Department of Biochemistry, School of Medical Sciences, University of Bristol, University Walk, Bristol BS8 1TD, UK1
Author for correspondence: Kevin Gaston.Fax +44 117 928 8274. e-mail Kevin.Gaston{at}Bristol.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The HPV-16 LCR consists of a complex array of transcription factor-binding sites that includes four binding sites for the viral E2 protein, a single binding site for the viral E1 protein and multiple binding sites for at least twelve different cellular transcription factors: AP-1 (Chan et al., 1990 ), cEBP (Bauknecht et al., 1996
), glucocorticoid receptor (Gloss et al., 1987
), progesterone receptor (Chan et al., 1989
), NF1 (Chong et al., 1990
), NF-IL6 (Kyo et al., 1993
), Oct-1 (O'Connor & Bernard, 1995
), PEF-1 (Cuthill et al., 1993
), TEF-1 (Ishiji et al., 1992
), TEF-2 (Chong et al., 1991
), Sp1 (Gloss & Bernard, 1990
) and YY1 (Dong et al., 1994
; May et al., 1994b
). In HPV-transformed cervical carcinoma cell lines and malignant cervical lesions, HPV sequences are often found integrated into the host genome (Dürst et al., 1985
). Integration frequently occurs within the E2 open reading frame, resulting in the loss of the E2 protein (Baker et al., 1987
). These observations led to the proposal that disruption of the E2 gene results in deregulated P97 promoter activity, uncontrolled expression of the E6 and E7 oncogenes and, ultimately, tumorigenesis. Consistent with this hypothesis, we have shown that re-introduction of the HPV-16 E2 protein into HPV-16-transformed cervical carcinoma cells up-regulates P97 promoter activity and triggers cell death via apoptosis (Sanchez-Perez et al., 1997
).
Although the experiment described above suggests that the HPV-16 E2 protein activates transcription from the P97 promoter, the exact role of the E2 protein in the regulation of HPV-16 transcription has been the subject of some controversy. Depending on the E2 expression system used and the type of reporter construct studied, the HPV-16 E2 protein has been shown both to activate (Bouvard et al., 1994 ; Cripe et al., 1987
; Kovelman et al., 1996
; Phelps & Howley, 1987
; Ushikai et al., 1994
) and to repress (Dostatni et al., 1991
; Romanczuk et al., 1990
; Tan et al., 1992
) transcription from the P97 promoter. Confusion over the functional role of the E2 protein in P97 regulation probably stems from the fact that the binding of E2 to each of its four sites within the LCR has different consequences for promoter activity. Fig. 1
shows the organization of the E2-binding sites within the P97 promoter region. Two adjacent E2-binding sites (E2 sites 1 and 2 in our nomenclature) are located immediately upstream of the P97 transcription start point and are flanked on the 5' side by an Sp1-binding site and on the 3' side by the P97 TATA box. The binding of E2 to these promoter-proximal sites prevents the binding of Sp1 and the TATA box-binding factor (TBP) to their respective sites and results in transcriptional repression (Dostatni et al., 1991
; Tan et al., 1992
, 1994
). Two E2-binding sites are located further upstream of the P97 transcription start point (E2 sites 3 and 4 in Fig. 1
). Although the binding of E2 to site 3 in HPV-18 results in transcriptional repression (Demeret et al., 1997
), the binding of E2 to promoter-distal sites has generally been shown to result in transcriptional activation (Ham et al., 1994
; Ushikai et al., 1994
). The overall effect of the E2 protein on promoter activity is therefore critically dependent on the relative affinity of E2 for each of its binding sites, the number and arrangement of the binding sites and the level of expression of E2 protein within the cell.
