Unit of Virology, Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK1
Department of Electronic Engineering and Physics, University of Dundee, Dundee DD1 4NH, UK2
Author for correspondence: Michael Taliansky. Fax +44 1382 562426. e-mail mtalia{at}scri.sari.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In the second mechanism, exemplified by Tobacco mosaic virus (TMV), the MP induces an increase in the size-exclusion limit of the plasmodesmata (Ding et al., 1995 ; Lucas, 1995
; Wolf et al., 1989
) and possesses non-specific, ssRNA-binding activity to form a transferable complex with viral RNA (Citovsky et al., 1990
, 1992
; Schoumacher et al., 1992
; Thomas & Maule, 1995
; Li & Palukaitis, 1996
; Donald et al., 1997
; Vaquero et al., 1997
; Fujita et al., 1998
; Jansen et al., 1998
). The MP of TMV has been shown also to bind to the cytoskeleton (Heinlein et al., 1995
; McLean et al., 1995
) and microtubules (Boyko et al., 2000
). Although the coat protein (CP) of TMV is essential for long-distance virus movement, it is not required for cell-to-cell movement (Carrington et al., 1996
). Some viruses, such as Cucumber mosaic virus (CMV), use a strategy for cell-to-cell movement similar to that of TMV, involving MP activity to increase the penetration capacity of the plasmodesmata (Ding et al., 1995
) and to bind to ssRNA (Li & Palukaitis, 1996
), but these viruses require both the MP and CP to move from cell to cell (Suzuki et al., 1991
; Boccard & Baulcombe, 1993
; Canto et al., 1997
). Nevertheless, the formation of virus particles is not required for CMV cell-to-cell movement (Kaplan et al., 1998
).
For a growing number of viruses, it has been shown that the MPs possess both the tubule-forming and the RNA-binding activities (Perbal et al., 1993 ; Jansen et al., 1998
; Canto & Palukaitis, 1999
). This suggests that both virion and non-virion mechanisms of movement may co-exist and that viruses can use different mechanisms in different hosts or tissues.
Members of the genus Umbravirus, such as Groundnut rosette virus (GRV), neither form virus particles nor code for a CP (Taliansky et al., 2000 ). Although umbraviruses depend on the assistance of a luteovirus for aphid transmission, the presence or absence of a luteovirus and its CP does not affect the movement of umbraviruses (Taliansky et al., 2000
). GRV has two viral proteins that are involved in virus movement. The 27 kDa ORF3-encoded protein was able to facilitate the long-distance movement of TMV in place of the TMV CP (Ryabov et al., 1999a
), whereas the overlapping 28 kDa ORF4-encoded product was able to mediate cell-to-cell movement of CMV (Ryabov et al., 1999b
) or Potato virus X (PVX) (Ryabov et al., 1998
) in place of their corresponding MPs. The GRV ORF4-encoded protein shows significant sequence similarity to the 3a MP of CMV (Taliansky et al., 1996
) and, like the CMV 3a (Blackman et al., 1998
; Vaquero et al., 1996
) and the TMV (Tomenius et al., 1987
; Atkins et al., 1991
) MPs, localizes to the plasmodesmata (Ryabov et al., 1998
).
Recently, atomic force microscopy (AFM) has been exploited to visualize nucleic acids, proteins and some of their complexes (Lyubchenko et al., 1995 ; Fritz et al., 1997
; Hansma et al., 1997
; Smith et al., 1997
; Drygin et al., 1998
; Klinov et al., 1998
; Kiselyova et al., 2001
). AFM operates by measuring tiny contact forces between the surface of the molecule and the scanning tip to visualize molecules on a nanometre scale under ambient and/or physiological conditions. Recently, Kiselyova et al. (2001)
described two types of structures formed by the TMV 30 kDa (30K) MP with ssRNA. At a low (non-saturated) molar ratio of protein:RNA, complexes referred to as beads-on-a-string were generated, in which beads of MPs were distributed along the RNA. At a high (saturated) molar ratio of protein:RNA, thick string complexes were formed, in which MPs were cooperatively and tightly packed around the RNA. Thus, imaging using AFM allows the architecture of MPRNA complexes to be discerned.
