Department of Genetics and Microbiology, Charles University in Prague, Vininá 5, 128 44 Prague 2, Czech Republic1
Department of Virology, Royal Postgraduate Medical School, Hammersmith Hospital, London W12 0NN, UK2
Institute of Molecular Genetics, Czech Academy of Sciences, Flemingovo n. 2, 166 37 Prague 6, Czech Republic3
Author for correspondence: Jitka Forstová (at Charles University in Prague). Fax +42 02 2195 3286. e-mail jitkaf{at}natur.cuni.cz
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The minor capsid proteins are not essential for capsid formation and VP1 alone can self-assemble into capsid-like particles, the only requirement being the presence of Ca2+ ions (Leavitt et al., 1985 ; Montross et al., 1991
). VP1 has been shown to consist of several isoelectric species (Bolen et al., 1981
; Forstová et al., 1993
). Forstová et al. (1993) observed that, in the baculovirus system at least, coexpression of VP2 is necessary for synthesis of all post-translationally modified VP1 species.
Although VP2 and VP3 possess their own nuclear localization signals, they are presumed to be transported to the nucleus (where virion assembly occurs) in complex with VP1 (Forstová et al., 1993 ; Barouch & Harrison, 1994
). This is in agreement with observations that the coexpression of VP1 is needed for the stable nuclear location of VP2 and VP3 in heterologous expression systems (Stamatos et al., 1987
; Forstová et al., 1993
). In contrast, VP2 and VP3 of the closely related simian virus 40 (SV40) can reach the nucleus independently of VP1 (Clever & Kasamatsu, 1991
). SV40 minor proteins contain a C-terminal domain that includes a nuclear localization signal (Clever & Kasamatsu, 1991
) and the DNA binding domain (Clever et al., 1993
). Py VP2 and VP3, which do not bind DNA (Chang et al., 1993
), have truncated C-terminal domains relative to their SV40 counterparts.
No specific functions in the viral life cycle have yet been assigned to VP2 and VP3. However, mutants of SV40 with deletions in the VP2 unique sequence have severely reduced growth (Cole et al., 1977 ). Sahli et al. (1993)
selected revertants with wild-type (wt) properties during a study of Py mutants that failed to express either VP2 or VP3.
The VP2s of both Py and SV40 are N-terminally modified with myristic acid (Streuli & Griffin, 1987 ). With many other viruses, it has been shown that fatty acid acylation of structural proteins plays an essential role in their life cycles. Myristylation of VP4 is important for the assembly and structural stability of poliovirus (Marc et al., 1990
; Ansardi et al., 1992
; Moscufo & Chow, 1992
) and myristylation of the Gag polyprotein is necessary for lentivirus and retrovirus C type capsid formation and virion maturation (Rein et al., 1986
; Bryant & Ratner, 1990
). Myristylated capsid proteins can be involved in early stages of virus infection (interaction with receptors and entry) as shown, for example, for poliovirus and hepatitis B virus (Moscufo et al., 1993
; Gripon et al., 1995
). In general, fatty acid acylations of proteins serve as membrane targeting and anchoring signals. However, myristylation alone is not sufficient for the membrane location of modified proteins. An increasing number of recent studies points to a function of acylation (particularly myristylation) in the binding of modified proteins to specialized membrane domains. These domains could be sites where viral assembly occurs, as shown for poliovirus (Martín-Belmonte et al., 2000
).
Myristic acid is co-translationally bound by an N-myristyl transferase to an N-terminal glycine, the amino acid essential for this modification, after removal of the initiator methionine (reviewed by Johnson et al., 1994 ). Consensus sequences for myristylation have been found on the N terminus of the VP2 protein for all polyomaviruses. The function of this modification has been studied using myr- VP2 Py mutants with an altered N-terminal glycine. The absence of myristyl moiety on VP2 (mutant E, with glutamic acid replacing glycine) did not abolish the ability of mutated virus to infect mouse cells (Krauzewicz et al., 1990
). In another study, a lowered infectivity was observed with a mutant containing alanine substituted for glycine. This mutant apparently exhibited a delay in replication compared with wt (Sahli et al., 1993
).
