Institute of Biochemistry and Biophysics PAS, Ul. Pawinskiego 5A, 02-106 Warsaw, Poland1
Institut des Sciences Végétales CNRS, Av. de la Terrasse, 91 198 Gif-sur-Yvette, France2
Author for correspondence: Ewa Sadowy. Present address: Sera & Vaccine Central Research Laboratory, Ul. Chemska 30/34, 00-725 Warszawa, Poland. Fax +48 22 841 29 49. e-mail sadowy{at}ibbrain.ibb.waw.pl
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
A prerequisite for the application of recombinant DNA techniques to RNA viruses is the generation of infectious cDNA clones or of infectious transcripts from cloned viral cDNA (reviewed by Boyer & Haenni, 1994 ). The availability of an infectious clone or transcript from a viral RNA genome makes it possible to determine the function of particular ORFs and non-coding regions in the virus life-cycle by targeted mutagenesis. Infectious clones have been described for several members of the Luteoviridae (Young et al., 1990
; Veidt et al., 1992
; Demler et al., 1993
; Prüfer et al., 1995
, 1997
). In addition, Leiser et al. (1992)
used agroinfection as a system to study Beet western yellows virus (BWYV; Luteoviridae). However, only few data on the effect of site-directed mutants of any PLRV ORF are available. Recently, we reported that in vitro synthesized transcripts from cloned cDNA of PLRV replicated in protoplasts and produced viral capsid protein (Sadowy et al., 1998
). Here we report the construction of expression cassettes of the PLRV genome, consisting of a full-length copy of the viral genome, flanked by the 35S promoter and terminator sequences of Cauliflower mosaic virus (CaMV; Caulimoviridae), in a binary T-DNA vector of Agrobacterium tumefaciens. We show that transcripts derived from the 35S promoter replicate in agroinoculated potato leaf discs and we prove the functional importance of two protein sequence motifs for the biology of PLRV. We also demonstrate that mutants in the GDD and H-D-S motifs complement each other. Finally, we show that a mutation in the putative catalytic triad of the proteinase influences in vitro processing of the ORF1 product.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plasmid pRT-X, a modified pRT104 (Töpfer et al., 1987 ) containing the CaMV 35S promoter (Guilley et al., 1982
) and terminator, separated by a multiple cloning site, was used as acceptor of the PLRV cDNA. The modification of pRT-104 involved a deletion of 19 bp between the KpnI and XhoI sites. A KpnIBamHI fragment of pPAK carrying 4166 bp of the PLRV genome was inserted into KpnI/BamHI-digested pRT-X resulting in plasmid pKB. Next, the PflMIBamHI fragment of pKB was replaced by the PflMIScaI fragment of pPAK yielding expression plasmid p35PFX.
The PLRV expression cassette of p35PFX was transferred into the binary T-DNA vector pBin19 (Bevan, 1984 ; Frisch et al., 1995
) by a three-fragment ligation. The HindIIIApaI and ApaISspI restriction fragments of p35PFX were inserted into pBin19, previously digested with Bsu36I, blunt-ended with T4 DNA polymerase and cut with HindIII, thus yielding pBPF. This plasmid contains the full-length PLRV cDNA flanked by the CaMV 35S promoter and terminator (Fig. 1B
). Finally, the 11 additional base pairs present at the 5' end of the cDNA in pBPF were deleted by site-directed mutagenesis (QuikChange, Stratagene). For this purpose it was necessary to sub-clone the EcoRIApaI fragment of pBPF into pBluescript KS(+) (Stratagene) digested with EcoRI/ApaI. The resulting plasmid, pPGA, carrying the first 369 bp of the viral genome, was used for mutagenesis with oligonucleotides del-1 (5' GTTCATTTCATTTGGAGAGGACAAAAGAATACCAGGAGAAATTGCAGCTTTAGCGC, non-viral nucleotides underlined) and del-2 (5' TTCTCCTGGTATTCTTTTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGG). The sequence of the clone obtained was checked. The junction thus engineered between the 35S promoter and the viral cDNA (plasmid pPOK) (Table 1
) was digested with KpnI/ApaI, and the altered promoter fragment was used to replace the corresponding fragment of pBPF, resulting in pBOK. The schematic maps of the relevant plasmids and expression vectors are presented in Fig. 1
.
|
The H and D amino acids in the putative catalytic centre of the proteinase (ORF1) were altered by site-directed mutagenesis of plasmid pBM (Sadowy et al., 1998 ) using oligonucleotides his-1 (5' GGTGACAGCTGAACTCTGCCTAGAAGGCGCTTTCG) and his-2 (5' CGAAAGCGCCTTCTAGGCAGAGTTCAGCTGTCACC; mutated nucleotides in bold) to change the histidine codon (CAC; nt 965967) to a leucine codon (CTC), and oligonucleotides asp-1 (5' GTGCCCGTAATGCTATCTCCATAC) and asp-2 (5' GTATGGAGATAGCATTACGGGCAC) for the replacement of the aspartic acid codon (GAT; nt 10581060) by an alanine codon (GCT; Table 1
). Next, the ApaISpeI fragments carrying either the mutation of the histidine or aspartic acid codons were sequenced and inserted into ApaI/SpeI-digested pBOK resulting in plasmids pB-H254L and pB-D286A, respectively.
