Research School of Biosciences, University of Kent, Canterbury, Kent CT2 7NJ, UK1
Centro de Genética e Biologia Molecular, Universidade de Lisboa, Portugal2
Author for correspondence: Mick F Tuite. Tel: +44 1227 823699. Fax: +44 1227 763912. e-mail: M. F.Tuite{at}ukc.ac.uk
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Keywords: SUP35 gene, polyQ, translation termination, [PSI+] determinant
The GenBank accession numbers for the sequences determined in this work are AF020554 (CaSUP35 gene) and AY028660AY028673 (CaSUP35 N domains).
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The SUP35 gene was originally identified in an S. cerevisiae screen for recessive mutations which impaired the maintenance of translation fidelity (Hawthorne & Leupold, 1974 ). The encoded Sup35p protein was subsequently shown to be a subunit of the eukaryotic release factor forming a heterodimer with a second subunit, Sup45p (also called eRF1) that functions in translation termination at all three stop codons (Stansfield et al., 1995b
; Zhouravleva et al., 1995
). Wickner (1994)
suggested that Sup35p, an essential component of the translation machinery, might be a prion protein responsible for the translation-termination-related [PSI+] phenotype of S. cerevisiae. This hypothesis has now been confirmed by a wide range of biochemical and genetical studies (reviewed by Wickner & Chernoff, 1999
).
[PSI+] strains have an elevated level of suppressor tRNA-mediated readthrough of nonsense codons compared with wild-type [psi-] strains (Cox, 1965 ; Firoozan et al., 1991
). Analysis of a mutation located in the SUP35 gene (Doel et al., 1994
), coupled with the demonstration that the deletion of the non-essential N-terminus of the protein (Ter-Avanesyan et al., 1994
) eliminated both the [PSI+] phenotype and the increased de novo appearance of [PSI+] following SUP35 overexpression (Chernoff et al., 1993
), showed that SUP35 is the [PSI] determinant. In [PSI+] strains, the majority of the cellular pool of Sup35p, not associated with Sup45p and/or the ribosome, is present as part of a high-molecular-mass aggregate which is incompatible with its translation release factor activity, leading to the translation-termination-associated phenotype characteristic of [PSI+] mutants (Patino et al., 1996
; Paushkin et al., 1996
, 1997
). The conversion of soluble Sup35p to the aggregated prion form is promoted by a yet-to-be fully defined conformational change in Sup35p and is driven by the accumulating altered conformer (Serio et al., 2000
; Sparrer et al., 2000
). Such a self-catalysed propagation of an altered protein conformer parallels the behaviour of the mammalian prion protein PrP (reviewed by Prusiner et al., 1998
).
Analysis of the known eukaryotic Sup35p protein sequences suggests they all contain two distinct regions: an evolutionarily conserved C-terminus, which in S. cerevisiae is essential for translation termination and hence cell viability, and a less conserved N-terminal extension of varying length and amino acid composition (Kushnirov et al., 1988 ; Wilson & Culbertson, 1988
). The prion conversion of Sup35p is promoted by this N-terminal prion-forming domain (PrD) of Sup35p (reviewed by Tuite, 2000
), a region of the protein molecule which is not required for eRF3 activity (Ter-Avanesyan et al., 1993
). Within the Sup35p PrD lie a series of five nonapeptide repeats with the core motif GGYQQ. Deletion of the repeat-containing region leads to an inability of the otherwise functional Sup35p to be propagated in its prion-like form (Ter-Avanesyan et al., 1993
) and we have recently shown that deletion of even one of the nonapeptide repeats leads to loss of the prion-like behaviour of Sup35p (Parham et al., 2001
). Intriguingly the human prion protein PrP also contains a series of sequence-related octapeptide repeats near its N-terminus which have also been implicated in mammalian prion propagation (Flechsig et al., 2000
).
Studies on Sup35p have recently been extended to a variety of other fungal species, including Candida albicans and Pichia methanolica (Santoso et al., 2000 ; Kushnirov et al., 2000
; Chernoff et al., 2000
). These studies have indicated that the N-terminal regions of these Sup35p homologues have diverged considerably from the S. cerevisiae Sup35p PrD at the amino acid sequence level although they are still Gln/Asn rich. Interestingly, the CaSup35p NM sequence reported by Santoso et al. (2000)
also contained a number of short poly(Gln) sequences. Replacing the ScSup35p N or NM region with the corresponding heterologous Sup35p region did not prevent the chimaeric Sup35p from forming a prion-like aggregate in S. cerevisiae, although such aggregates could only be induced by the overexpression of the corresponding heterologous Sup35p sequence. That overexpression of the ScSup35p NM region did not induce the formation of the chimaeric Sup35p aggregates was taken as evidence for a barrier to interspecies prion propagation in yeasts. Furthermore, Santoso et al. (2000)
showed that replacing a region of the CaSup35p N domain with residues 826 from the ScSup35p N domain overcame this barrier to seeding by ScSup35p NM. Further studies by Chien & Weissman (2001)
have indicated that this species barrier is probably due to the different Sup35p N domains forming distinct, non-interacting conformations with the S. cerevisiae protein. While the aggregation of chimaeric Sup35p protein can be seeded by homologous N domains in S. cerevisiae, there is no evidence that the full-length heterologous Sup35p behaves in the same way in S. cerevisiae or is able to establish a prion-like state in its natural host.
