Department of Virology, Haartman Institute and Helsinki University Central Hospital, POB 21, FIN-00014 University of Helsinki, Finland1
Author for correspondence: Laura Kakkola. Fax +358 9 19126491. e-mail laura.kakkola{at}helsinki.fi
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Full-length or near-full-length sequences from representatives of genotypes 13 and 1023 have been deposited in GenBank. DNA sequence analysis of the identified TTVs indicate that most genotypes hitherto sequenced contain at least 23 open reading frames (ORFs) (Erker et al., 1999 ; reviewed by Bendinelli et al., 2001
). The longest ORF, ORF1, encodes the putative capsid protein, whereas the shorter ORF2, often divided into ORFs 2a and 2b, possibly encode non-structural proteins. It has also been shown that mRNA splicing creates additional ORFs (Kamahora et al., 2000
; Okamoto et al., 2000b
).
As measured in serum or plasma by PCR, TTV is ubiquitous, with an age-dependent prevalence that approaches 94% among healthy adults (Hijikata et al., 1999a ; Saback et al., 1999
). TTV DNA can persist for several months or years and multiple infections with several genotypes are frequently detected in the blood (Nishizawa et al., 1997
; Ball et al., 1999
; Biagini et al., 1999
; Gallian et al., 1999
; Okamoto et al., 1999a
; Takayama et al., 1999
; Niel et al., 2000
) and in a diverse range of tissues (Okamoto et al., 2001
). The prevalence of the various genotypes does not seem to differ geographically (Mushahwar et al., 1999
; Gallian et al., 2000
). Primate infection studies have shown TTV to be a transmissible agent (Mushahwar et al., 1999
; Luo et al., 2000
; Tawara et al., 2000
) but it has not been shown to be the cause of any particular disease (reviewed by Bendinelli et al., 2001
; Okamoto & Mayumi, 2001
).
Diagnoses of TTV infections have been based almost solely on PCR. Due to high sequence variation, however, it is difficult to find a universal PCR primer set for all TTV genotypes (Okamoto et al., 1999a ). Only a few TTV antibody studies have been published. These studies have used either fragments of the ORF1-encoded protein or crude TTV particles as antigen. Robust immunoprecipitation experiments have suggested the existence of TTV-specific antibodies (Nishizawa et al., 1999
; Tsuda et al., 1999
) and an IgM-capture method combined with PCR has revealed IgM class antibodies (Tsuda et al., 2001
). TTV antibodies in serum have been detected by immunoblot assays using bacterially expressed N- and C-terminal fragments of the ORF1-encoded protein as antigen (Handa et al., 2000
; Ott et al., 2000
). In addition, electron microscopy has revealed that TTV particles in faeces are in free form as opposed to those found in serum, which are complexed with IgG antibodies (Itoh et al., 2000
).
The aims of this study were as follows: (1) to clone and sequence a TTV genome, to map its genomic organization and to compare it with other TTV genomes; (2) to express viral proteins; and (3) to study the antigenicity of those proteins. We have cloned and sequenced the near-full-length genome of a TTV (HEL32), representing a previously uncharacterized genotype 6, and compared the genomic organization of HEL32 with those of 41 TTV strains of 17 genotypes. Three ORFs were cloned, two of which (ORFs 2a and 2b) were successfully expressed and used as antigen in immunoblot assays. Specific antibodies and TTV DNA were measured in the sera of 89 non-symptomatic individuals, three of whom were followed retrospectively for 1215 years.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
To avoid contamination, the samples and PCR mixtures were prepared in separate rooms and under laminar flow hoods, using disposable racks and aerosol-resistant tips. Water was included as a negative control.
Cloning of the TTV genome.
A 3381 bp region of a TTV DNA isolate, termed HEL32, was amplified and cloned in two overlapping pieces. A 3269 bp PCR product, corresponding to nt 1133381 of the HEL32 genome, was amplified by nested PCR from the serum of a non-symptomatic Finnish female, using primers NG133, NG135, NG134 and NG136 (Okamoto et al., 1999a ). Both PCR reactions (50 µl) contained 200 µM of each dNTP (Roche), 320 nM of each primer, 1·5 mM MgCl2 and 2·6 U of Expand High Fidelity enzyme mix (Boehringer Mannheim). The sample volume was 25 µl for the outer PCR and 2 µl for the inner PCR. The PCR protocol consisted of annealing at 54 °C for 30 s and extension at 68 °C for 2·5 min for the first 10 cycles, with 5 s per cycle added to the extension time for the remaining 20 cycles. The amplicons were electrophoresed, stained with ethidium bromide (EtBr) and visualized under UV. The band of the expected size was excised and DNA was isolated with the QIAquick Gel Extraction kit (Qiagen). The 3269 bp PCR product was cloned into pSTBlue-1 (Novagen) and transformed into Escherichia coli DH5
cells.
