Department of Virology, Center for Basic Research1, and Division of Research and Development, Research Center for Biologicals2, The Kitasato Institute, 5-9-1 Shirokane, Minato-ku, Tokyo 108-8642, Japan
Department of Pediatrics, Tokyo Medical University, 6-7-1 Nishishinjyuku, Shinjyuku-ku, Tokyo 160-0023, Japan3
Author for correspondence: Tetsuo Nakayama. Fax +81 3 5791 6130. e-mail nakayama-t{at}kitasato.or.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The MV vaccine strain AIK-C, attenuated from the Edmonston strain (Sasaki, 1974 ; Makino, 1983
), was developed in Japan in 1976 by plaque cloning and passage in sheep kidney and chicken embryonic cells at 33 °C. It shows optimal growth at 33 °C and extremely poor or no growth at 40 °C, i.e. temperature sensitivity (ts), with small plaques in Vero cells (Sasaki, 1974
). To date, over 15 million doses of this vaccine have been used, mainly in Japan, and low reactogenicity has been reported. The AIK-C strain induced a higher seroconversion rate in infants of 4 to 6 months of age than the Schwarz strain in infants of 9 months of age (Tidjani et al., 1989
). Essentially the same results were reported in Russia and Ghana (Bolotovski et al., 1994
; Nkrumah et al., 1998
). Most current MV vaccines were developed from the Edmonston strain by passage in chicken embryonic cells (Hirayama, 1983
). We have reported that the genome sequence of the AIK-C strain has 56 nucleotide changes and 31 amino acid substitutions compared with the sequence of the Edmonston strain (Mori et al., 1993
). The sequences of the fusion (F), haemagglutinin (H) and nucleocapsid (N) protein regions of current vaccine strains have been determined (Bellini et al., 1994
; Rota et al., 1994
). There is, however, no information about mutations that relate to the characteristics of vaccine strains or to the process of attenuation.
In this study, we have constructed expression plasmids for the F and H regions of the MV vaccine seed strain AIK-C and its parental wild-type strain Edmonston. We have examined the fusion inducibility of these plasmids in B95a, HeLa and Vero cells infected with recombinant vaccinia virus expressing T7 RNA polymerase. We have also examined the infectivity and plaque formation of the virus and its recombinants rescued from a full-length cDNA clone of MV strain AIK-C in Vero cells.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Construction of expression plasmids.
Total RNA was extracted from tissue culture fluid and the F and H protein-coding regions were amplified by RTPCR using the primers F-ATG (5' CATGAATTCATGGGTCTCAAGGTGAACGT), F-TGA (5' TTAGCGGCCGCTCAGAGCGACCTTACATAG), H-ATG (5' GTTGAATTCATGTCACCACAACGAGACCGGA) and H-TAG (5' AATGCGGCCGCCTATCTGCGATTGGTTCCA). The linker restriction enzyme sites EcoRI and NotI are underlined. The F and H protein-coding regions were amplified by nested RTPCR as reported previously (Nakayama et al., 1995 ). Expression plasmids were constructed by inserting the full coding region sequences of the F and H proteins into pBluescript II SK(-) using the EcoRI and NotI multicloning sites located downstream of the T7 promoter. The F and H expression plasmids constructed from the AIK-C strain were designated pAIK-F01 and pAIK-H, and from the Edmonston strain, pEdm-F and pEdm-H. Constructs were sequenced by the dye terminator method using an ABI 377 sequencer (ABI PRISM, Perkin-Elmer).
Site-directed mutagenesis.
To introduce a point mutation at position 278 of the F protein, the primers 278R+ (5' GAGTCCTACCGTATTGTCCTC), 278R- (5' GAGGACAATACGGTAGGACTC), 278Y+ (5' GAGTCCTACTATATTGTCCTC) and 278Y- (5' GAGGACAATATAGTAGGACTC) were synthesized. Mutated amino acids, Arg and Tyr, are underlined. Mutated DNA fragments were amplified by PCR and, using the appropriate restriction enzymes, were inserted into pEdm-F. The two mutated clones were designated pEdm-F278Arg and pEdm-F278Tyr.
