ARTICLE |
Correspondence to: E. Ellen Billett, Dept. of Life Sciences, Nottingham Trent University, Clifton Lane, Nottingham NG11 8NS, UK..
![]() |
Summary |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Monoamine oxidase (MAO) oxidatively deaminates vasoactive and biogenic amines and exists in two distinct forms (A and B), coded for by separate genes, which exhibit distinct substrate specificities and inhibitor sensitivities. Using specific primers for MAO-A and MAO-B mRNA in a reverse transcription-polymerase chain reaction (RT-PCR) on RNA from human liver, the predicted products for both enzymes were detected. Furthermore, RT-PCR on RNA from human placenta, believed to contain predominantly (or only) MAO-A protein, also indicated the presence of both A and B gene transcripts. The cellular distribution of MAO mRNA in placental tissue was analyzed by in situ hybridization of MAO-A and MAO-B mRNA-specific cRNA probes on paraffin sections. MAO-A mRNA was mainly evident in the syncytiotrophoblastic layer. None was detected in the vascular endothelium/smooth muscles. Significantly, MAO-B mRNA signal was also evident in the placental villi, notably in the syncytiotrophoblasts, intermediate trophoblasts, cytotrophoblasts, and the vascular endothelium. To our knowledge, this is the first demonstration of the cellular distribution of MAO mRNA in human placenta via in situ hybridization. The expression of MAO-B in placental tissue rather than in blood elements within placenta is also unequivocally demonstrated. These highly specific cRNA probes can now be used to study the distribution of MAO-A and MAO-B expression in other tissues. (J Histochem Cytochem 46:13931400, 1998)
Key Words: monoamine oxidase, mRNA, in situ hybridization, reverse transcription, polymerase chain reaction, Northern analysis, human tissues, placenta, monoamine oxidase-A, monoamine oxidase-B
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Monoamine oxidase (MAO; EC 1.4.3.4) is localized in the outer mitochondrial membrane and is a flavin-containing enzyme involved in the catalysis of oxidative deamination of several neuroactive, vasoactive, and other biogenic amines (
MAO-A and -B are differentially expressed in a variety of tissues. Some, such as human liver and brain, contain both forms of MAO (
In this study we demonstrate the use of nonradioactively (digoxigenin, DIG)-labeled complementary RNA (cRNA) probes to specifically locate MAO-A and MAO-B mRNAs in placental sections via in situ hybridization histochemistry. The RNA probes were produced from cDNA clones encompassing the entire protein coding region (
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Synthesis of the cRNA Probes
Plasmids (pSP65) carrying the appropriate cDNA (MAO-A, 2.5 KB for the sense and anti-sense; MAO-B, 2.5 KB and 2 KB for the sense and the anti-sense orientations, respectively) (
Probes were subjected to limited alkaline hydrolysis in 0.2 M sodium carbonatebicarbonate buffer (pH 10.2) and incubation at 60C for 20 min (
RNA Isolation
Placental tissues were obtained fresh from routine elective cesarean section deliveries performed at the Queens Medical Centre, Nottingham, UK, by Mr. G. M. Filshie and his team. The procedures used were in accordance with the ethical standards approved by the Ethics Committee, Queens Medical Centre. Total RNA was isolated using RNAStat RNA extraction solution (Biogenesis; Poole, UK). Briefly, tissues were homogenized in ice-cold RNAStat (1 ml/100 mg tissue). After the addition of chloroform to a concentration of 10% (v/v) and vigorous mixing, each sample was kept on ice for 5 min, followed by centrifugation (10,000 x g) for 20 min at 4C. The upper aqueous phase was then aspirated and mixed with an equal volume of isopropanol and placed on ice for 10 min. Total RNA was collected by centrifugation at 7500 x g for 20 min at 4C and the RNA pellet was vacuum-dried after being washed twice with 75% ethanolDEPC water. RNA was dissolved in DEPC-treated water containing RNasin (1 U/µl) and stored in liquid nitrogen.
