Late temporal gene expression from the human cytomegalovirus pp28US (UL99) promoter when integrated into the host cell chromosome

Jun Wu1, Joseph O’Neill1 and Miguel S. Barbosab,1

Signal Research Division of Celgene, 5555 Oberlin Drive, San Diego, CA 92121, USA1

Author for correspondence: Jun Wu. Fax +1 858 623 0870. e-mail jwu{at}signalpharm.com


   Abstract
Top
Abstract
Introduction
Methods
Results
Discussion
References
 
Toward understanding the temporal regulation of human cytomegalovirus (HCMV) late genes, we studied the regulation of the late gene promoter (pp28US, UL99) when outside the context of the viral genome and its response to the immediate early (IE) proteins. Expression of the luciferase reporter gene, regulated by the pp28US promoter, was synchronous with that of the endogenous viral pp28 gene, independently of whether the reporter was episomal or integrated into the glioblastoma cell line U373MG. Cotransfection of the reporter with expression vectors for each of the three major IE genes, IE72, IE86 and IE55, indicated that only IE86 transactivated the pp28US promoter. However, the magnitude of the promoter activation upon HCMV infection suggested that additional factors are also required for higher promoter activity. The promoter activation was specific to HCMV, as herpes simplex virus type 1 infection did not induce luciferase expression.


   Introduction
Top
Abstract
Introduction
Methods
Results
Discussion
References
 
Human cytomegalovirus (HCMV) is an ubiquitous member of the herpesvirus family and a medically important pathogen. Primary infection by HCMV is usually asymptomatic in immunologically healthy people. In immunocompromised individuals, HCMV can cause pneumonitis, encephalitis, retinitis, hepatitis and gastroenteritis. In utero infection can lead to congenital neurological complications, including mental retardation, sensorineural hearing loss or even death (Alford & Britt, 1990 ; Ho, 1991 ). In order to control viral infection one has to understand the pathogenic mechanism leading to disease.

HCMV replicates in various terminally differentiated cell types, including smooth muscle, endothelial, epithelial, neuronal, and microglial cells, fibroblasts and differentiated cells of the monocyte/macrophage lineage (Drew et al., 1979 ; Fish et al., 1995 , 1998 ; Gonczol et al., 1984 ; Ibanez et al., 1991 ; Kondo et al., 1994 ; Sinzger et al., 1995 ). Productive infection is species- and cell-specific (McDonough & Spector, 1983 ) and requires the tightly coordinated expression of viral genes. This sequential, cascade-like, viral gene expression is divided into three kinetic classes: immediate early (IE) or {alpha}, early (E) or {beta} and late (L) or {gamma} (Spector, 1996 ; Stenberg, 1996 ; Chambers et al., 1999 ). The major IE gene products, regulated by a complex enhancer promoter, are synthesized immediately after viral infection and rely primarily on host factors for their expression. Transcriptional regulation of immediate early genes has been investigated in detail (Cherrington & Mocarski, 1989 ; Jahn et al., 1984 ; Lang & Stamminger, 1993 ; Pizzorno & Hayward, 1990 ; Wu et al., 1993 ). The three major IE proteins, IE1 (IE72) and IE2 (IE86 and IE55), play a critical role in the HCMV gene regulatory cascade (Hermiston et al., 1987 ; Baracchini et al., 1992 ; Hagemeier et al., 1992 ). Early genes are transcribed prior to viral DNA replication and their expression requires one or more viral IE gene products (Malone et al., 1990 ; Spaete & Mocarski, 1985 ; Schwartz et al., 1994 ; Sommer et al., 1994 ). The late genes, which constitute a majority of the viral genome, are transcribed in abundance only after viral DNA replication (Geballe et al., 1986 ; Stenberg et al., 1989 ).

Although studies on the mechanism of regulation of herpesvirus IE and E gene expression have been reported, the mechanism regulating L gene expression has not been well characterized. It has been shown that two early-late genes ({gamma}1), encoding ICP36 (UL44) and pp65 (UL83), are transcriptionally active at early and late times in infection, suggesting that these early-late genes are controlled by post-transcriptional events (Geballe et al., 1986 ; Goins & Stinski, 1986 ; Depto & Stenberg, 1989 ). It has been reported that the pp28 (UL99) protein is expressed as a true late gene product (Depto & Stenberg, 1992 ). These workers further suggested that the pp28 upstream (pp28US) promoter contains two regulatory components: one that is dependent on the onset of viral DNA synthesis and a second that is replication independent and responds to viral trans-acting factors. Using a recombinant virus, Kohler et al. (1994) further showed that the sequence from -40 to +106 in the pp28US promoter is sufficient to confer true late kinetics.