|
In this study, we show that cellular transcription factors bind tightly to E2 sites 1 and 3 within the HPV-16 LCR. Mutations that prevent the binding of these cellular factors dramatically reduce P97 promoter activity, suggesting that these factors play an important role in the regulation of HPV-16 gene expression.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
The E2-binding sites within pGL2-LCR were mutated by PCR-directed mutagenesis. E2-binding site 4 was mutated from 5' ACCN6GGT 3' to 5' ACAN6TGT 3', where N6 represents the six base pairs that differ between the four sites. In gel retardation assays, this mutation completely abolished binding of HPV-16 E2 protein (data not shown). E2 site 4 was mutated by using the primers Site 4forward, 5' GCTTCAACAGAATTCTGTTGCATGC 3', and Site 4reverse, 5' GCATGCAACAGAATTCTGTTGAAGC 3'. The underlined bases do not match the template and introduce the desired mutations. The forward primer was used in combination with the pGL2-specific primer GL1 (Promega) to amplify one half of the LCR sequence. The reverse primer was used in combination with the pGL2-specific primer GL2 (Promega) to amplify the opposite half of the LCR sequence. The LCR fragments were then mixed and a full-length LCR was amplified by using the pGL2-specific primers.
E2 site 3 was also mutated from 5' ACCN6GGT 3' to 5' ACAN6TGT 3'. This mutation completely abolished binding of CEF-2 (Fig. 2 B). E2 site 3 was mutated by using the KpnI primer 5' CCGGGGTACCCTGCACATGGGTGTGTGCAAACAGTTTTGTGTTACACATTTAC 3' and the wild-type HindIII primer. The amplified product was cloned between the KpnI and HindIII sites of pGL2-Enhancer, creating pGL2-
7837-CEF-2m. LCR sequences from bp 7165 to bp 7830 were inserted into the KpnI site of pGL2-
7837-CEF-2m to create pGL2-LCR-CEF-2m.
|
E2 sites 1 and 2 were mutated by using the HindIII primer 5' TCGAAAGCTTGTCTGCTTTTATACTAACAGGTTTCTGTTCAACAGATTTCTGTTACGCCC 3' and the KpnI primer described above. Combinations of mutations were obtained by cloning and by further rounds of PCR-directed mutagenesis with mutated constructs as template. The full-length wild-type LCR and the full-length construct containing mutations in all four E2-binding sites were transferred from pGL2-Enhancer into pGL2-basic as SmaIHindIII fragments to create plasmids pGLb-LCR and pGLb-LCR-1234, respectively.
All of the constructs used in this study were sequenced by using a Sequenase kit according to the supplier's instructions (USB). The LCR sequence was verified by using the PCR primers and the pGL2-specific primers GL1 and GL2 (Promega).
Cell culture and transfections.
All the cell lines used in this study were cultured in Dulbecco's modified Eagle's medium supplemented with 10% foetal calf serum, 10 µg/ml penicillin and 10 µg/ml streptomycin (Gibco-BRL). Cells were transiently transfected with 2·5 µg of each reporter plasmid by calcium phosphate precipitation. Luciferase activity was determined 24 h after transfection by using the Luciferase assay system (Promega) according to the manufacturer's instructions. The ß-galactosidase-expressing plasmid pRSV-ßgal (5 µg) was included in each transfection to determine the transfection efficiency.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
To investigate the DNA-binding specificity of CEF-1 and CEF-2, we tested the ability of these factors to bind mutated copies of E2 sites 1 and 3, respectively. E2 site 1 was mutated from 5' ACCGAAACCGGT 3' to 5' ACCGAATTCGGT 3', where the mutated base pairs are underlined. In gel retardation assays, this mutation completely abolished the ability of E2 site 1 to compete away the CEF-1E2 site 1 complex (Fig. 2 B, lanes 5 and 6). E2 site 3 was mutated from 5' ACCGTTTTGGGT 3' to 5' ACAGTTTTGTGT 3' (mutated base pairs underlined). This mutation completely abolished the ability of E2 site 3 to compete away the CEF-2E2 site 3 complex (Fig. 2C
, lanes 5 and 6). Thus, CEF-1 and CEF-2 bound wild-type but not mutated E2-binding sites 1 and 3, respectively. These data were confirmed by assaying the binding of CEF-1 and CEF-2 to the mutated sites (data not shown).
