Department of Virology, Institute of Tropical Medicine, Nagasaki University, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan1
Author for correspondence: Kouichi Morita. Fax +81 95 849 7830. email moritak{at}net.nagasaki-u.ac.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The alphaviruses are enveloped particles and their genome consists of a single-stranded, positive-sense RNA molecule of approximately 12000 nucleotides. The 5' end is capped with a 7-methylguanosine while the 3' end is polyadenylated. The non-structural proteins are translated directly from the 5' two-thirds of the genomic RNA. A subgenomic positive-strand RNA referred to as 26S RNA, identical to the 3' one-third of the genomic RNA, is transcribed from a negative-stranded RNA intermediate. This RNA serves as the mRNA for the synthesis of the viral structural proteins (Strauss & Strauss, 1986 , 1988
; Faragher et al., 1988
). According to the genomic organization of other alphaviruses, the genome of CHIK is considered to be: 5' cap-nsP1-nsP2-nsP3-nsP4-(junction region)-C-E3-E2-6K-E1-poly(A) 3'.
Alphaviruses possess conserved sequences at the 5' and 3' ends as well as the intergenic region. Conserved repeated sequence elements (RSEs) are also present in the 3' non-translated region (NTR) among alphaviruses. These conserved domains play an important role in the regulation of viral RNA synthesis (Ou et al., 1981 , 1982a
, b
, 1983
; Pfeffer et al., 1998
).
CHIK is an important human pathogen that causes a disease syndrome characterized by fever, headache, rash, nausea, vomiting, myalgia and arthralgia (Thaikruea et al., 1997 ; Diallo et al., 1999
; Powers et al., 2000
). Its association with a fatal haemorrhagic condition was reported in India (Sarkar et al., 1964
). CHIK is geographically distributed from Africa through Southeast Asia and South America, and its transmission to humans is mainly through Aedes species mosquitoes (Diallo et al., 1999
). CHIK activity in Asia has been documented since its isolation in Bangkok, Thailand, in 1958 (Hammon et al., 1960
).
Onyong-nyong virus (ONN) is considered to be a subtype of CHIK. This is because serological tests reveal a one-way antigenic cross-reactivity between the two agents (Chanas et al., 1979 ; Calisher et al., 1980
; Blackburn et al., 1995
). However, Powers et al. (2000)
reported that CHIK and ONN were two distinct viruses after phylogenetic analysis (E1 protein) and serological studies.
Although the 26S sequence of the CHIK genome (vaccine and Ross strains) is available in GenBank (accession nos L37661 and AF490259), the complete nucleotide sequence of a CHIK strain is not available. In the present study, the complete nucleotide sequence of the CHIK genome (strain S27 African prototype) was determined, and the homology of the nucleotide and amino acid sequences and the structure of the viral RNA of CHIK were precisely compared with other alphaviruses, with particular emphasis on the relationship with ONN.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
RNA extraction and RTPCR.
RNA was extracted from previously stored virus using Trizol LS (Gibco BRL) following the manufacturers instructions. To obtain short PCR products up to 1·2 kb in length, RTPCR was performed as previously described by Morita et al. (1991) .
To obtain long PCR products above 3·0 kb in length, cDNA was synthesized using Rever Tra Ace (MMLV reverse transcriptase RNaseH-; Toyobo). A 50 µl reaction volume was prepared as follows: a pre-mix consisting of 2·5 µl reverse primer (50 pmol/ µl), 5·0 µl 10 mM dNTP mix (Gibco BRL), 10·0 µl 5x RT buffer (Toyobo), 2·5 µl Prime RNase inhibitor (30 units; Eppendorf) and 27·5 µl autoclaved dH2O was prepared and kept at room temperature for 30 min to eliminate any trace of RNase activity. This pre-reaction mixture (47·5 µl) was transferred to an Eppendorf tube containing the extracted RNA pellet and mixed, and finally 2·5 µl of Rever Tra Ace (100 U/ µl) was added. After careful mixing, the RT reaction mixture (50 µl) was incubated at 55 °C for 1 h and then heated to 85 °C for 5 min to inactivate the enzyme. To remove the RNA complementary to the cDNA product, 5 units ribonuclease H (Takara) was added to the reaction mixture and incubated for 30 min at 37 °C. The long PCR amplification was performed using LA Taq polymerase (Takara) according to the manufacturers instructions, applying the following thermal cycling conditions: 94 °C for 3 min, followed by 20 cycles of 94 °C for 30 s and 68 °C for 4 min (1 kb per min) and a final extension at 72 °C for 10 min. The amplified PCR products were analysed by electrophoresis on 13% (w/v) agarose gel in TAE buffer followed by brief staining with ethidium bromide. The amplified products were visualized under UV light, excised from the gel and purified with the QIAEX-II Gel Extraction Kit (Qiagen) following the manufacturers instructions. The purified PCR products were then used for direct sequencing.