In this work, we demonstrate that, in spite of the lack of umbraviral particles, the GRV ORF4-encoded protein was capable of forming tubular structures on the surface of protoplasts. This had formerly been believed to be typical only for viruses moving from cell to cell as virions. To further characterize the GRV ORF4-encoded protein and to compare it to the CMV 3a MP, both MPs were expressed in Escherichia coli and the isolated proteins were compared for their RNA-binding characteristics. It was shown that, in contrast to the CMV 3a MP, which like many other viral MPs binds ssRNA cooperatively, the ORF4-encoded protein bound ssRNA in a non-cooperative manner and formed complexes of low protein:RNA ratios, independently of its concentration. These observations were supported by images of the MPRNA complexes obtained by AFM.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Inoculation of protoplasts with recombinant TMV (TMV.4-GFP; Ryabov et al., 1998 ) and PVX (PVX.4-GFP; Ryabov et al., 1998
), each expressing the GRV ORF4-encoded protein fused to the jellyfish green fluorescent protein (GFP), was conducted by electroporation with 1020 µg of transcript, as described by Gal-On et al. (1994)
. In vitro transcription was carried out using the mMESSAGE mMACHINE T7 kit (Ambion) as described by Ryabov et al. (1998)
.
Expression and purification of the GRV ORF4 protein in E. coli.
To clone and subsequently express the GRV ORF4 protein with a (His)6-affinity tag, restriction sites upstream (NcoI) and downstream (BclI) of ORF4 were generated by PCR using the oligonucleotide primers 5' GCATCCATGGCTTCGCAAGTGGC 3' and 5' GCATTGATCACGTCGCTTTGCGC 3'. The PCR product was digested with BclI/NcoI and cloned into the pQE60 vector using the QIAexpress Expression System (Qiagen) to give pQEGRV4-His. In this plasmid, ORF4 was linked to the strong bacteriophage T7 promoter at its 5' terminus and to six histidine codons at its 3' terminus. E. coli strain SG13009 (pREP4) expressing low levels of protease and containing an inducible T7 polymerase gene was used as the host for protein expression. Induction of protein synthesis from ORF4 by IPTG and purification of the expressed protein were conducted according to the Qiagen protocol. Protein purification involved solubilization of the bacterial pellet in buffer B (8 M urea, 0·1 M NaH2PO4, 0·01 M TrisHCl, pH 8·0), binding to Ni2+-NTAagarose, washing with buffers B and C (8 M urea, 0·1 M NaH2PO4, 0·01 M TrisHCl, pH 6·3) and elution with buffers D (8 M urea, 0·1 M NaH2PO4, 0·01 M TrisHCl, pH 5·9) and E (8 M urea, 0·1 M NaH2PO4, 0·01 M TrisHCl, pH 4·5). To allow for protein refolding, the solubilized protein was dialysed sequentially against buffer F (10 mM TrisHCl, pH 7·0, 50 mM NaCl, 1 mM EDTA, 1 mM DTT, 10% glycerol) containing 4 M urea, 1 M urea, or no urea.
RNA-binding experiments.
