Unité de Virologie Humaine U412 INSERM, Ecole Normale Supérieure de Lyon, 46 Allée dItalie, 69364 Lyon cedex 07, France1
Author for correspondence: Alain Sergeant. Fax +33 72 72 87 77. e-mail alain.sergeant{at}cri.ens-lyon.fr
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The hallmark of latent infection in vitro is the quasi-absence of cells producing virus (Schwarzmann et al., 1998 ). However, depending on the cell line, the number of cells producing virus can be dramatically increased by adding to the culture the tumour promoter 12-O-tetradecanoylphorbol 13-acetate (TPA) (zur Hausen et al., 1978
) or sodium butyrate (BA) (Luka et al., 1979
) or anti-immunoglobulin (Takada & Ono, 1989
). It is now well documented that these treatments induce, through different pathways, the expression of two EBV transcription factors: the BZLF1-encoded factor EB1 (also called Z, Zta or ZEBRA) (Countryman & Miller, 1985
) and the BRLF1-encoded factor, called R (or Rta) (Hardwick et al., 1988
) (Fig. 1A
). Once produced, EB1 and R activate the EBV early genes (Chevallier-Greco et al., 1986
, 1989
; Countryman et al., 1986
; Rooney et al., 1989
; Urier et al., 1989
; Flemington & Speck, 1990
; Francis et al., 1999
), probably by binding as homodimers to specific DNA-binding sites located in early EBV promoters (Farrell et al., 1989
; Chang et al., 1990
; Gruffat et al., 1990
; Lieberman & Berk, 1990
). Moreover, EB1 transactivates DNA replication from ORIlyt (Cho & Tran, 1993
; Schepers & Hammerschmidt, 1993
), the origin of replication active during the lytic cycle (Hammerschmidt & Sugden, 1988
). Thus, the EB1 transcription factor is a key determinant for activation of the lytic cycle.
|
All the studies cited above considered only two genes, BZLF1 and BRLF1 located at the B95-8 EBV locus between positions 102000 and 106200 (Baer et al., 1984 ). However, a transcript originating from the BRRF1 ORF located upstream of the BRLF1 ORF and in the inverse orientation (Fig. 1A
) has also been isolated, as a 1·3 kb long cDNA called Na (Fig. 1A
), from a library of Raji cells in which expression of the EBV early genes had been activated by TPA/BA (Manet et al., 1989
).
In this report, we present a characterization of the 5' end of the BRRF1 mRNA and therefore of the promoter, PNa, at which the BRRF1 pre-mRNA is initiated. Transcription initiated at the BRRF1 promoter was activated by EB1 but not by R, both in the viral genome and in transient expression assays, and several EB1-binding sites have been detected between positions -469 and +1. A 34 kDa Na protein could be translated from the BRRF1 mRNA in rabbit reticulocyte lysate. A rabbit polyclonal antibody raised against the purified Na protein detected Na protein both in HeLa cells transfected with an BRRF1 expression vector and in Raji and Akata cells treated with TPA/BA or anti-IgG respectively. The Na protein was found predominantly in the nucleus of HeLa cells transfected with a BRRF1 expression vector. There are thus three promoters in the BZLF1/BRLF1 region of the EBV chromatin, two of which, PZ and PNa, could share regulatory elements.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plasmids
Expression vectors.
The expression vectors for EB1 (pCMV-EB1), R (pCMV-R) have been described elsewhere (Manet et al., 1989 ). The FLAG-BRRF1 expression vector (pCMV-FLAG-BRRF1) was generated by PCR using the 5' primer sequences coding both for FLAG peptide (IBI Flag system, Kodak) and for part of the N terminus of BRRF1 (5' GCCCCGGATCCACCATGGACTACAAGGACGACGATGACAAGGCTAGTAGTAACAGAGG 3') and the 3' primer (5' GCCCGAATTCAGGTAAGAG 3') complementary to the 3' end of the BRRF1 cDNA. The PCR-amplified product was digested with BamHI/EcoRI, and cloned into plasmid pRc/CMV (Invitrogen) to generate pCMV-FLAG-BRRF1. Plasmid pRc/CMV contains the cytomegalovirus (CMV) immediate-early promoter, the bovine growth hormone cleavagepolyadenylation signal and the T7 promoter. The pGST-
1-86BRRF1 bacterial expression vector was constructed by inserting a SalIBamHI fragment from pcD-Z13 (Manet et al., 1989
) into the BamHI site of pGEX-1T (Pharmacia). The GST-BRRF1 fusion protein expressed from this construction lacks amino acids 1 to 86.