To further address the question of the conservation of function and prion-like properties of Sup35p in fungal species other than S. cerevisiae, we have isolated and characterized the full-length SUP35 gene from C. albicans (CaSUP35). This species of yeast, although closely related to S. cerevisiae, is pathogenic in man and is frequently encountered as a commensal of the human digestive system and vaginal tract (Smith, 1989 ). It has thus evolved to colonize distinct ecological niches to those of S. cerevisiae.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Genotypes of the S. cerevisiae strains used in this work and their origins are shown in Table 1. The diploid strain MT26 was obtained by mating the two haploid strains BSC783/4a and BSC783/4c. MT26.4 is a derivative of MT26 in which one of the SUP35 alleles was deleted and replaced with a kanMX4 allele, as described below. The haploid strains MT26.4/3c and MT26.4/5c were recovered from the meiotic progeny of MT26.4 transformed with pDR4, a centromeric plasmid containing the URA3 and the C. albicans SUP35 gene (see below and Table 3). The haploid strain MT700/9d [PSI+] was recovered from the meiotic progeny of the diploid strain MT700 transformed with pYK810, a centromeric plasmid containing the URA3 and the S. cerevisiae SUP35 genes (Kikuchi et al., 1988
; Table 3). The MT700/9d [psi-] derivative was created by growth in the presence of 3 mM GuHCl (Tuite et al., 1981
). The diploid strain MT700 was obtained by crossing MT26.4/3c with BSC772/18c. Table 2
provides details of all laboratory and clinical strains of C. albicans used in this study.
|
|
Recombinant DNA techniques.
Standard protocols were used for nucleic acid isolation, electrophoresis, fragment purification, restriction enzyme digestion, Southern blotting and PCR (Sambrook et al., 1989 ). Restriction enzymes and Taq DNA polymerase (Expand) were purchased from Boehringer Mannheim. For Southern hybridization analysis of isolated plasmid DNA, DNA probes were labelled with DIG-11-dUTP (Boehringer Mannheim) using the random primer method (Feinberg & Vogelstein, 1983
) and following the manufacturers instructions. Hybridization was carried out using a nylon membrane (Hybond-N; Amersham) according to the manufacturers instructions, as was luminescent detection (Boehringer Mannheim) of bound probe. For Southern blot analysis of C. albicans genomic DNA, a CaSUP35 gene probe was obtained from the plasmid pDR4 (Table 3
) as a 2 kb SpeIKpnI fragment and labelled with [
32P]dCTP by the random primer method (Amersham), according to the manufacturers instructions.
|
The plasmid pDR1 identified by this strategy further resulted in simultaneous loss of the suppression phenotype for several other ochre mutations in the strain, i.e. ade2-1, his5-2 and lys1-1. pDR1 transformants were then assayed for co-loss of the complementing phenotype simultaneously with loss of the pDR1 plasmid-borne URA3 marker following culturing in non-selective YPD medium. Transformation of a second strain JDS3-15 (Table 1) was used to confirm the complementing phenotype of pDR1.
The cloned CaSUP35 gene was sequenced by the chain-termination method (Sanger et al., 1977 ) by either Advanced Biotechnology Centre (Charing Cross & Westminster Medical School, London, UK) or MWG Biotech (Milton Keynes, UK). A variety of subclones derived from pDR1 were generated to facilitate gene localization and DNA sequencing. Both strands of the CaSUP35 gene were sequenced and the sequence data deposited at GenBank (accession no. AF020554). The N domains of the CaSUP35 gene were PCR-amplified from 14 different C. albicans strains (Table 2
), using high fidelity Pwo polymerase (Roche) with a 3' to 5' proofreading activity, and oligonucleotide primers NTCaSUP35I (ACTGACGGATCCGCTTGGAATGAGGTCTTC) and NTCaSUP35III (CAGGAGCTGGAGCTGGAGAT). Both strands of each of the CaSUP35 N domains were sequenced and the sequence data deposited with GenBank (accession nos AY028660AY028673).
Plasmid constructions.
Plasmid pDR2 was made by subcloning a 5·2 kb BamHISalI fragment from plasmid pDR1 into plasmid pRS416 (Sikorski & Hieter, 1989 ). This DNA fragment carried a region showing homology to the S. cerevisiae SUP35 (ScSUP35) gene probe as detected by the Southern blot analysis (data not shown). A 1·3 kb EcoRV fragment that did not hybridize to the ScSUP35 gene was deleted from the plasmid pDR2 to produce the URA3-based centromeric plasmid pDR4. The multicopy plasmid pDR6, containing the complete CaSUP35 gene, was constructed by subcloning the 3·9 kb BamHISalI fragment from pDR4 into the LEU2d-2µ plasmid pMA3a (Spalding & Tuite, 1989
). Plasmid pUKC1530 contained the complete CaSUP35 gene, including the promoter, cloned into pRS313 (Sikorski & Hieter, 1989
) as a BamHISalI fragment generated from plasmid pDR4.