Traditionally, drug discovery has relied on the systematic screening of natural products and synthetic chemicals in biological and pharmacological assays. The rapid pace at which discoveries have been made in the field of transcriptional regulation over the past decades has opened the possibility for rational targeting of transcription factors that are involved in human disease. Cell-based viral assays hold promise for the development of therapeutic agents. Virus-encoded regulatory proteins present attractive targets for antiviral therapy since interruption of the viral gene expression cascade should prevent virus propagation without affecting the host-cell machinery (Peterson & Baichwal, 1993 ).

We were interested in determining if the temporal regulation of the HCMV true late gene pp28 (UL99) occurs only within the context of the viral genome and what role the immediate early proteins play in the regulation of its promoter. Toward that goal we tested the ability of a construct containing the pp28US promoter fused to the luciferase reporter gene to respond to viral infection when present extrachromosomally, or integrated into the host-cell chromosome. In addition, we studied the effect of the immediate early proteins, IE72, IE86 and IE55, alone or together on the pp28US promoter. Our results demonstrate that the pp28US promoter has undetectable basal activity and requires viral infection for its activation. Expression of the luciferase reporter gene, regulated by the pp28US promoter, was synchronous with that of the endogenous viral pp28 gene, independently of whether the reporter was episomal or integrated. In addition, we found that IE86 was able to transactivate the pp28US promoter but IE72 and IE55 were not. Finally, we found that activation of the pp28US promoter was specific to HCMV, as herpes simplex virus (HSV) infection did not significantly induce luciferase expression.


   Methods
Top
Abstract
Introduction
Methods
Results
Discussion
References
 
{blacksquare} Plasmids.
The pp28US promoter sequence, from position -609 to +106, was amplified by PCR using cosmid pCM1 (gift from Peter Ghazal) as a template. The oligonucleotide primer sequences are 5' AAAGGTACCGCCGGCGTCTCGCCGGGCATC 3' (sense primer) and 5' AAAAAGCTTGCCGGCCCAGCAGCTCGGGCG 3' (antisense primer). These oligonucleotide primers introduced a KpnI restriction site at the 5' end and a HindIII site at the 3'end of the pp28US promoter fragment. These unique sites allowed directional cloning into the pGL2-basic luciferase reporter plasmid (Promega). The PCR fidelity of the pp28US promoter sequence was confirmed by sequencing. Expression vectors for each of the HCMV immediate early proteins, RSV IE72, RSV IE86, RSV IE55 (gifts from Peter Ghazal), and pSVH (kindly provided by Richard M. Stenberg) have been described (Depto & Stenberg, 1989 ; Baracchini et al., 1992 , respectively).

{blacksquare} Cells and viruses.
Experiments were done with the human glioblastoma cell line U373 MG. Conditions for their growth and infection have been described (Baracchini et al., 1992 ). The Towne strain of HCMV, Vero cells and HSV-1 were purchased from the ATCC. For all infection experiments, cells were treated at an m.o.i. of 5–10 p.f.u. per cell. Phosphonoacetic acid (PAA, Sigma 99·7% purity) treatment was done as previously described (Depto & Stenberg, 1989 ). For UV treatment, the virus was exposed to UV light at 254nm for 20 min.

{blacksquare} Transfection and infection assays.
U373 MG cells were first transfected with the reporter construct by the calcium phosphate method using the Profection mammalian transfection system (Promega); 14–16 h post-transfection, cells were infected at the indicated m.o.i. Cells were harvested at specific times and assayed for luciferase activity as prescribed by the assay system manufacturer (Analytical Luminescence Laboratory).

{blacksquare} Establishment of pp28-luc stable cell line.
The pp28-luciferase reporter and pSV2Neo selection plasmid were cotransfected into U373 MG cells by the calcium phosphate method. Transfectants were selected in medium containing 0·6 mg/ml G418 on the third day after transfection. G418-resistant clones were expanded and 3x104 cells seeded in triplicate in a 96-well plate. Cells were infected with HCMV at 5–10 p.f.u. per cell; 48 h post-infection, cells were harvested at the indicated times and assayed for luciferase activity. Clones showing high luciferase activity were further analysed by PCR to ascertain the integrity of the reporter transcriptional unit integrated into the genomic DNA.

