Department of Biological Sciences, National University of Singapore, Singapore 1175431
Tropical Marine Science Institute, National University of Singapore, Singapore 1192602
Key Laboratory of Marine Biotechnology, Third Institute of Oceanography, State Oceanic Administration, Xiamen 361005, Peoples Republic of China3
Author for correspondence: Choy Hew (at Department of Biological Sciences). Fax +65 67792486. e-mail dbshead{at}nus.edu.sg
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The characteristic feature of WSSV is its bacilliform shape and a long, tail-like envelope extension (Durand et al., 1997 ; Huang et al., 2001
). The full genome sequence of WSSV (
300 kb) reported recently contains approximately 180 putative open reading frames (ORFs) (van Hulten et al., 2001
; Yang et al., 2001
). More than 80% of these putative ORFs, and their products, share no homology to any known genes or proteins in GenBank (Yang et al., 2001
). The classification status of WSSV is still unknown due to the lack of molecular information.
At least 24 protein bands (5 major and about 20 minor bands) were present in the WSSV SDSPAGE profile using Coomassie blue R-250 staining. Proteomic approaches were utilized to analyse these bands and 18 WSSV structural protein genes were identified (Huang et al., 2002 ). Of the identified WSSV structural proteins, VP28, VP26/P22, VP19 and VP466 were associated with the viral envelope, whereas VP15 and VP24 were associated with the viral nucleocapsid (Zhang et al., 2002
; Huang et al., 2002
; van Hulten et al., 2002
); VP26 was reported originally to be a WSSV nucleocapsid protein (van Hulten et al., 2000a
). VP28, VP26/P22 and VP24 may have evolved by gene duplication due to the high amino acid identity of these proteins (van Hulten et al., 2000b
). VP28 was found to play an important role in the systemic infection of shrimp by WSSV (van Hulten et al., 2001
). In this study, we report a novel WSSV protein, VP281, identified by mass spectrometry. The transmission electron microscope (TEM) immunogold-labelling method was employed to localize VP281 in the WSSV virion. Homology search and computer-assisted prediction of VP281 domains were also performed in this investigation.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Identification and characterization of VP281.
Mass spectrometry analysis of WSSV VP281 was described in a previous study (Huang et al., 2002 ). Briefly, purified WSSV virions were separated using 12% SDSPAGE with a Protean II Electrophoresis system (Bio-Rad). Protein bands were visualized using Coomassie brilliant blue R-250 staining. The target protein, band 11, was excised and subsequently in-gel-digested using sequencing-grade, modified porcine trypsin (Promega). After a brief centrifugation step, the supernatant was vacuum-dried and redissolved in 0·5% trifluoroacetic acid and 50% acetonitrile (Shevchenko et al., 1996
). For MALDI-TOF mass spectrometry (matrix-assisted laser desorption ionization mass spectrometrytime of flight analysis), the matrix used was a saturated solution of
-cyano-4-hydroxycinnamic acid in 0·5% trifluoroacetic acid and 50% acetonitrile. The sample and the matrix (1:1, vol/vol) were loaded on the target plate and MALDI-TOF spectra of the peptides were obtained with a Voyager-DE STR Biospectrometry Workstation mass spectrometer (Perseptive Biosystems). Analysis was performed in positive ion reflector mode with an accelerating voltage of 20 kV and a delayed extraction of 150 ns. Typically, 180 scans were averaged. Trypsin autoproteolysis products were used as internal calibrants. Data mining was performed using MS-FIT software against the WSSV ORF database. For Nano-ESI (nano-electrospray ionization) mass spectrometry (Q-TOF) analysis, the in-gel-digested sample was desalted using C18 ZipTip (Millipore) and dried. After dissolving in 2 µl of 50% acetonitrile and 0·5% formic acid, the sample was loaded into a metal-treated glass capillary. The capillary was then mounted on the nanoflow Z-spray source of a Q-TOF-2 mass spectrometer (Micromass). Flow rates usually varied from 8 to 16 nl/min. Instrument operation, data acquisition and analysis were performed using MASSLYNX/BIOLYNX software, version 3.5 (Micromass). Data searches against the WSSV ORF database were performed using Global Server (Micromass).
Homology analysis.
An homology search of the vp281 gene and its deduced amino sequences was performed against GenBank/EMBL, SWISSPROT and PIR databases using FASTA and BLAST programs. Protein motifs were analysed by PROSITE release 16 database (Hofmann et al., 1999 ). The identified ORF and its deduced amino acid sequence were analysed using the DNASIS and PROSIS software (Hitachi Software Engineering), respectively. Alignments of the amino sequences were conducted in CLUSTAL X (Thompson et al., 1997
) and edited in GeneDoc (Nicholas et al., 1997
).
