Laboratory of Virology, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Tsurumai-cho 65, Showa-ku, Nagoya 466-8550, Japan1
Author for correspondence: Yukihiro Nishiyama.Fax +81 52 744 2452. e-mail ynishiya{at}tsuru.med.nagoya-u.ac.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The UL14 genes of HSV types 1 (HSV-1) and 2 (HSV-2) are located in a region of the HSV genome that is conserved in the whole herpesvirus family, and homologues are detected in alpha-, beta- and gammaherpesviruses including varicella zoster virus (Davison & Scott, 1986 ), human cytomegalovirus (HCMV) (Chee et al., 1990
), human herpesvirus-6 (Gompels et al., 1995
) and EpsteinBarr virus (Baer et al., 1984
). In other words, the UL14 gene belongs to the core genes of herpesviruses (McGeoch, 1992
). The UL14 genes of both HSV-1 and HSV-2 are predicted to encode 219 amino acid proteins with molecular masses of 23 kDa (McGeoch et al., 1988
; Dolan et al., 1998
) and their coding regions overlap with the coding region of the UL13 gene, which encodes a protein kinase (Dolan et al., 1998
; Daikoku et al., 1997
). Although the HSV-1 UL14 gene has been reported not to be dispensable for replication (Roizman, 1996
), no information on its properties or function is available at present. This study was thus undertaken to characterize the UL14 product of HSV-2.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
DNA manipulations.
The UL14 ORF is located between nucleotide positions 28229 and 28888 of the HSV-2 genome (Dolan et al., 1998 ). The UL14 coding sequences were cloned by PCR amplification from plasmid DNA containing the HSV-2 HindIII b fragment (Tsurumi et al., 1986
), using UL14f (5' GGGCGAATTCATGAGCCGAGACGCC) as the forward primer and UL14r (5' GACGCTCGAGTCACTCGCCATCGGG) as the reverse primer. EcoRI and XhoI sites were incorporated into the forward and reverse primers, respectively, to facilitate cloning. The PCR consisted of an initial 5 min denaturation step at 94 °C followed by 30 cycles of denaturation (94 °C, 30 s), annealing (60 °C, 30 s) and extension (72 °C, 2 min) and a final extension at 72 °C for 7 min. The PCR product was digested with EcoRI and XhoI and cloned in-frame and downstream of the region encoding the initiating ATG plus six histidine residues (6xHis) in the E. coli expression vector pET-28a (Novagen) to give plasmid pET28-UL14. The expression of 6xHis-tagged UL14 protein is regulated by the IPTG-inducible lac operator sequence and a phage T7 promoter. Translation is expected to terminate at the UL14 stop codon. Plasmid pET28-UL14 was transformed into E. coli strain BL21(DE3), which, following induction with IPTG, expressed large quantities of 6xHis-tagged UL14 fusion protein.
The expression plasmid pcDNA3-UL14 was constructed for expression of the UL14 gene in cultured cells. Cleavage of pET28-UL14 with EcoRI and XhoI released the UL14 ORF and this DNA fragment was ligated into the multicloning site of pcDNA3.1 (+) (Invitrogen) to give pcDNA3-UL14, which expressed the UL14 gene under the control of the HCMV immediate early promoter. Plasmid pcDNA3-UL14 was also used for in vitro transcription and translation, since it contains T7 promoter upstream of the multicloning site.
Plasmid transfection.
Cells were transfected by using a lipofection reagent according to the protocols recommended by the supplier (Gibco BRL).
Preparation of polyclonal antisera.
Antisera were produced in two rabbits by immunization with an emulsion containing approximately 0·6 mg E. coli-expressed, 6xHis-tagged UL14 protein in the MPL+TDM+CWS emulsion adjuvant system (RIBI ImmunoChem Research). Inoculations were by subcutaneous injection on the shaven back. The same adjuvant and 0·6 mg of the inclusion body preparation were used for subsequent boosts. A total of three booster injections were given at 3 week intervals after the primary injection. One week after the last immunization, we collected blood from the heart. Anti-UL42 polyclonal antisera were also produced in rabbits by immunization with E. coli-expressed, 6xHis-tagged HSV-2 UL42 protein as described above.
