Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK1
University of Aachen (RWTH), Institute for Molecular Genetics and Botany (Biologie I), Worringerweg 1, D-52074 Aachen, Germany2
USDA-ARS HCRL, Northwest Center for Small Fruit Research, 3420 NW Orchard Ave, Corvallis, OR 97330, USA3
Author for correspondence: Hugh Barker.Fax +44 1382 562426. e-mail H.Barker{at}scri.sari.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The study of PLRV gene function by reverse genetics is made unusually difficult because the virus is not mechanically transmissible. One approach to this problem has been to use agroinfection, in which Agrobacterium cultures carrying a DNA copy of the virus genome in a Ti plasmid are injected directly into plant tissues (Leiser et al., 1992 ; Mutterer et al., 1999
). As with aphid-inoculation, the resulting infections are limited to phloem tissue. An alternative way of inducing virus replication in a plant is by transformation with a full-length (biologically active) cDNA copy of a virus genome, but the methods are time consuming. For example, plants have been transformed with cDNA corresponding to full-length RNA genomes of Tobacco mosaic virus (Yamaya et al., 1988
), Brome mosaic virus (Kaido et al., 1995
), Potato virus X (Angell & Baulcombe, 1997
) and PLRV (Pr üfer et al., 1997
). For PLRV, this has presented an opportunity to study the behaviour of PLRV and its putative 17 kDa movement protein in cells outside the phloem tissue (Schmitz et al., 1997
). In some of the above examples, virus accumulated in transgenic plants in amounts similar to, or greater than those that accumulated in conventionally inoculated plants (Yamaya et al., 1988
; Pr üfer et al., 1997
). In other instances, much less virus accumulated (Kaido et al., 1995
; Angell & Baulcombe, 1997
). This effect has been attributed to gene silencing induced by the transgene (Angell & Baulcombe, 1997
).
We report here the results of experiments with transgenic tobacco and potato plants obtained by transformation with full-length infectious cDNA to PLRV RNA. Expression of the PLRV genome did not result in the accumulation of large amounts of PLRV in tobacco, although in potato, much larger amounts of PLRV accumulated than in infected WT plants.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plasmid constructions.
Previously described cDNA clones of the Canadian isolate of PLRV (Keese et al., 1990 ; Kawchuk et al., 1989
) were taken as a source for the construction of full- length cDNA in pBluescript KS(+) (Stratagene). pLP79 was cut with MluI and KpnI and the resulting fragment was cloned into the MluI/KpnI-linearized pLP93 to give pUP99. pB2a was cut with HindIII and SmaI and cloned into Hin dIII/SmaI-linearized pGem3Zf(+) (Promega) to give p3B2a. p3B2a was cut with NruI and KpnI and cloned into pUP99 linearized with the same enzymes, to give pUP99a. pLP4 was cut with SpeI and cloned into SpeI-linearized pUP99a to give pUP994a. The missing 5'-end cDNA was synthesized by RTPCR using the first strand primer, 5' CAAATGCCTCCATGTCATGTCCC 3', which is complementary to the virus sequence between positions 490 and 512, and the second strand primer, 5' TACGTATACAAAAGAATACCAGGAGAAATTG 3', which corresponds to the virus sequence (bold) from position 1 to position 24, with added sites for Bst1107I (underlined) and SnaBI (italicized). The PCR product was cloned into pT7- Blue (Novagen) to produce pT75'P. pT75'P was cut with ApaI and SnaBI and ligated into ApaI/Not I (filled-in)-linearized pUP994a, to give pUP100. The KpnI site of pGem3Zf(+) was removed by cutting with EcoRI and SalI and, after the fill-in reaction, the vector was religated to give pG3DE/S. The HindIII (filled-in) fragment of pRT103 (T öpfer et al., 1987
) containing the 35S promoter of Cauliflower mosaic virus and the corresponding transcription termination signal was cloned into the HindIII (filled-in) site of pG3DE/S, to give pG35S1. This vector provides unique NheI restriction sites flanking the expression cassette that are not present in the PLRV cDNA sequence. The Bst1107I/KpnI fragment of pUP100 was cloned into KpnI and XhoI (filled-in) linearized plasmid pG35S1 to give p35SUP100.