Direct sequencing of 5' and 3' ends.
The 3' terminal sequence was determined using a 3' RACE Kit (Gibco BRL) following the manufacturers instructions and the 5' terminal region was sequenced according to the CapSite cDNA manual (Nippon Gene Co.) with slight modifications. Briefly, to remove the cap structure, viral RNA was first dephosphorylated with calf intestinal alkaline phosphatase (Gibco BRL) and the dephosphorylated RNA was then incubated with tobacco acid pyrophosphatase (Nippon Gene Co.). The decapped RNA was ligated to a 30-mer oligoribonucleotide (5' AGCAUCGAGUCGGCCUUGUUGGCCUACUGG 3') using T4 RNA ligase (Takara). The ligated RNA was then subjected to RTPCR as previously described by Morita et al. (1991) using a primer complementary to the nsP1 gene (225C/CHIK nsP1; Table 1
) and a 21-mer DNA forward primer (RC primer, 5' AGCATCGAGTCGGCCTTGTTG 3') which had the exact nucleotide sequence of the oligoribonucleotide added at the 5' end of the viral RNA and which was specific for recapping. Purification of the PCR products was carried out using the methodology described above.
|
Sequencing strategy.
Nucleotide sequencing was done by the primer extension dideoxy chain termination method (Fig. 1a). For each sequencing reaction, 3090 ng purified PCR product was combined with 3·2 pmol primer and dRhodamine Terminator Cycle Sequencing Ready Reaction Mixture containing the four dye-labelled deoxynucleotide terminators (Perkin-Elmer/Applied Biosystems). The thermal cycle sequencing parameters used were as described by the manufacturer. The reaction mixture was column-purified (Centri-Sep) and the DNA vacuum-dried for 2530 min. The pellet was then resuspended in 15 µl of template suppression reagent, heated at 92 °C for 2 min and kept on ice until loaded into the sequencer (ABI Prism 310 Genetic Analyser, Perkin-Elmer/Applied Biosystems). RTPCR primers were designed using previously published partial sequences for CHIK and the conserved regions of other alphaviruses (Table 1
). For nucleotide sequencing, internal primers were designed from the nucleotide sequences of CHIK analysed in this study.
|
|
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The non-structural proteins were contained in an open reading frame of 7425 nucleotides initiated by a start codon triplet (ATG) at position 7779 and terminated at a stop codon triplet (TAG) at position 74997501. This open reading frame encoded a polyprotein of 2474 amino acids from which the individual non-structural proteins are formed by proteolytic cleavage. It was confirmed by us that CHIK, as in ONN and SF, has a sense codon (CGA encoding Arg) at the C-terminal region of nsP3 in place of the opal (TGA) termination codon present in other alphaviruses (RR, SIN, WEE, EEE, VEE and BF).
The subgenomic RNA (26S RNA) was 4327 nucleotides long excluding only the poly(A) tract at the 3' end and started at position 7498. The structural proteins were contained in an open reading frame of 3735 nucleotides initiated by a start codon at position 75677569 and terminated by a stop codon at position 1129911301. This open reading frame encodes a polyprotein of 1244 amino acids from which the individual structural proteins are formed.
