Laboratory of Viral Pathogenesis, Institute for Virus Research, Kyoto University, 53 Shogoin-Kawahara-cho, Sakyo-Ku, Kyoto 606-8507, Japan1
Department of Microbiology, Kyoto Prefectural University of Medicine, Kyoto 602-8566, Japan2
Author for correspondence: Tomoyuki Miura. Fax +81 75 761 9335. e-mail tmiura{at}virus.kyoto-u.ac.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Interleukin-5 (IL-5) is a Th2-type cytokine with pleiotropic functions. It exhibits biological activity on cells of diverse haemopoietic lineages. Its many functions include: (1) enhancement of mediator release from human basophils; (2) induction of activated B-cell proliferation; (3) involvement in the chemoattraction, proliferation, differentiation, survival and activation of eosinophils (including stimulation of CCR3 production in eosinophils); (4) induction of immunoglobulin (Ig) secretion in primed B-cells and BCL1 (T-cell replacing factor); and (5) induction of IL-2 receptors on T- and B-cells. Th2 T-cells, mast cells, basophils and eosinophils are the known cellular sources of this cytokine (Paul, 1989 ; Takatsu et al., 1987
; Sanderson, 1992
).
A model for determining the roles of Th2-type cytokines during the course of T-lymphotropic virus replication in vivo could be provided by a recently constructed simian/human immunodeficiency chimeric virus (SHIV). SHIV was generated in order to obtain a human immunodeficiency virus type 1 (HIV-1)-related virus that would be infectious to macaque monkeys. Briefly, the virus has the HIV-1 vpr, tat, rev, vpu and env genes on a simian immunodeficiency virus (SIV) (strain mac) background. Monkeys infected with the constructed virus have been shown to be a very useful animal model for HIV infection. Gene-deleted SHIVs, which are candidates for live-attenuated vaccines (Haga et al., 1998 ; Ui et al., 1999
), can serve as a representative model of virus replication as well as a vector that expresses cytokine genes along with virus replication. However, the replication ability of these SHIVs was significantly decreased due to the gene deletions (Kuwata et al., 1995
; Haga et al., 1998
; Ui et al., 1999
).
Recently, we have succeeded in the construction and in vitro investigation of replication-competent SHIV NI-IL5 (Fig. 1), which has the nef gene replaced with the human IL-5-coding sequence (Kozyrev et al., 2001
). Co-expression of IL-5 seemed to confer a growth advantage to SHIV during replication in vitro. To analyse whether the growth advantage of NI-IL5 in vitro would be relevant in vivo, the virus was inoculated into rhesus monkeys.
|
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Inoculation of rhesus monkeys with SHIV.
Monkeys were treated in accordance with regulations approved by the Institutional Animal Care and Use Committee of the Institute for Virus Research, Kyoto University, Japan. Three rhesus macaques (MM175, MM204 and MM249) were inoculated with 104 TCID50 of NI-IL5. All animals were housed in a P3 level, monkey storage facility; health conditions were examined weekly. Blood samples, treated with sodium citrate to prevent coagulation, were collected weekly for the first 4 weeks and subsequently at 2 week intervals.
Collecting and processing of blood samples.
PBMCs and plasma samples were isolated by centrifuging the collected blood with sodium citrate anticoagulant agent. Isolated plasma samples were frozen at -80 °C and subsequently used for viral RNA, IL-5 and antibody titre quantification. Isolated PBMCs (106 cells) were used to evaluate the CD4+ and CD20+ cell ratio by FACS analysis and another 106 PBMCs were used for virus isolation.
Plasma viral RNA quantification.
SHIV RNA quantitative assays were performed by RTPCR for the SIV gag region using the primers SIVII-696F (5' GGAAATTACCCAGTACAACAAATAGG 3') and SIVII-784R (5' TCTATCAATTTTACCCAAGGCATTTA 3') and a TaqMan RTPCR kit (Perkin-Elmer). Virion RNA was extracted from plasma samples using a Viral RNA kit (QIAGEN). A labelled probe, SIVII-731T (5' Fam-TGTCCACCTGCCATTAAGCCCG-Tamra 3'), was used for the detection of PCR products. For each run, a standard curve was generated from dilutions of a standard sample, measured by the Branched DNA method (Bayer Diagnostics).
Lymphocyte immunophenotyping and haematological evaluation.
