Centre for Biomolecular Sciences, School of Biology, Biomolecular Sciences Building, University of St Andrews, North Haugh, St Andrews KY16 9ST, UK1
The University of Birmingham, The School of Chemistry, Edgbaston, Birmingham B15 2TT, UK2
Author for correspondence: Martin Ryan. Fax +44 1334 463400. e-mail martin.ryan{at}st-and.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In the case of the picornaviruses, all of the proteins are encoded in a single, long, open reading frame (ORF). Picornavirus polyproteins undergo a primary co-translational cleavage in statu nascendi between domains containing the capsid proteins and domains containing the replicative proteins (Fig. 1). Precursors spanning these primary cleavage sites are not detected during native polyprotein processing. Only in hepatitis A and parechoviruses 1 and 2 does this type of primary cleavage not occur (Jia et al., 1993
; Schultheiss et al., 1994
, 1995
). In the entero- and rhinoviruses the 1D/2A primary cleavage is mediated by a well-characterized virus-encoded proteinase (2Apro), of some 17 kDa, acting in an intramolecular fashion (in cis) to cleave the nascent polyprotein at its own N terminus (Toyoda et al., 1986
; Sommergruber et al., 1989
). The analogous primary cleavage in the aphtho- and cardioviruses occurs at the C terminus of the 2A region between the capsid protein precursor ([P1-2A] aphthoviruses; [L-P1-2A] cardioviruses) and 2BC/P3 (Fig. 1
). Inspection of the cardiovirus 2A protein sequence (ca. 15 kDa) reveals no similarity to 2Apro of the entero- and rhinoviruses and none of the characteristic proteinase sequence motifs. The 2A region of the aphthovirus foot-and-mouth disease virus (FMDV) is only 18 aa long but is highly similar to the C-terminal region of cardiovirus 2A.
|
(i) The FMDV 2A sequence (together with the N-terminal proline of protein 2B) retained cleavage activity in recombinant FMDV polyproteins when either the upstream or downstream contexts were replaced, but the upstream context influenced the activity (Ryan et al., 1991 ).
(ii) A single ORF encoding an artificial polyprotein comprising FMDV 2A (plus the N-terminal proline of protein 2B; 19 aa in total) flanked by the reporter proteins chloramphenicol acetyltransferase (CAT) and -glucuronidase (GUS) produced three major translation products uncleaved [CAT2AGUS], GUS and [CAT2A]. The FMDV 2A sequence was able to mediate a co-translational cleavage in this artificial polyprotein directly analogous to its function in FMDV polyprotein processing such that
90% of the translation product was in the cleaved forms (Ryan & Drew, 1994
).
(iii) 2A-mediated cleavage occurred only co-translationally upon prolonged incubation the uncleaved translation products did not subsequently cleave (Ryan & Drew, 1994 ).
(iv) The C-terminal region (19 aa) of the cardiovirus encephalomyocarditis virus (EMCV) 2A (plus the N-terminal proline of protein 2B) was as active as the FMDV 2A sequence (Donnelly et al., 1997 ).
(v) The artificial [CAT2AGUS] polyprotein did not cleave when expressed in prokaryotic systems (Donnelly et al., 1997 ).
Our initial working hypothesis was that this short 2A region could mediate a single-turnover proteolysis of the polyprotein, in cis, at the 2A/2B site (invariantly a glycine/proline pair). The 2A sequence, together with the N-terminal residue of 2B, would represent an autonomous, self-aligning, nucleophile:electrophile couple that brought about the cleavage of the GlyPro peptide bond (not a proteinase:substrate couple sensu stricto). In this scenario the sequences in a proteinase which are concerned with imparting substrate specificity could be dispensed with. Similarly, the sequences required to provide the molecular environment whereby an active site nucleophile could be regenerated could also be dispensed with. Thus one might envisage how such a short sequence could bring about this specific (cis) proteolytic event.
The co-translational cleavage of the [CAT2AGUS] polyprotein into the [CAT2A] and GUS products was monitored by phosphorimaging. In both rabbit reticulocyte lysate and wheat germ extract in vitro translation systems an imbalance in the accumulated translation products was observed. Careful analysis of the translation profiles of the [CAT2AGUS] self-processing artificial polyprotein system showed considerable internal initiation within the CAT sequence in coupled transcription/translation in vitro systems (Donnelly et al., 1997 ), with higher levels of accumulation of [CAT2A] than of GUS. The substantial amount of the N-terminally truncated forms of [CAT2A] (produced by internal initiation) migrated on gels much more rapidly than [CAT2A] and was taken into account in our quantification of the translation products. When this was done the imbalance became more marked. A hypothesis in which 2A functions as a proteolytic element, however, would predict a 1:1 stoichiometry of the cleavage products.
In this paper we describe detailed analyses of the translation profiles from three types of polyprotein. The first is artificial self-processing polyproteins comprising two reporter proteins flanking FMDV 2A; the second an FMDV polyprotein in which 2A is in its native context; the third a polyprotein containing a defined cis-acting proteinase derived from human rhinovirus (HRV). We show striking differences in the polyprotein processing properties of these systems. Whilst the proteolytically processed HRV polyprotein showed equimolar quantities of the cleavage products, the artificial polyproteins showed a molar excess of the translation product N-terminal of the 2A sequence to that C-terminal of 2A. Experiments are described which were designed to eliminate the translational or transcriptional properties of the coupled in vitro systems, rather than the properties of the polyproteins themselves, as an explanation for this imbalance in the cleavage of the artificial polyproteins. A model of FMDV 2A cleavage is presented in which the 2A oligopeptide sequence is proposed to promote the hydrolysis of the peptidyl-tRNA ester linkage at a specific site the C terminus of 2A.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
pGFPGUS.
