US Department of Agriculture, Agricultural Research Service, Molecular Plant Pathology Laboratory, Beltsville, Maryland 20705, USA1
Author for correspondence: Rosemarie Hammond. Fax +1 301 504 5449. e-mail hammondr{at}ba.ars.usda.gov
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The establishment of a systemic virus or viroid infection in a susceptible host depends on the ability of the pathogen to replicate and spread throughout that host. This process involves both intra- and intercellular transport of viral and viroid nucleic acids. Studies of human and animal, as well as plant, viruses have shown that, for viruses which replicate in the nucleus, virus-encoded protein(s) play important roles in shuttling the viral genome to and from its site of replication (Bukrinskaya et al., 1996 ; Nakanishi et al., 1996
; Chou et al., 1998
; Whittaker & Helenius, 1998
). Many of the viral proteins involved have been shown to contain nuclear localization signals (Schmolke et al., 1995
; Ye et al., 1995
; Watanabe et al., 1996
; DAgrostino et al., 1997
; Chou et al., 1998
) and other regulatory motifs (Seydel & Jans 1996
; Xiao et al., 1996
; Bichko et al., 1997
; Kubota & Pomerantz, 1998
) that can interact with host factors involved in the nuclear transport pathway (Gorlich & Mattaj, 1996
; Greber et al., 1997
). In the case of the geminivirus Squash leaf curl virus, interaction of virus-encoded proteins BR1 and BL1 is required for movement of the viral genome from cell-to-cell, but only BR1 functions in nuclear import (and export) of the viral genome (Sanderfoot & Lazarowitz, 1995
; Sanderfoot et al., 1996
; Ward & Lazarowitz, 1999
). BR1 contains domain structures required for nuclear targeting and interaction with BL1, and a nuclear export sequence has been identified in BR1 (Sanderfoot et al., 1996
; Ward & Lazarowitz, 1999
). In another geminivirus, Maize streak virus, it has been shown that the viral coat protein facilitates the transfer of viral DNA into the nucleus (Liu et al., 1999
). In the nucleorhabdovirus Sonchus yellow net virus, which also replicates in the nucleus, the nucleocapsid protein and the phosphoprotein (M2) are primarily localized to the nucleus, although their role in nuclear transport of the viral RNA is unknown (Martins et al., 1998
). Much less is known about the possible role of RNA or DNA sequence motifs in nuclear transport.
Recently, Woo et al. (1999) examined the translocation of fluorescein-labelled Potato spindle tuber viroid (PSTVd) to the nuclei in permeabilized tobacco cells. The results of their study indicate that PSTVd import may be a cytoskeleton-independent process that is mediated by a specific and saturable receptor. Previous efforts to use plant virus-based episomal vectors to produce useful products or to study virus movement, gene regulation and hostpathogen interactions have focused on events occurring in the host cell cytoplasm (see Donson et al., 1991
; Sablowski et al., 1995
; Oparka et al., 1996
). Here, we describe an experimental system that utilizes a vector derived from the plant cytoplasmic virus Potato virus X (PVX) to study and ultimately identify the nuclear targeting signals of PSTVd in a whole plant system.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Construction of the intron-bearing reporter genes.
The coding region of GFP was artificially interrupted by inserting an intron derived from intervening sequence 2 (IV2) of the potato ST-LS1 gene. The second intron of the potato ST-LS1 gene (Eckes et al., 1986 ; GenBank accession no. X04401) was amplified by PCR and modified with a strategy similar to that described by Vancanneyt et al. (1990)
. The modifications made to the intron include: (i) addition of a BamHI recognition site to a position in the middle of the intron; (ii) alteration of the border sequences to introduce a SnaBI and a PvuII site at the 5' and 3' termini, respectively; and (iii) optimization of internal intron sequences with respect to the consensus sequence for plant introns (see Fig. 2
). At this point, the intron was digested with SnaBI and PvuII and inserted into an MscI site of mgfp4 within the GFP open reading frame. A full-length (359 nucleotide) copy of the intermediate strain of PSTVd was then embedded in the intron at the BamHI site, in the positive-sense orientation from nucleotide 88 to nucleotide 87 of PSTVd. This intron-bearing and PSTVd-embedded gfp reporter gene was cloned into the SalI site of the PVX-based vector pP2C2S.
|
For inoculation onto plant hosts, the transcripts were diluted to 0·5 µg/µl with 50 mM potassium phosphate (pH 7·0). Five µl of the diluted transcripts was gently rubbed onto each carborundum-dusted leaf of Nicotiana benthamiana plants using a sterile glass rod. The largest leaf of the three inoculated leaves was approximately 5 cm in length.
