Graduate Institute of Veterinary Microbiology1 and Department of Veterinary Medicine2, National Chung Hsing University, Taichung, Taiwan, Republic of China
Veterinary Science Division, Department of Agriculture and Rural Development for Northern Ireland, Stoney Road, Stormont, Belfast BT4 3SD, UK2
Author for correspondence: Happy K. Shieh. Fax +886 4 22872392. e-mail hkshieh{at}dragon.nchu.edu.tw
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
NDV remains one of the most important pathogens of poultry (Alexander, 1997 ). Outbreaks of NDV have been causing severe economic loses in many countries (Alexander, 1995
; Lomniczi et al., 1998
; Yang et al., 1999
) and at least three panzootics of NDV have been recognized (Alexander, 1988
). In addition to NDV, APMV-2 and -3 might also lead to severe disease. For example, APMV-2 infections have been associated with severe respiratory disease and a drop in egg production in turkeys (Bankowski et al., 1995
; Lipkind et al., 1995
) and APMV-3 infections might also be responsible for problems in egg production of turkeys (Alexander et al., 1983
; Alexander, 2000
). In comparison, infections of APMV-4 to -9 appear to be apathogenic, except that APMV-6 might cause a mild respiratory disease and problems in egg production in turkeys (Alexander, 1997
). Cross-reaction tests of haemagglutination inhibition (HI) and neuraminidase inhibition (NI) show that APMV could be divided into two subgroups: the first subgroup contains APMV-2 and -6 and the second subgroup contains APMV-1, -3, -4, -7, -8 and -9 (Lipkind & Shihmanter, 1986
).
The nucleotide sequence of the complete genome of NDV has been determined (Krishnamurthy & Samal, 1998 ; de Leeuw & Peeters, 1999
). The genome of NDV is 15186 nt in length and encodes at least seven proteins, nucleocapsid protein (NP), phosphoprotein (P), V protein, matrix protein (M), haemagglutininneuraminidase (HN) protein, fusion protein (F) and large protein (L). NDV is currently classified into the genus Rubulavirus, but unlike the rubulaviruses simian virus type 5 (SV-5) and mumps virus (MuV), NDV does not contain the small hydrophobic (SH) protein. Phylogenetic analyses based on nucleotide or protein sequences, together with other biological properties of NDV, suggest that NDV (and probably other APMV) should be assigned to a new genus or subfamily (de Leeuw & Peeters, 1999
; Seal et al., 2000
). Although this assignment is evident for NDV, it remains questionable for other APMV serotypes (APMV-2 to -9), as little information is available concerning the sequences of APMV-2 to -9. To date, only the sequences of the F and HN genes of APMV-2 and the HN gene of APMV-4 are deposited in GenBank (accession numbers D13977, D14030 and D14031, respectively; all unpublished). Here, we report the complete nucleotide sequence of an APMV-6 serotype and compare its sequence with those of other paramyxoviruses in order to understand the genomic structure and taxonomic position of APMV.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Virus purification and RNA isolation.
Virus was purified by discontinuous sucrose gradient centrifugation. In brief, 400 ml allantoic fluid was clarified by centrifugation at 5000 r.p.m. for 30 min at 4 °C in a JA-10 rotor (Beckman). Supernatant was collected and overlaid onto a 20% sucrose solution and centrifuged at 25000 r.p.m. for 4 h at 4 °C in an SW-28 rotor (Beckman). The pellet was collected and resuspended in a total of 10 ml TNE buffer (100 mM Tris, pH 7·2, 100 mM NaCl, 1 mM EDTA). The resuspended virus was overlaid onto a 2050% discontinuous sucrose gradient and centrifuged at 35000 r.p.m. for 2 h at 4 °C in an SW-41 rotor (Beckman). Virus bands were collected and diluted by adding 4 vols of TNE buffer. The virus was then pelleted by centrifugation at 35000 r.p.m. for 2 h at 4 °C in an SW-41 rotor. The virus pellet was resuspended in 1 ml of TNE buffer and stored at -20 °C. Viral RNA was extracted using Trizol reagent (Life Technologies), according to the manufacturers instructions.