To alter the serine residue in position 353, a 0·9 kb fragment was amplified on pJF by PCR using primers H8 (5' CGACTCCGCGCGTTGGAGCC) and ser-2 (5' CACTGGACCCGGATATGCCGGAACAGGGTT; mutated nucleotide in bold) thus changing the serine codon (TCC; nt 12621264) to an alanine codon (GCC). The PCR product was digested with NciI and PstI and the fragment obtained, corresponding to nt 12551846, was cloned together with the ApaINciI fragment of pJF (nt 3691255) into ApaI/PstI-digested pBluescript SK(+). The SpeIAatII fragment of the plasmid thus obtained (nt 10701725) was sequenced and exchanged with the corresponding fragment of pJF resulting in pS353A. The SpeIPmlI restriction fragment (nt 10693569) was transferred to SpeI/PmlI-digested pBOK, resulting in plasmid pB-S353A.
Agroinoculation of leaf discs.
Plasmids were introduced into A. tumefaciens strain LBA 4404 via electroporation (Mattanovich et al., 1989 ). The bacterial cells were harvested from liquid cultures at OD600=0·8 and resuspended in 1/10 of the culture volume containing 10 mM TrisHCl pH 8.0. Discs of
5 mm in diameter were cut from leaves of axenic potato cv. Desirée, incubated in suspensions of transfected agrobacteria for 10 min and placed on solid MS medium. After 2 days of co-cultivation at 20 °C in reduced light conditions, discs were transferred onto solid MS medium supplemented with cefotaxime and incubated as above (Elmer et al., 1988
).
Detection of viral RNA and proteins.
RNA was isolated using TRI Reagent (Molecular Research Company, MRC), following the procedure supplied by the manufacturer. Electrophoretic fractionation of RNA (10 µg per lane or 2 µg per lane in the case of RNA preparations from PLRV-infected Physalis floridana) was performed in denaturing agaroseformaldehyde gels and RNA was blotted onto Hybond-N membranes (Amersham) by capillary transfer (Ausubel et al., 1987 ). The efficiency of the transfer and level of RNA loading were examined by methylene blue staining (MRC) as recommended by the manufacturer. Viral RNA was detected by non-radioactive hybridization with an anti-sense RNA probe complementary to residues 31265176 (Sadowy et al., 1998
) and labelled with digoxigenin-UTP (Boehringer Mannheim) according to the manufacturers instructions.
Protein isolation from plant tissue was as described by Wu & Wang (1984) . Electrophoresis of proteins (amount per lane corresponding to 5 mg of tissue) was performed in denaturing 12·5% polyacrylamide gels (Laemmli, 1970
). Proteins were electroblotted onto nitrocellulose membranes and revealed by polyclonal anti-PLRV antibodies conjugated with alkaline phosphatase (Boehringer Mannheim) as described (Ausubel et al., 1987
).
RTPCR analysis of viral RNA.
RNA isolated as described above was treated with RQ DNaseI (Promega) and used for reverse transcription with Moloney murine leukaemia virus reverse transcriptase (Gibco BRL) using primers 1604-2 (5' GTCTTCTCTGCTGAGTTTGTTTGAGC) or 3725-2 (5' CTGCGTCTTCGGCGCCTGGGTTGC) under the conditions recommended by the manufacturer. One-tenth of the reaction was used for PCR with primers 1604-2, 590-1 (5' CCTTATGGGCAATTATCAACATTTGG), and 3725-2, 1730-1 (5' CCGACGTCGCTACAAGCGCACCACCAATGG), respectively, to amplify the regions of the genome encoding the active centres of the proteinase and replicase. PCR products were then digested with appropriate restriction enzymes (Table 1).
In vitro transcription and translation.
