CRC Beatson Laboratories, Beatson Institute for Cancer Research, Switchback Road, Garscube Estate, Bearsden, Glasgow G61 1BD, UK1
Author for correspondence: Malcolm Finbow. Present address: Department of Biological and Biomedical Sciences, Glasgow Caledonian University, Cowcaddens, Glasgow G4 0BA, UK. Fax +44 141 331 3208. e-mail M.Finbow{at}gcal.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Many of the E5 proteins have been found to bind growth factor receptors (Goldstein et al., 1994 ; Hwang et al., 1995
; Petti & DiMaio, 1994
). Bovine papillomavirus (BPV) type 1 E5 binds the platelet-derived growth factor receptor, whilst human papillomavirus (HPV) type 16 E5 binds epidermal growth factor receptor and both E5 proteins activate their respective receptors (Petti et al., 1991
; Pim et al., 1992
; Leechanachai et al., 1992
). Likewise, p12' binds the interleukin-2 receptor (Mulloy et al., 1996
). Expression of E5 proteins in cultured cells often leads to decreased receptor cycling (Martin et al., 1989
). So, although there is little sequence similarity across the E5 proteins, it would seem that they have a common mode of action.
Supporting this conclusion is the finding that all E5 proteins so far examined (BPV-1 E5, BPV-4 E5, HPV-6 E5, HPV-16 E5 and HTLV-I p12') bind to the 16 kDa subunit c proteolipid of the vacuolar H+-ATPase (V-ATPase) (Goldstein et al., 1991 ; Conrad et al., 1993
; Franchini et al., 1993
; Faccini et al., 1996
). This multi-subunit enzyme is an essential proton pump of eukaryotes and is responsible for the low pH of many endomembrane compartments including Golgi, secretory vesicles, endosomes and lysosomes (Finbow & Harrison, 1997
). The possible disturbance of V-ATPase activity has been suggested to account for the effects on growth factor receptor cycling (Finbow et al., 1991
).
Subunit c is also the ductin component of a type of gap junction, an intercellular complex that provides sites of cell-to-cell movement for low-molecular-mass solutes (Finbow et al., 1995 ). Connexins also form gap junction channels, and mutant forms of ductin that have transforming ability disturb connexin localization and down-regulate gap junction communication (Saito et al., 1998
). Several E5 proteins have also been shown to down-regulate gap junction communication (Oelze et al., 1995
; Faccini et al., 1996
; Ashrafi et al., 2000
). However, a recent mutational study on one E5 protein, BPV-4 E5 (previously designated E8), dissociates this down-regulation from anchorage-independence (Ashrafi et al., 2000
).
This suggests that the common target of E5 proteins is the V-ATPase form of subunit c. Consistent with this are the observations that HPV-16 E5 retards the acidification of early endosomes (Straight et al., 1995 ) and that BPV-1 E5 elevates the pH of the Golgi (Schapiro et al., 2000
). Two recent studies (Adam et al., 2000
; Briggs et al., 2001
) also suggest a substantial impairment of the V-ATPase in Saccharomyces cerevisiae on expression of HPV-16 E5. Expression of BPV-4 E5 also results in large clusters of perinuclear vesicles, often incompletely separated, indicating endomembrane dysfunction (Ashrafi et al., 2000
). In this context, a recent study (Peters et al., 2001
) has shown that the V0 domain may act in the later stages of membrane fusion and that subunit c may be part of the transient fusion-pore complex.
We have therefore investigated the effect of high levels of expression of E5 proteins on the V-ATPase. We chose S. cerevisiae for this study, as the yeast form of V-ATPase is similar in composition to higher eukaryotic forms and is not essential for viability under normal growth conditions, whereas loss of V-ATPase in higher eukaryotes is lethal. In contrast to the studies of Adam et al. (2000) and Briggs et al. (2001)
, we find that, although all E5 transforming proteins examined bind to Vma3p (the S. cerevisiae form of subunit c), they do not impair V-ATPase activity in any measurable way, unlike a dominant-negative form of subunit c, which inactivates the enzyme. At least one of them, HPV-16 E5, becomes dissociated from the active V-ATPase. In a compromised hybrid form of the V-ATPase containing Norway lobster subunit c, which is also known to bind all E5 proteins so far examined, there is no apparent disturbance of the V-ATPase. These results indicate that disturbance of vacuolar compartments by E5 transforming proteins is a secondary effect. A reason for the binding of E5 transforming proteins in terms of the mechanism of action of the V-ATPase is discussed.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plasmids.
Plasmid pPMA (Jones et al., 1995 ) was used for expression of the E5 proteins and Vma3p E137G. The inserted gene is under the control of the plasma membrane H+-ATPase promoter. pPMA is a 2 µ-based plasmid and contains the selectable marker URA3. A modified form of the pYES2 plasmid (Invitrogen) was used for the expression of the Norway lobster subunit c tagged at the C terminus with hexahistidine (Harrison et al., 1994
). The URA3 gene had been replaced by the TRP1 gene (Hughes et al., 1996
). Expression of the inserted gene in the pYES2 vector is under control of the GAL4 promoter.
Antibodies.
