Deutsches Krebsforschungszentrum, Forschungsschwerpunkt Angewandte Tumorvirologie, Abt. F0301, INF 242, D-69120 Heidelberg, Germany1
Author for correspondence: Pidder Jansen-Dürr. Present address: Institut f. Biomedizinische Alternsforschung der Österreichischen Akademie der Wissenschaften, Rennweg 10, A-6020 Innsbruck, Austria. Fax +43 512 583919 8. e-mail P.Jansen-Duerr{at}oeaw.ac.at
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Regulation of cyclin E gene expression may be involved in transformation of mammalian cells by viral oncogenes, since a rapid induction of cyclin E gene expression is observed when adenovirus E1A (Spitkovsky et al., 1994 , 1996
) or HPV-16 E7 (Zerfass et al., 1995
) are expressed in resting fibroblasts. In both cases, the ability of the viral oncogenes to activate cyclin E gene expression is genetically linked to their transforming potential (Spitkovsky et al., 1996
; Zerfass et al., 1995
). These results suggest that transcriptional regulation of the cyclin E gene contributes to the control of cell cycle progression in normal and virally transformed fibroblasts.
Here we report a structure/function analysis of the murine cyclin E promoter and identify promoter elements required for E7-dependent trans-activation of the cyclin E gene.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cell culture and transfection.
NIH3T3 subclones, stably transfected with an expression vector for HPV-16 E7 (E7/2 cells) or the empty expression vector (pMo cells; Davies et al., 1993 ), were obtained from K. Vousden (Frederick, USA). Cells were grown in Dulbecco's modified essential medium (DMEM) supplemented with 10% foetal calf serum (FCS). For transient transfections, cells were transfected by calcium phosphate precipitation as described elsewhere (Chen & Okayama, 1987
). Besides the pCE luciferase reporter gene series, cells were cotransfected with a second reporter gene construct, pCMV-gal, as described (Botz et al., 1996
), which was used to correct for transfection efficiency. At 16 h postincubation, cells were washed and placed in DMEM containing either 0·5% or 10% FCS. Luciferase and ß-galactosidase assays were performed on cell extracts prepared 24 h after transfection as described previously (Zerfass et al., 1995
).
Drosophila SL2 cells (kindly provided by G. Suske; Marburg, Germany) were transfected with the LipofectAMINE reagent (GibcoBRL). Cells were plated into six-well tissue culture plates and grown in Schneider's Drosophila medium with 10% FCS at 25 °C without CO2. After 2 h transient transfection with solution A (2 µg DNA with serum-free medium) and solution B (LipofectAMINE reagent with serum-free medium) cells were washed and grown in Schneider's Drosophila medium. At 24 h postincubation cell extracts were prepared and luciferase activity was measured.
Preparation of protein extracts.
Whole cell extracts were prepared as described (Schulze et al., 1996 ). For nuclear/cytoplasmic fractionation, cells were pelleted by centrifugation and incubated in hypotonic lysis buffer (10 mM HEPES pH 7·5, 10 mM KCl, 3 mM MgCl2, 1 mM EDTA, 1 mM DTT, 5 µg/ml aprotinin, 5 µg/ml leupeptin, 5 mM NaF and 0·1 mM Na-vanadate) for 5 min on ice. After addition of NP-40 to a final concentration of 0·05% and incubation for 5 min on ice, nuclei were pelleted by centrifugation at 1250 g, washed twice with hypotonic lysis buffer containing 0·05% NP-40 and extracted in high salt extraction buffer (10 mM HEPES pH 7·5, 500 mM KCl, 5 mM MgCl2, 0·5 mM EDTA, 35% glycerol, 1mM DTT, 5 mM NaF, 0·1 mM Na-vanadate, 5 µg/ml aprotinin and 5 µg/ml leupeptin) by flash freezing. After rocking for 30 min at 4 °C, cell debris was removed by centrifugation at 100000 g. Cytoplasmic extracts were cleared by centrifugation at 10000 g and supplemented with glycerol to 35%.
Western blotting.
Cell extracts were separated by SDSPAGE and probed with polyclonal antisera to Sp1 (Santa Cruz) and monoclonal antibodies to M2-PK (Schebo Tech). E2F-4 was detected by the monoclonal antibody WUF-11 (a gift from E. Harlow, Charlestown, USA), DP-1 by the monoclonal antibody TFD10 (Neomarkers) and p107 by the polyclonal antibody C-18 (Santa Cruz), as described (Zerfass et al., 1995 ).