Northern Blot Analysis
RNA samples were fractionated on 1% agaroseformaldehyde gels and capillary transferred onto nylon filters (Boehringer Mannheim) using 20 x SSC (salinesodium citrate 1 x = 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0). After washing with 6 x SSC, filters were allowed to air-dry. Then the transferred RNA was bound to the filter using a UV-translinker (Stratagene; Cambridge, UK). Marker lanes were removed and stained with 0.04% methylene blue. The rest of the filters were prehybridized in hybridization buffer (50% formamide, 4 x SSC, 7% SDS, 50 µg/ml denatured salmon sperm DNA) (Sigma; Poole, UK) at 55C for 4 hr. The positive control probe for Northern hybridization was DIG-labeled human ß-actin anti-sense RNA probe (corresponding to bases 69618 of ß-actin) (Boehringer Mannheim), and the test probes were DIG-labeled MAO-A and MAO-B probes in the sense and anti-sense directions. The probe concentrations used were 80 ng/ml for the actin probe and 100 ng/ml for the MAO probes. Filters were then incubated in hybridization solution containing the designated probe at 55C overnight and washed as follows: 2 x SSC, 0.1% SDS for 15 min at 55C; 0.5 x SSC, 0.1% SDS for 15 min at 55C and 0.1 x SSC, 0.1% SDS for 30 min at 65C. Hybridization was detected immunologically. Filters were blocked by immersion in TBS (Tris-buffered saline: 100 mM Tris-HCl, 150 mM NaCl, pH 7.5) containing 2% (v/v) heat-inactivated normal ovine serum and 0.3% (w/v) Triton X-100 for 30 min at room temperature (RT) and then incubated with alkaline phosphatase-conjugated sheep anti-digoxigenin (Fab fragment) (Boehringer Mannheim), diluted 1:1000 in the same buffer, for 30 min at RT. After two 15-min washes in TBS, the blots were equilibrated for 5 min in the detection buffer (100 mM Tris-HCl, 100 mM NaCl, pH 9.5). Alkaline phosphatase was visualized by the addition of 250 µM CSPD (disodium3-(4-methoxyspiro{1,2-dioxetane-3,2'-(5'-chloro)tricyclo{3.3.1.13,7]decan}-4yl) phenyl phosphate) chemiluminescent substrate (PerkinElmer; Warrington, UK) in detection buffer and the blots were incubated for 15 min at 37C. Signal was detected on Kodak Biomax ML film (Sigma).
In Situ Hybridization
Freshly prepared placental tissue sample blocks were fixed at RT in 4% formaldehyde in PBS for 24 hr, dehydrated, and embedded in paraffin. Sections (8 µm thick) were cut, mounted on silinated slides (
Prehybridization involved incubation at 55C for 4 hr in hybridization solution (HS; 100 µl per section) containing 50% formamide, 4 x SSC, 1 x Denhardt solution (0.02% Ficoll, 0.02% polyvinyl pyrrolidone, 10 mg/ml RNase-free bovine serum albumin), 0.5 mg/ml sheared salmon sperm DNA, 0.25 mg/ml yeast tRNA, 5% dextran sulfate. After removal of the prehybridization solution, sections were hybridized by the addition of 30 µl of HS containing 0.05 µg heat-denatured probes (80C for 5 min, 4C for 10 min). Sections were covered with Parafilm, sealed with rubber cement, and incubated at 55C overnight. Hybridization fluid was then aspirated and slides washed in 2 x SSC for 5 min at RT, and 50% formamide, 2 x SSC for 30 min at 55C as the stringency wash. Filters were washed with 0.1 x SSC for 30 min at 55C to remove formamide. Signal detection was as described above, except that levamisole (0.24 mg/ml) was added to the substrate as an inhibitor of endogenous alkaline phosphatase. Color development was terminated by immersing slides in 50 mM Tris-HCl, pH 7.5, 1 mM EDTA buffer. Sections were mounted in gelatinglycerol (Sigma), which was allowed to set at 4C.
Throughout the in situ hybridization procedure, temperature control was achieved using an Omnislide thermocycler (Hybaid).