Monoclonal antibodies (MAbs) to the V-ATPase components subunit A (Vma1p) and Vph1p and to the epitopes HA1 and AU1 were purchased from Cambridge Bioscience. The rabbit polyclonal antibody to Norway lobster subunit c has been described previously (Leitch & Finbow, 1990 ).
Oligonucleotides.
The construction of BPV-4 E5 and variant forms has been described elsewhere (OBrien et al., 1999 ; Ashrafi et al., 2000
). Coding sequences of BPV-1 E5 (a gift from R. Schlegel, Dept of Pathology, Georgetown University, Washington, DC, USA), HTLV-I p12' (a gift from G. Franchini, NIH, Bethesda, MD, USA) and HPV-16 E5 (a gift from A. Alonso, Deutsche Krebforschungszentrum, Heidelberg, Germany) were amplified by PCR (PfuTurbo; Stratagene) with oligonucleotides incorporating BamHI and KpnI restriction sites and an epitope tag to the HA1 antigen. These allowed ligation of the PCR product directly into the BamHI site of the pPMA vector and determination of orientation by KpnI restriction digestion. The BPV-1 E5 5' oligonucleotide was shorter because the template already contained the HA1 tag.
The primers used were: for HA1BPV-1 E5; 5' GCGGGATCCATGCCAAATCTATACCCATACG 3' and 3' GCGGGATCCGGTACCTTAAAAGGGCAGACCTGTACAG 5'; for HA1HTLV-I p12', 5' GGGATCCGCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTCTGTTTCGCCTTCTCAGCCC 3'and 3' GGGATCCCGGTACCCTAGAAGAGGAAAGCCGCGG 5'; for HA1HPV-16 E5, 5' GGCGGATCCTGCCGCCACCATGTACCCATACGATGTTCCAGATTACGCTACAAATCTTGATACTGCA 3' and 3' GGCGGATCCGGTACCTATTTATGTAATTAAAAAGCGTGC 5'. All cloned PCR products were sequenced and found to be the same as published sequences.
The dominant-negative ductin (Vma3p) construct was made in two stages. The first stage added the HA1 epitope tag and PstI and XhoI restriction sites to allow directional cloning into pCRscript (Stratagene). The second stage mutated glutamate-137 to glycine and the final product was blunt-end ligated into pPMA and sequenced to check the mutation and the integrity of the insert. The successive pairs of oligonucleotides were as follows, with the mutated nucleotide underlined: HA1Vma3p, 5' GGGCTGCAGATGACTGAATTGTGTCCTGTC 3' and 3' GGGCTCGAGTTAAGCGTAGTCTGGAACATCGTATGGGTAACAGACAACATCTTGAGTAGCC 5'; Vma3p E137G, 5' GATTTTGATTTTGATTTTTGCTGGAGTTTTGGGTCTATACGGTTT 3' and 3' AAACCGTATAGACCCAAAACTCCAGCAAAAATCAAAATCAAAATC 5'.
DNA templates for in vitro translation were synthesized by PCR using oligonucleotides that included the T7 RNA polymerase promoter, to allow T7-mediated transcription, and a Kozak sequence to ensure efficient translation of the RNA product. The HA1T7KOZAK oligonucleotide primed onto the HA tag sequence, so it was also used for all of the E5 proteins except BPV-1 E5. All products were generated from pPMA constructs, allowing the universal 3' oligonucleotide PMArev to be used, which was also used for sequencing the constructs.
Primer sequences were: Vma3p E137GT7KOZAK, 5' AAATAATACGACTCACTATAGGGAGAGCCACCATGACTGAATTGTGTCCTGTC 3'; HA1BPV-1 E5T7KOZAK, 5' AAATAATACGACTCACTATAGGGAGAGCCACCATGCCAAATCTATACCCATACG 3'; HA1T7KOZAK, 5' AAATAATACGACTCACTATAGGGAGAGCCACCATGTACCCATACGATGTTCCAG 3'; PMArev, 3' GGGAAGTAAGAGTTGAAGCC 5'.
Vacuole isolation.
Vacuoles were isolated by a method based on that of Uchida et al. (1985) . Yeast cultures (200 ml) were grown in minimal medium overnight at 30 °C to an OD600 of 0·51. Sugar (glucose or galactose/raffinose) was added to restore the concentration to 2% (w/v), 2 h before the cells were harvested by centrifugation at 5000 g for 5 min at room temperature. The cells were then washed in 20 ml phosphate buffer (50 mM Na2HPO4/NaH2PO4, pH 7·5) and spheroplasts were prepared by re-suspending in 20 ml digest buffer [1 M sorbitol, phosphate buffer, pH 7·5, 2% (w/v) glucose or galactose/raffinose, 0·4% (v/v)
-mercaptoethanol, 0·5 mg/ml yeast lytic enzyme (ICN Biochemicals; 70000 units/g)] and incubating at room temperature for 1 h. The spheroplasts were harvested at 2000 g for 5 min at room temperature under a cushion of 1·2 M sorbitol in the same buffer. All subsequent steps were carried out at 4 °C. The spheroplasts were re-suspended in 6 ml floatation buffer [8% (w/v) Ficoll 400, 10 mM MESTris pH 6·9, 0·5 mM MgCl2], containing the protease inhibitors 4-(2-aminoethyl)-benzenesulphonylfluoride (AEBSF; 0·1 mM) and benzamidine (1 mM) (both from Sigma-Aldrich). Spheroplasts were then lysed by four strokes in a loose-fitting homogenizer and the suspension was poured into a Beckman SW40 thin-walled polyallomer tube, overlaid with floatation buffer and centrifuged at 51900 g for 30 min. The layer of vacuoles was harvested with a spatula from the top of the tube and resuspended in 1·5 ml buffer C (10 mM MESTris pH 6·9, 5 mM MgCl2, 25 mM KCl, 0·1 mM AEBSF, 1 mM benzamidine). The vacuoles were harvested by centrifugation at 20000 g for 5 min, re-suspended to approximately 2 mg/ml in buffer C and either used immediately or stored at -70 °C in buffer C containing 10% (w/v) glycerol.
