination of transcription. The DNA sequences starting from the TGA stop codon for glpA for strains C305, A198 and 1311A were compared (data not shown). In all three strains, the sequence was almost identical up to the 3' end of the tRNA gene (the attL site). Within this sequence, there was a region of dyad symmmetry (loop 1) very close to the stop codon for glpA, which could act as a transcriptional terminator for glpA. Strains C305, A198 and 1311A had the intC, intA and intB elements, respectively, integrated after the attL site. The first 42 bp of the intA and intC elements were identical, and differed substantially from the first 42 bp of the intB element. Within this 42 bp sequence was a second region of dyad symmetry (loop 2), which could act as an alternative transcriptional terminator for glpA. If this transcriptional terminator were used, the transcript would include the tRNA molecule. This dyad symmetry (loop 2) was not present in the intB element. Thus, termination of transcription of glpA may differ according to whether intC, intA or intB is integrated at this position.
Virulent strains had the intA element integrated next to pnpA, while most benign strains had intB at this position. In the virulent strain A198, the stop codon in pnpA was located only one base before the tRNA-serGGA gene, and no putative transcriptional terminators were evident before the end of the tRNA gene. Thus, it is likely that pnpA transcripts include the tRNA molecule, and would differ according to the genetic element integrated at this position. The integration of the intA element, but not the intB element, next to pnpA would provide a transcriptional terminator.
Antisense RNA. Within the divergent region downstream of loop 2, sequences weakly resembling the consensus sequence for the E. coli 70 -35 and -10 promoter sequences (Hawley & McClure, 1983
) were identified in the regions upstream of intC and intA, but were not present upstream of intB. If these promoter sequences are functional, the antisense transcript produced could potentially sequester those messages transcribed on the opposite DNA strand, and left of the intC element and intA element integration sites, including those transcripts for glpA, pnpA, tRNA-serGCU and tRNA-serGGA genes.
tRNA processing. Since the intA and intC elements integrate into the 3' ends of tRNA-serGGA and tRNA-serGCU, they could alter the expression of these genes, thereby affecting the levels of these two serine tRNAs. This could, in turn, affect the translation of genes which use the corresponding serine codons. The tRNA-ser may have a role in virulence, similar to that proposed in uropathogenic E. coli, where the LeuX tRNA molecule is thought to act as a global regulator of several virulence factors (Ritter et al., 1995 ).
DNA topology. It has been reported previously that the integration of genetic elements can alter gene expression by affecting DNA topology (Dorman, 1995 ; Ott, 1993
; Zagaglia et al., 1991
). It is therefore possible that an element of critical size, such as the intC or intA elements, must be integrated adjacent to both glpA and pnpA, in order to provide the appropriate topology for thermostable protease expression or secretion.
A model for the role of the intA and intC elements in the virulence of D. nodosus
Our analysis of 16 strains of D. nodosus has shown that the intA, intB or intC elements may integrate next to glpA, and either the intA or the intB elements may integrate next to pnpA. Our model proposes that virulent strains of D. nodosus have the intA element integrated next to the pnpA gene, and the intC or intA element integrated next to the glpA gene. The presence of these integrated genetic elements may alter the expression of glpA, pnpA, tRNA-serGCU, tRNA-serGGA or askA, and reduce the expression of thermostable proteases through effects on mRNA stability, tRNA availability, or HSL levels.
It has been observed previously that virulent strains may have more than one copy of the intA element, but that strains with increased numbers of copies do not show increased virulence. This is consistent with our model, since the integration of a single copy of the intA element next to the pnpA gene and the intC element next to the glpA gene is sufficient for virulence. The presence of the intA element in some benign strains is also consistent with this model, since these strains would be benign if they did not have either the intA or the intC element integrated next to glpA, and the intA element integrated next to pnpA. For example, the benign strain AC390 has two copies of intA, one of which is integrated next to pnpA, but does not have the intC element, and the second copy of the intA element is not integrated next to glpA (Table 1). Based on these results, a diagnostic test to determine the virulence of strains of D. nodosus could be designed, using PCR to determine which genetic elements are integrated next to glpA and pnpA.
There is one report of a small number of virulent strains which lack sequences from the vap region (Rood et al., 1996 ). These strains may have a copy of the intC element integrated next to both glpA and pnpA. It will be of great interest to analyse such strains to determine whether genetic elements are integrated at these two locations.