Reverse Transcription-Polymerase Chain Reaction
Reverse transcription and PCR were performed to verify the presence or absence of MAO-A and MAO-B mRNA in hepatic and placental RNA. Sequence specific primers were selected from the full cDNA sequences of MAO-A and MAO-B (
Oligonu- cleotide Orientation Location Sequence (5'3')
MAOA51 Sense 756775 ACGGATAATGGA-CCTCCTCG
MAOBF1 Sense 13041323 ATATGGAAGGGTTCTACGCC
MAOA31 Anti-sense 1511540 GGTGTGGGTGATTTCTACCG
MAOBR1 Anti-sense 18451864 AAACTGGTGAAACAGAACGC
The fragments flanked by these primers were 745 BP and 522 BP for MAO-A and MAO-B, respectively. Selection of primers was based on the search results of comparisons of the primer sequences with other human sequences using the GenBank data bases (NCBI, National Library of Medicine, National Institute of Health, Bethesda, MD), where only gene-specific sequences were selected. Reverse transcription was performed in 50 µl reaction buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM DTT) containing 10 pmol specific 3' (anti-sense) primer (MAOA31, MAOBR1 for MAO-A and MAO-B, respectively); 5 µg of total RNA from either liver or placenta, 60 U RNasin ribonuclease inhibitor (Promega), 2 mM of each of dATP, dGTP, dCTP, and dTTP (Promega), and 400 U of Molony murine leukemia virus reverse transcriptase (M-MLV; Promega). The reaction mix was incubated for 1 hr at 37C and the reaction terminated by heating at 95C for 5 min. cDNA was used for PCR by adding 5 µl of RT samples to a reaction buffer (10 mM Tris-HCl, pH 9, 50 mM KCl, 0.1% Triton X-100, and 3 mM MgCl2) containing 0.5 mM each dATP, dGTP, dCTP, and dTTP (Promega), 0.75 µM specific 3' and 5' primers (MAOA31, MAOA51; MAOBF1, MAOBR1 for MAO-A and MAO-B respectively) and 2.5 U Taq DNA polymerase (Promega) in a final volume of 50 µl. The reaction mix was overlaid with 25 µl mineral oil (Sigma) and heat-denatured for 7 min at 95C, followed by 30 cycles of annealing (56C, 1 min), elongation (72C, 2 min), and denaturation (95C, 45 sec), followed by a final elongation at 72C for 7 min. The PCR products were electrophoresed on 1% agarose in 89 mM Tris-borate, pH 8, 2 mM EDTA buffer, and stained with ethidium bromide (
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Northern Hybridization
Total RNA from human liver was used to confirm the specificities of the MAO-A and MAO-B probes. Single bands of 4.9 KB were evident when the anti-sense probes of MAO-A and MAO-B were used (Figure 1A, Lanes 2 and 6), whereas no bands were revealed with the sense probes (Figure 1A, Lanes 4 and 8). Using MAO-B sense cRNA as a template, the MAO-B anti-sense probe, but not the MAO-A probe, hybridized to a 2.0-KB transcript, which corresponds to the size of the cDNA insert that was used as template for the synthesis of MAO-B cRNA (Figure 1B, Lanes 2 and 4). Similarly, when MAO-A cRNA was used as a template, only the MAO-A anti-sense probe revealed a product of 2.4 KB (Figure 1B, Lanes 3 and 5). Therefore, the specificity of the probes appeared to be conclusive. Analysis of total RNA purified from fresh placental tissue also indicated hybridization with single bands of 4.9 KB with both MAO-A and MAO-B anti-sense probes (Figure 1A, Lanes 3 and 7), but no hybridization when the MAO-A or MAO-B sense probe was used (Figure 1A, Lanes 5 and 9). With both placental and liver RNA, the 4.9-KB band detected with the MAO-A anti-sense probe was weak and there was a strong signal at the top of the gel (Figure 1A, Lanes 2 and 3).
|
Similar signal patterns were obtained for MAO-A and MAO-B transcripts in placental and hepatic RNA when specific digoxigenin-labeled anti-sense oligonucleotide probes were used instead of RNA probes (data not shown).
As expected, the human ß-actin anti-sense DIG-labeled RNA probe revealed a single band of approximately 1.8 KB for liver and placenta (Figure 1A, Lanes 10 and 11).
Reverse Transcription-Polymerase Chain Reaction
The RT-PCR revealed products from MAO-A and MAO-B genes in both liver and placenta. As predicted, a 745-BP product was generated for MAO-A from hepatic and placental RNA, similar to that produced by the unlabeled MAO-A (sense) cRNA when used as template for the RT-PCR (Figure 2, Lanes 24). Similarly, the products for MAO-B from hepatic and placental RNA, were 522 BP and, as expected, were similar to that produced when the unlabeled MAO-B (sense) cRNA was used as template (Figure 2, Lanes 57). It is recognized that quantitative conclusions are difficult to make using RT-PCR but, if one takes into account the fact that the efficiency of amplification of MAO-B cRNA is greater than that of MAO-A cRNA (equal amounts of the cRNAs having been used), it appears that the relative amounts of the A and B forms of mRNA are similar in liver. Furthermore, the amount of MAO-A mRNA is greater than MAO-B mRNA in placenta, but the latter is definitely present. These results also suggest that the signals observed with the MAO-A-specific RNA probes at the top of the gel in Figure 1A are real, i.e., for some reason MAO-A mRNA, but not MAO-B mRNA, is relatively insoluble.
|
Finally, these results give further confidence in the use of the RNA probes for in situ hybridization experiments.