Measurement of protein content.
Protein content was measured by using the bicinchoninic acid (BCA) method. BCA reagent (Sigma-EL38 Aldrich) was prepared fresh according the manufacturers instructions. Samples were solubilized in 0·1% (w/v) SDS and the reaction mixture was incubated at 65 °C for 30 min. Absorbance at 562 nm was measured and the protein concentration was calculated from a standard curve of BSA.
Purification of the V-ATPase by glycerol gradient centrifugation.
This was adapted from the method of Uchida et al. (1985) for a benchtop ultracentrifuge. Vacuoles (1 mg protein) were washed twice in TE (10 mM TrisHCl, pH 7·5, 1 mM EDTA) by centrifugation at 400000 gmax for 10 min at 4 °C. The final pellet was re-suspended in the residual buffer, to which was added 50 µl 10% (w/v) N-dodecyl maltoside solution and 5 µl yeast protease inhibitor cocktail (Sigma-Aldrich). The solution was mixed by slow pipetting and then incubated at 4 °C for 15 min to solubilize the membrane proteins. Insoluble material was removed by centrifugation at 400000 g for 10 min at 4 °C and the supernatant was loaded onto 2 ml of a 10-step density gradient [2050 % (w/v) glycerol, 10 mM HEPESNaOH, pH 7·5, 50 mM NaCl, 0·01 % (v/v) yeast protease inhibitor cocktail]. Centrifugation was carried out in a TLS-55 swing-out rotor at 200000 g for 5 h at 4 °C using minimum acceleration and deceleration. Fractions (200 µl) were collected into a 96-well plate by upward displacement using fluorinert (3M).
Measurement of V-ATPase activity.
Reactions contained 200 µl buffer C [plus 0·02% (w/v) sodium azide] and 5 µl vacuoles (10 µg protein). Ethanol (5 µl) (with or without 5 mg/ml N'N-dicyclohexylcarbodiimide; DCCD) was added to the reactions, which were mixed briefly by vortexing and then incubated at room temperature for 5 min. ATP (30 µl; 50 mM in buffer C) was added to all reactions, which were then mixed by vortexing and incubated at 30 °C for 30 min. The reaction was terminated by addition of 750 µl phosphate detection reagent [2% (v/v) sulphuric acid, 1% (w/v) SDS, 0·5% (w/v) ammonium molybdate, 0·1% (w/v) ascorbic acid]. The absorbance at 830 nm was measured after 10 min and phosphate concentrations were determined from a standard curve of sodium phosphate.
For the microplate assay of the purified V-ATPase, 50 µl buffer C containing 5 mM ATP and 0·02% (w/v) sodium azide was added to 530 µl aliquots from the gradient fractions. The reactions were mixed, incubated at 30 °C for 30 min and developed using 100 µl double-strength phosphate detection reagent and the absorbance was measured at 630 nm against a standard curve of sodium phosphate. Kinetic analysis was performed in the same way, using 12 µg vacuoles per well, as described in Harrison et al. (1994) . For determination of N-ethylmaleimide- (NEM; Sigma-Aldrich) sensitive ATPase activity, NEM was added to 100 µM for 5 min before the addition of ATP.
In vitro synthesis and immunoprecipitation.
In vitro synthesis in the presence of microsomal membranes and immunoprecipitation were carried out as described previously (Dunlop et al., 1995 ; Faccini et al., 1996
; Ashrafi et al., 2000
; Rodriguez et al., 2000
).
Protein preparation, SDSPAGE and autoradiography.
Four vols acetoneethanol (1:1) was added to vacuoles and the mixture was vortexed before being cooled at -20 °C for 30 min. The protein was collected by centrifugation at 20000 g for 30 min and the supernatant was removed before re-suspending the protein in SDS loading buffer [50 mM TrisHCl, pH 6·8, 5% (w/v) glycerol, 2·5% (w/v) SDS, 0·1% (w/v) bromophenol blue]. 15% TrisTricine polyacrylamide gels were used to optimize the resolution of the E5 proteins. The gel was fixed in 50% methanol10% acetic acid (v/v) for 1 h, dried onto Whatman paper and exposed to X-ray film (Fuji super RX) for approximately 1 week.
Immunoblotting and dot blotting.