Plasmid pUKC1530-C, expressing the C domain of CaSup35p, was constructed as follows. The fragment containing the CaSUP35 C domain was PCR-amplified from plasmid pDR4 using oligonucleotide primers CaSUP35SpeI (GAAGATACTAGTGACGAAGAAGTTGTCAAG) and CaSUP35SacI (GAGAAAGAGCTCCCGTTGACTCCATTGAGTTC) bearing extensions with SpeI and SacI restriction sites respectively (underlined). The suitably digested amplified fragment was then inserted into the plasmid pUKC1508 (with the SUP35 promoter inserted into pRS313) to generate pUKC1530-C.
Construction of an S. cerevisiae SUP35 gene deletion strain for plasmid shuffling.
The sup35::kanMX4 gene disruption was constructed by a directed PCR-mediated gene deletion strategy (Wach et al., 1994 ) using the plasmid pFA6a-KanMX4 as template. The PCR primers used were: S1, TGCTCGGAATAACATCTATATCTGCCCACTAGCAACAATGCGTACGCTGCAGGTCGAC; and S2, ATTATTGTGTTTGCATTTACTTATGTTTGCAAGAAATTTAATCGAT-GAATTCGAGCTCG. Oligonucleotides S1 and S2 were designed such that their 5' regions were complementary to the sequence flanking the chromosomal SUP35 coding sequence, while the 3' portions were complementary to the sequence flanking the kanMX4 cassette. The resulting PCR-amplified 1·59 kb kanMX4 cassette, with flanking extensions homologous to the sequences flanking the ScSUP35 gene, was then transformed into strain MT26 (Table 1
) and sup35::kanMX4/SUP35 heterozygous transplacements selected on YPD + G418 (200 µg ml-1) plates and verified by PCR (data not shown). The PCR primers used were: A1, CGCATTAGCTCGCTATTTG; A2, GCTGATTGTTGCCTTGG; A3, GAGAGATCAAGGTACCAC; A4, GATGATGATGATGCCGAG; K2, GATTGCCCGACATTATCGCG; and K3, TATGGAACTGCCTCGGTG. Primers A1A4 were complementary to the ScSUP35 sequence while K2 and K3 were complementary to the kanMX4 cassette and were designed for PCR verification of the expected sup35::kanMX4 replacement. The resulting kanamycin-resistant diploid strain, MT26.4, was then transformed with pDR4 (Table 3
), and two haploid spores with the sup35::kanMX4 disruption carrying the pDR4 plasmid (designated MT26.4/3c and MT26.4/5c; Table 1
) were identified amongst the meiotic progeny.
Plasmid shuffling to test CaSup35p function.
SUP35 genes were introduced either into the S. cerevisiae haploid strain MT700/9d (both [PSI+] and [psi-] derivatives: Table 1; Parham et al., 2001
), which carried both the sup35::kanMX allele and the viability-maintaining, single-copy plasmid pYK810 (Kikuchi et al., 1988
) bearing the ScSUP35 and URA3 genes, or into the [psi-] strains MT26.4/3c or /5c carrying the plasmid pDR4 (Table 3
). These strains were transformed with the various plasmid constructs carrying the HIS3 marker and one or other of the different SUP35 genes. His+ transformants were selected in SD-His medium, and single transformants were then spread onto both solid SD-His medium and YPD medium containing 5-fluoroorotic acid (1 g l-1), selecting for strains that had lost the URA3-containing plasmid (Kaiser et al., 1994
).
Western blot analysis.
Yeast protein extracts were prepared and fractionated into soluble and pelletable (i.e. insoluble) fractions by centrifugation essentially as described by Parham et al. (2001) . Protein samples were analysed using 10% SDS-polyacrylamide gels and electrophoretically transferred to nitrocellulose (Sartorius) for Western blot analysis, employing polyclonal antiserum raised against ScSup35p expressed in E. coli, essentially as described by Stansfield et al. (1995a
, b
). Anti-rabbit secondary antibody was purchased from Amersham. The ECL reagent (Amersham) was used for detection of bound antibody according to the manufacturers protocols. Molecular masses of proteins were estimated using pre-stained molecular mass markers (Sigma).
Preparation of yeast ribosomes and post-ribosomal supernatants.
Both S. cerevisiae and C. albicans strains were grown at 30 °C in YPD to a density of 12x107 cells ml-1 and harvested by centrifugation. Total cell lysates were then prepared in A buffer (25 mM Tris pH 7·2, 50 mM KCl, 5 mM MgCl2, 5 mM ß-mercaptoethanol, 10 mM PMSF) essentially as described by Stansfield et al. (1992) and loaded onto a sucrose cushion (15%, w/v, sucrose; 25 mM Tris pH 7·2, 150 mM KCl, 5 mM MgCl2, 5 mM ß-mercaptoethanol). After high-speed centrifugation (100000 g, 5 h at 4 °C in a fixed-angle rotor), the resulting post-ribosomal supernatant was divided into aliquots and the ribosomal pellet resuspended in A buffer.
Quantification of nonsense suppression levels in vivo.
