Department of Veterinary Microbiology and Preventive Medicine, College of Veterinary Medicine, 2Interdepartmental Genetics Program and 3Department of Mathematics, Iowa State University, Ames, IA 50011, USA
Author for correspondence: Susan Carpenter at College of Veterinary Medicine. Fax +1 515 294 8500. e-mail scarp{at}iastate.edu
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Lentivirus infections are typically characterized by the establishment of a persistent, lifelong infection and a slow, progressive disease course in the naturally infected host. There is wide variation in clinical disease both among and within the different members of the lentivirus subfamily. Two factors which influence the clinical outcome of infection are the virulence of the inoculum virus and the effectiveness of the host immune response. Reports of clinical disease syndromes in herds with a high incidence of BIV seroprevalence (Snider et al., 1996 ; St Cyr Coats et al., 1994
) suggest that field isolates of BIV may be more pathogenic than the cell culture-adapted BIVR29 isolate. In addition, calves experimentally infected with the field-derived BIVFL112 isolate exhibited a more pronounced leukocytosis (Suarez et al., 1993
) and higher levels of virus replication in vivo in comparison to BIVR29-infected calves (S. Carpenter & Y. Wannemuehler, unpublished observations). Attenuation of the BIVR29 isolate following extensive passage in cell culture may contribute to the lack of clinical disease observed in cattle experimentally infected with this isolate. In addition, the persistent low level of virus replication during long-term experimental infection with BIVR29 may be attributed to an effective host immune response. In the present study, we examined the role of virus-neutralizing (VN) antibody in controlling BIV replication in cattle experimentally infected with BIVR29.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cells and virus.
Primary FBL cells (Whetstone et al., 1991 ) were maintained in DMEM supplemented with 10% foetal calf serum (FCS) and antibiotics. A number of BIV stocks and/or isolates were derived from BIVR29 following in vivo and/or in vitro passage of the original virus (Van Der Maaten et al., 1972
). The virus stock used for experimental inoculation of the eight animals was propagated in FBL cells (Carpenter et al., 1992
) and is designated as BIVR29-4093. BIVR29-346M was derived by in vitro culture of monocyte-derived macrophages collected from a steer (#346) experimentally infected with BIVR29-4093 (Rovid et al., 1996
). BIVFL112 (Suarez et al., 1993
) was provided by D. Suarez. All virus stocks were maintained by passage in FBL cells. Additional in vivo isolates were obtained from experimentally infected cattle at 4 years p.i. by co-cultivation of PBMC with FBL as described below.
Virus isolation.
Whole blood was collected by jugular venipuncture and PBMC were isolated by centrifugation, collection of the buffy coat, and flash lysis of erythrocytes (Roth et al., 1981 ). Approximately 107 PBMC were co-cultivated with FBL cells in the presence of 8 µg/ml polybrene (Carpenter et al., 1992
). Cultures were passaged twice-weekly and visually monitored for syncytium formation. At each passage, replicate cultures were assayed for the presence of BIV, BLV, bovine spumavirus and bovine viral diarrhoea virus using immunofluorescence or immunoperoxidase assays as previously described (Carpenter et al., 1992
; Wannemuehler et al., 1993
). In most cases, cells were sub-cultured at least six times before they were considered virus-negative. Viruses isolated from experimentally infected cattle at 4 years p.i. which were used for antigenic and genetic characterization are referred to as BIVR29-341, BIVR29-342, BIVR29-345, BIVR29-347 and BIVR29-348.
Virus neutralization assay.
Sera collected from BIV-infected cattle prior to or post-inoculation were heat-inactivated to destroy complement, serially diluted twofold in DMEM with 10% FCS, and used in a VN assay similar to that previously described (Carpenter et al., 1987 ). Virus stocks were prepared from clarified BIV-infected culture supernatant and were diluted to 200 SFU in a 250 µl volume. Virus was added to an equal volume of serially diluted serum, incubated for 15 min at 4 °C and inoculated in duplicate onto FBL cells seeded the previous day at a density of 2x104 cells/cm2 into 6-well tissue culture plates. Cultures were incubated at 37 °C with 5% CO2 for 24 h, at which time the BIV/serum inoculum was removed and fresh DMEM with 10% FCS was added. After 3 days, cells were fixed in methanol, and BIV-induced syncytia were detected by immunocytochemistry (ICC) using monoclonal antibody to BIV Gag as previously described (Wannemuehler et al., 1993
). The number of BIV-specific SFU were counted and the serum dilution that resulted in at least 80% reduction in SFU as compared to negative control sera was considered to be the virus neutralization titre.