32P-labelled full-length Fny-CMV RNA 3 and GRV RNA corresponding to the 5'-terminal 2556 nucleotides of the GRV genome were generated by in vitro transcription of pFny309 (Rizzo & Palukaitis, 1990 ) and the GRV cDNA clone grpol (Taliansky et al., 1996
), respectively, in the presence of 5 µCi [32P]UTP (Amersham) using the mMESSAGE mMACHINE T7 kit. The labelled transcripts were mixed with purified proteins in 15 µl of binding buffer A (50 mM TrisHCl, 1 mM EDTA, pH 7·0, 50 mM NaCl, 1 mM DTT, 1 mg/ml BSA, 10% glycerol). After incubation on ice for 30 min, the mixture was subjected to electrophoresis in 1% agarose in TAE buffer, as described by Li & Palukaitis (1996)
. For UV cross-linking experiments, the mixture was irradiated with UV light (twice at 900 mJ) in a Stratalinker (Stratagene), treated with RNase A and analysed by 12% SDSPAGE. The gels were dried and autoradiographed. Nitrocellulose membrane-binding assays were carried out as described by Li & Palukaitis (1996)
. To analysis the stability of the MPRNA complexes, buffer A contained different concentrations of NaCl. In competition binding assays, different amounts (250 and 1250 ng) of competitor RNA or DNA [CMV ssRNA, TMV ssRNA, bacteriophage M13 ssDNA or a dsDNA plasmid fragment (SmaI-digested pUC18 DNA)] were added to the mixtures. The mixtures were then filtered through a 45 µm nitrocellulose membrane (Schleicher & Shuell). The membranes were then washed, dried and counted using a liquid scintillation counter (LKB).
Atomic force microscopy.
RNA samples were isolated from Fny-CMV as described by Ryabov et al. (1999b) . The final RNA concentration was 1 µg/ml. The concentration of the CMV 3a and GRV ORF4-encoded proteins was 10 µg/ml. Protein (10 µg/ml) and RNA (0·1 µg/ml) complexes were prepared on ice for 30 min in a buffer containing 50 mM TrisHCl, pH 7·0, 1 mM EDTA and 5 mM NaCl.
Freshly cleaved strips of mica were incubated in an atmosphere of 3-aminopropyltriethoxysilane (APTES), as described by Lyubchenko et al. (1993a , b
). The amino groups of APTES are bound covalently to a freshly cleaved mica surface, leaving it with properties similar to an anion exchanger. Modified mica (AP-mica) strips were immersed into the samples of RNA, purified proteins or their complexes in a TrisHCl buffer and incubated at room temperature for 1015 min. The substrates were then rinsed with deionized water and vacuum-dried at room temperature. Imaging was carried out in the tapping mode on a Nanoscope IIIa (Digital Instruments) using standard AFM cantilevers (Digital Instruments). Images were processed using Nanoscope software and transferred to Adobe PhotoShop for layout. Heights were measured using the Nanoscope software.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Comparative analysis of nucleic acid binding of the GRV and CMV MPs
The GRV ORF4 MP containing a C-terminal (His)6-tag was overexpressed in E. coli (Fig. 2, asterisk in lane 2) and was further purified by Ni2+-NTA affinity chromatography. The purified preparation of the protein resulted in a single band by SDSPAGE (Fig. 2
, lane 3). CMV 3a MP tagged with six histidine residues was produced and purified in a similar manner (data not shown) using the pETMP3a-His vector (Li & Palukaitis, 1996
). Binding of the His-tagged CMV 3a and GRV ORF4 proteins to ssRNA was assayed by gel retardation electrophoresis in non-denaturing agaroseTAE gels. Fig. 3
illustrates the binding of the proteins to two kinds of 32P-labelled ssRNAs: ssRNA corresponding to the 5' end 2556 nucleotides of the GRV genome (Fig. 3A
, B
) and RNA3 of Fny-CMV (Fig. 3C
) derived from in vitro transcription of the GRV grpol cDNA clone (Taliansky et al., 1996
) and the full-length cDNA clone of Fny-CMV RNA 3 (Rizzo & Palukaitis, 1990
), respectively. At low molar ratios of 3a protein:RNA, most of the labelled GRV RNA migrated as protein-free RNA (Fig. 3A
, lanes 13), but when the amount of the 3a protein was increased (150300 ng or more), the probes barely entered the gel (Fig. 3A
, lanes 57), indicating that the GRV RNA formed a complex with the CMV 3a protein. Moreover, the rapid shift of mobility shows that the binding of the labelled RNA probe appeared to occur in a highly cooperative fashion. Indeed, the fact that the RNA probe migrated either as a completely unbound or as a completely bound form (Fig. 3A
, lane 4) indicates that if one or a few molecules of MP are bound to a labelled RNA, this RNA molecule becomes a preferable substrate for the rapid binding of additional MPs. This would explain the absence of labelled RNA with an intermediate mobility. These results are consistent with a previous report on the mode of RNA binding of untagged CMV 3a protein (Li & Palukaitis, 1996
).