Mutations that block the binding of CEF-1 or CEF-2 reduce P97 promoter activity
To determine whether CEF-1 and/or CEF-2 play an important role in the control of HPV-16 gene expression in intact cells, we cloned the wild-type HPV-16 regulatory region and regulatory regions containing mutations in the E2-binding sites upstream of the luciferase gene in the promoterless reporter plasmid pGL2-Enhancer (Promega). The mutation in E2 site 1 described in the previous section blocked the binding of CEF-1 in vitro and was introduced into the HPV-16 LCR by PCR-directed mutagenesis. The other E2-binding sites were mutated individually from 5' ACCN6GGT 3' to 5' ACAN6TGT 3' (N6 represents the six base pairs that vary between the sites and the mutated bases are underlined). This mutation blocked the binding of CEF-2 to E2 site 3 in vitro (Fig. 2C) and also blocked the binding of E2 to these sites (data not shown). Combinations of mutated sites were obtained by cloning and by further rounds of PCR with mutated constructs as template.
The series of constructs shown schematically in Fig. 3(A) were transiently transfected into HeLa cells and assayed for promoter activity. Since HeLa cells do not produce E2 protein, mutations in the E2-binding sites might be expected to have little or no effect on P97 promoter activity in these cells. However, as can be seen from the data shown in Fig. 3(B)
, a mutation in either E2 site 1 or 3 severely reduced promoter activity (Fig. 3 B
, columns 3 and 4, respectively). In contrast, a mutation in E2 site 4 had little or no effect on promoter activity (Fig. 3B
, column 5) and this site failed to bind any cellular factors in vitro (Fig. 2A
). Constructs carrying mutations in two, three or all four E2-binding sites also showed significant reductions in promoter activity. To examine the generality of these results, we repeated the transfections in SiHa cells; these cells contain a disrupted copy of the HPV-16 E2 gene and, like HeLa cells, do not produce E2 protein. Although the overall level of promoter activity varied between the two cell lines, the mutations had similar effects in SiHa cells to those seen in HeLa cells (data not shown). Taken together, these data confirm that mutations that block the binding of either CEF-1 to E2 site 1 or CEF-2 to E2 site 3 bring about severe reductions in P97 promoter activity.
|
Characterization of CEF-1
Since E2 site 1 has been intensively investigated and shown to play a key role in the regulation of HPV-16 gene expression, we decided to focus on CEF-1 for the remainder of this work. The experiments described above show that CEF-1 is present in a HeLa cell nuclear extract. To characterize the DNA-binding activity of this factor further, we performed gel retardation assays using a labelled oligonucleotide carrying E2 site 1 and nuclear extracts prepared from HeLa and HaCat cells (Fig. 4A). The addition of HeLa cell nuclear extract resulted in the formation of the CEF-1E2 site 1 complex (Fig. 4A
, lane 2). This complex was competed away by the addition of an excess of unlabelled E2 site 1 oligonucleotide (Fig. 4A
, lanes 3 and 4) but was not competed away by an unrelated oligonucleotide that carries a YY1-binding site (lanes 5 and 6). Similar experiments using nuclear extract from HaCat cells revealed a band of the same mobility that was also competed away by the E2 site 1 oligonucleotide but not by the YY1 oligonucleotide (Fig. 4A
, lanes 711). The cellular transcription factor PEBP-2 binds to an E2 site present within the BPV-4 regulatory region (Jackson & Campo, 1995
). We wondered whether CEF-1 might be the human homologue of PEBP-2, a transcription factor known as AML-1 (Ogawa et al., 1993
). However, an oligonucleotide carrying an AML-1/PEBP-2-binding site failed to compete away the CEF-1E2 site 1 complex (data not shown).