Expression and localization of VP281.
The vp281 gene was amplified using the synthesized forward (5' CACCCATGGGTATGGCGGTAAACTTGGA 3') and reverse (5' AGACTCGAGTTATGTCCAACAATTTAAA 3') primers, containing a NcoI and an XhoI site (bold), respectively. The amplified DNA and plasmid vector were digested with NcoI and XhoI, respectively. After purification and ligation of the DNA fragments, the vp281 gene was inserted into the pET32a(+) vector downstream of a (His)6-tag and expressed in pET32a(+)-BL21 as a (His)6-tagged fusion protein. The resulting recombinant plasmid was named pET32a(+)-281. Escherichia coli BL21 competent cells were transformed with the recombinant pET32a(+)-281 plasmid and positive colonies containing transformants were screened by colony PCR; pET32a(+)-281 was confirmed by DNA sequencing. Expression and purification of (His)6-tagged VP281 were performed following the instructions of the pET System Manual, 9th edition (Novagen). The purified VP281 fusion protein was subsequently confirmed by MALDI-TOF mass spectrometry.
Antibody preparation.
The purified (His)6-VP281 fusion protein was used to immunize 3- to 4-week-old Swiss Albino mice once every 2 weeks by intradermal injection over an 8-week period. Titres of the antisera were 1:20000, as determined by ELISA (Harlow & Lane, 1988 ). Protein A Sepharose CL-4B was used to isolate anti-(His)6-VP281 IgGs, according to the manufacturers instructions (Amersham Pharmacia).
Western blot analysis.
Purified WSSV virions, viral envelope and nucleocapsid fractions were subjected to 12 % SDSPAGE. Proteins were then transfered onto nitrocellulose membranes (Bio-Rad) in electroblotting buffer (25 mM Tris, 190 mM glycine, 20% methanol) at a constant voltage of 70 V for 3 h. The membrane was immersed in blocking buffer (3% BSA, 20 mM Tris, 0·9% NaCl, 0·1% Tween-20, pH 7·2) at 4 °C overnight, followed by incubation with polyclonal mouse anti-(His)6-VP281 IgGs or mouse anti-(His)6-VP292 IgGs (1:1000) for 3 h, respectively. Subsequently, HRP-conjugated goat anti-mouse IgGs (Sigma) were used and detection was performed with a substrate solution (4-chloro-1-naphthol, Sigma).
Localization of VP281 by immunoelectron microscopy (IEM).
WSSV virions and nucleocapsids were mounted onto Formvar-coated or carbon-stabilized nickel grids, respectively. Grids were then blocked with 2% AURION BSA-C (Electron Microscopy Sciences) for 1 h and then incubated with the primary antibodies, purified polyclonal mouse anti-(His)6-VP281 IgGs (1:1000 dilution in 1% AURION BSA-C), for 2 h. After washing three to four times with 1x PBS, the grids were incubated with goat anti-mouse IgGs conjugated to 15 nm colloid gold (Electron Microscopy Sciences) for 1 h at room temperature. Grids were washed a further two times with 1xPBS and briefly stained with 2% phosphotungstic acid (PTA, pH 7·0) for 1 min. Specimens were examined under a TEM (JEOL 100 CXII). For control experiments, pre-immune mouse serum and mouse anti-(His)6 antibodies were used to replace the primary antibodies indicated above.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
Expression and purification of (His)6-VP281 fusion protein
The WSSV vp281 gene was cloned into the pET32a(+) vector and overexpressed as a (His)6-tagged fusion protein. A band corresponding to the (His)6-VP281 fusion protein was observed after inducing pET32a(+)-VP281 plasmid expression in E. coli. No protein bands were found at the same positions in both the induced and the uninduced pET32a(+) vector lanes (Fig. 3a). Recombinant (His)6-VP281 was purified using affinity chromatography (Fig. 3a
, lane 6) and the authenticity of the expressed protein was subsequently confirmed by mass spectrometry, MALDI-TOF (data not shown).
