Department of Microbiology, Fukui Medical University School of Medicine, Shimoaizuki 23-3, Matsuoka-cho, Yoshida-gun, Fukui 910-1193, Japan1
Author for correspondence: Yoshinobu Kimura. Fax +81 776 61 8104. e-mail ykimura{at}fmsrsa.fukui-med.ac.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In previous animal model experiments of intranasal vaccination (Kimura et al., 1979a ; Iwata et al., 1990
; Tagaya et al., 1995
), the ts mutant of PIV type 1 (PIV-1), which had been isolated from a persistently virus-infected cell culture (Kimura et al., 1975
), induced both humoral and cellular immunity and successfully protected animals from wild-type (wt) PIV challenge. This ts mutant virus cannot multiply at a temperature higher than 36 °C because of defective virus matrix protein synthesis (Kimura et al., 1979b
). However, soon after, it was found that PIV-1, and even its highly attenuated ts derivative, directly access the central nervous system (CNS) by infecting the olfactory neurons (Mori et al., 1995
, 1996
). The nasal cavity is the only site where central neurons are exposed to the external environment. In light of this fact, more careful consideration of the neurotropism of the vaccine virus should be given in the development of a safer live paramyxovirus vaccine for intranasal use. To avoid possible CNS complications due to the intranasally inoculated vaccine virus, alternative routes for vaccination, such as the alimentary tract and genitourinary tract, can be adopted. This strategy is based on the concept of a common mucosal immune system (Mestecky et al., 1978
; McDermott & Beinenstock, 1979
; Weisz-Carrington et al., 1979
, 1987
; Pierce & Cray, 1981
; Waldman & Bergmann, 1989
), in which immune competent cells that are initially sensitized at one site of a mucous membrane can migrate to other, more distant lymphoid tissues and act as effector cells.
Herein, we describe the immune responses induced by perorally administrating the ts mutant of PIV-1 through drinking water and its protective efficacy against respiratory challenge infection with the homologous wt virus. The positive control of intranasal vaccination has been used throughout as a reference point.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Mice.
Specific-pathogen-free, 5-week-old male C3H/HeJ mice (Clea) were purchased and acclimatized for 1 week before use. Mice had fresh water and autoclaved food and were kept at 23 °C under bioclean conditions throughout all experiments. To avoid laboratory contamination, all virus-infected mice were housed in negatively pressurized isolators equipped with a ventilation system through a high-efficiency particulate air filter (AH model; Nihon-Ika). This work was approved by the Institutional Animal Care and Use Committee of Fukui Medical University, Japan.
Experimental infection.
For peroral vaccination, a natural feeding method was employed. Overnight, a mouse drank about 6 ml of virus suspension in drinking water containing 5·0x107 p.f.u. of the ts mutant. The half-life of the ts virus in the water at room temperature was 12·5 h. For intranasal inoculation, mice were mildly anaesthetized with diethylether and inoculated into the right nostril with 20 µl of the ts mutant at a dose of 2·5x106 p.f.u. per mouse. For intragastric immunization, the ts mutant was given directly into the stomach by intubation through a gastric tube. After 3 weeks, mice were challenged intranasally with 6·3x106 p.f.u. of wt virus. Samples were then collected at regular intervals.
Immunohistochemical procedure.
Mice were anaesthetized and perfused with 4% paraformaldehyde. The periglandular and cervical lymph nodes were removed and embedded in Tissue-Tek OCT compound (Sakura Finetek). After being snap-frozen with dry iceacetone, tissues were processed to 6 µm thick sections in a cryostat. Frozen sections were stained for virus antigens by the streptavidinbiotinperoxidase method using a DAKO kit (DAKO) (Julian et al., 1990 ). The specific antibody against PIV-1 was prepared by intravenously injecting rabbits three times with the purified wt virus. Tissue sections from infected mice treated with preimmune serum were used as a negative control. Tissue samples from uninfected mice were also used as an additional control.
Polymerase chain reaction (PCR).