Cloning and sequence analysis.
Total DNA was isolated from virus-infected FBL using SDSproteinase K digestion. BIV env sequences were amplified by PCR using primers to conserved regions of the gene. The upstream primer sequence was 5' CTATGGATCAGGACCTAGAC (5' nt 5413) and the downstream primer sequence was 5' CAGCACAAGCAGGAATATTGC (5' nt 7092). The nucleotide sequence numbers of the primers are based on BIV127 (Garvey et al., 1990 ). Approximately 100 ng of total DNA was amplifed by PCR using the following conditions: 94 °C for 2 min, 30 cycles of 1 min denaturation at 94 °C, 1 min annealing at 50 °C, 2 min extension at 72 °C with a final 5 min extension at 72 °C. For direct sequencing of PCR products, amplified DNA was purified by column chromatography using a commercial kit (Promega) and sequenced using internal primers. For analysis of individual variants present in the BIVR29-4093 inoculum, 1 µl of amplified DNA was ligated to pCR2.1 (Invitrogen) and individual clones were isolated and sequenced. For amplification of viral sequences in the absence of selection for replication on FBL, DNA was isolated from PBMC collected from steer #348 at 4 years p.i. and a 656 nt fragment was amplified with the upstream primer 5' GTTGTCCCATATGTAGTTGGC (5' nt 5737), located in tat exon 1, and the downstream primer 5' GCAAACTTTGGAGGTATTTC (5' nt 6393), located in env. Amplification conditions were similar to those described above. The amplicon was cloned, and individual clones were picked and sequenced as above.
The program SITES, version 1.1 (Hey & Wakeley, 1997 ), was used to identify the number of synonymous (S) and non-synonymous (N) nucleotide changes, as well the number of synonymous sites and non-synonymous sites. These values were used to calculate the N/S and Kn/Ks ratios. SITES was also used to perform Tajimas D test, which tests whether observed mutations are due to positive Darwinian selection or to neutral mutations (Tajima, 1989
).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Limited antigenic variation during persistent BIV infection
Antigenic variation is a common feature of lentiviruses and the higher levels of virus replication observed in some animals (i.e. #342) may have been due to replication of virus antigenically distinct from the BIVR29-346M virus used in the neutralization assay. To explore this possibility, virus isolated from individual animals at 4 years p.i. was antigenically compared with the inoculum virus. BIVR29-342, BIVR29-345 and BIVR29-348 were used in a VN assay with sera collected from steers #342, #345 and #348 at 3 and 5 years p.i. In all three animals tested, sera collected at 3 years p.i. had neutralizing antibody to the inoculum virus, BIVR29-4093 (Table 2). Surprisingly, the same year three sera had equivalent or higher VN antibody titres to virus isolated at year 4 p.i. Moreover, VN titres to year 4 virus were essentially identical in sera collected at 3 and 5 years p.i. In all cases, VN titres to the inoculum virus and year 4 virus did not differ by more than twofold, indicating little or no antigenic variation between the inoculum virus and year 4 viruses.
|
|
|
|
Analysis of genetic diversity in the R29-4093 inoculum
The extent of genetic diversity of env in the BIVR29-4093 stock was determined by PCR amplification, cloning and sequencing individual clones. Differences between individual clones and the BIVR29-4093 consensus sequence ranged from 0·26 to 0·72% divergence at the nucleotide level and 0·78 to 1·76% divergence at the amino acid level (Fig. 1 and Table 4
). The total number of nucleotide substitutions/deletions found in BIVR29-4093 was only slightly less than that observed in the year 4 virus isolates (Table 4
). It is possible that the observed nucleotide substitutions occurred during PCR amplification; however, the error rate of Taq polymerase using our standard laboratory conditions is 0·025%, about 20-fold less than the variation observed among the analysed sequences. Therefore, these findings suggest that BIV is genetically conserved during long-term persistent infection.
