National Institute of Animal Health, 3-1-1 Kannondai, Tsukuba, Ibaraki 305-0856, Japan1
Author for correspondence: Shigeo Yamaguchi. Fax +81 298 38 7760. e-mail syama{at}niah.affrc.go.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
CAV infection causes mortality, severe anaemia, atrophy of the thymus and yellowish bone marrow in young chickens (Goryo et al., 1985 ; Otaki et al., 1987
; Taniguchi et al., 1982
; Todd et al., 1995
; Yuasa et al., 1979
; Yuasa & Imai, 1986
). However, chickens become resistant to the disease by 1 month of age (Rosenberger & Cloud, 1989
; Yuasa & Imai, 1986
). The presence of a maternal antibody is protective in experimental infections with CAV (Yuasa et al., 1980
). Therefore, the disease associated with CAV infection has been prevented by immunization of breeding flocks with live virus vaccines. As vertical transmission through the hatching egg is suspected to be the most important means of transmission of CAV infection (Chettle et al., 1989
; Hoop, 1992
), vaccine strains should have low pathogenicity even for young chickens.
This paper describes the generation of a low-pathogenic cloned virus by molecular cloning of CAV DNA from a low-passage CAV in cell culture and identification of the pathogenicity determinant in the genome of CAV.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cloning of RF-DNA of CAV.
DNAs were extracted by the Hirt procedure (Hirt, 1967 ) as described previously (Scott et al., 1999
) from MDCC-MSB1 cells infected with the AH and A2 virus pools. The extracted DNAs were treated with PstI or XbaI to generate a linear RF-DNA and ligated into the cloning site of pBluescript SK+ (Stratagene). Recombinant plasmids containing CAV RF-DNA was selected by colony hybridization with a digoxigenin-labelled probe (Boehringer Mannheim) as described by the manufacturer. The probe, 252 bases long, was synthesized from the VP3/VP2 gene overlapping region by PCR with primers (forward 485504, 5' AATGAACGCTCTCCAAGAAG 3'; reverse 736716, 5' GGAGGCTTGGGTTGATCGGTC 3') designed from GenBank accession no. M55918 (Noteborn et al., 1991
). Insertion of full-length RF-DNA was confirmed by detection of a 2·3 kb fragment by restriction enzyme digestion and agarose gel electrophoresis.
Nucleotide sequence determination.
The nucleotide sequence of the full-length RF-DNA of CAV was determined for the selected AH-and A2-derived clones. Thermal cycle sequencing (ABI PRISM Dye Terminator Cycle Sequencing kit; Perkin-Elmer) was performed as described by the manufacturer. Purified plasmid DNA prepared with a kit (Wizard Minipreps DNA Purification kit; Promega) was used as the template. Sequencing was performed in both directions with virus-specific primers based on the Cux-1 sequence (accession no. M55918; Noteborn et al., 1991 ) as well as the M13 forward and reverse primers. The sequences were complied and analysed by using the computer program GENETYX (Software Development).
Preparation of molecularly cloned CAV.
Full-length CAV RF-DNA was excised from the recombinant plasmid by restriction enzyme digestion. DNA fragments were isolated with a kit (QIAquick PCR purification kit, Qiagen) and circularized by ligation. The ligated DNA solutions, containing about 10 ng CAV RF-DNA in 5 µl, were used to transfect 105·5 MDCC-MSB1 cells in 0·1 ml by the DEAEdextran protocol, as described by the manufacturer (CellPhect transfection kit; Pharmacia Biotech).
Quantification of CAV.
Infectivity titration of CAV was performed by the microtest method, as described previously (Imai & Yuasa, 1990 ). Serial tenfold dilutions of the virus samples were prepared and 20 µl of each dilution was inoculated into each of two wells containing 4x104 MDCC-MSB1 cells in 200 µl. The results were read by examining the cytopathic effect (CPE) after seven subcultures.
Quantification of CAV grown in inoculated chicks was performed by competitive PCR as described previously (Yamaguchi et al., 2000 ). DNA was isolated from 10% (w/v) liver homogenates by phenolSDS treatment and ethanol precipitation. In this CAV quantification, the number of molecules of CAV DNA was estimated by comparing the amount of PCR product generated from the wild-type template and that from the competitive template (33 nt deleted) by agarose-gel electrophoresis.
Substitution of one amino acid in CAV cloned virus.