|
Localization of VP281 by IEM
Purified WSSV virions are shown in Fig. 4(a). Localization of VP281 in the WSSV virion was performed using the TEM immunogold-labelling method. Results demonstrated that the high-density gold particles were located specifically at the viral envelope (Fig. 4b
); no apparent signals can be seen in the nucleocapsids (Fig. 4c
). In a separate experiment, when mouse anti-(His)6 antibodies were used instead of anti-(His)6-VP281 IgGs, no gold labelling signals could be seen in the viral envelope (Fig. 4d
). The pre-immune mouse antiserum was also used to replace the primary antibody but no labelling signals could be observed either in WSSV virions or in nucleocapsids (data not shown). From the above observations, it was concluded that VP281 is a WSSV envelope protein.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Homology queries of the vp281 gene and its product did not reveal data of significant similarity to any other viral proteins in the NCBI database library. However, it is closely related to VP292, another newly identified WSSV structural protein (Huang et al., 2002 ), at the amino acid and nucleotide sequence level (Fig. 2b
). Such homologous genes have been found in WSSV VP28, VP26/P22 and VP24 (van Hulten et al., 2000b
) (and in some unknown ORFs in the WSSV genome database); these homologous genes were assumed to have evolved by gene duplication and were assigned to 10 gene families (van Hulten et al., 2002
). The newly identified vp281 and vp292 gene sequences were found to be identical to ORF127 and ORF118, respectively, as described by van Hulten et al. (2002)
, and were sorted into WSSV gene family 10 (van Hulten et al., 2002
). Our observations supported the proposition that VP281 and VP292 represented a new WSSV structural protein group that might have evolved by gene duplication from a common ancestral gene. Since characterization of VP292 is still in progress, it is unknown whether there are functional divergences between these two proteins. Gene duplication events are usually documented in RNA viruses and some large DNA viruses, such as closteroviruses (Boyko et al., 1992
), rhabdoviruses (Wang & Walker, 1993
), simian haemorrhagic fever virus (Godeny et al., 1998
) and alphaherpesviruses. For RNA viruses, such events were due possibly both to the strict constraints on the size of the RNA genome and to their rapid evolution (Boyko et al., 1992
); it was also presumed that the duplicated genes present in large DNA viruses might play important roles for the co-evolution of the virus and host in responding to pressures of selection (Davison, 1999
and references therein). Further research will be performed to investigate the biological importance of the presence of multiple duplicated genes with high identities in the WSSV genome.
So far a total of five WSSV envelope proteins has been identified: VP28, VP26/P22, VP19, VP466 and VP281 (Huang et al., 2002 ; van Hulten et al., 2002
and references therein). Compared to some known membrane proteins, VP281 lacks a predominant transmembrane region. The absence of transmembrane domains may suggest that this protein was produced in soluble form. Such forms were well documented in some membrane fusion proteins, pathogen receptors and some cell adhesion molecules, functioning to anchor the polypeptides to the membrane hydrophobic phase by means of locating aqueous activities or possibly interacting with some membrane-spanning components (Stevens & Arkin, 2000
).
For enveloped viruses, in vivo neutralization experiments are conducted routinely to study the function of viral envelope proteins and to identify viral protein epitopes involved in the virus infection process, which might lead to preventive approaches to control virus diseases (Burton et al., 2000 ; Schofield et al., 2000
). Of the identified WSSV envelope proteins, VP28 was found to be involved in the systemic infection of shrimp by WSSV and its polyclonal antiserum was capable of neutralizing virus infection (van Hulten et al., 2001
). Similar experiments can be conducted to elucidate if VP281 is also involved in such processes and to find out if its antiserum can play a role to prevent or inhibit WSSV infection of shrimp.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Boonyakiat, Y., Hughes, P. J., Ghazi, F. & Stanway, G. (2001). Arginineglycineaspartic acid motif is critical for human parechovirus 1 entry. Journal of Virology 75, 10000-10004.
Boyko, V. P., Karasev, A. V., Agranovsky, A. A., Koonin, E. V. & Dolja, V. V. (1992). Coat protein gene duplication in a filamentous RNA virus of plants. Proceedings of the National Academy of Sciences, USA 89, 9156-9160.[Abstract]
Burton, D. R., Williamson, R. A. & Parren, P. W. H. I. (2000). Antibody and virus: binding and neutralization. Virology 270, 13.[Medline]
Davison, A. (1999). What sequence homology tells us about the functions and origins of viral genes. Microbiology Today 26, 160-161.
Durand, S., Lightner, D. V., Redman, R. M. & Bonami, J. R. (1997). Ultrastructure and morphogenesis of white spot syndrome baculovirus (WSSV). Diseases of Aquatic Organisms 29, 205-211.
Godeny, E. K., de Vries, A. A. F., Wang, X. C., Smith, S. L. & de Groot, R. J. (1998). Identification of the leader-body junctions for the viral subgenomic mRNAs and organization of the simian hemorrhagic fever virus genome: evidence for gene duplication during arterivirus evolution. Journal of Virology 72, 862-867.
Harlow, E. & Lane, D. (editors) (1988). Antibodies: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Hofmann, K., Bucher, P., Falquet, L. & Bairoch, A. (1999). The PROSITE database, its status in 1999. Nucleic Acids Research 27, 215-219.