{blacksquare} mRNA isolation and Northern blot analysis.
Transfected and infected U373 MG cells were processed for messenger RNA as indicated by the manufacturer (Stratagene) of the Northern blot kit. Equal aliquots of mRNA were subjected to Northern blot analysis. Probes were labelled with [{alpha}-32P]dCTP (3000Ci/mmol, Amersham) using Prime-It RmT random primer labelling kit (Stratagene). Blots were hybridized to the radiolabelled probes for each gene using QuikHyb hybridization solution following the manufacturer’s protocol (Stratagene).

{blacksquare} IE2 antisense oligonucleotide treatment.
The sequence of oligonucleotides complementary to RNA of the IE2 region (GCGTTTGCTCTTCTTCTTGCG) and nonspecific RNA (TGGAAAGTGTACACAGGCGAA) has been described previously (Azad et al., 1993 ). The pp28-luc stable cell lines were seeded in duplicate in a 96-well plate and treated the following day with different concentrations of IE2 or nonspecific antisense oligonucleotide/Lipofectin mixture for 4 h (Azad et al., 1993 ). The medium was changed and cells were infected with HCMV at 5 p.f.u. per cell; 48 h after infection, cell were harvested, and assayed for luciferase activity.

{blacksquare} Cytotoxicity assays.
Cytotoxicity of PAA under viral DNA replication inhibition conditions was evaluated with a non-radioactive cell proliferation assay (Promega). Briefly, U373 MG cells seeded in 96-well plates were treated with 200 or 400  µg/ml PAA for 72 h, and then assayed according to the assay manufacturer’s protocol (Promega).


   Results
Top
Abstract
Introduction
Methods
Results
Discussion
References
 
Luciferase expression from the pp28US-luc reporter depends on HCMV infection
Our goal was to determine the temporal regulation of a viral late gene when out of the context of the viral genome. Molecular and biological characteristics of HCMV, namely the size of the genome (about 230 kb) and slow growth cycle in cell culture, make construction of recombinant viruses difficult. Therefore, our strategy was to construct a plasmid carrying a reporter gene under the control of a viral late promoter, reflective of a late gene expression event in the life-cycle of HCMV. We inserted the pp28US promoter fragment upstream of the luciferase reporter gene (Fig. 1). Essentially no luciferase expression resulted when this plasmid was transfected into the HCMV-permissive glioblastoma cell line U373MG, even at 72 h post-transfection (Fig. 2A). However, when the transfection was followed by infection with HCMV, luciferase activity was readily detectable at 24 h and progressively increased at 48 and 72 h (Fig. 2A). These data indicate that luciferase expression regulated through the pp28US promoter is very low in permissive cells but is strongly activated upon viral infection. However, if the transfected cells were infected with the UV-treated virus, luciferase activity was not detected, demonstrating that expression of other viral protein is necessary for late gene expression (Fig. 2B). Due to the short half-life of reporter protein and the lack of luciferase activity from transfected and uninfected cells we concluded that the increase in luciferase activity reflects activation of transcription and not simply accumulation of the reporter protein. These results indicate that activation of the pp28US promoter required viral infection.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 1. Construction of the pp28US-luciferase reporter plasmid. The prototype HCMV genome is diagrammed at the top. The genomic region between UL84 and UL110 cloned into cosmid pCM1 is shown below. pCM1 was used as template for PCR amplification of the pp28US promoter fragment (-609 to +106). The promoter sequence was then inserted into the reporter vector pGL2-basic.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Activation of the pp28US promoter requires viral infection. Glioblastoma cell line U373 MG cells were cotransfected with pp28US-luc and RSV-Lac Z; 14–16 h after transfection cells were infected with HCMV (A) or UV-treated HCMV as indicated (B) at 5–10 p.f.u. per cell, and then harvested at the indicated time-points after infection and assayed for luciferase activity. Luciferase units were normalized to {beta}-galactosidase activity.