|
CEF-1 recognizes the central region of the E2-binding site
The experiments described above show that CEF-1 bound to DNA fragments carrying E2 site 1 but not to DNA fragments carrying E2 site 4. E2 sites 1 and 4 are shown aligned in Fig. 5(A) (lines 1 and 2). As can be seen from the figure, these binding sites differ at only six positions over 20 base pairs. Since both E2 sites 1 and 4 contain perfect copies of the consensus E2-binding site (5' ACCGN4CGGT 3', where N represents any nucleotide), base pairs outside the consensus E2 site must be critically important for the binding of CEF-1. To identify these base pairs, we mutated E2 site 1 at the positions that differ between sites 1 and 4 and tested the ability of these mutated sites to compete away the CEF-1E2 site 1 complex. The sequences of the mutated E2 sites and the results of the competition assay are shown in Fig. 5(A) and (B)
, respectively. The exchange of two base pairs in the central region of the E2-binding site abolished the ability of E2 site 1 to compete away the CEF-1E2 site 1 complex (Fig. 5B
, lanes 7 and 8). In contrast, the exchange of four base pairs in the regions that flank the E2-binding site had little effect on competition (Fig. 5 B
, lanes 9 and 10). These results were confirmed by assaying the binding of CEF-1 to labelled oligonucleotides carrying each of the competitor sequences. CEF-1 bound the E2(e) site but did not bind E2 site 4 or E2(m) (data not shown). Taken together, these data show that mutation of the A:T and C:G base pairs at positions +1 and +2 of E2 site 1 blocked the binding of CEF-1. Mutations at these positions had little or no effect on the binding of E2 (not shown).
CEF-1 and E2 compete for binding at E2 site 1
Given the overlap of the CEF-1- and E2-binding sites, we reasoned that these factors might compete for binding to E2 site 1 or that both factors might bind simultaneously to form a ternary complex. To test these possibilities, we added increasing amounts of the E2 protein to a binding reaction consisting of labelled E2 site 1 and HeLa cell nuclear extract and separated the proteinDNA complexes on non-denaturing polyacrylamide gels. In these experiments, we used either the E2 DNA-binding domain alone (E2Ct, consisting of the 86 C-terminal amino acids of the HPV-16 E2 protein) or the full-length E2 protein. E2Ct bound E2 site 1 and formed a specific complex (Fig. 6, lane 2). In the absence of E2, CEF-1 bound E2 site 1 and formed a slower-migrating complex (Fig. 6
, lane 3). The addition of increasing amounts of the E2Ct protein resulted in the formation of increasing amounts of the E2DNA complex (Fig. 6
, lanes 412). However, no additional bands that might represent ternary complexes were observed. Increasing the amount of the E2Ct protein in the binding reaction brought about a decrease in the amount of CEF-1DNA complex, suggesting that E2Ct and CEF-1 compete for binding to the E2 site. Because CEF-1 is present in limiting amounts in nuclear extract, a large amount of free probe was used in these experiments and a large amount of E2 was therefore needed to compete out CEF-1 binding. Similar results were obtained with the full-length HPV-16 E2 protein. In this case, however, the E2DNA complex and the CEF-1DNA complex had similar (but not identical) electrophoretic mobilities, making it difficult to see the decrease in the amount of the CEF-1DNA complex (data not shown). Although our data suggest that the binding of CEF-1 and E2 are mutually exclusive, it is important to point out that this method might not be sufficiently sensitive to detect weak interactions.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Since E2 site 1 has been shown to play a key role in the regulation of P97 promoter activity, the existence of a cellular transcription factor that competes with E2 for binding to this site has important consequences for the regulation of viral gene expression and the origin of cervical cancer. In vitro experiments have shown that the HPV-16 E2 protein binds most tightly to E2 site 4, the promoter-distal site, and less tightly to E2 sites 1, 2 and 3, the promoter-proximal sites (Sanders & Maitland, 1994 ; Thain et al., 1997
). The E2 protein activates transcription from the full-length HPV-16 LCR (Bouvard et al., 1994
; Kovelman et al., 1996
; Phelps & Howley, 1987
). However, E2 can repress transcription from P97 promoter derivatives that contain only the promoter-proximal E2-binding sites. The binding of E2 to sites 1 and 2 has been shown to block the binding of TBP and Sp1 to their respective sites within the P97 promoter (Dostatni et al., 1991
; Tan et al., 1992
, 1994
). These experiments suggest a plausible model whereby high concentrations of E2 might repress the P97 promoter by preventing the binding of Sp1 and TBP. However, we have shown that mutations that blocked the binding of CEF-1 to E2 site 1 dramatically reduced P97 promoter activity. These data suggest that the binding of E2 to E2 site 1 might repress P97 promoter activity by blocking the binding of CEF-1 rather than, or as well as, TBP.