Plasmids used as templates for in vitro transcription (pJF and pS353A) were linearized with ScaI (nt position 5882). In vitro transcription was performed as described by Kujawa et al. (1993) . The uncapped transcripts (200 ng) were used for in vitro translation in a rabbit reticulocyte lysate (Boehringer Mannheim) supplemented with L-[35S]methionine in conditions recommended by the manufacturer. Proteins synthesized after incubation for 1 or 24 h were analysed by electrophoresis in denaturing polyacrylamide gels followed by autoradiography.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
RNA preparations isolated from agroinoculated leaf discs 3, 5, 7 or 10 days p.i. were analysed by Northern blot hybridization. RNA fractionated by electrophoresis in denaturing agarose gels was transferred to a Hybond-N membrane and probed with a DIG-labelled riboprobe. Two RNAs, corresponding to the genomic and subgenomic viral RNAs, were detected in preparations from infected plants (Fig. 2A, lane 1) and in leaf discs agroinoculated with pBPF and pBOK (lanes 36 and 710 respectively), the highest RNA level being reached 7 days p.i. No PLRV-specific signal could be detected in RNA preparations originating from leaf discs inoculated with pBin19 (lane 2).
|
These results demonstrate the ability of the 35S-derived PLRV transcripts to replicate in plant cells and to produce subgenomic RNA. The RNA thus synthesized was also able to direct in vivo synthesis of the viral capsid protein. Eleven additional nucleotides, present at the 5' end of the pBPF-derived transcript, diminished but did not completely inhibit virus replication. In all subsequent experiments, pBOK was used as a positive control and samples were collected 7 days p.i. This plasmid also served for construction of the replicase and proteinase mutants used in further studies.
To ascertain that the PLRV RNAs detected in the leaf discs were products of replication and not merely transcripts of the 35S promoter and potential processing products thereof, a mutant in the GDD513515 motif of the ORF2 product was constructed (pB-GDD513515VHD; Table 1). The amino acid motif GDD encoded by ORF2 at nt 30763084 is characteristic of all viral RNA-dependent RNA polymerases (Kamer & Argos, 1984
). Molecularly, the two active site aspartates are implicated in the co-ordination of divalent cations (Mg2+, Mn2+) required for catalysis in several polymerases (for a review see Joyce & Steitz, 1994
). Neither viral genomic RNA and subgenomic RNA nor the viral coat protein were detectable in leaf discs agroinoculated with pB-GDD513-515VHD (Fig. 2A
, lane 11 and Fig. 2B
, lane 11).
Amino acids H254-D286-S353 are essential for the PLRV proteinase function
Alignment of the ORF1 protein sequence with those of the serine proteinase family showed the presence of the characteristic amino acid motif H-D-S in the ORF1 product (Bazan & Fletterick, 1990 ; Koonin & Dolja, 1993
), thought to constitute the catalytic centre of the proteinase. In the case of PLRV, this centre would consist of histidine-254, aspartic acid-286 and serine-353. Although suggestive, experimental evidence of the importance of these amino acids is missing for PLRV and all other poleroviruses. To confirm the importance of these amino acids for virus amplification, each codon specifying an amino acid of the putative catalytic triad was mutated individually (Table 1
), and the effect of the respective mutation on virus replication was examined.
Three plasmids carrying the mutations H254L (pB-H254L), D286A (pB-D286A) or S353A (pB-S353A) were used for agroinoculation of potato leaf discs. Northern blot hybridization of total plant RNA isolated from leaf discs agroinoculated with each of the three mutants failed to produce any signal of viral genomic or subgenomic RNA (Fig. 3A, lanes 35). The genomic and subgenomic RNAs were readily detected in RNA preparations from leaf discs agroinoculated with pBOK (Fig. 3A
, lane 1).
|
Complementation between the replicase and proteinase mutants
Mutations that change amino acid residues constituting the putative catalytic triad of the proteinase and a mutation in the GDD motif might also influence the secondary structure of the viral RNA and/or cis-acting signals involved in PLRV replication. Therefore, we tested whether these mutants can complement each other. Several independent assays of co-agroinoculation of pB-GGD513-515VHD with one of the proteinase mutants (pBS353A, pB-H254L or pH-D286A) resulted in wild-type or close to wild-type levels of synthesis of viral genomic and subgenomic RNA (Fig. 4A, lanes 46). Similarly, the capsid protein was easily detected in protein preparations from discs agroinoculated with pB-GDD513-515VHD and either pB-H254L, pB-D286A or pB-S353A (Fig. 4B
, lanes 46, respectively). In contrast, no viral products were detected in discs co-agroinoculated with two constructs containing different mutations in the proteinase motif (Fig. 4A
, lanes 79 and Fig. 4B
, lanes 79).
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Here we have used the full-length cDNA of a Polish isolate of PLRV (Sadowy et al., 1998 ) to construct a nuclear expression cassette and show that the derived RNA replicates in leaf discs. In addition, we prove that PLRV-specific RNAs detected in leaf discs agroinoculated with such T-DNA-based expression vectors are generated by the action of the viral replicase, since a mutation in the GDD motif of the replicase abolishes RNA-dependent replication (Fig. 2
).
