Division of Viral Hepatitis, Centers for Disease Control and Prevention, Atlanta, GA 30333, USA1
Georgetown University, Washington DC, USA2
Second Department of Medicine, Nagoya City University Medical School, Nagoya 467-8601, Japan3
Author for correspondence: Betty H. Robertson. Fax +1 404 639 1563. e-mail bjr1{at}cdc.gov
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() |
---|
![]() |
Main text |
---|
![]() ![]() ![]() ![]() |
---|
Three phylogenetically distinct genotypes (I, II and III) of HDV that have different geographical distributions have been identified. Genotype I is found in North America, Europe, Africa, east and west Asia and the South Pacific (Zhang et al., 1996 ; Shakil et al., 1997
; Niro et al., 1997
). Genotype II has been found only in east Asia (Imazeki et al., 1991
; Wu et al., 1995
, 1998
; Lee et al., 1996
; Sakugawa et al., 1999
), while genotype III has been identified only among cases in South America (Casey et al., 1993
, 1996
).
There have been reports of severe or fulminant hepatitis with unique clinical and morphological features in the northern regions of South America as far back as the 1930s. These infections, commonly known as Santa Marta hepatitis or Labrea hepatitis, have been identified as HBV and HDV super-or co-infections (Ljunggren et al., 1985 ; Buitrago et al., 1986a
, b
; Bensabath et al., 1987
; Colichon et al., 1988
; Gayotto, 1991
). Hepatitis outbreaks with these clinical features and serological markers occurred in an epidemic identified in the Yucpa Amerindians in the northwestern portion of Venezuela between 1979 and 1981 (Hadler et al., 1984
). In this study, the complete HDV genome isolated from three individuals who developed hepatitis during this outbreak was sequenced and evaluated.
Serum samples from the three individuals, who were residents of three distinct but closely located villages, were tested and found to be positive for HBV and HDV markers, as described previously (Hadler et al., 1992 ; Fields et al., 1986
). Samples were collected in 1990, although the infections occurred in the early 1980s. Nucleic acid was extracted from 50 µl of serum using the MasterPure RNA Purification kit (Epicentre). cDNA was prepared by reverse transcription using random hexamers (Boehringer Mannheim) and Moloney murine leukaemia virus reverse transcriptase (Boehringer Mannheim). One-tenth of the cDNA sample was amplified by PCR using Taq polymerase (Boehringer Mannheim). The conditions for PCR were 2 min at 95 °C, 45 cycles of 1 min at 94 °C, 1 min at 55 °C and 3 min at 72 °C and 1 cycle of 7 min at 72 °C. Amplicons for sequencing the entire HDV genome consisted of five overlapping fragments. Fragments were amplified using the primer pairs 308P (5' TCCAGAGGACCCCTTCGGCGAACA 3') and 720N (5' CTCGGATCGTTGCCCAGCCGG 3') for nucleotide positions 307737 (nucleotide positions are according to the Italy isolate; Wang et al., 1986
); 688P (5' TGGCCGGCATGGCCCCAGC 3') and 889N (5' TTCCTCTTCGGGTCGGCATGGGAT 3') for nucleotide positions 685909; 853P (5' CGGATGCCCAGGTCGGACC 3') and 1267N (5' GAAGGAAGGCCCTGGAGAACAAGA 3') for nucleotide positions 8551287; 1267P (5' TCTTGTTCTCCAGGGCCTTCCTTC 3') and 503N (5' CCCCGGGATAAGCCTCACTCG 3') for nucleotide positions 1264485; and 887P (5' GAGATCCCATGCCGACCCGAAGAG 3') and 1360N (5' GGCGAGAGGACATGGAGATTG 3') for nucleotide positions 8831374.
Using the PCR primers above, PCR products were sequenced in the presence of dRhodamine terminators using a 377A DNA Sequencer (Applied Biosystems). An internal primer pair, 1660P (5' AGCTCTCGAACGCTCTTCCG 3') and 60N (5' ATTCGCTCTCTTTCTTCTCC 3'), was also used to sequence the fragment spanning nucleotide positions 1264485. The Wisconsin package, version 10.1 (Genetics Computer Group, Madison, WI, USA), and the ODEN computer program, version 1.1.1 (Ina, 1994 ), were used for sequence analyses.
