Departments of Medicine and Microbiology, Duke University Medical Center, Durham, NC, USA1
Author for correspondence: Gary M. Cox. Tel: +1 919 681 5055. Fax: +1 919 684 8902. e-mail: gary.cox{at}duke.edu
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Keywords: calcineurin, antisense oligonucleotide, yeast, fungus, pathogenesis
Abbreviations: RACE, rapid amplification of cDNA ends; 5-FOA, 5-fluoroorotic acid
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Antisense repression is a means to alter gene function that works at the level of mRNA rather than at the level of the genomic locus (Inouye, 1988 ; Kuss & Cotter, 1999
; Persidis, 1999
). Antisense repression starts by having single-stranded RNA that is complementary to the target mRNA. The antisense RNA binds to the target mRNA to form an RNARNA duplex, and the target mRNA is inactivated, possibly as a result of degradation or inability to access the translational machinery (Liu & Carmichael, 1994
; Kumar & Carmichael, 1998
).
Antisense repression has several features that can be complementary to the standard methods of gene inactivation using targeted disruption. In conventional gene disruption strategies, especially in an organism like C. neoformans whose genome has many introns, the genomic locus must be cloned. Antisense repression does not require the isolation of the genomic locus, and gene inactivation can be accomplished by using relatively short pieces of coding sequence rather than entire genes. This allows for the use of techniques such as RACE (rapid amplification of cDNA ends) to quickly make constructs for mutagenesis. Another advantage is that antisense repression does not require homologous integration, and it may be especially useful for other fungal organisms in which rates of homologous recombination are very low. Another potential use for antisense repression is the simultaneous inactivation of multiple loci by using a single antisense molecule that targets a sequence common to all of the target mRNAs. For example, a single antisense transcript affected the expression of all three discoidin I genes in Dictyostelium, a feat that otherwise would have required three separate rounds of targeted disruption (Crowley et al., 1985 ). In addition, a single antisense oligonucleotide targeted against the multicopy gene encoding gp90 of Trypanosoma cruzi was able to inhibit function in vivo (Malaga & Yoshida, 2001
). Genes essential for vegetative growth can be identified with antisense repression (Liu et al., 1992
; Tentler et al., 1997
), and this was also recently demonstrated in Candida albicans (DeBacker et al., 2001
). Proving that genes are essential to an organism is extremely complicated since they cannot be easily identified using conventional gene knockout strategies. However, genes essential to the organism may be ideal targets for the development of new antifungal drugs since inhibition of function would confer fungicidal rather than fungistatic activities.
Antisense repression is not only useful as a laboratory tool, but has also been used in vivo as an antibiotic and to alter host gene function. There is currently an FDA-approved medication consisting of antisense oligonucleotides for the treatment of cytomegalovirus (CMV) retinitis (Perry & Balfour, 1999 ), and there are clinical trials in humans that are using antisense oligonucleotides to treat leukaemia and other malignancies (Kuss & Cotter, 1999
). Furthermore, investigators have injected antisense oligonucleotides into experimental animals to alter gene expression of both the host (McKinley et al., 2000
) and the pathogen (Chakraborty et al., 1999
).
In this paper we describe the adaptation of antisense repression to the study of a human-pathogenic fungus, and the potential use of antisense oligonucleotides as antifungals. The availability of this technique should facilitate future molecular studies using Cryptococcus neoformans, and we also propose that antisense repression can be applied to other human-pathogenic fungi. Antisense repression has already proven itself to be valuable in the diploid Candida albicans, where a single transformation event has resulted in altered gene function (DeBacker et al., 2001 ). Antisense repression may also be valuable in molecular studies of other fungi such as Coccidioides immitis and Histoplasma capsulatum where genetic manipulations are much more technically difficult.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Antisense vectors.