Proteins were transferred from SDSPAGE gels to Hybond nitrocellulose membrane (Amersham Pharmacia) using a semi-dry blotting apparatus. The transfer buffer contained 100 mM Tris base, 100 mM glycine, 0·1 % SDS and 20% (v/v) methanol. Methanol was not included for immunoblotting of E5 proteins or Vma3p E137G. The membranes were blocked with commercial skimmed milk powder in 10 mM TrisHCl (pH 7·5), 50 mM NaCl and 0·01% (w/v) Tween for 30 min and incubated overnight with the appropriate antibody (1:500 dilution) after rinsing four times in the above buffer. Bound antibody was detected using the ECL detection system (Amersham Pharmacia). For dot blotting, 10 µg aliquots of vacuolar protein samples were precipitated in acetoneethanol as described above, solubilized in SDS loading buffer and spotted directly onto nitrocellulose membrane. The samples were allowed to dry completely before blocking and processing as for immunoblots.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Included in this study were the following E5 proteins: BPV-1 E5A, HPV-16 E5, HTLV-I p12', BPV-4 E5 and three mutant forms, N17A, N17S and Cterm, in the last of which, the 12 C-terminal residues have been removed. BPV-4 E5 N17A has hypertransforming activity, while BPV-4 E5
Cterm has lost transformation ability (OBrien et al., 1999
). All the E5 proteins were tagged at their N termini with the HA1 epitope. Vma3p was tagged with the AU1 epitope at its C terminus. RNAs were translated in the presence of microsomes derived from pancreatic endoplasmic reticulum and pelleted microsomes were used for immunoprecipitation after solubilization.
Immunoprecipitation with MAbs to AU1 brought down Vma3p, as expected, but not any of the E5 proteins (Fig. 1a, b
), when the RNAs were translated separately. However, when the RNAs for the E5 proteins were translated together with the RNA for Vma3p, E5 proteins were also precipitated. Varying amounts of the E5 proteins were seen, and we therefore repeated these experiments but precipitating with MAbs to the HA1 epitope (Fig. 1c
). As expected, this antibody did not precipitate Vma3p in separate translations but, when co-translated with E5 proteins, Vma3p was present in the immunoprecipitate.
|
Expression of E5 transforming proteins in S. cerevisiae
We used the vector pPMA, in which expression of the inserted gene is constitutive, for expression of the E5 transforming proteins. This vector was chosen because a previous study (Jones et al., 1995 ) had shown that expression was much higher than that from galactose-inducible promoters (e.g. GAL4), to the extent that even deleterious mutant forms of subunit c could be detected on immunoblots of vacuolar membranes. As a positive control to show that we could inactivate the V-ATPase by expression from this vector, we prepared a mutant form of Vma3p in which residue E137 had been changed to glycine (Vma3p E137G). This residue is crucial for proton pumping and we have shown previously that such a mutant can act as a dominant negative (Hughes et al., 1996
). As with the viral proteins, Vma3p E137G was tagged with the HA1 epitope, but at its C terminus. The YPH500 haploid strain of S. cerevisiae was used, a strain that has been used by others to examine the V-ATPase (Umemoto et al., 1991
).
YPH500 cells were transfected with the various pPMA vector constructs and RTPCR analysis confirmed the expression of the inserted genes (data not shown). Vacuoles were isolated from transfected cells and examined for the presence of the appropriate protein by probing immunoblots or dot blots with MAbs to the HA1 epitope.
Immunoblots from vacuoles showed the presence of HPV-16 E5 and Vma3p E137G migrating at their expected sizes (Fig. 2a). There were also aggregated forms of HPV-16 E5, which were not broken down to monomeric species by reducing agents. However, the other E5 proteins could not be detected, even though a number of different membranes and blotting conditions were tried. Presumably, the smaller size of the proteins, notably those derived from BPVs, and their high hydrophobicity makes their detection difficult. We therefore used dot blots, drying the solubilized vacuolar membranes directly on to the support membrane. By this approach, all E5 proteins were found to be present (Fig. 2b
). Measurement of the exponential growth rates of these strains in liquid minimal medium plus appropriate supplements showed no effect. Cells expressing any of the E5 proteins had doubling times similar to that of control cells (2·6 h). However, cells expressing Vma3p E137G had an increased doubling time of 5·6 h, close to the doubling time (6·4 h) of the vat c strain, in which the VMA3 gene has been disrupted.
|
Transformed cells were grown on complete medium plates with glucose as the major nutrient source at pH 5·5 or 7·5 or with 100 mM calcium. As controls, YPH500 and VMA3-knockout cells were transfected with an empty pPMA vector. The VMA3-knockout strain was vat c, derived from W303-1B, used in previous studies (Harrison et al., 1994 , 1999
, 2000
; Jones et al., 1995
).
Cells of strains vat c and YPH500 expressing Vma3p E137G failed to grow at pH 7·5, whilst all others transfectants grew (Fig. 3). There was weak growth of the Vma3p E137G mutant in 100 mM calcium, however. In addition, vat c cells and Vma3p E137G cells formed white colonies, consistent with the loss of V-ATPase activity. Both parental strains are ade2- and therefore give rise to red colonies in the presence of an active V-ATPase (Umemoto et al., 1991
). These results showed that none of the E5 proteins, whether transforming or not, appeared to inactivate the V-ATPase and that this was unlikely to be due to poor expression from the pPMA vector. The same results were also obtained if the transfectants were grown on selective minimal medium (lacking uracil) to maintain the pPMA vector (data not shown).
|
Effects on V-ATPase activity and ATP hydrolysis
Growth under restricted conditions occurs at low levels of V-ATPase activity or when the enzyme has been partially disabled. For example, replacing Vma3p with the Norway lobster subunit c tagged with a hexahistidine tail at its C terminus still rescues growth at pH 7·5, but elevates the Km for ATP hydrolysis tenfold relative to the native enzyme (Harrison et al., 1994 ). We therefore measured the V-ATPase activity in isolated vacuoles and the Km for ATP hydrolysis.