Yeast strains were transformed with one or other of the two read-through assay vectors, pUKC815-L or pUKC817-L (Stansfield et al., 1995a ). The single-copy vector pUKC815-L carries the lacZ gene under the control of the constitutive PGK promoter. The read-through vector pUKC817-L has an in-frame premature ochre (TAA) termination codon at the PGKlacZ junction. The degree of nonsense codon suppression was determined essentially as described by Stansfield et al. (1995a
). Units of ß-galactosidase activity were calculated according to Miller (1972)
. ß-Galactosidase activity was expressed as a percentage of the control activity (i.e. that of strains bearing the control vector pUKC815-L).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Hybridization experiments with digested total genomic DNA from C. albicans strain 2005E, probed with a 2 kb SpeIKpnI fragment containing the CaSUP35 gene, demonstrated that CaSUP35 was present as a single copy sequence (data not shown). Northern blot analysis confirmed that CaSUP35 encodes a single 2400 nt mRNA transcript (data not shown).
CaSUP35 can provide the essential eRF3 function in S. cerevisiae
The ability of the CaSUP35 gene to supply the essential Sup35p function to an S. cerevisiae strain carrying a sup35::kanMX disruption was tested. The CaSUP35 gene should be efficiently and authentically translated in S. cerevisiae since there are no CUG codons in the coding sequence; the CUG codon is exclusively decoded as Ser rather than Leu in C. albicans (Santos & Tuite, 1995 ). A diploid strain MT26.4 (Table 1
), heterozygous for a sup35::kanMX deletion, was constructed and transformed with pDR4, a URA3-based CEN-plasmid carrying the CaSUP35 gene (Table 3
). Viable haploid progeny carrying the sup35::kanMX disruption were obtained and found to be incapable of growing in the presence of 5-fluoroorotic acid, confirming that their growth depended on retention of the plasmid-borne CaSUP35 gene. The sup35::kanMX pDR4-containing haploid progeny showed a weak allosuppressor phenotype (i.e. pink colonies, weak growth in the absence of adenine), indicating that CaSup35p is unable to fully restore efficient translation termination in the absence of ScSup35p. This did not simply reflect a lower steady-state level of the heterologous Sup35p since Western blot analysis of a sup35::kanMX, pDR4 strain, using an anti-ScSup35p, confirmed the expression of CaSup35p in S. cerevisiae (Fig. 2
) to a level approximately equivalent to the endogenous ScSup35p. Neither was the allosuppressor phenotype due to the formation of [PSI+] since growth of this transformant in 3 mM GuHCl, a treatment known to cure yeast cells of the [PSI+] determinant (Tuite et al., 1981
), had no effect on the allosuppression phenotype.
|
|
|
Analysis of the CaSup35p levels in both the yeast and hyphal phases of C. albicans indicated that this translation factor is not differentially expressed between the two morphological forms (Fig. 2, lanes 4 and 5). Swoboda et al. (1994)
reported similar findings for the translation elongation factor eEF-3.
The CaSUP35 gene does not sustain the [PSI+] determinant in S. cerevisiae
It has been previously shown by others that overexpression of the CaSUp35p N domain in S. cerevisiae does not induce the de novo conversion of endogenous ScSup35p to form the [PSI] determinant (Santoso et al., 2000 ; Chien & Weissman, 2001
). To determine whether overexpression of the full-length CaSup35p in S. cerevisiae might be more effective as a cross-species seeding agent we utilized the strain MT700/9d. This haploid strain carries a sup35::kanMX disruption, with viability being maintained by the single-copy plasmid pYK810 carrying the wild-type ScSUP35 gene (see Methods). Starting with either a [PSI+] or a [psi-] derivative of this strain, in conjunction with a plasmid-shuffling strategy (Parham et al., 2001
) we introduced either a single-copy plasmid (pUKC1530) or a multicopy plasmid (pDR6) carrying the full-length CaSUP35 gene into both strains. Following elimination of the ScSUP35-bearing plasmid pYK810, the CaSup35p was unable to induce or sustain the [PSI+] phenotype in either strain, even when introduced on a multicopy plasmid (Fig. 4a
). In a control experiment, the introduction of the ScSUP35 gene on plasmid pYK810 maintained [PSI+] after plasmid shuffling (Fig. 4a
). The weak termination defect (i.e. allosuppression) associated with the pDR4 transformant (see above) was also observed with the pUKC1530 transformant although, as with the pDR4 transformant, this phenotype was not eliminated following growth on 3 mM GuHCl (Tuite et al., 1981
) confirming this was not a [PSI+]-associated phenotype. In strains carrying the multicopy plasmid pDR6, this allosuppression phenotype was no longer detected. Thus, full-length CaSup35p cannot be seeded by ScSup35p [PSI+] aggregates in vivo to undergo the necessary conformational change required to sustain Sup35p aggregates (i.e. the [PSI] determinant) in S. cerevisiae.