The three complete HDV genomes were 1673 (VnzD8349), 1672 (VnzD8375) and 1674 (VnzD8624) nucleotides in length and were closely related to each other (97·098·5% nucleotide identity). The percentage identity to the other complete genotype III isolate, Peru-1, was 8989·6% (Casey et al., 1993 ), while the identity to genotype I and II sequences was only 63·867·1% (Wang et al., 1986
; Imazeki et al., 1991
; Wu et al., 1998
). Phylogenetic analysis of the Venezuelan HDV full-length genome sequences and other available full-length genome sequences was performed. Initial alignments were made using the GCG Pile-Up program. However, when we reviewed the computer-generated alignments, we noted multiple regions of apparent identity in the hypervariable region (Lee et al., 1996
) that were not computer-aligned; therefore, alignments were manually corrected to produce optimal matching of the bases. Intermittent conserved segments were aligned first, followed by alignment of the sequences between the conserved segments, which were aligned for highest homology, inserting gaps if needed. The phylogenetic tree was constructed using the neighbour-joining method (Saitou & Nei, 1987
), with genetic distances calculated using the six-parameter method (Gojobori et al., 1982
). The tree showed that the three Venezuelan isolates clustered with the previously reported genotype III isolate, Peru-1, and were distinctly distant from the isolates reported as genotypes I or II (Fig. 1a
). A more inclusive phylogenetic analysis using 30 partial HDV sequences (nucleotide positions 9111260) was also performed (Fig. 1b
). Once again, the Venezuelan sequences clustered with the two Peruvian and one Colombian isolate, confirming that the three Venezuelan isolates belong to genotype III.
|
When the translated amino acid sequences of the Venezuelan isolates were compared to each other and to the genotype III Peru-1 isolate, amino acid identity within HDAg among the genotype III Venezuelan isolates was 94·098·1%, and between the Venezuelan and the Peru-1 isolates, amino acid identity was 87·089·3%. Each Venezuelan sequence had unique amino acid substitutions, the majority (11/13) of which were clustered within the first 90 amino acids (Fig. 2a and b
, i
). This amino acid pattern was also seen when the three Venezuelan isolates were compared with the other available genotype III sequences (Fig. 2a
and b
, ii
). Amino acid variability may reflect the fact that genotype III-specific amino acids within the amino terminal region of small-HDAg (S-HDAg) are not critical for replication of genotype III RNA (Casey & Gerin, 1998
). However, the hydrophobic amino acids at positions 44, 51 and 58, which are thought to be important for HDAg dimerization (Xia et al., 1992
; Rozzelle et al., 1995
), were all conserved; basic amino acids in the nuclear localization signal (NLS) (Xia et al., 1992
) were also conserved among genotype III sequences.
|
L-HDAg originates from S-HDAg as a result of RNA editing. RNA editing at nucleotide 1012 replaces the stop codon (UAG) of S-HDAg with a tryptophan codon (UGG), resulting in the translation of 1920 additional amino acids to generate L-HDAg (Luo et al., 1990 ; Wang et al., 1992
; Casey et al., 1992
). Genotype I sequences have a mixture of sequences with either an A residue or a G residue at the RNA-editing site (Fig. 3a
, nucleotide 1012). The six genotype III sequences available for analysis all have an A residue at the RNA-editing site (Fig. 3b
, nucleotide 1014). It has been shown for genotype I that a particular base-paired structure is formed between nucleotides surrounding the edited A residue and those around nucleotide 580, which is on the opposite side of the branched rod structure typical of HDV RNA (Fig. 3c
) (Casey et al., 1992
; Casey & Gerin, 1995
). The structure formed by genotype III RNA is significantly different from the genotype I RNA structure in that there is a bulge of five nucleotides, including the A residue, in the region of sequence to be edited (Fig. 3d
). This deviation, which is conserved in all of the additional genotype III sequences reported here (Fig. 3b
), is likely to be significant for the editing activity of genotype III RNA, as site-directed mutagenesis has shown that editing of the HDV genotype I RNA is extremely sensitive to the identity of the base opposite the A residue (Casey et al., 1992
; Casey & Gerin, 1995
). This deviation could also result in less RNA editing, thereby limiting the amount of L-HDAg produced and could influence the pathogenesis of HDV infection (Govindarajan et al., 1993
; Tang et al., 1994
; Yang et al., 1995
); L-HDAg is postulated to reduce genomic replication and limit infection (Glenn & White, 1991
; Chao et al., 1990
). This might be reflected in genotype III infections, which appear to cause a more severe form of HDV infection (Casey et al., 1993
, 1996
). Additional information on the sequences associated with RNA editing and the different HDV genotypes is needed to conclusively identify the relationship between HDV RNA editing and severe liver disease.