Characteristics of CHIK non-structural proteins
The nsP1 was 535 amino acids long. Seventeen amino acids (QVTPNDHANARAFSHLA) conserved among alphaviruses were identified near the N terminus of nsP1 at position 3147. The nsP2, the largest non-structural protein among alphaviruses, was 798 amino acids long in the CHIK strain used in this study. CHIK contained a large net positive charge (+21) in this protein, similar to other alphaviruses. The replicase motif (GXXXXGKS, where X represents any amino acid) was found in the nsP2 of CHIK at position 186193. A three amino acid motif (CWA) of the non-structural proteinase among alphaviruses was also identified in the nsP2 of CHIK at position 478480. The degree of identity between CHIK and the other alphaviruses for the deduced nsP2 amino acid sequence ranged from 56% (WEE) to 92% (ONN) (data not shown). The nsP3 for CHIK was 530 amino acids long. This protein has a large net negative charge in CHIK and ONN (-24 and -25, respectively) compared with the net negative charges recorded for RR, SF and SIN (-12, -10 and -8, respectively). The nsP4 contained 611 amino acids. The deduced amino acid sequence identity between CHIK and the other alphaviruses for the nsP4 ranged from 71% (BF) to 91% (ONN) (data not shown) indicating that it is the best-conserved protein among the alphaviruses. The motif Gly-Asp-Asp (GDD) of the RNA polymerase was found to be located at position 465467, near the C terminus of the nsP4 sequence for the CHIK isolate presented herein.
Characteristics of CHIK structural proteins
The capsid (C) protein was 261 amino acids long and the E3 protein of CHIK consisted of 64 amino acids. The E2 protein had two possible glycosylation sites at positions 263 and 345 assigned by the sequence Asn-X-Ser/Thr (where X is any amino acid except proline) and it contained 423 amino acids. In this protein, CHIK shared an 82% amino acid sequence identity with ONN. The total length of the 6K protein was 61 amino acids. The E1 protein contained 435 amino acids, and a possible glycosylation site was identified at position 141. In this region, the amino acid sequence identity between CHIK and ONN was 88%. The E1 protein of CHIK contained an uncharged tract (residues 8096).
Percentage identities of non-structural and structural polyproteins among alphaviruses
The percentage of amino acid sequence identity between CHIK and the other alphaviruses was determined using BLAST (Altschul et al., 1990 ) for the non-structural and structural polyproteins (Table 2
). For the non-structural polyprotein, the degree of identity between CHIK and the other alphaviruses ranged from 58% to 85%, with ONN as the closest related virus and EEE, VEE, WEE, BF and SIN the most distantly related viruses. For the structural polyprotein, however, the degree of identity between CHIK and the other alphaviruses was wider, ranging from 42% to 85%. The CHIK structural polyprotein had 85% identity with that of ONN, but only 42% identity with that of WEE. A comparison of amino acid sequences from the C-terminal regions of the viral-encoded proteins among alphaviruses was made to predict the cleavage sites of CHIK generated by proteolytic activity, as described in Strauss & Strauss (1994)
.
|
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The non-structural proteins among alphaviruses contain a number of common characteristics, such as 17 consensus amino acids at the N terminus of nsP1 (Ou et al., 1983 ), a large net positive charge for nsP2 (Strauss et al., 1984
; Faragher et al., 1988
), a consensus sequence (GXXXXGKS) for mononuclear binding protein in the nsP2 (Kaariainen et al., 1987
), a three amino acid motif (CWA) for the proteinase in the nsP2 (Hardy & Strauss, 1989
), a net negative charge for nsP3 (Strauss et al., 1984
; Faragher et al., 1988
) and the RNA-dependent polymerase motif (GDD) near the C terminus of the nsP4 (Kamer & Argos, 1984
). CHIK non-structural proteins, which are reported for the first time in this paper, possess all the features common to the alphaviruses, as shown in Results. In addition, putative cleavage sites for the polyproteins of alphaviruses were well conserved, except for the cleavage sites within E3 and E2 (data not shown).
The percentage identities of non-structural and structural polyproteins between CHIK and ONN were 85% compared with 4270% between CHIK and other alphaviruses (Table 2). Thus, among the alphaviruses, ONN is the closest related virus to CHIK. Although RR and SF belong to the SF antigenic complex together with ONN and CHIK (Calisher et al., 1980
), RR and SF are more closely related to each other than to CHIK, as demonstrated by the percentage identities in Table 2
. Phylogenetic analysis (Fig. 2
) also demonstrated the same findings. These findings are in agreement with the data reported earlier by Lee et al. (1997)
and Lanciotti et al. (1998)
, who analysed the nucleotide and amino acid sequences for the structural polyprotein of another CHIK strain (GenBank accession no. L37661). We observed that the amino acid sequence of their CHIK strain showed a 96% homology to our S27 strain (Table 2
).