Total RNA was extracted from mouse tissues using TRIzol reagent (Invitrogen) and cDNA was synthesized using Moloney murine leukaemia virus reverse transcriptase (Invitrogen) with 10 pmol sense primer (5' ACCAAACAAGAG 3'). cDNA was amplified in a single tube by nested PCR using a DNA Thermal Cycler (Perkin-Elmer), as described previously (Mori et al., 1995 ). Primers for PIV-1 nucleoprotein gene were designed with reference to the published nucleotide sequences (Shioda et al., 1983
) and were either external, 5' CGGGATCCTGAAGTTATACAGGAT 3' (sense) and 5' CCAGCACAATCCAGACTTGGAC 3' (antisense), or internal, 5' CGGGATCCAGACCCTTTGCTTTGC 3' (sense) and 5' ATTTGACATCGGCGTTTACTCCG 3' (antisense). The final nested product was 340 bp in length.
Quantification of antibody level.
Antiviral antibody titres were determined by ELISA using a Zymed kit (Zymed). Briefly, test samples were incubated for 2 h at 37 °C in microplates coated with 10 µg of purified wt virus proteins. After washing, the microplates were treated with individual alkaline phosphatase-conjugated anti-mouse IgG, IgA or IgM antiserum for an additional 2 h. Finally, p-nitrophenol phosphate substrate solution was added and the absorbance value at 415 nm was measured in an automated microplate reader.
Neutralizing antibody titre was determined by the plaque-reduction method. A constant amount of virus was mixed with serial dilutions of sample. The highest dilution, causing a 50% reduction of infectivity, contained 1 neutralization unit.
Assay of cytotoxic T lymphocyte (CTL) activity.
Spleen lymphocytes were collected through density-gradient centrifugation with lymphocyte-separation solution (Antibody Institute) and suspended in RPMI 1640 medium containing 10% foetal calf serum and 5x10-5 M 2-mercaptoethanol. Lymphocytes were restimulated in vitro by co-cultivating for 5 days with mitomycin C (Biomol Research Laboratories) treated syngeneic spleen cells that had been infected with wt virus 1 h before. L929 cells infected with wt virus at an input m.o.i. of 1 p.f.u. were used as target cells. The L929 cell line was originally derived from a C3H mouse and both L929 and spleen cells tested have the same H-2k haplotype. Lymphocytes and target cells were mixed and incubated at 37 °C in a 5% CO2 atmosphere for 4 h. Specific lysis of target cells was determined by the lactate dehydrogenase-release assay (Decker & Lohmann-Matthes, 1988 ) using a cytotoxic detection kit (Roche). Data were expressed as the percentage of specific release using the following formula: cytotoxicity (%)=100x{[(target with effector-effector spontaneous)-target spontaneous]/[target maximum-target spontaneous]}.
Assay of natural killer (NK) cell activity.
Yac-1 target cells were incubated with spleen cells at 37 °C for 4 h. Specific lysis of target cells was determined by the lactate dehydrogenase-release assay.
Assay of interferon (IFN) activity.
The antiviral activity of IFN was measured by a microassay method using mouse L929 cells and vesicular stomatitis virus as the challenge virus (Iwata et al., 1990 ). The highest dilution of the test serum causing complete protection against the cytopathic effects of the challenge virus was defined as containing 1 unit of IFN. In our laboratory, 1 IFN unit is equivalent to 2·7 reference research units of a research preparation of mouse IFN (NIH, catalogue no. G002-904-511).
Statistical analysis.