Huang, C., Zhang, L., Zhang, J., Xiao, L., Wu, Q., Chen, D. & Li, J. K. (2001). Purification and characterization of white spot syndrome virus (WSSV) produced in an alternate host: crayfish, Cambarus clarkii. Virus Research 76, 115-125.[Medline]
Huang, C., Zhang, X., Lin, Q., Xun, X., Hu, Z. & Hew, C.-L. (2002). Proteomic analysis of shrimp white spot syndrome viral proteins and characterization of a novel envelope protein VP466. Molecular & Cellular Proteomics 1, 223231.[Medline]
Kozak, M. (1989). The scanning model for translation: an update. Journal of Cell Biology 108, 229241.[Abstract]
Mateu, M. G., Valero, M. L., Andreu, D. & Domingo, E. (1996). Systematic replacement of amino acid residues within an ArgGlyAsp-containing loop of foot-and-mouth disease virus and effect on cell recognition. Journal of Biological Chemistry 271, 12814-12819.
Nadala, E. C. B.Jr, Tapay, L. M. & Loh, P. C. (1998). Characterization of a non-occluded baculovirus-like agent pathogenic to penaeid shrimp. Diseases of Aquatic Organisms 33, 221-229.[Medline]
Nicholas, K. B., Nicholas, H. B., Jr & Deerfield, D. W., II (1997). GeneDoc: analysis and visualization of genetic variation. EMBNEW News 4, 14.
Ruoslahti, E. & Pierschbacher, M. D. (1986). ArgGlyAsp: a versatile cell recognition signal. Cell 44, 517-518.[Medline]
Schofield, D. J., Glamann, J., Emerson, S. U. & Purcell, R. H. (2000). Identification by phage display and characterization of two neutralizing chimpanzee monoclonal antibodies to the hepatitis E virus capsid protein. Journal of Virology 74, 5548-5555.
Shevchenko, A., Wilm, M., Vorm, O. & Mann, M. (1996). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Analytical Chemistry 68, 850-858.[Medline]
Stevens, T. J. & Arkin, I. T. (2000). Turning an opinion inside-out: Rees and Eisenbergs commentary (Proteins 2000; 38:121122) on Are membrane proteins inside-out proteins?' (Proteins 1999; 36:135143). Proteins 40, 463-464.[Medline]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. (1997). The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 48764882.
van Hulten, M. C., Westenberg, M., Goodall, S. D. & Vlak, J. M. (2000a). Identification of two major protein genes of white spot syndrome virus of shrimp. Virology 266, 227-236.[Medline]
van Hulten, M. C., Goldbach, R. W. & Vlak, J. M. (2000b). Three functionally diverged major structural proteins of white spot syndrome virus evolved by gene duplication. Journal of General Virology 81, 25252529.
van Hulten, M. C., Witteveldt, J., Peters, S., Kloosterboer, N., Tarchini, R., Fiers, M., Sandbrink, H., Lankhorst, R. K. & Vlak, J. M. (2001). The white spot syndrome virus DNA genome sequence. Virology 286, 7-22.[Medline]
van Hulten, M. C., Reijns, M., Vermeesch, A. M., Zandbergen, F. & Vlak, J. M. (2002). Identification of VP19 and VP15 of white spot syndrome virus (WSSV) and glycosylation status of the WSSV major structural proteins. Journal of General Virology 83, 257-265.
Wang, Y. & Walker, P. J. (1993). Adelaide River rhabdovirus expresses consecutive glycoprotein genes as polycistronic mRNAs: new evidence of gene duplication as an evolutionary process. Virology 195, 719-731.[Medline]
Wang, Y. C., Lo, C. F., Chang, P. S. & Kou, G. H. (1998). Experimental infection of white spot baculovirus in some cultured and wild decapods in Taiwan. Aquaculture 164, 221231.
Wongteerasupaya, C., Vickers, J. E., Sriurairatana, S., Nash, G. L., Akarajamorn, A., Boonsaeng, V., Panyim, S., Tassanakajon, A., Withyachumnarnkul, B. & Flegel, T. W. (1995). A non-occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Diseases of Aquatic Organisms 21, 69-77.
Yang, F., He, J., Lin, X., Li, Q., Pan, D., Zhang, X. & Xu, X. (2001). Complete genome sequence of the shrimp white spot bacilliform virus. Journal of Virology 75, 1181111820.
Zhang, L., Zhang, J., Chen, D. & Xiao, L. (1994). Assembly of the rod-shape virus of Penaeus orientalis kishinoye in vivo. Journal of Chinese Electron Microscopy Society 13, 354363.
Zhang, X., Huang, C., Xu, X. & Hew, C. L. (2002). Transcription and identification of an envelope protein gene (p22) from shrimp white spot syndrome virus. Journal of General Virology 83, 471-477.
Received 4 June 2002;
accepted 28 June 2002.