Two molecularly cloned viruses, AH-C140 and AH-C364, were selected from each of the low- and high-pathogenic clones for single amino acid substitution in the AH-derived clones. Substitution of a single amino acid, at VP1 residue 394, was achieved by exchanging the XbaINcoI DNA fragments of the clones. The resulting mutated clones were designated AH-C140Q and AH-C364H (Fig. 1). To achieve the amino acid substitution in the A2-derived clone A2-C15, the XbaINcoI fragment was subcloned into a plasmid and oligonucleotide-mediated site-directed mutagenesis was performed using a kit, as described by the manufacturer (Mutan-Super Express Km kit, Takara). After sequence analysis, the mutated XbaINcoI fragment was reintegrated into the original clone and the sites of mutation and ligation were verified by sequencing.
|
In experiment A, for screening of low-pathogenic clones, groups of four to ten chicks were inoculated with the molecularly cloned viruses or virus pools containing 105·7106·5 TCID50 in 0·1 ml and reared for 14 days. Experiments A-1 and A-3 were screening tests with the AH- and A2-derived clones, respectively, and used four chicks in each group. Experiment A-2 was done to confirm the results of experiment A-1 with selected clones and used 10 chicks in each group.
In experiment B, experiments for the determination of the effect of a single amino acid substitution on pathogenicity, groups of 12 chicks were inoculated with the cloned virus containing 105·5 or 106·2 TCID50 in 0·1 ml. Ten chicks in each group were reared for 21 days to evaluate pathogenicity and the remaining two chicks in each group were used for examination of virus growth by quantification of CAV DNA in liver at 7 days p.i. The liver homogenate from each inoculated chick was also used for direct PCR sequencing to confirm the sequence of the virus produced.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Experiment A
Eight and one molecularly cloned viruses obtained from the AH and A2 virus pools, respectively, were used for evaluation of pathogenicity to chicks together with the parental virus pools. The uninoculated groups showed no mortality and a normal haematocrit in each experiment. All of the inoculated groups showed various severities of pathogenicity as determined by haematocrit, mean BW ratio and mortality. Each group showed similar pathogenic severity in the three examinations. The pathogenic severity determined in experiment A-1 was confirmed in experiment A-2, especially for the haematocrit. Both the AH and A2 virus pools and some cloned viruses, such as AH-C364, AH-C367, AH-C368, AH-C370 and A2-C15, were scored as ++ for severity in most of the examinations and were judged as highly pathogenic. The other groups, such as AH-C140, AH-C363 and AH-C369, gave scores of - or + for severity in all examinations and were judged as having low pathogenicity (Table 1).
|
|
Experiment B
One clone from the low-pathogenic group, AH-C140, and two clones from the high-pathogenic group, AH-C364 and A2-C15, were selected and used for substitution of VP1 residue 394. No chicks died before 14 days p.i. in any group used for pathogenicity examinations. Clone AH-C140Q, which was created from AH-C140 by substitution of glutamine for histidine at VP1 residue 394, showed distinctly higher pathogenicity in all examinations compared with the parental clone (Table 2). On the other hand, clones AH-C364H and A2-C15H, which were created by substitution of histidine for glutamine, showed distinctly lower pathogenicity than the parental clones.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We could obtain low-pathogenic clones successfully from the AH isolate. This is the first report of the isolation of low-pathogenic CAV clones from a non-attenuated virus pool. It was shown that the AH virus pool used in this study consisted of a mixed population of genetically and pathogenically diverse clones. Genetically and pathogenically diverse clones were also obtained from multiply passaged CAV isolates in MDCC-MSB1 cells by Scott et al. (1999) and Todd et al. (1995)
. Spontaneous mutation may occur during propagation in chickens and in cell culture, and most CAV isolates may consist of a genetically diverse mixed population. As there is no effective conventional method of virus selection for CAV, such as plaque cloning, recombinant DNA cloning and transfection methodologies are essential for biological characterization of CAV isolates.
There has been no report of a low-pathogenic CAV isolate obtained from field materials, as far as we know. All 28 CAV DNA sequences retrieved from DNA databases had glutamine as the putative amino acid corresponding to position 394 in VP1. Todd et al. (1995) attenuated CAV by multiple passage in MDCC-MSB1 cells and molecularly characterized the virus, but they could not define the genetic determinants of pathogenicity (Meehan et al., 1997
; Todd et al., 1998
). Their attenuated CAV clones possessed glutamine at this residue. There may be many genetic determinants of pathogenicity in the CAV genome, and the amino acid at VP1 residue 394 may be a crucial one.
Pathogenicity evaluation by examination of haematocrit was very reliable because the severity score was highly reproducible. The cloned viruses AH-C140 and AH-C364 were used three times in experimental inoculation to chicks, in experiments A-1, A-2 and B-1, and there were no significant differences in mean haematocrit among the experiments. Retardation of BW expressed as a ratio to the control group was also highly reproducible in each experiment and is an important factor for evaluation of the pathogenicity of CAV when the economic influence of this virus infection is considered.