Similarities between the intA and intC elements
The majority of the genes from the intA and intC elements are quite unrelated. However, the two integrases, IntA and IntC, have 54·2% amino acid identity, and vapG and vapH, from the intA element, and vapG' and vapH', from the intC element, have approximately 55% amino acid identity, and 81% nucleotide identity. In addition, two sequences of 42 bp and 61 bp are almost totally conserved in the DNA segment between the att site and the beginning of intA and intC. These results suggest that there has been genetic exchange between the intA and intC elements, that the related sequences are required for similar functions and have been maintained by selection, or that the two elements have evolved from a common ancestor.
Phase variation in D. nodosus
In culture we have shown loss of the intC element from a virulent strain of D. nodosus, resulting in loss of a virulence factor. Loss of the intC element from D. nodosus strains in natural infections may allow switching from the virulent to the benign phenotype, and may have a selective advantage. However, this has not yet been observed in vivo. Loss of the intA element is very unlikely, due to the vapA/toxA maintenance system in this element (Bloomfield et al., 1997 ). At present, we do not know whether the intA, intB or intC elements can be transferred between D. nodosus strains, although a plasmid containing the genes from vap region 1 has been identified in one strain of D. nodosus (Billington et al., 1996
). It is possible that strains of D. nodosus may be able to switch between the benign and virulent states by the loss or gain of these genetic elements. This work has significant implications for footrot eradication programmes which are currently in place in Australia.
![]() |
ACKNOWLEDGEMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alifano, P., Bruni, C. B. & Carlomagno, M. S. (1994). Control of mRNA processing and decay in prokaryotes. Genetica 94, 157-172.[Medline]
Argos, P., Landy, A., Abremski, K. & 9 other authors. (1986). The integrase family of site-specific recombinases: regional similarities and global diversity. EMBO J 5, 433440.[Abstract]
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1989). Current Protocols in Molecular Biology. New York: Wiley.
Beveridge, W. I. B. (1941). Footrot in sheep: a transmissible disease due to infection with Fusiformis nodosus. CSIRO Bull 140, 1-40.
Bik, E. M., Gouw, R. D. & Mooi, F. R. (1996). DNA fingerprinting of Vibrio cholerae strains with a novel insertion sequence element: a tool to identify epidemic strains. J Clin Microbiol 34, 1453-1461.[Abstract]
Billington, S. J., Sinistaj, M., Cheetham, B. F., Ayres, A., Moses, E. K., Katz, M. E. & Rood, J. I. (1996). Identification of a native Dichelobacter nodosus plasmid and implications for the evolution of the vap regions. Gene 172, 111-116.[Medline]
Bloomfield, G. A., Whittle, G., McDonagh, M. B., Katz, M. E. & Cheetham, B. F. (1997). Analysis of sequences flanking the vap regions of Dichelobacter nodosus: evidence for multiple integration events, a killer system, and a new genetic element. Microbiology 143, 553-562.[Abstract]
Censini, S., Lange, C., Xiang, Z., Crabtree, J. E., Ghiara, P., Borodovsky, M., Rappuoli, R. & Covacci, A. (1996). cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors. Proc Natl Acad Sci USA 93, 14648-14653.
Cheetham, B. F., Tattersall, D. B., Bloomfield, G. A., Rood, J. I. & Katz, M. E. (1995). Identification of a bacteriophage-related integrase gene in a vap region of the Dichelobacter nodosus genome. Gene 162, 53-58.[Medline]
Cui, Y., Chatterjee, A., Liu, Y., Dumenyo, C. K. & Chatterjee, A. K. (1995). Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp. carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L-homoserine lactone, and pathogenicity in soft-rotting Erwinia spp. J Bacteriol 177, 5108-5115.[Abstract]
Depiazzi, L. J. & Richards, R. B. (1985). Motility in relation to virulence of Bacteroides nodosus. Vet Microbiol 10, 107-116.[Medline]
Depiazzi, L. J., Henderson, J. & Penhale, W. J. (1990). Measurement of protease thermostability, twitching motility and colony size of Bacteroides nodosus. Vet Microbiol 22, 353-363.[Medline]
Dorman, C. J. (1995). DNA topology and the global control of bacterial gene expression: implications for the regulation of virulence gene expression. Microbiology 141, 1271-1280.[Medline]
Green, R. S. (1985). A method to differentiate between virulent and benign isolates of Bacteroides nodosus based on the thermal stability of their extracellular proteinases. NZ Vet J 33, 11-13.