Western blotting.
At the times indicated, the denatured, solubilized polypeptides from mock-infected and HSV-infected cell lysates were electrophoretically separated on SDSpolyacrylamide gels and electrically transferred to Hybond PVDF membranes (Amersham Japan). Nonspecific protein binding was blocked by treating membranes at 4 °C overnight with Tris-buffered saline (TBS; 25 mM TrisHCl, 150 mM NaCl, pH 7·5) containing 5% skim milk and 0·05% Tween 20. The membranes were washed once with TBS and incubated at 37 °C for 1 h with a 1:5000 dilution of the UL14 antiserum in TBS containing 0·1% BSA and 0·05% Tween 20. After washing three times with TBS containing 0·05% Tween 20, the membranes were incubated at 37 °C for 1 h with a 1:7000 dilution of goat anti-rabbit peroxidase-labelled second antibody (BIO SOURCE). The membranes were then washed three times with TBS containing 0·05% Tween 20, treated with the ECL Western blotting detection system (Amersham Japan) and exposed to Hyperfilm-ECL (Amersham Japan).
Immunofluorescence microscopy.
Vero cells were grown on coverslips and were either mock-infected or infected with HSV-2 at a multiplicity of 3 p.f.u. per cell. At various times after infection, the cells were fixed in cold acetone. Coverslips were then incubated for 1 h at room temperature with a solution of 20% human serum in PBS in order to reduce levels of background produced as a consequence of the affinity-binding of rabbit immunoglobulin to the Fc receptor formed by glycoproteins E and I. The cells were reacted for 1 h at 37 °C with anti-UL14 serum diluted 1:1000 in PBS containing 0·1% BSA, washed in excess PBS and then reacted for 1 h at 37 °C with a 1:60 dilution of FITC-conjugated goat anti-rabbit immunoglobulin in blocking solution. Fluorescent images were viewed with a Zeiss laser scanning microscope LSM510.
In vitro transcription and translation.
For in vitro transcription and translation, the Single Tube protein system 2, T7 (Novagen) was used. In the standard reaction, the DNA template (0·5 µg pcDNA3-UL14 DNA) was transcribed in 10 µl at 30 °C for 15 min, followed by the addition of 40 µl translation mixture and continued incubation at 30 °C for 60 min. In vitro translation products were analysed by Western blotting after SDSPAGE.
Preparation of nuclear fractions.
Infected cells were washed three times with PBS. The cell were suspended in RSB buffer (10 mM TrisHCl, 10 mM NaCl, 1·5 mM MgCl2, pH 7·4) and left on ice for 5 min. After adding NP-40 alone or with deoxycholic acid (DOC) to final concentrations of 0·5%, the cells were homogenized by ten strokes with a glass homogenizer. The homogenate was layered over 0·5 M sucrose in RSB buffer and centrifuged at 1500 r.p.m. for 5 min. The nuclear pellet was then washed again with TM sucrose buffer (0·25 M sucrose, 5 mM MgCl2, 50 mM Tris-HCl, pH 7·4). After sedimentation, the nuclei were resuspended in TM sucrose buffer and the purity and morphology of isolated nuclei were examined with a light microscope after staining with 0·1% toluidine blue.
Fractionation of intracellular viral capsids.
Vero cells were infected with HSV-2 at a multiplicity of 3 p.f.u. per cell and incubated at 37 °C for 15 h. Infected cells were harvested by centrifugation and washed three times with PBS. Cell lysates were resuspended in 1 ml lysis buffer I (20 mM TrisHCl, 0·1 M NaCl, 1 mM EDTA, 1% Triton X-100, pH 7·5) or lysis buffer II (20 mM TrisHCl, 0·5 M NaCl, 1 mM EDTA, 1% Triton X-100, pH 7·5) and disrupted by sonication and the debris was pelleted at 3000 r.p.m. for 10 min. The supernatant was layered onto a 12 ml linear gradient of 1050% (w/v) sucrose in buffer I or buffer II and centrifuged at 24000 r.p.m. for 40 min in a Hitachi RPS 40 rotor. Five hundred µl fractions were collected from the bottom to the top and the position of virus capsids was determined by SDSPAGE followed by silver staining.