Genome walking by RTPCR.
The NP gene was used as the first start-point for walking and sequencing of the APMV-6 genome. Based on the consensus sequences of the NP genes of rubulaviruses, two primers, NP (+), 5' AAYRCSGGKMTKRCWSCWTTCTT, and NP (), 5' GWWSCYAYWCCCATKGCAWA (Y=C/T, R=A/G, S=G/C, K=G/T, M=A/C and W=A/T), were designed. These primers amplify a 236 bp fragment from APMV-6. The sequence of this 236 bp fragment was then used as the first start-point for walking the APMV-6 genome. The second start-point for genome walking was a primer design based on the consensus sequences of the HN genes of different strains of NDV. This primer, 5' CTGCCTTCGGCCCCCATGAG, anneals specifically to the corresponding region of the HN gene of APMV-6 and serves as the second start-point for genome walking. Two strategies were used for genome walking. The first strategy, targeted gene walking PCR (Parker et al., 1991 ), is based on the use of two primers. The first primer is specific and anneals to a known sequence, whereas the second is a nonspecific walking primer, which anneals to an unknown site. We found the following nonspecific primers useful for walking the genome of APMV-6: NSP1 (5' AKCRAAAGCACC), NSP2 (5' AGTAGAAACAAGG), NSP3 (5' ACAAGGGTGAGG), NSP4 (5' GTTTTTTCTTAA) and NSP5 (5' ATACGGGTAGAA). The second strategy used for genome walking is SMART PCR cDNA synthesis' (Clontech). In this strategy, first-strand cDNA is synthesized by SuperScript II reverse transcriptase (Life Technologies) using a primer specific to APMV-6. SuperScript II adds a poly(dC) tail to the 3' end of the newly synthesized cDNA. RTPCR is then carried out using the SMART II primer (5' AAGCAGTGGTAACAACGCAGAGTACGCGGG) coupled with the primer used for first-strand cDNA synthesis.
RTPCR was carried out in a 25 µl reaction mixture containing 2·5 µl of 10x reaction buffer, 2·5 µl dNTPs (2 mM each of four dNTPs), 0·2 µl AMV reverse transcriptase (50 U/µl), 0·3 µl RNase inhibitor (40 U/µl), 0·5 µl Taq DNA polymerase (9 U/µl), 1 µl of each primer (10 pmol each of four dNTPs), 1 µl of RNA template and 17 µl of water. All reagents were purchased from Promega. The general conditions for RTPCR were 42 °C for 50 min (reverse transcription), 95 °C for 3 min, 35 cycles of 95 °C for 40 s (denaturation), 45 °C for 40 s (annealing) and 72 °C for 1 min (extension), followed by 72 °C for 7 min (final extension).
3'- and 5'-RACE (rapid amplification of cDNA ends).
The sequences of the 3'- and 5'-termini of the viral genome were amplified by 3'- and 5'-RACE. 3'-RACE was carried out as described previously (Schutze et al., 1995 ; de Leeuw & Peeters, 1999
). In brief, 100 pmol of the primer ALG3 (5' CACGAATTCACTATCGATTCTGATCCTTC) was ligated to the 3' end of the viral RNA (5 µg) by T4 RNA ligase (50 U) (New England Biolabs) in a 25 µl reaction mixture at 25 °C for 6 h. The ligated product was purified using the High Pure PCR Product Purification kit (Roche) and then used as a template for RTPCR with the primers ALG4 (5' GAAGGATCCAGAATCGATAG), which is complementary to ALG3, and SP3 (5' AGTGAAACGAATGGTCTGGT), which is specific for the NP gene of APMV-6. 5'-RACE was carried out using the 5'-RACE kit (Roche). In brief, first-strand cDNA was synthesized by AMV reverse transcriptase using the primer SP1 (5' CCTGACGTGACGATTGATG), which anneals to sequences located 61 nt downstream of the termination codon of the L gene of APMV-6. First-strand cDNA was then purified using the High Pure PCR Product Purification kit and a poly(A) tail was added to the 3' end of the cDNA using terminal transferase and dATP. The poly(A)-tailed cDNA was then used as the template for PCR with the primers oligo(dT)-anchor (5' ACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTV) (V=A/C/G) and SP2 (5' GGTATCGGTATCGGAGATTA), which anneals to sequences located 144 nt downstream of the termination codon of the L gene of APMV-6.