 
Luciferase expression is synchronous with the expression of endogenous HCMV pp28 gene
Since the expression of luciferase reporter gene is under the control of the pp28US promoter, which is out of context of the viral genome, it was essential that we establish the mechanism by which it responds to viral infection compared with its endogenous counterpart. If they are expressed in a similar manner upon viral infection, one would expect to see similar expression patterns for the luciferase and the endogenous pp28 genes. To address this question, a transfection/infection assay was undertaken and mRNA analysed by Northern blot using luciferase and pp28 gene probes. As shown in Fig. 3, the pp28 mRNA was detected at 24 h post-transfection, and increased progressively at 48 and 72 h (Fig. 3A, lanes 4, 5 and 6, respectively). The expression pattern for luciferase was similar to that seen for pp28 (Fig. 3B, lanes 4, 5 and 6, respectively). In contrast, no luciferase mRNA could be detected in cells infected only (Fig. 3B, lane 2), or transfected only (Fig. 3B, lane 3), compared to mock-treated control cells (Fig. 3A, B, lane 1). These results suggest that the pp28US promoter, when outside of the viral genome context, behaves similarly to its endogenous counterpart.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3. Synchronous expression of the luciferase reporter gene with the endogenous HCMV pp28 gene. U373 MG cells were first transfected with the pp28US-luc construct (lanes 3–6). The cells were then infected with HCMV at 5–10 p.f.u. per cell (lanes 4–6) 16 h post-transfection, and harvested at the indicated times after infection. As controls, cells were left untreated (lane 1), infected only (lane 2) or transfected only (lane 3). Messenger RNA was isolated and analysed by Northern blot analysis. The same membrane was hybridized with HCMV pp28- (A) and luciferase- (B) specific probes, respectively. The arrows indicate the specific mRNAs.

 
Induction of luciferase activity from an integrated pp28US-luc reporter depends on viral DNA replication
To determine if activation of the pp28US promoter requires that it remain extrachromosomal we established a cell line carrying an integrated copy of the pp28US-luc reporter. Luciferase activity was not detectable in uninfected cells. However, upon infection with HCMV, luciferase activity was detected. Time-course analysis from three different clonal lines indicated that the pattern of induction of luciferase activity in the pp28 stable lines was similar to that in the transient transfection/infection experiments (Fig. 4A–C). These results demonstrate that the pp28US promoter integrated into the host cell chromosome required viral infection for its activation. Therefore we conclude that induction of luciferase upon infection with HCMV from the integrated pp28US reporter is a general phenomenon rather than a clonal effect.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. Effect of PAA on luciferase activity and viral DNA replication. Stable pp28US-luc cell lines were mock-infected or infected with HCMV at 5–10 p.f.u. per cell in the absence or presence of PAA as indicated. Cells were harvested 48 h post-infection, and assayed for luciferase activity. Data from three independent cell lines are shown (A–C).

 
To further characterize whether the induction of luciferase was dependent on viral DNA replication, we used PAA, a well-characterized viral DNA inhibitor (Depto & Stenberg, 1989 ). Three independent pp28US-luc cell lines were analysed, respectively. As shown in Fig. 4(A–C), the luciferase activity induced by viral infection was significantly inhibited by PAA. The inhibitory concentration of PAA (200–400 µg/ml) was not toxic to the U373 MG cells based on MTS cytotoxicity assay (data not shown); thus, the inhibitory effect was not due to general toxicity. Western analysis showed that viral pp28 protein was inhibited in a similar manner (data not shown). These results demonstrate that activation of the exogenous pp28US promoter required viral DNA replication. Therefore, we conclude that the integrated pp28US promoter is regulated similarly to the endogenous HCMV pp28 promoter. The temporal regulation of the integrated pp28US promoter represents a late stage of the life-cycle of HCMV.

IE86 is required for transactivation of the pp28US promoter
It has been reported that some viral late genes are regulated by IE gene products (Depto & Stenberg, 1989 ; Stasiak & Mocarski, 1992 ). Therefore, we were interested in determining if any of the three HCMV major IE proteins, IE86, IE72 and IE55, transactivated the pp28US promoter. Toward this goal the pp28US-luc construct was cotransfected with individual RSV expression vectors for IE86, IE72 and IE55 into U373MG cells. We found that only IE86 activated luciferase activity (18-fold), while neither IE72 nor IE55 induced luciferase activity above background (Fig. 5A). However, if pp28US-luc was cotransfected with a plasmid (pSVH) which expresses IE1 and IE2 under control of its own promoter (major immediate early promoter, MIEP), a 35-fold activation of pp28US promoter activity was seen. Western blot analysis indicated that the difference in pp28US promoter activation by different expression vectors is most likely a reflection of the higher expression level of IE86 protein from the pSVH expression vector (data not shown).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5. IE proteins activate the pp28US promoter. (A) U373 MG cells were transfected with the pp28US-luc reporter, RSV-Lac Z and increasing amounts of RSV-IE86, RSV-IE72, RSV-IE55 and pSVH as indicated; 48 h after transfection cells were harvested and assayed for luciferase activity. Luciferase units were normalized to {beta}-galactosidase activity. -Fold activation is shown. The data represent three independent experiments. (B) The pp28US-luc cell line was first treated with oligonucleotides complementary to RNA of IE2 or nonspecific RNA, respectively. Cells were then mock-infected or infected with 5–10 p.f.u. per cell HCMV and harvested 48 h later. Cell lysates were assayed for luciferase. Values are averages unit of data from triplicate samples.