Fusion analysis of cells co-transfected with expression plasmids.
Plasmid constructs were expressed using the vaccinia virus T7 expression system, kindly supplied by B. Moss (Fuerst et al., 1986 ). Monolayers of confluent B95a or HeLa cells were infected with recombinant vaccinia virus vTF7.3, which expresses bacteriophage T7 RNA polymerase, at an m.o.i. of 1 for B95a cells or 0·25 for HeLa cells. Cells were incubated at 37 °C for 1 h in 24-well plates. Inoculated virus was removed and cells were washed with Opti-MEM (GIBCO BRL). Vero cell monolayers in 24-well plates were infected with replication-deficient vaccinia virus expressing T7 RNA polymerase (MVAT7pol) at an m.o.i. of 10, kindly supplied by G. Sutter (Sutter et al., 1995
). The F and H expression plasmids were transfected (0·2 µg per well) using SuperFect transfection reagent (Qiagen) for B95a and Vero cells or DMRIE-C reagent (GIBCO BRL) for HeLa cells. After overnight incubation, cells were fixed with 0·5% glutaraldehyde and stained with Giemsas staining solution (Merck).
Immunofluorescence assay.
HeLa cells were cultured in a LabTek 8-well chamber slide (Nunc) and transfected with the F and/or H expression plasmids. Cells were fixed with cold acetone and an indirect immunofluorescence assay was performed using an anti-MV hyperimmune mouse antiserum followed by an FITC-conjugated monoclonal antibody against mouse IgG (Sigma).
Construction of full-length AIK-C cDNA and recovery of recombinant virus.
We constructed a full-length cDNA clone of the vaccine seed strain AIK-C. A fragment of the recombinant F protein plasmid was inserted into the cDNA clone using appropriate restriction sites. A diagram of the cloning strategy is shown in Fig. 1. We constructed plasmids in two parts. The first half of pNEB193M-278Leu contains the leader sequence of the AIK-C genome to the PacI site at nucleotide position 7238. The second half of the plasmid contains the H and L regions from the PacI site at nucleotide position 7238 of the AIK-C genome to the trailer sequence. To change the amino acid at position 278 from Leu to Phe, a fragment of the recombinant plasmid pMV-F278Phe (as shown in Fig. 3
) digested with AseI (positions 172 and 1211 of the F gene in F-ATG) was introduced into the pNEB193M-278Leu fragment, also digested with AseI. The resultant plasmid, designated pNEB193M-278Phe was digested with NotI/PacI and ligated into the second half of the plasmid, also digested with NotI/PacI. This construct was designated pIC-MVAIK-F278Phe. The original AIK-C cDNA was designated pIC-MVAIK-F278Leu. For the recovery of recombinant MV, B95a cells were infected with MVAT7pol, a replication-deficient vaccinia virus expressing T7 RNA polymerase, and then transfected with pAIK-N, pAIK-P, pAIK-L (pCIAN001, pCIAP001 and pCIAL001) and pIC-MVAIK-F278Leu (original of AIK-C) or pIC-MVAIK-F278Phe (mutant), as reported previously (Schneider et al., 1997
). B95a cells were cultured at 32·5 °C in 5% CO2 until syncytia were apparent.