Cloning and sequencing of RTPCR products.
PCR products were purified using the Geneclean III kit (BIO101) and cloned into the pCR2.1-TOPO vector (Invitrogen), according to the manufacturers instructions. Recombinant plasmids from 10 to 20 clones containing the product of each PCR reaction were purified using the QIAprep Spin Plasmid Purification kit (Qiagen) and sequenced in both directions with primers flanking the inserts using an automatic sequencer (ABI-377, PE Applied Biosystems). Each nucleotide position of APMV-6 was sequenced four to eight times. Moreover, the sequences of all intergenic and coding regions of the NP, P, M, F, SH and HN genes and important regions of the L gene were confirmed by direct sequencing of the RTPCR products, amplified from the above regions by the high fidelity Titan One Tube RTPCR kit (Roche).
Sequence and phylogenetic analysis.
Sequences were compiled using the SEQMAN program in LASERGENE (DNASTAR). Open reading frames (ORFs) were predicted using the GENEQUEST program in the same package. The BLAST program was used to search GenBank for homologous protein sequences (Altschul et al., 1990 ). Phylogenetic analysis was performed using the MEGALIGN program in LASERGENE with CLUSTAL multiple-alignment algorithm. Bootstrap values were calculated using the following software: SEQBOOT, PRODIST, NEIGHBOR and CONSENSE in PHYLIP (Felsenstein, 1993
).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Leader and trailer sequences of APMV-6
The 3' and 5' ends of the APMV-6 genome comprise the leader and trailer regions; the leader sequence is 55 nt long and the trailer sequence is 54 nt long (Fig. 1A, B
). The length of the leader sequence, 55 nt (Fig. 1A
), is highly conserved among members of the subfamily Paramyxovirinae, confirming that APMV-6 belongs to this subfamily. In comparison, the length of the trailer is variable (Fig. 1B
). APMV-6 contains a 54 nt trailer, which is within the typical range (4060 nt) of most members of the subfamily Paramyxovirinae (Fig. 1B
). The 3' terminus of the leader (UGGU) and the 5' terminus of the trailer (ACCA) sequences are identical in all Paramyxovirinae (Fig. 1A
, B
; shaded sequences). For APMV-6, the termini of the leader (UGGUUUGU) and trailer (ACCAAACAA) sequences are similar to those of NDV and members of the genera Morbillivirus [canine distemper virus (CDV), measles virus (MeV) and rinderpest virus (RPV)] and Respirovirus [bovine and human parainfluenza virus (PIV) type 3 and Sendai virus (SeV)] (Fig. 1A
, B
; underlined sequences), but distinct from members of the genus Rubulavirus (hPIV-2, MuV and SV-5, SV-41). Complementarity is found between the 3' and 5' ends of APMV-6; 22 of the first 24 terminal nucleotides are exactly complementary to each other (Fig. 1C
), indicating that the promoters for genomic and anti-genomic replication are located in the first 24 terminal nucleotides.