In the case of certain como-, cucumo- and alfamoviruses, the presence of non-viral nucleotides at the 5' end of their in vitro-derived transcripts had an inhibitory effect on their biological activity (Eggen et al., 1989 ; Rizzo & Palukaitis, 1990
; Dore et al., 1990
). Therefore, the 11 additional nucleotides located between the transcript initiation site of the 35S promoter and the 5' end of the PLRV cDNA were removed from plasmid pBPF, resulting in plasmid pBOK. Thus, the pBPF- and pBOK-derived transcripts differ only by the presence or absence of the 11 nucleotides at the 5' end of the former, whereas the pBOK-encoded transcript starts precisely at the authentic viral sequence. The presence of the 11 additional nucleotides in the pBPF-derived transcript decreased virus replication (Fig. 2
).
The 3' ends of pBPF and pBOK transcripts are identical; both presumably contain an extension of about 200 nt and a poly(A) tail. The tolerance of additional sequences at the 3' end of the pBPF- and pBOK-derived transcripts is consistent with the results of similar experiments with other viruses, such as White clover mosaic virus (Potexvirus; Beck et al., 1990 ) and BWYV (Leiser et al., 1992
). In the latter case, a 35S-derived transcript with a 3' extension was as infectious as one containing a 3' ribozyme to precisely restore the viral 3' end.
The importance of the amino acid motif GDD, found in the replicases of all (+)-strand RNA viruses (Koonin, 1991 ), is well established and has been investigated by site-directed mutagenesis of the infectious clones of numerous bacterial, animal and plant viruses (Inokuchi & Hirashima, 1987
; Taschner et al., 1991
; Ribas & Wickner, 1992
; Longstaff et al., 1993
; Jablonski & Morrow, 1995
; Li & Carrington 1995
; Molinari et al., 1998
). In each case, the alteration of amino acids of this motif completely abolished infectivity of the viral RNA. Moreover, mutated forms of the viral replicases were inactive when tested by in vitro assays (Jablonski & Morrow, 1995
; Hong & Hunt, 1996
). Therefore, a mutant containing the sequence VHD instead of GDD (pB-GDD513-515VHD) was constructed to prove whether the RNA species observed following agroinoculation were products of the viral replicase. The absence of these RNAs in agroinoculation experiments using pB-VHD confirms that the viral RNAs observed following inoculation with pBPF and pBOK indeed result from viral replicase activity.
Proteinases are required for the processing of the polyproteins expressed by many viruses infecting eukaryotic hosts (reviewed in Dougherty & Semler, 1993 ). Often, the rate of proteolysis has a regulatory role during the virus life-cycle (Babé & Craik, 1997
). In chymotrypsin-like serine proteinases, a triad composed of a histidine, an aspartic or glutamic acid and a serine residue constitute the active centre of the enzyme. In ORF1 of PLRV a sequence motif typical of serine proteinases, H(X25)[D/E](X7080)TR/KXGXSG, was detected (triad in bold; Koonin & Dolja, 1993
). Moreover, a VPg domain has been identified within ORF1 of PLRV (van der Wilk et al., 1997
) and a 25 kDa cleavage product of the ORF1-encoded protein has been detected in infected plants (Prüfer et al., 1999
). While these data suggest that a proteinase might be involved in the PLRV life-cycle, the present work provides the first genetic evidence that the serine residue of the putative triad encoded by ORF1 is indispensable for PLRV replication. Alteration of any of the three amino acids constituting the catalytic triad likewise abolished replication (Fig. 3
). Consistent with these results, the viral capsid protein, expressed from the subgenomic RNA, was not detected in cells infected with any of the three mutants in the catalytic triad.
Complementation is an effective way to rescue mutant viral genomes as studied extensively for Poliovirus (e.g. Bernstein et al., 1986 ; Charini et al., 1991
; Teterina et al., 1995
) and demonstrated for plant viruses such as Turnip yellow mosaic virus (Tymovirus; Weiland & Dreher, 1993
), Turnip crinkle virus (Tombusviridae; White et al., 1995
), Artichoke mottled crinkle virus (Tombusviridae; Molinari et al., 1998
) and Tomato bushy stunt virus (Tombusviridae; Oster et al., 1998
). A complementation phenomenon also occurs in the natural viral population of Tomato aspermy virus (Bromoviridae; Moreno et al., 1997
). Here we show that mixed agroinoculations of a mutant in the GDD motif of the viral replicase with any of the three mutants in the putative catalytic triad of the proteinase restores virus replication in leaf discs. The pattern of viral RNA did not differ from that produced by the wild-type clone (Fig. 4
). RTPCR analysis followed by digestion with diagnostic restriction enzymes revealed that the original mutations were still present in the progeny viral RNAs resulting from complementation (Fig. 5
). It can therefore be concluded that both replication components, the proteinase and replicase, can act in trans on viral RNA templates. Such a result is consistent with the finding that the PLRV proteinase cleaves in trans (Li et al., 2000
). On the other hand, the proteinase mutants themselves never complemented each other in co-agroinoculation experiments (Fig. 4
). These observations indicate that the observed replication was indeed basically due to complementation and not reversion of the mutants or recombination between the viral RNAs. Although we cannot exclude the possibility that some recombination occurs, if only the hypothetical recombinants were viable, one would expect them to rapidly become the predominant or exclusive form present in the discs, which is not the case.