|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() |
---|
Bensabath, G., Hadler, S. C., Soares, M. C., Fields, H., Dias, L. B., Popper, H. & Maynard, J. E. (1987). Hepatitis delta virus infection and Labrea hepatitis. Prevalence and role in fulminant hepatitis in the Amazon Basin. Journal of the American Medical Association 258, 479-483.[Medline]
Bonino, F., Heermann, K. H., Rizzetto, M. & Gerlich, W. H. (1986). Hepatitis delta virus: protein composition of delta antigen and its hepatitis B virus-derived envelope. Journal of Virology 58, 945-950.[Medline]
Buitrago, B., Hadler, S. C., Popper, H., Thung, S. N., Gerber, M. A., Purcell, R. H. & Maynard, J. E. (1986a). Epidemiologic aspects of Santa Marta hepatitis over a 40-year period. Hepatology 6, 1292-1296.[Medline]
Buitrago, B., Popper, H., Hadler, S. C., Thung, S. N., Gerber, M. A., Purcell, R. H. & Maynard, J. E. (1986b). Specific histologic features of Santa Marta hepatitis: a severe form of hepatitis delta virus infection in northern South America. Hepatology 6, 1285-1291.[Medline]
Casey, J. L. & Gerin, J. L. (1995). Hepatitis D virus RNA editing: specific modification of adenosine in the antigenomic RNA. Journal of Virology 69, 7593-7600.[Abstract]
Casey, J. L. & Gerin, J. L. (1998). Genotype-specific complementation of hepatitis delta virus RNA replication by hepatitis delta antigen. Journal of Virology 72, 2806-2814.
Casey, J. L., Bergmann, K. F., Brown, T. L. & Gerin, J. L. (1992). Structural requirements for RNA editing in hepatitis delta virus: evidence for a uridine-to-cytidine editing mechanism. Proceedings of the National Academy of Sciences, USA 89, 7149-7153.[Abstract]
Casey, J. L., Brown, T. L., Colan, E. J., Wignall, F. S. & Gerin, J. L. (1993). A genotype of hepatitis D virus that occurs in northern South America. Proceedings of the National Academy of Sciences, USA 90, 9016-9020.[Abstract]
Casey, J. L., Niro, G. A., Engle, R. E., Vega, A., Gomez, H., McCarthy, M., Watts, D. M., Hyams, K. C. & Gerin, J. L. (1996). Hepatitis B virus (HBV)/hepatitis D virus (HDV) coinfection in outbreaks of acute hepatitis in the Peruvian Amazon basin: the roles of HDV genotype III and HBV genotype F. Journal of Infectious Diseases 174, 920-926.[Medline]
Chao, M., Hsieh, S. Y. & Taylor, J. (1990). Role of two forms of hepatitis delta virus antigen: evidence for a mechanism of self-limiting genome replication. Journal of Virology 64, 5066-5069.[Medline]
Chao, Y. C., Tang, H. S. & Hsu, C. T. (1994). Evolution rate of hepatitis delta virus RNA isolated in Taiwan. Journal of Medical Virology 43, 397-403.[Medline]
Colichon, A. A., Sjogren, M. H., Galvez, J. D., Campomanes, E. E. & Cantella, R. A. (1988). Hepatitis B and delta hepatitis in inhabitants of the Peruvian Amazon basin. In Viral Hepatitis and Liver Disease , pp. 425-426. Edited by A. J. Zuckerman. New York:Alan R. Liss.