Plasmid pCATGUS (Ryan & Drew, 1994 ) was restricted with BamHI and XbaI and the large DNA restriction fragment purified by agarose gel electrophoresis. Plasmid pGFP-N2 (Clontech) was similarly restricted and the smaller restriction fragment (GFP gene) was gel purified. Purified restriction fragments were ligated to form pGFPGUS.
pGFP2AGUS.
Plasmid pCAT2AGUS (Ryan & Drew, 1994 ) was restricted with BamHI and XbaI and the large DNA restriction fragment purified by agarose gel electrophoresis. Plasmid pGFP-N2 (Clontech) was similarly restricted and the smaller restriction fragment (GFP gene) was gel purified. Purified restriction fragments were ligated to form pGFP2AGUS.
pGUS2AGFP.
A PCR product containing the sequence encoding GUS was amplified from pGFP2AGUS using the oligonucleotide primers GUSfor (5' AGAGAGGATCCGCCGCCACCATGTTACGTCTTGTA 3') and GUS23 (5' ATATAGGGCCCAAATCTAGATTCTTTGCGTCCCTG 3'). The PCR product was restricted with BamHI and XbaI, gel purified, and ligated into the similarly restricted pCAT2AGUS to give the intermediate plasmid pGUS2AGUS. A PCR product containing the sequence encoding GFP was then amplified by PCR from pGFP2AGUS using the oligonucleotide primers ApaGFPfor (5' AGAGAGGGGCCCGGTAAAGGAGAAGAA 3') and GFPrev (5' GCGCGCCTGCAGTCATCTAGATCCGGACTTGTATAG 3'). The PCR product was restricted with ApaI and PstI, gel purified, and ligated into the similarly restricted pGUS2AGUS to form plasmid pGUS2AGFP.
pAM2.
A single nucleotide insertion frame-shift mutation (underlined) was introduced into the GUS sequence immediately following the codon corresponding to the initiating AUG. Sequences encoding GUS within plasmid pGFP2AGUS were amplified by PCR using oligonucleotide primers 186 (5' TCCAACCCTGGGCCCATGGTTACGTCCT 3') and SP6 (5' TATTTAGGTGACACTATAG 3'). The PCR product was restricted with ApaI and NsiI, gel purified, and ligated into pGFP2AGUS, similarly restricted, to form the intermediate plasmid pAM1. A two-nucleotide insertion, together with a further point mutation to remove a stop codon (mutations underlined), were introduced into the 2A region. Sequences encoding GFP and 2A were amplified by PCR using primers T7 (5' TAATACGACTCACTATAGGG 3') and 187 (5' CCGCAAGCTTAAGAAGGTCAAAATTAAACAGCTGGCATGCTCCTCTAGATATCCGGACTT3'). The PCR product was restricted with BamHI and HindIII, gel purified, and ligated into plasmid pAM1, similarly restricted, to form plasmid pAM2.
pHRVP1P2.
A PCR product containing the sequence encoding HRV-14 P1P2 was amplified by PCR from HRV-14 cDNA using the oligonucleotide primers OB12 (5' GGGGGTACCGCCGCCACCATGGGCGCTCAGGTT 3') and P2-rev (5' TTTTTTGCGGCCGCCTATTGAAACAGTGTTTCTAG 3'). The PCR product was ligated into pGEMT (Promega) to give plasmid pHRVP1P2.
pFMDVP1P2.
A PCR product containing the sequence encoding FMDV P1P2 was amplified by PCR from pMR15 (Ryan et al., 1989 ) using the oligonucleotide primers FMDVP1for (5' GAGAGAGGTACCGCCGCCACCATGGGGGCTGGACAATCC 3') and FMDVP2rev (5' CCCCCCTCTAGACTACTGCTTGAAGATCGG 3'). The PCR product was ligated into pGEM-T to give plasmid pFMDVP1P2.
Coupled transcription/translation in vitro.
Coupled transcription/translation (TNT) reactions were performed as per the manufacturers instructions (Promega). Briefly, rabbit reticulocyte lysates (20 µl) or wheat germ extracts (20 µl), each containing [35S]methionine (50 µCi; Amersham), were programmed with unrestricted plasmid DNA (0·5 µg) and incubated at 30 °C for 45 min.
Immunoprecipitation.
CAT and GUS translation products were characterized by immunoprecipitation with anti-CAT and anti-GUS antibodies as described previously (Ryan & Drew, 1994 ). Puromycin- (Sigma) labelled proteins were immunoprecipitated using the same protocol with anti-puromycin antibody (kind gift of J. Brown, Institute of Cell and Molecular Biology, Edinburgh, UK), used at a 1:5 dilution.
Transcription in vitro.
Plasmid pGFP2AGUS DNA was restricted with NotI and the linearized product purified by agarose gel electrophoresis. Restricted DNA was used to programme a transcription reaction as per the manufacturers instructions (RiboMAX; Promega). RNA transcripts were purified by Sephadex G-50 column chromatography and the integrity of transcript RNA was checked by agarose gel electrophoresis prior to translation experiments.