|
|
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Fusion inducibility of recombinant F protein expression plasmids
Amino acid differences and a diagram of the methods used for the construction of recombinant F gene DNAs are shown in Fig. 3. Using SalI (position 814 from the ATG codon of the F protein-coding region), Bst1107I (position 935) and PshAI (position 1343), we constructed six recombinant plasmids. Expression of the recombinant F plasmids in B95a cells was ascertained by immunofluorescence (data not shown). These recombinant plasmids were transfected into B95a or Vero cells infected with vTF7.3 or MVAT7pol. The results of fusion inducibility are shown in Fig. 3
. Three amino acid changes were retained in pMV-F-SVS and pMV-F-VFS after exchanging the DNA fragments digested with PshAI. pMV-F-VFS induced strong fusion and so, using Bst1107I, pMV-F362Ser and pMV-F-VF were constructed. We constructed pMV-F278Phe and pMV-F237Val by exchanging DNA fragments between pAIK-F01 and pMV-F-VF after digestion with SalI. After co-transfection with pAIK-H as the expression partner for the H protein in B95 cells, extensive syncytium formation was observed with pEdm-F, pMV-F-VFS, pMV-F-VF and pMV-F278Phe, whereas pAIK-F01, pMV-F-SVS, pMV-F362Ser and pMV-F237Val induced very few syncytia (Fig. 3
). The fusion inducibility in B95a, HeLa and Vero cells was the same. Few fused cells were observed after transfection with recombinant plasmids with Leu at position 278 of the F protein, whereas plasmids with Phe at position 278 induced extensive cell fusion.
The recombinant plasmid pEdm-F278Leu was constructed by substituting the DNA fragments of pEdm-F and pAIK-F01 after digestion with SalI/Bst1107I. Site-directed mutations were introduced by PCR. pEdm-F278Tyr and pEdm-F278Arg were constructed using the same procedure. The results of fusion inducibility in Vero cells are shown in Fig. 4. Small syncytia were observed after co-transfection with pAIK-F01 and pEdm-H, but extensive fusion was induced after co-transfection with pEdm-F and pEdm-H. When pEdm-F278Leu was co-transfected with pEdm-H as the expression partner, cell fusion decreased. The recombinant plasmid pEdm-F278Tyr induced extensive cell fusion, as did pEdm-H and pMV-F278 Phe, but not pEdm-F278Arg. Phe or Tyr at 278, as an aromatic amino acid, was essential for extensive syncytium formation, whereas Leu at 278 resulted in poor syncytium formation, as seen with the AIK-C strain of MV.
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The F protein is a type I membrane protein that is initially synthesized as the F0 precursor. F0 is transported to the Golgi apparatus where it is cleaved by a host protease into two disulfide-linked subunits, F1 and F2. Several functional domains of the F protein have been clarified. The well-known cleavage motif RRHKR follows the N-terminal 20 residues of F1 (fusion peptide), which is a highly conserved hydrophobic region among paramyxoviruses and which intercalate into the target membrane (Alkhatib et al., 1994 ; Horvath & Lamb, 1992
). The processed F protein reaches the cell membrane as an oligomer, possibly a trimer (reviewed by Griffin & Bellini, 1995
; Lamb, 1993
). Interaction between two heptad repeats was reported for F protein oligomerization of simian virus type 5 (SV-5) (Ghosh et al., 1997
, 1998
; Dutch et al., 1999
; Joshi et al., 1998
). In MV, one repeat is located in the amphipathic
-helix region of the C terminus adjacent to the fusion peptide (heptad repeat A) and the other extends from positions 455 to 490 (heptad repeat B). A synthetic peptide corresponding to the heptad leucine repeat B region inhibited MV fusion, whereas the peptide corresponding to positions 148 to 177 (heptad repeat A) did not (Buckland et al., 1992
; Wild & Buckland, 1997
). In addition to these domains, a limited part of the cysteine-rich region of the MV F protein was required for interaction with the H protein in recombinant F gene construction experiments using MV and canine distemper virus (CDV), which has a similar cysteine-rich region (Wild et al., 1994
). The cytoplasmic tail and Cys at position 506 or 519 located in the transmembrane domain were suggested to participate in cell fusion (Caballero et al., 1998
), modifying the interaction of F, H and membrane (M) proteins to promote assembly (Cathomen et al., 1998
).