Virion purification.
Monolayers of Vero cells cultured in roller bottles (850 cm2) were infected with HSV-2 at a multiplicity of 3 p.f.u. per cell. After 1 h adsorption at 37 °C, maintenance medium containing 5% serum was added. HSV-2 virions were harvested from the extracellular medium at 36 h post-infection (p.i.). After removal of cell debris by low-speed centrifugation, virions were pelleted from the supernatant by centrifugation at 87000 g for 1 h. The virus suspension was layered onto a continuous 1050% sucrose gradient, followed by centrifugation at 20000 r.p.m. for 1 h at 4 °C. The peak virion-containing fractions were collected as described above, diluted in PBS and pelleted again by centrifugation at 87000 g for 1 h. The virions were further purified by a second cycle of sucrose-gradient centrifugation.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
In order to examine the subcellular localization of the UL14 protein in infected cells, the cells were next fractionated into nuclear and cytoplasmic fractions by NP-40 lysis. Western blot analysis showed that approximately equal amounts of the UL14 product were distributed in the crude nuclear and cytoplasmic/membrane fractions of infected cells at 12 h p.i. (Fig. 3a, lanes 10 and 11). Since the nuclear fraction obtained by NP-40 lysis contains perinuclear structures, the ionic detergent DOC was also used to remove perinuclear structures from the crude nuclear fractions. The addition of DOC reduced the amount of UL14 protein detected in the nuclear fraction (Fig. 3a
, lanes 12 and 13), suggesting that a significant amount of the UL14 protein was present in a perinuclear region. However, it would be very difficult to estimate accurately the relative amounts of nuclear and cytoplasmic UL14 protein in infected cells, as the UL42 protein, which is a typical nuclear protein, was easily detected in the cytoplasmic fraction even after NP-40 lysis, a very mild fractionation procedure (Fig. 3b
, lanes 10 and 11).
Intracellular localization of the UL14 gene product in HSV-2-infected cells
The intracellular distribution of UL14 protein was also examined by indirect immunofluorescence staining. At various times after infection, Vero cells infected with HSV-2 were fixed with cold acetone, treated with human serum to block nonspecific binding and reacted with the UL14 antiserum. No specific staining was observed in mock-infected cells that were reacted with the UL14 antiserum (Fig. 4a) or in HSV-2-infected cells reacted with preimmune serum (Fig. 4f
). Specific fluorescence became detectable both in the cytoplasm and in the nucleus of infected cells at 6 h p.i.: in the nucleus, the UL14 protein was detected in a net-like structure (Fig. 4b
) or as fine, discrete particles (Fig. 4c
). Similar patterns of immunofluorescence were observed at 9 h p.i., but in some cells the UL14 protein localized predominantly to the perinuclear region of the cytoplasm (Fig. 4d
). The UL14 protein thereafter formed a mass in the perinuclear region by 12 h p.i. (Fig. 4e
).