Vacuoles were isolated from exponentially growing cultures and the ATPase activity was measured in the presence of azide to remove any contamination by mitochondria. V-ATPase activity is inhibited by the fungal macrolide bafilomycin and by NEM and DCCD, in all cases giving a 70% loss of total ATPase activity. Vacuoles isolated from vat c cells have residual ATPase activity. As DCCD is known to react uniquely with the critical glutamic acid on the fourth -helix of subunit c (E137 of Vma3p; Finbow et al., 1992
) and this residue has been identified as the site of binding of BPV-1 E5 (Andresson et al., 1995
), we measured the DCCD-inhibitable ATPase activity.
The results show that none of the E5 proteins affected the level of V-ATPase activity (Fig. 4). In contrast, V-ATPase activity in the Vma3p E137G mutant was reduced by over 90% and is similar to a level of ATPase activity found in vacuoles isolated from the vat c strain. We also measured the V-ATPase activity in vacuoles isolated from cells expressing the untagged, wild-type form of HPV-16 E5 (data not shown) but, again, there was no impairment of the V-ATPase, indicating that the N-terminal tag does not interfere.
|
|
The peak NEM-inhibitable ATPase activity coincided with the presence of V-ATPase subunits (Fig. 6). However, HPV-16 E5 was found in lighter fractions and did not overlap with the V-ATPase.
|
As expected, the cultures took longer to grow and, again, whilst Vma3p E137G blocked the rescue of growth at pH 7·5 by N subunit chis6, none of the E5 proteins did (Fig. 7). Examination of glycerol gradients showed assembled V-ATPase present in fractions similar to those for the wild-type enzyme, but HPV-16 E5, whilst now having a broader distribution, overlapped little (Fig. 8 a
). We also probed for the N subunit chis6 using a polyclonal rabbit antibody and its distribution overlapped with HPV-16 E5 and Vma1p, indicating that there may still be binding between these two polypeptides. We therefore examined possible binding between HPV-16 E5 and N subunit chis6 using nickel-affinity columns to bind the hexahistidine tails. Eluates of highly stringent washes from these columns indicated the presence in the vacuole of complexes of HPV-16 E5 and N subunit chis6 (Fig. 8 b
).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Given the specificity of binding, it would be expected that the E5 transforming proteins would affect the functions of subunit c complexes such as the V-ATPase. Several studies indicate that this might be the case. For example, HPV-16 E5 appears to delay the acidification of the early endosome (Straight et al., 1995 ), whilst BPV-1 E5 and BPV-4 E5 both appear to elevate Golgi pH (Schapiro et al., 2000
; M. S. Campo and R. Schlegel, unpublished results). Also, HPV-16 E5 and various mutant forms decrease the exponential growth rate of S. cerevisiae at pH 7·5 when present at high levels (Adam et al., 2000
), indicating impairment of the V-ATPase.
Our study shows that none of the E5 proteins, whether capable of transformation or not, perturbs V-ATPase activity in any detectable way, even when a compromised subunit c is used under poor growth conditions. In addition, at least one of these proteins, HPV-16 E5, is not part of the active V-ATPase, although it can remain bound to subunit c complexes within the vacuolar membrane. It is not clear why we found no disturbance of the V-ATPase in S. cerevisiae whilst Adam et al. (2000) and Briggs et al. (2001)
found that HPV-16 E5 and many mutant forms impaired growth at pH 7·5 and appeared to destabilize the V-ATPase. However, not all mutants of HPV-16 E5 that bind subunit c impaired growth at the restrictive pH, indicating that other factors may have come into play in these two studies.
If E5 proteins bind specifically to subunit c, why do they not remain attached to the active V-ATPase? There are two possibilities. Firstly, Vma12p and Vma22p of S. cerevisiae are not dissimilar to the E5 transforming proteins, being short, highly hydrophobic polypeptides (Graham et al., 1998 ). They are essential assembly factors of V0, but are not present in the holoenzyme and are presumably lost during maturation or targeting of the enzyme. A similar situation might also occur for E5 proteins. Secondly, the proposed rotation (Harrison et al., 1997
) of the subunit c core driven by ATP hydrolysis past the Vph1p stator may physically dislodge E5 proteins. Recent structural data (Páli et al., 1999
; Harrison et al., 1999
, 2000
) on the arrangement of subunit c shows helix 4 to be outermost, facing the bilayer, and this helix forms part of the binding region with BPV-1 E5 and HPV-16 E5 (Goldstein et al., 1992a
; Adam et al., 2000
), notably the key glutamic acid residue. Thus, E5 transforming proteins are likely to be attached peripherally to V0, rather than being integrated within the complex. In addition, recent work on the related F0 subunit c (Rastogi & Girvin, 1999
) predicts that much of the BPV-1 E5 binding domain on the V0 subunit c may undergo a substantial conformational change during proton translocation and be transiently re-located within the interior of V0.