|
|
To verify the ability of the ORF4-encoded protein, and not just undetected contaminating E. coli proteins, to bind to ssRNA, UV cross-linking experiments were carried out. The 32P-labelled GRV or CMV RNA was incubated with the ORF4 protein and the incubation mixture was irradiated with UV light. This treatment can covalently cross-link proteinRNA complexes. Unbound RNA was removed by RNase A digestion and the mixtures were analysed by SDSPAGE and autoradiography. As shown in Fig. 4(lanes 1, 2), a band can be seen in the position expected for the His-tagged ORF4-encoded protein (arrow in Fig. 4
). The intense band migrating faster than the ORF4-encoded protein may be a degradation product of the labelled RNA. When no RNase was added, the band corresponding to the ORF4-encoded protein disappeared into a smeared background (Fig. 4
, lane 3). No ORF4 protein-specific band could be detected if UV irradiation was omitted (data not shown). When BSA was substituted for the ORF4 protein by adding BSA to an equivalent protein preparation from E. coli transformed with pQE60, which lacks the GRV sequences, no band was observed (Fig. 4
, lane 4). This shows that RNA binding is due to the ORF4-encoded protein and not to a protein contaminant. Similar results have been obtained for complexes of the CMV 3a protein with CMV (Fig. 4
, lanes 5, 7) or GRV (Fig. 4
, lane 6) RNA. These data do not contradict the results that show a difference in the behaviour of the ORF4-encoded and 3a proteins in gel retardation assays. UV cross-linking measures all the complexes, even those in which RNA and protein are in nearly equimolar ratios and, therefore, does not correlate either with cooperativity of binding or with protein:RNA ratio.
|
|
|
In the first series of experiments, MP and RNA components were visualized separately (Fig. 7A, B
). The height of most of the GRV ORF4 MP molecules was about 0·8 nm. Given the uniform size of these molecules, they probably represent monomers of the ORF4 MP (Fig. 7A
). CMV 3a MP molecules have a similar size, but sometimes form clumps of aggregated molecules (data not shown).
|
Complexes of GRV ORF4-encoded or CMV 3a protein with CMV RNA were prepared at saturated protein:RNA ratios (100:1) in binding buffer A containing no glycerol. The GRV MPRNA complexes (Fig. 7CF
) were very similar to the beads-on-a-string type of complex described by Kiselyova et al. (2001)
and consisted of small globules (beads; circles in Fig. 7D
, F
) with heights of about 1·11·5 nm. These apparently represent individual MP molecules or their dimers bound to RNA non-cooperatively and separated by protein-free RNA segments of varying length (arrows in Fig. 7
), with heights similar to those of denatured RNA chains. Sometimes, the GRV MPRNA complexes also contained the larger globules (asterisk in Fig. 7F
), which might represent extensive unbound RNA sequences (in the form of globular structures), with extending ribonucleoprotein beads-on-a-string chains (Fig. 7E
, F
).