Translation in vitro.
Translation reactions (20 µl), containing [35S]methionine (50 µCi), were performed as per the manufacturers instructions (Ambion). Briefly, translation mixtures were programmed with 0·5 µg transcript RNA and incubated at 30 °C for 45 min.
Protein degradation.
Translation reactions (50 µl) were performed for 45 min after which synthesis was arrested by addition of RNase (1 µg) and cycloheximide (50 µg). The mixture was then incubated further; samples (5 µl) were removed at the times indicated and SDSPAGE sample buffer (5 µl) added. Samples were stored on ice until the conclusion of the incubations and then analysed by 10% SDSPAGE and phosphorimaging.
Distribution of radiolabel.
Translation reactions were analysed by SDSPAGE (10%) and the distribution of radiolabel was determined either by autoradiography or by phosphorimaging using a Fujix BAS 1000. Incorporation of radioactivity into specific products was quantified directly by the latter method.
Calculation of molar ratios of cleavage products.
Using phosphorimaging the photo-stimulated luminescence (PSL) was determined for each translation product. The local background was subtracted (PSL-BG) and this value divided by the number of methionine residues for a given translation product. The calculation of molar ratios of the cleavage products was repeated three times (by integration of profile peaks or encircling the band either by freehand or by using a rectangle) to estimate the error in this method of determination, which was estimated to be 2%. The methionine contents of the proteins used in our studies are; CAT=9; GUS=12; GFP=6; HRVP1=19; HRV P2=16; FMDV [P12A]=15 and FMDV [2BC]=14.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Translation products derived from pCAT2AGUS (Fig. 2), analysed by 10% SDSPAGE, showed three protein bands migrating more slowly than the GUS cleavage product (Fig. 3A
). These were identified by the analysis of a series of N-terminally truncated constructs as (i) the faint uppermost band being the full-length, uncleaved, [CAT2AGUS], (ii) a strong (doublet) band corresponding to the two uncleaved products produced by internal initiation within the CAT sequence at Met67 and Met77 and (iii) a further uncleaved product produced by initiation at Met163 (data not shown). The presence of the predicted [
CAT2A] cleavage products produced by initiation at Met67 and Met77 (mol. mass 20·3 and 19·3 kDa, respectively) was confirmed by immunoprecipitation with anti-CAT antibodies (Fig. 3A
). The [
CAT2A] cleavage product derived from initiation at Met163 (mol. mass 9 kDa) was not resolved in this gel system.
|
|
The analysis of the distribution of radioactivity between the various products is complicated by the considerable internal initiation within the CAT sequence. The multiplicity of products together with the inability to resolve all of the products by 10% SDSPAGE led us to construct another artificial polyprotein system ([GFP2AGUS]).
Characterization of pGFP2AGUS and pGUS2AGFP translation products
Translation profiles derived from pGFP2AGUS (Fig. 2) showed very low levels of internal initiation and produced a much more easily quantifiable protein band pattern (Fig. 3B
). Three major translation products were observed: uncleaved [GFP2AGUS] plus the cleavage products GUS and [GFP2A]. Phophorimaging analyses again showed an excess of translation product N-terminal of 2A ([GFP2A]) to that C-terminal. We found that this excess varied between different batches of rabbit reticulocyte lysates (from 5:1 to 2:1) and between different batches of wheat germ extract (from 10:1 to 3:1). The most noticeable difference occurred between the two different in vitro translation systems, rather than batches of the same translation system.
Experiments were performed to eliminate the intrinsic properties of the in vitro systems as an explanation for this imbalance. We also wished to show that by reversing the order of the reporter proteins in the artificial polyprotein the same N-to C-terminal imbalance was observed. Phosphorimaging analyses of translation products derived from pGUS2AGFP (Fig. 2) showed that the translation product N-terminal of 2A ([GUS2A]) was present in excess over the product C-terminal of 2A (GFP) by some 2- to 7-fold, even though the order of the proteins in the polyprotein was reversed, thereby eliminating the possibility that translation was being interrupted by an effect of the CAT or GUS sequences themselves (Fig. 2
, Fig. 3B
).
Protein degradation studies
One very simple explanation for the observed difference in accumulated protein levels is that of different protein degradation rates. This was addressed by translating constructs for 45 min, arresting further synthesis by addition of RNase plus cycloheximide, and then incubating the (arrested) translation mixture for progressively longer periods at 30 °C. Although the levels of CAT2A, GFP and GUS present in the translations systems decreased to some extent (over much longer incubation periods compared to the 45 min translation), neither the absolute rates nor the relative rates of degradation could account for the imbalance in the accumulated products that we had observed (Fig. 4) particularly dramatic in wheat germ extracts. The experiment comparing the translation profiles from pGFP2AGUS and pGUS2AGFP also, perhaps, argues against protein degradation as an explanation for the imbalance.
|
pGFP2AGUS was transcribed separately in vitro to produce a single, discrete, RNA transcript. This defined mRNA was used to programme an uncoupled in vitro translation system. Translation profiles from pGFP2AGUS transcribed in vitro (and subsequently used to programme an in vitro translation system) were compared with those obtained by using the plasmid DNA to programme a coupled transcription/translation system. Phosphorimaging analysis showed that both methods produced a molar excess of [GFP2A]:GUS of 4:1 and 5:1, respectively (data not shown).
