Veterinary Research Institute, Hudcova 70, Brno 621 32, Czech Republic1
University of Veterinary Sciences, Veterinärplatz 1, A-1210 Vienna, Austria2
Faculty of Science, Masaryk University, Kotlárská 2, Brno 611 37, Czech Republic3
Author for correspondence: Stanislav Indik. Fax +420 5 41211229. e-mail indik{at}vri.cz
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() |
---|
![]() |
Main text |
---|
![]() ![]() ![]() ![]() |
---|
The major viral glycoprotein, GP5, binds to the M protein to form a disulphide-linked heterodimer and contains immunologically important domains associated with virus neutralization (Meulenberg et al., 1997 ; Pirzadeh & Dea, 1997
; van Nieuwstadt et al., 1996
). Pigs immunized with plasmid DNA encoding GP5 of PRRSV produced specific anti-GP5 neutralizing antibodies and induced a cellular immune response, thus protecting the vaccinated pigs from the development of viraemia and the build-up of typical macroscopic lung lesions (Pirzadeh & Dea, 1998
).
Several studies have described a high degree of antigenic and genetic diversity between American and European PRRSV isolates (Meng et al., 1995 ; Kapur et al., 1996
; Andreyev et al., 1997
). GP5 has been found to be the most variable protein, with only 5155% amino acid sequence identity between American and European isolates (Murtaugh et al., 1995
; Kapur et al., 1996
). ORF5 (and ORF3) also shows the highest degree of diversity within one genotype (87·199·2% identity among European isolates; 8599% identity among American isolates) (Suárez et al., 1996
; Pirzadeh et al., 1998
).
PRRS was diagnosed in the Czech Republic by serological methods and by RTPCR for the first time in 1995 and seven virus strains were subsequently isolated (Valíek et al., 1997
, 1999
). In order to determine the amount of genetic variation among these Czech isolates, the ORF5 nucleotide sequences of the seven Czech strains were determined and compared with each other and with the sequences of the European strains present in the GenBank database. In further studies, the effects on nucleotide sequences of in vitro passage of the V-502 strain were analysed.
The seven Czech PRRSV isolates used in this study were isolated in porcine alveolar macrophages in 1995 (V-503 and V-516), 1996 (V-501 and V-502) and 1998 (V-546, V-547 and V-548). Some of the isolates were adapted to grow in the MARC-145 cell line (Kim et al., 1993 ), which was also used as a source of high-passage virus.
Total intracellular RNA was isolated from the infected cells with Trizol LS. The ORF5 region was amplified as described previously by Oleksiewicz et al. (1998) using European type-specific primers. The forward primer 5' CAATGAGGTGGGCTACAACC 3' and the reverse primer 5' TATGTGATGCTAAAGGCTAGCAC 3', corresponding to nucleotides 1343213451 and 1412914150, respectively, of the Lelystad strain, generated a 719 bp DNA fragment. The RTPCR products, encompassing the entire ORF5 with flanking regions from ORF4 and ORF6, were purified and both strands were sequenced on an Applied Biosystems 310 automated sequencer.
The nucleotide and deduced amino acid sequences were aligned by using CLUSTAL W (Thompson et al., 1994 ). Phylogenetic analysis was performed by the neighbour-joining method using the PHYLIP 3.5 software (Felsenstein, 1993
). The robustness of the phylogenetic analysis and significance of branch order were determined by bootstrap analysis with 1000 replications (Felsenstein, 1985
). Graphic outputs of phylogenetic trees were produced by TreeView 1.5 (Page, 1996
). Hydrophobicity plots were generated by the Kyte and Doolittle method by using the Antheprot V4.0 software. The ORF5 nucleotide sequences of the Czech isolates have been deposited in GenBank under the accession numbers AF253531AF253537.
The nucleotide and deduced amino acid sequences of the envelope glycoprotein GP5 genes of seven Czech PRRSV isolates were determined and compared with known sequences of the European and American prototype strains Lelystad and VR-2332. All of the Czech isolates were more related to the Lelystad strain than to the VR-2332 strain. No nucleotide insertions or deletions that may have resulted in amino acid insertions or deletions or frame shifting were found in the ORF5 sequences of the field isolates.