To elucidate the function(s) of the myristic acid modification of VP2 and possible effects of an altered N terminus of VP2 during the polyomavirus life cycle, we created myr- VP2 mutants with different amino acids substituted for glycine. We also prepared mutants lacking either VP2 or VP3 in their virions. Mutants were prepared containing at least three nucleotide substitutions of wt sequences to limit the formation of revertants.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Swiss albino mouse fibroblasts 3T6 (ATCC CCL 96) were grown in Dulbeccos modified Eagles medium (DMEM) supplemented with 4 mM glutamine and 10% foetal calf serum (FCS) at 37 °C in 10% CO2. Primary cultures of whole mouse embryo (WME) cells were prepared as previously described (Hogan et al., 1994 ) and grown in DMEM with 10% FCS at 37 °C in 10% CO2.
The recombinant plasmid pMJG contains the complete sequence of wt polyomavirus strain A2, interrupted at the EcoRI site (position 1560, according to Griffin et al., 1981 ) and cloned into the EcoRI site of plasmid pMJ (Krauzewicz et al., 1990
). The recombinant plasmid pMJE (Krauzewicz et al., 1990
) contains the genome of polyomavirus strain A2, with a point mutation in the VP2 gene replacing the N-terminal GGA glycine codon with a GAA glutamic acid codon (mutated nucleotide 4998).
Construction of mutated polyomavirus genomes.
Plasmids pMJQ and pMJH were obtained from pMJG by replacing the BclIEcoRV fragment, comprising the N terminus of VP2, with a BclIEcoRV fragment prepared by PCR mutagenesis. Oligonucleotide primers 5' AGCTGATCAAGTAAGTGAATTTTCAAAATGCAGGCCGCA 3', introducing the substitution of the VP2 N-terminal glycine codon GGA by CAG (glutamine), and 5' AGCTGATCAAGTAAGTGAATTTTCAAAATGCATGCCGCA 3', with a histidine (CAT) codon, were used in the PCR reaction. In pMJH, a unique NsiI restriction site (ATGCAT) was created by the mutagenesis.
pMJM, with the ATG initiation codon for VP2 translation abolished, was prepared from pMJH by NsiI cleavage. Overlapping ends were blunt-ended and religated to produce a frame-shifted, three-codon-long open reading frame. pMJA was prepared by replacing the BclIBamHI fragment of pMJG with a PCR fragment where the GCA codon for alanine had been substituted for the ATG VP3 translation start codon using the PCR primer 5' GGGCTGGATCCCGCCATGGTATCAACGCTGCATTTC 3'.
Preparation of wt and mutant viruses.
Wt and mutant genomes were excised from their respective plasmids with EcoRI and the resultant linear fragments diluted to a concentration of 34 µg/ml and ligated. Ligated mixtures were transfected into 3T6 cells. Cells were incubated at room temperature with DEAE-dextran (1 mg/ml in DMEM). After 10 min, dextran was replaced with DNA in DMEM (400 ng of circular religated genome per 8x105 cells). DMEM with 10% FCS was added after a 15 min incubation at room temperature. Transfected cells were subcultured when they reached confluency. Cells were harvested after five passages, viruses isolated as described (Türler & Beard, 1985 ) and purified by centrifugation through a 20% sucrose cushion (25000 r.p.m., Beckman SW28 rotor, 3 h, 4 °C). Isolated mutants were designated A, M, H, E and Q according to the recombinant plasmids from which they originated. Particles were quantified by a haemagglutination test, as previously described (Türler & Beard, 1985
).
SDSPAGE and Western blot analysis.
Viral proteins were resolved on 12% SDSPAGE (Laemmli, 1970 ) and electrotransferred on to a nitrocellulose membrane in cooled blot buffer (0·3% Tris base, 1·44% glycine, 20%, v/v, methanol) at 2·5 mA/cm2 for 3 h. For large T (LT) antigen detection, blot buffer was supplemented with 0·1% SDS and the transfer carried out for 1 h. The filters were incubated in 5% fat-free milk in PBS and then with
VP1 (dilution 1:10) or
VP2/3-B (dilution 1:4) mouse monoclonal antibodies (Forstová et al., 1993
) or
LT 7 rat monoclonal antibody (Dilworth & Griffin, 1982
). Goat anti-mouse or goat anti-rat immunoglobulins conjugated with horseradish peroxidase (1:3000; Bio-Rad) were used as a secondary antibodies. Membranes were developed with ECL Chemiluminescent Reagent (Amersham) and exposed to X-ray film.