Premature termination of translation throughout the length of the RNA transcript template could also account for the observed imbalance in the accumulation of products. Similarly, this effect could produce an excess of N-:C-terminal translation products. One way to address this question was to analyse the translation profile of a system that should (i) produce a unitary stoichiometry of proteolytic cleavage products and (ii) be of a size comparable to the artificial polyprotein systems we have been analysing. The 2A protein of HRV is known to be a cis-acting proteinase and should, therefore, produce a 1:1 stoichiometry in its cleavage products in the case of the polyprotein encoded by construct pHRVP1P2 (Fig. 2) the capsid protein precursor, P1, and replicative proteins precursor, P2. The size of the [P1P2] ORF in pHRVP1P2 is 1429 codons compared to the [GFP2AGUS] ORF at 887 codons over 50% longer. Phosphorimaging analysis of the cleavage products derived from coupled in vitro transcription/translation of pHRVP1P2 showed the two expected translation products, P1 (mol. mass 95 kDa) and P2 (mol. mass 64 kDa). The molar ratio of HRVP1:HRVP2 was 1:1, showing that in the coupled translation systems we were using random premature termination was not producing the imbalance effect observed in the artificial polyprotein systems (Fig. 3C
). Interestingly, phosphorimaging analysis of the translation products derived from pFMDP12ABC showed the expected two major products, [P12A] (mol. mass 82 kDa) and [2BC] (mol. mass 52 kDa), to be present in the molar ratio 1:1 (Fig. 3C
). This result, again, argues against premature termination effects accounting for the imbalance of translation products derived from our artificial self-processing polyprotein cDNA constructs.
Is 2A-mediated cleavage an RNA or oligopeptidic effect?
A construct (pAM2) was made in which two frame-shifts were introduced into pGFP2AGUS such that the reading frame of GFP and GUS was maintained whilst the 2A region was in an alternative (+2) reading frame (Fig. 2). A further single-base mutation was, of necessity, introduced into the 2A region to remove a stop codon such that the single, long, ORF was maintained. This mutation is in a region of 2A shown not to be required for 2A activity (Ryan & Drew, 1994
). Although the RNA sequence corresponding to the 2A region is present in transcripts derived from this construct the recombinant polyprotein does not contain the 2A peptide sequence. Translation of pAM2 showed a single product of the same size as [GFPGUS]: no cleavage activity was observed (Fig. 3B
).
Incorporation of puromycin into nascent translation products
Having eliminated proteolysis as a mechanism for generation of the cleavage products we have proposed a translational model of 2A-mediated cleavage (see below) which we wished to test. Puromycin is added to the C terminus of nascent proteins via an amide linkage but is incorporated independent of the nature of the codon present in the ribosomal A site. Inclusion of puromycin throughout translation should result in its incorporation throughout the synthesis of the polyprotein leading to the (random) truncation of translation products. Puromycin incorporation could, however, occur preferentially at any significant ribosomal pause sites. When pGFP2AGUS was translated in the presence of puromycin (50 µg/ml) and the translation products immunoprecipitated with anti-puromycin antibodies, a single, discrete product was observed with a gel migration indistinguishable from that of [GFP2A] (Fig. 3D).
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
FMDV 2A-mediated cleavage is not mediated by the RNA sequence
Inspection of the aligned nucleotide sequences available for aphtho- and cardiovirus 2A regions shows little similarity other than bases absolutely required to encode the conserved amino acids. Algorithms which predict RNA secondary structures were used to examine all available sequences. No RNA structure was found to be conserved amongst aphtho- and cardioviruses (data not shown). Plasmid pAM2 encodes a single ORF but with the RNA sequence encoding 2A frame-shifted into the +2 reading frame with respect to GFP and GUS. Analysis of translation products showed no cleavage.
Product imbalance is not due to protein degradation
Studies in which artificial polyprotein synthesis was arrested and the mixture subsequently incubated showed that the rates of [CAT2A] and GUS degradation in the in vitro translation systems were low and directly comparable, one with another. Identical experiments using pGFP2AGUS produced the same results (data not shown). These experiments were performed for periods much longer than the synthetic phase of the translation reactions, with very little protein degradation, and we concluded that protein degradation rates cannot account for the imbalance in the accumulation of the products.
Product imbalance is not due to premature termination of transcription or translation
An alternative explanation for the artificial polyprotein cleavage product imbalance is specific termination of (T7 RNA polymerase-driven) transcription at the 2A site. Individual (T7) transcription reactions were performed, and the T7 RNA transcripts were characterized and used to programme translation reactions. These experiments produced the same translation profiles as the coupled TNT systems. We conclude that explanations such as RNA degradation or premature termination of transcription in the coupled transcription/translation system did not account for the imbalance of FMDV 2A-mediated cleavage. A good test of whether premature, random, termination of transcription or translation in these systems was producing the observed imbalance of cleavage products was translation of pHRVP1P2. In this polyprotein construct the HRV 2A region encodes a cis-acting proteinase cleaving co-translationally at its own N terminus (1D/2A site). In this case we predict a unitary stoichiometry of the proteolytic products (P1 and P2) and this is what we observed.