Microscopic analysis of the plants.
Five to 15 days after inoculation, the inoculated and systemically infected leaves of N. benthamiana were examined with a Zeiss epifluorescence microscope (Axioskop 2) for the presence of green fluorescence. Green fluorescence was detected using an FITC multiband filter set (#41001, Chroma) with a blue excitation filter (HQ480/40), a dichroic mirror (Q505LP) and a green barrier filter (HQ535/50). Photographs were taken with Kodak Ektachrome Elite II film 400 using the microscope-coupled SLR camera and automatic exposure meter.
Reverse transcriptasePCR.
Total cellular RNA was prepared from the inoculated and systemic N. benthamiana leaves 2 weeks after inoculation of the PVX constructs using TRI REAGENT (Molecular Research Center). Five µg of the total RNA was incubated at 65 °C for 4 min before being reverse transcribed at 42 °C for 90 min using 400 units of M-MLV reverse transcriptase (Life Technologies) in a 25 µl reaction mixture containing 10 mM TrisHCl pH 8·3, 50 mM KCl, 3 mM MgCl2, 1 mM dNTPs, 20 pmol of GFP reverse primer (5' GATTCTCGAGTCGACTTAAAGGTATAGTTC 3'), 20 units RNasin (Promega) and 1 mM DTT. Two µl of the resulting first strand cDNA was heated at 94 °C for 5 min and amplified by the GFP forward (5' GGATACCGGTCGACATAACAATGTCTAAAGG 3') and reverse primer pair in a 100 µl reaction mixture containing 1x Perkin Elmer PCR buffer I, 200 µM dNTPs, 2·5 units AmpliTaq DNA polymerase (Perkin Elmer, Roche Research Systems) and 50 pmol of each primer. The amplification conditions were 1 min at 94 °C for denaturation, 2 min at 42 °C for annealing and 2 min at 72 °C for synthesis. The PCR fragments were fractionated on a 1·0% agarose gel. RTPCR controls included nucleic acid obtained from a healthy N. benthamiana plant and from a plant infected with the PVX vector lacking the GFP constructs.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Expression of a functional protein from an intron-containing gene is strong circumstantial evidence of proper mRNA processing, which depends on the functions of the nuclear-dwelling splicing apparatus. To obtain further evidence that the RNA splicing event did indeed occur, the messenger RNA for the intron/PSTVd-bearing gfp reporter gene was amplified by RTPCR and mapped with the restriction enzyme MscI.
Fig. 3(A) shows the expression profiles of the intron/PSTVd-bearing gfp gene in leaves of N. benthamiana plants sampled 2 weeks post-inoculation. A band of 740 bp corresponding to the spliced GFP open reading frame was detected in all sample leaves in which the intron/PSTVd-bearing gfp gene was expressed (lanes 4, 6, 7, 8, 9), and in those leaves sampled from plants inoculated with the gfp gene lacking the intron (lanes 13). Lane 5 corresponds to a leaf that had not yet become infected. In addition to the correctly spliced product, some samples containing the intron/PSTVd-bearing gfp gene contained residual, unspliced RNA of 1300 bp (e.g. lanes 7 and 9). The accurate removal of the intron was confirmed by the restoration of the MscI site in the GFP open reading frame (Fig. 3B
, lane 2), as evidenced by restriction analysis of RTPCR products yielding bands of 548 and 192 bp. Again, residual, unspliced RNA is present in one of the samples (1300 bp, lane 2). The presence of unspliced RNA in several of the samples indicates that either import of the viroid-containing RNA to the nucleus and/or splicing of the intron-containing RNA and return to the cytoplasm are not 100% efficient.