The antisense expression vectors (Figs 1 and 2
) were constructed by first amplifying a 310 bp fragment containing the terminator sequence and stop codon from the C. neoformans strain H99 TRP1 (Perfect et al., 1992
) using primers to introduce EcoRI and XbaI sites at the 5' and 3' ends, respectively (CTGAATTCTGAAGGCGGTAAGGGGTTAA and TGTCTAGAGCGACAGAAGAGAAATGGTGA; enzyme sites underlined). The amplicon was digested with EcoRI and XbaI, and cloned into pBluescript SK- (Stratagene). The resulting plasmid was digested with XbaI and SacII, and a fill-in reaction using Taq polymerase was performed. Into this blunt site was cloned a 2012 bp fragment containing the C. neoformans URA5 (Edman & Kwon-Chung, 1990
), which was digested from pCnTEL (Edman, 1992
) using ClaI and EcoRI, and blunt-ended using Taq polymerase. A 624 bp fragment containing the promoter and ATG start site from the C. neoformans strain JEC21 GAL7 (Wickes & Edman, 1995
) was amplified using primers to introduce a KpnI site at the 5' end and NotI, XhoI, StuI and EcoRI sites at the 3' end (GAGGTACCATCACACATTTGTTCCGCCGGT and GAGAATTCAGGCCTCTCGAGAGGCGGCCGCCATTCTCAAGAGGGGATTGAGCGCTGATAA). The amplicon was digested with KpnI and EcoRI and ligated into the plasmid containing URA5 and the TRP1 terminator sequence to result in pJMM170 (Fig. 1a
). An 860 bp fragment containing the promoter and ATG start site from the C. neoformans strain H99 actin gene (Cox et al., 1995
) was amplified using primers to introduce the same sites on the ends as above (ATGGTACCACTCGCTATTGTCCAGGCT and GAGAATTCAGGCCTCTCGAGAGGCGGCCGCCATAGACATGTTGGGCGAGT). The amplicon was digested with KpnI and EcoRI and ligated into the plasmid containing URA5 and the TRP1 terminator sequence to result in pJMM180 (Fig. 2a
). All ligations were confirmed with sequencing.
|
|
Transformation of strains JEC43 and H99R was performed using biolistic DNA delivery of intact plasmid as described by Davidson et al. (2000) . Transformants were selected on minimal medium at 30 °C.
Antisense oligonucleotides having phosphorothioate substitutions were obtained unpurified from the manufacturer (Operon) with the following sequences: CN1, ataCCACATCTTGAGCGACCACAAATAaagC; CN2, gggATGGGGCGTACAATTGAATTGTCggaT; CN4, cgcCAAGCAGTGAGTGGCGGACCTCCAatgG (phosphorothioate-substituted nucleotides in lower case; approximate locations of each oligonucleotide within CNA1 shown in Fig. 1b). Oligonucleotides were suspended in TE buffer, aliquoted and frozen at -20 °C. Yeast experiments using oligonucleotides were done by diluting OligofectAMINE reagent (Life Technologies) 1:5 with RPMI (pH 7·0) medium. Ten microlitres of the diluted reagent was mixed with various concentrations of oligonucleotides and left to incubate at room temperature for 20 min. The oligonucleotide/OligofectAMINE mixtures were then placed into 96-well plates, and 10 µl of a suspension of 106 c.f.u. of strain H99 cryptococci ml-1 was added to each well. The total volume of each well was adjusted to 100 µl with RPMI, and the plates were incubated for 24 h at 37 °C with shaking. Growth was assessed using duplicate quantitative cultures. Each experiment was repeated three separate times and the data were averaged.
![]() |
RESULTS AND DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Demonstration of antisense effect
The calcineurin transformants were screened for phenotype on glucose- and galactose-containing media at both 30 °C and 37 °C (Fig. 3). A cna1 strain (MCC1), wild-type and an empty vector transformant (transformed with pJMM170 alone) were used as controls. The cna1 strain demonstrated the expected phenotype of no growth at 37 °C on both YEPD and YEPGal, whereas the empty vector control was able to grow on both media at both temperatures (Fig. 3
). Ten independent transformants containing the full-length CNA1 antisense construct (pCNA-full) were able to grow on both YEPD and YEPGal at 30 °C and YEPD at 37 °C (data for five of these are shown in Fig. 3
). However, the antisense transformants were not viable under conditions of induction (YEPGal) at 37 °C (Fig. 3
).
|
The laccase antisense construct was used to transform the serotype A strain H99R. Twelve randomly selected transformants were screened on dopamine agar with H99 (wild-type), a lac1 strain (HCM6) and an empty vector transformant as controls (Fig. 4). Eleven of the twelve antisense transformants had the albino phenotype of the lac1 strain, and one appeared to make melanin near wild-type levels (Fig. 4
).
|
|
|
Using the antisense vector to target CNA1 in a serotype D strain and LAC1 in a serotype A strain, we were able to demonstrate that the function of these genes could be altered by antisense repression. This was demonstrated by the fact that transformants containing the antisense vector had the expected phenotype of the corresponding knockout mutants. In the case of the calcineurin antisense mutants, the antisense phenotype was only observed under the conditions of induction of the antisense transcript. Furthermore, the level of CNA1 mRNA in an antisense transformant was markedly decreased only when the cells were grown under the conditions of induction, suggesting that the native mRNA was destroyed by the antisense transcripts. The use of an inducible promoter not only helps with demonstrating that antisense repression is responsible for the observed phenotypes, but also provides for the screening of essential genes. Antisense repression seems broadly applicable for use in C. neoformans since we have demonstrated success by targeting different genes in both of the main serotypes used in molecular studies of this yeast.