 
The level of transactivation of the pp28US promoter by IE86 in cotransfection experiments is reproducible but limited. Therefore, we were interested in determining the effect of IE86 during infection on the integrated pp28US-luc reporter gene expression. The reporter cell line was infected with HCMV in the presence of an antisense oligonucleotide specific for the IE86 mRNA or nonspecific oligonucleotide (Azad et al., 1993 ). The result showed that treatment of infected cells with the IE86-specific antisense oligonucleotide resulted in a 7-fold decrease in luciferase expression (Fig. 5B), while the control oligonucleotide resulted in a slight decrease in expression of the reporter gene. Therefore, these results suggest that IE86 protein is required for activation of the pp28US promoter.

Induction of the integrated pp28 promoter is virus specific
The cascade-like pattern of gene expression in different herpesviruses is similar (Honess & Roizman, 1974 , 1975 ). In addition, the immediate early viral proteins appear to have a regulatory role in early and late gene expression. Therefore, we compared the response of the pp28US-luc reporter to two herpesviruses, HCMV and HSV. The pp28US-luc reporter cell line was infected with HCMV or HSV-1, and luciferase activity quantified at different times post-infection. As shown in Fig. 6, HCMV infection resulted in significant expression of luciferase while HSV infection had no effect on expression of the reporter gene. Western blot analysis revealed that HSV-1 gC, a late viral gene product, was efficiently expressed in HSV-1-infected U373 MG cells (data not shown). Although HSV and HCMV replicate at vastly different rates, we did not observe luciferase induction at 4 to 8 h post-infection as would be expected for HSV-1-induced gene expression. Therefore, while HSV-1 infects U373 MG cells and is able to express its late genes, it does not efficiently induce the HCMV pp28US promoter, suggesting that activation of the pp28US promoter is virus specific.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6. Kinetic analysis of luciferase induction of the pp28US-luc stable cell line upon HCMV or HSV infection. The pp28US-luc stable cell line, described in Methods, was infected with HCMV or HSV at 5–10 p.f.u. per cell. Cells were harvested at the indicated times post-infection and assayed for luciferase activity. The data represent three independent experiments.

 

   Discussion
Top
Abstract
Introduction
Methods
Results
Discussion
References
 
We describe a cell-based viral assay system derived by transfection of U373 MG cells with a reporter construct containing the luciferase gene under control of an HCMV pp28US late promoter. Several reporter genes have been used extensively (Moreira et al., 1992 ): bacterial chloramphenicol acetyltransferase (CAT), firefly luciferase (LUC), human growth hormone (hGH), and bacterial {beta}-galactosidase. Both cat and luc genes are most commonly used in eukaryotic cells. Luciferase offers the advantage of being 10- to 1000-fold more sensitive than CAT, fast quantification, short half-life (3 h for luc compared to 50 h for cat in mammalian cells) and negligible background. These properties of the luciferase reporter provide a more sensitive monitor of changes in transcription than more stable reporters like cat (Thompson et al., 1991 ). The results showed that temporal regulation of integrated pp28US promoter has the following characteristics: first, its activation is dependent on viral infection; second, the induction is synchronous with that of the endogenous pp28 gene; and third, activation depends on viral DNA replication. These features demonstrate that the exogenous pp28US-luciferase reporter system provides an accurate reflection of late gene expression events in the HCMV infection cycle.

This study demonstrates that the pp28US (UL99) promoter requires viral DNA replication for its maximal expression even when present on a plasmid. This is consistent with studies on the true late US11 promoter of HSV-1 (Johnson & Everett, 1986 ; Johnson et al., 1986 ). In that study, the authors found that the US11 promoter present on a plasmid was expressed with similar kinetics to the viral US11 promoter, and required viral DNA replication for abundant expression. However, the temporal regulation of the HCMV pp28US promoter is different from that reported for the HSV late gene, gC (Arsenakis et al., 1986 ). In that study, the authors found that the gC transcriptional unit integrated into the host cell genome was expressed as an early gene. In addition, they found that in the presence of PAA the integrated gC was expressed at higher levels, as expected of a natural viral early gene. In contrast, we did not observe an increase in luciferase activity, protein or mRNA levels in the presence of PAA at any concentration. It has been reported that the pp28US promoter is activated early in a cotransfection assay (Depto & Stenberg, 1992 ). In this study, we also detected luciferase activity at 24 h post-infection in a transfection/infection assay (see Fig. 2A). However, when the promoter is integrated into the host chromosome, this effect was greatly decreased (see Fig. 6). This difference between the response of transiently transfected and integrated reporters may reflect the expected tighter regulation of the chromatin structure of the integrated promoter. Our results demonstrate that the temporal regulation of the integrated pp28US promoter mimics that of its endogenous counterpart. Therefore, we conclude that the pp28US promoter behaves as a late promoter when removed from the context of the viral genome and integrated into the host cell genome.