In vitro mutagenesis (Kunkel et al., 1987 ) was used to remove non-viral sequences at the 5'- end of the putative 35S promoter transcript. For this purpose, the plasmid p35SUP100 was shortened by digestion with SalI, removing all but the 5' and 3' termini of the viral cDNA from the vector, to give p35SUP
S. The mutagenic oligonucleotide, 5' CATTTCATTTGGAGAGGACAAAAGAAATACCAGG 3' contained 35S promoter sequence up to the transcript start site (italicized) and virus sequence (bold) between positions 1 and 16. The resulting plasmid was named p35SUP
SM10. The ApaI/ScaI fragment from p35SUP100 was replaced by the same fragment from p35SUP
SM10 to give p35SUP110.
The NheI fragment of p35SUP110 was finally cloned into XbaI-linearized pBIN19 (Bevan, 1984 ) to give pBNUP110. The plasmid was mobilized into A. tumefaciens by direct DNA transformation according to An et al. (1988)
.
Plant transformation and culture of transgenic plants
Transformation of Nicotiana tabacum cv. `Samsun' and potato was according to Barker et al. (1993) and Barker et al. (1992)
, respectively, using A. tumefaciens containing plasmid pBNUP110 described above.
Tobacco.
Transformed plantlets, designated AW1 to AW35, were transferred to a glasshouse and grown to maturity. Mature seeds were collected from self-fertilized flowers and retained for further use. The resistance of seedlings (T1 progeny) to kanamycin was tested as described by Barker et al. (1993) . Transgenic plants for other tests were obtained from unselected seedlings germinated in compost, and grown to maturity in peat-based compost that was treated regularly with liquid fertilizer.
Potato.
Stem tissue pieces of potato genotypes cv. Maris Piper and the SCRI breeding line G8107(1) were transformed, but it was not possible to obtain transgenic lines of Maris Piper because callus grew poorly and died without regenerating transgenic shoots. Transformation of G8107(1), which has strong host-mediated resistance to PLRV accumulation (Barker & Woodford, 1992 ), produced vigorously growing callus from which shoots were regenerated. Following thermotherapy treatment (see below), in vitro plantlets of four transgenic lines were obtained that were transferred to a glasshouse. Transgenic plants grew poorly, but a few tubers were produced. After storage for approximately 6 months, they were planted to produce the progeny plants with which most tests were made.
Detection of transgenic plants by PCR.
Total leaf DNA extracts were prepared essentially as described by Reavy et al. (1997) . DNA was tested for the presence of PLRV cDNA by PCR amplification using oligonucleotide primers designed to amplify sequences from the 5'-most 537 nt, the 3'-most 1686 nt or the 3'-most 538 nt of ORF 5 of the PLRV genome (Mayo et al., 1989
).
Assay and quantification of RNA transcript.
A PCR product amplified from a plasmid containing the sequence of the coat protein (CP) gene of PLRV (Mayo et al., 1989 ), was labelled with digoxigenin (Boehringer Mannheim) to make a probe as described by Webster & Barker (1998)
. The oligonucleotide primers used were #210 and #211 (Naidu et al. , 1997
) and yielded cDNA corresponding to the 3'- most 550 nt of the CP gene. The labelled DNA product (CP probe) was used to detect RNA transcript by Northern blotting and in RNA dot blots of total leaf RNA extracts as described by Webster & Barker (1998)
.
Assay of PLRV by ELISA, tissue printing and immunosorbent electron microscopy.
The accumulation of PLRV antigen was assessed and quantified by ELISA as described by Barker & Solomon (1990) . Tissue prints of leaf and stem tissues were made essentially as described by Wisniewski et al. (1990)
. Briefly, imprints of leaf lamina, from which the lower epidermis had been removed by peeling with forceps, and transverse sections of stems were made on nitrocellulose membranes (BA85; Schleicher & Schuell). The membranes were treated essentially as described by Derrick & Barker (1997)
with a monoclonal antibody against PLRV CP, followed by a goat anti-mouse antibody conjugated to alkaline phosphatase (Kirkegaard & Perry Laboratories). Finally, membranes were incubated in substrate, Fast tablets NBT/BCIP (Sigma) for about 5 min then washed in water and dried. In developed prints, the presence of PLRV was apparent as discrete foci (stained cells) of purple indoxyl precipitate which were counted and photographed in a microscope at low magnification. Extracts of transgenic plants were tested by immunosorbent electron microscopy essentially as described by Roberts (1986)
using an anti-PLRV polyclonal antiserum.