A characteristic leucine zipper motif located between two heptad repeats is conserved among paramyxoviruses. This region interacts with two heptad repeat regions to form a stable core (Ghosh et al., 1997 , 1998
). But positions 255 to 293 of SV-5 lack the classical zipper motif, having two heptadic leucines, and the peptide corresponding to this domain did not influence the stable interaction between heptad repeats A and B (Dutch et al., 1999
). In comparison with other morbillivirus F proteins, including CDV, peste-des-petits-ruminants virus and phocine distemper virus, the amino acid relevant to position 278 of the F protein was reported to be Phe (Evans et al., 1994
). All wild-type MV isolates had Phe at position 278 of the F protein (data not shown). From the results obtained with the T7 polymerase expression system and the recombinant infectious virus cDNA, Leu at position 278 was responsible for the reduced fusion capability and Phe was responsible for extensive cell fusion. Site-directed mutagenesis experiments showed that Tyr at position 278 of the F protein also induced extensive cell fusion, but that Arg did not. Phe and Tyr are aromatic amino acids; therefore, we suppose that this region influences the stable interaction of F protein oligomerization.
Several attenuated live MV vaccines have been used worldwide. However, information on the molecular basis for attenuation is limited. MV isolated in B95a cells was fully pathogenic in cynomolgus monkeys and had lost pathogenicity after adaptation in Vero cells (Takeda et al., 1998 ). During the adaptation process, several amino acid changes occurred: two amino acid changes in the P and V regions, one in the C protein, three in the H region and two in the L region, but the critical regions were not identified (Takeda et al., 1998
). In the present study, the MV vaccine seed strain AIK-C produced a mixture of medium- and small-sized plaques in Vero cells and the consensus sequence of the F gene had either Leu or Phe at position 278. Expression experiments with different recombinant F protein expression plasmids demonstrated that the Leu at position 278 was responsible for reduced fusion capacity and Phe for marked fusion inducibility. We suppose that the AIK-C seed strain has a mixed population of MVAIK-278Leu and MVAIK-278Phe. To assess the contribution of phenotype difference in plaque formation to the attenuation of the AIK-C strain, further in vivo analysis using the recombinant MVAIK-278Leu and MVAIK-278Phe viruses is required. The AIK-C strain has another biological characteristic in that it grows well at 32 °C but not at 40 °C (Sasaki, 1974
). The introduction of Phe at position 278 of pIC-MVAIK-F278Leu did not influence the ts marker and we suppose that another mechanism exists for AIK-C. We also examined other regions of the genome to determine the domains of N, P/V/C and L related to genome replication and transcription.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alkhatib, G., Roder, J., Richardson, C., Briedis, D., Weinberg, R., Smith, D., Taylor, J., Paoletti, E. & Shen, S.-H. (1994). Characterization of a cleavage mutant of the measles virus fusion protein defective in syncytium formation. Journal of Virology 68, 6770-6774.[Abstract]
Bellini, W. J., Rota, J. S. & Rota, P. A. (1994). Virology of measles virus. Journal of Infectious Diseases 170, 515-523.
Bolotovski, V. M., Grabowsky, M., Clements, C. J., Albrecht, P., Brenner, E. R., Zargaryantzs, A. I., Litvinov, S. K. & Mikheyeva, I. V. (1994). Immunization of 6 and 9 month old infants with AIK-C, Edmonston-Zagreb, Leningrad-16 and Schwarz strains of measles vaccine. International Journal of Epidemiology 23, 1069-1077.[Abstract]
Buckland, R., Malvoisin, E., Beauverger, P. & Wild, T. F. (1992). A leucine zipper structure present in the measles virus fusion protein is not required for its tetramerization but is essential for fusion. Journal of General Virology 73, 1703-1707.[Abstract]
Caballero, M., Carabana, J., Ortego, J., Fernandez-Munoz, R. & Celma, M. L. (1998). Measles virus fusion protein is palmitoylated on transmembrane-intracytoplasmic cysteine residues which participate in cell fusion. Journal of Virology 72, 8198-8204.