The cascade model of gene regulation predicts that late gene expression is dependent on the production of viral transactivators early in infection. It has been demonstrated that IE1 and IE2 are sufficient for activation of a late gene encoding pp65 (Depto & Stenberg, 1989 ) and that the activation of the ICP36 promoter requires viral immediate early proteins, IE86, IE72 and IE55 (Stasiak & Mocarski, 1992 ). In cotransfection assays, Depto & Stenberg (1992) showed that the IE proteins are insufficient for activation of the pp28US promoter in human fibroblast cells. In our study, we found that IE proteins were able to transactivate the pp28US promoter in the permissive human glioblastoma cell line U373 MG. This difference may be a reflection of the different cell types used. In addition, use of different reporters and possible distinct transfection efficiencies could exacerbate stoichiometric differences in viral and cellular factors necessary for transactivation. Nevertheless, our results show that the kinetics of activation of the endogenous viral pp28US promoter is identical to that of the integrated copy in HCMV-susceptible U373 MG cells. Furthermore, our data suggest that IE86 is a viral transcription factor required for pp28US promoter activation. However, the higher activation observed upon HCMV infection may reflect accessory activation by other viral factors.

Comparative analysis of luciferase activity in the stable cell line infected with either HCMV or HSV-1 showed that robust induction was seen only with the homologous virus, HCMV. As expected from our results with PAA, inhibition of HCMV virus replication blocks expression of the luciferase gene, thus making this assay also sensitive to inhibition of viral DNA replication. This virus replication-dependent assay is a facile, microtitre plate-formatted assay amenable for high throughput screening. In addition, the assay system can be completed in 24–48 h and thus is more expedient than the 3–4 weeks required for an HCMV plaque assay. Therefore, this system provides a quick, sensitive and quantitative HCMV detection assay.

In summary, we developed a reporter cell line with two important biological applications: first, it is specific for HCMV and thus can be used for quick and sensitive detection of HCMV; second, it provides a method for identifying inhibitors of HCMV virus replication. Potentially, two classes of inhibitors may be detected. Those that directly inhibit virus replication; and those that indirectly inhibit virus replication by decreasing expression of a viral gene required for genomic replication.


   Acknowledgments
 
We thank Peter Ghazal and Richard M. Stenberg for the gifts of the RSV IE gene expression vectors, pCM1 and the plasmid pSVH, respectively, and Robert Kovelman, Leon Garcia-Martinez and Laure de Parseval for critical comments on the manuscript.


   Footnotes
 
b Present address: Keck Graduate Institute of Applied Life Science, 535 Watson Drive, Claremont, CA 91711, USA.


   References
Top
Abstract
Introduction
Methods
Results
Discussion
References
 
Alford, C. A. & Britt, W. J. (1990). Cytomegalovirus. New York: Raven Press.

Azad, R. F., Driver, V. B., Tanaka, K., Crooke, R. M. & Anderson, K. P. (1993). Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region. Antimicrobial Agents and Chemotherapy 37, 1945-1954.[Abstract]

Arsenakis, M., Foa-Tomasi, L., Speziali, V., Roizman, B. & Campadelli-Fiume, G. (1986). Expression of regulation of glycoprotein C gene of herpes simplex virus 1 resident in a clonal L-cell line. Journal of Virology 58, 367-376.[Medline]

Baracchini, E., Glezer, E., Fish, K., Stenberg, R. M., Nelson, J. A. & Ghazal, P. (1992). An isoform variant of the cytomegalovirus immediate-early auto repressor functions as a transcriptional activator. Virology 188, 518-529.[Medline]

Chambers, J., Angulo, A., Amaratunga, D., Guo, H., Jiang, Y., Wan, J. S., Bittner, A., Frueh, K., Jackson, M. R., Peterson, P. A., Erlander, M. G. & Ghazal, P. (1999). DNA microarrays of the complex human cytomegalovirus genome: profiling kinetic class with drug sensitivity of viral gene expression. Journal of Virology 73, 5757-5766.[Abstract/Free Full Text]