A number of recent mutational studies (Adam et al., 2000 ; Ashrafi et al., 2000
; Rodriguez et al., 2000
) show that the ability of E5 proteins to bind subunit c does not correlate with their transforming activity. The biological significance of this interaction is therefore unclear. One possibility is a chaperone function. Tagging BPV-1 E5 with an endoplasmic reticulum retention signal results in the inability to transform, indicating that the site of action of this transforming polypeptide lies outside the endoplasmic reticulum (Sparkowski et al., 1995
). Binding to subunit c may therefore provide an export mechanism for E5 transforming proteins to the Golgi and post-Golgi compartments. Once in the Golgi, when the V-ATPase is first activated, E5 proteins may become dissociated to bind to other targets, e.g. growth factor receptors.
Another explanation for binding of E5 proteins to subunit c relates to the recent finding that apposing V0 sectors form inter-membrane complexes during late stages of vesicle fusion (Peters et al., 2001 ), possibly being the fusion pore observed a number of years ago in exocytosis (Breckenridge & Almers, 1987
; Finbow et al., 1991
). Such a possibility might account for the profusion of vesicles in fibroblasts expressing E5 proteins. Coincidentally, these vesicles are coupled to one another, as shown by the transfer of the gap junction-permeant tracer dye Lucifer yellow, indicating stalled fusion events.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Andresson, T., Sparkowski, J., Goldstein, D. J. & Schlegel, R. (1995). Vacuolar H+-ATPase mutants transform cells and define a binding site for the papillomavirus E5 oncoprotein. Journal of Biological Chemistry 270, 6830-6837.
Ashrafi, G. H., Pitts, J. D., Faccini, A., McLean, P., OBrien, V., Finbow, M. E. & Campo, M. S. (2000). Binding of bovine papillomavirus type 4 E8 to ductin (16K proteolipid), down-regulation of gap junction intercellular communication and full cell transformation are independent events. Journal of General Virology 81, 689-694.
Bergman, P., Ustav, M., Sedman, J., Moreno-Lopez, J., Vennstrom, B. & Pettersson, U. (1988). The E5 gene of bovine papillomavirus type 1 is sufficient for complete oncogenic transformation of mouse fibroblasts. Oncogene 2, 453-459.[Medline]
Breckenridge, L. J. & Almers, W. (1987). Currents through the fusion pore that forms during exocytosis of a secretory vesicle. Nature 328, 814-817.[Medline]
Briggs, M. W., Adam, J. L. & McCance, D. J. (2001). The human papillomavirus type 16 E5 protein alters vacuolar H+-ATPase function and stability in Saccharomyces cerevisiae. Virology 280, 169-175.[Medline]
Conrad, M., Bubb, V. J. & Schlegel, R. (1993). The human papillomavirus type 6 and 16 E5 proteins are membrane-associated proteins which associate with the 16-kilodalton pore-forming protein. Journal of Virology 67, 6170-6178.[Abstract]
DiMaio, D., Guralski, D. & Schiller, J. T. (1986). Translation of open reading frame E5 of bovine papillomavirus is required for its transforming activity. Proceedings of the National Academy of Sciences, USA 83, 1797-1801.[Abstract]
Dunlop, J., Jones, P. C. & Finbow, M. E. (1995). Membrane insertion and assembly of ductin: a polytopic channel with dual orientations. EMBO Journal 14, 3609-3616.[Abstract]
Faccini, A. M., Cairney, M., Ashrafi, G. H., Finbow, M. E., Campo, M. S. & Pitts, J. D. (1996). The bovine papillomavirus type 4 E8 protein binds to ductin and causes loss of gap junctional intercellular communication in primary fibroblasts. Journal of Virology 70, 9041-9045.[Abstract]
Finbow, M. E. & Harrison, M. A. (1997). The vacuolar H+-ATPase: a universal proton pump of eukaryotes. Biochemical Journal 324, 697-712.[Medline]
Finbow, M. E., Pitts, J. D., Goldstein, D. J., Schlegel, R. & Findlay, J. B. C. (1991). The E5 oncoprotein target: a 16-kDa channel-forming protein with diverse functions. Molecular Carcinogenesis 4, 441-444.[Medline]
Finbow, M. E., Eliopoulos, E. E., Jackson, P. J., Keen, J. N., Meagher, L., Thompson, P., Jones, P. & Findlay, J. B. C. (1992). Structure of a 16 kDa integral membrane protein that has identity to the putative proton channel of the vacuolar H+-ATPase. Protein Engineering 5, 7-15.[Abstract]
Finbow, M. E., Harrison, M. A. & Jones, P. (1995). Ductin a proton pump component, a gap junction channel and a neurotransmitter release channel. Bioessays 17, 247-255.[Medline]
Franchini, G., Mulloy, J. C., Koralnik, I. J., Lo Monico, A., Sparkowski, J. J., Andresson, T., Goldstein, D. J. & Schlegel, R. (1993). The human T-cell leukemia/lymphotropic virus type I p12I protein cooperates with the E5 oncoprotein of bovine papillomavirus in cell transformation and binds the 16-kilodalton subunit of the vacuolar H+ ATPase. Journal of Virology 67, 7701-7704.[Abstract]
Goldstein, D. J., Finbow, M. E., Andresson, T., McLean, P., Smith, K., Bubb, V. & Schlegel, R. (1991). Bovine papillomavirus E5 oncoprotein binds to the 16K component of vacuolar H+-ATPases. Nature 352, 347-349.[Medline]
Goldstein, D. J., Kulke, R., Dimaio, D. & Schlegel, R. (1992a). A glutamine residue in the membrane-associating domain of the bovine papillomavirus type 1 E5 oncoprotein mediates its binding to a transmembrane component of the vacuolar H+-ATPase. Journal of Virology 66, 405-413.[Abstract]