Preparation of protoplasts.
Protoplasts were prepared from tobacco plants grown in controlled conditions (16 h at 25 °C with illumination of 7000 lux alternating with 8 h at 20 °C in darkness) as described by Kubo et al. (1975) . Protoplasts were used immediately after preparation for ELISA and extraction of total RNA.
Transmission of PLRV by aphids and grafting.
Non-transgenic WT tobacco plants were inoculated with PLRV by exposure for 3 days to five viruliferous Myzus persicae that had been reared on PLRV-infected potato, cv. Maris Piper as described by Barker & Harrison (1985) . Plants were tested by ELISA approximately 21 days after inoculation, and infected plants were retained.
Attempts were made to recover PLRV from AW3 transgenic plants by return graft inoculation of shoots to virus-free tobacco plants and by aphid inoculation of Physalis floridana, Nicotiana clevelandii or N. tabacum by using M. persicae raised on AW3 plants. The receptor plants were tested by ELISA approximately 21 days after inoculation.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
DNA was extracted from pooled leaf tissue samples of eight T1 seedlings from each of 15 AW lines and tested using PCR primers that anneal to the readthrough region of the CP gene. In addition, 11 lines were also tested using two sets of primers that anneal to the 5' and 3' regions of the PLRV genome. Positive reactions were obtained from AW3 and AW14 DNA using primers that annealed to the 5', ORF 5 and 3' regions, but no positive reactions were obtained with samples from the other 13 lines. Individual plants from several batches of lines AW3 and AW14 were tested by PCR and very few plants failed to give a positive reaction (ratio of PCR-positive to PCR- negative plants was approximately 15:1).
Characterization of transgenic lines of potato
In attempts to transform cv. Maris Piper, only a few non-transgenic shoots regenerated from the callus which eventually died. Samples of the callus were tested by ELISA using an anti-PLRV CP antibody and a positive reaction was obtained. It is possible that the growing callus was transgenic and the stress caused by accumulating PLRV inhibited callus growth and shoot regeneration. By using the methods described in this paper, it has been possible to transform cv. Maris Piper using other transformation vectors (H. Barker, unpublished results).
Transformation of the PLRV-resistant Solanum tuberosum clone G8107(1) produced vigorously growing callus from which sixteen independent regenerating shoots were removed and micropropagated in vitro. Five lines (BF10, BF16, BF17, BF19 and BF21) were found to contain PLRV (determined by ELISA of the initially transformed plantlets), and DNA extracts from these lines yielded a specific product when assayed by PCR using primers that annealed to the readthrough region of the CP gene. PLRV could not be detected in other plantlets and PCR tests on DNA extracted from these plants did not yield a product.
Tests for agroinfection as the source of PLRV in transgenic lines
Some of the transformed tobacco plants (T0 generation) contained substantial amounts of PLRV, although they were not transgenic and their subsequent seed generations (T1) did not accumulate PLRV. It was assumed that such plants had become infected by `agroinfection' during tissue culture but that infection had not been passed to the seed generation, in contrast to the situation with transgenic lines AW3 and AW14. Because the transformed potato plants were propagated clonally and not through seed, it was possible that PLRV accumulating in transformed potato plants was, at least in part, the result of agroinfection during the process of tissue culture. To test this, in vitro plantlets were `heat-treated' by incubation for periods of 4 h at 39 °C alternating with 4 h at 20 °C. Such thermotherapy treatment of PLRV-infected non-transgenic plantlets for 25 days, freed them of PLRV infection. However, plants of lines BF10, BF16, BF17, BF19 and BF21 still contained high concentrations of PLRV following thermotherapy treatment for 54 days. These lines were transferred to the glasshouse for further propagation. BF10, BF16, BF19 and BF21 produced a few tubers that were stored for approximately 6 months at 4 °C before planting to produce the progeny plants on which most tests were made.