|
Natural variation in the N domain of CaSup35p
To determine whether the amino acid sequence of the N domain of CaSup35p was conserved between different strains of this pathogenic fungal species we next PCR-amplified the region of the CaSUP35 gene encoding amino acids 1143 from 14 different clinical strains obtained from a variety of sources (Table 2) using a high-fidelity Taq polymerase (Pwo) with a 3' to 5' exo-proofreading activity. Among the 14 strains analysed eight different CaSUP35 alleles were observed (Fig. 5
). Most significantly, there were four alleles with differing numbers of Gln residues in the largest of the poly(Gln) repeat regions in the N domain (Fig. 1a
; amino acids 2730) with lengths of 7, 9, 11 and 13 residues. The other four variants noted were single amino acid substitutions at positions 2, 6 and 12 in the region N-terminal to the variable-length poly(Gln) repeat region, and at position 93 within one of the copies of the repeated GGYQQ motif.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The ScSup35p molecule appears to have three distinct functional domains, N, M and C. These were originally annotated on the basis of the location of the first three Met residues in the ScSup35p sequence, Met1, Met124 and Met 254 (Kushnirov et al., 1988 ; Wilson & Culbertson, 1988
). Although the equivalent N region of the CaSup35p contains an additional Met residue (Met 15; Fig. 1a
), the Met residues at positions 144 and 300 in the CaSup35p sequence correspond to the Met residues used to define the N, M and C regions of ScSup35p. The C domain of ScSup35p (amino acids 254685) is known to carry the function with regard to translation termination (Ter-Avanesyan et al., 1993
) and we show here that the equivalent C domain of CaSup35p also carries the same essential function (Fig. 4b
). Both the CaSup35p and the ScSup35p C domains show significant amino acid identity to translation elongation factor eEF1A (Kushnirov et al., 1988
; Wilson & Culbertson, 1988
; Ter-Avanesyan et al., 1993
). While the role of eEF1A is well defined in the translation elongation cycle, the exact role of ScSup35p, and more specifically its essential C domain, in translation termination remains to be established. The presence of GTP-binding domains, which are conserved between eEF1A and Sup35p from both S. cerevisiae and C. albicans, implies that GTP hydrolysis is required for Sup35p activity although, as with other translation factors with such G domains, this may simply regulate binding of the substrate, which, in this case, would be Sup45p (eRF1) and/or the ribosome.
The failure of the CaSup35p to fully restore efficient translation termination in either an S. cerevisiae sup35 null mutant or a sal3-4 mutant, as defined by the weak nonsense suppressor phenotype, is not a consequence of lower cellular levels of the heterologous Sup35p (Fig. 2). Rather, it may simply reflect lower efficiency of binding to Sup45p (eRF1) or another, yet-to-be defined, component of the translation termination machinery. Overexpression of CaSup35p does however restore efficient termination (Fig. 4a
), suggesting that a combination of lower efficiency of initial binding between CaSup35p and ScSup45p with the elevated level of CaSup35p in this strain ensures that a level of functional CaSup35pScSup45p complex is formed sufficient to allow for efficient termination of translation.
The N domain of CaSup35p
CaSup35p has an N domain of 143 aa which shows many of the sequence features of the well-defined N-terminal prion-forming domain (PrD) of ScSup35p (Tuite, 2000 ). In particular, there is a high content of Gln and Asn residues (53%) and a low content of charged residues (5%). Between the PrD and the essential C domain lies the functionally undefined M domain, whose role in ScSup35p function in termination is dispensable although it remains to be established whether this part of the protein contributes to the prion-like behaviour of ScSup35p. The ScSup35p M domain is 130 aa in length and is highly charged, with Lys and Glu representing 36% of the residues. The corresponding region in CaSup35p is some 26 residues longer, with 26% of the residues being Lys and Glu. Alignment between the putative M regions of published fungal Sup35p sequences shows little evidence of evolutionary conservation of primary sequence, although a consistent feature is a high proportion of Lys and Glu residues (data not shown).
Santoso et al. (2000) have recently shown that a chimaeric Sup35p containing the NM domain of CaSup35p (amino acids 1299) and the C domain of ScSup35p could not be incorporated into endogenous ScSup35p prion aggregates in a [PSI+] strain. Furthermore, these authors have now shown that this apparent species barrier is probably the consequence of differences in conformation and hence seeding potential (Chien & Weissman, 2001
). In our experiments reported here, we demonstrate that full-length CaSup35p is similarly unable to be seeded by the endogenous ScSup35p prion even when overexpressed (Fig. 4a
). This would suggest that the lack of the CaSup35p C domain in the recombinant molecules used in the cross-seeding experiments of Santoso et al. (2000)
did not alter the inter- or intramolecular interactions required for aggregate formation, ruling out the need for an interaction between the CaSup35p N and C domains in prion aggregation. This would in turn rule out a role for the C domain in establishing the species barrier to fungal prion propagation. We have recently shown that replacing the CaSup35p M domain in a hybrid Sup35p molecule with the ScSup35p M domain does not overcome this potential species barrier (C. Resende, S. N. Parham & M. F. Tuite, unpublished data). However, Santoso et al. (2000)
showed that a CaSup35pNMGFP fusion protein, when expressed at high levels, was able to form prion-like foci in both [PSI+] and [psi-] cells with similar kinetics. This finding demonstrates that the CaSup35pNM region can direct self-aggregation in vivo, but its polymerization requires no interaction with the endogenous ScSup35p.
Given the similarity in amino acid composition between the PrD of ScSup35p and CaSup35p, and in particular the presence of related repeat sequences (with the core motif of GGYQQ) in both, it is perhaps surprising that the CaSup35p is not seeded by ScSup35p. Santoso et al. (2000) demonstrated that replacement of a short region of the CaSup35pN domain with the 19 aa between residues 8 and 26 from the ScSup35pN domain generated a CaSup35pNMGFP fusion protein whose aggregation could now be seeded by the endogenous ScSup35p. Their data suggest that a region of the N domain of Sup35p N-terminal to, but excluding, the oligopeptide repeats, plays a key role in driving prion conversion of Sup35p. This region shows no amino acid sequence identity between the ScSup35p-PrD and the CaSup35p-PrD, and the corresponding region in the ScSup35p N domain has a significantly higher proportion of Gln and Asn residues than the corresponding CaSup35p region. These differences may be sufficient to inhibit the conformational conversion event even though the heterologous N domain may be able to physically interact via the conserved oligopeptide repeats (see below).