Reporter genes.
The pZ-CAT reporter gene construct containing the CAT gene under the control of the pZ promoter has been described elsewhere (Urier et al., 1989 ). The pNa 1300CAT reporter gene was generated by inserting the BamHIPvuII fragment of pcD-Z13 (Manet et al., 1989
), containing 1300 bp of the Raji BRRF1 promoter, into the BamHIBglII site of plasmid pBLCAT4. The pNa 471CAT construct was obtained by a partial XhoI and SalI digestion of pNa 1300CAT. The pNa 185CAT plasmid was constructed by inserting the CfoIPvuII fragment from pcD-Z13 into the BamHIBglII site of pBLCAT4. pNa 90CAT was obtained by PCR as follows. The 5' primer contained the EBV B95-8 DNA sequences between positions 104956 and 104973 (Baer et al., 1984
) and a HindIII restriction site (5 CGGGGAAGCTTGCAGATGTTGAGCGTGGC 3'). The 3' primer (5' GGAAGACTTTCTGAGGCTAACTC 3') was complementary to the EBV B95-8 DNA sequences between positions 105160 and 105138. The PCR-amplified product was digested with HindIII and PvuII, and cloned into the HindIIIBglII site of plasmid pBLCAT4 to generate pNa 90CAT. In all the PNa promoter constructs, the promoter sequences are collinear at the 3' end.
Production of bacterial GST-
1-86Na.
GST-1-86Na and GST proteins were generated by standard techniques and purified as previously described (Manet et al., 1993
).
Production of polyclonal rabbit antiserum.
New Zealand White rabbits were inoculated with 100 µg of purified GST-1-86Na fusion protein in Freunds complete adjuvant and were then given three similar immunizations but in incomplete Freunds adjuvant, 2 weeks apart. The Na antibodies (AbNa) were purified on an agaroseGST column in order to eliminate antibodies raised against the GST protein.
Transfections and immunoblotting.
The plasmids were prepared by the alkaline lysis method and purified through two sequential ethidium bromidecaesium chloride gradients. HeLa cells were seeded at 1x106 cells per 100 mm culture plate 8 h before the transfection. Transfections were performed by the calcium precipitation method. Cells were mixed with the appropriate DNAs: typically 15 µg of DNA was used which included the expression vector, plasmids carrying the reporter genes and pUC19 up to 15 µg. EBV-infected B cells (Raji) and EBV-negative B cells (DG75) were resuspended 1 day before transfection at a density of 0·5x106 cells/ml in fresh medium. Transfections of B cells were performed by electroporation of 30 µg of reporter genes and 10 µg of EB1 or R expression vectors per 5x106 cells. Cells were shocked at 220 V, 950 µF with a Zapper electroporation unit (Bio-Rad) and then incubated in fresh medium with 10% FCS at the concentration of 0·5x106 cells/ml. Transfected cells were washed and collected 48 h after transfection. Immunoblots were performed and stained with the anti-EB1 antibody as described previously (Segouffin et al., 1996 ).
CAT assays.
CAT-ELISA was performed using the Boehringer Mannheim CAT-ELISA kit following the manufacturers instructions. After transfection, cells were lysed in 1 ml of lysis buffer, and the amount of CAT protein produced was calculated for the total protein extract.
EMSA (electrophoretic mobility shift assay).
The EB1 protein was produced in E. coli as a His-tagged protein and purified by standard techniques. For EMSA, the DNA probes used were the restriction fragments shown in Fig. 5(A). EMSA was performed by incubating 4x104 c.p.m. of 5'-32P-labelled double-stranded DNA probes with 10 µl of His-tagged EB1 for 30 min at room temperature in 20 mM HEPES (pH 7·9), 100 mM KCl, 1 mM MgCl2, 0·5 mM DTT, 10% glycerol and 0·1 µg poly(dIdC) in a final volume of 20 µl. After incubation, the mixture was loaded onto a 4·5% (w/v) polyacrylamide gel (29:1 cross-linked), 0·2x TBE, and run at room temperature at 10 V/cm for 3 h. The proteinDNA complexes were visualized by autoradiography.
|
Mapping of the BRRF1 mRNA 5'-end by S1 nuclease protection assay.
