Institute of Molecular Biology1, Virus Diagnostics2 and Infectology3, Friedrich-Loeffler-Institutes, Federal Research Centre for Virus Diseases of Animals, Boddenblick 5a, D-17498 Insel Riems, Germany
Strandstr. 23 B, D-17498 Neuenkirchen, Germany4
Institute of Virology, Slovak Academy of Sciences, Bratislava 842 45, Slovakia5
Lohmann Animal Health, 27472 Cuxhaven, Germany6
Author for correspondence: Nikolaus Osterrieder. Present address: Department of Microbiology and Immunology, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA. Fax +1 607 253 3384. e-mail klaus.osterrieder{at}gmx.de
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
MD is controlled by immunization, but despite vaccination more and more pathogenic MDV strains have evolved (Witter, 2001 ). These strains have been classified as so-called virulent (v), very virulent (vv) or very virulent plus (vv+) strains (Schat et al., 1982
; Witter, 1983
, 1997
). Vaccination using HVT protected chickens against infections with vMDV, but failed to protect against newly emerging vvMDV in the late 1970s (Witter, 2001
). Vaccines containing MDV-2 strains or combinations of HVT and MDV-2 were used successfully in the 1980s (Witter, 1982
, 1997
; Calnek et al., 1983
; Witter & Lee, 1984
), but within a few years novel vv+MDV-1 strains such as 648A and 584A were isolated, which could break bivalent vaccination and cause acute transient paralysis as well as a significant increase in mortality within the first 2 weeks after infection (Witter, 1997
; Gimeno et al., 1999
). The appearance of vv+MDV has led to the introduction of the CVI988/Rispens vaccine in the USA, which has been used in Europe since the 1970s (Rispens et al., 1972a
, b
; Witter, 1992
; Witter et al., 1995
).
The isolation of highly virulent strains from vaccinated flocks has been reported not only in the USA but also in Europe. Changes in clinical signs and cellular tropism were reported for strain C12/130 (Barrow & Venugopal, 1999 ). The mechanisms underlying the steady increase in MDV virulence and the appearance of a more acute neuronal form of MD remain enigmatic, but imperfect vaccines may have an impact on these phenomena (Witter, 2001
). MDV exhibits high cell association in vitro, and vaccines, except for some HVT formulations, represent living chicken cells infected with the agent, which are kept in liquid nitrogen until application (Sharma, 1971
). Inactivated and recombinant fowlpox virus vaccines expressing various MDV tegument and envelope proteins have also been tested, and some protection against MD was reported. Oil-adjuvant whole cell preparations (Lee & Witter, 1991
; Witter, 2001
), and especially gB-expressing fowlpox and baculoviruses (Nazerian et al., 1992
, 1996
; Niikura et al., 1992
), were shown to elicit protective immune responses. It was demonstrated that passive immunization after inoculation of serum of birds immunized with inactivated and oil-adjuvant vaccines prevented MD development to a certain degree (Lee & Witter, 1991
). Protection against MD appears to be both humoral and cell-mediated, but based on experiments with MDV and taking into account the situation in other herpesviruses, cell-mediated responses appear to play the important role, at least in long-lived anti-tumour immunity (Schat & Markowski-Grimsrud, 2001
).
After the introduction of DNA vaccination, a number of preparations were shown to confer protection against infectious diseases (Robinson & Torres, 1997 ). This is especially true for infectious diseases of chickens, e.g. influenza virus infections (Fynan et al., 1993
, 1995
). The DNA vaccines contain individual genes of an infectious agent, controlled by relatively strong viral promoters, like the SV40 or human cytomegalovirus (HCMV) immediate-early promoter (Fynan et al., 1993
, 1995
). Based on a technique that allows cloning and maintenance of large herpesvirus genomes as infectious bacterial artificial chromosomes (BAC) in Escherichia coli (Messerle et al., 1997
), an infectious MDV clone (BAC20) was generated by our laboratory (Schumacher et al., 2000
). BACs not only allow efficient analysis of individual open reading frames and their effect on virus replication, but may represent a new form of vaccine that combines the advantages of DNA and modified live virus preparations, because vaccine virus can be reconstituted in vivo after administration of infectious DNA (Suter et al., 1999
). The results of this study demonstrate that MDV BAC20 DNA applied intramuscularly (i.m.) in saline was able to protect 4256% of conventional chickens against tumorigenic MD, whereas a replication-deficient gE-negative BAC20 did not induce protection against the disease.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cells and viruses.