Electrophoretic mobility shift assay.
Bandshift experiments were performed as described previously (Schulze et al., 1996 ). The following double-stranded oligonucleotide probes were derived from the murine cyclin E promoter:
cycEIwt (5' GATCGGGCGGGCGCGAGGGCGGGACGGGGCGATC 3'),
cycEImutA (5' GATCGGGCGGTGATCAGGGCGGGACGGGGCGATC 3'),
cycEImutB (5' GATCGGGCGGGCGCGAGGAGATCTCGGGGCGATC 3'),
cycEImutAB (5' GATCGGGCGGTGATCAGGAGATCTCGGGGCGATC 3'),
cycEIIwt (5' CGGGCGCGAGGGCGGGACGGGGCCGGTGCCGCGCG 3'),
cycEIImutE2F (5' CGGGCGTATGGGCGTAGCGGGGCCGGTGCCGCGCG 3'),
cycEIImutSp1 (5' CGGGCGCGACCGCGGGAAGGGGCCGGTGCCGCGCG 3')
cycEIIIwt (5' GATCGCCGCTTCCCGCCTCCTGCTTCCCGCTCGCGATC 3'),
cycEIIImutC ( 5' GATCGCCGAGATATATCTCCTGCTTCCCGCTCGCGATC 3'),
cycEIIImutD (5' GATCGCCGCTTCCCGCCTCCTGAGATATATTCGCGATC 3'),
cycEIIImutCD (5' GATCGCCGAGATATATCTCCTGAGATATATTCGCGATC 3').
Oligonucleotides were chemically synthesized, 3'-end-labelled by Klenow DNA polymerase and incubated with cellular extracts, as described (Schulze et al., 1996 , 1998
). The oligonucleotides containing the E2F binding site of the adenovirus E2 promoter are described elsewhere (Schulze et al., 1995
). Proteins in nucleoprotein complexes were analysed by the addition of specific antibodies to the bandshift reaction followed by incubation on ice for 50 min prior to electrophoresis. p107 was detected by monoclonal antibody SD15 (a gift from N. Dyson, Charlestown, USA), pRb by a polyclonal antiserum (C-20, Santa Cruz), DP-1 by monoclonal antibody TFD10 (Neomarkers), E2F-4 by monoclonal antibody WUF-11 (a gift from E. Harlow, Charlestown, USA) and Sp1 by polyclonal antibody PEP 2 (Santa Cruz). To define uncomplexed E2F/DP heterodimers, 100 ng of a GST fusion protein containing the pocket domain of pRb (GSTRb 379928; Spitkovsky et al., 1997
) was added to the bandshift reaction.
![]() |
Results and Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
Antagonistic effects of E2F and Sp1 on cyclin E promoter activity
To be able to discriminate between the binding of Sp1 and E2F to the overlapping binding sites in the P1 promoter, a new set of oligonucleotides was prepared, in which specific mutations were introduced in the B element that would selectively disrupt the consensus sequence for one DNA binding protein but leave the other consensus sequence intact. Oligonucleotide CycEIIwt, extending from -20 to +14, was chosen as reference oligonucleotide, as it is centred on the potential E2F/Sp1 double binding site (Fig. 3a). It is known that many DNA binding proteins bind with reduced affinity to motifs which are located close to the ends of a DNA fragment. To produce a fragment deficient for E2F binding, oligonucleotide cycEIImutE2F was designed, in which the E2F consensus sequences in A and B were destroyed. In this case, the mutations were chosen such that the Sp1 consensus sequence (5'G/AC/TT/CA/CCGCCC/TA/C3'; Locker & Buzard, 1990
) was retained. To create a fragment deficient in Sp1 binding (cycEIImutSp1; Fig. 3a
), three nucleotides outside the E2F identity region (5'TTTCC/GCGCG; Lathangue, 1996
) were mutated, thereby affecting the Sp1 consensus sequence. The mutated oligonucleotides were radioactively labelled and used as probes in bandshift experiments. Similar to oligonucleotide cycEIwt in Fig. 2(b)
, probe cycEIIwt formed four different complexes with cellular DNA binding proteins (Fig. 3b
). By competition experiments applying oligonucleotides E2wt and E2mut, we found that one specific complex, equivalent to complex III in Fig. 2(b)
, contains a protein with the sequence specificity of E2F transcription factors (Fig. 3b
). Upon addition of antibodies to E2F-4 and DP-1, this complex was eliminated (Fig. 3b)
, indicating that it contains E2F-4/DP-1 heterodimers, most likely in the form of free E2F (see below, Fig. 5
). Addition of antibodies to Sp1 revealed that the slower migrating complex, which is equivalent to complex I in Fig. 2(b)
, contains Sp1. Oligonucleotide cycEIImutE2F bound Sp1 with an affinity similar to wild-type but was unable to bind E2F, whereas cycEIImutSp1 was unable to interact with Sp1 but strongly interacted with E2F complexes (Fig. 3b
). Addition of antibodies to p107 revealed weak supershifts with a subset of the labelled probes. Since p107 supershifts were visible with oligonucleotides cycEIIwt and cycEIImutSp1 but not with cycEIImutE2F, these data suggest that a p107-containing E2F complex weakly interacts with the cyclin E promoter in NIH3T3 cells (see also below, Fig. 5
).