In Situ Hybridization
The anti-sense probes for both MAO-A and MAO-B gave signals in paraffin-embedded human liver sections, with the MAO-B mRNA predominating, and the sense probes giving no signals (data not shown).
In placental samples, both MAO-A mRNA and MAO-B mRNA were again detected. At low magnification, MAO-A mRNA was evident mainly on the outer (syncytiotrophoblastic) surface of villi (Figure 3A). In the stem villous trunks, a signal was observed only in the cytotrophoblastic cellular groups distributed in the stroma (Figure 3A). Very low levels of MAO-A mRNA were evident in the smooth musculature of placental vessels and the endothelial lining of the arteries and veins (Figure 4A). At higher magnification, the expression of MAO-A mRNA was mainly localized in the syncytiotrophoblastic and the cytotrophoblastic cells of chorionic villi (Figure 4A, inset).
|
|
The use of MAO-B anti-sense probes indicated that the highest levels of MAO-B mRNA are in the syncytiotrophoblastic layer of the small and budding villi; (Figure 3C) and in the cytotrophoblastic cellular groups distributed in the villous trunk (Figure 3C and Figure 4C). In the placental vasculature, expression of MAO-B mRNA was absent from the connective tissue surrounding blood vessels whereas, unlike that of MAO-A, there was strong expression in the smooth musculature and the endothelial lining of the placental arteries and veins (Figure 4C). At higher magnifications, the expression of MAO-B mRNA in the villi was mainly localized in the syncytiotrophoblastic and cytotrophoblastic layers (Figure 4C, inset).
No hybridization was evident with the sense probes for MAO-A or -B (Figure 3B, Figure 3D, Figure 4B, and Figure 4D). Posthybridization treatment with RNase also had no effect on the signal intensity or distribution; this was the case with both the sense and anti-sense probes.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In this study we have clearly demonstrated the distribution of monoamine oxidase-A and -B mRNA in placental sections obtained from normal full-term deliveries, using in situ hybridization with DIG-labeled RNA probes. DIG-labeled cRNA probes were syn-thesized from MAO-A and MAO-B cDNA templates (
Previous work using MAO cDNA as a probe has indicated that two MAO-A transcripts occur in placenta, one of between 4.4 and 5.4 KB and the other around 2 KB (
When the RNA probes were used for in situ hybridization on sections, MAO-A mRNA was easily detected in the trophoblast cells of the placental villi. This distribution agrees with earlier studies, based on enzyme catalytic activity (
With histochemical techniques, MAO-B catalytic activity has not been detected in placental sections (
Our findings clearly demonstrated that, using in situ hybridization with DIG-labeled RNA probes, it was possible to study, for the first time, the cellular distribution of MAO-A and MAO-B mRNAs in human placenta. Although in situ hybridization has recently been used to locate MAO mRNA in rat brain samples (
![]() |
Acknowledgments |
---|
Supported by a Grant from the Higher Education Funding Council (UK). We thank Prof Jean Chen Shih (Department of Molecular Pharmacology and Toxicology, University of Southern California) for providing the MAO-A and -B cDNA. Prof J. Lowe and Dr G. Robinson (Department of Pathology, University of Nottingham) kindly provided the tissues.
Received for publication April 17, 1998; accepted August 18, 1998.