Cherrington, J. M. & Mocarski, E. S. (1989). Human cytomegalovirus IE1 transactivates the promoter-enhancer via an 18-base-pair repeat element. Journal of Virology 63, 1435-1440.[Medline]

Depto, A. S. & Stenberg, R. M. (1989). Regulated expression of the human cytomegalovirus pp65 gene: octamer sequence in the promoter is required for activation by viral gene products. Journal of Virology 63, 1232-1238.[Medline]

Depto, A. S. & Stenberg, R. M. (1992). Functional analysis of the true late human cytomegalovirus pp28 upstream promoter: cis-acting elements and viral trans-acting proteins necessary for promoter activation. Journal of Virology 66, 3241-3246.[Abstract]

Drew, W. L., Mintz, L., Hoo, R. & Finly, T. N. (1979). Growth of herpes simplex and cytomegalovirus in cultured human alveolar macrophages. American Review of Respiratory Disease 119, 287-291.[Medline]

Fish, K. N., Depto, A. S., Moses, A. V., Britt, W. & Nelson, J. A. (1995). Growth kinetics of human cytomegalovirus are altered in monocyte-derived macrophages. Journal of Virology 69, 3737-3743.[Abstract]

Fish, K. N., Soderberg-Naucler, C., Mills, L. K., Stenglein, S. & Nelson, J. A. (1998). Human cytomegalovirus persistently infects aortic endothelial cells. Journal of Virology 72, 5661-5669.[Abstract/Free Full Text]

Geballe, A. P., Leach, F. S. & Mocarski, E. S. (1986). Regulation of cytomegalovirus late gene expression: {gamma} genes are controlled by posttranscriptional events. Journal of Virology 57, 864-874.[Medline]

Goins, W. F. & Stinski, M. F. (1986). Expression of a human cytomegalovirus late gene is posttranscriptionally regulated by a 3' end processing event occurring exclusively late after infection. Molecular and Cellular Biology 6, 4202-4213.[Medline]

Gonczol, E., Andrew, P. W. & Plotkin, S. A. (1984). Cytomegalovirus replicates in differentiated but not in undifferentiated human embryonal carcinoma cells. Science 224, 159-161.[Medline]

Hagemeier, C., Walker, S., Caswell, R., Kouzarides, T. & Sinclair, J. (1992). The human cytomegalovirus 80-kilodalton but not the 72-kilodalton immediate-early protein transactivates heterologous promoters in a TATA box-dependent mechanism and interacts directly with TFIID. Journal of Virology 66, 4452-4456.[Abstract]

Hermiston, T., Malone, C., Witte, P. & Stinski, M. (1987). Identification and characterization of the human cytomegalovirus immediate-early region 2 gene that stimulates gene expression from an inducible promoter. Journal of Virology 61, 3214-3221.[Medline]

Ho, M. (1991). Cytomegalovirus: Biology and Infection. New York: Plenum.

Honess, R. W. & Roizman, B. (1974). Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins. Journal of Virology 14, 8-19.[Medline]

Honess, R. W. & Roizman, B. (1975). Regulation of herpesvirus macromolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides. Proceedings of the National Academy of Sciences, USA 72, 1276-1280.[Abstract]

Ibanez, C. E., Schrier, R., Ghazal, P., Wiley, C. & Nelson, J. A. (1991). Human cytomegalovirus productively infects primary differentiated macrophages. Journal of Virology 65, 6581-6588.[Medline]

Jahn, G., Knust, E., Schmulla, H., Jarre, T., Nelson, J. A., McDougall, J. K. & Fleckenstein, B. (1984). Predominant immediate-early transcripts of human cytomegalovirus AD169. Journal of Virology 49, 363-370.[Medline]

Johnson, P. A. & Everett, R. D. (1986). DNA replication is required for abundant expression of a plasmid-borne late US11 gene of herpes simplex virus type 1. Nucleic Acids Research 14, 3609-3625.[Abstract]

Johnson, P. A., MacLean, C., Marsden, H. S., Dalziel, R. G. & Everett, R. D. (1986). The product of gene US11 of herpes simplex virus type 1 is expressed as a true late gene. Journal of General Virology 67, 871-883.[Abstract]

Kohler, C. P., Kerry, J. A., Carter, M., Muzithras, V. P., Jones, T. R. & Stenberg, R. M. (1994). Use of recombinant virus to assess human cytomegalovirus early and late promoters in the context of the viral genome. Journal of Virology 68, 6589-6597.[Abstract]

Kondo, K., Kaneshima, H. & Mocarski, E. S. (1994). Human cytomegalovirus latent infection of granolocyte-macrophage progenitors. Proceedings of the National Academy of Sciences, USA 91, 11879-11883.[Abstract/Free Full Text]