RNAs (50 µg) were resuspended in 20 µl 10 mM TrisHCl (pH 7·4), 300 mM NaCl, 0·2 mM EDTA, 80% (v/v) formamide, and mixed with an excess of double-stranded HindIIIPvuII DNA fragment [S1 DNA probe, positions 104956 and 105120 on the B95-8 sequence (Baer et al., 1984 )]. The S1 DNA probe was asymmetrically 32P-labelled at the 5' end of the PvuII site with polynucleotide kinase (see Fig. 3 B
). After heating at 80 °C for 5 min, probe and RNAs were allowed to hybridize for 18 h at 43 °C, 2 °C greater than the melting point of the DNA probe as determined experimentally in 80% formamide (data not shown).
|
Rapid amplification of cDNA ends (RACE).
Poly(A)+ RNA (2 µg) purified from Raji cells treated with TPA/BA was reverse transcribed using Mo-MuLV reverse transcriptase (New England Biolabs) and the primer 5' GGAAGACTTTCTGAGGCTAACTC 3', complementary to the 5' end of the BRRF1 cDNA [EBV B95-8 DNA sequences 105160 to 105138 (Baer et al., 1984 )]. The cDNA was purified on a green SPIN-X column (Dutscher). For tailing, 4 µl of 2 mM dATP, 4 µl of 5x tailing buffer and 20 units of Terminal Transferase (Promega) were added, and the mixture was incubated for 10 min at 37 °C and then heated at 70 °C for 15 min. The reaction mixture was diluted to 500 µl in water and 10 µl aliquots were used for amplification. For the first round of PCR, primer T0T1 (5' GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT 3') and a nested primer [5' CTGGGCTCTCTGGTCTCTGACTAC 3'; EBV B95-8 DNA sequences 105097 to 105120 (Baer et al., 1984
)] were used. For the second PCR, primer T0 (5' GACTCGAGTCGACATCGA 3') replaced T0T1. The PCR product was cloned directly into pGEM-T (Promega).
Immunofluorescence staining.
Cells were plated on sterile coverslips and transfected as described above. At 36 h after transfection, cells were washed with PBS and fixed for 15 min with 4% paraformaldehyde. The fixed cells were incubated twice (10 min each time) in PBS0·1 M glycine and once for 5 min in PBS0·1% Triton X-100. The coverslips were then washed for 10 min in PBS0·2% gelatine and incubated for 30 min at room temperature with an anti-FLAG monoclonal antibody (mAbM2) (IBI FLAG System, Kodak). After three washes in PBS, the coverslips were finally incubated with a fluorescein isothiocyanate-conjugated donkey anti-mouse IgG antibody (Jackson; 1:200 dilution), washed extensively with PBS, and mounted on microscope slides with Mowiol and PBS.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
A time-course of induction by TPA/BA of the BRRF1 transcripts (Fig. 1A, DNA probe 1) and the BZLF1-containing transcripts (Fig. 1A
, DNA probe 2) was determined in Raji cells (Fig. 2A
). As expected, no mRNA containing BRRF1 (Fig. 2A
, panel b, lane 1) or BZLF1 (Fig. 2A
, panel a, lane 1) was detectably expressed in uninduced Raji cells. However, BZLF1-containing mRNAs called Z13, Z15 and Z24 according to the name of their corresponding full-length cDNAs (Fig. 1A
), were detected at 10 h post-induction and accumulated up to 48 h post-induction (Fig. 2A
, panel a, lanes 3, 4 and 5). The time-course of appearance of BRRF1 mRNAs was similar to that of BZLF1-containing mRNAs (Fig. 2A
, panel b, lanes 3, 4 and 5). Since in Raji cells there is no lytic DNA replication due to a deletion in the BALF2 gene, induction by TPA/BA of BRRF1 transcription clearly shows that it is an EBV early gene.
|
Determination of the 5' end of the BRRF1 mRNA
We next determined the 5' end of the BRRF1 mRNA in order to locate the promoter at which it was initiated. For this, we used the RACE method. The sequence of the RACE clone with the longest 5' end generated by this approach, which is shown in Fig. 3(A), terminated at EBV B95-8 DNA sequence position 105048 (Baer et al., 1984
), 27 nucleotides longer than the BRRF1 cDNA isolated previously (Manet et al., 1989
). Thus, from the cDNA cloning and the RACE data, the size of the BRRF1 mRNA should be 1080 bases without a poly(A) tail, which is very close to the size evaluated by Northern blotting, about 1·3 kb including the poly(A) tail (Manet et al., 1989
).