Symptom development in transgenic tobacco and potato
Transgenic plants of AW3 and AW14 tobacco were indistinguishable from either virus-free or PLRV-infected WT plants (symptomless in our glasshouse conditions). In the glasshouse, plants of BF lines grown from tubers initially did not look much different from PLRV-infected WT plants of G8107(1), which do not show characteristic `leafroll' symptoms of PLRV infection. However, as plants aged, most leaves of BF plants, except those at the top of the stem, became necrotic and died prematurely and plants became severely stunted in comparison to infected WT plants of G8107(1), which continued to grow without showing symptoms. BF plants remained severely stunted throughout their lives and produced a few small tubers. In vitro transgenic BF plantlets grew more slowly than the non-transgenic WT controls, but otherwise were indistinguishable and showed no visible symptoms.
Expression of the PLRV transgene
Tobacco.
T1 plants of lines AW3 and AW14 were assayed by ELISA to determine the amounts of PLRV antigen in young, fully expanded leaves. Plants used for these tests were tested by PCR prior to ELISA and no non-transgenic segregants were found. For ELISA, plants were sampled approximately 10 weeks after sowing. Of 20 plants of each line, 15 of AW3 and 16 of AW14 contained PLRV antigen. Virus was not detected in further tests on the virus-free transgenic plants after an additional 2 weeks. The concentration of PLRV in plants that contained detectable antigen varied greatly among plants of the same line. Thus, plants of AW3 with the highest concentration of antigen contained 12-fold more than the plant with the lowest concentration and, in line AW14, the difference was 18-fold (Fig. 1). The test on 12-week-old plants gave very similar results (data not shown).
|
|
|
Analysis of PLRV-specific RNA
Northern blots of RNA extracted from PLRV-infected plants of AW3 were similar to blots of RNA from PLRV-infected WT plants; two bands were detected, one of 6 kb (genomic RNA) and one of 2·5 kb (sub-genomic RNA). In general, relatively low amounts of PLRV-specific RNA could be extracted from tobacco compared with infected WT potato. Transgenic AW3 plants in which PLRV-CP could not be detected by ELISA or immunoblotting did not contain detectable PLRV RNA. RNA extracted from an AW3 transgenic plant in which PLRV-CP was detected, and from a WT PLRV-infected tobacco plant, was separated into poly(A)+ and poly(A)- fractions and tested in RNA dot blots by hybridization with the CP probe. Only the poly(A)- RNA from infected WT plants hybridized with the probe, whereas both fractions of RNA from the AW3 plant hybridized strongly with the probe (data not presented). Presumably the AW3 RNA extracts contained polyadenylated RNA transcripts of the PLRV cDNA in the AW3 genome.
PLRV in isolated tobacco protoplasts
Mesophyll protoplasts were isolated from leaves of PLRV-infected AW3 tobacco plants and from infected WT plants, and analysed for their PLRV antigen and RNA contents by ELISA or Northern blotting. In eight tests, no PLRV was detected in protoplasts extracted from infected WT plants; in one test the protoplast sample contained 81 ng virus/106 protoplasts. In contrast, virus was detected in all nine preparations of protoplasts from leaves of transgenic tobacco plants at levels in the range 36220 ng virus/106 protoplasts. Genomic and sub-genomic PLRV RNAs were readily detected by Northern blotting in RNA extracted from transgenic mesophyll protoplasts or in RNA from leaves similar to those from which the protoplasts were prepared. No PLRV-specific RNA was found in mesophyll protoplasts prepared from infected WT tobacco plants.
Location of PLRV by tissue printing
Tissue prints of leaves and stems were made to assess the number and distribution of cells containing PLRV. Stained foci of indoxyl precipitate were identified in prints from transgenic and infected WT plants, but were not seen in any of the prints made from virus-free plants. It was assumed that the stained foci indicated the location of infected cells, although we cannot exclude the possibility that some infected cells contained insufficient PLRV to be detected by staining.