Data represent the mean ±SD, which are expressed as geometric means. The two-tailed MannWhitney U-test was done to determine whether there was a significant difference (P<0·05) between the experimental and control groups.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
|
|
|
|
Protective capacity of peroral vaccination against wt virus challenge
In order to evaluate the protective capacity of vaccination, mice were administered perorally with the ts mutant and 3 weeks later challenged intranasally with wt virus. The growth of the challenge virus in the lungs was completely inhibited (Table 3). The prophylactic efficacy was comparable to that of intranasal vaccination. When the ts mutant was introduced at a dose of 5·0x107 p.f.u./0·1 ml into the stomach directly through a gastric tube, no virus growth in the upper and lower digestive tract tissues could be detected by PCR and no successful protection against wt virus challenge could be achieved. The protective capacity of the ts mutant through the peroral route was removed when the virus was inactivated by a large dose of UV irradiation.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
For induction of protective immune responses, replication of the vaccine virus and/or synthesis of virus structural proteins are essential, since the UV-inactivated virus proved to be ineffective (Table 3). The invalidity of a direct intragastric route of vaccination might be due to destruction of the vaccine virus by the acid in gastric juice. From the results of the preliminary experiment, an inoculum dose of more than 5·0x105 p.f.u. per mouse in drinking water was needed for protection. The replication of orally administered vaccine virus possibly occurs in mucous membrane cells of the alimentary tract above the stomach, namely the oral cavity, the pharynx and the oesophagus. In the present peroral vaccination, the intestinal lymphoid tissues (Nedrud et al., 1987
) might not be involved. Actually, virus antigen-positive cells are detected in the oropharyngeal lymph nodes that are draining from the site of antigen exposure. Even at non-permissive temperatures, these ts mutant-infected cells produce virus proteins, such as haemagglutinin and neuraminidase protein and fusion protein (Kimura et al., 1979b
); the former binds to the cellular receptors and the latter functions during the fusion process between the virus envelope and host cell membrane. Both envelope spike proteins act at the first indispensable step of virus penetration into the cell. Therefore, the immune responses to them play a decisive role in a host defence system.
Paramyxovirus is transmitted naturally by droplets and spreads throughout the respiratory tract. It is reasonable to consider that respiratory immunity can be established by intranasal vaccination. However, even the attenuated vaccine strain of PIV-1 accesses the CNS by infecting the olfactory bulbs when administered intranasally (Mori et al., 1996 ). No trace of infection with the perorally inoculated vaccine virus in the olfactory neurons as well as in the respiratory tract grants the peroral route of vaccination an advantage in warding off an unfavourable involvement with CNS complications. Thus, peroral delivery of PIV vaccine attains definite points of superiority over the intranasal route as follows: (i) the induction of sufficient prophylactic efficacy by sensitizing a mass of lymphoid tissues associated with the orogastrointestinal tract; (ii) increased safety in terms of CNS involvement; (iii) no infliction of pain on the recipient; and (iv) cheaper and easier handling without any equipment like syringes and nebulizers.
It is tempting to speculate that a strategy of peroral vaccination with a live attenuated virus could be applied to respiratory infectious diseases, such as measles, mumps, rubella and influenza.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Crowe, J. E.Jr (1995). Current approaches to the development of vaccines against disease caused by respiratory syncytial virus (RSV) and parainfluenza virus (PIV). Vaccine 13, 415-421.[Medline]
Decker, T. & Lohmann-Matthes, M. L. (1988). A quick and simple method for the quantitation of lactate dehydrogenase release in measurements of cellular cytotoxicity and tumor necrosis factor (TNF) activity. Journal of Immunological Methods 115, 61-69.[Medline]
Heilman, C. A. (1990). Respiratory syncytial and parainfluenza viruses. Journal of Infectious Diseases 161, 402-406.[Medline]
Hou, S., Doherty, P. C., Zijlstra, M., Jaensich, R. & Katz, J. M. (1992). Delayed clearance of Sendai virus in mice lacking class I MHC-restricted CD8+ T cells. Journal of Immunology 149, 1319-1325.
Iwata, H., Tagaya, M., Matsumoto, K., Miyadai, T., Yokochi, T. & Kimura, Y. (1990). Aerosol vaccination with a Sendai virus temperature-sensitive mutant (HVJ-pB) derived from persistently infected cells. Journal of Infectious Diseases 162, 402-407.[Medline]
Julian, R. T., Edward, W. P. & Dinesh, A. J. (1990). A novel immunohistochemical technique for demonstration of specific binding of human monoclonal antibodies to human cryostat tissue sections. Journal of Histochemistry and Cytochemistry 33, 923-926.