CHIK, RR and ONN possess very similar secondary structures at the 5' NTR (Fig. 3), which may play a role in viral RNA replication. In contrast, we identified a significant difference between CHIK and ONN at the 3' NTR, as demonstrated in Fig. 4
. We found that CHIK, RR and BF contained similar RSEs in the 3' NTR (Fig. 4A
, B
), whereas ONN possessed different types of RSE with different secondary structures, as previously reported by Levinson et al. (1990)
. One of the possible explanations for this difference is that the two viruses may have undergone divergent evolution from a common ancestral alphavirus. Also noteworthy is the fact that CHIK, RR and BF use the Aedes mosquito as their vector, while ONN is the only known alphavirus to use the Anopheles mosquito. These RSEs may have a function in determining vector specificity during virus multiplication in the respective vector mosquitoes. This should be clarified in a separate study with genetically engineered recombinant viruses.
Some researchers have considered ONN as a subtype of CHIK based on a number of immunological studies revealing a one-way antigenic cross-reactivity between the two agents (Chanas et al., 1979 ; Calisher et al., 1980
; Blackburn et al., 1995
). However, a biological difference has also been recorded between the two viruses in that ONN does not replicate in an Aedes aegypti cell line (Chanas et al., 1979
). Powers et al. (2000)
reported that CHIK and ONN are two distinct viruses after carrying out phylogenetic analysis on the E1 protein and serological studies.
Comparing the nucleotide sequence of the E1 protein for previously published CHIK isolates RSU1, H15483, H2123 and Ag41855 (Powers et al., 2000 ) with CHIK in our study, the degree of identity ranged from 95 to 98%. The nucleotide sequence similarity of the E1 protein between the two isolates A234 and IbH12628 of ONN (Powers et al., 2000
) was 97%. However, the nucleotide sequence identity of the E1 protein among CHIK isolates and ONN isolates ranged from 74 to 77%, and among CHIK isolates and VEE isolates P676 and Trinidad donkey (Kinney et al., 1992
) ranged from 56 to 57%. Therefore, based on (i) nucleotide and amino acid homology among alphaviruses, (ii) data from phylogenetic analysis, and (iii) the characteristics of the RSEs found in the 3' NTR, it can be concluded that CHIK and ONN, although closely related, are in fact two distinct viruses.
In this study, we found an internal poly(A) tract within the 3' NTR of the CHIK genome. The length of the I-poly(A) varied from 19 to 106 adenine nucleotides among the six clones examined (Table 3). None of them was identical in length. This means that the internal poly(A) was generated not by an accidental insertion of an adenine oligonucleotide but, most likely, by an authentic polyadenylation capacity of CHIK RNA polymerase, which may generate poly(A) at the 3' termini. We believe that in the region adjacent to the I-poly(A) of the S27 strain there must be a signal sequence that triggers or influences the occurrence of polyadenylation. We base this conclusion on the observation that in all six clones analysed, the poly(A) sequence started at the same position, i.e. nucleotide position 11438 (Fig. 1b
).
Barr et al. (1997) reported that in the junction region of the vesicular stomatitis virus (VSV), the tetranucleotide 3' AUAC 5' followed by a U7 tract was implicated in the synthesis of poly(A) and termination of mRNA transcription. The process by which a poly(A) tail is templated by the U7 tract is called polymerase slippage. In this process the VSV polymerase uses the U7 stretch as a template beginning a cycle that involves backward slippage of the polymerase on the nascent strand, followed by a cycle of nascent chain elongation and further slippage. It was also reported that AU-rich fragments preceding a U7 template, such as the tetranucleotides 3' AUAA 5', 3' AUAU 5' and 3' AUAG 5', can act as the signal for polymerase slippage but they are unable to signal termination (Barr & Wertz, 2001
). In the 3' NTR of CHIK, no consensus sequence was identified between the sequences adjacent to the I-poly(A) and 3' poly(A), except that both sequences were AT(U) rich. We are currently unsure about the mechanism by which the I-poly(A) tract is created and whether the I-poly(A) is really generated by the same mechanism that synthesizes the 3' poly(A). However, the existence of the I-poly(A) strongly suggests that the poly(A) is generated by a template-dependant mechanism similar to the polymerase slippage seen for VSV, rather than simple nucleotidyl-terminal-transferase-type enzymic activity.