Labelling of viruses.
3T6 cells, infected with virus H, E, Q or wt, were labelled 30 h post-infection (p.i.) with [3H]myristic acid (54 Ci/mmol; Amersham) in DMEM with 10% FCS (100 µCi per 35 mm diameter dish). At 48 h p.i., cells were washed with PBS and lysed for 20 min by the addition of 100 µl/106 cells of ice-cold RIPA buffer (150 mM NaCl, 5 mM EDTA, 50 mM TrisHCl, pH 7·4, 0·05% NP-40, 1% deoxycholic acid, 1% Triton X-100, containing 0·2 trypsin-inhibiting units/ml aprotinin). Cell lysates were immunoprecipitated with VP2/3-A antibody as previously described (Forstová et al., 1993
) and products were analysed by SDSPAGE. The gels were fixed, signal-enhanced with Amplify (Amersham) and autoradiographed for 79 weeks at -70 °C.
Infection of cells.
3T6 cells (at 70 % confluency) were washed with DMEM and incubated with virus inoculum diluted in DMEM. Adsorption of virus was carried out for 1 h at 37 °C. DMEM with 10% FCS was added and cells were further incubated.
Immunofluorescence of cells.
3T6 cells grown on glass coverslips were fixed with methanol/acetone (1:1, v/v) for 3 min at room temperature. Cells were incubated for 30 min with PBS containing 0·25% gelatin and 0·25% BSA, and then for 1 h with VP1,
VP2/3-A or
LT antibody (diluted 1:10, 1:2 and non-diluted, respectively). Unbound antibody was removed by washing with PBS. A secondary anti-mouse or anti-rat FITC-conjugated antibody (Sevac), diluted 1:40, was added for 30 min and after washing with PBS, coverslips were mounted in 70% glycerol and observed with a fluorescence microscope.
Plaque assay.
Plaque assays were performed on WME cells according to Türler & Beard (1985) . Briefly, an equal number of haemagglutination units (HAU) of mutant or wt virus was adsorbed on WME cells by incubation for 90 min at 37 °C. After removal of unadsorbed virus, cells were overlaid with 0·9% Sea Plaque agarose (FMC) in DMEM with 10% FCS. Ten days p.i., living cells were stained with 0·01% neutral red and plaques were counted.
Replication assay.
3T6 cells were plated on 24-well dishes and infected with mutant or wt virus (5 HAU/5x104 cells). At indicated times p.i., cells were washed three times with PBS and harvested by lysis in 400 µl per well of lysis buffer (10 mM TrisHCl, pH 7·5, 5 mM EDTA, 0·5% SDS, 100 µg/ml RNase A). Samples were incubated with proteinase K (100 µg/ml) for 1 h at 50 °C and the DNA-containing solutions extracted with phenolchloroform. DNA was precipitated with ethanol, digested with EcoRI and resolved on 1% agarose gels. The DNA was transferred on to a nylon membrane (Zeta-Probe, Bio-Rad) by capillary transfer in 0·4 M NaOH, 0·6 M NaCl and hybridized with 32P-labelled Py genome probes in hybridization buffer [6x SSC, 0·1% SDS, 2x Denhardts solution (Maniatis et al., 1982 ), containing 100 µg/ml salmon sperm ssDNA] at 68 °C for 20 h. Washing was performed with 0·1x SSC, 1% SDS at 68 °C and membranes were exposed to X-ray film.
DNA content determination.
Aliquots of each virus (containing the same amount of VP1, as estimated by SDSPAGE) were diluted in TE (10 mM TrisHCl, pH 7·8, 1 mM EDTA) with 0·5% SDS and 100 µg/ml proteinase K. After incubation for 1 h at 50 °C, the DNA-containing solution was extracted with phenolchloroform and ethanol-precipitated. DNA samples were resolved on 1% agarose gels, transferred on to membranes (Zeta-Probe, Bio-Rad) and viral DNA was visualized by hybridization and autoradiography, as described above.