|
|
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The UL14 protein localized both to the nucleus and to the perinuclear region of the cytoplasm. At 9 h p.i., the UL14 protein within the nucleus co-localized with the scaffolding protein ICP35, suggesting a possible role either in capsid assembly or capsid maturation, including viral DNA cleavage/packaging. While the UL14 gene of HSV-1 is not dispensable for replication (Roizman, 1996 ), it is known that only six genes (UL18, UL19, UL35, UL38, UL26 and UL26·5) encoding capsid proteins and scaffolding proteins are necessary for the formation of capsids. In fact, co-expression of these six genes enables cells to produce capsids that are indistinguishable in appearance and protein composition from those made during HSV infection (Tatman et al., 1994
; Thomsen et al., 1994
). It thus seems unlikely that the UL14 protein plays a critical role in the formation of capsids. On the other hand, it has been reported that at least six genes (UL6, UL15, UL25, UL28, UL32 and UL33) are essential for the cleavage and packaging of viral DNA (Steven & Spear, 1996
). Temperature-sensitive mutants and genetically engineered mutants with mutations in these genes have been isolated and characterized, showing that these mutants have similar phenotypes, in that viral DNA can be replicated but not packaged (Addison et al., 1990
; al-Kobaisi et al., 1991
; Poon & Roizman, 1993
; Schaffer et al., 1973
; Sherman & Bachenheimer, 1987
; Weller et al., 1987
). A recent study has also shown that the UL17 gene product plays an essential role in cleavage and packaging of viral DNA (Salmon et al., 1998
). Among the proteins involved in this process, some, such as the UL6 and UL25 proteins, are tightly associated with B or C capsids (Ali et al., 1996
; Patel & MacLean, 1995
) and some are not (Lamberti & Weller, 1998
; Yu & Weller, 1998
). Although the UL14 protein was detectable in the mature virion, the interaction with capsids in the nucleus appeared to be weak. The properties of the UL14 protein seem consistent with its putative role in capsid maturation, but further experiments using deletion mutants will be required to test this possibility.
In cells transfected with the UL14 gene, both nuclear and cytoplasmic staining were observed. At early times of transfection, the UL14 protein was detected in the nucleus or in both the nucleus and the cytoplasm, but at later times cytoplasmic staining was predominant. Western blot analysis revealed that only the 34 kDa species was detected in transfected cells (not shown), suggesting that the modification to the 33 kDa species may not be involved in the change in localization. Although the distribution patterns of proteins overexpressed in transfected cells may not always reflect the normal behaviour of the proteins, the marked change in the UL14 staining pattern in transfected cells seems very interesting. We are planning to study the time-course of distribution after transfection and the mechanism of the change by using various kinds of UL14green fluorescent protein fusion.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ali, M. A., Forghani, B. & Cantin, E. M. (1996). Characterization of an essential HSV-1 protein encoded by the UL25 gene reported to be involved in virus penetration and capsid assembly. Virology 216, 278-283.[Medline]
al-Kobaisi, M. F., Rixon, F. J., McDougall, I. & Preston, V. G. (1991). The herpes simplex virus UL33 gene product is required for the assembly of full capsids. Virology 180, 380-388.[Medline]
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S. & Barell, B. G. (1984). DNA sequence and expression of the B95-8 EpsteinBarr virus genome. Nature 310, 207-211.[Medline]
Chee, M. S., Bankier, A. T., Beck, S., Bohni, R., Brown, C. M., Cerny, R., Horsnell, T., Hutchinson, C. A.III, Kouzarides, T., Martignetti, J. A., Preddie, E., Satchwell, S. C., Tomlinson, P., Weston, K. M. & Barrell, B. G. (1990). Analysis of the protein-coding content of the sequence of human cytomegalovirus strain AD169. Current Topics in Microbiology and Immunology 154, 125-169.[Medline]
Daikoku, T., Shibata, S., Goshima, F., Oshima, S., Tsurumi, T., Yamada, H., Yamashita, Y. & Nishiyama, Y. (1997). Purification and characterization of the protein kinase encoded by the UL13 gene of herpes simplex virus type 2. Virology 235, 82-93.[Medline]
Davison, A. J. & Scott, J. E. (1986). The complete DNA sequence of varicella-zoster virus. Journal of General Virology 67, 1759-1816.[Abstract]
Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. & McGeoch, D. J. (1998). The genome sequence of herpes simplex virus type 2. Journal of Virology 72, 2010-2021.
Gompels, U. A., Nicholas, J., Lawrence, G., Jones, M., Thomson, B. J., Martin, M. E. D., Efstathiou, S., Craxton, M. & Macaulay, H. A. (1995). The DNA sequence of human herpesvirus-6: structure, coding content, and genome evolution. Virology 209, 29-51.[Medline]
Lamberti, C. & Weller, S. K. (1998). The herpes simplex virus type 1 cleavage/packaging protein, UL32, is involved in efficient localization of capsids to replication compartments. Journal of Virology 72, 2463-2473.