As suggested by the experiments of Chien & Weismann (2001) the failure to efficiently recruit the newly synthesized CaSup35p molecules into the pre-existing ScSup35p aggregates in a [PSI+] strain is probably due to the different conformations these two proteins take up in the cell. More specifically, the underlying problem may be the different folding intermediates that predispose the nascent polypeptide chains to conformational conversion in vivo. Structure prediction suggests that both the ScSup35p and the CaSup35p N domains are highly flexible and unstructured regions. However, an important requirement for prion establishment and maintenance in S. cerevisiae is a dependence upon a certain wild-type level of the molecular chaperone Hsp104 (Chernoff et al., 1995
). Thus, in S. cerevisiae, the newly synthesized CaSup35p may be unable to access one or more of the components of the protein-folding machinery to which the ScSup35pN domain has been evolutionarily tuned.
One of the most intriguing features of the ScSup35p PrD is the presence of five copies of a 9 aa repeat with a conserved core motif of GGYQQ. This highly repeated core motif is also present in multiple copies in the N domain of the CaSup35p (Fig. 1b). Deletion analysis of the equivalent ScSup35p repeats has led us to propose that these repeats mediate the Sup35pSup35p interactions that precede the conformational conversion event that leads in turn to aggregate formation (Parham et al., 2001
). Even deletion of one repeat, although not preventing interaction with the wild-type ScSup35p PrD, does prevent interaction with similarly deleted ScSup35pPrD molecules. That the CaSup35p is unable to interact with the wild-type ScSup35p to form aggregates would suggest that multiple copies of the GGYQQ motif are not sufficient for the important intermolecular interactions required for prion propagation. However, it might be that the conformational conversion of the oligomeric intermediates (Serio et al., 2000
) rather than the intermolecular interactions per se is the step that is blocked or at least less efficient. The transient intramolecular interactions between the CaSup35p PrD and the molecular chaperone Hsp104 that are essential for [PSI+] maintenance in S. cerevisiae (Chernoff et al., 1995
) may therefore not be optimal for efficient propagation of a CaSup35p-based prion in the absence of the homologous folding factor.
Polyglutamine repeat expansion in the N domain of CaSup35p?
One feature of the CaSup35p that differentiates it from the ScSup35p sequence is the presence of several poly(Gln) repeat regions. Expansion of such poly(Gln) repeats has been identified with a number of inherited human diseases, in particular Huntingtons disease, fragile X syndrome and myotonic dystrophy (reviewed by Zoghbi & Orr, 2000 ), and this is due to the underlying protein having an increased propensity to aggregate in the brain. Our finding that there is a significant level of polymorphism in the length of one (but not all) such tracts in the CaSup35p N domain (Fig. 5
) raises the interesting possibility that CaSup35p aggregation may be modulated by a different mechanism to ScSup35p (which has no such poly(Gln) repeat regions in the PrD). It remains to be established whether or not changes in the Gln repeat number do alter the aggregation behaviour of CaSup35p in C. albicans. It should be noted that the subcellular fractionation analysis of strains carrying the different CaSUP35 alleles (Fig. 3
) failed to detect any differences in the levels of solubility of the CaSup35p between the strains although the centrifugation steps we employ only pellet material in excess of 190S (F. Ness & M. F. Tuite, unpublished data). We also note that the variable poly(Gln) repeat region lies within the same region as implicated in the species barrier of yeast prion propagation (Santoso et al., 2000
).
The mechanism by which poly(Gln) repeats expand is still far from clear although meiotic gene conversion and/or unequal crossing-over between two homologous chromosomes has been widely suggested (Berg et al., 2000 ; Jakupciak & Wells, 2000
). It is important to note that C. albicans is apparently unable to undergo meiosis, lacking many of the genes essential for meiosis in S. cerevisiae (Tzung et al., 2001
). This would suggest that the mechanism of poly(Gln) repeat expansion in C. albicans may occur via a non-meiotic event, either through unequal crossing-over between the two sister chromatids of a chromosome during mitosis or due to replication slippage (reviewed by Moore et al., 1999
). None of the strains we studied showed clear evidence of heteroallelism at the CaSUP35 locus since all DNA sequences of the PCR-generated fragments were homogeneous, although were polymorphisms to exist within the primer binding site(s), this might bias such an analysis in favour of one allele. The significance of this high-frequency variation in the length of the poly(Gln) repeat in CaSup35p may be in the rapid evolution of a directed mechanism of protein aggregation akin to the prion-like behaviour of the S. cerevisiae homologue. It now remains to be established whether any of the identified alleles of the CaSUP35 gene encode a form of CaSup35p that is able to behave as a prion in C. albicans.