Felsenstein, J. (1985). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Fields, H. A., Govindarajan, S., Margolis, H. S., Schable, C. D., Ebert, J. W. & Maynard, J. E. (1986). Experimental transmission of the delta virus to a hepatitis B chronic carrier chimpanzee with the development of persistent delta carriage. American Journal of Pathology 122, 308-314.[Abstract]
Gayotto, L. C. (1991). Hepatitis delta in South America and especially in the Amazon region. Progress in Clinial and Biological Research 364, 123-135.
Glenn, J. S. & White, J. M. (1991). Trans-dominant inhibition of human hepatitis delta virus genome replication. Journal of Virology 65, 2357-2361.[Medline]
Gojobori, T., Ishii, K. & Nei, M. (1982). Estimation of average number of nucleotide substitutions when the rate of substitution varies with nucleotide. Journal of Molecular Evolution 18, 414-423.[Medline]
Govindarajan, S., Hwang, S. & Lai, M. M. (1993). Comparison of the presence of two forms of delta antigen in liver tissues of acute versus chronic delta hepatitis. Progress in Clinical and Biological Research 382, 139-143.[Medline]
Hadler, S. C., De, M. M., Ponzetto, A., Anzola, E., Rivero, D., Mondolfi, A., Bracho, A., Francis, D. P., Gerber, M. A., Thung, S., Gerin, J., Maynard, J. E., Popper, H. & Purcell, R. H. (1984). Delta virus infection and severe hepatitis. An epidemic in the Yucpa Indians of Venezuela. Annals of Internal Medicine 100, 339-344.[Medline]
Hadler, S. C., de Monzon, M. A., Rivero, D., Perez, M., Bracho, A. & Fields, H. A. (1992). Epidemiology and long-term consequences of hepatitis delta virus infection in the Yucpa Indians of Venezuela. American Journal of Epidemiology 136, 1507-1516.[Abstract]
Imazeki, F., Omata, M. & Ohto, M. (1991). Complete nucleotide sequence of hepatitis delta virus RNA in Japan. Nucleic Acids Research 19, 5439.[Medline]
Ina, Y. (1994). ODEN: a program package for molecular evolutionary analysis and database search of DNA and amino acid sequences. Computer Applications in the Biosciences 10, 11-12.[Medline]
Lee, C. Z., Lin, J. H., Chao, M., McKnight, K. & Lai, M. M. (1993). RNA-binding activity of hepatitis delta antigen involves two arginine-rich motifs and is required for hepatitis delta virus RNA replication. Journal of Virology 67, 2221-2227.[Abstract]
Lee, C. M., Changchien, C. S., Chung, J. C. & Liaw, Y. F. (1996). Characterization of a new genotype II hepatitis delta virus from Taiwan. Journal of Medical Virology 49, 145-154.[Medline]
Ljunggren, K. E., Patarroyo, M. E., Engle, R., Purcell, R. H. & Gerin, J. L. (1985). Viral hepatitis in Colombia: a study of the hepatitis of the Sierra Nevada de Santa Marta. Hepatology 5, 299-304.[Medline]
Luo, G. X., Chao, M., Hsieh, S. Y., Sureau, C., Nishikura, K. & Taylor, J. (1990). A specific base transition occurs on replicating hepatitis delta virus RNA. Journal of Virology 64, 1021-1027.[Medline]
Makino, S., Chang, M. F., Shieh, C. K., Kamahora, T., Vannier, D. M., Govindarajan, S. & Lai, M. M. (1987). Molecular cloning and sequencing of a human hepatitis delta () virus RNA. Nature 329, 343-346.[Medline]
Nakano, T., Lu, L., Hu, X., Mizokami, M., Orito, E., Shapiro, C. N., Hadler, S. C. & Robertson, B. H. (2001). Characterization of hepatitis B virus genotypes among Yucpa Indians in Venezuela. Journal of General Virology 82, 359-365.