The in vitro translation of wild-type and mutated full-length transcripts of PLRV resulted in the synthesis of the 118, 66 and 28 kDa proteins, corresponding to the ORF1ORF2 frameshift protein, ORF1 and ORF0 products, respectively (Fig. 6). Translation for 24 h using wild-type transcripts produced an additional 25 kDa band, which probably results from slow autocatalytic processing of the ORF1 product. It is also known that in the case of some viral proteinases efficient cleavage requires the presence of membranes (Amberg et al., 1994
; Pinon et al., 1997
; Rubino & Russo, 1998
), metal cations (De Francesco et al., 1996
; Petersen et al., 1999
), polypeptide cofactors (Ding et al., 1996
; Kim et al., 1996
) or RNA (Matthews et al., 1994
; Daros & Carrington, 1997
). Lack of one or more such cofactors in the in vitro incubation conditions may limit autoproteolysis of the PLRV ORF1 product. Low cleavage efficiency may be also due to the fact that the PLRV proteinase presumably acts in trans (Li et al., 2000
) and a low concentration of the enzyme might represent a limiting factor for processing. The 25 kDa protein produced in vitro presumably corresponds to the 25 kDa protein detected in PLRV-infected plants with antibodies specific to the C-terminal part of the ORF1 product (Prüfer et al., 1999
). Moreover, mutagenesis of the putative catalytic serine prevented the appearance of the 25 kDa band by in vitro translation. These data strongly support the hypothesis that the ORF1 product is a serine proteinase. However, our attempts to further characterize the proteinase by the use of specific inhibitors such as phenylmethylsulfonyl fluoride, aprotinin and diisopropyl fluorophosphate to prevent self-cleavage were unsuccessful (data not shown). However, it is known that some proteinases, e.g. the NS2B-3 of Yellow fever virus (Flaviviridae), the epidermolytic toxin of Staphylococcus aureus or Npro of Sindbis virus (Togaviridae), do not react with such proteinase inhibitors (Amberg et al., 1994
; Bailey et al., 1995
; Rumenapf et al., 1998
). Further experiments, in particular expression of ORF1 in vivo and structural studies, are required to elucidate the mechanism of the action of the PLRV proteinase.
The following paper (Sadowy et al., 2001 ) reports experiments to prove that the ORF0 product is indispensable for virus accumulation.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. & Struhl, K. (1987). Current Protocols in Molecular Biology. New York: Greene Publishing Associates/Wiley-Interscience.
Babé, L. M. & Craik, Ch. S. (1997). Viral proteases: evolution of diverse structural motifs to optimize function. Cell 91, 427-430.[Medline]
Bailey, C. J., Lockhart, B. P., Redpath, M. B. & Smith, T. P. (1995). The epidermolytic (exfoliative) toxins of Staphylococcus aureus. Medical Microbiology and Immunology 184, 53-61.[Medline]
Bazan, J. F. & Fletterick, R. J. (1990). Structural and catalytic models of trypsin-like viral proteases. Seminars in Virology 1, 311-322.
Beck, D. L., Forster, R. L., Bevan, M. W., Boxen, K. A. & Lowe, S. C. (1990). Infectious transcripts and nucleotide sequence of cloned cDNA of the potexvirus white clover mosaic virus. Virology 177, 152-158.[Medline]
Bernstein, H. D., Sarnow, P. & Baltimore, D. (1986). Genetic complementation among poliovirus mutants derived from an infectious cDNA clone. Journal of Virology 60, 1040-1049.[Medline]
Bevan, M. (1984). Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12, 8711-8721.[Abstract]
Boyer, J.-Ch. & Haenni, A.-L. (1994). Infectious transcripts and cDNA clones of RNA viruses. Virology 198, 415-426.[Medline]
Charini, W. A., Burns, C. C., Ehrenfeld, E. & Semler, B. L. (1991). Trans-rescue of a mutant poliovirus RNA polymerase function. Journal of Virology 65, 2655-2665.[Medline]
Daros, J. A. & Carrington, J. C. (1997). RNA binding activity of NIa proteinase of tobacco etch potyvirus. Virology 237, 327-336.[Medline]
De Francesco, R., Urbani, A., Nardi, M. C., Tomei, L., Steinkuhler, C. & Tramontano, A. (1996). A zinc binding site in viral serine proteinases. Biochemistry 35, 13282-13287.[Medline]
Demler, S. A., Rucker, D. G. & de Zoeten, G. A. (1993). The chimeric nature of the genome of pea enation mosaic virus: the independent replication of RNA2. Journal of General Virology 74, 1-14.[Abstract]
Ding, J., McGrath, W. J., Sweet, R. M. & Mangel, W. F. (1996). Crystal structure of the human adenovirus proteinase with its 11 amino acid cofactor. EMBO Journal 15, 1778-1783.[Abstract]