Previous studies of variation in the BIV surface (SU) protein have reported sequence divergence of up to 50% among unrelated BIV isolates (Suarez & Whetstone, 1995 ). In addition to nucleotide substitutions, insertions/duplications within the hypervariable V2 domain can result in a large amount of SU protein size variation (Garvey et al., 1990
; Suarez & Whetstone, 1995
, 1997
). Comparison of BIVR29-related sequences and sequences obtained from heterologous field isolates BIVFL112 and BIVOK40 of BIV demonstrate that BIVR29-related isolates are genetically quite diverse from the more recently described BIV genotypes (Fig. 2
). In addition, we did not detect amino acid insertions in the V2 domain in any of the BIVR29-4093 variants or in vivo isolates (Figs 1
and 2
). In fact, more than half of the observed amino acid differences among the BIVR29 variants were found to lie outside the previously described variable regions (Suarez & Whetstone, 1995
). Therefore, both quantitative and qualitative differences in variation were observed in BIVR29-4093-infected cattle as compared to cattle infected with more recently described field isolates of BIV.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Broadly reacting neutralizing antibodies are found in human immunodeficiency virus type 1-infected long-term non-progressors and may contribute to the lack of disease progression in these individuals (Cao et al., 1997 ). In the present study, the neutralizing antibody response in BIV-infected cattle exhibited a fairly narrow specificity and only low levels of cross-reacting neutralizing antibody were detected. Despite this narrow specificity, VN antibody did not appear to contribute to immune selection of antigenically variant virus. The twofold differences in VN titre to the inoculum virus and the year 4 viruses are within the range of experimental error and cannot be considered as evidence of antigenic variation. Antigenic variation in the absence of immune pressure by neutralizing antibody has been reported in other lentivirus infections (Carpenter et al., 1987
; Cheevers et al., 1993
, 1999
; Leroux et al., 1997
). It is possible that other immune mechanisms exert selective pressure in vivo and that antigenic differences between BIVR29-4093 and year 4 viruses may be detectable by cytotoxic T lymphocytes and/or monoclonal antibodies. However, given the limited antigenic diversity observed, it was surprising that the host immune response failed to clear the virus after more than 4 years post-infection.
Previous studies of BIV variation in cattle experimentally infected with the Florida isolates of BIV identified nucleotide substitutions as well as insertions/duplications in the V2 region of the env gene (Suarez et al., 1995 ; Suarez & Whetstone, 1997
). The BIVR29-4093 inoculum was derived from the same BIVR29 stock previously shown to contain at least two size variants, BIV106 and BIV127 (Garvey et al., 1990
). BIV127 contains 29 additional amino acids in the V2 region of env as compared to BIV106 (Garvey et al., 1990
). If the larger genotype has a selective advantage in vivo it might be expected to become the predominant genotype after 4 years in vivo. The only genotype detected in our studies was the smaller, BIV106-like, genotype. It is possible that the larger genotype was present in vivo, but was selected against during in vitro isolation in FBL cells. However, other studies have demonstrated selection of larger genotypes during in vitro replication of isolates containing mixed populations of larger and smaller genotypes (Suarez & Whetstone, 1997
). Further studies are needed to clarify the role of the V2 region in BIV replication in vivo and in vitro.
Lentivirus infections are characterized by a high rate of genetic variation in vivo, and the genetic conservation in BIV env over a 4 year period in vivo was not expected. The percentage of non-synonymous nucleotide substitutions over 4 years in vivo was only slightly higher than that observed in the in vitro population. Although the ratios of N/S and Kn/Ks were higher than expected for random substitutions, the Tajima test indicated that the changes were due to neutral mutations. Moreover, the changes which did occur in vivo were not clustered in previously described hypervariable regions (Suarez & Whetstone, 1995 ), as might have been expected if the changes arose as a result of selective pressure. Together, these results strongly suggest that there was little selective pressure for virus variation in vivo. It is possible that the attenuation of BIVR29 following long-term culture in vitro, together with limited genetic diversity in the inoculum, contributed to the persistence of non-pathogenic virus genotypes in vivo. In the absence of high levels of virus replication and overt clinical disease, limited generation and selection of virus variants could result in antigenic and genetic stability of BIVR29 during long-term persistent infection. In vivo studies with BIVFL112 and BIVFL491 suggest that these isolates are somewhat more pathogenic than BIVR29-related isolates (Suarez et al., 1993
), and it might be expected that other isolates of BIV are characterized by a higher rate of genetic and antigenic variation than observed in the present study. Delineating the factors which contribute to the genetic stability and persistence of BIV in vivo may provide insight into strategies that restrict lentivirus-associated disease in humans and animals.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cao, Y., Qin, L., Zhang, L., Safrit, J. & Ho, D. D. (1997). Virologic and immunologic characterization of long-term survivors of human immunodeficiency virus type 1 infection. New England Journal of Medicine 332, 201-208.