The MDV strains used were CVI988 (MarekVac forte, Lohmann), 584Ap80C (Schumacher et al., 2000 ) and the highly virulent European isolate, EU1, which was isolated from a CVI988-vaccinated flock in Italy and induces MD in approximately 20% of CVI988-vaccinated chickens (Schumacher et al., 2002
). Strain 584Ap80C was reconstituted from the infectious BAC20 DNA clone (Schumacher et al., 2000
) and is referred to as BAC20 virus (Fig. 1A
). BAC20 virus was propagated in chicken embryo cells (CECs) and gE-negative BAC20 virus (20
gE) was propagated in the cell line SOgE, which represents quail muscle QM7 cells constitutively expressing gE (Schumacher et al., 2002
).
|
Statistical analyses.
The number of animals per group was calculated using nQuery Advisor (Statistical Solutions), and statistical analyses were carried out using SAS, version 6.12 (SAS Institute). As the primary end point, differences of protection against challenge infection between vaccination groups were analysed using Fishers exact test (Stokes et al., 2000 ). Protective potentials of individual DNA preparations and survival functions of individual groups were also compared (secondary end points). The statistical model applied for the comparative analyses was a calculation of contrasts of the survival rates (Stokes et al., 2000
). Comparisons of survival functions were carried out using the LogRank and Wilcoxon tests (SAS Institute Inc., 1984
). Lastly, medians of survival times including the 95% confidence intervals were calculated.
Analysis of blood samples.
Blood (500 µl in 100 µl of 2% sodium citrate) was collected on various days (Fig. 1B). Blood samples of two animals each were pooled and PBMCs and plasma were isolated. One aliquot of PBMCs was used to isolate DNA (Qiagen) and the other aliquot was used to infect CECs. Purified total DNA was eluted with 100 µl H2O and 10 µl each were used in two independent PCR assays. One PCR assay targeted the MDV gB gene (Lee et al., 2000
; Tulman et al., 2000
), and 100 pmol each of forward (5' GCATATCAGCCTGTTCTATC 3') and reverse (5' AACCAATGGTCGGCTATAAC 3') primer were mixed with DNA and 35 cycles (95 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s) were run. Specificity of the PCR products was confirmed by Southern blotting using digoxigenin-labelled gB sequences as a probe. The second assay targeted the MDV 132 bp repeats. In the case of avirulent MDV strains, amplification of the repeats results in typical laddering of the PCR products on agarose gels and can be used to discriminate vaccine from virulent MDV, where a distinct band appears (Becker et al., 1993
; Zhu et al., 1992
). Twenty-five pmol each of forward (5' ACCGCGATCATTAAAATGGGAAGGTTT 3') and reverse (5' CGTAAGGCTTCCCGTCACTCAAAGGAA 3') primer were mixed with DNA, and 40 cycles (94 °C for 30 s, 68 °C for 30 s, 72 °C for 120 s) were run after a primary denaturation step at 94 °C for 120 s, with a final extension at 72 °C for 300 s.
After addition of 1x108 PBMCs to CECs, up to three blind passages were carried out, and MDV antigen in CECs was detected by indirect immunofluorescence using pp38-specific mAb H19 (Cui et al., 1990 ) or reconvalescent anti-MDVI chicken serum, and anti-mouse or anti-chicken IgG Alexa488nm (Molecular Probes) (Schumacher et al., 2000
).