Dore, J.-M., Erny, C. & Pinck, L. (1990). Biologically active transcripts of alfalfa mosaic virus RNA3. FEBS Letters 264, 183-186.[Medline]
Dougherty, W. G. & Semler, B. L. (1993). Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes. Microbiological Reviews 57, 781-822.[Abstract]
Eggen, R., Verver, J., Wellink, J., De Jong, A., Goldbach, R. & van Kammen, A. (1989). Improvements of the infectivity of in vitro transcripts from cloned cowpea mosaic virus cDNA: impact of terminal nucleotide sequences. Virology 173, 447-455.[Medline]
Elmer, J. S., Brand, L., Sunter, G., Gardiner, W. E., Bisaro, D. M. & Rogers, S. G. (1988). Genetic analysis of the tomato golden mosaic virus. II. The product of the AL1 coding sequence is required for replication. Nucleic Acids Research 16, 7043-7060.[Medline]
Frisch, D. A., Harris-Haller, L. W., Yokubaitis, N. T., Thomas, T. L., Hardin, S. H. & Hall, T. C. (1995). Complete sequence of the binary vector Bin19. Plant Molecular Biology 27, 405-409.[Medline]
Gorbalenya, A. E., Donchenko, A. P., Blinov, V. M. & Koonin, E. V. (1989). Cysteine proteases of positive strand RNA viruses and chymotrypsin-like serine proteases. A distinct protein superfamily with a common structural fold. FEBS Letters 243, 103-114.[Medline]
Grimsley, N., Hohn, T., Davies, J. W. & Hohn, B. (1987). Agrobacterium-mediated delivery of infectious maize streak virus into maize plants. Nature 325, 177-179.
Guilley, H., Dudley, R. K., Jonard, G., Balazs, E. & Richards, K. E. (1982). Transcription of cauliflower mosaic virus DNA: detection of promoter sequences, and characterization of transcripts. Cell 30, 763-773.[Medline]
Harrison, B. D. (1984). Potato leafroll virus. CMI/AAB Description of Plant Viruses, no 291.
Hong, Y. & Hunt, A. G. (1996). RNA polymerase activity catalyzed by a potyvirus-encoded RNA-dependent RNA polymerase. Virology 226, 146-151.[Medline]
Inokuchi, Y. & Hirashima, A. (1987). Interference with viral infection by defective RNA replicase. Journal of Virology 61, 3946-3949.[Medline]
Jablonski, S. A. & Morrow, C. D. (1995). Mutation of the aspartic acid residues of the GDD sequence motif of poliovirus RNA-dependent RNA polymerase results in enzymes with altered metal ion requirements for activity. Journal of Virology 69, 1532-1539.[Abstract]
Joyce, C. M. & Steitz, T. A. (1994). Function and structure relationships in DNA polymerases. Annual Review of Biochemistry 63, 777-822.[Medline]
Kamer, G. & Argos, P. (1984). Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Research 12, 7269-7282.[Abstract]
Keese, P., Martin, R. R., Kawchuk, L. M., Waterhouse, P. M. & Gerlach, W. L. (1990). Nucleotide sequences of an Australian and a Canadian isolate of potato leafroll luteovirus and their relationships with two European isolates. Journal of General Virology 71, 719-724.[Abstract]
Kim, I. C., Kim, J. S., Lee, S. H. & Byun, S. M. (1996). C-terminal peptide of streptokinase, Met369-Pro373, is important in plasminogen activation. Biochemistry and Molecular Biology International 40, 939-945.[Medline]
Koonin, E. V. (1991). The phylogeny of RNA-dependent RNA polymerase of positive strand RNA viruses. Journal of General Virology 72, 2197-2206.[Abstract]
Koonin, E. V. & Dolja, V. V. (1993). Evolution and taxonomy of positive-strand RNA viruses: implications of comparative analysis of amino acid sequences. Critical Reviews in Biochemistry and Molecular Biology 28, 375-430.[Abstract]
Kujawa, A. B., Drugeon, G., Hulanicka, D. & Haenni, A.-L. (1993). Structural requirements for efficient translational frameshifting in the synthesis of the putative viral RNA-dependent RNA polymerase of potato leafroll virus. Nucleic Acids Research 21, 2165-2171.[Abstract]
Laemmli, U. K. (1970). Cleavage of structural proteins during assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Leiser, R.-M., Ziegler-Graff, V., Reutenauer, A., Herrbach, E., Lemaire, O., Guilley, H., Richards, K. & Jonard, G. (1992). Agroinfection as an alternative to insects for infecting plants with beet western yellows luteovirus. Proceedings of the National Academy of Sciences, USA 89, 9136-9140.[Abstract]
Li, X. H. & Carrington, J. C. (1995). Complementation of tobacco etch potyvirus mutants by active RNA polymerase expressed in transgenic cells. Proceedings of the National Academy of Sciences, USA 92, 457-461.[Abstract]
Li, X., Ryan, M. D. & Lamb, J. W. (2000). Potato leafroll virus protein P1 contains a serine proteinase domain. Journal of General Virology 81, 1857-1864.