|
|
|
|
SH protein
Hydrophilicity analysis shows that the putative SH protein of APMV-6 contains a hydrophobic region near the terminus of the protein (Fig. 3). This hydrophobic region is about 30 residues in size, which is similar to the general size of the hydrophobic regions of other paramyxoviruses (Fig. 3
). However, the SH protein of APMV-6 exhibits two unique features. First, it contains a second large hydrophobic region of about 20 residues downstream of the first hydrophobic region (Fig. 3
). The presence of two hydrophobic regions, both of 2030 residues, is unique among paramyxoviruses. Second, the full size of the SH protein of APMV-6 is 142 residues, which is larger than the general size (4481 residues) of the paramyxovirus SH protein, but is smaller than the unusual large size (174 residues) of the SH protein of avian pneumovirus (APV), also known as turkey rhinotracheitis virus (TRTV) (Ling et al., 1992
). Two potential N-linked glycosylation sites, located at residues 90 and 105, are found in the SH protein of APMV-6. Both sites are on the C-terminal side of the hydrophobic region, which is consistent with the notion that the C-terminal side of the SH protein is located on the outside of the cell membrane (Hiebert et al., 1988
; Collins & Mottet, 1993
).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
NDV is classified into the genus Rubulavirus. However, phylogenetic analysis and other biological properties all suggest that NDV should be assigned to a new genus (de Leeuw & Peeters, 1999 ; Seal et al., 2000
). This assignment is evident for NDV, but remains undecided for other APMV, primarily due to the lack of APMV sequence data. In this report, we show the complete nucleotide sequence of APMV-6 and demonstrate that NDV, APMV-2, -4 and -6 form a unique phylogenetic cluster within the subfamily Paramyxovirinae. This result might provide an important basis for the reclassification of all APMV serotypes into a new genus, separate from the genus Rubulavirus. As well as the result of phylogenetic analysis, there is additional evidence supporting this separation. First, the sequences of the 5'- and 3'-termini and the editing site of the APMV-6 P and V proteins are all similar to those of NDV and other members of the genera Morbillivirus and Respirovirus, but distinct from those of the genus Rubulavirus. Second, NDV and APMV-6 edit their P gene mRNA from P to V; this strategy is similar to that employed by respiroviruses and morbilliviruses, but differs from that of rubulaviruses, which edit their mRNA from V to P (Steward et al., 1993
). Third, the hosts of NDV and other APMV are birds, whereas those of rubulaviruses and all other paramyxoviruses are mammals.
Although APMV should form a new genus, the new genus is still closer to the genus Rubulavirus than to other genera within the subfamily Paramyxovirinae. This conclusion is based on the following observations. First, in all of the phylogenetic trees examined in this work, APMV form a cluster that is closer to the genus Rubulavirus than to the Morbillivirus and Respirovirus genera. Second, the lack of conservation in length and sequence of intergenic regions of the viral genome is common in NDV, APMV-6 and members of the genus Rubulavirus, but entirely different from members of the Respirovirus and Morbillivirus genera, which have conserved trinucleotide intergenic sequences (Kolakofsky et al., 1998 ). Finally, APMV-6 contains the SH gene, which is present in SV-5 and MuV (genus Rubulavirus), but absent in all members of the Respirovirus and Morbillivirus genera. Therefore, although APMV should constitute a new genus, the genus is still closely related to the genus Rubulavirus. This notion justifies, to some extent, the previous taxonomic classification of NDV into the genus Rubulavirus, and also justifies the current name of the new genus, Avulavirus. The presence of the SH gene in APMV-6 suggests that APMV-6 might play an intermediate role between the evolution of APMV and members of the genus Rubulavirus.
We show by phylogenetic analysis that APMV-6 is more similar to APMV-2 than to NDV and APMV-4. A previous study using HI and NI tests has shown that APMV serotypes are divided into two subgroups: the first group contains APMV-6 and -2 and the second group contains the remaining APMV serotypes (Lipkind et al., 1995 ). Therefore, the result of grouping by phylogenetic analysis is consistent with that determined by traditional serological study.