|
Since Sp1 and E2F appear to interact with overlapping binding sites in both the P1 and P2 promoters, we analysed the influence of Sp1 and E2F on transcriptional activity of both promoters. For these experiments, Drosophila Schneider cells were used, which have been described as a suitable experimental system to test the trans-activation function of Sp1 in cotransfections (Hagen et al., 1994 ), as such cells are devoid of any endogenous Sp1. For cotransfection experiments, E2F-1 was used, as it is known that E2F-1, unlike other E2F family members, contains an autonomous nuclear localization signal, which enables it to reach the nucleus independent of any auxiliary proteins (Delaluna et al., 1996
; Magae et al., 1996
). Furthermore, it was shown previously that E2F-1 can act synergistically with Sp1 to induce transcription of the DHFR gene (Karlseder et al., 1996
). Expression of E2F-1 in Schneider cells resulted in a 25-fold activation of transcription from the reporter gene construct pCE(-94/+95), whereas Sp1 induced only a weak trans-activation (about threefold). Interestingly, when E2F-1 and Sp1 were coexpressed, we did not observe any further trans-activation; in contrast, coexpression of Sp1 severely impaired E2F-1-mediated trans-activation (Fig. 3 d
). As in the case of the P1 promoter, E2F-1-induced transcription from the P2 reporter gene construct pCE(+95/+263) is downregulated by Sp1 (Fig. 3d
), indicating that both transcription factors compete for the same site also in the P2 promoter. These experiments suggest that the presence of excess Sp1 limits the interaction of E2F with both transcription units of the cyclin E gene, resulting in a lack of trans-activation.
Previous studies from other laboratories suggest a functional interaction between Sp1 and E2F. It was shown that Sp1 and E2F-1 act synergistically to induce transcription of the DHFR gene, and synergistic activation may result from a physical interaction between both transcription factors (Karlseder et al., 1996 ; Lin et al., 1996
). While these data provide evidence for cooperation between adjacent binding sites for E2F and Sp1, our finding that E2F and Sp1 apparently compete for overlapping binding sites in the cyclin E promoter suggests that Sp1 may modulate inducibility of the gene by E2F. These observations suggest that transcriptional activity of the cyclin E gene depends on a functional balance between transcription factors of the E2F and Sp1 families.
The E2F/Sp1 binding sites are involved in trans-activation of cyclin E gene expression by E7
Since expression of HPV-16 E7 prevents downregulation of cyclin E mRNA levels in serum-starved NIH3T3 cell clones (Zerfass et al., 1995 ), we asked if expression of E7 would lead to an activation of cyclin E transcription in NIH3T3 cells. To address this question, NIH3T3 cells were cotransfected with an expression vector for HPV-16 E7 and the cyclin E reporter gene constructs mentioned above. As could be expected from previous studies (Zerfass et al., 1995
), expression of E7 did not significantly affect the activity of the cyclin E-derived reporter genes in asynchronously growing cells (data not shown). However, when expressed in serum-starved cells, E7 induced a five- to sixfold increase in the activity of constructs pCE(-3565/+263) and pCE(-543/+263) (Table 1
). Further deletion of 5' sequences reduced responsiveness to E7. Thus, construct pCE(-94/+263) responds by a threefold activation to E7 expression, indicating that a promoter element(s) located between -543 and -94 contributes to full inducibility of the cyclin E promoter by E7. Separate analysis of P1 and P2 revealed that P1, as in the reporter gene construct pCE(-94/+95), was induced about threefold by E7, while the activity of P2, as in construct pCE(+95/+263), was induced about twofold by E7 (Table 1
). These results indicate that at least three different promoter elements, each of which is only weakly activated by E7, contribute to the observed significant trans-activation of the gene by E7.