Of the TTV genome, nt 1222 were amplified with the semi-nested primers NG054, NG147 and NG132 (Okamoto et al., 1999a ). The reaction mixture and PCR program were as described for universal PCR (see below), except that annealing occurred at 50 °C, the extension time was 45 s and the cycles were repeated 30 times, with a final extension of 3 min. Amplicons were isolated and cloned as described above.
Sequence analysis.
All new TTV sequences reported in this paper were obtained using ABI PRISM (Perkin-Elmer) at the sequencing core facility of the Haartman Institute, University of Helsinki, Finland. The genomic organization in HEL32 was determined and compared to 41 other near-full-length TTV sequences (obtained from GenBank) using MAPDRAW (DNASTAR) and DNASTRIDER, version 1.0 (Marck C., Commissariat a lEnergie Atomique, France). Multiple sequence alignment and evolutionary distance analyses were obtained using the PILEUP, GROWTREE and DISTANCES programs, all of which are part of the Wisconsin package 10.1 (Genetics Computer Group) and are maintained by the Center for Scientific Computing (Espoo, Finland). For genotyping, the sequence of the N22 area of HEL32 was compared to those of 20 published TTV genotypes (Muljono et al., 2001 ) and the ORF1 sequence was compared to 17 genotypes reported by Okamoto et al. (2001)
. Phylogenetic trees (see Fig. 2) were constructed with TREEPUZZLE using the maximum-likelihood approach (Strimmer & von Haesler, 1997
); 10000 puzzling steps were applied using the HKY model of substitution (Hasegawa et al., 1985
). For confirmation, the trees were also constructed using the neighbour-joining algorithm of the PHYLIP program package with 500 bootstrap replicates (Felsenstein, 1989
). The program BLAST was used for database searches (NCBI).
Cloning of ORFs into expression plasmids.
In-frame PCR primers specific for each of the three ORFs (Fig. 1) were designed. Primers were as follows: for ORF1, forward 5' TCGGAATTCATGGCCTGGTACTGGT 3' (nt 581598) and reverse 5' GCTTTGGGCAGCGGCCGCTATGTGG 3' (nt 29172941); for ORF2a, forward 5' CGTGGGATCCGCTGAGTTTTCCACGCCCGTC 3' (nt 109129) and reverse 5' TCTAATAAAGGCGGCCGCCCACTG 3' (nt 799822); and for ORF2b, forward 5' TCGGAATTCATGGGCAAGGCTCTTAG 3' (nt 239255) and reverse 5' TCTAATAAAGGCGGCCGCCCACTG 3' (nt 799822). In each primer, restriction enzyme sites (underlined) were incorporated to allow cloning into the expression plasmid. ORFs 2a and 2b were amplified together as a single PCR amplicon (ORF2a/b). ORF2b was also amplified separately. The reverse primers were designed downstream of the stop codons in each ORF. However, to verify the presence of the ORF2a stop codon at nt 255, the same reverse primer as that used for ORF2b was employed.
|
Expression of TTV proteins.
The ORF amplicons in pGEX-4T-1 were expressed as GST fusion proteins in E. coli strain BL21 (Amersham Pharmacia). The GST protein alone was also expressed as a control. IPTG was used (0·4 mM) for 2-, 4-, 6- and 8-h inductions, both at room temperature and at 37 °C. Cells were lysed as described previously (Söderlund et al., 1992 ). Whole-cell lysates were studied by 10% SDSPAGE and protein bands were visualized with Coomassie stain (Serva).
Immunoblotting.
Proteins from SDSPAGE were transferred to a Protran nitrocellulose membrane (Schleicher & Schuell) at 400 mA for 2 h (Söderlund et al., 1992 ). Membranes were blocked with 5% fat-free milk powder (Valio) and 0·2% Triton X-100 in PBS. For immunodetection of the GST fusion proteins, the primary antibody was goat anti-GST (1:1000; Amersham Pharmacia) and the secondary antibody was peroxidase-conjugated, affinity purified rabbit anti-goat IgG (1:100; Jackson Immunoresearch).
Human sera were diluted (in PBS containing 5% milk powder and 0·2% Triton X-100) 1:50 for IgG detection and 1:30 for IgM detection. The respective peroxidase conjugates were horseradish peroxidase-labelled, rabbit anti-human IgG and IgM (Dako); bound antibodies were detected with hydrogen peroxide and DAB (Söderlund et al., 1992 ). Sera showing antibody reactivity with the GST fusion proteins fp2a and fp2b were re-examined with the expressed GST control protein and uninduced lysates of E. coli. The possibility of rheumatoid factor interference in IgM detection was eliminated by the prior removal of IgG using Gullsorb (Meridian Diagnostics).
Universal PCR.
A conserved sequence (nt 90232) (Fig. 1), immediately downstream of the untranslated region and partially overlapping ORF2a, was amplified using primers NG133, NG147, NG134 and NG132 (Okamoto et al., 1999a
), resulting in a 110 bp product. PCR mixtures contained 200 µM of each dNTP (Roche), 600 nM of each primer, 1·5 mM MgCl2 and 2·5 U of AmpliTaq Gold polymerase (Applied Biosystems/Roche) in 25 µl. The sample volume in the outer PCR was 8 µl and in the inner PCR was 2 µl. Amplification conditions were as described by Okamoto et al. (1999a
), except that both PCRs comprised 35 cycles. Amplicons were detected by agarose gel electrophoresis followed by EtBr staining.