To confirm the results obtained by the RACE method, the 5' end of the BRRF1 mRNAs induced by TPA/BA treatment in Raji cells was also mapped by primer extension analysis using the RT probe, a 32P-labelled single-stranded oligodeoxynucleotide [Fig. 3B; EBV B95-8 DNA sequence 105120 to 105097 (Baer et al., 1984
)] and by S1 nuclease protection assay using an asymmetrically 5'-32P-labelled double-stranded DNA fragment called the S1 probe (Fig. 3B
; coordinates from 105120 to 104956). The primer extension products and the S1 nuclease-protected DNA fragments were run on a denaturing ureapolyacrylamide gel together with the sequence of the EBV genomic region overlapping the 5' end of the BRRF1 mRNA (Fig. 3C
, lanes 1 to 10). As shown in Fig. 3(C)
, no primer extension product (lanes 1 and 2) and no S1-protected DNA fragment (lanes 5 and 6) was detected with RNAs prepared from EBV-negative DG75 cells (lanes 1 and 6) or non-induced Raji cells (lanes 2 and 5). However, with RNAs prepared from TPA/BA-treated Raji cells, a major primer extension product (lane 3, arrow RT) and two S1-nuclease-resistant DNA fragments (lane 4, arrows S1) about 72 nucleotides long were detected. In order to identify precisely the base at the 5' end, the primer extension products (lane 11) and the S1-protected DNA fragments (lane 12) were mixed with the G reaction of the DNA sequence (lane 10) and run on the polyacrylamideurea gel. By comparison with the EBV DNA sequence (lanes 7 to 10), the size of both the primer extension product (lane 11) and the S1 nuclease-protected DNA fragment (lane 12) demonstrated that the 5' end of the BRRF1 mRNA is located around position 105046. Accordingly, the BRRF1 promoter is probably located immediately upstream of this position. Interestingly, the sequence TATAAAT was found at position 105022, and could therefore be the BRRF1 promoter TATA box (see Fig. 5A
).
Transcription factor EB1 activates transcription initiated at the BRRF1 promoter
In order to further identify the BRRF1 promoter sequences responsive to EB1, 1300 bp of the DNA located upstream of position 105120 (Raji DNA, BamHI to PvuII site) were cloned upstream of the CAT reporter gene in plasmid pBLCAT4, to generate plasmid pNa 1300CAT (Fig. 4A), and a series of deletions extending from the 5' end to the 3' end of the promoter were derived from plasmid pNa 1300CAT (Fig. 4A
). As BRRF1 gene expression was transactivated in EBV-infected B cells by the EBV transcription factor EB1 (Fig. 2B
), we therefore asked whether EB1-responsive elements could be localized in the putative BRRF1 promoter. Thus, EBV-negative DG75B cells were transfected with the pNa 1300CAT reporter construct either alone or with the EB1 expression vector pCMV-EB1. As shown in Fig. 4(B)
, the weak constitutive expression of CAT protein from plasmid pNa 1300CAT (lane 1), was significantly increased in the presence of EB1 (lane 2), demonstrating in transient expression assay that DNA sequences located upstream of the BRRF1 mRNA initiation site behave like promoter sequences, and were responsive to the EB1 transcription factor. The deletion constructs were also transfected into DG75 cells, and activation of transcription of the reporter gene by EB1 was completely impaired when promoter sequences located between nucleotides -185 and -90 were deleted (Fig. 4B
, lanes 7 and 8).
|
Since the EB1 protein was present in comparable amounts in each transient transfection assay (data not shown), our results strongly suggest that the BRRF1 promoter regions located between nucleotides -185 to -90 contain EB1-binding sites essential for EB1-mediated activation of transcription in both B lymphocytes and HeLa cells.