|
To evaluate the role of the GC-rich elements for activation of cyclin E transcription by E7, specific point mutations were introduced into P1 and P2. Mutations that selectively disrupt either the Sp1 or the E2F binding site, as shown in Fig. 3, were introduced into the P1 reporter gene construct pCE(-94/+95) to yield pCE(-94/+95)mutE2F and pCE(-94/+95)mutSp1, respectively. Similarly, point mutations were introduced into elements C and D of the P2 reporter gene construct pCE(+95/+263) to yield construct pCE(+95/+263)mutCD. Mutation of the GC-rich elements affected induction of the promoter by E7. Thus, transcription from the P1 promoter construct pCE(-94/+95) is induced three- to fourfold by HPV-16 E7, whereas simultaneous mutation of the E2F and Sp1 binding sites, as in pCE(-94/+95)mutAB, reduced inducibility to background levels (Fig. 4
). The constructs in which either the E2F or Sp1 binding site was mutated, were both inducible about twofold by E7, indicating that both binding sites are required for maximal trans-activation. Transcription of the P2 promoter construct pCE(+95/+263) is induced twofold by E7, and this is reduced to background levels by simultaneous disruption of elements C and D, as in construct pCE(+95/+263)mutCD. Although the foldness of E7-dependent trans-activation is quite weak for all constructs shown in Fig. 4
, the observation that the GLY24 mutant has no significant effect in either case suggests that the effects observed for wild-type E7 are specific. Together, these results expand our previous conclusion that activation of cyclin E transcription by E7 results from the combination of several pathways which would only weakly affect promoter activity in isolation.
|
When the nuclear extracts were analysed in a bandshift experiment using the wild-type sequence (cycEIIwt) as labelled probe, we found that Sp1 was the major protein binding to the oligonucleotide in nuclear extracts (Fig. 5b). While we noted a slight increase in the abundance of Sp1 in extracts from E7-expressing cells, the amount of Sp1 binding activity in these extracts was very similar. Under the conditions used here, an interaction of E2F with the probe was not observed. In control experiments, using a probe containing the E2F sites from either the cyclin A promoter (Schulze et al., 1995
) or the adenovirus E2 promoter, strong E2F binding activity was observed in these extracts (data not shown), indicating that E2F is present in these extracts but fails to interact with its binding site in the cyclin E promoter. Nuclear extracts from both pMo and E7/2 cells yielded an additional nucleoprotein complex, which comigrates with free E2F (Fig. 5b, c
). However, this band represents an unspecific complex, as its abundance and gel migration are not significantly affected by addition of any competitor oligonucleotide or antibody used in the experiments shown in Fig. 5
.
Since the E2F binding site overlaps with the Sp1 consensus sequence, the failure to detect E2F complexes in nuclear extracts raises the possibility that binding of Sp1 to its recognition site may prevent the binding of E2F species. To analyse this possibility, additional bandshift experiments were performed using a probe (cycEIImutSp1) in which the Sp1 binding site is destroyed, while the binding of E2F is not affected (Fig. 3b). Under these conditions, E2F binding was readily detected (Fig. 5c
), indicating that also in nuclear extracts, E2F can interact with the P1 promoter when Sp1 binding is prevented. Different E2F complexes were revealed in extracts from control and E7-expressing cells. Thus, in nuclear extracts from pMo cells, complexes containing E2F-4/DP-1 and p107 were the main DNA binding proteins, whereas in extracts from E7-expressing cells, p107-containing complexes were not observed; instead, these extracts contained predominantly free E2F, consisting of E2F-4 and DP-1, as revealed by supershift experiments. That the faster migrating complexes indeed represent free E2F is further suggested by the observation that this complex is supershifted upon addition of a recombinant GSTpocket fusion protein (Fig. 5c
) (Spitkovsky et al., 1997
). These data indicate that the P1 promoter of the cyclin E gene can interact with distinct E2F complexes, and the composition of these complexes is modulated by E7.