Tobacco.
Tissue prints of stem sections showed that the majority of phloem cells in AW3 transgenic and infected WT plants were unstained, and thus that relatively few cells were infected (estimated to be less than 5% of the phloem companion cells) (Fig. 2b, c
, d
). In approximately 25 sections from each of AW3 and infected WT plants, means of 16 and 26 infected cells per section, respectively, were observed. A few infected cells were also observed in epidermal tissue of stem sections from some AW3 transgenic plants (a mean of about one cell per section), but PLRV was never detected in epidermal cells from infected WT tobacco plants (Fig. 2d
vs b
).
|
Potato.
Tissue prints were made of stem and leaf tissue from plants of the BF lines, and PLRV-infected WT Maris Piper and clone G8107(1). Far fewer infected phloem cells were found in stem tissue of infected plants of clone G8107(1) and infected cells were largely restricted to the internal phloem bundles in comparison with Maris Piper plants in which many infected cells were found in the internal and external phloem (Table 3; Fig. 3a
vs c
). Derrick & Barker (1997)
found a similar distribution of infected phloem cells in potato clones that differed in susceptibility to PLRV accumulation, and suggested that a characteristic of PLRV-resistant clones [such as G8107(1)] was that infection was restricted in cells of the external phloem bundles. When the numbers of stained foci in plants of BF lines and G8107(1) plants were compared, there were more infected cells in the external phloem of the BF clones than in G8107(1) (Table 3
). However, a more notable difference was that infected cells were detected in stem epidermis of transgenic BF lines, but not in the infected WT Maris Piper and G8107(1) plants (Table 3
; Fig. 3a
, c
). Many infected cells were observed in mesophyll of transgenic BF plants, although these were often distributed in clusters (Fig. 3d
). Thus, in many of the prints examined, the number of stained cells was low, but occasionally leaf areas with large amounts of stained foci were observed near areas with few stained cells (Fig. 3d
).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The PLRV-infected transgenic T1 tobacco plants were symptomless, as were naturally infected WT tobacco plants. Likewise, symptoms did not develop on infected WT G8107(1) potato plants, but plants of the transgenic BF lines were very severely stunted, died prematurely and produced very few small tubers. Relatively little PLRV accumulated in infected WT tobacco and G8107(1) potato plants, both being poor hosts for PLRV when inoculated by using viruliferous aphids. A major difference between the transgenic tobacco and potato lines was that although PLRV contents of transgenic AW3 tobacco plants were similar to, or less than, those in infected WT tobacco, considerably more PLRV accumulated in leaf tissue of transgenic BF potato plants than in infected WT G8107(1) plants. Thus, plants of our BF lines resemble those of Prüfer et al. (1997) whose potato plants transformed with a full-length PLRV genome contained much higher levels of viral RNAs and protein, and had a reduced lifespan. We were not able to transform the susceptible potato cv. Maris Piper, and it seems possible that we were able to obtain the BF lines only because the parental clone G8107(1) has a high level of resistance to PLRV accumulation (Barker & Woodford, 1992
).
Stem tissue prints of transgenic and infected WT tobacco and G8107(1) potato plants, showed that less than 5% of the available phloem companion cells in stem tissue were infected. The major difference between transgenic plants and infected WT plants was that in transgenic tissue, PLRV-infected cells were in tissues other than the phloem. Thus, many infected cells were found in the stem epidermis of transgenic potato plants although there were rather fewer in tobacco plants. Moreover, in transgenic tobacco plants, PLRV was also found in a few mesophyll cells, although such cells were infrequent (approximately 1 in 40000). In transgenic potato, a greater proportion of mesophyll cells was infected, although these had an irregular distribution with some areas containing many and other areas containing relatively few.
On average, more PLRV accumulated in AW3 plants than in AW14 plants, although PLRV could not be detected in about 25% of transgenic AW3 or AW14 plants. Further studies are required to reveal why the accumulation of PLRV differs so much between lines and individual plants. The 25% of transgenic plants that were consistently virus-free contained no PLRV genomic and sub-genomic RNA. It is possible that such plants do contain PLRV but in such low amounts that it cannot be detected, or that the amount of transcribed RNA from the PLRV transgene is insufficient to initiate infection. The reason such transgenic plants do not become infected is being investigated.