Several studies on other papillomavirus systems have revealed cellular factors that can bind at, or near, E2-binding sites. The cellular transcription factor PEBP-2 binds to an E2 site present within the BPV-4 LCR and mutations that block the binding of PEBP-2 significantly reduce BPV-4 LCR promoter activity (Jackson & Campo, 1995 ). The human homologue of PEBP-2 is a transcription factor known as AML-1 (Ogawa et al., 1993
). We have used competition experiments to show that CEF-1 and AML-1/PEBP-2 are unrelated. Cellular transcription factors also bind to sequences that overlap an E2 site immediately downstream of the BPV-1 P7185 promoter and stimulate promoter activity (Stenlund & Botchan, 1990
). Unlike CEF-1, the cellular factors that bind to this site do not require A:T and C:G base pairs at positions +1 and +2 of the E2-binding site. Furthermore, the BPV-1 factors require DNA sequences that are well outside the consensus E2-binding site, whereas CEF-1 binds tightly to short oligonucleotides that span the E2-binding site and include only four base pairs of the flanking DNA sequences. Finally, a cellular factor has been shown to bind to a negative regulatory element (NRE) present upstream of the HPV-8 late promoter P7535 (May et al., 1994a
). Although this NRE contains an E2-binding site, the cellular NRE-binding factor, unlike CEF-1, binds to sequences well outside the E2 site (May et al., 1994a
; Stubenrauch et al., 1996
). Whilst these observations suggest that CEF-1 is unrelated to any of these previously identified transcription factors, they do not exclude the possibility that CEF-1 might be involved in the regulation of other papillomaviruses.
In malignant cervical lesions, HPV DNA sequences are often found integrated into the host genome (Baker et al., 1987 ). Virus integration frequently disrupts the E2 gene, resulting in loss of the E2 protein, deregulated expression of the E6 and E7 oncogenes and, finally, the transformed phenotype. The data presented in this paper suggest that loss of the E2 protein would allow CEF-1 and CEF-2 free access to E2-binding sites 1 and 3. Increased binding of these factors might result in increased P97 promoter activity, leading in turn to increased transcription of the E6 and E7 genes and higher levels of the E6 and E7 oncoproteins.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bauknecht, T., See, R. H. & Shi, Y. (1996). A novel C/EBP ßYY1 complex controls the cell-type-specific activity of the human papillomavirus type 18 upstream regulatory region. Journal of Virology 70, 7695-7705.[Abstract]
Bouvard, V., Storey, A., Pim, D. & Banks, L. (1994). Characterization of the human papillomavirus E2 protein: evidence of trans-activation and trans-repression in cervical keratinocytes. EMBO Journal 13, 5451-5459.[Abstract]
Chan, W.-K., Klock, G. & Bernard, H.-U. (1989). Progesterone and glucocorticoid response elements occur in the long control regions of several human papillomaviruses involved in anogenital neoplasia. Journal of Virology 63, 3261-3269.[Medline]
Chan, W.-K., Chong, T., Bernard, H.-U. & Klock, G. (1990). Transcription of the transforming genes of the oncogenic human papillomavirus-16 is stimulated by the tumor promoters through AP1 binding sites. Nucleic Acids Research 18, 763-769.[Abstract]