Separation of virions and capsids by CsCl density gradients was performed according to Krauzewicz et al. (1990) .
Cell fractionation.
In situ fractionation of infected 3T6 cells was performed as previously described (Staufenbiel & Deppert, 1984 ). Briefly, cells were washed with KM buffer (10 mM MES, pH 6·2, 10 mM NaCl, 1·5 mM MgCl2, 10 % glycerol, with 0·2 units/ml aprotinin) and sequentially extracted with buffer I (KM buffer plus 1% NP-40, 0·1 mM EGTA, 1 mM DTT), buffer II (KM buffer plus 50 µg/ml DNase I), buffer III (KM buffer plus 2 M NaCl, 0·1 mM EGTA, 1 mM DTT) and buffer IV (KM buffer plus 50 µg/ml DNase I, 50 µg/ml RNase A). The residual material was solubilized by 1% SDS in KM buffer. Aliquots of fractions were analysed by dot blot or SDSPAGE and the presence of VP1 was detected with
VP1 antibody.
Electron microscopy.
Infected 3T6 cells grown on coverslips were washed with SB buffer (freshly prepared 0·1 M Na2HPO4, 0·1 M KH2PO4, at a ratio of 7:3, v/v, pH 7·27·4) and fixed with 3% paraformaldehyde, 0·1% glutaraldehyde in SB buffer at 4 °C for 2050 min. Fixed cells were washed with SB buffer and dehydrated with increasing concentrations of ethanol on ice. Samples were flat-embedded into LR White resin (Polysciences Inc.). Ultrathin sections (60 nm) were mounted on grids, contrasted with uranyl acetate and Reynolds citrate and examined with a JEOL 1200 EX electron microscope.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
In initial experiments, the same number of HAU of mutants or wt were used to follow the time-course of infection during the interval of the first life cycle. The expression of LT antigen was detected by Western blot and by indirect fluorescence (Fig. 2A, B
). No delay in LT antigen expression in E and Q mutant-infected cells relative to wt was observed. Nuclei staining positive for LT appeared at 10 h p.i. and the number of positively stained cells increased equally in mutant- and wt-infected cells (evaluated up to 23 h p.i.). The number of LT-positive cells (and the signal on Western blots) was substantially lower for the H mutant. The number of cells staining positive for VP1 was followed over 48 h. Levels were similar for mutants E and Q and wt, but substantially lower for mutant H (Fig. 3A
). No significant change in location and intensity of staining of late antigens was observed when
VP1 or
VP2/3-A antibodies were used (not shown).
|
|
Mutants M (VP2-) and A (VP3-) were both able to infect 3T6 cells, albeit with very low efficiency (Fig. 3C). Although the number of cells infected with mutant A was one order lower and mutant M two orders lower than wt, immunofluorescent staining throughout the 48 h time-course showed that, in infected cells, the level of viral antigens was not substantially affected by the absence of VP2 or VP3.
Thus, absence of VP2 or VP3 in mutated virions was already apparent during the first life cycle, while the lack of a myristyl moiety on VP2 did not affect the number of infected cells until the reinfection stage. To investigate whether the lack of a virus burst using myr- mutants was due to lower numbers of infectious viral particles being produced in cells infected with mutated viruses, equal HAU of mutant E and wt virus were used for infections. Infected cells were harvested 48 h p.i. and viruses isolated. Equal aliquots of isolated wt and mutant viruses were used for the subsequent infection. Although the number of VP1-positive cells was comparable during the first infection, approximately half the number of stained cells for mutant E were obtained after the second infection compared with wt, indicating that fewer infectious particles were assembled during the previous life cycle (Fig. 3D).