Sequences of five of the seven field isolates obtained from different herds were highly conserved and their nucleotide sequences displayed a high degree of similarity to the Lelystad strain. The among-isolate nucleotide identities ranged from 99·3 to 100%. The remaining two isolates, V-501 and V-503, shared only 88·1 and 88·9% nucleotide identity, respectively, with the European reference strain Lelystad. Nevertheless, 45·3 and 45·8% divergence was obtained when these isolates were compared with the VR-2332 strain, which is almost identical to the divergence between the Lelystad and VR-2332 strains.
Third base position mutations were predominant in ORF5. More than 60% of the mutations occurred at this last codon position and did not result in amino acid replacement, thus indicating an evolutionary stabilizing pressure to conserve the amino acid sequence.
The alignment of the deduced amino acid sequences of the Czech isolates is illustrated in Fig. 1. The envelope glycoprotein amino acid sequence for each strain consisted of 201 amino acids and the among-strain identity was 87·6100%. The N terminus, containing the putative signal sequence, was the most variable region. Despite the high variability of the putative signal sequence, the cleavage site was situated between positions 32 and 33 for all the isolates tested. Other amino acid substitutions affected positions 5663, 100122, 75, 136, 140, 154, 173, 175 and 196. The Czech isolates, as well as the Lelystad strain, possessed two potential N-glycosylation sites, located at amino acids 46 and 53. An additional N-glycosylation site at position 37 was predicted in isolates V-501 and V-503. The region between amino acid residues 100 and 122 has previously been reported as a conserved part of GP5 (Andreyev et al., 1997
). A comparison of this region with that of the other European PRRSV isolates revealed many point mutations in this part of the protein. The membrane topology of PRRSV GP5 is not known, but the amino acid sequence and hydrophobicity profile are similar to those of the primary virion envelope glycoprotein, VP-3, of lactate dehydrogenase-elevating virus (LDV). Thus, the membrane topology of GP5 is probably similar to that of VP-3. Three closely adjacent transmembrane segments are located in the middle of the coding region of ORF5 (Faaberg & Plagemann, 1995
; Meulenberg et al., 1995
). At least a part of the variable region between amino acids 100 and 122 is probably situated outside the virion, between two membrane-spanning domains, where it is probably subjected to greater immunoselective pressure, thus causing variations in amino acid sequence.
|
Fig. 2 shows the GP5 hydrophobicity plots of isolates V-501 and V-503 and the Lelystad and VR-2332 strains. The separately clustered isolate V-503 had a profile similar to those of the Lelystad and VR-2332 strains. Surprisingly, the hydrophobicity plots revealed differences in the profile of the second separately clustered strain V-501. One of the differences was located between amino acids 137 and 143, where a hydrophilic peak was absent. Another variable area was noted between amino acids 53 and 60. Each of these two differences resulted from a single amino acid substitution, namely R to C (aa 140) and D to V (aa 56), respectively. The substitution D to V is probably located within the ectodomain of the protein (by analogy with VP-3 of LDV after removal of the signal peptide, approximately 30 aa in length), to which neutralizing antibodies are probably directed. A single point mutation in the epitope recognizable by an antibody may change the reactivity of the strain to antibodies. The differences between V-501 and V-503 could have resulted from evolution, but they could also have been a consequence of immune pressure against GP5 and selection of a neutralization-resistant mutant. The V-501 strain was isolated from a sentinel pig 90 days after its introduction into a PRRSV-positive herd. Therefore, this change may have led to the establishment of persistent infection. Studies with LDV have shown that only a small amount of variation within the VP-3 ectodomain can affect interactions with neutralizing antibodies, cell tropism and the maintenance of persistent infection (Chen et al., 1998
).
|
|
The nine point mutations that resulted from 152 in vitro passages of the V-502 isolate in cell culture at 37 °C appeared to be scattered randomly across the protein. Five of them resulted in amino acid substitutions (R to C, L to F, L to F, V to I and R to G at positions 9, 20, 71, 113 and 153). Such a high mutation rate is expected for RNA viruses. These amino acid substitutions did not affect the ectodomain of the glycoprotein, but two mutations were detected within the signal peptide. An arginine at residue 153 was replaced by the uncharged amino acid glycine, which is also present at the same position of ORF5 in the vaccine strain RespPRRS, derived by attenuation of the VR-2332 strain in MARC-145 cells. This mutation changes the polarity of the hydrophilic region of the endodomain and could have been one of the mutations that resulted in a decrease in virulence. Unfortunately, this mutation reverts rapidly as the virus replicates in pigs (Madsen et al., 1998 ; Wesley et al., 1999
).