Carpenter, S., Evans, L. H., Sevoian, M. & Chesebro, B. (1987). Role of the host immune response in selection of equine infectious anemia virus variants. Journal of Virology 61, 3783-3789.[Medline]
Carpenter, S., Miller, L. D., Alexandersen, S., Whetstone, C. A., Van Der Maaten, M. J., Viuff, B., Wannemuehler, Y., Miller, J. M. & Roth, J. A. (1992). Characterization of early pathogenic effects after experimental infection of calves with bovine immunodeficiency-like virus. Journal of Virology 66, 1074-1083.[Abstract]
Cheevers, W. P., McGuire, T. C., Norton, L. K., Cordery-Cotter, R. & Knowles, D. P. (1993). Failure of neutralizing antibody to regulate CAE lentivirus expression in vivo. Virology 196, 835-839.[Medline]
Cheevers, W. P., Cordery-Cotter, R., McGuire, T. C. & De Martini, J. C. (1999). Neutralizing antibody responses and evolution of antigenic variants in monozygotic twin lambs infected with phenotypically distinct ovine lentiviruses. Virology 258, 382-388.[Medline]
Cockerell, G. L., Jensen, W. A., Rovnak, J., Ennis, W. H. & Gonda, M. A. (1992). Seroprevalence of bovine immunodeficiency-like virus and bovine leukemia virus in a dairy cattle herd. Veterinary Microbiology 31, 109-116.[Medline]
Cole, K. S., Rowles, J. L., Jagerski, B. A., Murphey-Corb, M., Unangst, T., Clements, J. E., Robinson, J., Wyand, M. S., Desrosiers, R. C. & Montelaro, R. C. (1997). Evolution of envelope-specific antibody responses in monkeys experimentally infected or immunized with simian immunodeficiency virus and its association with the development of protective immunity. Journal of Virology 71, 5069-5079.[Abstract]
Flaming, K., Van Der Maaten, M., Whetstone, C., Carpenter, S., Frank, D. & Roth, J. (1993). The effect of bovine immunodeficiency-like virus infection on immune function in experimentally infected cattle. Veterinary Immunology and Immunopathology 36, 91-105.[Medline]
Flaming, K. P., Frank, D. E., Carpenter, S. & Roth, J. A. (1997). Longitudinal studies of immune function in cattle experimentally infected with bovine immunodeficiency-like virus and/or bovine leukemia virus. Veterinary Immunology and Immunopathology 56, 27-38.[Medline]
Forman, A. J., Gibson, C. A. & Rodwell, B. J. (1992). Serological evidence for the presence of bovine lentivirus infection in cattle in Australia. Australian Veterinary Journal 69, 337.[Medline]
Garvey, K. J., Oberste, M. S., Elser, J. E., Braun, M. J. & Gonda, M. A. (1990). Nucleotide sequence and genome organization of biologically active proviruses of the bovine immunodeficiency-like virus. Virology 175, 391-409.[Medline]
Hammond, S. A., Cook, S. J., Lichtenstein, D. L., Issel, C. J. & Montelaro, R. C. (1997). Maturation of the cellular and humoral immune responses to persistent infection in horses by equine infectious anemia virus is a complex and lengthy process.Journal of Virology 71, 3840-3852.[Abstract]
Hey, J. & Wakeley, J. (1997). A coalescent estimator of the population recombination rate. Genetics 145, 833-846.
Horner, G. W. (1991). Serologic evidence of bovine immunodeficiency-like virus and bovine syncytial virus in New Zealand. Surveillance 18, 9-14.
Isaacson, J. A., Roth, J. A., Wood, C. & Carpenter, S. (1995). Loss of gag-specific antibody reactivity in cattle experimentally infected with bovine immunodeficiency-like virus. Viral Immunology 8, 27-36.[Medline]
Leroux, C., Issel, C. J. & Montelaro, R. C. (1997). Novel and dynamic evolution of equine infectious anemia virus genomic quasispecies associated with sequential disease cycles in an experimentally infected pony. Journal of Virology 71, 9627-9639.[Abstract]
McNab, W. B., Jacobs, R. M. & Smith, H. E. (1994). A serological survey for bovine immunodeficiency-like virus in Ontario dairy cattle and association between test results, production records and management practices. Canadian Journal of Veterinary Research 58, 36-41.[Medline]
Onuma, M., Koomoto, E., Furuyama, H., Yasutomi, Y., Taniyama, H., Iwai, H. & Kawakami, Y. (1992). Infection and dysfunction of monocytes induced by experimental inoculation of calves with bovine immunodeficiency-like virus. Journal of Acquired Immune Deficiency Syndrome 5, 1009-1015.[Medline]
Roth, J. A., Kaeberle, M. L. & Griffith, R. W. (1981). Effects of bovine viral diarrhea virus infection on bovine polymorphonuclear leukocyte function. American Journal of Veterinary Research 41, 244-250.