Numbers of molecules of viral DNA in the livers of inoculated chicks seemed to be higher in the high-pathogenic clones (AH-C140Q and AH-C364) than in the low-pathogenic clones (AH-C140 and AH-C364H) at 7 days p.i. (Table 2). This should be confirmed statistically by using a number of chicks sufficient to define the pathogenicity mechanism of CAV. Previous papers have reported that the CAV VP3 protein induced apoptosis in cultured cells (Danen-Van Oorschot et al., 1997
; Noteborn et al., 1994a
; Pietersen et al., 1999
) and revealed the existence of an enhancer/promoter region in the untranslated region (Noteborn et al., 1994b
) that could be related to pathogenicity (Noteborn et al., 1998
). The genetic determinant for pathogenicity defined in this study did not relate either to the VP3 protein or to the enhancer/promoter region but was related to the VP1 capsid protein. Amino acids in the virus capsid protein could be related to pathogenicity through the function of a receptor for target cells, such as erythroblastoid cells. Histidine belongs to the positively charged group and glutamine belongs to the polar but uncharged group, and this difference could influence the interaction between the virus and cells as a constituent of a receptor. Precise examination is necessary to define the function of this amino acid.
As the amino acid found in the low- and high-pathogenic clones was histidine (codon CAC) and glutamine (codon CAG or CAA), respectively, differentiation of low-pathogenic clones from high-pathogenic clones was possible by PCR with a primer corresponding to the low-pathogenic sequence (reverse primer: residues 20342013 of accession no. AB046587, 5' TGTAGCTGTGCCGAACTTGTAG 3') (data not shown). The naturally existing low-pathogenic cloned CAV could have advantages for development of a live vaccine. Because the virus genome was not modified by recombinant DNA techniques, it requires less complicated safety tests before field application. The naturally existing low-pathogenic clones in the AH virus pool may have been created by spontaneous point mutation and maintained in the virus pool without extinction. However, the genetic stability of the low-pathogenic clones obtained in this study must be assessed.
The methodologies applied in this study for the selection, identification and creation of low-pathogenic clones may be useful for the development of a genetically homogeneous and stable CAV live vaccine as well as for determination of the functions of CAV genes.
![]() |
Footnotes |
---|
b Present address: Shimane Prefectural Livestock Hygiene Research Institute, 918-4 Jinzaioki, Izumo, Shimane 699-0822, Japan.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Chettle, N. J., Eddy, R. K., Wyeth, P. J. & Lister, S. A. (1989). An outbreak of disease due to chicken anaemia agent in broiler chickens in England. Veterinary Record 124, 211-215.[Medline]
Claessens, J. A. J., Schrier, C. C., Mockett, A. P. A., Jagt, E. H. J. M. & Sondermeijer, P. J. A. (1991). Molecular cloning and sequence analysis of the genome of chicken anaemia agent. Journal of General Virology 72, 2003-2006.[Abstract]
Danen-Van Oorschot, A. A., Fischer, D. F., Grimbergen, J. M., Klein, B., Zhuang, S., Falkenburg, J. H., Backendorf, C., Quax, P. H., Van der Eb, A. J. & Noteborn, M. H. M. (1997). Apoptin induces apoptosis in human transformed and malignant cells but not in normal cells. Proceedings of the National Academy of Sciences, USA 94, 5843-5847.
Goryo, M., Sugimura, H., Matsumoto, S., Umemura, T. & Itakura, C. (1985). Isolation of an agent inducing chicken anaemia. Avian Pathology 14, 483-496.
Hirt, B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures. Journal of Molecular Biology 26, 365-369.[Medline]
Hoop, R. K. (1992). Persistence and vertical transmission of chicken anaemia agent in experimentally infected laying hens. Avian Pathology 21, 493-501.
Imai, K. & Yuasa, N. (1990). Development of a microtest method for serological and virological examinations of chicken anemia agent. Japanese Journal of Veterinary Science 52, 873-875.[Medline]
McNulty, M. S. (1991). Chicken anaemia agent: a review. Avian Pathology 20, 187-203.
McNulty, M. S., McIlroy, S. G., Bruce, D. W. & Todd, D. (1991). Economic effects of subclinical chicken anemia agent infection in broiler chickens. Avian Diseases 35, 263-268.[Medline]
Meehan, B. M., Todd, D., Creelan, J. L., Connor, T. J. & McNulty, M. S. (1997). Investigation of the attenuation exhibited by a molecularly cloned chicken anemia virus isolate by utilizing a chimeric virus approach. Journal of Virology 71, 8362-8367.[Abstract]
Noteborn, M. H. M. & Koch, G. (1995). Chicken anaemia virus infection: molecular basis of pathogenicity. Avian Pathology 24, 11-31.