The infectivity of mutated virions was also assessed by plaque assay on WME cells. Under conditions when plaques of wt infected cells were clearly formed, mutants A, M and H did not form visible plaques. The concentrations of viral particles needed to produce plaques in numbers comparable to wt were 400 times higher for the mutant E virus and approximately 28 times higher for the mutant Q virus (Table 1B). Mutant plaques were heterogeneous in size, only some of them reaching the size of wt plaques. When plaque assays were carried out on 3T6 fibroblasts, only wt plaques developed properly. No plaques were found with mutant H, and plaques from E and Q mutants were not sufficiently defined to be counted on 3T6 cells. The data were consistent with defects in the E and Q viruses being compensated for in epithelial cells in WME cultures, but not in fibroblasts.
Replication assay
To investigate further the different growth properties of the mutants, replication of viral DNA was studied during a 48 h life cycle. 3T6 cells were infected and DNA isolated as described in Methods. Fig. 4(A) demonstrates that the replication courses of wt and mutant genomes E and Q were comparable. Neither a time delay in the replication start nor significant quantitative differences were observed. Parallel detection of VP1 in lysates (Fig. 4B
) showed that synthesis of VP1 followed DNA replication and no significant differences were observed between wt and mutants E and Q.
|
Electron microscopy studies
To find out whether there were differences between mutants and wt virus in their interactions with subcellular structures, electron microscopy (EM) studies were carried out. The data showed that cells successfully infected with mutant viruses exhibited no differences when compared with wt. New viral particles appeared in the nuclei in similar distinct patches under the nuclear membrane and in the proximity of nucleoli (Fig. 5A). Lysis of infected cells at 60 h p.i. and the release of virions could also be seen in both mutant- and wt-infected cells. At this time p.i., we could also see the adsorption of released viral particles and their internalization into monopinocytic vesicles in surrounding non-infected cells (Fig. 5B
). Thus, EM revealed no qualitative morphological differences between mutant and wt viruses.
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In our studies, three different myr- mutants were studied. In addition to the previously described mutant E, where the N-terminal glycine of VP2 was replaced by glutamic acid (E), we also exchanged glycine with neutral glutamine (Q) and basic histidine (H). In plaque assays performed on WME cells, we observed a decreasing infectivity in the order wt Q
E and no plaques were formed with the H mutant, suggesting that not only the absence of the myristyl modification but also the character of the N terminus of VP2 influenced its properties.
The specific infectivity (as measured by plaque assays) of mutant Q was in general agreement, although slightly reduced, with observations on the alanine mutant described by Sahli et al. (1993) , but neither mutant Q nor E exhibited an early step defect described for the alanine mutant. Particles of myr- mutants were internalized efficiently in vesicles morphologically indistinguishable from those used by wt particles. Comparable courses of the first cycle of infection, as estimated by immunofluorescent staining of VP1, demonstrated the ability of myr- mutants to enter and infect the cell with the same efficiency as wt Py. We also observed no delay in the appearance of the early gene product, the large T antigen, nor any significant quantitative differences in the course of replication among the mutant E and Q and the wt genomes. In lysates of cells infected with mutant H and in isolated H virions, only very low quantities of VP2 were detected, possibly explaining why the H mutant had a phenotype more similar to that of the VP2- mutant M. A defect of the H mutant (as well as M and A mutants) consists apparently in the very low efficiency of the delivery of viral genomes into cell nuclei, i.e. in the early steps of viral infection. In a few cells, where genomes reached the cell nucleus, further development of viral progeny appeared not to be substantially affected as immunofluorescent staining of LT (Fig. 2B
) or VP1 (not shown) and the appearance of virion progeny in the nucleus (Fig. 5A
) were comparable with those of wt Py. At present, we cannot distinguish between the possibilities that mutation to H affects the stability of the VP2 gene transcript or its translation product, since basic amino acids on the N terminus can assign a protein for degradation via a ubiquitin pathway (Bachmair et al., 1986
).