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In nature, PSTVd is a circular molecule that assumes an unbranched rod-like structure through intramolecular base pairing. However, in our experimental system, this circular molecule was artificially linearized and attached to a recombinant PVX subgenomic RNA of more than 1·5 kb, yet the nuclear-targeting signal(s) remained functional in this chimeric molecule. In this regard, it is of particular interest to note that both the ability of PSTVd to move from cell-to-cell (Ding et al., 1997 ) and its ability to act as a promoter for a viral RNA replicase (Maroon, 1997
) are preserved when the PSTVd molecule is linearized and fused to non-viroid sequences. Likewise, our data indicate that the nuclear targeting capacity of the viroid is retained in the linear form, and, with the reporter system, the nucleotide sequence motifs required for nuclear-targeting should be identifiable.
The ability of linearized and tagged PSTVd to retain its nuclear-targeting functions does not necessarily mean that the nuclear-targeting motif(s) resides in the linear (or primary) sequence of the viroid. Theoretical calculations using the mfold program (Wisconsin package version 9.1, 1997; Zuker, 1989 ) indicate that the PSTVd sequences embedded within the intron are a distinct domain that retains a rod-like, i.e. native conformation (data not shown). For PSTVd and related viroids, the rod-like skeleton can be divided into five structural and functional domains (Keese & Symons, 1985
) and there is a strong correlation between various biological properties and individual domain structures (Hammond, 1992
; Hammond & Owens, 1987
; Owens et al., 1986
, 1995
, 1996
; Sano et al., 1992
). These individual domain structures will be examined in our future experiments to locate the precise nuclear-targeting motif(s).
The mechanisms of recognition of viroid nuclear localization signals by putative host factors remain to be elucidated. Being a circular, rod-like, nuclear-replicating RNA, human Hepatitis delta virus (HDV) shares many common features with viroids; its single open reading frame encodes two amino-coterminal proteins known as hepatitis delta antigen (HDAg). HDAg bears both nuclear localization signals and RNA-binding motifs and mediates the nuclear import and replication of the HDV RNA (Chou et al., 1998 ; Dingle et al., 1998
). Our results suggest that a cellular counterpart of the HDAg protein may exist in plants. If so, it will be interesting to determine how this protein interacts with viroid RNAs and modulates their biological activities.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bonfiglioli, R. G., McFadden, G. I. & Symons, R. H. (1994). In situ hybridization localizes avocado sunblotch viroid on chloroplast thylalkoid membranes and coconut cadang cadang viroid in the nucleus. Plant Journal 6, 99-103.
Bonfiglioli, R. G., Webb, D. R. & Symons, R. H. (1996). Tissue and intra-cellular distribution of coconut cadang cadang viroid and citrus exocortis viroid determined by in situ hybridization and confocal laser scanning and transmission electron microscopy. Plant Journal 9, 457-465.
Bukrinskaya, A. G., Ghorpade, A., Heinzinger, N. K., Smithgall, T. E., Lewis, R. E. & Stevenson, M. (1996). Phosphorylation-dependent human immunodeficiency virus 1 infection and nuclear targeting of viral DNA. Proceedings of the National Academy of Sciences, USA 93, 367-371.
Chou, H.-C., Hsien, T.-Y., Sheu, G.-T. & Lai, M. M. C. (1998). Hepatitis delta antigen mediates the nuclear import of hepatitis delta virus RNA. Journal of Virology 72, 3684-3690.
DAgrostino, D. M., Ciminale, V., Zotti, L., Rosato, A. & Chieco-Bianchi, L. (1997). The human T-cell lymphotropic virus type 1 Tof protein contains a bipartite nuclear localization signal that is able to functionally replace the amino-terminal domain of Rex. Journal of Virology 71, 75-83.[Abstract]
Diener, T. O. (1987). The Viroids. New York: Plenum Press.
Ding, B., Kwon, M.-O., Hammond, R. & Owens, R. (1997). Cell-to-cell movement of potato spindle tuber viroid. Plant Journal 12, 931-936.[Medline]
Dingle, K., Bichko, V., Zuccola, H., Hogle, J. & Taylor, J. (1998). Initiation of hepatitis delta virus genome replication. Journal of Virology 72, 4783-4788.