Longstaff, M., Brigneti, G., Boccard, F., Chapman, S. & Baulcombe, D. (1993). Extreme resistance to potato virus X infection in plants expressing a modified component of the putative viral replicase. EMBO Journal 12, 379-386.[Abstract]
Mattanovich, D., Ruker, F., da Camara Machado, A., Laimer, M., Regner, F., Steinkellner, H., Himmler, G. & Katinger, H. (1989). Efficient transformation of Agrobacterium spp. by electroporation. Nucleic Acids Research 17, 6747.[Medline]
Matthews, D. A., Smith, W. W., Ferre, R. A., Condon, B., Budahazi, G., Sisson, W., Villafranca, J. E., Janson, C. A., McElroy, H. E. & Gribskov, C. L. (1994). Structure of human rhinovirus 3C protease reveals a trypsin-like polypeptide fold, RNA-binding site, and means for cleaving precursor polyprotein. Cell 77, 761-771.[Medline]
Mayo, M. A., Barker, H., Robinson, D. J., Tamada, T. & Harrison, B. D. (1982). Evidence that potato leafroll virus RNA is positive-stranded, is linked to a small protein and does not contain polyadenylate. Journal of General Virology 59, 163-167.
Mayo, M. A., Robinson, D. J., Jolly, C. A. & Hyman, L. (1989). Nucleotide sequence of potato leafroll luteovirus RNA. Journal of General Virology 70, 1037-1051.[Abstract]
Miller, W. A., Brown, C. M. & Wang, S. (1997). New punctuation for the genetic code: luteovirus gene expression. Seminars in Virology 8, 3-13.
Molinari, P., Marusic, C., Lucioli, A., Tavazza, R. & Tavazza, M. (1998). Identification of artichoke mottled crinkle virus (AMCV) proteins required for virus replication: complementation of AMCV p33 and p92 replication-defective mutants. Journal of General Virology 79, 639-647.[Abstract]
Moreno, I. M., Malpica, J. M., Rodriguez-Cerezo, E. & Garcia-Arenal, F. (1997). A mutation in tomato aspermy cucumovirus that abolishes cell-to-cell movement is maintained to high levels in the viral RNA population by complementation. Journal of Virology 71, 9157-9162.[Abstract]
Oster, S. K., Wu, B. & White, A. K. (1998). Uncoupled expression of p33 and p92 permits amplification of tomato bushy stunt virus RNAs. Journal of Virology 72, 5845-5851.
Paucha, A., Sadowy, E., Kujawa, A., Juszczuk, M., Zagórski, W. & Hulanicka, D. (1994). Nucleotide sequence of RNA of a Polish isolate of potato leafroll luteovirus. Acta Biochimica Polonica 41, 405-414.[Medline]
Petersen, J. F., Cherney, M. M., Liebig, H. D., Skern, T., Kuechler, E. & James, M. N. (1999). The structure of the 2A proteinase from a common cold virus: a proteinase responsible for the shut-off of host-cell protein synthesis. EMBO Journal 18, 5463-5475.
Pinon, J. D., Mayreddy, R. R., Turner, J. D., Khan, F. S., Bonilla, P. J. & Weiss, S. R. (1997). Efficient autoproteolytic processing of the MHV-A59 3C-like proteinase from the flanking hydrophobic domains requires membranes. Virology 230, 309-322.[Medline]
Pringle, C. R. (1998). Virus taxonomy San Diego 1998. Report of the 27th Meeting of the Executive Committee of the International Committee on Taxonomy of Viruses. Archives of Virology 143, 1449-1459.[Medline]
Prüfer, D., Tacke, E., Schmitz, J., Kull, B., Kaufmann, A. & Rohde, W. (1992). Ribosomal frameshifting in plants: a novel signal directs the -1 frameshift in the expression of the putative viral replicase of potato leafroll virus. EMBO Journal 11, 1111-1117.[Abstract]
Prüfer, D., Wipf-Schibel, C., Richards, K., Guiley, H., Lecoq, H. & Jonard, G. (1995). Synthesis of a full-length infectious cDNA clone of cucurbit aphid-borne yellows virus and its use in gene exchange experiments with structural proteins from other luteoviruses. Virology 214, 150-158.[Medline]
Prüfer, D., Schmitz, J., Tacke, E., Kull, B. & Rohde, W. (1997). In vivo expression of a full-length cDNA copy of potato leafroll virus (PLRV) in protoplasts and transgenic plants. Molecular & General Genetics 253, 609-614.[Medline]
Prüfer, D., Kawchuk, L., Monecke, M., Nowok, S., Fischer, R. & Rohde, W. (1999). Immunological analysis of potato leafroll luteovirus (PLRV) P1 expression identifies a 25 kDa RNA-binding protein derived via P1 processing. Nucleic Acids Research 27, 421-425.