Products of the universal PCR were confirmed by dot-blot hybridization. A digoxigenin-labelled 110 bp probe was prepared by incorporation of digoxigenin-11 dUTP (Boehringer Mannheim) during a separate inner universal PCR of cloned HEL32. Membranes were hybridized at 42 °C overnight. Non-labelled amplicons of the probe PCR, the PCR product of a TTV-negative control, pSTBlue-1 either with and without nt 1222 of HEL32 and water were included as the controls.
Three universal PCR products that were longer than expected, as well as four randomly chosen amplicons, were cloned into pSTBlue-1 and the plasmid inserts were sequenced.
N22 PCR.
The N22 region of 270 bp, illustrated in Fig. 1
(Nishizawa et al., 1997
), was amplified by nested PCR using primers TT69 (Höhne et al., 1998
). PCR conditions were as described for universal PCR, except that annealing was at 42 °C and the elongation time was 45 s, plus 3 min at the end.
Genotype 6 PCR and hybridization.
Nested primers within the N22 region were designed for genotype 6-specific detection of HEL32-like DNA. The primers used were as follows: for outer PCR, forward 5' CCCCTGGAGCATACCAAG 3' (nt 18051822) and reverse 5' CATGACCTCTAGCTGGTGGAAC 3' (nt 21812202); for inner PCR, forward 5' CAGTATACTCAGAAAAGCAAAG 3' (nt 18981919) and reverse 5' CATTTCCACCTCATTCTTATAGG 3' (nt 21462168). Amplification conditions were as described for universal PCR, except that the annealing temperature was 55 °C for the outer PCR and 52 °C for the inner PCR.
The genotype 6 PCR products underwent dot-blot hybridization. A digoxigenin-labelled 273 bp probe was prepared as described above, but using the inner genotype 6 PCR primers and cloned HEL32 DNA as template. The genotype 6 PCR products obtained were also sequenced.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
When the ORF2a sequences of all the 42 TTV DNA isolates were compared to each other, this region was found to be highly conserved both at the nucleotide level and at the amino acid level. The ORF2a nucleotide and amino acid divergences between TA278 and HEL32 were 8 and 12%, respectively. Also, the length (49 aa) of the predicted ORF2a product was conserved in 26 of 34 ORF2a-containing isolates. The ORF2b region varied both in sequence (divergence of >50%) and in length. The lengths of the predicted ORF1 products were found to vary by 646816 aa. Interesting exceptions were isolates US32 (detected by Erker et al., 1999 ) and SENV-B, which had stop codons within the ORF1 regions that disrupted the potential proteins. The ORF1-encoded protein of HEL32 was predicted to be 736 aa in length and to contain the conserved arginine-rich region described by Okamoto et al. (1998)
and Mushahwar et al. (1999)
.
Expression of TTV proteins
The three putative ORFs (ORFs 1, 2a and 2b) were amplified by PCR and cloned into a GST fusion expression plasmid. Both fp2a and fp2b were successfully expressed at 4, 6 and 8 h post-induction, both at room temperature and at 37 °C (Fig. 4a), with increasing yields over time. However, no protein product was obtained from the ORF1GST construct. The correct molecular masses of fp2a (32 kDa), fp2b (43 kDa) and the GST moiety (26 kDa) were confirmed by immunoblotting with an anti-GST antibody (Fig. 4b
). In all future assays, an 8 h induction at room temperature was used.
|
|
|
|
|
None of the TTV antibody-positive sera showed comparable reactivity with lysates of uninduced E. coli or with the GST protein moiety (Fig. 5). The IgM result of the only sample that was both IgM- and IgG-positive for the same antigen (fp2b), was retained after Gullsorb treatment, i.e. it was not abrogated by the removal of IgG.
Follow-up studies
Sequential serum samples covering 1215 years were available from three subjects and a fourth subject was followed for 1·5 years (Fig. 6). The DNA and antibody status remained unaltered in two subjects (#26 and #55), who maintained very strong fp2b-specific IgM reactivity but no IgG reactivity in all samples. Both subjects were TTV DNA-positive for at least 14 and 15 years, respectively. The DNA and antibody status of two subjects changed with time. Subject #1 showed strong fp2b IgM reactivity for three years, after which it gradually declined below levels of detection. This subject was the only one in the study presenting with strong fp2a IgG immunoreactivity, which, furthermore, persisted throughout the 12 year follow-up period. Only the last sample was TTV DNA-positive. Subject #97 showed fluctuating borderline fp2b IgM and IgG reactivity for 1·5 years and, in the last sample, converted to TTV DNA-positivity. The TTV strains of subjects #1 and #97, detected by universal PCR, were (as described below) closely related to the TTV-like miniviruses (TLMV; Okamoto et al., 2000a
; Takahashi et al., 2000
).