In summary, our results demonstrate high variability among Czech PRRSV isolates. Moreover, the isolation of two distinct virus variants on a single farm over the period of 1 year is strongly suggestive of their co-existence. This may represent an additional consideration in the development of effective control strategies and in vaccine development.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() |
---|
Chen, Z., Li, K., Rowland, R. R. & Plagemann, P. G. (1998). Neuropathogenicity and susceptibility to immune response are interdependent properties of lactate dehydrogenase-elevating virus (LDV) and correlate with the number of N-linked polylactosaminoglycan chains on the ectodomain of the primary envelope glycoprotein.Advances in Experimental Medicine and Biology 440, 583-592.[Medline]
Dea, S., Gagnon, C. A., Mardassi, H. & Milane, G. (1996). Antigenic variability among North American and European strains of porcine reproductive and respiratory syndrome virus as defined by monoclonal antibodies to the matrix protein. Journal of Clinical Microbiology 34, 1488-1493.[Abstract]
Drew, T. W., Meulenberg, J. J., Sands, J. J. & Paton, D. J. (1995). Production, characterization and reactivity of monoclonal antibodies to porcine reproductive and respiratory syndrome virus. Journal of General Virology 76, 1361-1369.[Abstract]
Faaberg, K. S. & Plagemann, P. G. (1995). The envelope proteins of lactate dehydrogenase-elevating virus and their membrane topography. Virology 212, 512-525.[Medline]
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Felsenstein, J. (1993). PHYLIP (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington, Seattle, WA. USA.
Goldberg, T. L., Hahn, E. C., Weigel, R. M. & Scherba, G. (2000). Genetic, geographical and temporal variation of porcine reproductive and respiratory syndrome virus in Illinois. Journal of General Virology 81, 171-179.
Kapur, V., Elam, M. R., Pawlovich, T. M. & Murtaugh, M. P. (1996). Genetic variation in porcine reproductive and respiratory syndrome virus isolates in the midwestern United States. Journal of General Virology 77, 1271-1276.[Abstract]
Keffaber, K. K. (1989). Reproductive failure of unknown etiology. American Association of Swine Practitioners Newsletter 1, 1-9.
Kim, H. S., Kwang, J., Yoon, I. J., Joo, H. S. & Frey, M. L. (1993). Enhanced replication of porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous subpopulation of MA-104 cell line. Archives of Virology 133, 477-483.[Medline]
Madsen, K. G., Hansen, C. M., Madsen, E. S., Strandbygaard, B., Botner, A. & Sorensen, K. J. (1998). Sequence analysis of porcine reproductive and respiratory syndrome virus of the American type collected from Danish swine herds.Archives of Virology143, 1683-1700.[Medline]
Mardassi, H., Mounir, S. & Dea, S. (1995). Molecular analysis of the ORFs 3 to 7 of porcine reproductive and respiratory syndrome virus, Quebec reference strain.Archives of Virology140, 1405-1418.[Medline]
Meng, X. J., Paul, P. S., Halbur, P. G. & Lum, M. A. (1995). Phylogenetic analyses of the putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): implication for the existence of two genotypes of PRRSV in the USA and Europe.Archives of Virology140, 745-755.[Medline]
Meulenberg, J. J., Hulst, M. M., de Meijer, E. J., Moonen, P. L., den Besten, A., de Kluyver, E. P., Wensvoort, G. & Moormann, R. J. (1993). Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV.Virology192, 62-72.[Medline]
Meulenberg, J. J., Petersen-den Besten, A., de Kluyver, E. P., Moormann, R. J., Schaaper, W. M. & Wensvoort, G. (1995). Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus.Virology206, 155-163.[Medline]