Ribas, J. C. & Wickner, R. B. (1992). RNA-dependent RNA polymerase consensus sequence of the L-A double-stranded RNA virus: definition of essential domains. Proceedings of the National Academy of Sciences, USA 89, 2185-2189.[Abstract]
Rizzo, T. M. & Palukaitis, P. (1990). Construction of full-length cDNA clones of cucumber mosaic virus RNA 1, 2 and 3: generation of infectious RNA transcripts. Molecular & General Genetics 222, 249-256.[Medline]
Rohde, W., Gramstat, A., Schmitz, J., Tacke, E. & Prüfer, D. (1994). Plant viruses as model systems for the study of non-canonical mechanisms in higher plants. Journal of General Virology 75, 2141-2149.[Medline]
Rubino, L. & Russo, M. (1998). Membrane targeting sequences in tombusvirus infections. Virology 252, 431-437.[Medline]
Rumenapf, T., Stark, R., Heimann, M. & Thiel, H. J. (1998). N-terminal protease of pestiviruses: identification of putative catalytic residues by site-directed mutagenesis. Journal of Virology 72, 2544-2547.
Sadowy, E., Pluta, K., Gronenborn, B. & Hulanicka, D. (1998). Infectious transcripts from cloned cDNA of potato leafroll virus. Acta Biochimica Polonica 45, 611-619.[Medline]
Sadowy, E., Maasen, A., Juszczuk, M., David, C., Zagórski-Ostoja, W., Gronenborn, B. & Hulanicka, M. D. (2001). The ORF0 product of Potato leafroll virus is indispensable for virus accumulation. Journal of General Virology 82, 1529-1532.
Smith, O. P. & Harris, K. F. (1990). Potato leafroll virus 3' genome organization: sequence of the coat protein gene and identification of a viral subgenomic RNA. Phytopathology 80, 609-614.
Taschner, P. E., van der Kuyl, A. C., Neeleman, L. & Bol, J. F. (1991). Replication of an incomplete alfalfa mosaic virus genome in plants transformed with viral replicase genes. Virology 181, 445-450.[Medline]
Teterina, N. L., Zhou, W. D., Cho, M. W. & Ehrenfeld, E. (1995). Inefficient complementation activity of poliovirus 2C and 3D proteins for rescue of lethal mutations. Journal of Virology 69, 4245-4254.[Abstract]
Töpfer, R., Matzeit, V., Gronenborn, B., Schell, J. & Steinbiss, H. H. (1987). A set of plant expression vectors for transcriptional and translational fusions. Nucleic Acids Research 15, 5890.[Medline]
van der Wilk, F., Huisman, M. J., Cornelissen, B. J., Huttinga, H. & Goldbach, R. (1989). Nucleotide sequence and organization of potato leafroll virus genomic RNA. FEBS Letters 245, 51-56.[Medline]
van der Wilk, F., Verbeek, M., Dullemans, A. M. & van den Heuvel, J. F. J. M. (1997). The genome-linked protein of potato leafroll virus is located downstream of the putative protease domain of the ORF1 product. Virology 234, 300-303.[Medline]
Veidt, I., Bouzoubaa, S. E., Leiser, R.-M., Ziegler-Graff, V., Guilley, H., Richards, K. & Jonard, G. (1992). Synthesis of full-length transcripts of beet western yellows virus RNA: messenger properties and biological activity in protoplasts. Virology 186, 192-200.[Medline]
Weiland, J. J. & Dreher, T. W. (1993). Cis-preferential replication of the turnip yellow mosaic virus RNA genome. Proceedings of the National Academy of Sciences, USA 90, 6095-6099.[Abstract]
White, K. A., Skuzeski, J. M., Li, W., Wei, N. & Morris, T. J. (1995). Immunodetection, expression strategy and complementation of turnip crinkle virus p28 and p88 replication component. Virology 211, 525-534.[Medline]
Wu, F. S. & Wang, M. Y. (1984). Extraction of proteins for sodium dodecyl sulfatepolyacrylamide gel electrophoresis from protease-rich plant tissues. Analytical Biochemistry 139, 100-103.[Medline]
Young, M. J., Kelly, L., Larkin, P. J., Waterhouse, P. M. & Gerlach, W. L. (1990). Infectious in vitro transcripts from a cloned cDNA of barley yellow dwarf virus. Virology 180, 372-379.
Received 17 November 2000;
accepted 14 February 2001.