MDV-specific antibodies in plasma were determined by ELISA exactly as previously described (Schumacher et al., 2002 ). Total chicken IgG titres in plasma were determined by diluting plasma samples in log2 steps in 96-well plates, which were then incubated for 16 h at 4 °C. Free binding sites on plates were blocked with 2% skimmed milk in PBS containing 0·05% Tween 20 (PBS-T) for 30 min at 20 °C. After three washes with PBS-T, anti-chicken IgG peroxidase conjugate (Sigma) was added and end-point titres were determined after addition of tetramethylbenzidine substrate and stopping the reaction using 2 M H2SO4 (Osterrieder et al., 1995
).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The systemic presence of MDV DNA after vaccination and challenge infection was investigated by isolation of total DNA from PBMCs and subsequent PCR analysis. Blood from two birds of each group was collected on the indicated days after immunization and challenge (Fig. 1B) and pooled for further analysis. MDV-specific DNA could be detected after i.m. vaccination of BAC20 DNA in PBS on day 8 after vaccination (Table 1
; group 4). Reconstitution of MDV from BAC20 DNA by virus isolation from PBMCs, however, could not be demonstrated (Table 1
). We were able, however, to identify amplification of the 132 bp repeats, which is specific for avirulent vaccine MDV strains, in some blood samples after BAC20 DNA application using a PCR assay targeting the repeat region (Table 1
). These results suggested that vaccine virus was reconstituted in vivo from cloned DNA. After immunization with CVI988, DNA and infectious virus were detected in some vaccinated birds on days 8 and 10 after immunization (Table 1
). After EU1 challenge infection, MDV-specific DNA was detected on days 3 and 6 after challenge in all groups, with the exception of group 4 (BAC20 DNA in PBS by the i.m. route) and group 7 (CVI988) (Fig. 2
; Table 1
). In PBMCs from chickens of these groups, no viral DNA was detected up to day 6 after EU1 challenge infection by the very sensitive gB-specific PCR and Southern blot analysis (Fig. 2
, Table 1
). From day 9 after infection, MDV-specific DNA could be amplified from PBMCs of all groups (Table 1
). In animals immunized with BAC20 DNA incorporated into nanoparticles by the i.m. route (group 2), infectious MDV was isolated at day 9 after challenge infection. The isolated virus induced large plaques in CEC cultures, which were reactive with the H19 and the MDVI antibody (data not shown). We concluded that this isolate represented reconstituted BAC20 and not EU1 virus because it grew readily in CECs. Contamination with the CVI988 strain was excluded by reactivity with anti-pp38 antibody H19, which does not recognize the CVI988 strain (Cui et al., 1990
, 1999
).
|
|
|
Animals were vaccinated and monitored for the development of MD for 11 weeks after challenge infection before the experiment was terminated and all surviving birds were killed and scanned by gross pathological examination for MD and/or tumour development. Starting at day 7 after challenge infection, approximately 25% of chickens suffered from transient paralysis. More than 50% of the birds recovered from the paralysis, and early MD mortality (death within 2 weeks after challenge infection), which was associated with atrophy of the thymus and the bursa of Fabricius, was observed in approximately 10% of chickens (Table 1; Fig. 4
). None of the CVI988-immunized animals or birds having received BAC20 DNA in PBS by the i.m. route suffered from acute transient paralysis (Table 1
; Fig. 4
). Starting at 3 weeks and culminating in weeks 7 and 8 after EU1 challenge infection, chickens were found to be dying from MD as evidenced by severe atrophy of the thymus and bursa of Fabricius, oedematous swelling of peripheral nerves such as the N. ischiadicus, the N. vagus and the Plexus brachialis, and especially tumours of visceral organs and the lymphatic extraorbital tissue (Table 1
; Fig. 4
). The tumours were confirmed to be caused by MDV by histopathology and in situ hybridization (data not shown). All animals vaccinated with the negative control plasmid pDS-pHA1 and the CVI988 contact birds died within 57 days of challenge infection (Table 1
; Fig. 4
). Most of the animals vaccinated with BAC20 DNA also suffered and died of MD with similar kinetics as the negative controls, but all birds vaccinated with BAC20 DNA in PBS by the i.m. route and all CVI988-vaccinated chickens survived until day 57 after infection (Table 1
; Fig. 4
). Four out of seven animals of group 4 (BAC20 DNA in PBS by the i.m. route) and five out of seven birds of group 7 (CVI988) were protected against MD until termination of the experiment, and gross pathology of surviving animals did not identify any other individual in these two groups as suffering from the disease (Table 1
; Fig. 4
).