Lang, D. & Stamminger, T. (1993). The 86-kilodalton IE-2 protein of human cytomegalovirus is a sequence-specific DNA-binding protein that interacts directly with the negative autoregulatory response element located near the cap site of the IE-1/2 enhancer-promoter. Journal of Virology 67, 323-331.[Abstract]

McDonough, S. H. & Spector, D. H. (1983). Transcription in human fibroblasts permissively infected by human cytomegalovirus strain AD169. Virology 125, 31-46.[Medline]

Malone, C. L., Vesole, D. H. & Stinski, M. F. (1990). Transactivation of human cytomegalovirus early promoters by gene products from the immediate-early gene IE2 and augmentation by IE1: mutational analysis of the viral proteins. Journal of Virology 64, 1498-1506.[Medline]

Moreira, J. L., Wirth, M., Fitzek, M. & Hauser, H. (1992). Evaluation of reporter genes in mammalian cell lines. Methods in Molecular and Cellular Biology 3, 23-29.

Peterson, M. G. & Baichwal, V. R. (1993). Transcription factor based therapeutics: drugs of the future? Trends in Biotechnology 11, 11-18.[Medline]

Pizzorno, M. C. & Hayward, G. S. (1990). The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major immediate-early promoter through a target sequence located near the cap site. Journal of Virology 64, 6154-6165.[Medline]

Schwartz, R., Sommer, M. H., Scully, A. L. & Spector, D. H. (1994). Site-specific binding of the human cytomegalovirus IE2 86-kilodalton protein to an early gene promoter. Journal of Virology 68, 5613-5622.[Abstract]

Sinzger, C., Grefte, A., Plachter, B., Gouw, A. S. H., The, T. H. & Jahn, G. (1995). Fibroblasts, epithelial cells, endothelial cells, and smooth muscle cells are the major targets of human cytomegalovirus infection in lung and gastrointestinal tissues. Journal of General Virology 76, 741-750.[Abstract]

Sommer, M. H., Scully, A. L. & Spector, D. H. (1994). Transactivation by the human cytomegalovirus IE2 86 protein requires a domain that binds to both the TATA box-binding protein and the retinoblastoma protein. Journal of Virology 68, 6223-6231.[Abstract]

Spaete, R. R. & Mocarski, E. S. (1985). Regulation of cytomegalovirus gene expression: {alpha} and {beta} promoters are transactivated by viral function in permissive human fibroblasts. Journal of Virology 56, 135-143.[Medline]

Spector, D. H. (1996). Activation and regulation of human cytomegalovirus early gene. Intervirology 39, 361-377.[Medline]

Stasiak, P. & Mocarski, E. S. (1992). Transactivation of the cytomegalovirus ICP36 gene promoter requires a gene product TRS1 in addition to IE1 and IE2. Journal of Virology 66, 1050-1058.[Abstract]

Stenberg, R. M. (1996). The human cytomegalovirus major immediate-early gene. Intervirology 39, 343-349.[Medline]

Stenberg, R. M., Depto, A. S., Fortney, J. & Nelson, J. A. (1989). Regulated expression of early and late RNAs and proteins from the human cytomegalovirus immediate-early gene region. Journal of Virology 63, 2699-2708.[Medline]

Thompson, J. F., Hayes, L. S. & Lloyd, D. B. (1991). Modulation of firefly luciferase stability and impact on studies of gene regulation. Gene 103, 171-177.[Medline]

Wu, J., Jupp, R., Stenberg, R. M., Nelson, J. A. & Ghazal, P. (1993). Site-specific inhibition of RNA polymerase II preinitiation complex assembly by human cytomegalovirus IE86 protein. Journal of Virology 67, 7547-7555.[Abstract]

Received 22 August 2000; accepted 15 January 2001.



This Article
Abstract
Full Text (PDF)
Alert me when this article is cited
Alert me if a correction is posted
Citation Map
Services
Email this article to a friend
Similar articles in this journal
Similar articles in PubMed
Alert me to new issues of the journal
Download to citation manager
Google Scholar
Articles by Wu, J.
Articles by Barbosa, M. S.
Articles citing this Article
PubMed
PubMed Citation
Articles by Wu, J.
Articles by Barbosa, M. S.
Agricola
Articles by Wu, J.
Articles by Barbosa, M. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
INT J SYST EVOL MICROBIOL MICROBIOLOGY J GEN VIROL
J MED MICROBIOL ALL SGM JOURNALS