Target gene walking PCR has been used successfully for the amplification of unknown DNA sequences adjacent to known DNA sequences (Parker et al., 1991 ). Two primers are used for this type of PCR: one is a sequence-specific primer, which hybridizes to known sequences, and the other is a nonspecific walking primer, which hybridizes to unknown sequences. PCR using the two primers allows the amplification of an unknown sequence adjacent to the site of a known sequence. It was found that Taq polymerase can initiate PCR from the nonspecific walking primer, as long as there is a partial homology at the 3' end of the primer (Parker et al., 1991
). In this report, we show that the same strategy can be used for walking on RNA as well as DNA. Moreover, walking can be directed either upstream or downstream of the known RNA sequence, indicating that reverse transcriptase, like Taq polymerase, can initiate DNA synthesis from a primer that bears only partial homology to its target site.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alexander, D. J. (1989). Newcastle disease. In A Laboratory Manual for the Isolation and Identification of Avian Pathogens , pp. 110-112. Edited by H. G. Purchase, L. H. Arp, S. B. Hitchner, C. H. Domermuth & J. E. Pearson. Texas:American Association of Avian Pathologists.
Alexander, D. J. (1995). The epidemiology and control of avian influenza and Newcastle disease. Journal of Comparative Pathology 112, 105-126.[Medline]
Alexander, D. J. (1997). Newcastle disease and other avian Paramyxoviridae infections. In Diseases of Poultry , pp. 541-569. Edited by B. W. Calnek. Ames:Iowa State University Press.
Alexander, D. J. (2000). Newcastle disease and other avian paramyxoviruses. Revue Scientifique et Technique 19, 443462 (in French).[Medline]
Alexander, D. J., Pattisson, M. & Macpherson, I. (1983). Avian paramyxovirus of PMV-3 serotype in British turkeys. Avian Pathology 12, 469-482.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology 215, 403-410.[Medline]
Bankowski, R. A., Almquist, J. & Dombruski, J. (1995). Effect of paramyxovirus Yucaipa on fertility, hatchability, and poultry yield of turkeys. Avian Diseases 25, 517-520.
Collins, P. L. & Mottet, G. (1993). Membrane orientation and oligomerization of the small hydrophobic protein of human respiratory syncytial virus. Journal of General Virology 74, 1445-1450.[Abstract]
Collins, M. S., Bashiruddin, J. B. & Alexander, D. J. (1993). Deduced amino acid sequences at the fusion protein cleavage site of Newcastle disease viruses showing variation in antigenicity and pathogenicity. Archives Virology 128, 363-370.
de Leeuw, O. & Peeters, B. J. (1999). Complete nucleotide sequence of Newcastle disease virus: evidence for the existence of a new genus within the subfamily Paramyxovirinae. Journal of General Virology 80, 131-136.[Abstract]
Felsenstein, J. (1993). PHYLIP: Phylogeny Inference Package, version 3.5c. University of Washington, Seattle, WA, USA.
Graham, D. A., German, A., Abernethy, D., McCullough, S. J., Manvell, R. J. & Alexander, D. J. (1999). Isolation of ortho- and paramyxoviruses from wild birds in Northern Ireland during the 1997 Newcastle disease epizootic. Veterinary Record 145, 20-21.[Medline]
Hiebert, S. W., Richardson, C. D. & Lamb, R. A. (1988). Cell surface expression and orientation in membranes of the 44-amino-acid SH protein of simian virus 5. Journal of Virology 62, 2347-2357.[Medline]
Kolakofsky, D., Pelet, T., Garcin, D., Hausmann, S., Curran, J. & Roux, L. (1998). Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology 72, 891-899.
Krishnamurthy, S. & Samal, S. K. (1998). Nucleotide sequences of the trailer, nucleocapsid protein gene and intergenic regions of Newcastle disease virus strain Beaudette C and completion of the entire genome sequence. Journal of General Virology 79, 2419-2424.[Abstract]
Lamb, R. A. & Kolakofsky, D. (1996). Paramyxoviridae: the viruses and their replication. In Fields Virology , pp. 577-604. Edited by B. N. Fields, D. M. Knipe & P. M. Howley. Philadelphia:LippincottRaven.