|
BAC-based vaccination requires inoculation of viral DNA that results in infectious MDV-1
In a second animal experiment, the question was addressed of whether protection against MDV challenge can also be induced by DNA of a replication-incompetent MDV. Therefore, groups of eight to 12 animals were immunized i.m. with PBS-suspended BAC20 DNA or 20gE DNA, which lacks the essential gE gene. On transfection of 20
gE DNA into CECs or QM7 cells, MDV that is not viable on non-complementing cells is reconstituted (Schumacher et al., 2001
). Groups of eight and 12 animals, respectively, were also immunized with 1x103 p.f.u. of BAC20 virus or 1x103 20
gE virus propagated on complementing SOgE cells (Schumacher et al., 2002
). The results of this second animal experiment are summarized in Table 2
and Fig. 5
. Whereas six out of eight animals immunized with reconstituted BAC20 virus survived EU1 challenge infection and did not exhibit signs of MD at post-mortem examination (Table 2
, group 4), none of the 12 animals immunized with replication-incompetent 20
gE virus remained free of MD (Table 2
, group 5). Similarly, all 12 chickens immunized with 10 µg of 20
gE DNA as well as all animals immunized with 10 µg of the negative control BAC pDS-pHA1 died as a consequence of EU1 challenge infection or exhibited the tumour form of MD at post-mortem examination (Table 2
, groups 2 and 3). In contrast, five out of 12 animals vaccinated with 10 µg BAC20 DNA survived EU1 challenge infection and did not exhibit signs of MD as verified by gross pathology (Table 2
, group 1). It is important to note that no virus could be isolated from PBMCs of animals immunized with either BAC20 virus or BAC20 DNA (Table 2
). However, on days 8 and 10 after immunization, MDV DNA was detected by both the gB-specific and the 132 bp repeat-specific PCR in three pooled blood samples of BAC20 DNA-immunized animals and in all pooled blood samples of chickens immunized with BAC20 virus (Table 2
, groups 1 and 4). In contrast, no MDV DNA could be PCR-amplified in animals immunized with either 20
gE DNA or the gE-negative MDV (Table 2
, groups 2 and 5). After challenge infection, MDV DNA was detectable from day 6 post-infection (Table 2
) in all blood samples of all groups. It was absent, however, on day 3 p.i. in the groups vaccinated with BAC20 DNA (two out of six samples) or with BAC20 virus (three out of four samples) (Table 2
). As described for the first animal experiment, anti-MDV antibody titres gradually increased in chickens that survived challenge infection (Fig. 5
). In animals immunized with BAC20 virus, all four pooled blood samples exhibited MDV-specific ELISA titres of >1:128000 at the final bleeding at day 46 after challenge infection (Fig. 5
). In BAC20 DNA-immunized animals, four out of the six plasma pools reacted in the same manner, whereas the two remaining plasma pools exhibited titres of <1:4000 on day 46 after challenge. The four plasma pools with high titres of anti-MDV antibodies all contained plasma obtained from the five surviving birds (Fig. 5
).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
For a primary assessment of the efficacy of immunization of chickens with BAC20 DNA, various routes of immunization and delivery systems were tested. It could be demonstrated that from all tested routes and formulations, only i.m. application of BAC20 DNA in saline led to protection in four out of seven chickens. In contrast, no significant protection against MD was seen in any of the other DNA-vaccinated groups, although moderate effects on the median times to death and survival functions of immunized and challenge-infected birds were observed. The lack of protection after gene-gun vaccination was unexpected because the potency of i.d. delivery of plasmid DNA in protecting laboratory animals and chickens against lethal virus challenge had been demonstrated (Fynan et al., 1993 , 1995
). Furthermore, immunization of mice twice with 1·5 µg of a replication-defective herpes simplex virus BAC clone by this route led to virus-specific cytotoxic T cell responses, production of neutralizing antibodies and protection against lethal challenge infection (Suter et al., 1999
). The exact mechanisms by which i.m. vaccination with BAC20 DNA in saline caused a significant reduction in tumour formation and incidence of MD after EU1 challenge infection is not known. It is possible that BAC20 DNA in PBS may have been taken up more efficiently by macrophages in muscular tissue and may have replicated in these cells, which are primary targets of MDV (Calnek, 2001