Kast, W. M., Roux, L., Curren, J., Blom, H. J., Voordouw, A. C., Meloen, R. H., Kolakofsky, D. & Melief, C. J. (1991). Protection against lethal Sendai virus infection by in vivo priming of virus-specific cytotoxic T lymphocytes with a free synthetic peptide. Proceedings of the National Academy of Sciences, USA 88, 2283-2287.[Abstract]
Kimura, Y., Ito, Y., Shimokata, K., Nishiyama, Y., Nagata, I. & Kitoh, J. (1975). Temperature-sensitive virus derived from BHK cells persistently infected with HVJ (Sendai virus). Journal of Virology 15, 55-63.[Medline]
Kimura, Y., Norrby, E., Nagata, I., Ito, Y., Shimokata, K. & Nishiyama, Y. (1976). Homologous interference induced by a temperature-sensitive mutant derived from an HVJ (Sendai virus) carrier culture. Journal of General Virology 33, 333-343.[Abstract]
Kimura, Y., Aoki, H., Shimokata, K., Ito, Y., Takano, M., Hirabayashi, N. & Norrby, E. (1979a). Protection of mice against virulent virus infection by a temperature-sensitive mutant derived from an HVJ (Sendai virus) carrier culture. Archives of Virology 61, 297-304.[Medline]
Kimura, Y., Orvell, C. & Norrby, E. (1979b). Characterization of the polypeptides synthesized in cells infected with a temperature-sensitive mutant derived from an HVJ (Sendai virus) carrier culture. Archives of Virology 61, 23-33.[Medline]
McDermott, M. R. & Beinenstock, J. (1979). Evidence for a common mucosal immunologic system. I. Migration of B immunoblasts into intestinal, respiratory, and genital tissues. Journal of Immunology 122, 1892-1898.[Abstract]
Mestecky, J., McGhee, J. R., Arnold, R. R., Michalek, S. M., Prince, S. J. & Babb, J. L. (1978). Selective induction of an immune response in human external secretions by ingestion of bacterial antigen. Journal of Clinical Investigation 61, 731-737.[Medline]
Mori, I., Komatsu, T., Takeuchi, K., Nakakuki, K., Sudo, M. & Kimura, Y. (1995). Parainfluenza virus type 1 infects olfactory neurons and establishes long-term persistence in the nerve tissue. Journal of General Virology 76, 1251-1254.[Abstract]
Mori, I., Nakakuki, K. & Kimura, Y. (1996). Temperature-sensitive parainfluenza type 1 vaccine virus directly accesses the central nervous system by infecting olfactory neurons. Journal of General Virology 77, 2121-2124.[Abstract]
Nedrud, J. G., Liang, X. P., Hague, N. & Lamm, M. E. (1987). Combined oral/nasal immunization protects mice from Sendai virus infection. Journal of Immunology 139, 3484-3492.
Pierce, N. F. & Cray, W. C.Jr (1981). Cellular dissemination of priming for a mucosal immune response to cholera toxin in rats. Journal of Immunology 127, 2461-2464.
Shioda, T., Hidaka, Y., Kanda, T., Shibuta, H., Nomoto, A. & Iwasaki, K. (1983). Sequence of 3, 687 nucleotides from the 3 end of Sendai virus genome RNA and the predicted amino acid sequences of viral NP, P and C proteins. Nucleic Acids Research 11, 7317-7330.[Abstract]
Tagaya, M., Mori, I., Miyadai, T., Kimura, Y., Ito, H. & Nakakuki, K. (1995). Efficacy of a temperature-sensitive Sendai virus vaccine in hamsters. Laboratory Animal Science 45, 233-238.[Medline]
Waldman, R. H. & Bergmann, K.-C. (1989). Introduction of oral immunization against viral infections. Current Topics in Microbiology and Immunology 146, 69-72.[Medline]
Weisz-Carrington, P., Roux, M. E., McWilliams, M., Phillips-Quagliata, J. M. & Lamm, M. E. (1979). Organ and isotype distribution of plasma cells producing specific antibody after oral immunization: evidence for a generalized secretory immune system. Journal of Immunology 123, 1705-1708.[Abstract]
Weisz-Carrington, P., Grimes, S. R.Jr & Lamm, M. E. (1987). Gut-associated lymphoid tissue as source of an IgA immune response in respiratory tissues after oral immunization and intrabronchial challenge. Cellular Immunology 106, 132-138.[Medline]
Received 16 July 2001;
accepted 30 August 2001.