Although all cells of plants transformed with full-length PLRV cDNA should produce infective PLRV RNA, only a very small proportion of cells accumulated detectable amounts of virus. Transgenic tobacco and potato differed in that much more PLRV accumulated in transgenic potato than in equivalent infected non-transgenic plants, but in transgenic and infected tobacco plants the amounts of PLRV were similar. Nevertheless, the majority of cells in transgenic plants did not accumulate PLRV, which suggests that they were expressing some form of resistance to the establishment of infection. The difference between hosts may reflect a differential resistance effect, and further study of this may be of value in work on transgene or host gene-mediated resistance.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Angell, S. M. & Baulcombe, D. C. (1997). Consistent gene silencing in transgenic plants expressing a replicating potato virus X RNA. EMBO Journal 16, 3675-3684 .
Atabekov, J. G., Taliansky, M. E., Drampyan, A. H., Kaplan, I. B. & Turka, I. E. (1984). Systemic infection by a phloem- restricted virus in parenchyma cells in mixed infection. Biologicheskie Nauki 10, 2831 (in Russian).
Barker, H. (1987). Invasion of non-phloem tissue in Nicotiana clevelandii by potato leafroll luteovirus is enhanced in plants also infected with potato Y potyvirus. Journal of General Virology 68, 1223-1227 .
Barker, H. & Harrison, B. D. (1985). Restricted multiplication of potato leafroll virus in resistant potato genotypes. Annals of Applied Biology 107, 205-212.
Barker, H. & Solomon, R. M. (1990). Evidence of simple genetic control in potato of ability to restrict potato leaf roll virus concentration in leaves. Theoretical and Applied Genetics 80, 188-192.
Barker, H. & Woodford, J. A. T. (1992). Spread of potato leafroll virus is decreased from plants of potato clones in which virus accumulation is restricted. Annals of Applied Biology, 121, 345-354.
Barker, H. , Reavy, B. , Kumar, A. , Webster, K. D. & Mayo, M. A. (1992). Restricted virus multiplication in potatoes transformed with the coat protein gene of potato leafroll luteovirus: similarities with a type of host gene- mediated resistance. Annals of Applied Biology, 120, 55-64.
Barker, H. , Reavy, B. , Webster, K. D. , Jolly, C. A. , Kumar, A. & Mayo, M. A. (1993). Relationship between transcript production and virus resistance in transgenic tobacco expressing the potato leafroll virus coat protein gene. Plant Cell Reports 13, 54-58.
Bevan, M. (1984). Binary Agrobacterium vectors for plant transformation. Nucleic Acids Research 12, 8711-8721 .[Abstract]
Derrick, P. M. & Barker, H. (1997). Short and long distance spread of potato leafroll luteovirus: effects of host genes and transgenes conferring resistance to virus accumulation in potato. Journal of General Virology 78, 243-251.[Abstract]
Kaido, M. , Mori, M. , Mise, K. , Okuno, T. & Furusawa, I. (1995). Inhibition of brome mosaic virus (BMV) amplification in protoplasts from transgenic tobacco plants expressing replicable BMV RNAs. Journal of General Virology 76, 2827-2833 .[Abstract]
Kawchuk, L. M. , Martin, R. R. , Rochon, D. M. & McPherson, J. (1989). Identification and characterization of the potato leafroll virus putative coat protein gene. Journal of General Virology 70, 783-788.[Abstract]
Keese, P. , Martin, R. R. , Kawchuk, L. M. , Waterhouse, P. M. & Gerlach, W. L. (1990). Nucleotide sequences of an Australian and a Canadian isolate of potato leafroll luteovirus and their relationships with two European isolates. Journal of General Virology 71, 719-724.[Abstract]
Kubo, S. , Harrison, B. D. , Robinson, D. J. & Mayo, M. A. (1975). Tobacco rattle virus in tobacco mesophyll protoplasts: infection and virus multiplication. Journal of General Virology 27, 293-304.[Abstract]
Kunkel, T. A. , Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-382.[Medline]
Leiser, R.-M. , Ziegler-Graff, V. , Reutenauer, A. , Herrbach, E. , Lemaire, O. , Guilley, H. , Richards, K. & Jonard, G. (1992). Agro-infection as an alternative to insects for infecting plants with beet western yellows luteovirus. Proceedings of the National Academy of Sciences, USA 89, 9136-9140 .[Abstract]
Mayo, M. A. & Ziegler-Graff, V. (1996). Molecular biology of luteoviruses. Advances in Virus Research 46, 416-468.