). In the muscle, high numbers of macrophages have been demonstrated after injection when compared with other tissues (Davis et al., 1994
). Macrophages also attract and activate B and/or T lymphocytes, which themselves are targets of lytic MDV replication (Calnek, 2001
). In this respect, it is important to note that only application of BAC DNA of replication-competent MDV led to protection against subsequent challenge, indicating that in vivo replication of the vaccine is important for protection. There was evidence for MDV replication after BAC20 administration, because a PCR assay that was able to discriminate between cloned BAC20 DNA and virus reconstituted from BAC20 gave positive results in some blood samples of chickens immunized with BAC20 DNA. This assay was also able to distinguish between vaccine and virulent virus, because in the latter only a single band and no laddering is observed (Schumacher et al., 2000
). In addition, infectious MDV was isolated at day 9 after challenge from PBMCs of animals that had been immunized by the i.m. route with BAC20 incorporated into nanoparticles (group 2). Since we have not been able to isolate EU1 in CECs or chicken kidney cells so far, despite numerous trials, we speculate that latent BAC20 virus was reactivated by EU1 challenge infection in these animals. MDV DNA was also detected by PCR in PBMCs of chickens after i.m. immunization with BAC20 DNA in saline in both animal experiments, but not in birds immunized with 20
gE DNA or reconstituted 20
gE virus (Schumacher et al., 2001
). MDV-specific DNA in PBMCs was detected on only two days after CVI988 or BAC20 virus vaccination. Low amounts of infectious virus could be isolated in the case of CVI988 but not after application of BAC20 virus, indicating that levels of viraemia after application of vaccine viruses may be determined by the virus strain used rather than the dose of virus or DNA applied. However, the positive PCR results after application of BAC20 DNA or virus and the sustained antibody response indicate that low levels of lytically replicating and/or latent or reactivated virus are present in the chicken after administration of BAC20 DNA. Future experiments will address virus replication and reactivation in various compartments of vaccinated birds, especially in lymphatic organs (thymus, spleen and bursa of Fabricius) after injection of infectious BAC20 DNA.
The protection of immunized chickens against MDV challenge was shown to be irregularly associated with an absence of MDV DNA in PBMCs on days 3 and 6 after challenge infection. A sustained MDV-specific antibody response with continuously rising titres up to day 46 after challenge infection, however, was observed in all immunized birds that survived EU1 challenge and did not develop MD, as assessed by gross pathology examination. An up to 10-fold reduction of total IgG was also observed in chickens that were not protected against EU1 challenge infection. In contrast, in chickens immunized with BAC20 in PBS by the i.m. route or avirulent BAC20 or CVI988 virus, total IgG exhibited a moderate increase (up to fourfold) after challenge infection. These results can be interpreted in several ways, the most likely being that uncontrolled infection with MDV strain EU1 caused a depletion of B cells, which represent the major target of lytic MDV replication (Calnek, 2001 ). It is conceivable that total IgG levels were reduced by lytic replication in and destruction of B cells, especially because plasma IgG levels were decreasing in unprotected birds from day 6 after infection, which corresponds well to the reported half-life of chicken IgG in serum (Yokoyama et al., 1993
). It is important to stress that a clear correlation between antibody production and the absence of signs of MD was observed. The fact that BAC20 DNA-immunized birds only survived when high antibody titres were determined after challenge infection, and that none of the animals having received replication-incompetent 20
gE virus or 20
gE DNA was protected strongly suggests that in vivo reconstitution of MDV and replication are imperative for protection. These findings are in contrast to those seen with a replication-incompetent HSV BAC that was able to induce protection in a murine model (Suter et al., 1999
).