Cathomen, T., Naim, H. Y. & Cattaneo, R. (1998). Measles viruses with altered envelope protein cytoplasmic tails gain cell fusion competence. Journal of Virology 72, 1224-1234.
Dutch, R. E., Leser, G. P. & Lamb, R. A. (1999). Paramyxovirus fusion protein: characterization of the core trimer, a rod-shaped complex with helices in anti-parallel orientation. Virology 254, 147-159.[Medline]
Evans, S. A., Baron, M. D., Chamberlain, R. W., Goatley, L. & Barrett, T. (1994). Nucleotide sequence comparisons of the fusion protein gene from virulent and attenuated strains of rinderpest virus. Journal of General Virology 75, 3611-3617.[Abstract]
Fuerst, T. R., Niles, E. G., Studier, W. & Moss, B. (1986). Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase Proceedings of the National Academy of Sciences, USA 83, 8122-8126.[Abstract]
Garenne, M., Leroy, O., Beau, J. P. & Sene, I. (1991). Child mortality after high-titre measles vaccines: prospective study in Senegal. Lancet 338, 903-907.[Medline]
Ghosh, J. K., Ovadia, M. & Shai, Y. (1997). A leucine zipper motif in the ectodomain of Sendai virus fusion protein assembles in solution and in membranes and specifically binds biologically-active peptides and the virus. Biochemistry 36, 15451-15462.[Medline]
Ghosh, J. K., Peisajovich, S. G., Ovadia, M. & Shai, Y. (1998). Structure-function study of a heptad repeat positioned near the transmembrane domain of Sendai virus fusion protein which blocks viruscell fusion. Journal of Biological Chemistry 273, 27182-27190.
Griffin, D. E. & Bellini, W. J. (1995). Measles virus. In Fields Virology , pp. 1267-1312. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Hirayama, M. (1983). Measles vaccines used in Japan. Reviews of Infectious Diseases 5, 495-503.[Medline]
Horvath, C. M. & Lamb, R. A. (1992). Studies on the fusion peptide of a paramyxovirus fusion glycoprotein: roles of conserved residues in cell fusion. Journal of Virology 66, 2443-2455.[Abstract]
Joshi, S. B., Dutch, R. E. & Lamb, R. A. (1998). A core trimer of the paramyxovirus fusion protein: parallels to influenza virus hemagglutinin and HIV-1 gp41. Virology 248, 20-34.[Medline]
Lamb, R. A. (1993). Paramyxovirus fusion: a hypothesis for changes. Virology 197, 1-11.[Medline]
Makino, S. (1983). Development and characteristics of live AIK-C measles virus vaccine: a brief report. Reviews of Infectious Diseases 5, 504-505.[Medline]
Mori, T., Sasaki, K., Hashimoto, H. & Makino, S. (1993). Molecular cloning and complete nucleotide sequence of genomic RNA of the AIK-C strain of attenuated measles virus. Virus Genes 7, 67-81.[Medline]
Nakayama, T., Mori, T., Yamaguchi, S., Sonoda, S., Asamura, S., Yamashita, R., Takeuchi, Y. & Urano, T. (1995). Detection of measles virus genome directly from clinical samples by reverse transcriptasepolymerase chain reaction and genetic variability. Virus Research 35, 1-16.[Medline]
Nkrumah, F. K., Osei-Kwasi, M., Dunyo, S. K., Koram, K. A. & Afari, E. A. (1998). Comparison of AIK-C measles vaccine in infants at 6 months with Schwarz vaccine at 9 months: a randomized controlled trial in Ghana. Bulletin of the World Health Organization 76, 353-359.[Medline]
Pan American Health Organization (2000). Global measles efforts. In Expanded Programme on Immunization Newsletter, vol. XXII, no. 5, p. 8.
Redd, S. C., Markowitz, L. E. & Katz, S. L. (1999). Measles vaccine. In Vaccines , pp. 222-266. Edited by S. A. Plotkin & W A. Orenstein. Philadelphia:W. B. Saunders.