CD4+/CD3+/CD8- and CD20+/CD3- cell populations in PBMCs isolated from the macaques were calculated before and after infection with NI-IL5. PBMCs were treated with anti-CD3 (FN-18/FITC) (Becton-Dickinson), anti-CD8 (Leu-2a/PerCP) (Becton-Dickinson) and either anti-CD4 (Nu-TH/1-PE) (NICHIREI) or anti-CD20 (Leu-16/PE) (Becton Dickinson) antibody and examined on a FACScan analyser (Becton-Dickinson), according to the manufacturer's recommendations. Absolute lymphocyte counts in the blood were determined with an automated blood cell counter (F-820) (Sysmex).
Human IL-5 immunoassay (ELISA).
IL-5 levels in the plasma were determined using a commercially available Quantikine Human IL-5 ELISA kit (R&D Systems).
Anti-SHIV antibody titres.
Anti-SHIV antibody titres were determined using a commercial Serodia-HIV kit (Fujirebio). Plasma samples were isolated from sodium citrate anticoagulated blood, serially diluted and assayed routinely. The end-point titre was determined as the highest dilution to give a positive result.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Since a drop in the population of CD4+ T-cells is an early prognostic marker for the onset of immunodeficiency in both humans and macaques, the number of these cells was determined (Fig. 2A). However, the levels of CD4+ cells showed no significant change during the early stages of infection and recovered to the pre-infection state soon after 4 weeks post-infection.
|
The concentration of human IL-5 in the plasma of NI-IL5-infected macaques was examined by human IL-5 ELISA (Fig. 2C). All monkeys showed detectable levels of IL-5, with peaks of more than 14 pg/ml at 24 weeks post-infection; this was not detected in SHIV-dn-infected monkeys. The IL-5 concentration at the time of peak production was about twofold higher than the normal IL-5 concentration in plasma (<7·4 pg/ml) and may indicate IL-5 expression by NI-IL5 in vivo.
Plasma viral RNA loads were almost the same in all NI-IL5-infected monkeys, reaching peak values of more than 20000 RNA copies/ml at 1 week post-infection (Fig. 2D). As was observed in the in vitro experiments (Kozyrev et al., 2001
), NI-IL5 showed a detectable growth advantage during the early phase of infection in comparison with SHIV-dn (nef-deleted) without IL-5. NI-IL5 replication peaked 1 week earlier than SHIV-dn and was significantly higher. Furthermore, the viral RNA titre of NI-IL5 at 1 week post-infection was higher than that of NM-3rN (which has an intact nef gene). Although the viral RNA titre of NI-IL5 at 1 week post-infection was higher than that of NM-3rN, the viral titre of NI-IL5, like that of SHIV-dn, declined to an undetectable level after 4 weeks, while the viral titre of NM-3rN persisted at high levels for up to 10 weeks.
The virus could also be isolated from CD8-depleted PBMCs of each NI-IL5-infected monkey for up to 4 weeks after infection. Subsequently, no virus could been isolated. The presence of the IL-5 gene in each lot of isolated virus was confirmed by PCR using flanking primers (data not shown).
The co-expression of viral antigen and IL-5 may modify antiviral immune responses. Therefore, the effect of IL-5 over-expression on the humoral immune response was analysed by an HIV-1 particle agglutination assay (Table 1). Of the three NI-IL5-infected monkeys, two (MM175 and MM249) developed a very strong antiviral antibody response, whose titre was much higher than that in SHIV-dn-infected monkeys. Although, the antiviral antibody titre of the third monkey (MM204) was similar to the titres of the SHIV-dn-infected monkeys, when we examined the data of antibody titre at 4 and 6 weeks post-infection using an unpaired Student's t-test, there was a significant difference between SHIV-dn- and NI-IL5-infected monkeys (P<0·05).
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Similar to the in vitro results, NI-IL5 showed a detectable growth advantage during the early phase of infection in comparison with SHIV-dn (nef-deleted) without the IL-5 gene. NI-IL5 replication peaked 1 week earlier than SHIV-dn replication and was significantly higher. However, the highest peaks of replication were shown by NM-3rN, which has an intact nef gene, suggesting that IL-5 can not functionally replace the nef gene. The twofold increase in IL-5 in the plasma of NI-IL5-infected monkeys at the time of peak virus replication, as detected by ELISA, suggests the successful expression of IL-5 by NI-IL5. Despite the higher replication ability and co-expression of the Th2-type cytokine IL-5, the percentage of CD4+ cells in infected monkeys remained stable, thus providing further evidence that NI-IL5 is less capable of causing disease than the parental viruses NM-3rN and SHIV-dn.