FMDV 2A-mediated cleavage is not due to proteolysis
The experiments we have done to characterize the in vitro translation systems have shown that the imbalance in the accumulation of translation products from the artificial polyproteins is due to unequal levels of synthesis, which cannot be accounted for by the reasons described above. Phosphorimaging analysis of the translation products derived from pFMDP1P2 showed that no translation product spanning 2A could be detected and that the cleavage products [P12A] and [2BC] were present in equimolar quantities. Taken together with the translation profile derived from pHRVP1P2, this showed that translation factors, aminoacyl-tRNAs, metabolites etc. were present in the in vitro translation systems (during the synthetic phase of our translation reactions) at a level sufficient to synthesize an ORF considerably longer than our artificial polyproteins without levels of premature termination of transcription/translation sufficient to produce a spurious imbalance result.
Our data are not consistent with 2A-mediated proteolysis of the nascent polyprotein, nor proteolysis by a cellular enzyme. The imbalance in these systems must be due to an effect on the translational machinery, rather than events subsequent to synthesis.
A translational model of FMDV 2A activity
The multiple translation products described above are generated from a single ORF. Our data are not consistent with these being produced by proteolysis of a precursor molecule. The model we have developed for the mechanism of 2A activity on the translational apparatus must account for the three outcomes we observed in the translation of the artificial polyproteins. Firstly, peptide bond formation proceeds throughout the length of the polyprotein (i.e. uncleaved [GFP2AGUS]). Secondly, the translational complex either stalling or dissociating at the C terminus of 2A in a stop codon-independent manner. Either effect would account for our observation that the [GFP2A] product is synthesized at higher levels than GUS. Thirdly, translation of the upstream product ([CAT2A] or [GFP2A]) followed by translation of the discrete downstream product (GUS) without the synthesis of a peptidic linkage between the two.
The scheme we have proposed is summarized in Fig. 5. The ProGly peptide bond at the C terminus of 2A is synthesized (Fig. 5
, steps iii). Translocation of the peptidyl(2A)-tRNAGly from the A to P site, mediated by elongation factor 2 (eEF2), would allow ingress of prolyl-tRNA (Fig. 5
, step iii). The nucleophilic attack by the prolyl-tRNA amide nitrogen upon the peptidyl(2A)-tRNAGly carbonyl carbon is inhibited by 2A. Hydrolysis of the peptidyl(2A)-tRNAGly ester linkage occurs, releasing the nascent peptide from the ribosome (Fig. 5
, steps iv and v). Prolyl-tRNA in the A site is then translocated to the P site, as if a peptide bond had been synthesized (Fig. 5
, step vi), and translation of the downstream product can continue.
|
Our analyses of site-directed mutagenic and N-terminally extended forms of FMDV 2A (accompanying paper: Donnelly et al., 2001 ) and other 2A-like sequences (Donnelly et al., 2001
) show that amino acid changes some distance from the C terminus of 2A may affect events within the peptidyltransferase centre. In the case of FMDV 2A we have mapped these influential sequences entirely within a 2332 aa tract constituting FMDV 2A and the C-terminal region of FMDV protein 1D. It has been proposed that the most probable conformation of a nascent peptide is helical (Lim & Spirin, 1986
) and the dimensions of the ribosomal exit tunnel are consistent with this notion (Nissen et al., 2000
). The prokaryotic ribosome exit tunnel is some 100
in length and straight, although it has a bend some 2035
from the peptidyltransferase centre. Modelling a range of different 2A sequences as
-helixes shows that all of these structures could be easily accommodated entirely within the ribosome exit tunnel.
(b) Inhibition of peptidyltransferase activity.
Since mutation of the N-terminal proline residue (secondary amino acid) of 2B to primary amino acids resulted in the synthesis of uncleaved polyprotein alone (Hahn & Palmenberg, 1996 ; Donnelly et al., 2001
) any mechanism for the inhibition of peptidyltransferase activity would need to account for this effect only being observed when prolyl-tRNA is the nucleophile. Mutation of the proline residue to a primary amino acid permits the aminoacyl-tRNA to out-compete the hydrolysis of the peptidyl(2A)-tRNAGly ester linkage. The absolute requirement for a proline residue in this position for cleavage could be explained by the chemical character of proline as a nucleophile. The secondary amino group is sterically hindered relative to the primary amino groups of other amino acids and is conformationally restrained due to its location in a five-membered ring. Indeed, the lower nucleophilicity of proline compared to that of primary amino acids in peptide synthesis and translation is well documented (Nathans & Niedle, 1963
; Rychlik et al., 1970
; Lenman et al., 1997
).
The mechanism of peptidyltransferase activity proposed by Nissen et al. (2000) invokes many ribosome components, and the involvement of the 3' end of tRNAs in this reaction is clear (Samaha et al., 1995
; Green et al., 1998
). The nature of the interaction of 2A with the exit tunnel clearly plays a role in this inhibition since peptide bond formation between the peptidyl(2A)-tRNAGly and prolyl-tRNA occurs when the 19 aa version of 2A is used in the artificial polyprotein systems (synthesis of [GFP2AGUS] at
10%), but not when 2A is present in its native context or when 2A bears an N-terminal extension of between 514 aa (Donnelly et al., 2001
).
(c) Hydrolysis of the peptidyl(2A)-tRNAGly ester linkage.