Ling, R., Easton, A. J. & Pringle, C. R. (1992). Sequence analysis of the 22K, SH and G genes of turkey rhinotracheitis virus and their intergenic regions reveals a gene order different from that of other pneumoviruses. Journal of General Virology 73, 1709-1715.[Abstract]
Lipkind, M. & Shihmanter, E. (1986). Antigenic relationships between avian paramyxoviruses. I. Quantitative characteristics based on hemagglutination and neuraminidase inhibition tests. Archives of Virology 89, 89-111.[Medline]
Lipkind, M., Alexander, D., Shihmanter, E., Weisman, Y. & Collins, M. (1995). Antigenic heterogeneity of avian paramyxoviruses of serotype 2 (Yucaipa-like) isolated from domestic and wild birds in Israel. Comparative Immunology, Microbiology and Infectious Diseases 18, 189-207.[Medline]
Lomniczi, B., Wehmann, E., Herczeg, J., Ballagi-Pordany, A., Kaleta, E. F., Werner, O., Meulemans, G., Jorgensen, P. H., Mante, A. P., Gielkens, A. L., Capua, I. & Damoser, J. (1998). Newcastle disease outbreaks in recent years in western Europe were caused by an old (VI) and a novel genotype (VII). Archives of Virology 143, 49-64.[Medline]
Marius-Jestin, V., Cherbonnel, M., Picault, J. P. & Bennejean, G. (1987). Isolation from ducks of a hypervirulent strain of duck plague virus and an avian type 6 paramyxovirus. Comparative Immunology, Microbiology and Infectious Disease 10, 173-186.
Mayo, M. A. & Pringle, C. R. (1998). Virus taxonomy 1997. Journal of General Virology 79, 649-657.
Parker, J. D., Rabinovitch, P. S. & Burmer, G. C. (1991). Targeted gene walking polymerase chain reaction. Nucleic Acids Research 19, 3055-3060.[Abstract]
Pringle, C. R. (1998). Virus taxonomy San Diego 1998. Archives of Virology 143, 1449-1459.[Medline]
Rima, B. K., Alexander, D. J., Billeter, D. J., Collins, M. A., Kingsbury, P. L., Lipkind, D. W., Nagai, M. A., Örvell, C., Pringle, C. R. & ter Meulen, V. (1995). Paramyxoviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses , pp. 268-274. Edited by F. A. Murphy, C. M. Fauquet, D. H. L Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna:Springer-Verlag.
Schutze, H., Enzmann, P. J., Kuchling, R., Mundt, E., Niemann, H. & Mettenleiter, T. C. (1995). Complete genomic sequence of the fish rhabdovirus infectious haematopoietic necrosis virus. Journal of General Virology 76, 2519-2527.[Abstract]
Seal, B. S., King, D. J. & Meinersmann, R. J. (2000). Molecular evolution of the Newcastle disease virus matrix protein gene and phylogenetic relationships among the Paramyxoviridae. Virus Research 66, 1-11.[Medline]
Shortridge, K. F., Alexander, D. J. & Collins, M. S. (1980). Isolation and properties of viruses from poultry in Hong Kong which represent a new (sixth) distinct group of avian paramyxoviruses. Journal of General Virology 49, 255-262.[Abstract]
Steward, M., Vipond, I. B., Millar, N. S. & Emmerson, P. T. (1993). RNA editing in Newcastle disease virus. Journal of General Virology 74, 2539-2547.[Abstract]
Wang, L. F., Yu, M., Hansson, E., Pritchard, L. I., Shiell, B., Michalski, W. P. & Eaton, B. T. (2000). The exceptionally large genome of Hendra virus: support for creation of a new genus within the family Paramyxoviridae. Journal of Virology 74, 9972-9979.
Yang, C. Y., Shieh, H. K., Lin, Y. L. & Chang, P. C. (1999). Newcastle disease virus isolated from recent outbreaks in Taiwan phylogenetically related to viruses (genotype VII) from recent outbreaks in western Europe. Avian Diseases 43, 125-130.[Medline]
Received 18 April 2001;
accepted 29 May 2001.