The ability of E7 to sequester p107 from E2F (Fig. 5c; see also Lam et al., 1994
), which results in nuclear free E2F-4/DP-1 heterodimers (Fig. 5c
; see also Schulze et al., 1998
) probably contributes to transcriptional activation, as in the case of the cyclin A gene (Schulze et al., 1998
). In contrast, no evidence for stable association of Sp1 and pRb or p107 was found in our bandshift experiments, and no changes of Sp1 complexes were noticed when extracts of E7-expressing and control cells were compared (Fig. 5
). While it appears possible that altered binding of E2F family members may affect the binding of Sp1 to the promoter, given the fact that both factors compete for overlapping binding sites, the mechanism by which E7 activates Sp1-driven transcription remains to be elucidated. There is precedent for the ability of E7 to activate transcription factors distinct from E2F. Thus, evidence was presented for functional interactions between HPV-16 E7 and the transcription factors AP-1 (Antinore et al., 1996
), ATF, Oct-1 (Wong & Ziff, 1996
), Oct-4 (Brehm et al., 1999
), TBP (Massimi et al., 1996
) and the TBP-associated factor TAF110 (Mazzarelli et al., 1995
). Our finding that multiple cis-acting elements in the cyclin E gene respond to expression of the E7 oncogene is reminiscent of the pleiotropic effects on gene expression exerted by the E1A gene of adenovirus 5, a well-known trans-activator of several cellular genes (for review, see Nevins, 1993
).
Recent work from other laboratories (Magnaghi-Jaulin et al., 1998 ; Brehm et al., 1998
) implies a role for histone deacetylases, in particular HDAC-1, in the regulation of E2F-driven transcription, including transcription from the murine cyclin E promoter (Brehm et al., 1998
). At present it is unclear if a functional interaction of E7 with histone deacetylases is relevant for transcriptional regulation of the cyclin E promoter. As a matter of fact, preliminary data suggest that E7 binds to an unknown cellular protein that displays histone deacetylase activity; however, this unknown cellular protein is apparently unrelated to either HDAC-1 or HDAC-2, as suggested by the results of coimmunoprecipitation experiments (W. Zwerschke, unpublished). Hence, the role, if any, of chromatin-modifying enzymes in transcriptional regulation by E7 remains to be clarified.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Banks, L., Edmonds, C. & Vousden, K. H. (1990). Ability of the HPV16 E7 protein to bind RB and induce DNA synthesis is not sufficient for efficient transforming activity in NIH3T3 cells. Oncogene 5, 1383-1389.[Medline]
Botz, J., Zerfass-Thome, K., Spitkovsky, D., Delius, H., Vogt, B., Eilers, M., Hatzigeorgiou, A. & Jansen-Dürr, P. (1996). Cell cycle regulation of the murine cyclin E gene depends on an E2F binding site in the promoter. Molecular and Cellular Biology 16, 3401-3409.[Abstract]
Brehm, A., Miska, E. A., McCance, D. J., Reid, J. L., Bannister, A. J. & Kouzarides, T. (1998). Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391, 597-601.[Medline]
Brehm, A., Ohbo, K., Zwerschke, W., Botquin, V., Jansen-Dürr, P. & Scholer, H. R. (1999). Synergism with germ line transcription factor oct-4: viral oncoproteins share the ability to mimic a stem cell-specific activity. Molecular and Cellular Biology 19, 2635-2643.
Chen, C. & Okayama, H. (1987). High efficiency transformation of mammalian cells by plasmid DNA. Molecular and Cellular Biology 7, 2745-2752.[Medline]
Davies, R., Hicks, R., Crook, T., Morris, J. & Vousden, K. (1993). Human papillomavirus type-16 E7 associates with a histone H1 kinase and with p107 through sequences necessary for transformation. Journal of Virology 67, 2521-2528.[Abstract]
Delaluna, S., Burden, M. J., Lee, C. W. & Lathangue, N. B. (1996). Nuclear accumulation of the E2F heterodimer regulated by subunit composition and alternative splicing of a nuclear localization signal. Journal of Cell Science 109, 2443-2452.