The major loss of infectivity and the absence of a significant CPE during long-term infection of 3T6 cells by myr- mutants suggested a defect at a late stage of the viral life cycle, during virion assembly or successful reinfection of the surrounding cells by viral progeny. However, the results presented on Fig. 3(D) showed that a slightly (half) lower yield of viral particles per infected cell was achieved with myr- mutants as compared with wt virus. On the other hand, the ratio of capsids and virions obtained proved to be similar. Electron microscopic studies showed that 3T6 cells that were successfully infected with myr- mutants finally lysed, releasing viral progeny. A poor reinfection by mutated viruses could more probably be explained by their altered interactions with host cell structures. In situ fractionation of wt Py-infected cells demonstrated that newly assembled virions were concentrated at the nuclear matrix and subsequently also appeared in chromatin and NP-40-soluble fractions. The absence of VP1 signals from myr- mutants in NP-40-soluble material on dot blots with native structures versus its presence on Western blots after SDS treatment suggests that the antibody epitopes of mutated viruses (in the reactive DE loop of VP1) and possibly other virion surface substructures might be masked due to altered interactions with host cell structures (apparently caused by an altered surface conformation of mutated virions). No such effects were observed with wt-infected cells. In agreement with this, Krauzewicz et al. (1990)
observed slightly changed mutant E virion shapes by electron microscopy. Together with the finding that cells infected with myr- mutant E produce slightly lower amounts of infectious viral particles than cells infected with wt virus, fewer virions may thus be available for reinfection. Moreover, inappropriate complexes of newly created virions with cell structures might affect the specificity of cell-surface interactions during reinfection events and direct entering particles to a non-productive route. Productive and non-productive routes of viral particle movement in cells have been recently suggested (Krauzewicz et al., 2000
).
In contrast to myr- mutants, mutants lacking either VP2 (mutant M and mutant H also exhibiting VP2 deficiency) or VP3 (mutant A) exhibited defects even during the early stages of viral infections. The adsorption and uptake of mutated virions through monopinocytic vesicles proceeded efficiently, as observed by electron microscopy of cell sections (not shown). Although receptor-interacting epitopes lie within the VP1 molecule (Stehle et al., 1994 ) and even recombinant capsid-like particles, composed of VP1 only, are able to enter 3T6 cells (Forstová et al., 1995
; Richterová et al., 2001
), the specificity of entry and further fate of mutant particles could be affected by the absence of the minor capsid proteins. An et al. (1999)
found that recombinant particles composed of both VP1 and VP2 were the most effective competitors of wt infection. This is in agreement with our finding that viruses lacking VP2 were substantially less infectious than those lacking VP3. Coexpression of VP2 is needed for the proper phosphorylation of VP1, at least in a heterologous system (Forstová et al., 1993
; Li et al., 1995
). The unique N-terminal part of VP2 (and not the myristic acid moiety) was found to be involved in mediating phosphorylation of a threonine residue occurring in the BC loop of VP1. Others have suggested a role for this modification in virus attachment and entry (Li et al., 1995
).
The lesion in mutants lacking minor capsid proteins could also affect later sorting and uncoating processes. Incoming SV40, as well as Py and polyoma VP1 capsid-like particles, accumulate in the endoplasmic reticulum (Pelkmans et al., 2001 ; Richterová et al., 2001
) but where and how uncoating of polyomaviruses is carried out remains to be determined.
When considered altogether, myristylation of Py VP2 did not appear obligatory for any particular infection step. With myr- mutants, no step was totally abolished. The myristyl moiety appeared to have a role in the fine-tuning of VP2 functions, possibly by maintaining a biologically active virion surface conformation. Its absence resulted in slightly changed interactions with cell structures and a concomitant decrease in virus progeny production. These effects accumulated during repeated reinfections. On the other hand, the expression of both minor capsid proteins and their presence in viral particles were essential for viral infectivity. The total absence of either VP2 or VP3 in virions was manifested even in early stages of infection, suggesting additional distinct functions for polyomavirus minor capsid proteins.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
c Present address: Viral Oncology Unit, Division of Medicine, Imperial College School of Medicine at St Mary's, London W2 1PG, UK.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ansardi, D. C., Porter, D. C. & Morrow, C. D. (1992). Myristylation of poliovirus capsid precursor P1 is required for assembly of subviral particles. Journal of Virology 66, 4556-4563.[Abstract]
Bachmair, A., Finley, D. & Varshavsky, A. (1986). In vivo half-life of a protein is a function of its amino-terminal residue. Science 234, 179-186.[Medline]
Barouch, D. H. & Harrison, S. C. (1994). Interactions among the major and minor coat proteins of polyomavirus. Journal of Virology 68, 3982-3989.[Abstract]
Bolen, J. B., Anders, D. G., Trempy, J. & Consigli, R. A. (1981). Differences in the subpopulations of the structural proteins of polyoma virions and capsids: biological functions of the multiple VP1 species. Journal of Virology 37, 80-91.[Medline]
Bryant, M. & Ratner, L. (1990). Myristoylation-dependent replication and assembly of human immunodeficiency virus 1. Proceedings of the National Academy of Sciences, USA 87, 523-527.[Abstract]
Chang, D., Cai, X. & Consigli, R. A. (1993). Characterization of the DNA binding properties of polyomavirus capsid proteins. Journal of Virology 67, 6327-6331.[Abstract]
Clever, J. & Kasamatsu, H. (1991). Simian virus 40 Vp2/3 small structural proteins harbor their own nuclear transport signal. Virology 181, 78-90.[Medline]
Clever, J., Dean, D. A. & Kasamatsu, H. (1993). Identification of a DNA binding domain in simian virus 40 capsid proteins Vp2 and Vp3. Journal of Biological Chemistry 268, 20877-20883.