Prevalence of TTV DNA
Serum samples of all 89 subjects were studied for TTV DNA by universal PCR. The sera of most (80) subjects were also analysed by N22 PCR. Each PCR was repeated at least once and the universal PCR results were confirmed by dot-blotting and sequencing. Six samples showed poorly reproducible results in universal PCR, probably due to low DNA concentrations, but were considered to be TTV DNA-positive. All water controls were always negative.
TTV DNA in serum was detected by universal PCR in 85% (74 of 87) of the subjects (Tables 1 and 2
). Two additional subjects became positive during follow-up (see above and Fig. 6
). The less sensitive, or more specific (detecting fewer genotypes), N22 PCR was positive in 18% (14 of 80) of subjects, one of whom was negative by universal PCR. Thus, the overall prevalence of TTV DNA among these 87 non-symptomatic subjects was 86% (75 of 87).
By universal PCR, three samples (subjects #1, 52 and 97) gave PCR products that were longer than expected (130160 bp versus 110 bp) and did not hybridize with the TTV probe. To avoid potential interference of multiple genotypes in sequencing, these three amplicons were cloned into plasmids and sequenced. Sequence comparison, using the BLAST and GROWTREE programs, showed that all three sequences grouped with those of TLMVs (Okamoto et al., 2000a ; Takahashi et al., 2000
) (data not shown).
Genotype 6 DNA detection
For detection of TTVs of the HEL32 genotype, samples of all 17 IgM- and/or IgG-positive subjects (15 of whom were, or became, TTV DNA-positive) and 18 antibody negative subjects (16 of whom were TTV DNA-positive), including all samples of three subjects followed up (#1, #26 and #55), were studied by genotype 6 PCR. Serum of the HEL32 donor and the plasmid clone were included as positive controls. PCR results were confirmed both by sequencing and by hybridization with a genotype 6-specific probe.
By genotype 6 PCR, only 2 (#23 and #86) of 35 subjects, in addition to the HEL32 donor, had TTV of genotype 6, revealing a genotype 6 DNA prevalence of 8·6% in total and 9·7% (3 of 31) in the TTV DNA-positive group. Comparison of the amplified DNA sequences of subjects #23 and #86 to that of HEL32 revealed 2 and 8 of 213 nucleotide differences, respectively. Subject #23 was also universal, but not N22 PCR-positive, whereas subject #86 was both universal and N22 PCR-positive. Both subjects had IgG antibodies for fp2b. The donor of our HEL32 clone, on the other hand, lacked antibodies for fp2a and fp2b, but was both universal and N22 PCR-positive and, based on the sequenced PCR products, carried at least two other TTV genotypes (data not shown).
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In CAV, the longest ORF encodes the capsid protein, whereas the other ORFs encode non-structural proteins (Todd et al., 1990 ; Noteborn et al., 1992
; Douglas et al., 1995
; Kato et al., 1995
). In light of the similarity of genome organization, TTV ORF1 could encode the capsid protein and ORFs 2a and 2b the non-structural proteins. We compared the ORF2 sequences of 18 genotypes (altogether 41 sequences obtained from GenBank, plus our HEL32 strain) and found ORF2a to be highly conserved in all TTV strains. In contrast, the ORF2b sequences varied extensively. This has been reported previously, albeit with fewer genotypes (Erker et al., 1999
; Tanaka et al., 2000
).
In HEL32, ORFs 1 and 2a are in the same reading frame and ORF2b is in a separate one, partly overlapping ORF2a. Similar genomic organizations were found in several genotypes. Starting at A106TG in frame 1, the ORF2a of HEL32 encodes a putative protein of 49 aa. ORF2b, in frame 2, contains three possible transcription initiation sites at nt 239, 272 and 356, and the longest transcript encodes a putative protein of 156 aa.
In recent TTV mRNA studies, due to late transcription start sites and splicing (removing the first two initiation sites), only the third ATG at nt 353 or 338 was suggested to be used for translation of the ORF2 gene (Kamahora et al., 2000 ; Okamoto et al., 2000b
). Consequently, if this would apply for HEL32, the ORF2a-encoded protein would not be produced at all and the ORF2b-encoded protein would be shortened considerably. However, by Kozaks criteria (Kozak, 1996
), this third A356TG of ORF2b in HEL32 is in a weak context for initiation and is therefore not likely to be a start site, whereas the context of the first A239TG is considered to be strong. Alternative transcription initiation (Ellis et al., 1987
; Suzuki et al., 2001
) and splicing may thereby occur in HEL32-like TTV genotypes, allowing the use of these first initiator codons. Interestingly, we found in every single TTV sequence, at nt
107, an ATG initiation site that adequately satisfied Kozaks criteria (Kozak, 1996
). The short 5' leader upstream of this ATG would not necessarily hinder translation, as shown for even shorter leaders (Ellis et al., 1987
; Maicas et al., 1990
). Furthermore, based on sequence comparison, the ORF2a region is highly conserved among all genotypes (also at the protein level). Obviously, this highly conserved area has some important function, either at the protein level or at the nucleotide level. Finally, by in vitro transcription and translation, the full-length 202 aa protein of genotype 1 ORF2 has been produced, beginning from A107TG (Tanaka et al., 2000
). However, in a genotype 3-related isolate with a divided ORF2, ORF2a, starting at A107TG was, for some reason, not translated. The translation of ORF2b began at the first A263TG initiation site. The more important in vivo effects of transcription and translation initiation sites and alternative splicing of ORFs 2a and 2b of HEL32 genotype 6 (and other similar genotypes) remain to be studied.