Rota, J. S., Wang, Z.-D., Rota, P. A. & Bellini, W. J. (1994). Comparison of sequences of the H, F and N coding genes of measles virus strains. Virus Research 31, 317-330.[Medline]
Rota, J. S., Heath, J. L., Rota, P. A., King, G. E., Celma, M. L., Carabana, J., Fernandez-Munoz, R., Brown, D., Jin, L. & Bellini, W. J. (1996). Molecular epidemiology of measles virus: identification of pathways of transmission and implications for measles elimination. Journal of Infectious Diseases 173, 32-37.[Medline]
Sasaki, K. (1974). Studies on the modification of the live AIK measles vaccine. I. Adaptation of the further attenuated AIK measles virus (the strain of AIK-L33). to chick embryo cells. Kitasato Archives of Experimental Medicine 47, 1-12.
Schneider, H., Spielhofer, P., Kaelin, K., Dotsch, C., Radecke, F., Sutter, G. & Billeter, M. A. (1997). Rescue of measles virus using a replication-deficient vaccinia-T7 vector. Journal of Virological Methods 64, 557-564.
Sergel, T., McGinnes, L. W., Peeples, M. E. & Morrison, T. G. (1993). The attachment function of the Newcastle disease virus haemagglutininneuraminidase protein can be separated from fusion promotion by mutation. Virology 193, 717-726.[Medline]
Sutter, G., Ohlmann, M. & Erfle, V. (1995). Non-replicating vaccinia vector efficiently expresses bacteriophage T7 RNA polymerase. FEBS Letters 371, 9-12.[Medline]
Takeda, M., Kato, A., Kobune, F., Sakata, H., Li, Y., Shioda, T., Sakai, Y., Asakawa, M. & Nagai, Y. (1998). Measles virus attenuation associated with transcriptional impediment and a few amino acid changes in the polymerase and accessory proteins. Journal of Virology 72, 8690-8696.
Taylor, J., Pincus, S., Tartaglia, J., Richardson, C., Alkhatib, G., Briedis, D., Appel, M., Norton, E. & Paoletti, E. (1991). Vaccinia virus recombinants expressing either the measles virus fusion or haemagglutinin glycoprotein protect dogs against canine distemper virus challenge. Journal of Virology 65, 4263-4274.[Medline]
Tidjani, O., Grunitsky, B., Guerin, N., Levy-Bruhl, D., Lecam, N., Xuereff, C. & Tatagan, K. (1989). Serological effects of Edmonston-Zagreb, Schwarz, and AIK-C measles vaccine strains given at ages 45 or 810 months. Lancet ii, 13571360.
Weiss, R. (1991). Measles battle loses potent weapon. Science 259, 546-547.
Whittle, H. C., Mann, G., Eccles, M., ONeill, K., Jupp, L., Hanlon, P., Hanlon, L. & Marsh, V. (1988). Effects of dose and strain of vaccine on success of measles vaccination of infants aged 45 months. Lancet i, 963966.
WHO (1992). Expanded Programme on Immunization: safety of high titre measles vaccines. Weekly Epidemiological Record 67, 357364.[Medline]
Wild, T. F. & Buckland, R. (1997). Inhibition of measles virus infection and fusion with peptides corresponding to the leucine zipper region of the fusion protein. Journal of General Virology 78, 107-111.[Abstract]
Wild, T. F., Malvoisin, E. & Buckland, R. (1991). Measles virus: both the haemagglutinin and fusion glycoproteins are required for fusion. Journal of General Virology 72, 439-442.[Abstract]
Wild, T. F., Fayolle, J., Beauverger, P. & Buckland, R. (1994). Measles virus fusion: role of the cysteine-rich region of the fusion glycoprotein. Journal of Virology 68, 7546-7548.[Abstract]
Received 26 February 2001;
accepted 11 May 2001.
HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
INT J SYST EVOL MICROBIOL | MICROBIOLOGY | J GEN VIROL |
J MED MICROBIOL | ALL SGM JOURNALS |