We were able to target CNA1 using antisense repression by using both whole and partial cDNA sequences as template for the antisense transcripts. Because one potential use of antisense repression is to screen cDNA libraries for phenotypes of interest, it was important to verify that partial cDNA sequences, especially from the 3' portion of the gene, can be used in antisense repression. It is difficult to predict how small an antisense transcript can be and still disrupt gene function since the efficiency of binding to the target mRNA is dependent on multiple different factors including copy number of the native mRNA and secondary structure. It is also likely that genes differ widely in the number of mRNA copies that are necessary for wild-type function. Antisense repression probably cannot completely abolish all native mRNAs, and some genes may have wild-type function with only very few copies of mRNA present, whereas other genes may require many copies. It appears that the C. neoformans CNA1 may be an example of the latter possibility. The Northern blots of transformants grown under the conditions of induction show that the levels of the native CNA1 mRNA were very low, but still detectable. However, the transformants were still unable to grow at high temperatures, suggesting that high levels of message are needed for wild-type expression of this particular phenotype.
In order to test whether very small pieces of DNA could also be used in antisense repression in C. neoformans, we used 30 bp oligonucleotides complementary to various parts of CNA1. We used sequences that were predicted to have low secondary structure so as to select for parts of the target mRNA that are more likely to bind the antisense oligonucleotide. The sugars of the terminal three nucleotides had phosphorothioate substitutions in order to increase resistance to nucleases, and thus increase stability within the cell. Only one of the three oligonucleotides appeared to have any significant effect on growth at 37 °C, and the associated growth defect was relatively modest. There did appear to be non-specific toxicities associated with high concentrations of oligonucleotides, as demonstrated by the yeast exposed to 400 µg ml-1 of the T7 oligonucleotide. However, the growth defect at 37 °C associated with the CN4 oligonucleotide does not appear to be a non-specific toxicity since yeast grown with the same concentration of the CN4 oligonucleotide did not have a growth defect at 30 °C. The fact that the CN1 and CN2 oligonucleotides did not appear to affect growth as compared to both the T7 and no-oligonucleotide controls also supports the absence of non-specific toxicities at the 40 µg ml-1 concentration. Therefore, we have demonstrated that a biological effect on growth can be achieved in this pathogenic yeast with antisense oligonucleotides.
There are two possible reasons why the antisense effect using the CN4 oligonucleotide was so much less pronounced than when using the integrated antisense vectors. The much smaller sizes of the oligonucleotides as compared to the antisense transcripts are likely to result in less effective targeting of the native mRNA. Furthermore, the introduced antisense oligonucleotides need to be taken up by the yeasts, whereas the antisense transcripts are produced in high numbers within the nucleus. We used the OligofectAMINE reagent with the oligonucleotides to form transformation complexes in an effort to increase delivery to the yeasts since this has apparently worked with a variety of cultured eukaryotic cells (unpublished data provided by the manufacturer). However, it seems clear that in order to optimize antisense oligonucleotides for use as antifungal agents, there will have to be technological advances in the delivery of oligonucleotides to yeast. There will also have to be careful mapping of selected genes in order to identify short sequences that can be targeted with high efficiency. Ideally, the targeted sequences would be conserved across a wide range of fungi so that the oligonucleotide would have a broad spectrum of action. It is possible that antisense oligonucleotides may be useful as adjuncts to standard antifungals in the treatment of infections.
![]() |
ACKNOWLEDGEMENTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Chakraborty, R., Dasgupta, D., Adhya, S. & Basu, M. K. (1999). Cationic liposome-encapsulated antisense oligonucleotide mediates efficient killing of intracellular Leishmania. Biochem J 340, 393-396.[Medline]
Cox, G. M., Rude, T. H., Dykstra, C. C. & Perfect, J. R. (1995). The actin gene from Cryptococcus neoformans: structure and phylogenetic analysis. J Med Vet Mycol 33, 261-266.[Medline]
Crowley, T. E., Nellen, W., Gomer, R. H. & Firtel, R. A. (1985). Phenocopy of discoidin I-minus mutants by antisense transformation in Dictyostelium. Cell 43, 633-641.[Medline]
Cruz, M. C., Sia, R. A. L., Olson, M., Cox, G. M. & Heitman, J. (2000). On the roles of calcineurin in physiology and virulence in serotype D compared to serotype A strains of Cryptococcus neoformans. Infect Immun 68, 982-985.