We have in E. coli productively expressed both of the HEL32 ORF2 putative protein-coding regions, ORFs 2a (nt 106255) and 2b (nt 239709). Interestingly, ORF1 resisted expression, possibly due to the cytotoxicity of the product. The suitability of the corresponding recombinant proteins fp2a and fp2b as antigens for the detection of specific IgM and IgG antibodies was investigated in constitutionally healthy adults.
Fp2a- and fp2b-specific IgM antibodies were found in an unexpectedly high (9%) prevalence. By using TTV particles of faecal origin, short-lived IgM responses have been previously detected in three liver patients but not in healthy controls (Tsuda et al., 2001
). Another study found no IgM reactivity against the C terminus of the ORF1 protein among patients with hepatitis of unknown aetiology or among blood donors or healthy children (Ott et al., 2000
). In most virus infections, the typical IgM responses are early and short-lived. However, we observed strong fp2b IgM responses that persisted for years. Most of our fp2 IgM-positive individuals were fp2 IgG-negative but carried circulating TTV DNA, a pattern that could possibly infer an acute stage preceding virus clearance. However, such a conclusion lends no support to our follow-up study, where persistent IgM and DNA coexisted. The reason for the absence of an immunoglobulin class shift (IgM
IgG) in our long-term follow-up subjects is at present unknown. One possible reason could be impaired helper T-cell activity, which in turn might be due to T-cell cross-tolerance against multiple TTV genotypes.
In the present study, fp2a- and fp2b-specific IgG antibodies were also detected but, relative to IgM, in a surprisingly low (10%) prevalence. Interestingly, all the IgG-positive subjects had TTV DNA in their sera. Two other immunoblot studies, using prokaryotically expressed proteins of TTV genotype 1 as antigen, have reported considerably higher TTV IgG prevalence values of 38% for the N-terminal ORF1 product (Handa et al., 2000 ) and 98·6% for the C-terminal part (Ott et al., 2000
). In both studies, the ORF1-specific antibodies and TTV DNA coexisted. In light of their high prevalence (Ott et al., 2000
), the ORF1-specific antibodies could be highly cross-reactive and non-protective.
Using two nested PCRs, we found the prevalence of TTV DNA to be 86%. This result is in line with a previous study that reported a TTV DNA prevalence of 73% in Finnish blood donors (Simmonds et al., 1999 ). Other studies worldwide have yielded comparable values of TTV DNA prevalence; e.g. for Italian blood donors, the prevalence of TTV DNA was 87·5% (Zehender et al., 2001
) and for healthy Japanese subjects, the prevalence of TTV DNA was 94% (Hijikata et al., 1999a
; reviewed Bendinelli et al., 2001
).
By genotype 6-specific PCR, 3 of 35 (8·6%) subjects had TTV of genotype 6. However, because HEL32 is the only available (long) sequence of TTV genotype 6, the extent of intra-genotype sequence variation in the amplified regions that could affect the PCR result is not known. Of the three subjects with genotype 6 DNA, two had coexistent fp2b IgG but none had IgM. The donor of our HEL32 clone carried at least two other TTV genotypes. Superinfections with several TTV genotypes are well documented, inferring lack of inter-genotype protection (Okamoto et al., 1999a ; Takayama et al., 1999
; Niel et al., 2000
; Romeo et al., 2000
).
Altogether, our results suggest that the ORF2 protein-specific antibodies are not cross-protective, because TTV DNA was found to coexist with the fp2 antibodies. The fp2b-specific antibodies could, theoretically, also be genotype-specific, because (1) the ORF2b sequence varies considerably among different TTV genotypes and (2) the fp2b antibodies were detected only in a minority of our subjects. On the other hand, the ORF2a sequences are very similar in all genotypes, also at the putative protein level. Consequently, antibodies for this protein are not likely to be genotype-specific. The very low prevalence of fp2a-specific antibodies could result from inefficient protein production (Kamahora et al., 2000 ; Okamoto et al., 2000b
; Ellis et al., 1987
), as discussed above. The low prevalence of fp2 antibody and the apparent lack of cross-protectiveness of these antibodies could also be easily understandable assuming that these proteins are non-structural and intracellular. Furthermore, it should be kept in mind that immunoblotting tends to favour antibodies against linear epitopes, the relative proportion of which may change during the course of virus infection (Söderlund et al., 1995
; Kaikkonen et al., 1999
). Furthermore, prokaryotic expression does not create the post-translational modifications that may be required for optimal antigenicity. Finally, an interesting possibility is that the ORF2 antibodies are produced at very low levels in healthy individuals but more abundantly in some diseases yetto be associated with this virus, as has been suggested (von Poblotzki et al., 1995
; Hemauer et al., 2000
) for the non-structural protein of parvovirus B19, another human single-stranded DNA virus.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bendinelli, M., Pistello, M., Maggi, F., Fornai, C., Freer, G. & Vatteroni, M. L. (2001). Molecular properties, biology, and clinical implications of TT virus, a recently identified widespread infectious agent of humans. Clinical Microbiology Reviews 14, 98-113.