Dulic, V., Lees, E. & Reed, S. (1992). Association of human cyclin E with a periodic G1S phase protein kinase. Science 257, 1958-1961.[Medline]
Edmonds, C. & Vousden, K. (1989). A point mutational analysis of human papillomavirus type 16 E7 protein. Journal of Virology 63, 2650-2656.[Medline]
Geng, Y., Eaton, E. N., Picon, M., Roberts, J. M., Lundberg, A. S., Gifford, A., Sardet, C. & Weinberg, R. A. (1996). Regulation of cyclin E transcription by E2Fs and retinoblastoma protein. Oncogene 12, 1173-1180.[Medline]
Hagen, G., Muller, S., Beato, M. & Suske, G. (1994). Sp1-mediated transcriptional activation is repressed by Sp3. EMBO Journal 13, 3843-3851.[Abstract]
Helin, K. (1998). Regulation of cell proliferation by the E2F transcription factors. Current Opinion in Genetics & Development 8, 28-35.[Medline]
Karlseder, J., Rotheneder, H. & Wintersberger, E. (1996). Interaction of Sp1 with the growth- and cell cycle-regulated transcription factor E2F. Molecular and Cellular Biology 16, 1659-1667.[Abstract]
Knoblich, J. A., Sauer, K., Jones, L., Richardson, H., Saint, R. & Lehner, C. F. (1994). Cyclin E controls S phase progression and its down-regulation during drosophila embryogenesis is required for the arrest of cell proliferation. Cell 77, 107-120.[Medline]
Koff, A., Cross, F., Fisher, A., Schumacher, J., Leguellec, K., Philippe, M. & Roberts, J. M. (1991). Human cyclin E, a new cyclin that interacts with two members of the cdc2 gene family. Cell 66, 1217-1228.[Medline]
Koff, A., Giordano, A., Desai, D., Yamashita, K., Harper, J. W., Elledge, S., Nishimoto, T., Morgan, D. O., Franza, B. R. & Roberts, J. M. (1992). Formation and activation of a cyclin Ecdk2 complex during the G1 phase of the human cell cycle. Science 257, 1689-1694.[Medline]
Lam, E. W. F., Morris, J. D. H., Davies, R., Crook, T., Watson, R. J. & Vousden, K. H. (1994). HPV16 E7 oncoprotein deregulates B-myb expression: correlation with targeting of p107/E2F complexes. EMBO Journal 13, 871-878.[Abstract]
Lathangue, N. B. (1996). E2F and the molecular mechanisms of early cell-cycle control. Biochemical Society Transactions 24, 54-59.[Medline]
Lin, S. Y., Black, A. R., Kostic, D., Pajovic, S., Hoover, C. N. & Azizkhan, J. C. (1996). Cell cycle-regulated association of E2F1 and Sp1 is related to their functional interaction. Molecular and Cellular Biology 16, 1668-1675.[Abstract]
Lindeman, G. J., Gaubatz, S., Livingston, D. M. & Ginsberg, D. (1997). The subcellular localization of E2F-4 is cell-cycle dependent. Proceedings of the National Academy of Sciences, USA 94, 5095-5100.
Locker, J. & Buzard, G. (1990). A dictionary of transcription control sequences. DNA Sequence 1, 3-11.[Medline]
Magae, J., Wu, C. L., Illenye, S., Harlow, E. & Heintz, N. H. (1996). Nuclear localization of DP and E2F transcription factors by heterodimeric partners and retinoblastoma protein family members. Journal of Cell Science 109, 1717-1726.
Magnaghi-Jaulin, L., Groisman, R., Naguibneva, I., Robin, P., Lorain, S., Le, V. J., Troalen, F., Trouche, D. & Harel, B. A. (1998). Retinoblastoma protein represses transcription by recruiting a histone deacetylase. Nature 391, 601-605.[Medline]
Massimi, P., Pim, D., Storey, A. & Banks, L. (1996). HPV-16 E7 and adenovirus E1a complex formation with TATA box binding protein is enhanced by casein kinase II phosphorylation. Oncogene 12, 2325-2330.[Medline]
Mazzarelli, J. M., Atkins, G. B., Geisberg, J. V. & Ricciardi, R. P. (1995). The viral oncoproteins Ad5 E1A, HPV16 E7 and SV40 TAg bind a common region of the TBP-associated factor-110. Oncogene 11, 1859-1864.[Medline]
Motokura, T., Bloom, T., Kim, H. G., Jüppner, H., Ruderman, J. V., Kronenberg, H. M. & Arnold, A. (1991). A novel cyclin encoded by a bc/1-linked candidate oncogene. Nature 350, 512-515.[Medline]
Nevins, J. R. (1993). Transcriptional activation by the adenovirus E1A proteins. Seminars in Virology 4, 25-31.