Gulig, P. A., Caldwell, A. L. & Chiodo, V. A. (1992). Identification, genetic analysis and DNA sequence of a 7·8-kb virulence region of the Salmonella typhimurium virulence plasmid. Mol Microbiol 6, 1395-1411.[Medline]
Hawley, D. K. & McClure, W. R. (1983). Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res 11, 2237-2255.[Abstract]
Hu, P., Elliott, J., McCready, P., Skowronski, E., Garnes, J., Kobayashi, A., Brubaker, R. R. & Garcia, E. (1998). Structural organization of virulence-associated plasmids of Yersinia pestis. J Bacteriol 180, 5192-5202.
Katayama, S., Dupuy, B., Garnier, T. & Cole, S. T. (1995). Rapid expansion of the physical and genetic map of the chromosome of Clostridium perfringens CPN50. J Bacteriol 177, 5680-5685.[Abstract]
Katz, M. E., Howarth, P. M., Yong, W. K., Riffkin, G. G., Depiazzi, L. J. & Rood, J. I. (1991). Identification of three gene regions associated with virulence in Dichelobacter nodosus, the causative agent of ovine footrot. J Gen Microbiol 137, 2117-2124.[Medline]
Katz, M. E., Strugnell, R. A. & Rood, J. I. (1992). Molecular characterization of a genomic region associated with virulence in Dichelobacter nodosus. Infect Immun 60, 4586-4592.[Abstract]
Katz, M. E., Wright, C. L., Gartside, T. S., Cheetham, B. F., Doidge, C. V., Moses, E. K. & Rood, J. I. (1994). Genetic organization of the duplicated vap region of the Dichelobacter nodosus genome. J Bacteriol 176, 2663-2669.[Abstract]
Li, Z. & Deutscher, M. P. (1994). The role of individual exoribonucleases in processing at the 3' end of Escherichia coli tRNA precursors. J Biol Chem 269, 6064-6071.
Liu, M. Y., Yang, H. & Romeo, T. (1995). The product of the pleiotropic Escherichia coli gene csrA modulates glycogen biosynthesis via effects on mRNA stability. J Bacteriol 177, 2663-2672.[Abstract]
Moses, E. K., Good, R. T., Sinistaj, M., Billington, S. J., Langford, C. J. & Rood, J. I. (1995). A multiple site-specific inversion model for the control of Omp1 phase and antigenic variation in Dichelobacter nodosus. Mol Microbiol 17, 183-196.[Medline]
Mukherjee, A., Cui, Y., Liu, Y., Dumenyo, C. K. & Chatterjee, A. K. (1996). Global regulation in Erwinia species by Erwinia carotovora rsmA, a homologue of Escherichia coli csrA: repression of secondary metabolites, pathogenicity and hypersensitive reaction. Microbiology 142, 427-434.[Abstract]
Ott, M. (1993). Dynamics of the bacterial genome: deletions and integrations as mechanisms of bacterial virulence modulation. Zentbl Bakteriol 278, 457-468.
Pullinger, G. D. & Lax, A. J. (1992). A Salmonella dublin virulence plasmid locus that affects bacterial growth under nutrient-limited conditions. Mol Microbiol 6, 1631-1643.[Medline]
Ritter, A., Blum, G., Emody, L., Kerenyi, M., Bock, A., Neuhier, B., Rabsch, W., Scheutz, F. & Hacker, J. (1995). tRNA genes and pathogenicity islands: influence on virulence and metabolic properties of uropathogenic Escherichia coli. Mol Microbiol 17, 109-121.[Medline]
Rood, J. I., Howarth, P. A., Haring, V. & 7 other authors. (1996). Comparison of gene probe and conventional methods for the diagnosis of ovine footrot. Vet Microbiol 52, 127142.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sun, J., Inouye, M. & Inouye, S. (1991). Association of a retroelement with a P4-like cryptic prophage (retronphage phiR73) integrated into the selenocystyl tRNA gene of E. coli. J Bacteriol 173, 4171-4181.[Medline]
Tian, Q. B., Ohnishi, M., Tabuchi, A. & Terawaki, Y. (1996). A new plasmid-encoded killer gene system: cloning, sequencing, and analyzing hig locus of plasmid Rts1. Biochem Biophys Res Commun 220, 280-284.[Medline]
Zagaglia, C., Casalino, M., Colonna, B., Conti, C., Calconi, A. & Nicoletti, M. (1991). Virulence plasmids of enteroinvasive Escherichia coli and Shigella flexneri integrate into a specific site on the host chromosome: integration greatly reduces expression of plasmid-carried virulence genes. Infect Immun 59, 792-799.[Medline]
Received 2 March 1999;
revised 10 June 1999;
accepted 1 July 1999.