Biagini, P., Gallian, P., Attoui, H., Cantaloube, J.-F., de Micco, P. & de Lamballerie, X. (1999). Determination and phylogenetic analysis of partial sequences from TT virus isolates. Journal of General Virology 80, 419-424.[Abstract]
Douglas, A. J., Phenix, K., Mawhinney, K. A., Todd, D., Mackie, D. P. & Curran, W. L. (1995). Identification of a 24 kDa protein expressed by chicken anaemia virus. Journal of General Virology 76, 1557-1562.[Abstract]
Ellis, S. R., Hopper, A. K. & Martin, N. C. (1987). Amino-terminal extension generated from an upstream AUG codon is not required for mitochondrial import of yeast N2,N2-dimethylguanosine-specific tRNA methyltransferase. Proceedings of the National Academy of Science, USA 84, 5172-5176.[Abstract]
Erker, J. C., Leary, T. P., Desai, S. M., Chalmers, M. L. & Mushahwar, I. K. (1999). Analyses of TT virus full-length genomic sequences. Journal of General Virology 80, 1743-1750.[Abstract]
Felsenstein, J. C. (1989). PHYLIP: Phylogeny Interference Package, version 3.2. Cladistics 5, 164-166.
Gallian, P., Berland, Y., Olmer, M., Raccah, D., de Micco, P., Biagini, P., Simon, S., Bouchouareb, D., Mourey, C., Roubicek, C., Touinssi, M., Cantaloube, J.-F., Dussol, B. & de Lamballerie, X. (1999). TT virus infection in French hemodialysis patients: study of prevalence and risk factors. Journal of Clinical Microbiology 37, 2538-2542.
Gallian, P., Biagini, P., Zhong, S., Touinssi, M., Yeo, W., Cantaloube, F. J., Attoui, H., de Micco, P., Johnson, P. J. & de Lamballerie, X. (2000). TT virus: a study of molecular epidemiology and transmission of genotypes 1, 2 and 3. Journal of Clinical Virology 17, 43-49.[Medline]
Handa, A., Dickstein, B., Young, N. S. & Brown, K. E. (2000). Prevalence of the newly described human circovirus, TTV, in United States blood donors. Transfusion 40, 245-251.[Medline]
Hasegawa, M., Kishino, H. & Yano, T. (1985). Dating of the humanape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22, 160-174.[Medline]
Hemauer, A., Gigler, A., Searle, K., Beckenlehner, K., Raab, U., Broliden, K., Wolf, H., Enders, G. & Modrow, S. (2000). Seroprevalence of parvovirus B19 NS1-specific IgG in B19-infected and uninfected individuals and in infected pregnant women. Journal of Medical Virology 60, 48-55.[Medline]
Hijikata, M., Iwata, K., Ohta, Y., Nakao, K., Matsumoto, M., Matsumoto, H., Kanai, K., Baba, K., Samokhvalov, E. I. & Mishiro, S. (1999a). Genotypes of TT virus (TTV) compared between liver disease patients and healthy individuals using a new PCR system capable of differentiating 1a and 1b types from others. Archives of Virology 144, 2345-2354.[Medline]
Hijikata, M., Takahashi, K. & Mishiro, S. (1999b). Complete circular DNA genome of a TT virus variant (isolate name SANBAN) and 44 partial ORF2 sequences implicating a great degree of diversity beyond genotypes. Virology 260, 17-22.[Medline]
Höhne, M., Berg, T., Müller, A. R. & Schreier, E. (1998). Detection of sequences of TT virus, a novel DNA virus, in German patients. Journal of General Virology 79, 2761-2764.[Abstract]
Itoh, Y., Takahashi, M., Fukuda, M., Shibayama, T., Ishikawa, T., Tsuda, F., Tanaka, T., Nishizawa, T. & Okamoto, H. (2000). Visualization of TT virus particles recovered from the sera and feces of infected humans. Biochemical and Biophysical Research Communications 279, 718-724.[Medline]
Kaikkonen, L., Lankinen, H., Harjunpää, I., Hokynar, K., Söderlund-Venermo, M., Oker-Blom, C., Hedman, L. & Hedman, K. (1999). Acute-phase-specific heptapeptide epitope for diagnosis of parvovirus B19 infection. Journal of Clinical Microbiology 37, 3952-3956.