Ohtani, K., Degregori, J. & Nevins, J. R. (1995). Regulation of the cyclin E gene by transcription factor E2F1. Proceedings of the National Academy of Sciences, USA 92, 12146-12150.[Abstract]
Ohtsubo, M., Theodoras, A. M., Schumacher, J., Roberts, J. M. & Pagano, M. (1995). Human cyclin E, a nuclear protein essential for the G(1)-to-S phase transition. Molecular and Cellular Biology 15, 2612-2624.[Abstract]
Resnitzky, D., Gossen, M., Bujard, H. & Reed, S. I. (1994). Acceleration of the G(1)/S phase transition by expression of cyclins D1 and E with an inducible system. Molecular and Cellular Biology 14, 1669-1679.[Abstract]
Schulze, A., Zerfaß, K., Spitkovsky, D., Henglein, B. & Jansen-Dürr, P. (1994). Activation of the E2F transcription factor by cyclin D1 is blocked by p16INK4, the product of the putative tumor suppressor gene MTS1. Oncogene 9, 3475-3482.[Medline]
Schulze, A., Zerfaß, K., Spitkovsky, D., Berges, J., Middendorp, S., Jansen-Dürr, P. & Henglein, B. (1995). Cell cycle regulation of cyclin A gene transcription is mediated by a variant E2F binding site. Proceedings of the National Academy of Sciences, USA 92, 11264-11268.[Abstract]
Schulze, A., Zerfass-Thome, K., Berges, J., Middendorp, S., Jansen-Dürr, P. & Henglein, B. (1996). Anchorage-dependent transcription of the cyclin A gene. Molecular and Cellular Biology 16, 4632-4638.[Abstract]
Schulze, A., Mannhardt, B., Zerfass-Thome, K., Zwerschke, W. & Jansen-Dürr, P. (1998). Anchorage-independent transcription of the cyclin A gene induced by the E7 oncoprotein of human papillomavirus type 16. Journal of Virology 72, 2323-2334.
Sherr, C. J. (1994). G1 phase progression: cycling on cue. Cell 79, 551-555.[Medline]
Spitkovsky, D., Steiner, P., Lukas, J., Lees, E., Pagano, M., Schulze, A., Joswig, S., Picard, D., Tommasino, M., Eilers, M. & Jansen-Dürr, P. (1994). Modulation of cyclin gene expression by adenovirus E1A in a cell line with E1A-dependent conditional proliferation. Journal of Virology 68, 2206-2214.[Abstract]
Spitkovsky, D., Jansen-Dürr, P., Karsenti, E. & Hoffmann, I. (1996). S-phase induction by adenovirus E1A requires activation of cdc25A tyrosine phosphatase. Oncogene 12, 2549-2554.[Medline]
Spitkovsky, D., Schulze, A., Boye, B. & Jansen-Dürr, P. (1997). Downregulation of cyclin A gene expression upon genotoxic stress correlates with reduced binding of free E2F to the promoter. Cell Growth and Differentiation 8, 699-710.[Abstract]
Tani, K., Yoshida, M. C., Satoh, H., Mitamura, K., Noguchi, T., Tanaka, T., Fujii, H. & Miwa, S. (1988). Human M2-type pyruvate kinase: cDNA cloning, chromosomal assignment and expression in hepatoma. Gene 73, 509-516.[Medline]
Weinberg, R. A. (1995). The retinoblastoma protein and cell cycle control. Cell 81, 323-330.[Medline]
Wimmel, A., Lucibello, F., Sewing, A., Adolph, S. & Müller, R. (1994). Inducible acceleration of G(1). Progression through tetracycline-regulated expression of human cyclin E. Oncogene 9, 995-997.[Medline]
Wong, H. K. & Ziff, E. B. (1996). The human papillomavirus type 16 E7 protein complements adenovirus type 5 E1A amino-terminus-dependent transactivation of adenovirus type 5 early genes and increases ATF and Oct-1 DNA binding activity. Journal of Virology 70, 332-340.[Abstract]
Zerfass, K., Schulze, A., Spitkovsky, D., Friedman, V., Henglein, B. & Jansen-Dürr, P. (1995). Sequential activation of cyclin E and cyclin A gene expression by HPV-16 E7 through sequences necessary for transformation. Journal of Virology 69, 6389-6399.[Abstract]
Received 19 January 1999;
accepted 12 April 1999.