Chong, T., Chan, W.-K. & Bernard, H.-U. (1990). Transcriptional activation of human papillomavirus 16 by nuclear factor I, AP1, steroid receptors and a possibly novel transcription factor, PVF: a model for the composition of genital papillomavirus enhancers. Nucleic Acids Research 18, 465-470.[Abstract]
Chong, T., Apt, D., Gloss, B., Isa, M. & Bernard, H.-U. (1991). The enhancer of human papillomavirus type 16: binding sites for the ubiquitous transcription factors oct-1, NFA, TEF-2, NF1, and AP-1 participate in epithelial cell-specific transcription. Journal of Virology 65, 5933-5943.[Medline]
Cripe, T. P., Haugen, T. H., Turk, J. P., Tabatabai, F., Schmid, P. G.III, Dürst, M., Gissmann, L., Roman, A. & Turek, L. P. (1987). Transcriptional regulation of the human papillomavirus-16 E6-E7 promoter by a keratinocyte-dependent enhancer, and by viral E2 trans-activator and repressor gene products: implications for cervical carcinogenesis. EMBO Journal 6, 3745-3753.[Abstract]
Cuthill, S., Sibbet, G. J. & Campo, M. S. (1993). Characterization of a nuclear factor, papilloma enhancer binding factor-1, that binds the long control region of human papillomavirus type 16 and contributes to enhancer activity. Molecular Carcinogenesis 8, 96-104.[Medline]
Demeret, C., Desaintes, C., Yaniv, M. & Thierry, F. (1997). Different mechanisms contribute to the E2-mediated transcriptional repression of human papillomavirus type 18 viral oncogenes. Journal of Virology 71, 9343-9349.[Abstract]
Dignam, J. D., Lebovitz, R. M. & Roeder, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Research 11, 1475-1489.[Abstract]
Dong, X.-P., Stubenrauch, F., Beyer-Finkler, E. & Pfister, H. (1994). Prevalence of deletions of YY1-binding sites in episomal HPV 16 DNA from cervical cancers. International Journal of Cancer 58, 803-808.
Dorn, A., Benoist, C. & Mathis, D. (1989). New B-lymphocyte-specific enhancer-binding protein. Molecular and Cellular Biology 9, 312-320.[Medline]
Dostatni, N., Lambert, P. F., Sousa, R., Ham, J., Howley, P. M. & Yaniv, M. (1991). The functional BPV-1 E2 trans-activating protein can act as a repressor by preventing formation of the initiation complex. Genes & Development 5, 1657-1671.[Abstract]
Dürst, M., Gissmann, L., Ikenberg, H. & zur Hausen, H. (1983). A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proceedings of the National Academy of Sciences, USA 80, 3812-3815.[Abstract]
Dürst, M., Kleinheinz, A., Hotz, M. & Gissmann, L. (1985). The physical state of human papillomavirus type 16 DNA in benign and malignant genital tumours. Journal of General Virology 66, 1515-1522.[Abstract]
Dyson, N., Howley, P. M., Münger, K. & Harlow, E. (1989). The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science 243, 934-937.[Medline]
Gloss, B. & Bernard, H.-U. (1990). The E6/E7 promoter of human papillomavirus type 16 is activated in the absence of E2 proteins by a sequence-aberrant Sp1 distal element. Journal of Virology 64, 5577-5584.[Medline]
Gloss, B., Bernard, H.-U., Seedorf, K. & Klock, G. (1987). The upstream regulatory region of the human papilloma virus-16 contains an E2 protein-independent enhancer which is specific for cervical carcinoma cells and regulated by glucocorticoid hormones. EMBO Journal 6, 3735-3743.[Abstract]
Ham, J., Steger, G. & Yaniv, M. (1994). Cooperativity in vivo between the E2 transactivator and the TATA box binding protein depends on core promoter structure. EMBO Journal 13, 147-157.[Abstract]