Donson, J., Kearney, C. M., Hilf, M. E. & Dawson, W. O. (1991). Systemic expression of a bacterial gene by a tobacco mosaic virus-based vector. Proceedings of the National Academy of Sciences, USA 88, 7204-7208.[Abstract]
Eckes, P., Rosahl, S., Schell, J. & Willmitzer, L. (1986). Isolation and characterization of a light-inducible, organ-specific gene from potato and analysis of its expression after tagging and transfer into tobacco and potato shoots. Molecular and General Genetics 205, 14-22.
Gorlich, D. & Mattaj, I. W. (1996). Nucleocytoplasmic transport. Science 271, 1513-1518.[Abstract]
Greber, U. F., Suomalainen, M., Stidwill, R. P., Boucke, K., Ebersold, M. W. & Helenius, A. (1997). The role of the nuclear pore complex in adenovirus DNA entry. EMBO Journal 16, 5998-6007.
Hammond, R. W. (1992). Analysis of the virulence modulating region of potato spindle tuber viroid (PSTVd) by site-directed mutagenesis. Virology 187, 654-662.[Medline]
Hammond, J. & Lawson, R. H. (1988). An improved purification procedure for preparing potyviruses and cytoplasmic inclusions from the same tissue. Journal of Virological Methods 20, 203-217.[Medline]
Hammond, R. W. & Owens, R. A. (1987). Mutational analysis of potato spindle tuber viroid reveals complex relationships between structure and infectivity. Proceedings of the National Academy of Sciences, USA 84, 3967-3971.[Abstract]
Harders, J., Lukacs, N., Robert-Nicoud, M., Jovin, J. M. & Riesner, D. (1989). Imaging of viroids in nuclei from tomato leaf tissue by in situ hybridization and confocal laser scanning microscopy. EMBO Journal 8, 3941-3949.[Abstract]
Haseloff, J., Siemering, K. R., Prasher, D. C. & Hodge, S. (1997). Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proceedings of the National Academy of Sciences, USA 94, 2122-2127.
Keese, P. & Symons, R. H. (1985). Domains in viroids: evidence of intermolecular RNA rearrangements and their contribution to viroid evolution. Proceedings of the National Academy of Sciences, USA 82, 4582-4586.[Abstract]
Kubota, S. & Pomerantz, R. J. (1998). A cis-acting peptide signal in human immunodeficiency virus type I Rev which inhibits nuclear entry of small proteins. Oncogene 16, 1851-1861.[Medline]
Liu, H., Boulton, M. I., Thomas, C. L., Prior, D. A. M., Oparka, K. J. & Davies, J. W. (1999). Maize streak virus coat protein is karyophyllic and facilitates nuclear transport of viral DNA. Molecular PlantMicrobe Interactions 12, 894-900.
Maroon, C. J. M. (1997). Molecular studies on the replication and epidemiology of the potato spindle tuber viroid. PhD dissertation, University of Maryland, USA.
Martins, C. R. F., Johnson, J. A., Lawrence, D. M., Choi, T.-J., Pisi, A.-M., Tobin, S. L., Lapidus, D., Wagner, J. D. O., Ruzin, S., McDonald, K. & Jackson, A. O. (1998). Sonchus yellow net rhabdovirus nuclear viroplasms contain polymerase-associated proteins. Journal of Virology 72, 5669-5679.
Nakanishi, A., Clever, J., Yamada, M., Li, P. P. & Kasamatsu, H. (1996). Association with capsid proteins promotes nuclear targeting of simian virus 40 DNA. Proceedings of the National Academy of Sciences, USA 93, 96-100.
Navarro, J.-A., Daròs, J.-A. & Flores, R. (1999). Complexes containing both polarity strands of avocado sunblotch viroid: identification in chloroplasts and characterization. Virology 253, 77-85.[Medline]
Oparka, K. J., Roberts, A. G., Roberts, I. M., Prior, D. A. M. & Cruz, S. S. (1996). Viral coat protein is targeted to, but does not gate, plasmodesmata during cell-to-cell movement of potato virus X. Plant Journal 10, 805-813.
Owens, R. A., Hammond, R. W., Gardner, R. C., Kiefer, M. C., Thompson, S. M. & Cress, D. E. (1986). Site-specific mutagenesis of potato spindle tuber viroid cDNA. Plant Molecular Biology 6, 179-192.