Important advantages of a DNA-based vaccine over conventional vaccines against MD are the stability and ease of handling of DNA vaccines (Davis & McCluskie, 1999 ; Krishnan, 2000
). MD vaccines consist of infected CECs and have included serotype 1, 2 and 3 strains alone or in various combinations (Witter, 2001
). For these reasons it is necessary to maintain the liquid nitrogen cold chain from the vaccine manufacturer to the chicken, and vaccine production cannot easily be standardized because primary CECs have to be used. In future experiments, alternative DNA delivery systems and application routes will be tested in an attempt to combat this important infectious disease of the domestic chicken.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Adler, H., Messerle, M., Wagner, M. & Koszinowski, U. H. (2000). Cloning and mutagenesis of the murine gammaherpesvirus 68 genome as an infectious bacterial artificial chromosome. Journal of Virology 74, 6964-6974.
Barrow, A. & Venugopal, K. (1999). Molecular characteristics of very virulent European MDV isolates. Acta Virologica 43, 90-93.[Medline]
Becker, Y., Tabor, E., Asher, Y., Davidson, I., Malkinson, M. & Witter, R. L. (1993). PCR detection of amplified 132 bp repeats in Mareks disease virus type 1 (MDV-1) DNA can serve as an indicator for critical genomic rearrangement leading to the attenuation of virus virulence. Virus Genes 7, 277-287.[Medline]
Calnek, B. W. (2001). Pathogenesis of Mareks disease virus infection. Current Topics in Microbiology and Immunology 255, 25-55.[Medline]
Calnek, B. W., Schat, K. A., Peckham, M. C. & Fabricant, J. (1983). Field trials with a bivalent vaccine (HVT and SB-1) against Mareks disease. Avian Diseases 27, 844-849.[Medline]
Cui, Z. Z., Yan, D. & Lee, L. F. (1990). Mareks disease virus gene clones encoding virus-specific phosphorylated polypeptides and serological characterization of fusion proteins. Virus Genes 3, 309-322.[Medline]
Cui, Z., Qin, A., Lee, L. F., Wu, P. & Kung, H. J. (1999). Construction and characterization of a H19 epitope point mutant of MDV CVI988/Rispens strain. Acta Virologica 43, 169-173.[Medline]
Davis, H. L. & McCluskie, M. J. (1999). DNA vaccines for viral diseases. Microbes and Infection 1, 7-21.[Medline]
Davis, H. L., Michel, M. L., Mancini, M., Schleef, M. & Whalen, R. G. (1994). Direct gene transfer in skeletal muscle: plasmid DNA-based immunization against the hepatitis B virus surface antigen. Vaccine 12, 1503-1509.[Medline]
Delecluse, H. J. & Hammerschmidt, W. (1993). Status of Mareks disease virus in established lymphoma cell lines: herpesvirus integration is common. Journal of Virology 67, 82-92.[Abstract]
Delecluse, H. J., Schuller, S. & Hammerschmidt, W. (1993). Latent Mareks disease virus can be activated from its chromosomally integrated state in herpesvirus-transformed lymphoma cells. EMBO Journal 12, 3277-3286.[Abstract]
Fynan, E. F., Webster, R. G., Fuller, D. H., Haynes, J. R., Santoro, J. C. & Robinson, H. L. (1993). DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proceedings of the National Academy of Sciences, USA 90, 11478-11482.[Abstract]
Fynan, E. F., Webster, R. G., Fuller, D. H., Haynes, J. R., Santoro, J. C. & Robinson, H. L. (1995). DNA vaccines: a novel approach to immunization. International Journal of Immunopharmacology 17, 79-83.[Medline]
Gimeno, I. M., Witter, R. L. & Reed, W. M. (1999). Four distinct neurologic syndromes in Mareks disease: effect of viral strain and pathotype. Avian Diseases 43, 721-737.[Medline]
Krishnan, B. R. (2000). Current status of DNA vaccines in veterinary medicine. Advanced Drug Delivery Reviews 43, 3-11.[Medline]
Lee, L. F. & Witter, R. L. (1991). Humoral immune responses to inactivated oil-emulsified Mareks disease vaccine. Avian Diseases 35, 452-459.[Medline]
Lee, L. F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H. J. & Witter, R. L. (2000). The complete unique long sequence and the overall genomic organization of the GA strain of Mareks disease virus. Proceedings of the National Academy of Sciences, USA 97, 6091-6096.
Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H. & Koszinowski, U. H. (1997). Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proceedings of the National Academy of Sciences, USA 94, 14759-14763.
Morgan, R. W., Cantello, J. L. & McDermott, C. H. (1990). Transfection of chicken embryo fibroblasts with Mareks disease virus DNA. Avian Diseases 34, 345-351.[Medline]
Nazerian, K., Lee, L. F., Yanagida, N. & Ogawa, R. (1992). Protection against Mareks disease by a fowlpox virus recombinant expressing the glycoprotein B of Mareks disease virus. Journal of Virology 66, 1409-1413.[Abstract]
Nazerian, K., Witter, R. L., Lee, L. F. & Yanagida, N. (1996). Protection and synergism by recombinant fowl pox vaccines expressing genes from Mareks disease virus. Avian Diseases 40, 368-376.[Medline]
Niikura, M., Matsuura, Y., Endoh, D., Onuma, M. & Mikami, T. (1992). Expression of the Mareks disease virus (MDV) homolog of glycoprotein B of herpes simplex virus by a recombinant baculovirus and its identification as the B antigen (gp100, gp60, gp49) of MDV. Journal of Virology 66, 2631-2638.[Abstract]
Osterrieder, N., Wagner, R., Brandmüller, C., Schmidt, P., Wolf, H. & Kaaden, O. R. (1995). Protection against EHV-1 challenge infection in the murine model after vaccination with various formulations of recombinant glycoprotein gp14 (gB). Virology 208, 500-510.[Medline]
Rispens, B. H., van Vloten, H., Mastenbroek, N., Maas, H. J. & Schat, K. A. (1972a). Control of Mareks disease in the Netherlands. I. Isolation of an avirulent Mareks disease virus (strain CVI 988) and its use in laboratory vaccination trials. Avian Diseases 16, 108-125.[Medline]
Rispens, B. H., van Vloten, H., Mastenbroek, N., Maas, J. L. & Schat, K. A. (1972b). Control of Mareks disease in the Netherlands. II. Field trials on vaccination with an avirulent strain (CVI 988) of Mareks disease virus. Avian Diseases 16, 126-138.[Medline]
Robinson, H. L. & Torres, C. A. (1997). DNA vaccines. Seminars in Immunology 9, 271-283.[Medline]
Roy, K., Mao, H. Q., Huang, S. K. & Leong, K. W. (1999). Oral gene delivery with chitosanDNA nanoparticles generates immunologic protection in a murine model of peanut allergy. Nature Medicine 5, 387-391.[Medline]
Sambrook, J., Fritsch, D. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
SAS Institute Inc. (1984). SAS/STAT Users Guide, Version 6. Cary, NC: SAS Institute Inc.
Schat, K. A. & Markowski-Grimsrud, C. J. (2001). Immune responses to Mareks disease virus infection. Current Topics in Microbiology and Immunology 255, 91-120.[Medline]
Schat, K. A., Calnek, B. W. & Fabricant, J. (1982). Characterisation of two highly oncogenic strains of Mareks disease virus. Avian Pathology 11, 593-605.