Niro, G. A., Smedile, A., Andriulli, A., Rizzetto, M., Gerin, J. L. & Casey, J. L. (1997). The predominance of hepatitis delta virus genotype I among chronically infected Italian patients. Hepatology 25, 728-734.[Medline]
Norder, H., Hammas, B., Lee, S.-D., Bile, K., Courouce, A.-M., Mushahwar, I. K. & Magnius, L. O. (1993). Genetic relatedness of hepatitis B viral strains of diverse geographical origin and natural variations in the primary structure of the surface antigen. Journal of General Virology 74, 1341-1348.[Abstract]
Perrotta, A. T. & Been, M. D. (1991). A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature 350, 434-436.[Medline]
Rizzetto, M., Canese, M. G., Gerin, J. L., London, W. T., Sly, D. L. & Purcell, R. H. (1980). Transmission of the hepatitis B virus-associated delta antigen to chimpanzees. Journal of Infectious Diseases 141, 590-602.[Medline]
Rozzelle, J. J., Wang, J. G., Wagner, D. S., Erickson, B. W. & Lemon, S. M. (1995). Self-association of a synthetic peptide from the N terminus of the hepatitis delta virus protein into an immunoreactive -helical multimer. Proceedings of the National Academy of Sciences, USA 92, 382-386.[Abstract]
Saitou, N. & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406-425.[Abstract]
Sakugawa, H., Nakasone, H., Nakayoshi, T., Kawakami, Y., Miyazato, S., Kinjo, F., Saito, A., Ma, S. P., Hotta, H. & Kinoshita, M. (1999). Hepatitis delta virus genotype IIb predominates in an endemic area, Okinawa, Japan. Journal of Medical Virology 58, 366-372.[Medline]
Shakil, A. O., Hadziyannis, S., Hoofnagle, J. H., Di Bisceglie, A. M., Gerin, J. L. & Casey, J. L. (1997). Geographic distribution and genetic variability of hepatitis delta virus genotype I. Virology 234, 160-167.[Medline]
Tang, J. R., Faure, P., Lamelin, J. P., Vitvitski, L., Gaudin, J. L. & Trepo, C. (1994). Detection of small and large genomes of hepatitis D virus in serum of patients with hepatitis D. Journal of Medical Virology 42, 1-6.[Medline]
Wang, K. S., Choo, Q. L., Weiner, A. J., Ou, J. H., Najarian, R. C., Thayer, R. M., Mullenbach, G. T., Denniston, K. J., Gerin, J. L. & Houghton, M. (1986). Structure, sequence and expression of the hepatitis delta () viral genome. Nature 323, 508-514.[Medline]
Wang, J.-G., Cullen, J. & Lemon, S. M. (1992). Immunoblot analysis demonstrates that the large and small forms of hepatitis delta virus antigen have different C-terminal amino acid sequences. Journal of General Virology 73, 183-188.[Abstract]
Wu, J.-C., Chen, C. M., Sheen, I.-J., Lee, S. D., Tzeng, H. M. & Choo, K. B. (1995). Evidence of transmission of hepatitis D virus to spouses from sequence analysis of the viral genome. Hepatology 22, 1656-1660.[Medline]
Wu, J.-C., Chiang, T.-Y. & Sheen, I.-J. (1998). Characterization and phylogenetic analysis of a novel hepatitis D virus strain discovered by restriction fragment length polymorphism analysis. Journal of General Virology 79, 1105-1113.[Abstract]
Xia, Y. P., Yeh, C. T., Ou, J. H. & Lai, M. M. (1992). Characterization of nuclear-targeting signal of hepatitis delta antigen: nuclear transport as a protein complex. Journal of Virology 66, 914-921.[Abstract]
Yang, A., Karayiannis, P., Thomas, H. & Monjardino, J. (1995). Editing efficiency of hepatitis delta virus RNA is related to the course of infection in woodchucks. Journal of General Virology 76, 3071-3078.[Abstract]
Zhang, Y. Y., Tsega, E. & Hansson, B. G. (1996). Phylogenetic analysis of hepatitis D viruses indicating a new genotype I subgroup among African isolates. Journal of Clinical Microbiology 34, 3023-3030.[Abstract]
Received 2 April 2001;
accepted 4 June 2001.