![]() |
ACKNOWLEDGEMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Chernoff, Y., Derkatch, I. L. & Inge-Vechtomov, S. G. (1993). Multicopy SUP35 gene induces the de novo appearance of psi-like factors in the yeast Saccharomyces cerevisiae. Curr Genet 24, 268-270.[Medline]
Chernoff, Y. O., Lindquist, S. L., Ono, B.-I., Inge-Vechtomov, S. G. & Liebman, S. W. (1995). Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+]. Science 268, 880-884.[Medline]
Chernoff, Y. O., Galkin, A. P., Lewitin, E., Chernova, T. A., Newnam, G. P. & Belenkiy, S. M. (2000). Evolutionary conservation of prion-forming abilities of the yeast Sup35 protein. Mol Microbiol 35, 865-876.[Medline]
Chien, P. & Weissman, J. S. (2001). Conformational diversity in a yeast prion dictates its seeding specficity. Nature 410, 223-227.[Medline]
Cox, B. S. (1965). , a cytoplasmic suppressor of super-suppression in yeast. Heredity 20, 505-521.
Crouzet, M. & Tuite, M. F. (1987). Genetic control of translation fidelity in yeast: molecular cloning and analysis of the allosuppressor gene sal3. Mol Gen Genet 210, 581-583.[Medline]
Didichenko, S. A., Ter-Avanesyan, M. D. & Smirnov, V. N. (1991). Ribosome-bound EF-1-like protein in the yeast Saccharomyces cerevisiae. Eur J Biochem 198, 705-711.[Abstract]
Doel, S. M., McCready, S. J., Nierras, C. R. & Cox, B. S. (1994). The dominant PNM2- mutation that eliminates the factor of Saccharomyces cerevisiae is the result of a missense mutation in the SUP35 gene. Genetics 137, 659-670.
Feinberg, A. P. & Vogelstein, B. (1983). A technique for radiolabeling restriction endonucleasese fragments to high specific activity. Anal Biochem 132, 6-13.[Medline]
Firoozan, M., Grant, C. M., Duarte, J. A. B. & Tuite, M. F. (1991). Quantitation of readthrough of termination codons in yeast using a novel gene fusion assay. Yeast 7, 173-183.[Medline]
Flechsig, E., Shmerling, D., Hegyi, I., Raeber, A. J., Fischer, M., Cozzio, A., von Mering, C., Aguzzi, A. & Weissmann, C. (2000). Prion protein devoid of the octapeptide repeat region restores susceptibility to scrapie in PrP knockout mice. Neuron 27, 399-408.[Medline]
Hanahan, D. (1983). Studies on transformation of Escherichia coli with plamids. J Mol Biol 166, 557-580.[Medline]
Hawthorne, D. C. & Leupold, U. (1974). Suppressor mutations in yeast. Curr Top Microbiol Immunol 64, 1-47.[Medline]
Ito, H., Fukuda, Y., Murata, K. & Kimura, A. (1983). Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153, 163-168.[Medline]
Jakupciak, J. P. & Wells, R. D. (2000). Genetic instabilities of triplet repeat sequences by recombination. IUBMB Life 50, 355-359.[Medline]
Kaiser, C., Michaelis, S. & Mitchell, A. (1994). Methods in Yeast Genetics. A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Kikuchi, Y., Shimatake, H. & Kikuchi, A. (1988). A yeast gene required for the G1-to-S transition encodes a protein containing an A-Kinase target site and GTPase domain. EMBO J 7, 1175-1182.[Abstract]
Kushnirov, V. V., Ter-Avanesyan, M. D., Telckov, M. V., Surguchov, A. P., Smirnov, V. N. & Inge-Vechtomov, S. G. (1988). Nucleotide sequence of the SUP2(SUP35) gene of Saccharomyces cerevisiae. Gene 66, 45-54.[Medline]
Kushnirov, V. V., Kochneva-Pervukhova, N. V., Chechenova, M. B., Frolova, N. S. & Ter-Avanesyan, M. D. (2000). Prion properties of the Sup35 protein of yeast Pichia methanolica. EMBO J 19, 324-331.
Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Moore, H., Greenwell, P. W., Liu, C. P., Arnheim, N. & Petes, T. D. (1999). Triplet repeats form secondary structures that escape DNA repair in yeast. Proc Natl Acad Sci USA 96, 1504-1509.
Parham, S. N., Resende, C. G. & Tuite, M. F. (2001). Oligopeptide repeats in the yeast protein Sup35p stabilise intermolecular prion interactions. EMBO J 20, 2111-2119.
Patino, M. M., Liu, J., Glover, J. R. & Lindquist, S. (1996). Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273, 622-626.[Abstract]
Paushkin, S. V., Kushnirov, V. V., Smirnov, V. N. & Ter-Avanesyan, M. D. (1996). Propagation of the yeast prion-like [PSI+] determinant is mediated by polymerization of the SUP35-encoded polypeptide chain release factor. EMBO J 15, 3127-3134.[Abstract]
Paushkin, S. V., Kushnirov, V. V., Smirnov, V. N. & Ter-Avanesyan, M. D. (1997). In vitro propagation of the prion-like state of yeast SUP35 protein. Science 277, 381-383.