Hawley-Nelson, P., Vousden, K. H., Hubbert, N. L., Lowy, D. R. & Schiller, J. T. (1989). HPV16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes. EMBO Journal 8, 3905-3910.[Abstract]
Ishiji, T., Lace, M. J., Parkkinen, S., Anderson, R. D., Haugen, R. H., Cripe, T. P., Xiao, J. H., Davidson, I., Chambon, P. & Turek, L. P. (1992). Transcriptional enhancer factor (TEF)-1 and its cell-specific co-activator activate human papillomavirus-16 E6 and E7 oncogene transcription in keratinocytes and cervical carcinoma cells. EMBO Journal 11, 2271-2281.[Abstract]
Jackson, M. E. & Campo, M. S. (1995). Both viral E2 protein and the cellular factor PEBP2 regulate transcription via E2 consensus sites within the bovine papillomavirus type 4 long control region. Journal of Virology 69, 6038-6046.[Abstract]
Kovelman, R., Bilter, G. K., Glezer, E., Tsou, A. Y. & Barbosa, M. S. (1996). Enhanced transcriptional activation by E2 proteins from the oncogenic human papillomaviruses. Journal of Virology 70, 7549-7560.[Abstract]
Kyo, S., Inoue, M., Nishio, Y., Nakanishi, K., Akira, S., Inoue, H., Yutsudo, M., Tanizawa, O. & Hakura, A. (1993). NF-IL6 represses early gene expression of human papillomavirus type 16 through binding to the noncoding region. Journal of Virology 67, 1058-1066.[Abstract]
May, M., Grassmann, K., Pfister, H. & Fuchs, P. G. (1994a). Transcriptional silencer of the human papillomavirus type 8 late promoter interacts alternatively with the viral trans activator E2 or with a cellular factor. Journal of Virology 68, 3612-3619.[Abstract]
May, M., Dong, X. P., Beyer-Finkler, E., Stubenrauch, F., Fuchs, P. G. & Pfister, H. (1994b). The E6/E7 promoter of extrachromosomal HPV16 DNA in cervical cancers escapes from cellular repression by mutation of target sequences for YY1. EMBO Journal 13, 1460-1466.[Abstract]
Mohr, I. J., Clark, R., Sun, S., Androphy, E. J., MacPherson, P. & Botchan, M. R. (1990). Targeting the E1 replication protein to the papillomavirus origin of replication by complex formation with the E2 transactivator. Science 250, 1694-1699.[Medline]
Münger, K., Phelps, W. C., Bubb, V., Howley, P. M. & Schlegel, R. (1989). The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. Journal of Virology 63, 4417-4421.[Medline]
O'Connor, M. & Bernard, H.-U. (1995). Oct-1 activates the epithelial-specific enhancer of human papillomavirus type 16 via a synergistic interaction with NFI at a conserved composite regulatory element. Virology 207, 77-88.[Medline]
Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, M., Lu, J., Satake, M., Shigesada, K. & Ito, Y. (1993). PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proceedings of the National Academy of Sciences, USA 90, 6859-6863.[Abstract]
Peto, R. & zur Hausen, H. (editors) (1986). Viral Etiology of Cervical Cancer. Banbury Report 21. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Phelps, W. C. & Howley, P. M. (1987). Transcriptional trans-activation by the human papillomavirus type 16 E2 gene product. Journal of Virology 61, 1630-1638.[Medline]
Romanczuk, H., Thierry, F. & Howley, P. M. (1990). Mutational analysis of cis elements involved in E2 modulation of human papillomavirus type 16 P97 and type 18 P105 promoters. Journal of Virology 64, 2849-2859.[Medline]