Cole, C. N., Landers, T., Goff, S. P., Manteuil-Brutlag, S. & Berg, P. (1977). Physical and genetic characterization of deletion mutants of simian virus 40 constructed in vitro. Journal of Virology 24, 277-294.[Medline]
Dilworth, S. M. & Griffin, B. E. (1982). Monoclonal antibodies against polyoma virus tumor antigens. Proceedings of the National Academy of Sciences, USA 79, 1059-1063.[Abstract]
Forstová, J., Krauzewicz, N., Wallace, S., Street, A. J., Dilworth, S. M., Beard, S. & Griffin, B. E. (1993). Cooperation of structural proteins during late events in the life cycle of polyomavirus. Journal of Virology 67, 1405-1413.[Abstract]
Forstová, J., Krauzewicz, N., Sandig, V., Elliott, J., Palková, Z., Strauss, M. & Griffin, B. E. (1995). Polyoma virus pseudocapsids as efficient carriers of heterologous DNA into mammalian cells. Human Gene Therapy 6, 297-306.[Medline]
Griffin, B. E., Soeda, E., Barrell, B. G. & Staden, R. (1981). Sequence and analysis of polyoma virus DNA. In DNA Tumor Viruses , pp. 843-910. Edited by J. Tooze. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Griffith, G. R. & Consigli, R. A. (1984). Isolation and characterization of monopinocytotic vesicles containing polyomavirus from the cytoplasm of infected mouse kidney cells. Journal of Virology 50, 77-85.[Medline]
Gripon, P., Le Seyec, J., Rumin, S. & Guguen-Guillouzo, C. (1995). Myristylation of the hepatitis B virus large surface protein is essential for viral infectivity. Virology 213, 292-299.[Medline]
Hogan, B., Beddington, R., Costantini, F. & Lacy, E. E. (1994). Manipulating the Mouse Embryo: Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Johnson, D. R., Bhatnagar, R. S., Knoll, L. J. & Gordon, J. I. (1994). Genetic and biochemical studies of protein N-myristoylation. Annual Review of Biochemistry 63, 869-914.[Medline]
Krauzewicz, N., Streuli, C. H., Stuart-Smith, N., Jones, M. D., Wallace, S. & Griffin, B. E. (1990). Myristylated polyomavirus VP2: role in the life cycle of the virus. Journal of Virology 64, 4414-4420.[Medline]
Krauzewicz, N., tokrová, J., Jenkins, C., Elliott, M., Higgins, C. F. & Griffin, B. E. (2000). Virus-like gene transfer into cells mediated by polyoma virus pseudocapsids. Gene Therapy 7, 2122-2131.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Leavitt, A. D., Roberts, T. M. & Garcea, R. L. (1985). Polyoma virus major capsid protein, VP1: purification after high level expression in Escherichia coli. Journal of Biological Chemistry 260, 12803-12809.