Two of the three NI-IL5-infected monkeys developed a very strong antiviral antibody response, with titres much higher than those in SHIV-dn-infected monkeys. This result, taken together with the finding that Ig secretion is induced in primed B-cells (Paul, 1989 ; Takatsu et al., 1987
), suggests that IL-5 stimulated an antiviral antibody response in the NI-IL5-infected monkeys. If this is correct, recombinant viruses such as NI-IL5 may be useful in the development of live-attenuated vaccines.
Although antibody production was increased, no significant increase in CD20+-positive cells was observed. A non-significant increase in B-cell number, which could not be detected by flow cytomenty due to its low sensitivity, can lead to a significant increase in antibody titers.
Although there have been several attempts to clarify the role of Th1-type cytokines during the course of SIV and SHIV virus replication in vivo (Giavedoni & Yilma, 1996 ; Gundlach et al., 1997
; Kuwata et al., 2000
), no similar study has been done with Th2-type cytokines. Therefore, this report is the first to describe a positive effect of a Th2-type cytokine (IL-5) on the replication of a nef-deleted SHIV chimeric virus in vivo. Furthermore, this finding, taken together with the results of replication of viruses containing Th1-type cytokines, provides direct evidence of an essential role of Th2-type cytokines during the early stages of HIV-1 replication, which was suggested by the Th1- to Th2-type cytokine shift. However, the mechanisms of this interaction are still unclear.
IL-5 has been shown recently to be a potent inducer of CCR3 co-receptor expression on the surface of eosinophilic cells (Tiffany et al., 1998 ; Zimmermann et al., 2000
). Because CCR3 can interact with most primary and T-cell line-adapted HIV-1 Env proteins (Alkhatib et al., 1997
; Bazan et al., 1998
), it could also be used by a virus to enter eosinophils. This may occur in HIV-1 infections, since HIV-1 has been detected in bone marrow eosinophils from certain HIV-1-infected individuals (Tiffany et al., 1998
; Diagbouga et al., 1999
). Other well-known effects of IL-5 on eosinophils are that it stimulates their proliferation and differentiation, activates them and increases their survival (Paul, 1989
; Takatsu et al., 1987
). These two separate functions of IL-5 (stimulating CCR3 expression and stimulating eosinophils) could provide the virus with an expanded population of target cells.
IL-5 can induce the proliferation of activated B-cells and cytotoxic T-lymphocytes and the secretion of Ig in primed B-cells (Paul, 1989 ; Takatsu et al., 1987
; Wasik et al., 1997
). Taken together with results of serology assays, these facts suggest that IL-5 stimulated an antiviral antibody response in NI-IL5-infected monkeys. If this is correct, recombinant viruses such as NI-IL5 may be useful as models for live-attenuated or half-live DNA vaccines (Akahata et al., 2000
) because of their ability to improve the antiviral immune response.
In conclusion, we have shown that incorporation of a Th2-type cytokine (IL-5) in a gene-deleted SHIV chimera results in the over-expression of the cytokine and increases the replication and immunogenicity of immunodeficiency viruses in vivo. Our results indicate that the postulated Th1- to Th2-type cytokine shift might stimulate HIV-1 replication. Also, if the immunogenicity of a vaccine candidate such as nef-deleted SHIV can be enhanced by the co-expression of a Th2-type cytokine, it may be useful as a model for live-attenuated or half-live DNA vaccines against AIDS.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alkhatib, G., Berger, E. A., Murphy, P. M. & Pease, J. E. (1997). Importance of both extracellular and transmembrane/cytoplasmic regions. Determinants of HIV-1 coreceptor function on CC chemokine receptor 3. Journal of Biological Chemistry 272, 20420-20426.
Bazan, H. A., Alkhatib, G., Broder, C. C. & Berger, E. A. (1998). Patterns of CCR5, CXCR4, and CCR3 usage by envelope glycoproteins from human immunodeficiency virus type 1 primary isolates. Journal of Virology 72, 4485-4491.