Meulenberg, J. J., Petersen den Besten, A., de Kluyver, E., van Nieuwstadt, A., Wensvoort, G. & Moormann, R. J. (1997). Molecular characterization of Lelystad virus.Veterinary Microbiology55, 197-202.[Medline]
Murtaugh, M. P., Elam, M. R. & Kakach, L. T. (1995). Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus.Archives of Virology140, 1451-1460.[Medline]
Oleksiewicz, M. B., Botner, A., Madsen, K. G. & Storgaard, T. (1998). Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RTPCR amplification of whole viral genes.Veterinary Microbiology64, 7-22.[Medline]
Page, R. D. M. (1996). TreeView: an application to display phylogenetic trees on personal computers.Computer Applications in the Biosciences 12, 357-358.[Medline]
Paton, D. J., Brown, I. H., Edwards, S. & Wensvoort, G. (1991). Blue ear disease of pigs.Veterinary Record128, 617.[Medline]
Pirzadeh, B. & Dea, S. (1997). Monoclonal antibodies to the ORF5 product of porcine reproductive and respiratory syndrome virus define linear neutralizing determinants.Journal of General Virology78, 1867-1873.[Abstract]
Pirzadeh, B. & Dea, S. (1998). Immune response in pigs vaccinated with plasmid DNA encoding ORF5 of porcine reproductive and respiratory syndrome virus.Journal of General Virology79, 989-999.[Abstract]
Pirzadeh, B., Gagnon, C. A. & Dea, S. (1998). Genomic and antigenic variations of porcine reproductive and respiratory syndrome virus major envelope GP5 glycoprotein.Canadian Journal of Veterinary Research 62, 170-177.[Medline]
Plagemann, P. G. & Moennig, V. (1992). Lactate dehydrogenase-elevating virus, equine arteritis virus, and simian hemorrhagic fever virus: a new group of positive-strand RNA viruses.Advances in Virus Research41, 99-192.[Medline]
Suárez, P., Zardoya, R., Martin, M. J., Prieto, C., Dopazo, J., Solana, A. & Castro, J. M. (1996). Phylogenetic relationships of European strains of porcine reproductive and respiratory syndrome virus (PRRSV) inferred from DNA sequences of putative ORF-5 and ORF-7 genes.Virus Research42, 159-165.[Medline]
Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.Nucleic Acids Research22, 4673-4680.[Abstract]
Valíek, L., P
ikal, I.,
míd, B., Rodák, L., Kubalíková, R. & Kosinová, E. (1997). Isolation and identification of porcine reproductive and respiratory syndrome virus in cell cultures.Veterinarni Medicina42, 281-287.[Medline]
Valíek, L., P
ikal, I.,
míd, B., Indik, S., Rodák, L. & Kosinová, E. (1999). Circulation of porcine reproductive and respiratory syndrome in swine herds in the Czech Republic.Veterinarni Medicina44, 289-294.
van Nieuwstadt, A. P., Meulenberg, J. J. M., van Essen-Zanbergen, A., Petersen-den Besten, A., Bende, R. J., Moormann, R. J. M. & Wensvoort, G. (1996). Proteins encoded by open reading frames 3 and 4 of the genome of Lelystad virus (Arteriviridae) are structural proteins of the virion.Journal of Virology70, 4767-4772.[Abstract]
Wensvoort, G., Terpstra, C., Pol, J. M. A., ter Laak, E. A., Bloemraad, M., de Kluyver, E. P., Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F., Broekhuijsen, J. M., Moonen, P. L. J. M., Zetstra, T., de Boer, E. A., Tibben, H. J., de Jong, M. F., vant Veld, P., Groenland, G. J. R., van Gennep, J. A., Voets, M. T., Verheijden, J. H. M. & Braamskamp, J. (1991). Mystery swine disease in the Netherlands: the isolation of Lelystad virus.Veterinary Quarterly13, 121-130.[Medline]
Wesley, R. D., Mengeling, W. L., Lager, K. M., Vorwald, A. C. & Roof, M. B. (1999). Evidence for divergence of restriction fragment length polymorphism patterns following in vivo replication of porcine reproductive and respiratory syndrome virus.American Journal of Veterinary Research 60, 463-467.[Medline]
Received 18 April 2000;
accepted 14 June 2000.