Rovid, A. H., Carpenter, S. & Roth, J. A. (1995). Monocyte function in cattle experimentally infected with bovine immunodeficiency-like virus. Veterinary Immunology and Immunopathology 45, 31-43.[Medline]
Rovid, A. H., Carpenter, S., Miller, L. D., Flaming, K. P., Long, M. J., Van Der Maaten, M. J., Frank, D. E. & Roth, J. A. (1996). An atypical T-cell lymphosarcoma in a calf with bovine immunodeficiency-like virus infection. Veterinary Pathology 33, 457-459.[Abstract]
St Cyr Coats, K., Pruett, S. B., Nash, J. W. & Cooper, C. R. (1994). Bovine immunodeficiency virus: incidence of infection in Mississippi dairy cattle. Veterinary Microbiology 42, 181-189.[Medline]
Snider, T. G.III, Luther, D. G., Jenny, B. F., Hoyt, P. G., Battles, J. K., Ennis, W. H., Balady, J., Blas-Machado, U., Lemarchand, T. X. & Gonda, M. A. (1996). Encephalitis, lymphoid tissue depletion and secondary diseases associated with bovine immunodeficiency virus in a dairy herd. Comparative Immunology, Microbiology and Infectious Diseases 19, 117-131.[Medline]
Suarez, D. L. & Whetstone, C. A. (1995). Identification of hypervariable and conserved regions in the surface envelope gene in the bovine lentivirus. Virology 212, 728-733.[Medline]
Suarez, D. L. & Whetstone, C. A. (1997). Size variation within the second hypervariable region of the surface envelope gene of the bovine lentivirus (BIV) in experimentally and naturally infected cattle. Journal of Virology 71, 2482-2486.[Abstract]
Suarez, D. L., Van Der Maaten, M. J., Wood, C. & Whetstone, C. A. (1993). Isolation and characterization of new wild-type isolates of bovine lentivirus.Journal of Virology 67, 5051-5055.[Abstract]
Suarez, D. L., Van Der Maaten, M. J. & Whetstone, C. A. (1995). Improved early and long-term detection of bovine lentivirus by a nested polymerase chain reaction test in experimentally infected calves. American Journal of Veterinary Research 56, 579-586.[Medline]
Tajima, F. (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123, 585-595.
Van Der Maaten, M. J., Boothe, A. D. & Seger, C. L. (1972). Isolation of a virus from cattle with persistent lymphocytosis. Journal of the National Cancer Institute 49, 1649-1657.[Medline]
Wannemuehler, Y., Isaacson, J., Wannemuehler, M., Wood, C., Roth, J. A. & Carpenter, S. (1993). In vitro detection of bovine immunodeficiency-like virus using monoclonal antibodies generated to a recombinant gag fusion protein. Journal of Virological Methods 44, 117-128.[Medline]
Whetstone, C. A., Van Der Maaten, M. J. & Miller, J. M. (1991). A Western blot assay for the detection of antibodies to bovine immunodeficiency-like virus in experimentally inoculated cattle, sheep, and goats. Archives of Virology 116, 119-131.[Medline]
Zhang, S., Troyer, D. L., Kapil, S., Zheng, L., Kennedy, G., Weiss, M., Xue, W., Wood, C. & Minocha, H. C. (1997a). Detection of proviral DNA of bovine immunodeficiency virus in bovine tissues by polymerase chain reaction (PCR) and PCR in situ hybridization. Virology 236, 249-257.[Medline]
Zhang, S., Wood, C., Xue, W., Krukenberg, S. M., Chen, Q. & Minocha, H. C. (1997b). Immune suppression in calves with bovine immunodeficiency virus. Clinical Diagnostic Laboratory Immunology 4, 232-235.[Abstract]
Received 8 November 1999;
accepted 25 February 2000.
HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
J MED MICROBIOL | ALL SGM JOURNALS |