EB1 protein binds directly to the BRRF1 promoter
To localize DNA sequences containing EB1-binding sites, EMSAs were performed with 5'-32P-labelled HaeIII DNA fragments covering the Raji BRRF1 promoter sequences between positions -470 to +90 (Fig. 5A), and His-tagged EB1. As shown in Fig. 5(B)
, lanes 1 to 10, EB1 bound efficiently to DNA fragments 124, 102, 37 and 27, with probably two binding sites in fragments 124, 102 and 27 (lanes 1, 2 and 9), since two complexes formed on these DNA fragments. EB1 also bound, although more weakly, to DNA fragments 58 and 39 (lanes 4 and 5). The EB1DNA complexes formed on DNA fragments 124, 102, 37 and 27 were specific since an excess of an unlabelled double-stranded oligonucleotide carrying the AP-1 site TGACTCA added to the binding reaction completely inhibited binding of EB1 to the 5'-32P-labelled DNA fragments (Fig. 5B
, lanes 11 to 18). However, adding an excess of the unlabelled oligonucleotide carrying the mutated AP-1 site AGACTCT to the binding reaction had no effect on the formation of the EB1DNA complexes (Fig. 5B
, lanes 19 to 26). There are therefore several binding sites for the EB1 protein in the BRRF1 promoter sequences spanning nucleotides -470 to +90.
EBV BRRF1 encodes a 34 kDa nuclear protein
The BRRF1 mRNA contains an ORF from which a putative 310 amino acid protein could be translated. However, the product of the BRRF1 gene has not as yet been visualized. In order to characterize the Na protein, we first generated an antibody specific for Na. We constructed a chimeric gene consisting of the truncated BRRF1 ORF (1-86 BRRF1) fused to the GST gene. The purified GST-
1-86 Na fusion protein was used as the immunogen to produce a rabbit polyclonal antiserum. This polyclonal antibody (AbNa) was purified as described in Methods. In order to visualize the Na protein and evaluate the quality of the Na antibody, the coding sequence for a tag peptide called FLAG, recognized by monoclonal antibody mAbM2, was inserted 5' to the BRRF1 cDNA in plasmid pCMV to generate pCMV-FLAG-BRRF1. This FLAG-Na fusion protein was translated in vitro or expressed after transfection of pCMV-FLAG-BRRF1 in HeLa cells. As shown in Fig. 6(A)
, a polypeptide of about 34 kDa was detected by mAbM2 (lanes 1 to 4) and by AbNa (lanes 5 to 8), both in vitro (lanes 2 and 6) and in HeLa cell extracts (lanes 4 and 8). These results strongly indicate that AbNa was specific for the Na protein, which was expressed as a 34 kDa polypeptide.
|
We also transfected the empty vector or the pCMV-FLAG-BRRF1 vector into HeLa cells to assess the subcellular localization of the Na protein. As shown in Fig. 6(C), an intense, even nuclear fluorescence was seen in HeLa cells transfected with the plasmid expressing the FLAG-Na protein.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Indeed, the BRRF1 promoter contains EB1-binding sites that cover at least 446 bp upstream of the site at which BRRF1 pre-mRNA is initiated (B95-8 nucleotide 105046). This pre-mRNA is transcribed in the opposite direction to the BRLF1/BZLF1 bicistronic pre-mRNAs initiated at promoter PR (Fig. 1A), and could interfere with their elongation. Moreover, deletion of the EB1-binding sites impairs the EB1-inducibility of the BRRF1 promoter in a transient expression assay. Since the PZ promoter extends more than 500 bp upstream of B95-8 nucleotide 103210 and promoter PNa probably extends more than 500 bp upstream of B95-8 nucleotide 105046 (Fig. 1A
), it is possible that the PZ and PNa promoters share control elements which have been neglected until now. Indeed, one must keep in mind that the EBV DNA is assembled in nucleosomes in the nucleus of infected cells. Therefore, the distance between regulatory elements measured in base pairs of DNA is not valid, and apparently distant DNA elements might be close by or even associated by virtue of chromatin folding and/or proteinprotein interactions.