Davidson, R. C., Cruz, M. C., Sia, R. A., Allen, B., Alspaugh, J. A. & Heitman, J. (2000). Gene disruption by biolistic transformation in serotype D strains of Cryptococcus neoformans. Fungal Genet Biol 29, 38-48.[Medline]
DeBacker, M. D., Nelissen, B., Logghe, M. & 10 other authors (2001). An antisense-based functional genomics approach for identification of genes critical for growth of Candida albicans. Nat Biotechnol 19, 235241.[Medline]
Edman, J. C. (1992). Isolation of telomerelike sequences from Cryptococcus neoformans and their use in high-efficiency transformation. Mol Cell Biol 12, 2777-2783.[Abstract]
Edman, J. C. & Kwon-Chung, K. J. (1990). Isolation of the URA5 gene from Cryptococcus neoformans var. neoformans and its use as a selective marker for transformation. Mol Cell Biol 10, 4538-4544.[Medline]
Inouye, M. (1988). Antisense RNA: its functions and applications in gene regulation. Gene 72, 25-34.[Medline]
Kumar, M. & Carmichael, G. G. (1998). Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes. Microbiol Mol Biol Rev 62, 1415-1434.
Kuss, B. & Cotter, F. (1999). Antisense time to shoot the messenger. Ann Oncol 10, 495-503.[Medline]
Liu, Z. & Carmichael, G. G. (1994). Nuclear antisense RNA. Mol Biotechnol 2, 107-118.[Medline]
Liu, T., Williams, J. G. & Clarke, M. (1992). Inducible expression of calmodulin antisense RNA in Dictyostelium cells inhibits the completion of cytokinesis. Mol Biol Cell 3, 1403-1413.[Abstract]
Malaga, S. & Yoshida, N. (2001). Targeted reduction in expression of Trypanosoma cruzi surface glycoprotein gp90 increases parasite infectivity. Infect Immun 69, 353-359.
McKinley, M. J., Guzzo-Pernell, N. & Sinnayah, P. (2000). Antisense oligonucleotide inhibition of angiotensinogen in the brains of rats and sheep. Methods 22, 219-225.[Medline]
Odom, A., Muir, S., Lim, E., Toffaletti, D. L., Perfect, J. R. & Heitman, J. (1997). Calcineurin is required for virulence of Cryptococcus neoformans. EMBO J 16, 2576-2589.
Perfect, J. R. (1996). Fungal virulence genes as targets for antifungal chemotherapy. Antimicrob Agents Chemother 40, 1577-1583.[Abstract]
Perfect, J. R., Rude, T. H., Penning, L. M. & Johnston, S. A. (1992). Cryptococcus neoformans TRP1 gene by complementation in Saccharomyces cerevisiae. Gene 122, 213-217.[Medline]
Perry, C. M. & Balfour, J. A. (1999). Fomivirsen. Drugs 57, 375-380.[Medline]
Persidis, A. (1999). Antisense therapeutics. Nat Biotechnol 17, 403-404.[Medline]
Rosas, A. L., Nosanchuk, J. D., Feldmesser, M., Cox, G. M., McDade, H. M. & Casadevall, A. (2000). Synthesis of polymerized melanin by Cryptococcus neoformans in rodents. Infect Immun 68, 2845-2853.
Salas, S. D., Bennett, J. E., Kwon-Chung, K. J., Perfect, J. R. & Williamson, P. R. (1996). Effect of the laccase gene, CNLAC1, on virulence of Cryptococcus neoformans. J Exp Med 184, 377-386.[Abstract]
Tentler, S., Palas, J., Enderlin, C., Campbell, J., Taft, C., Miller, T. K., Wood, R. L. & Selitrennikoff, C. P. (1997). Inhibition of Neurospora crassa growth by a glucan synthase-1 antisense construct. Curr Microbiol 34, 303-308.[Medline]
Wickes, B. L. & Edman, J. C. (1995). The Cryptococcus neoformans GAL7 gene and its use as an inducible promoter. Mol Microbiol 16, 1099-1109.[Medline]
Received 4 May 2001;
revised 5 September 2001;
accepted 11 September 2001.