Sanchez-Perez, A.-M., Soriano, S., Clarke, A. R. & Gaston, K. (1997). Disruption of the human papillomavirus type 16 E2 gene protects cervical carcinoma cells from E2F-induced apoptosis. Journal of General Virology 78, 3009-3018.[Abstract]
Sanders, C. M. & Maitland, N. J. (1994). Kinetic and equilibrium binding studies of the human papillomavirus type-16 transcription regulatory protein E2 interacting with core enhancer elements. Nucleic Acids Research 22, 4890-4897.[Abstract]
Smotkin, D. & Wettstein, F. O. (1986). Transcription of human papillomavirus type 16 early genes in a cervical cancer and a cancer-derived cell line and identification of the E7 protein. Proceedings of the National Academy of Sciences, USA 83, 4680-4684.[Abstract]
Smotkin, D., Prokoph, H. & Wettstein, F. O. (1989). Oncogenic and nononcogenic human genital papillomaviruses generate the E7 mRNA by different mechanisms. Journal of Virology 63, 1441-1447.[Medline]
Stenlund, A. & Botchan, M. R. (1990). The E2 trans-activator can act as a repressor by interfering with a cellular transcription factor. Genes & Development 4, 123-136.[Abstract]
Stubenrauch, F., Leigh, I. M. & Pfister, H. (1996). E2 represses the late gene promoter of human papillomavirus type 8 at high concentrations by interfering with cellular factors. Journal of Virology 70, 119-126.[Abstract]
Tan, S.-H., Gloss, B. & Bernard, H.-U. (1992). During negative regulation of the human papillomavirus-16 E6 promoter, the viral E2 protein can displace Sp1 from a proximal promoter element. Nucleic Acids Research 20, 251-256.[Abstract]
Tan, S.-H., Leong, L. E.-C., Walker, P. A. & Bernard, H.-U. (1994). The human papillomavirus type 16 E2 transcription factor binds with low cooperativity to two flanking sites and represses the E6 promoter through displacement of Sp1 and TFIID. Journal of Virology 68, 6411-6420.[Abstract]
Thain, A., Webster, K., Emery, D., Clarke, A. R. & Gaston, K. (1997). DNA binding and bending by the human papillomavirus type 16 E2 protein. Recognition of an extended binding site. Journal of Biological Chemistry 272, 8236-8242.
Ushikai, M., Lace, M. J., Yamakawa, Y., Kono, M., Anson, J., Ishiji, T., Parkkinen, S., Wicker, N., Valentine, M.-E., Davidson, I., Turek, L. P. & Haugen, T. H. (1994). trans activation by the full-length E2 proteins of human papillomavirus type 16 and bovine papillomavirus type 1 in vitro and in vivo: cooperation with activation domains of cellular transcription factors. Journal of Virology 68, 6655-6666.[Abstract]
van Ranst, M., Tachezy, R. & Burk, R. D. (1996). Human papillomaviruses: a never-ending story? In Papillomavirus Reviews: Current Research on Papillomaviruses, pp. 1-19. Edited by C. Lacey. Leeds: Leeds University Press.
Vande Pol, S. B. & Howley, P. M. (1990). A bovine papillomavirus constitutive enhancer is negatively regulated by the E2 repressor through competitive binding for a cellular factor. Journal of Virology 64, 5420-5429.[Medline]
Watanabe, S., Kanda, T. & Yoshiike, K. (1989). Human papillomavirus type 16 transformation of primary human embryonic fibroblasts requires expression of open reading frames E6 and E7. Journal of Virology 63, 965-969.[Medline]
Werness, B. A., Levine, A. J. & Howley, P. M. (1990). Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science 248, 76-79.[Medline]
Received 23 February 1999;
accepted 22 April 1999.