Goldstein, D. J., Toyama, R., Dhar, R. & Schlegel, R. (1992b). The BPV-1 E5 oncoprotein expressed in Schizosaccharomyces pombe exhibits normal biochemical properties and binds to the endogenous 16-kDa component of the vacuolar proton-ATPase. Virology 190, 889-893.[Medline]
Goldstein, D. J., Li, W., Wang, L. M., Heidaran, M. A., Aaronson, S., Shinn, R., Schlegel, R. & Pierce, J. H. (1994). The bovine papillomavirus type 1 E5 transforming protein specifically binds and activates the beta-type receptor for the platelet-derived growth factor but not other related tyrosine kinase-containing receptors to induce cellular transformation. Journal of Virology 68, 4432-4441.[Abstract]
Graham, L. A., Hill, K. J. & Stevens, T. H. (1998). Assembly of the yeast vacuolar H+ATPase occurs in the endoplasmic reticulum and requires a Vma12p/Vma22p assembly complex. Journal of Cell Biology 142, 39-49.
Harrison, M. A., Jones, P. C., Kim, Y.-I., Finbow, M. E. & Findlay, J. B. C. (1994). Functional properties of a hybrid vacuolar H+-ATPase in Saccharomyces cells expressing the Nephrops 16-kDa proteolipid. European Journal of Biochemistry 221, 111-120.[Abstract]
Harrison, M. A., Finbow, M. E. & Findlay, J. B. C. (1997). Postulate for the molecular mechanism of the vacuolar H+-ATPase (hypothesis). Molecular Membrane Biology 14, 1-3.[Medline]
Harrison, M. A., Murray, J., Powell, B., Kim, Y.-I., Finbow, M. E. & Findlay, J. B. C. (1999). Helical interactions and membrane disposition of the 16-kDa proteolipid subunit of the vacuolar H+-ATPase analyzed by cysteine replacement mutagenesis. Journal of Biological Chemistry 274, 25461-25470.
Harrison, M., Powell, B., Finbow, M. E. & Findlay, J. B. C. (2000). Identification of lipid-accessible sites on the Nephrops 16-kDa proteolipid incorporated into a hybrid vacuolar H+-ATPase: site-directed labeling with N-(1-pyrenyl)cyclohexylcarbodiimide and fluorescence quenching analysis. Biochemistry 39, 7531-7537.[Medline]
Horwitz, B. H., Burkhardt, A. L., Schlegel, R. & DiMaio, D. (1988). 44-amino-acid E5 transforming protein of bovine papillomavirus requires a hydrophobic core and specific carboxyl-terminal amino acids. Molecular and Cellular Biology 8, 4071-4078.[Medline]
Hughes, G., Harrison, M. A., Kim, Y.-I., Griffiths, D. E., Finbow, M. E. & Findlay, J. B. C. (1996). Interaction of dibutyltin-3-hydroxyflavone bromide with the 16 kDa proteolipid indicates the disposition of proton translocation sites of the vacuolar ATPase. Biochemical Journal 317, 425-431.[Medline]
Hwang, E. S., Nottoli, T. & Dimaio, D. (1995). The HPV16 E5 protein: expression, detection, and stable complex formation with transmembrane proteins in COS cells. Virology 211, 227-233.[Medline]
Jones, P. C., Harrison, M. A., Kim, Y.-I., Finbow, M. E. & Findlay, J. B. C. (1995). The first putative transmembrane helix of the 16 kDa proteolipid lines a pore in the V0 sector of the vacuolar H+-ATPase. Biochemical Journal 312, 739-747.[Medline]
Leechanachai, P., Banks, L., Moreau, F. & Matlashewski, G. (1992). The E5 gene from human papillomavirus type 16 is an oncogene which enhances growth factor-mediated signal transduction to the nucleus. Oncogene 7, 19-25.[Medline]
Leitch, B. & Finbow, M. (1990). The gap junction-like form of a vacuolar proton channel component appears not to be an artefact of isolation: an immunocytochemical localization study. Experimental Cell Research 190, 218-226.[Medline]
Leptak, C., Ramon y Cajal, S., Kulke, R., Horwitz, B. H., Riese, D. J.II, Dotto, G. P. & DiMaio, D. (1991). Tumorigenic transformation of murine keratinocytes by the E5 genes of bovine papillomavirus type 1 and human papillomavirus type 16. Journal of Virology 65, 7078-7083.[Medline]
Martin, P., Vass, W. C., Schiller, J. T., Lowy, D. R. & Velu, T. J. (1989). The bovine papillomavirus E5 transforming protein can stimulate the transforming activity of EGF and CSF-1 receptors. Cell 59, 21-32.[Medline]
Mulloy, J. C., Crownley, R. W., Fullen, J., Leonard, W. J. & Franchini, G. (1996). The human T-cell leukemia/lymphotropic virus type 1 p12I proteins bind the interleukin-2 receptor beta and gamma chains and affects their expression on the cell surface. Journal of Virology 70, 3599-3605.[Abstract]
OBrien, V., Ashrafi, G. H., Grindlay, G. J., Anderson, R. & Campo, M. S. (1999). A mutational analysis of the transforming functions of the E8 protein of bovine papillomavirus type 4. Virology 255, 385-394.[Medline]
Oelze, I., Kartenbeck, J., Crusius, K. & Alonso, A. (1995). Human papillomavirus type 16 E5 protein affects cellcell communication in an epithelial cell line. Journal of Virology 69, 4489-4494.[Abstract]
Páli, T., Finbow, M. E. & Marsh, D. (1999). Membrane assembly of the 16-kDa proteolipid channel from Nephrops norvegicus studied by relaxation enhancements in spin-label ESR. Biochemistry 38, 14311-14319.[Medline]
Parra, K. J. & Kane, P. M. (1998). Reversible association between the V1 and V0 domains of yeast vacuolar H+-ATPase is an unconventional glucose-induced effect. Molecular and Cellular Biology 18, 7064-7074.