One question addressed by Nissen et al. (2000) was how is the catalysed hydrolysis of the peptidyl tRNA in the P site prevented prior to the delivery of the next appropriate amino acid-tRNA to the A site?. They discuss the possibility that a catalytic rRNA base (A2486) and/or the peptidyl-tRNA substrate are not properly oriented for hydrolysis to occur or that the binding site for the amino group is blocked by a reoriented base whilst the A site is unoccupied. Indeed, we have proposed that the C-terminal NPG residues of 2A could serve to re-orient the peptidyl(2A)-tRNAGly substrate to disfavour peptide bond formation and promote hydrolysis (Ryan et al., 1999
), although in our case this would occur when the A site is occupied by prolyl-tRNA. Promotion of the hydrolytic event could be due to a 2A-mediated enhancement of the intrinsic rate of hydrolysis within ribosomes or one could envisage 2A being an active hydrolytic element in its own right: positioning the peptidyl(2A)-tRNAGly ester linkage to lie beneath the
-helix such that the dipole moment could be harnessed to generate an activated water molecule.
(d) Ribosomal A to P site translocation rates.
The complexes shown in Fig. 5 (steps v and vi) would not be encountered during the normal course of translation. Were the stability of either, or both, of these complexes to be low then ribosomal subunits might dissociate at this point generating a molar excess of the upstream translation product. Alternatively, if the 2A peptidyl-tRNA resided for too long in the A site, hydrolysis in this situation would lead to deacylated tRNAs occupying both the P and A sites termination of translation. Interestingly, translation studies on cardiovirus RNA using Krebs-2 cell-free extracts (containing low levels of eEF-2 activity) showed a translational barrier in the central region of the genome (Svitkin & Agol, 1983
). The translation products formed indicate that this barrier prevented translation of products downstream of cardiovirus 2A. The addition of eEF-2 greatly enhanced the synthesis of proteins C-terminal of cardiovirus 2A.
(e) Puromycin incorporation.
Puromycin competes with all aminoacyl-tRNAs for incorporation onto the C terminus of nascent polypeptide chains. Translation of pGFP2AGUS in the presence of puromycin gave, however, not a uniform pattern of puromycin incorporation, but a single major species. This band represented a significant population of translation complexes which were paused at a specific site and translational state competent to incorporate puromycin. We argue that this corresponds to a kinetically slow step and it is at this stage that a water molecule (or in this case puromycin) can hydrolyse the peptidyl-tRNA ester linkage step (iv), Fig. 5. These data also provide an additional line of evidence arguing against a proteolytic model proteolytic cleavage (at the 2A/2B site; glycylprolyl pair) of translation products which had been extended past 2A would separate the puromycin tag (present only at C termini) from [GFP2A] which would not, therefore, be immunoprecipitated using the anti-puromycin antibodies which would not produce a specific [GFP2A] band.
2A activity in native and artificial polyproteins
Differences in 2A activity were apparent when 2A was present in its native, or an artificial, polyprotein context. 2A-mediated cleavage appeared to be complete when the 2A region was present in its normal FMDV polyprotein context (Ryan et al., 1989 , 1991
), whereas 2A activity in artificial polyproteins showed an imbalance in cleavage products and a low level (
5%) of full-length translation products. Translation of pFMDP12ABC showed the cleavage products [P12A] and [2BC] were present in equimolar quantities. We have shown that FMDV sequences upstream of 2A do, however, play a role in maximizing the cleavage activity, reducing the amount of uncleaved product (Ryan et al., 1991
; Donnelly et al., 1997
, 2001
).
Product imbalance the translational model
The imbalances in translation products we observed in the artificial polyprotein systems could be accounted for by two, quite possibly functionally independent, aspects of the system. Firstly, the efficiency of the pseudo-termination event and secondly, the efficiency of the re-initiation event.
(a) The efficiency of pseudo-termination.
Here, we have observed two outcomes: either the full-length translation product is synthesized (formation of the peptide bond between 2A and GUS) or, we propose, it is not formed and a stop codon-independent (pseudo-) termination of translation occurs. Two explanations are considered here as to how the efficiency of this event could affect the imbalance in translation products.
(i) The 19 aa 2A tract we have analysed is suboptimal and incorrectly re-aligns the peptidyl-tRNAGly ester linkage such that in a proportion of cases neither hydrolysis of the ester linkage nor attack by prolyl-tRNA can occur. This would lead to a stall or arrest of translation at the C terminus of 2A and, following the disruption of this stalled complex by the sample preparation procedure for SDSPAGE analysis, result in a net N-:C-terminal product imbalance. In its native polyprotein context [and N-terminally extended forms of 2A; see accompanying paper (Donnelly et al., 2001 )], however, the proposed re-alignment of the 2A peptidyl-tRNAGly ester linkage is correct in that it adopts a conformation in which hydrolysis of the bond can occur, but nucleophilic attack by prolyl-tRNA cannot.
(ii) In the same proportion of cases the rate of hydrolysis is increased such that this occurs at a stage (Fig. 5, steps iii) prior to the ingress of prolyl-tRNA into the A site. This would result in either deacylated tRNAs in both A and P sites (hydrolysis occurring at step i, Fig. 5
) the situation produced by stop codon-mediated termination of translation or deacylated tRNA in the P site with the A site unoccupied (hydrolysis occurring at step ii, Fig. 5
). Our puromycin incorporation data showed, however, that the C terminus of 2A represents the major translational pause site throughout the ORF.