Prusiner, S. B. (1982). Novel proteinaceous infectious particles cause scrapie. Science 216, 136-144.[Medline]
Prusiner, S. B., Scott, M. R., DeArmond, S. J. & Cohen, F. E. (1998). Prion protein biology. Cell 93, 337-348.[Medline]
Rose, M. D., Novick, P., Thomas, J. H., Bolstein, D. & Fink, G. R. (1987). A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60, 237-243.[Medline]
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual. 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-5467.[Abstract]
Santos, M. A. & Tuite, M. F. (1995). The CUG codon decoded in vivo as serine and not leucine in Candida albicans. Nucleic Acids Res 23, 1481-1486.[Abstract]
Santoso, A., Chien, P., Osherovich, L. Z. & Weissman, J. S. (2000). Molecular basis of a yeast prion species barrier. Cell 100, 277-288.[Medline]
Serio, T. R., Cashikar, A. G., Kowal, A. S., Sawicki, G. J., Moslehi, J. J., Serpell, L., Arnsdorf, M. F. & Lindquist, S. L. (2000). Nucleated conformational conversion and the replication of conformational information by a prion determinant. Science 289, 1317-1321.
Sikorski, R. S. & Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.
Smith, J. M. B. (1989). Opportunistic Mycoses of Man and Other Animals. Wallingford, UK: CAB International.
Spalding, A. & Tuite, M. F. (1989). Hostplasmid interactions in Saccharomyces cerevisiae: effect of host ploidy on plasmid stability and copy number. J Gen Microbiol 135, 1037-1045.[Medline]
Sparrer, H. E., Santoso, A., Szoka, F. C. & Weissman, J. S. (2000). Evidence for the prion hypothesis: induction of the yeast [PSI+] factor by in vitro-converted Sup35 protein. Science 289, 595-599.
Stansfield, I., Grant, C. M., Akhmaloka & Tuite, M. F. (1992). Ribosomal association of the yeast SAL4 (SUP45) gene product: implication for its role in translation fidelity and termination. Mol Microbiol 6, 34693478.[Medline]
Stansfield, I., Akhmaloka & Tuite, M. F. (1995a). A mutant allele of the SUP45 (SAL4) gene of Saccharomyces cerevisiae shows temperature-dependent allosuppressor and omnipotent suppressor phenotypes. Curr Genet 27, 417426.[Medline]
Stansfield, I., Jones, K. M., Kushnirov, V. V., Dagkesamanskaya, A. R., Paulshkin, S. V., Nierras, C. R., Cox, B. S., Ter-Avanesyan, M. D. & Tuite, M. F. (1995b). The products of the SUP45 (eRF1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae. EMBO J 14, 4365-4373.[Abstract]
Swoboda, R. K., Bertram, G., Colthurst, D. R., Tuite, M. F., Gow, N. A. R., Gooday, G. W. & Brown, A. J. P. (1994). Regulation of the gene encoding translation elongation factor 3 during growth and morphogenesis in Candida albicans. Microbiology 140, 2611-2616.[Abstract]
Ter-Avanesyan, M. D., Kushnirov, V. V., Dagkesamanskaya, A. R., Didichenko, S. A., Chernoff, Y. O. & Inge-Vechtomov, S. G. (1993). Deletion analysis of the SUP35 gene of the yeast Saccharomyces cerevisiae reveals two non-overlapping functional regions in the encoded protein. Mol Microbiol 7, 683-692.[Medline]
Ter-Avanesyan, M. D., Dagkesamanskaya, A. R., Kushnirov, V. V. & Smirnov, V. N. (1994). The SUP35 omnipotent suppressor gene is involved in the maintenance of the non-Mendelian determinant [PSI+] in the yeast Saccharomyces cerevisiae. Genetics 137, 671-676.
Tuite, M. F. (2000). Yeast prions and their prion-forming domain. Cell 100, 289-292.[Medline]
Tuite, M. F., Mundy, C. R. & Cox, B. S. (1981). Agents that cause a high frequency of genetic change from [PSI+] to [psi-] in Saccharomyces cerevisiae. Genetics 98, 691-711.
Tzung, K.-W., Williams, R. M., Scherer, S. & 10 other authors (2001). Genomic evidence for a complete sexual cycle in Candida albicans. Proc Natl Acad Sci USA 98, 32493253.
Wach, A., Brachat, A., Poehlmann, R. & Philippesen, P. (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793-1808.[Medline]
Wickner, R. B. (1994). [URE3] as an altered Ure2 protein: evidence for a prion analog in Saccharomyces cerevisiae. Science 264, 566-569.[Medline]
Wickner, R. B. & Chernoff, Y. O. (1999). Prions of fungi: [URE3], [PSI], and [Het-s] discovered as heritable traits. In Prion Biology and Diseases , pp. 229-272. Edited by S. B. Prusiner. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory.
Wilson, P. G. & Culbertson, M. R. (1988). SUF12 suppressor protein of yeast. A fusion protein related to the EF-1 family of elongation factors. J Mol Biol 199, 559-573.[Medline]
Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-199.[Medline]
Zhouravleva, G., Frovola, L., LeGoff, X., LeGuellec, R., Inge-Vechtomov, S. G., Kisselev, L. & Philippe, M. (1995). Termination of translation in eukaryotes is governed by two interacting polypeptide chain release factors, eRF1 and eRF3. EMBO J, 14, 4065-4072.[Abstract]
Zoghbi, H. Y. & Orr, H. T. (2000). Glutamine repeats and neurodegeneration. Annu Rev Neurosci 23, 217-247.[Medline]
Received 12 October 2001;
accepted 29 November 2001.