Noteborn, M. H. M., de Boer, G. F., van Roozelaar, D. J., Karreman, C., Kranenburg, O., Vos, J. G., Jeurissen, S. H. M., Hoeben, R. C., Zantema, A., Koch, G., Ormondt, H. & van der Eb, A. J. (1991). Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle. Journal of Virology 65, 3131-3139.[Medline]
Noteborn, M. H. M., Todd, D., Verschueren, C. A. J., de Gauw, H. W. F. M., Curran, W. L., Veldkamp, S., Douglas, A. J., McNulty, M. S., van der Eb, A. J. & Koch, G. (1994a). A single chicken anemia virus protein induces apoptosis. Journal of Virology 68, 346-351.[Abstract]
Noteborn, M. H. M., Verschueren, C. A. J., Zantema, A., Koch, G. & van der Eb, A. J. (1994b). Identification of the promoter region of chicken anemia virus (CAV) containing a novel enhancer-like element. Gene 150, 313-318.[Medline]
Noteborn, M. H. M., Verschueren, C. A. J., van Ormondt, H. & van der Eb, A. J. (1998). Chicken anemia virus strains with a mutated enhancer/promoter region share reduced virus spread and cytopathogenicity. Gene 223, 165-172.[Medline]
Otaki, Y., Nunoya, T., Tajima, M., Tamada, H. & Nomura, Y. (1987). Isolation of chicken anaemia agent and Mareks disease virus from chickens vaccinated with turkey herpesvirus and lesions induced in chicks by inoculating both agents. Avian Pathology 16, 291-306.
Pietersen, A. M., van der Eb, M. M., Rademaker, H. J., van den Wollenberg, D. J. M., Rabelink, M. J. W. E., Kuppen, P. J. K., van Dierendonck, J. H., van Ormondt, H., Masman, D., van de Velde, C. J. H., van der Eb, A. J., Hoeben, R. C. & Noteborn, M. H. M. (1999). Specific tumor-cell killing with adenovirus vectors containing the apoptin gene. Gene Therapy 6, 882-892.[Medline]
Rosenberger, J. K. & Cloud, S. S. (1989). The effects of age, route of exposure, and coinfection with infectious bursal disease virus on the pathogenicity and transmissibility of chicken anemia agent (CAA). Avian Diseases 33, 753-759.[Medline]
Scott, A. N. J., Connor, T. J., Creelan, J. L., McNulty, M. S. & Todd, D. (1999). Antigenicity and pathogenicity characteristics of molecularly cloned chicken anaemia virus isolates obtained after multiple cell culture passages. Archives of Virology 144, 1961-1975.[Medline]
Studdert, M. J. (1993). Circoviridae: new viruses of pigs, parrots and chickens. Australian Veterinary Journal 70, 121-122.[Medline]
Takagi, S., Goryo, M. & Okada, K. (1996). Pathogenicity for chicks of six isolates of chicken anemia virus (CAV) isolated in the past two years (93 94). Journal of the Japanese Society on Poultry Diseases 32, 9097 (in Japanese).
Taniguchi, T., Yuasa, N., Maeda, M. & Horiuchi, T. (1982). Hematopathological changes in dead and moribund chicks induced by chicken anemia agent. National Institute of Animal Health Quarterly (Tokyo) 22, 61-69.
Todd, D., Connor, T. J., Calvert, V. M., Creelan, J. L., Meehan, B. M. & McNulty, M. S. (1995). Molecular cloning of an attenuated chicken anaemia virus isolate following repeated cell culture passage. Avian Pathology 24, 171-187.
Todd, D., Connor, T. J., Creelan, J. L., Borghmans, B. J., Calvert, V. M. & McNulty, M. S. (1998). Effect of multiple cell culture passages on the biological behaviour of chicken anaemia virus. Avian Pathology 27, 74-79.
Yamaguchi, S., Kaji, N., Munangandu, H. M., Kojima, C., Mase, M. & Tsukamoto, K. (2000). Quantification of chicken anaemia virus by competitive polymerase chain reaction. Avian Pathology 29, 305-310.
Yuasa, N. & Imai, K. (1986). Pathogenicity and antigenicity of eleven isolates of chicken anaemia agent (CAA). Avian Pathology 15, 639-645.
Yuasa, N., Taniguchi, T. & Yoshida, I. (1979). Isolation and some characteristics of an agent inducing anemia in chicks. Avian Diseases 23, 366-385.
Yuasa, N., Noguchi, T., Furuta, K. & Yoshida, I. (1980). Maternal antibody and its effect on the susceptibility of chicks to chicken anemia agent. Avian Diseases 24, 197-202.
Yuasa, N., Imai, K., Watanabe, K., Saito, F., Abe, M. & Komi, K. (1987). Aetiological examination of an outbreak of haemorrhagic syndrome in a broiler flock in Japan. Avian Pathology 16, 521-526.
Received 6 November 2000;
accepted 9 January 2001.