Owens, R. A., Chen, W., Hu, Y. & Hsu, Y.-H. (1995). Suppression of potato spindle tuber viroid replication and symptom expression by mutations which stabilize the pathogenicity domain. Virology 208, 554-564.[Medline]
Owens, R. A., Steger, G., Hu, Y., Fels, A., Hammond, R. W. & Riesner, D. (1996). RNA structural features responsible for potato spindle tuber viroid pathogenicity. Virology 222, 144-158.[Medline]
Sablowski, R. W. M., Baulcombe, D. C. & Bevan, M. (1995). Expression of a flower-specific Myb protein in leaf cells using a viral vector causes ectopic activation of a target promoter. Proceedings of the National Academy of Sciences, USA 92, 6901-6905.[Abstract]
Sanderfoot, A. A. & Lazarowitz, S. G. (1995). Cooperation in viral movement: the geminivirus BL1 movement protein interacts with BR1 and redirects it from the nucleus to the cell periphery. Plant Cell 7, 1185-1194.
Sanderfoot, A. A., Ingham, D. J. & Lazarowitz, S. G. (1996). A viral movement protein as a nuclear shuttle. The geminivirus BR1 movement protein contains domains essential for the interaction with BL1 and nuclear localization. Plant Physiology 110, 23-33.
Sano, T., Candresse, T., Hammond, R. W., Diener, T. O. & Owens, R. A. (1992). Identification of multiple structural domains regulating viroid pathogenicity. Proceedings of the National Academy of Sciences, USA 89, 10104-10108.[Abstract]
Schindler, I. M. & Mühlbach, H. P. (1992). Involvement of nuclear DNA-dependent RNA polymerases in potato spindle tuber viroid replication: a reevaluation. Plant Science 84, 221-229.
Schmolke, S., Drescher, P., Jahn, G. & Plachter, B. (1995). Nuclear targeting of the tegument protein pp65 (UL83) of human cytomegalovirus: an unusual bipartite nuclear localizaton signal functions with other portions of the protein to mediate its efficient nuclear transport. Journal of Virology 69, 1071-1078.[Abstract]
Seydel, U. & Jans, D. A. (1996). Evidence for an inhibitory feedback loop regulating simian virus 40 large T-antigen fusion protein nuclear transport. Biochemical Journal 315, 33-39.[Medline]
Vancanneyt, G., Schmidt, R., OConnor-Sanchez, A., Willmitzer, L. & Rocha-Sosa, M. (1990). Construction of an intron-containing marker gene: splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Molecular and General Genetics 220, 245-250.[Medline]
Ward, B. W. & Lazarowitz, S. G. (1999). Nuclear export in plants: use of geminivirus movement proteins for a cell-based export assay. Plant Cell 11, 1267-1276.
Watanabe, N., Kawano, M., Tsurudome, M., Kusagawa, S., Nishio, M., Komada, H., Shima, T. & Ito, Y. (1996). Identification of the sequences responsible for nuclear targeting of the V protein of human parainfluenza virus type 2. Journal of General Virology 77, 327-338.[Abstract]
Whittaker, G. R. & Helenius, A. (1998). Nuclear import and export of viruses and virus genomes. Virology 246, 1-23.[Medline]
Woo, Y.-M., Itaya, A., Owens, R. A., Tang, L., Hammond, R. W., Chou, H.-C., Lai, M. M. C. & Ding, B. (1999). Characterization of nuclear import of potato spindle tuber viroid RNA in permeabilized protoplasts. Plant Journal 17, 627-635.
Xiao, C. Y., Hubner, S., Elliot, R. M., Caon, A. & Jans, D. A. (1996). A consensus cAMP-dependent protein kinase (PK-A) site in place of the CcN motif casein kinase II site simian virus 40 large T-antigen confers PK-A mediated regulation of nuclear import. Journal of Biological Chemistry 271, 6451-6457.
Ye, Z., Robinson, D. & Wagner, R. R. (1995). Nucleus-targeting domain of the matrix protein (M1) of influenza virus. Journal of Virology 69, 1964-1970.[Abstract]
Zuker, M. (1989). On finding all suboptimal foldings of an RNA molecule. Science 244, 48-52.[Medline]
Received 2 January 2001;
accepted 16 February 2001.