Mayo, M. A. , Robinson, D. J. , Jolly, C. A. & Hyman, L. (1989). Nucleotide sequence of potato leafroll luteovirus RNA. Journal of General Virology 70, 1037-1051 .[Abstract]
Murphy, G. & Kavanagh, T. (1988). Speeding-up the sequencing of double-stranded DNA. Nucleic Acids Research 16, 5198.[Medline]
Mutterer, J. D., Ziegler-Graff, V. & Richards, K. E. (1999). Agro-infection as a means of transmitting luteoviruses to host plants for study of genome function. In The Luteoviridae, chapter 4.Edited by H. G. Smith & H. Barker. Wallingford: CAB International (in press).
Naidu, R. A. , Mayo, M. A. , Reddy, S. V. , Jolly, C. A. & Torrance, L. (1997). Diversity among the coat proteins of luteoviruses associated with chickpea stunt disease in India. Annals of Applied Biology 130, 37-47.
Prüfer, D. , Schmitz, J. , Tacke, E. , Kull, B. & Rohde, W. (1997). In vivo expression of a full- length cDNA copy of potato leafroll virus (PLRV) in protoplasts and transgenic plants. Molecular and General Genetics 253, 609-614.[Medline]
Reavy, B. , Sandgren, M. , Barker, H. , Heino, P. & Oxelfelt, P. (1997). A coat protein transgene from a Scottish isolate of potato mop-top virus mediates strong resistance against Scandinavian isolates which have similar coat protein genes. European Journal of Plant Pathology 103, 829-834.
Roberts, I. M. (1986). Practical aspects of handling, preparing and staining samples containing plant virus particles for electron microscopy. In Developments and Applications in Virus Testing , pp. 213-243. Edited by R. A. C. Jones & L. Torrance. Wellesbourne: Association of Applied Biologists.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Schmitz, J. , Stussi-Garaud, C. , Tacke, E. , Prüfer, D. , Rohde, W. & Rohfritsch, O. (1997). In situ localization of the putative movement protein (pr17) from potato leafroll luteovirus (PLRV) in infected and transgenic potato plants. Virology 235, 311-322.[Medline]
Töpfer, R. , Matzeit, V. , Gronenborn, B. , Schell, J. & Steinbiss, H. H. (1987). A set of plant expression vectors for transcriptional and translational fusions. Nucleic Acids Research 15, 5890.[Medline]
Waterhouse, P. M., Gildow, F. E. & Johnstone G. R. (1988). Luteovirus group. AAB Descriptions of Plant Viruses no. 339, pp. 9. Wellesbourne: Association of Applied Biologists.
Webster, K. D. & Barker, H. (1998). Detection and quantification of transcript RNA in transgenic plants using digoxigenin-labelled cDNA probes. In Plant Virology Protocols: From Virus Isolation to Transgenic Resistance, Methods in Molecular Biology Series , pp. 437-445. Edited by G. D. Foster & S. Taylor. Totowa, NJ: Humana Press.
Wisniewski, L. A. , Powell, P. A. , Nelson, R. S. & Beachy, R. N. (1990). Local and systemic spread of tobacco mosaic virus in transgenic tobacco. Plant Cell 2, 559-567.
Yamaya, J. , Yoshioka, M. , Meshi, T. , Okada, Y. & Ohno, T. (1988). Expression of tobacco mosaic virus RNA in transgenic plants. Molecular and General Genetics 211, 520-525.[Medline]
Received 5 July 1999;
accepted 4 August 1999.