Kamahora, T., Hino, S. & Miyata, H. (2000). Three spliced mRNAs of TT virus transcribed from a plasmid containing the entire genome in COS1 cells. Journal of Virology 74, 9980-9986.
Kato, A., Fujino, M., Nakamura, T., Ishihama, A. & Otaki, Y. (1995). Gene organization of chicken anemia virus. Virology 209, 480-488.[Medline]
Kozak, M. (1996). Interpreting cDNA sequences: some insights from studies on translation. Mammalian Genome 7, 563-574.[Medline]
Luo, K., Liang, W., He, H., Yang, S., Wang, Y., Xiao, H., Liu, D. & Zhang, L. (2000). Experimental infection of nonenveloped DNA virus (TTV) in rhesus monkey. Journal of Medical Virology 61, 159-164.[Medline]
Maicas, E., Shago, M. & Friesen, J. D. (1990). Translation of the Saccharomyces cerevisiae tcm1 gene in the absence of a 5'-untranslated leader. Nucleic Acids Research 18, 5823-5828.[Abstract]
Miyata, H., Tsunoda, H., Kazi, A., Yamada, A., Khan, M. A., Murakami, J., Kamahora, T., Shiraki, K. & Hino, S. (1999). Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded DNA genome of TT virus, the first human circovirus. Journal of Virology 73, 3582-3586.
Muljono, D. H., Nishizawa, T., Tsuda, F., Takahashi, M. & Okamoto, H. (2001). Molecular epidemiology of TT virus (TTV) and characterization of two novel TTV genotypes in Indonesia. Archives of Virology 146, 1249-1266.[Medline]
Mushahwar, I. K., Erker, J. C., Muerhoff, A. S., Leary, T. P., Simons, J. N., Birkenmeyer, L. G., Chalmers, M. L., Pilot-Matias, T. J. & Desai, S. M. (1999). Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proceedings of the National Academy of Sciences, USA 96, 3177-3182.
Niel, C., Saback, F. L. & Lampe, E. (2000). Coinfection with multiple TT virus strains belonging to different genotypes is a common event in healthy Brazilian adults. Journal of Clinical Microbiology 38, 1926-1930.
Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y. & Mayumi, M. (1997). A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochemical and Biophysical Research Communications 241, 92-97.[Medline]
Nishizawa, T., Okamoto, H., Tsuda, F., Aikawa, T., Sugai, Y., Konishi, K., Akahane, Y., Ukita, M., Tanaka, T., Miyakawa, Y. & Mayumi, M. (1999). Quasispecies of TT virus (TTV) with sequence divergence in hypervariable regions of the capsid protein in chronic TTV infection. Journal of Virology 73, 9604-9608.
Noteborn, M. H. M., Kranenburg, O., Zantema, A., Koch, G., de Boer, G. F. & van der Eb, A. J. (1992). Transcription of the chicken anemia virus (CAV) genome and synthesis of its 52-kDa protein. Gene 118, 267-271.[Medline]
Okamoto, H. & Mayumi, M. (2001). TT virus: virological and genomic characteristics and disease associations. Journal of Gastroenterology 36, 519-529.[Medline]
Okamoto, H., Nishizawa, T., Kato, N., Ukita, M., Ikeda, H., Iizuka, H., Miyakawa, Y. & Mayumi, M. (1998). Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown etiology. Hepatology Research 10, 1-16.
Okamoto, H., Takahashi, M., Nishizawa, T., Ukita, M., Fukuda, M., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1999a). Marked genomic heterogeneity and frequent mixed infection of TT virus demonstrated by PCR with primers from coding and noncoding regions. Virology 259, 428-436.[Medline]
Okamoto, H., Nishizawa, T., Ukita, M., Takahashi, M., Fukuda, M., Iizuka, H., Miyakawa, Y. & Mayumi, M. (1999b). The entire nucleotide sequence of a TT virus isolate from the United States (TUS01): comparison with reported isolates and phylogenetic analysis. Virology 259, 437-448.[Medline]
Okamoto, H., Nishizawa, T., Tawara, A., Peng, Y., Takahashi, M., Kishimoto, J., Tanaka, T., Miyakawa, Y. & Mayumi, M. (2000a). Species-specific TT viruses in humans and nonhuman primates and their phylogenetic relatedness. Virology 277, 368-378.[Medline]
Okamoto, H., Nishizawa, T., Tawara, A., Takahashi, M., Kishimoto, J., Sai, T. & Sugai, Y. (2000b). TT virus mRNAs detected in the bone marrow cells from an infected individual. Biochemical and Biophysical Research Communications 279, 700-707.[Medline]
Okamoto, H., Nishizawa, T., Takahashi, M., Asabe, S., Tsuda, F. & Yoshikawa, A. (2001). Heterogeneous distribution of TT virus of distinct genotypes in multiple tissues from infected humans. Virology 288, 358-368.[Medline]
Ott, C., Duret, L., Chemin, I., Trépo, C., Mandrand, B. & Komurian-Pradel, F. (2000). Use of a TT virus ORF1 recombinant protein to detect anti-TT virus antibodies in human sera. Journal of General Virology 81, 2949-2958.