At the moment, it is unlikely that the I-poly(A) is a typical feature of the CHIK genome, because I-poly(A) does not exist in the 3' NTR CHIK sequence obtained by Pfeffer et al. (1998) , who reported a six-adenine sequence (U6 in the template RNA) at the same position of the same strain (S27). Also, two other CHIK strains isolated in Malaysia in 1998 possess four adenines at the same position (data not shown). Before this experiment, the CHIK strain S27 of our laboratory had been passaged more than 50 times using the Aedes albopictus clone C6/36 cell line (Igarashi, 1978
). Because Pfeffers CHIK (S27) and our CHIK possessed exactly the same nucleotide sequence for the 3' NTR, except for the I-poly(A), it could be speculated that due to a history of multiple passage, one or more extra T (U in the template RNA) could have been added to the U6 tract of the viral RNA, creating the right template to initiate polyadenylation at that position. Further clarification of the process by which the I-poly(A) was generated may provide a clue to understanding fully the mechanism of polyadenylation among the alphaviruses.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
b Present address: Kyushu University of Health and Welfare, Yoshinomachi 1714-1, Nobeoka City, Miyazaki 882-8508, Japan.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Barr, J. N. & Wertz, G. W. (2001). Polymerase slippage at vesicular stomatitis virus gene junctions to generate polyA is regulated by the upstream 3'-AUAC-5' tetranucleotide: implications for the mechanism of transcription termination. Journal of Virology 75, 6901-6913.
Barr, J. N., Whelan, S. P. J. & Wertz, G. W. (1997). Cis-acting signals involved in termination of vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the U7 signal for polyadenylation. Journal of Virology 71, 8718-8725.[Abstract]
Blackburn, N. K., Besselaar, T. G. & Gibson, G. (1995). Antigenic relationship between Chikungunya virus strains and onyong-nyong virus using monoclonal antibodies. Research Virology 146, 69-73.
Calisher, C. H., Shope, R. E., Brandt, W., Casals, J., Karabatsos, N., Murphy, F. A., Tesh, R. B. & Wiebe, M. E. (1980). Proposed antigenic classification of registered arboviruses. I. Togaviridae, Alphavirus. Intervirology 14, 229-232.[Medline]
Chanas, A. C., Hubalek, Z., Johnson, B. K. & Simpson, D. I. H. (1979). A comparative study of onyong-nyong virus with Chikungunya virus and plaque variants. Archives of Virology 59, 231-238.[Medline]
Diallo, M., Thonnon, J., Traore-Lamizana, M. & Fontenille, D. (1999). Vectors of Chikungunya virus in Senegal: current data and transmission cycles. American Journal of Tropical Medicine and Hygiene 60, 281-286.
Faragher, S. G., Meek, A. D. J., Rice, C. M. & Dalgarno, L. (1988). Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus. Virology 163, 509-526.[Medline]
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Felsenstein, J. (1993). PHYLIP: phylogeny inference package, version 3.5c. University of Washington, Seattle, Washington, USA.
Hammon, W. McD., Rudnick, A. & Sather, G. E. (1960). Viruses associated with epidemic hemorrhagic fevers of the Philippines and Thailand. Science 131, 1102-1103.
Hardy, W. R. & Strauss, J. H. (1989). Processing the nonstructural polyproteins of Sindbis virus: nonstructural proteinase is in the C-terminal half of nsP2 and functions both in cis and in trans. Journal of Virology 63, 4653-4664.[Medline]
Igarashi, A. (1978). Isolation of a Singhs Aedes albopictus cell clone sensitive to dengue and Chikungunya viruses. Journal of General Virology 40, 531-544.[Abstract]
Kaariainen, L., Takkinen, K., Keranen, S. & Soderlund, H. (1987). Replication of the genome of alphaviruses. Journal of Cell Science 7(Suppl.), 231250.