2A in its native polyprotein context (pFMDVP1P2), however, produces complete cleavage. We have determined that by N-terminally extending the inserted 2A sequence in the [GFP2AGUS] reporter polyprotein system the accumulation of uncleaved material is either reduced (N-terminal extension of 5 aa of 1D) or eliminated (N-terminal extension of 14 aa of 1D) (Donnelly et al., 2001 ). We would argue, therefore, that the efficiency of the pseudo-termination event is determined primarily by the nature of the sequences upstream (within
30 aa) of the conserved -DxExNPGP- motif.
(b) The efficiency of pseudo-reinitiation.
Given that the cleavage occurred as shown in step (v) of Fig. 5, what other factors could come into play to affect the efficiency of the pseudo-reinitiation event? The complex shown in step (vi) would not be encountered during the normal course of protein synthesis and the stability of this complex could well determine whether translation terminates at this point or continues to synthesize the (discrete, cleaved) downstream product. The in vitro translation of constructs encoding 2A in its native polyprotein context (pFMDVP1P2) and N-terminally extended forms of 2A (extension by
14 aa 1D; Donnelly et al., 2001
) resultes in equimolar ratios of up- and downstream translation products. This argues that the complex shown in step (vi) would lead to continued translation in a highly efficient manner.
The product imbalances we have observed for pSAT1 (suboptimal 20 aa 2A tract) were dramatically different between rabbit reticulocyte lysates and wheat germ extracts, although no such differences between these translation systems were observed for 2A-mediated cleavage when 2A was in its native polyprotein complex. Taking our data together we account for this observation by the ability of the different lengths (and sequences; Donnelly et al., 2001 ) of 2A to interact with the exit pores of the rabbit or wheat ribosomes to produce the correct realignment of the peptidyl-tRNAGly ester linkage in the peptidyltransferase centre to promote hydrolysis rather than a complete translational arrest.
In summary, we think that by studying FMDV 2A within artificial polyprotein systems the stoichiometric imbalance in the cleavage products and the low-level synthesis of full-length translation products are a product of its suboptimal functioning, compared to its activity in a native polyprotein context. We believe that the study of 2A activity in these artificial polyprotein systems has, however, provided us with real insights as to its mode of action.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Benhar, I., Miller, C. & Engelberg-Kulka, K. (1992). Frameshifting in the expression of the Escherichia coli trpR gene. Molecular Microbiology 6, 2777-2784.[Medline]
Donnelly, M. L. L., Gani, D., Flint, M., Monoghan, S. & Ryan, M. D. (1997). The cleavage activity of aphtho- and cardiovirus 2A proteins. Journal of General Virology 78, 13-21.[Abstract]
Donnelly, M. L. L., Hughes, L. E., Luke, G., Mendoza, H., ten Dam, E., Gani, D & Ryan, M. D. (2001). The cleavage activities of foot-and-mouth disease virus 2A site-directed mutants and naturally occurring 2A-like sequences. Journal of General Virology 82, 1027-1041.
Dougherty, W. G. & Semler, B. L. (1993). Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes. Microbiological Reviews 57, 781-822.[Abstract]
Douglas, J., Civelli, O. & Herbert, E. (1984). Polyprotein gene-expression generation of diversity of neuro-endocrine peptides. Annual Review of Biochemistry 53, 665-715.[Medline]
Farabaugh, P. J. (1996). Programmed translational frameshifting. Microbiological Reviews 60, 103-134.
Gesteland, R. F. & Atkins, J. F. (1996). Recoding: dynamic reprogramming of translation. Annual Review of Biochemistry 65, 741-768.[Medline]
Green, R., Switzer, C. & Noller, H. F. (1998). Ribosome-catalyzed peptide-bond formation with an A-site substrate covalently linked to 23S ribosomal RNA. Science 280, 286-289.
Gu, Z., Harrod, R., Rogers, E. J. & Lovett, P. S. (1994). Anti-peptidyl transferase leader peptides of attenuation-regulated chloramphenicol-resistance genes. Proceedings of the National Academy of Sciences, USA 91, 5612-5616.[Abstract]
Hahn, H. & Palmenberg, A. C. (1996). Mutational analysis of the encephalomyocarditis virus primary cleavage. Journal of Virology 70, 6870-6875.[Abstract]
Harrod, R. & Lovett, P. S. (1995). Peptide inhibitors of peptidyltransferase alter the conformation of domains IV and V of large subunit rRNA: a model for nascent peptide control of translation. Proceedings of the National Academy of Sciences, USA 92, 8650-8654.[Abstract]
Jia, X.-Y., Summers, D. F. & Ehrenfeld, E. (1993). Primary cleavage of the HAV capsid protein precursor in the middle of the proposed 2A coding region. Virology 193, 515-519.[Medline]
Kurjan, J. & Herskowitz, I. (1982). Structure of yeast pheromone gene (MF): a putative
-factor precursor contains four tandem copies of mature
-factor. Cell 30, 933-943.[Medline]
Lenman, M. M., Lewis, A. & Gani, D. (1997). Synthesis of fused 1,2,5-triazepine-1,5-diones and some N2- and N3-substituted derivatives: potential conformational mimetics for cis-peptidyl prolinamides. Journal of the Chemical Society Perkin Transactions 1, 2297-2311.