The PNa promoter appears to contain a negative regulatory element active only in HeLa cells and located between positions -185 and -90, overlapping with EB1-responsive elements essential for the EB1-activated transcription in B cells. It is likely that this region binds a cellular repressor. However, it is not yet known whether this negative element can be transferred to an heterologous promoter and if proteins bind to it. It remains to be established if the EB1-induced transcription at promoter constructs pNa 1300CAT, pNa 470CAT and pNa 185CAT in HeLa cells (Fig. 5B), is due to EB1-induced derepression, or due to a true transcriptional activation or to a combination of the two mechanisms. It is noteworthy that in HaeIII DNA fragments 27 and 124 (Fig. 5A
), there are EB1-binding sites that are also found in the promoter construct pNa 90CAT (Fig. 5A
). However, these EB1-binding sites did not confer EB1-inducibility to the promoter sequences found in the pNa 90CAT construct (Fig. 4B
, lanes 7 and 8), suggesting that EB1 does indeed release repression of transcription at the promoter Na in HeLa cells. However, it remains to be shown if these EB1-binding sites act in synergy with the more remote PNa EB1-binding sites to counterbalance the effect of the putative repressor or are not functional per se. Site-directed mutagenesis must be used to determine if the distal EB1-binding sites act in synergy with the proximal ones in B cells, since only the deletion of the proximal sites are deleterious for the EB1-mediated activation of transcription.
In EBV-infected cells, a 34 kDa protein could be detected by Western blotting using a rabbit antibody (AbNa) raised against the GST-Na protein, but only when the viral early genes had been induced (Fig. 6B). This, plus the fact that an in vitro-translated or a transiently transfected FLAG-Na protein of 34 kDa is seen both by an anti-FLAG monoclonal antibody and by AbNa (Fig. 6A
), demonstrate that the BRRF1 gene product is a protein with an apparent molecular mass of 34 kDa. Indirect immunofluorescence also clearly indicated that the Na protein is almost exclusively located in the nuclei of transfected HeLa cells. However, the function of this EBV nuclear protein is not yet known. A search for homologies in databases revealed that the protein Na had some identities and homologies with the vacuolar ATP synthase catalytic subunit A (EC 3.6.1.34), in a region which is neither the ATP-binding site, nor identified as carrying catalytic functions. However, since the Na protein is an early gene product, it must either be involved in the regulation of early/late gene expression or in the ORIlyt-dependent EBV DNA replication. This is what we are currently investigating.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Chang, Y.-N., Dong, D. L.-Y., Hayward, G. S. & Hayward, D. (1990). The EpsteinBarr virus Zta transactivator: a member of the bZIP family with unique DNA-binding specificity and a dimerization domain that lacks the characteristic heptad leucine zipper motif. Journal of Virology 64, 3358-3369.[Medline]
Chang, P. J., Chang, Y. S. & Liu, S. T. (1998). Role of Rta in the translation of bicistronic BZLF1 of EpsteinBarr virus. Journal of Virology 72, 5128-5136.
Chevallier-Greco, A., Manet, E., Chavrier, P., Mosnier, C., Daillie, J. & Sergeant, A. (1986). Both EpsteinBarr virus (EBV) encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO Journal 5, 3243-3249.[Abstract]
Chevallier-Greco, A., Gruffat, H., Manet, E., Calender, A. & Sergeant, A. (1989). The EBV DR enhancer contains two functionally different domains: domain A is constitutive and cell specific, domain B is transactivated by the EBV early protein R. Journal of Virology 63, 615-623.[Medline]
Cho, M. & Tran, V. (1993). A concatenated form of EpsteinBarr viral DNA in lymphoblastoid cell lines induced by transfection with BZLF1. Virology 194, 838-842.[Medline]
Countryman, J. & Miller, G. (1985). Activation of expression of latent EpsteinBarr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proceedings of the National Academy of Sciences, USA 82, 4085-4089.[Abstract]
Countryman, J. K., Jenson, H., Grogan, E. & Miller, G. (1986). A 2·7-kb rearranged DNA fragment from EpsteinBarr virus capable of disruption of latency. Cancer Cells 4, 517-523.
Farrell, P. J., Rowe, D. T., Rooney, C. M. & Kouzarides, T. (1989). EpsteinBarr virus BZLF1 transactivator specifically binds to a consensus AP-1 site and is related to c-fos. EMBO Journal 8, 127-132.[Abstract]
Flemington, E. & Speck, S. H. (1990). Autoregulation of EpsteinBarr virus putative switch gene BZLF1. Journal of Virology 64, 1227-1232.[Medline]
Francis, A., Ragoczy, T., Gradoville, L., Heston, L., El-Guindy, A., Endo, Y. & Miller, G. (1999). Amino acid substitutions reveal distinct functions of serine 186 of the ZEBRA protein in activation of early lytic cycle genes and synergy with the EpsteinBarr virus R transactivator. Journal of Virology 73, 4543-4551.