McGeoch, D. J. (1992). Molecular evolution of large DNA viruses of eukaryotes. Seminars in Virology 3, 399-408.
McGeoch, D. J., Dalrymple, M. A., Davison, A. J., Dolan, A., Frame, M. C., McNab, D., Perry, L. J., Scott, J. E. & Taylor, P. (1988). The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. Journal of General Virology 69, 1531-1574.[Abstract]
Patel, A. H. & MacLean, J. B. (1995). The product of the UL6 gene of herpes simplex virus type 1 is associated with virus capsids. Virology 206, 465-478.[Medline]
Poon, A. P. W. & Roizman, B. (1993). Characterization of a temperature-sensitive mutant of the UL15 open reading frame of herpes simplex virus 1. Journal of Virology 67, 4497-4503.[Abstract]
Rixon, F. J. (1993). Structure and assembly of herpesviruses. Seminars in Virology 4, 135-144.
Roizman, B. (1996). The function of herpes simplex virus genes: a primer for genetic engineering of novel vectors. Proceedings of the National Academy of Sciences, USA 93, 11307-11312.
Roizman, B. & Sears, A. E. (1996). Herpes simplex viruses and their replication. In Fields Virology, pp. 1043-1107. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia: LippincottRaven.
Salmon, B., Cunningham, C., Davison, A. J., Harris, W. J. & Baines, J. D. (1998). The herpes simplex virus type 1 UL17 gene encodes virion tegument proteins that are required for cleavage and packaging of viral DNA. Journal of Virology 72, 3779-3788.
Schaffer, P. A., Aron, G. M., Biswal, N. & Benyesh-Melnick, M. (1973). Temperature-sensitive mutants of herpes simplex virus type 1: isolation, complementation and partial characterization. Virology 52, 57-71.
Sherman, G. & Bachenheimer, S. L. (1987). DNA processing in temperature-sensitive morphogenic mutants of HSV-1. Virology 158, 427-430.[Medline]
Steven, A. C. & Spear, P. G. (1996). Herpesvirus capsid assembly and envelopment. In Structural Biology of Viruses, pp. 312-351. Edited by R. Burnet, W. Chiu & R. Garcea. New York: Oxford University Press.
Tatman, J. D., Preston, V. G., Nicholson, P., Elliott, R. M. & Rixon, F. J. (1994). Assembly of herpes simplex virus type 1 capsids using a panel of recombinant baculoviruses. Journal of General Virology 75, 1101-1113.[Abstract]
Thomsen, D. R., Roof, L. L. & Homa, F. L. (1994). Assembly of herpes simplex virus (HSV) intermediate capsids in insect cells infected with recombinant baculoviruses expressing HSV capsid proteins. Journal of Virology 68, 2442-2457.[Abstract]
Tsurumi, T., Maeno, K. & Nishiyama, Y. (1986). Molecular cloning of herpes simplex virus type 2 DNA. Journal of Biochemistry 99, 981-984.[Abstract]
Ward, P. L., Ogle, W. O. & Roizman, B. (1996). Assemblons: nuclear structures defined by aggregation of immature capsids and some tegument proteins of herpes simplex virus 1. Journal of Virology 70, 4623-4631.[Abstract]
Weller, S. K., Carmichael, E. P., Aschman, D. P., Goldstein, D. J. & Schaffer, P. A. (1987). Genetic and phenotypic characterization of mutants in four essential genes that map to the left half of HSV-1 UL DNA. Virology 161, 198-210.[Medline]
Yu, D. & Weller, S. K. (1998). Herpes simplex virus type 1 cleavage and packaging proteins UL15 and UL28 are associated with B but not C capsids during packaging. Journal of Virology 72, 7428-7439.
Received 9 December 1998;
accepted 26 May 1999.