Pennie, W. D., Grindlay, G. J., Cairney, M. & Campo, M. S. (1993). Analysis of the transforming functions of bovine papillomavirus type 4. Virology 193, 614-620.[Medline]
Peters, C., Bayer, M. J., Buhler, S., Andersen, J. S., Mann, M. & Mayer, A. (2001). Trans-complex formation by proteolipid channels in the terminal phase of membrane fusion. Nature 409, 581-588.[Medline]
Petti, L. & DiMaio, D. (1994). Specific interaction between the bovine papillomavirus E5 transforming protein and the beta receptor for platelet-derived growth factor in stably transformed and acutely transfected cells. Journal of Virology 68, 3582-3592.[Abstract]
Petti, L., Nilson, L. A. & DiMaio, D. (1991). Activation of the platelet-derived growth factor receptor by the bovine papillomavirus E5 transforming protein. EMBO Journal 10, 845-855.[Abstract]
Pim, D., Collins, M. & Banks, L. (1992). Human papillomavirus type 16 E5 gene stimulates the transforming activity of the epidermal growth factor receptor. Oncogene 7, 27-32.[Medline]
Rastogi, V. K. & Girvin, M. E. (1999). Structural changes linked to proton translocation by subunit c of the ATP synthase. Nature 402, 263-268.[Medline]
Rodriguez, M. I., Finbow, M. E. & Alonso, A. (2000). Binding of human papillomavirus 16 E5 to the 16 kDa subunit c (proteolipid) of the vacuolar H+-ATPase can be dissociated from the E5-mediated epidermal growth factor overactivation. Oncogene 19, 3727-3732.[Medline]
Saito, T., Schlegel, R., Andresson, T., Yuge, L., Yamamoto, M. & Yamasaki, H. (1998). Induction of cell transformation by mutated 16K vacuolar H+-ATPase (ductin) is accompanied by down-regulation of gap junctional intercellular communication and translocation of connexin 43 in NIH3T3 cells. Oncogene 17, 1673-1680.[Medline]
Schapiro, F., Sparkowski, J., Adduci, A., Suprynowicz, F., Schlegel, R. & Grinstein, S. (2000). Golgi alkalinization by the papillomavirus E5 oncoprotein. Journal of Cell Biology 148, 305-315.
Schiller, J. T., Vass, W. C., Vousden, K. H. & Lowy, D. R. (1986). E5 open reading frame of bovine papillomavirus type 1 encodes a transforming gene. Journal of Virology 57, 1-6.[Medline]
Sherman, F. (1991). Getting started with yeast. Methods in Enzymology 194, 3-21.[Medline]
Sparkowski, J., Anders, J. & Schlegel, R. (1995). E5 oncoprotein retained in the endoplasmic reticulum/cis Golgi still induces PDGF receptor autophosphorylation but does not transform cells. EMBO Journal 14, 3055-3063.[Abstract]
Straight, S. W., Herman, B. & McCance, D. J. (1995). The E5 oncoprotein of human papillomavirus type 16 inhibits the acidification of endosomes in human keratinocytes. Journal of Virology 69, 3185-3192.[Abstract]
Uchida, E., Ohsumi, Y. & Anraku, Y. (1985). Purification and properties of the H+ translocating, Mg2+ adenosine triphosphatase from vacuolar membranes of Saccharomyces cerevisiae. Journal of Biological Chemistry 260, 1090-1095.
Umemoto, N., Ohya, Y. & Anraku, Y. (1991). VMA11, a novel gene that encodes a putative proteolipid, is indispensable for expression of yeast vacuolar membrane H+-ATPase activity. Journal of Biological Chemistry 266, 24526-24532.
Received 4 June 2001;
accepted 13 June 2001.