![]() |
Literature Cited |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bach WJA, Lan NC, Johnson DL, Abell CW, Bembenek ME, Kwan S-W, Seeburg PH, Shih JC (1988) cDNA cloning of human liver monoamine oxidase A and B: molecular basis of differences in enzymatic properties. Proc Natl Acad Sci USA 85:4934-4938[Abstract]
Barnea ER, MacLusky NJ, DeCherney AH, Naftolin F, Phil D (1986) Monoamine oxidase activity in the term human placenta. Am J Perinatol 3:219-224[Medline]
Bond PA, Cundall RL (1977) Properties of monoamine oxidase (MAO) in blood platelets, plasma, lymphocytes and granulocytes. Clin Chim Acta 80:317-326[Medline]
Brahic M, Haase A (1978) Detection of viral sequences of low reiteration frequency by in situ hybridisation. Proc Natl Acad Sci USA 75:6125-6129[Abstract]
Chiba K, Trevor A, Castagnoli N, Jr (1984) Metabolism of the neurotoxic tertiary amine, MPTP, by brain monoamine oxidase. Biochem Biophys Res Commun 120:574-578[Medline]
Church RJ, Robinson G, Billett EE (1994) The localization of monoamine oxidase in human placenta using a new specific monoclonal antibody to monoamine oxidase-A. Proc R Microsc Soc 29(4):243
Cox KH, DeLeon DV, Angerer LM, Angerer RC (1984) Detection of messenger RNAs in sea urchin embryos by in situ hybridization using asymmetric RNA probes. Dev Biol 101:485-502[Medline]
Egashira T, Yamanaka Y (1981) Further studies on the synthesis of A-form of monoamine oxidase. Jpn J Pharmacol 31:763-770[Medline]
Fowler CJ, Tipton KF (1984) On the substrate specificities of the two forms of monoamine oxidase. J Pharm Pharmacol 36:111-115[Medline]
Grimsby J, Lan NC, Neve R, Chen K, Shih JC (1990) Tissue distribution of human monoamine oxidase A and B mRNA. J Neurochem 55:1166-1169[Medline]
Gujrati VR, Shanker K, Parmar SS, Vrat S, Chandrawati Bhargava KP (1985) Serotonin in toxaemia of pregnancy. Clin Exp Pharmacol Physiol 12:9-18[Medline]
Hotamisligil GS, Breakfield XO (1991) Human monoamine oxidase A gene determines levels of enzyme activity. Am J Hum Genet 49:383-392[Medline]
Hsu Y-PP, Weyler W, Chen S, Sims KB, Rinehart WB, Utterback MC, Powell JF, Breakfield XO (1988) Structural features of human monoamine oxidase A elucidated from cDNA and peptide sequences. J Neurochem 51:1321-1324[Medline]
Ito A, Kuwahara T, Inadome S, Sagara Y (1988) Molecular cloning of a cDNA for rat liver monoamine oxidase B. Biochem Biophys Res Commun 157:970-976[Medline]
Jahng JW, Houpt TA, Wessel TC, Chen K, Shih JC, Joh TH (1997) Localisation of monoamine oxidase A and B mRNA in the rat brain by in situ hybridisation. Synapse 25:30-36[Medline]
Johnston JP (1968) Some observations upon a new inhibitor of monoamine oxidase in human brain. Biochem Pharmacol 17:1285-1297[Medline]
Knoll J, Magyar K (1972) Some puzzling pharmacological effects of monoamine oxidase inhibitors. Adv Biochem Psychopharmacol 5:393-408[Medline]
Kuwahara T, Takamoto S, Ito A (1990) Primary structure of rat monoamine oxidase deduced from cDNA and its expression in rat tissues. Agric Biol Chem 54:253-257[Medline]
Lewis FA, Wells M (1992) Detection of virus in infected human tissue by in situ hybridization. In Wilkinson DG, ed. In Situ Hybridisation: A Practical Approach. Oxford, New York, IRL Press, Oxford University Press, 121-130
Riley LA, Waguespack MA, Denney RM (1989) Characterization and quantitation of monoamine oxidases A and B in mitochondria from human placenta. Mol Pharmacol 36:54-60[Abstract]
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Vol 1. 2nd Ed. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press, pp. 135
Thorpe LW, Westlund KN, Kochersperger LM, Abell CW, Denney RM (1987) Immunocytochemical localization of monoamine oxidases A and B in human peripheral tissues and brain. J Histochem Cytochem 35:23-32[Abstract]
von Kroff RW (1979) Monoamine oxidase: unanswered questions. In Singer TP, von Kroff RW, Murphy DL, eds. Monoamine Oxidase: Structure, Function and Altered Functions. New York, Academic Press, 17
Weiner CP (1987) The role of serotonin in the genesis of hypertension in preeclampsia. Am J Obstet Gynecol 156:885-888[Medline]
Weyler W, Salach JI (1985) Purification and properties of mitochondrial monoamine oxidase type A from human placenta. J. Biol Chem 260:13199-13207
Yeomanson KB, Billett EE (1992) An enzyme immunoassay for the measurement of human monoamine oxidase B protein. Biochim Biophys Acta 1116:261-268[Medline]
Yoshimoto Y, Sakumoto T, Aono T, Kimura H, Maeda T, Tanizawa O (1986) Histochemical studies on human placental and chorionic monoamine oxidase. Obstet Gynecol 67:344-348[Abstract]