Schumacher, D., Tischer, B. K., Fuchs, W. & Osterrieder, N. (2000). Reconstitution of Mareks disease virus serotype 1 (MDV-1) from DNA cloned as a bacterial artificial chromosome and characterization of a glycoprotein B-negative MDV-1 mutant. Journal of Virology 74, 11088-11098.
Schumacher, D., Tischer, B. K., Reddy, S. M. & Osterrieder, N. (2001). Glycoproteins E and I of Mareks disease virus serotype 1 are essential for virus growth in cultured cells. Journal of Virology 75, 11307-11318.
Schumacher, D., Tischer, B. K., Teifke, J.-P., Wink, K. & Osterrieder, N. (2002). Generation of a permanent cell line that supports efficient growth of Mareks disease virus (MDV) by constitutive expression of MDV glycoprotein C. Journal of General Virology 83, 1987-1992.
Sharma, J. M. (1971). In vitro cell association of Mareks disease herpesvirus. American Journal of Veterinary Research 32, 291-301.[Medline]
Stokes, M. E., Davis, C. S. & Koch, G. G. (2000). Categorical Data Analysis Using the SAS System. Cary, NC: SAS Institute Inc.
Suter, M., Lew, A. M., Grob, P., Adema, G. J., Ackermann, M., Shortman, K. & Fraefel, C. (1999). BAC-VAC, a novel generation of (DNA) vaccines: a bacterial artificial chromosome (BAC) containing a replication-competent, packaging-defective virus genome induces protective immunity against herpes simplex virus 1. Proceedings of the National Academy of Sciences, USA 96, 12697-12702.
Tulman, E. R., Afonso, C. L., Lu, Z., Zsak, L., Rock, D. L. & Kutish, G. F. (2000). The genome of a very virulent Mareks disease virus. Journal of Virology 74, 7980-7988.
Witter, R. L. (1982). Protection by attenuated and polyvalent vaccines against highly virulent strains of Mareks disease virus. Avian Pathology 11, 49-62.
Witter, R. L. (1983). Characteristics of Mareks disease viruses isolated from vaccinated commercial chicken flocks: association of viral pathotype with lymphoma frequency. Avian Diseases 27, 113-132.[Medline]
Witter, R. L. (1992). Safety and comparative efficacy of the CVI988/Rispens vaccine strain. In Proceedings of the WPA, pp. 315319. Amsterdam: Worlds Poultry Science Association.
Witter, R. L. (1997). Increased virulence of Mareks disease virus field isolates. Avian Diseases 41, 149-163.[Medline]
Witter, R. L. (2001). Protective efficacy of Mareks disease vaccines. Current Topics in Microbiology and Immunology 255, 57-90.[Medline]
Witter, R. L. & Lee, L. F. (1984). Polyvalent Mareks disease vaccines: safety, efficacy and protective synergism in chicken with maternal antibodies. Avian Pathology 13, 75-92.
Witter, R. L., Lee, L. F. & Fadly, A. M. (1995). Characteristics of CVI988/Rispens and R2/23, two prototype vaccine strains of serotype 1 Mareks disease virus. Avian Diseases 39, 269-284.[Medline]
Yokoyama, H., Peralta, R. C., Sendo, S., Ikemori, Y. & Kodama, Y. (1993). Detection of passage and absorption of chicken egg yolk immunoglobulins in the gastrointestinal tract of pigs by use of enzyme-linked immunosorbent assay and fluorescent antibody testing. American Journal of Veterinary Research 54, 867-872.[Medline]
Zhu, G. S., Ojima, T., Hironaka, T., Ihara, T., Mizukoshi, N., Kato, A., Ueda, S. & Hirai, K. (1992). Differentiation of oncogenic and nononcogenic strains of Mareks disease virus type 1 by using polymerase chain reaction DNA amplification. Avian Diseases 36, 637-645.[Medline]
Received 29 April 2002;
accepted 21 June 2002.