Furnari, F. B., Zacny, V., Quinlivan, E. B., Kenney, S. & Pagano, J. S. (1994). RAZ, an EpsteinBarr virus transdominant repressor that modulates the viral reactivation mechanism. Journal of Virology 68, 1827-1836.[Abstract]
Gruffat, H., Manet, E., Rigolet, A. & Sergeant, A. (1990). The enhancer factor R of EpsteinBarr virus (EBV) is a sequence-specific DNA binding protein. Nucleic Acids Research 18, 6835-6843.[Abstract]
Hammerschmidt, W. & Sugden, B. (1988). Identification and characterization of ORIlyt, a lytic origin of replication of the EpsteinBarr virus. Cell 55, 427-433.[Medline]
Hardwick, J. M., Lieberman, P. M. & Hayward, D. (1988). A new EpsteinBarr virus transactivator, R, induces expression of a cytoplasmic early antigen. Journal of Virology 62, 2274-2284.[Medline]
Kieff, E. (1996). EpsteinBarr virus and its replication. In Fields Virology, pp. 2343-2395. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Le Roux, F., Sergeant, A. & Corbo, L. (1996). EpsteinBarr virus (EBV) EB1/Zta protein provided in trans and competent for the activation of productive cycle genes does not activate the BZLF1 gene in the EBV genome. Journal of General Virology 77, 501-509.[Abstract]
Lieberman, P. M. & Berk, A. J. (1990). In vitro transcriptional activation, dimerization, and DNA-binding specificity of the EpsteinBarr virus Zta protein. Journal of Virology 64, 2560-2568.[Medline]
Luka, J., Kallin, B. & Klein, G. (1979). Induction of the EpsteinBarr virus (EBV) cycle in latently infected cells by n-butyrate. Virology 94, 228-231.[Medline]
Manet, E., Gruffat, H., Trescol-Biemont, M.-C., Moreno, N., Chambard, P., Giot, J.-F. & Sergeant, A. (1989). EpsteinBarr virus bicistronic mRNA generated by facultative splicing code for two transcriptional transactivators. EMBO Journal 8, 1819-1826.[Abstract]
Manet, E., Allera, C., Gruffat, H., Mikaelian, I., Rigolet, A. & Sergeant, A. (1993). The acidic activation domain of the EpsteinBarr virus transcription factor R interacts in vitro with both TBP and TFIIB and is cell-specifically potentiated by a proline-rich region. Gene Expression 3, 48-58.
Rooney, C. M., Rowe, D. T., Ragot, T. & Farrell, P. J. (1989). The spliced BZLF1 gene of EpsteinBarr virus (EBV) transactivates an early EBV promoter and induces the virus productive cycle. Journal of Virology 63, 3109-3116.[Medline]
Schepers, A. P. D. & Hammerschmidt, W. (1993). Transcription factor with homology to the AP1 family links RNA transcription and DNA replication in the lytic cycle of EpsteinBarr virus. EMBO Journal 12, 3921-3929.[Abstract]
Schwarzmann, F., Jager, M., Prang, N. & Wolf, H. (1998). The control of lytic replication of EpsteinBarr virus in B lymphocytes (Review). International Journal of Molecular Medicine 1, 137-142.[Medline]
Segouffin, C., Gruffat, H. & Sergeant, A. (1996). Repression by RAZ of EpsteinBarr virus bZIP transcription factor EB1 is dimerization independent. Journal of General Virology 77, 1529-1536.[Abstract]
Takada, K. & Ono, Y. (1989). Synchronous and sequential activation of latently infected EpsteinBarr virus genomes. Journal of Virology 63, 445-449.[Medline]
Urier, G., Buisson, M., Chambard, P. & Sergeant, A. (1989). The EpsteinBarr virus early protein EB1 activates transcription from different responsive elements including AP-1 binding sites. EMBO Journal 8, 1447-1453.[Abstract]
zur Hausen, H., ONeil, F. J., Freese, U. K. & Hecker, E. (1978). Persisting oncogenic herpesvirus induced by the tumour promoter TPA. Nature 27, 373-375.
Received 4 January 2000;
accepted 3 April 2000.