Li, M., Delos, S. E., Montross, L. & Garcea, R. L. (1995). Polyomavirus VP1 phosphorylation: coexpression with the VP2 capsid protein modulates VP1 phosphorylation in Sf9 insect cells. Proceedings of the National Academy of Sciences, USA 92, 5992-5996.
Lin, W., Hata, T. & Kasamatsu, H. (1984). Subcellular distribution of viral structural proteins during simian virus 40 infection. Journal of Virology 50, 363-371.[Medline]
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Marc, D., Masson, G., Girard, M. & van der Werf, S. (1990). Lack of myristoylation of poliovirus capsid polypeptide VP0 prevents the formation of virions or results in the assembly of noninfectious virus particles. Journal of Virology 64, 4099-4107.[Medline]
Martín-Belmonte, F., López-Guerrero, J. A., Carrasco, L. & Alonso, M. A. (2000). The amino-terminal nine amino acid sequence of poliovirus capsid VP4 protein is sufficient to confer N-myristoylation and targeting to detergent-insoluble membranes. Biochemistry 39, 1083-1090.[Medline]
Montross, L., Watkins, S., Moreland, R. B., Mamon, H., Caspar, D. L. D. & Garcea, R. L. (1991). Nuclear assembly of polyomavirus capsids in insect cells expressing the major capsid protein VP1. Journal of Virology 65, 4991-4998.[Medline]
Moscufo, N. & Chow, M. (1992). Myristatprotein interactions in poliovirus: interactions of VP4 threonine 28 contribute to the structural conformation of assembly intermediates and the stability of assembled virions. Journal of Virology 66, 6849-6857.[Abstract]
Moscufo, N., Gomez Yafal, A., Rogowe, A., Hogle, J. & Chow, M. (1993). A mutation in VP4 defines a new step in the late stages of cell entry by poliovirus. Journal of Virology 67, 5075-5078.[Abstract]
Pelkmans, L., Kartenbeck, J. & Helenius, A. (2001). Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular-transport pathway to the ER. Nature Cell Biology 5, 473-483.
Rein, A., McClure, M. R., Rice, N. R., Luftig, R. B. & Schultz, A. M. (1986). Myristylation site in Pr65gag is essential for virus particle formation by Moloney murine leukemia virus. Proceedings of the National Academy of Sciences, USA 83, 7246-7250.[Abstract]
Richterová, Z., Liebl, D., Horák, M., Palková, Z., tokrová, J., Hozák, P., Korb, J. & Forstová, J. (2001). Caveolae are involved in the trafficking of mouse polyoma virions and artificial VP1 pseudocapsids towards cell nuclei. Journal of Virology 75, 10880-10891.
Sahli, R., Freund, R., Dubensky, T., Garcea, R., Bronson, R. & Benjamin, T. (1993). Defect in entry and altered pathogenicity of a polyoma virus mutant blocked in VP2 myristylation. Virology 192, 142-153.[Medline]
Stamatos, N. M., Chakrabarti, S., Moss, B. & Hare, J. D. (1987). Expression of polyomavirus virion proteins by a vaccinia virus vector: association of VP1 and VP2 with the nuclear framework. Journal of Virology 61, 516-525.[Medline]
Staufenbiel, M. & Deppert, W. (1984). Preparation of nuclear matrices from cultured cells: subfractionation of nuclei in situ. Journal of Cell Biology 98, 1886-1894.[Abstract]
Stehle, T., Yan, Y., Benjamin, T. L. & Harrison, S. C. (1994). Structure of murine polyomavirus complexed with an oligosaccharide receptor fragment. Nature 369, 160-163.[Medline]
Streuli, C. H. & Griffin, B. E. (1987). Myristic acid is coupled to a structural protein of polyoma virus and SV40. Nature 326, 619-621.[Medline]
Türler, H. & Beard, P. (1985). Simian virus 40 and polyoma virus: growth, titration, transformation and purification of viral components. In Virology. A Practical Approach , pp. 169-192. Edited by B. W. J. Mahy. Oxford: IRL Press.
Yanisch-Perron, C., Vieira, J. & Messing, J. (1985). Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33, 103-119.[Medline]
Received 21 February 2002;
accepted 5 April 2002.