Lim, V. L. & Spirin, A. S. (1986). Stereochemical analysis of ribosomal transpeptidation: conformation of the nascent peptide. Journal of Molecular Biology 188, 565-577.[Medline]
Manch-Citron, J. N. & London, J. (1994). Expression of the Prevotella loescheii adhesin gene (plaA) is mediated by a programmed frameshifting hop. Journal of Bacteriology 176, 1944-1948.[Abstract]
Matsushita, O., Russell, J. B. & Wilson, D. B. (1991). A Bacteroides ruminicola 1,4--D-endoglucanase is encoded in 2 reading frames. Journal of Bacteriology 173, 6919-6926.[Medline]
Nakanishi, S., Teranishi, Y., Noda, M., Notake, M., Watanabe, Y., Kakidani, H., Jingami, H. & Numa, S. (1980). The protein-coding sequence of the bovine ACTH--LPH precursor is split near the signal peptide region. Nature 287, 752-755.[Medline]
Nathans, D. & Niedle, A. (1963). Structural requirements for puromycin inhibition of protein synthesis. Nature 197, 1076-1077.[Medline]
Nissen, P., Hansen, J., Ban, N., Moore, P. B. & Steitz, T. A. (2000). The structural basis of ribosome activity in peptide bond synthesis. Science 289, 920-930.
Rogers, E. J. & Lovett, P. S. (1994). The cis-effect of a nascent peptide on its translating ribosome: influence of the cat-86 leader pentapeptide on translation at leader codon 6. Molecular Microbiology 12, 181-186.[Medline]
Ryan, M. D. & Drew, J. (1994). Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein. EMBO Journal 13, 928-933.[Abstract]
Ryan, M. D. & Flint, M. (1997). Virus-encoded proteinases of the picornavirus super-group. Journal of General Virology 78, 699-723.
Ryan, M. D., Belsham, G. J. & King, A. M. Q. (1989). Specificity of substrateenzyme interactions in foot-and-mouth disease virus polyprotein processing. Virology 173, 35-45.[Medline]
Ryan, M. D., King, A. M. Q. & Thomas, G. P. (1991). Cleavage of foot-and-mouth disease virus polyprotein is mediated by residues located within a 19 amino acid sequence. Journal of General Virology 72, 2727-2732.[Abstract]
Ryan, M. D., Monaghan, S. & Flint, M. (1998). Virus-encoded proteinases of the Flaviviridae. Journal of General Virology 79, 947-959.
Ryan, M. D., Donnelly, M. L. L., Lewis, A., Mehrotra, A. P., Wilkie, J. & Gani, D. (1999). A model for non-stoichiometric co-translational protein scission in eukaryotic ribosomes. Bioorganic Chemistry 27, 55-79.
Rychlik, I., Cerna, J., Chaldek, S., Pulkrabek, P. & Zemlicke, J. (1970). Substrate specificity of ribosomal peptidyl transferase. The effect of the nature of the amino acid side chain on the acceptor activity of 2'(3')-O-aminoacyladenosines. European Journal of Biochemistry 16, 136-142.[Medline]
Samaha, R. R., Green, R. & Noller, H. F. (1995). A base pair between tRNA and 23S rRNA in the peptidyl transferase centre of the ribosome. Nature 377, 309-314.[Medline]
Schultheiss, T., Kusov, Y. Y. & Gauss-Muller, V. (1994). Proteinase 3C of hepatitis A virus (HAV) cleaves the HAV polyprotein P2P3 at all sites including VP1/2A and 2A/2B. Virology 198, 275-281.[Medline]
Schultheiss, T., Emerson, S. U., Purcell, R. H. & Gauss-Muller, V. (1995). Polyprotein processing in echovirus 22 a first assessment. Biochemical and Biophysical Research Communications 219, 1120-1127.
Scott, A. P., Ratcliffe, J. G., Rees, L. H., London, J., Bennett, H. P. J., Lowry, P. J. & McMartin, C. (1973). Pituitary peptide. Nature New Biology 244, 65-67.[Medline]
Sommergruber, W., Zorn, M., Blaas, D., Fessl, F., Volkmann, P., Maurer-Fogy, I., Pallai, P., Merluzzi, V., Matteo, M., Skern, T. & Keuchler, E. (1989). Polypeptide 2A of human rhinovirus type 2: identification as a protease and characterization by mutational analysis. Virology 169, 68-77.[Medline]
Svitkin, Y. V. & Agol, V. I. (1983). Translational barrier in central region of encephalomyocarditis virus genome: modulation by elongation factor 2 (eEF-2). European Journal of Biochemistry 133, 145-154.[Abstract]
Toyoda, H., Nicklin, M. J. H., Murray, M. G., Anderson, C. W., Dunn, J. J., Studier, F. W. & Wimmer, E. (1986). A second virus-encoded proteinase involved in proteolytic processing of poliovirus polyprotein. Cell 45, 761-770.[Medline]
Weiss, R., Huang, W. & Dunn, D. (1990). A nascent peptide is required for ribosomal bypass of the coding gap in bacteriophage T4 gene 60. Cell 62, 117-126.[Medline]
Received 29 September 2000;
accepted 26 January 2001.