Romeo, R., Hegerich, P., Emerson, S. U., Colombo, M., Purcell, R. H. & Bukh, J. (2000). High prevalence of TT virus (TTV) in naive chimpanzees and in hepatitis C virus-infected humans: frequent mixed infections and identification of new TTV genotypes in chimpanzees. Journal of General Virology 81, 1001-1007.
Saback, F. L., Gomes, S. A., de Paula, V. S., da Silva, R. R. S., Lewis-Ximenez, L. L. & Niel, C. (1999). Age-specific prevalence and transmission of TT virus. Journal of Medical Virology 59, 318-322.[Medline]
Simmonds, P., Prescott, L. E., Logue, C., Davidson, F., Thomas, A. E. & Ludlam, C. A. (1999). TT-virus: part of the normal human flora? Journal of Infectious Diseases 180, 1748-1750.[Medline]
Söderlund, M., Brown, K. E., Meurman, O. & Hedman, K. (1992). Prokaryotic expression of a VP1 polypeptide antigen for diagnosis by a human parvovirus B19 antibody enzyme immunoassay. Journal of Clinical Microbiology 30, 305-311.[Abstract]
Söderlund, M., Brown, C. S., Spaan, W. J. M., Hedman, L. & Hedman, K. (1995). Epitope type-specific IgG responses to capsid proteins VP1 and VP2 of human parvovirus B19. Journal of Infectious Diseases 172, 1431-1436.[Medline]
Strimmer, K. & von Haesler, A. (1997). Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Molecular Biology and Evolution 13, 964-969.
Suzuki, Y., Taira, H., Tsunoda, T., Mizushima-Sugano, J., Sese, J., Hata, H. and others (2001). Diverse transcriptional initiation revealed by fine, large-scale mapping of mRNA start sites. EMBO Reports 2, 388393.
Takahashi, K., Iwasa, Y., Hijikata, M. & Mishiro, S. (2000). Identification of a new human DNA virus (TTV-like mini virus, TLMV) intermediately related to TT virus and chicken anemia virus. Archives of Virology 145, 979-993.[Medline]
Takayama, S., Yamazaki, S., Matsuo, S. & Sugii, S. (1999). Multiple infection of TT virus (TTV) with different genotypes in Japanese hemophiliacs. Biochemical and Biophysical Research Communications 256, 208-211.[Medline]
Tanaka, Y., Orito, E., Ohno, T., Nakano, T., Hayashi, K., Kato, T., Mukaide, M., Iida, S. & Mizokami, M. (2000). Identification of a novel 23 kDa protein encoded by putative open reading frame 2 of TT virus (TTV) genotype 1 different from the other genotypes. Archives of Virology 145, 1385-1398.[Medline]
Tawara, A., Akahane, Y., Takahashi, M., Nishizawa, T., Ishikawa, T. & Okamoto, H. (2000). Transmission of human TT virus of genotype 1a to chimpanzees with fecal supernatant or serum from patients with acute TTV infection. Biochemical and Biophysical Research Communications 278, 470-476.[Medline]
Todd, D., Creelan, J. L., Mackie, D. P., Rixon, F. & McNulty, M. S. (1990). Purification and biochemical characterization of chicken anaemia agent. Journal of General Virology 71, 819-823.[Abstract]
Tsuda, F., Okamoto, H., Ukita, M., Tanaka, T., Akahane, Y., Konishi, K., Yoshizawa, H., Miyakawa, Y. & Mayumi, M. (1999). Determination of antibodies to TT virus (TTV) and application to blood donors and patients with post-transfusion non-A to G hepatitis in Japan. Journal of Virological Methods 77, 199-206.[Medline]
Tsuda, F., Takahashi, M., Nishizawa, T., Akahane, Y., Konishi, K., Yoshizawa, H. & Okamoto, H. (2001). IgM-class antibodies to TT virus (TTV) in patients with acute TTV infection. Hepatology Research 19, 1-11.[Medline]
von Poblotzki, A., Gigler, A., Lang, B., Wolf, H. & Modrow, S. (1995). Antibodies to parvovirus B19 NS-1 protein in infected individuals. Journal of General Virology 76, 519-527.[Abstract]
Worobey, M. (2000). Extensive homologous recombination among widely divergent TT viruses. Journal of Virology 74, 7666-7670.
Zehender, G., Manzin, A., De Maddalena, C., Colasante, C., Solforosi, L., Corsi, F., Bianchi-Bosisio, A., Girotto, M., Schirru, I., Russo, U., Galli, M. & Clementi, M. (2001). Molecular epidemiology of TT virus in Italy and phylogenesis of viral isolates from subjects at different risk for parenteral exposure. Journal of Medical Virology 63, 76-84.[Medline]
Received 16 May 2001;
accepted 7 January 2002.