Clerici, M. & Shearer, G. M. (1993). A Th1Th2 switch is a critical step in the etiology of HIV infection. Immunology Today 14, 107-111.[Medline]
Diagbouga, S., Aldebert, D., Fumoux, F., Capron, M. & Ledru, E. (1999). Relationship between interleukin-5 production and variations in eosinophil count during HIV infection in West Africa: influence of Mycobacterium tuberculosis infection. Scandinavian Journal of Immunology 49, 203-209.[Medline]
Giavedoni, L. D. & Yilma, T. (1996). Construction and characterization of replication-competent simian immunodeficiency virus vectors that express gamma interferon. Journal of Virology 70, 2247-2251.[Abstract]
Gundlach, B. R., Linhart, H., Dittmer, U., Sopper, S., Reiprich, S., Fuchs, D., Fleckenstein, B., Hunsmann, G., Stahl-Hennig, C. & Uberla, K. (1997). Construction, replication, and immunogenic properties of a simian immunodeficiency virus expressing interleukin-2. Journal of Virology 71, 2225-2232.[Abstract]
Haga, T., Kuwata, T., Ui, M., Igarashi, T., Miyazaki, Y. & Hayami, M. (1998). A new approach to AIDS research and prevention: the use of gene-mutated HIV-1/SIV chimeric viruses for anti-HIV-1 live-attenuated vaccines. Microbiology and Immunology 42, 245-251.[Medline]
Klein, S. A., Dobmeyer, J. M., Dobmeyer, T. S., Pape, M., Ottmann, O. G., Helm, E. B., Hoelzer, D. & Rossol, R. (1997). Demonstration of the Th1 to Th2 cytokine shift during the course of HIV-1 infection using cytoplasmic cytokine detection on single cell level by flow cytometry. AIDS 11, 1111-1118.[Medline]
Kozyrev, I. L., Miura, T., Haga, T., Kuwata, T. & Hayami, M. (2001). Construction of SIV/HIV-1 chimeric viruses having the IL-5 gene and determination of their ability to replicate and produce IL-5. Archives of Virology 146, 1051-1062.[Medline]
Kuwata, T., Igarashi, T., Ido, E., Jin, M., Mizuno, A., Chen, J. & Hayami, M. (1995). Construction of human immunodeficiency virus 1/simian immunodeficiency virus strain mac chimeric viruses having vpr and/or nef of different parental origins and their in vitro and in vivo replication. Journal of General Virology 76, 2181-2191.[Abstract]
Kuwata, T., Miura, T., Haga, T., Kozyrev, I. & Hayami, M. (2000). Construction of chimeric simian and human immunodeficiency viruses that produce interleukin 12. AIDS Research and Human Retroviruses 16, 465-470.[Medline]
Meroni, L., Trabattoni, D., Balotta, C., Riva, C., Gori, A., Moroni, M., Luisa Villa, M., Clerici, M. & Galli, M. (1996). Evidence for type 2 cytokine production and lymphocyte activation in the early phases of HIV-1 infection. AIDS 10, 23-30.[Medline]
Paul, W. E. (1989). Peripheral T lymphocytes. In Fundamental Immunology, pp. 398399. New York: Raven Press.
Sanderson, C. J. (1992). Interleukin-5, eosinophils, and disease. Blood 79, 3101-3109.[Medline]
Takatsu, K., Kikuchi, Y., Takahashi, T., Honjo, T., Matsumoto, M., Harada, N., Yamaguchi, N. & Tominaga, A. (1987). Interleukin 5, a T-cell-derived B-cell differentiation factor also induces cytotoxic T lymphocytes. Proceedings of the National Academy of Sciences, USA 84, 4234-4238.[Abstract]
Tiffany, H. L., Alkhatib, G., Combadiere, C., Berger, E. A. & Murphy, P. M. (1998). CC chemokine receptors 1 and 3 are differentially regulated by IL-5 during maturation of eosinophilic HL-60 cells. Journal of Immunology 160, 1385-1392.
Ui, M., Kuwata, T., Igarashi, T., Ibuki, K., Miyazaki, Y., Kozyrev, I. L., Enose, Y., Shimada, T., Uesaka, H., Yamamoto, H., Miura, T. & Hayami, M. (1999). Protection of macaques against a SHIV with a homologous HIV-1 Env and a pathogenic SHIV-89.6P with a heterologous Env by vaccination with multiple gene-deleted SHIVs. Virology 265, 252-263.[Medline]
Wasik, T. J., Jagodzinski, P. P., Hyjek, E. M., Wustner, J., Trinchieri, G., Lischner, H. W. & Kozbor, D. (1997). Diminished HIV-specific CTL activity is associated with lower type 1 and enhanced type 2 responses to HIV-specific peptides during perinatal HIV infection. Journal of Immunology 158, 6029-6036.[Abstract]
Zimmermann, N., Daugherty, B. L., Stark, J. M. & Rothenberg, M. E. (2000). Molecular analysis of CCR-3 events in eosinophilic cells. Journal of Immunology 164, 1055-1064.
Received 20 August 2001;
accepted 28 December 2001.