Kamer, G. & Argos, P. (1984). Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Research 12, 7269-7282.[Abstract]
Kinney, R. M., Tsuchiya, K. R., Sneider, J. M. & Trent, D. W. (1992). Genetic evidence that epizootic Venezuelan equine encephalitis (VEE) viruses may have evolved from enzootic VEE subtype I-D virus. Virology 191, 569-580.[Medline]
Lanciotti, R. S., Ludwig, M. L., Rwaguma, E. B., Lutwama, J. J., Kram, T. M., Karabatsos, N., Cropp, B. C. & Miller, B. R. (1998). Emergence of epidemic onyong-nyong fever in Uganda after a 35-year absence: genetic characterization of the virus. Virology 252, 258-268.[Medline]
Lee, E., Stocks, C., Lobigs, P., Hislop, A., Straub, J., Marshall, I., Weir, R. & Dalgarno, L. (1997). Nucleotide sequence of the Barmah forest virus genome. Virology 227, 509-514.[Medline]
Levinson, R. S., Strauss, J. H. & Strauss, E. G. (1990). Complete sequence of the genomic RNA of onyong-nyong virus and its use in the construction of alphavirus phylogenetic trees. Virology 175, 110-123.[Medline]
Morita, K., Tanaka, M. & Igarashi, A. (1991). Rapid identification of dengue virus serotypes by using polymerase chain reaction. Journal of Clinical Microbiology 29, 2107-2110.[Medline]
Ou, J.-H., Strauss, E. G. & Strauss, J. H. (1981). Comparative studies of the 3'-terminal sequences of several alphavirus RNAs. Virology 109, 281-289.[Medline]
Ou, J.-H., Trent, D. W. & Strauss, J. H. (1982a). The 3'-noncoding regions of alphavirus RNAs contain repeating sequences. Journal of Molecular Biology 156, 719-730.[Medline]
Ou, J.-H., Rice, C. M., Dalgarno, L., Strauss, E. G. & Strauss, J. H. (1982b). Sequence studies of several alphavirus genomic RNAs in the region containing the start of the subgenomic RNA. Proceedings of the National Academy of Sciences, USA 79, 5235-5239.[Abstract]
Ou, J.-H., Strauss, E. G. & Strauss, J. H. (1983). The 5'-terminal sequences of the genomic RNAs of several alphaviruses. Journal of Molecular Biology 168, 1-15.[Medline]
Page, R. D. M. (1996). Treeview: an application to display phylogenetic trees on personal computers. Cabios 12, 357-358.[Medline]
Pfeffer, M., Kinney, R. M. & Kaaden, O.-R. (1998). The alphavirus 3'-nontranslated region: size heterogeneity and arrangement of repeated sequence elements. Virology 240, 100-108.[Medline]
Porterfield, J. H. (1980). Antigenic characteristics and classification of Togaviridae. In The Togaviruses , pp. 13-46. Edited by R. W. Schlesinger. New York:Academic Press.
Powers, A. M., Brault, A. C., Tesh, R. B. & Weaver, S. C. (2000). Re-emergence of chikungunya and onyong-nyong viruses: evidence for distinct geographical lineages and distant evolutionary relationships. Journal of General Virology 81, 471-479.
Ross, R. W. (1956). The Newala epidemic. III. The virus: isolation, pathogenic properties and relationship to the epidemic. Journal of Hygiene 54, 177-191.[Medline]
Sarkar, J. K., Chatterjee, S. N. & Chakravarty, S. K. (1964). Haemorrhagic fever in Calcutta: some epidemiological observations. Indian Journal of Medical Research 52, 651-659.[Medline]
Strauss, E. G. & Strauss, J. H. (1986). Structure and replication of the alphavirus genome. In The Togaviridae and Flaviviridae , pp. 35-90. Edited by S. Schlesinger & M. J. Schlesinger. New York:Plenum Press.
Strauss, J. H. & Strauss, E. G. (1988). Evolution of RNA viruses. Annual Review of Microbiology 42, 657-683.[Medline]
Strauss, J. H. & Strauss, E. G. (1994). The alphaviruses: gene expression, replication and evolution. Microbiological Reviews 58, 491-562.[Abstract]
Strauss, E. G., Rice, C. M. & Strauss, J. H. (1984). Complete nucleotide sequence of the genomic RNA of Sindbis virus. Virology 133, 92-110.[Medline]
Thaikruea, L., Charearnsook, O., Reanphumkarnkit, S., Dissomboon, P., Phonjan, R., Ratchbud, S., Kounsang, Y. & Buranapiyawong, D. (1997). Chikungunya in Thailand: a re-emerging disease? Southeast Asian Journal of Tropical Medicine and Public Health 28, 359-364.[Medline]
Van Regenmortel, M. H. V., Fauquet, C. M., Bishop, D. H. L., Carstens, E. B., Estes, M. K., Lemon, S. M., Maniloff, J., Mayo, M. A., McGeoch, D. J., Pringle, C. R. & Wickner, R. B (editors) (2000). Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses. San Diego: Academic Press.
Received 5 February 2002;
accepted 20 August 2002.