In contrast, the CMV 3a proteinRNA complexes were immobilized onto the AP-mica surface in the form of net-type aggregates consisting of tangled chains, apparently representing strands of RNA molecules tightly and cooperatively bound by clusters of CMV MP molecules (Fig. 7G), without any apparent protein-free RNA segments. The heights of the chains were 1·11·6 nm, which are comparable with those of the GRV MPRNA beads. The tangling of the chains of the CMV MPRNA complexes possibly occurred due to strong interactions between protein molecules belonging to different chains. This may explain the aggregated state of the CMV MPRNA complexes (Fig. 7G
) and their failure to enter even an agarose gel.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Induction of tubules on the surface of protoplasts
Like other umbraviruses, GRV does not form conventional virus particles. In this respect, it was rather unexpected to find that the umbraviral ORF4-encoded protein formed tubular structures on the surface of protoplasts; this is a typical characteristic of viruses that move from cell to cell in the form of virions. Although data concerning the formation of tubules in intact tissues of plants infected by GRV have not been obtained, tubules associated with the cell wall plasmodesmata were detected in plants infected with another umbravirus, Carrot mottle virus (Murant et al., 1973 ). Of course these results cannot rule out completely that tubule formation induced by umbraviruses is just an atavistic remnant remaining from an earlier hypothetical evolutionary stage when umbraviruses did code for a functionally active CP (Ryabov et al., 1999a
, b
). However, it is also possible that the tubules are still used by umbraviruses for cell-to-cell movement, at least in some hosts or tissues or under some physiological circumstances. If so, we could speculate that GRV (and other umbraviruses) can move through tubules in a form other than a virion (e.g. as MPRNA complexes). It is worth noting that the plant-infecting bunyavirus Tomato spotted wilt virus is also able to induce the formation of tubules in both protoplasts and intact plant tissues, but virus particles are not observed in these tubules (Storms et al., 1995
; Kikkert et al., 1997
). Possibly, Tomato spotted wilt virus can also move through the tubules as a complex of viral RNA with its MP (the NSm protein).
Another possible function for these tubules relates to the observation that umbraviruses are often associated with luteoviruses in nature and can be encapsidated by the CP of the latter (reviewed by Taliansky et al., 2000 ). Luteoviruses alone are normally restricted to the phloem, but in the presence of umbraviruses, they can spread into mesophyll cells (Mayo et al., 2000
). The ORF4-mediated tubular structures might be used by both umbraviruses encapsidated by the luteoviral CP and luteoviruses themselves to spread from cell to cell during mixed infections.
RNA-binding properties
Results of the gel retardation analysis and competition binding assays presented here demonstrate that the GRV ORF4-encoded MP binds to both ssRNA and ssDNA without any obvious sequence specificity, but does not bind to dsDNA. UV cross-linking assays and analysis of the stability of MPRNA complexes at different salt concentrations indicated that the GRV ORF4-encoded protein binds RNA as stably as does the CMV 3a protein. Results of AFM analysis complemented these conclusions and allowed direct visualization of the complexes. The architecture of the GRV MPRNA complexes obtained as a result of non-cooperative proteinRNA binding, even at high protein:RNA ratios, resembled another type of non-cooperative complex: the beads-on-a-string-structure described by Kiselyova et al. (2001) for TMV MPRNA complexes obtained at low protein:RNA ratios. On the other hand, CMV MP bound to RNA cooperatively and formed net-type structures. It is worth noting that another MPRNA complex, the TMV MPRNA complex, also formed as a result of cooperative binding to RNA at high protein:RNA ratios and exhibited a thick string appearance (Kiselyova et al., 2001)
, quite different from the CMV MPRNA net-type complexes. It was suggested that thick string compexes formed by TMV MP and RNA are able to move from cell to cell as they are (Kiselyova et al., 2001
). However, it is difficult to imagine how cooperative CMV MPRNA aggregates containing tangled chains are able to pass through the plasmodesmata. In the case of CMV, another factor may be required to unwind the tangled aggregates. Since the CMV CP is required for cell-to-cell movement (Suzuki et al., 1991
; Boccard & Baulcombe, 1993
; Canto et al., 1997
), it may play such a role.
Previously, we have shown that GRV MP localizes to the plasmodesmata (Ryabov et al., 1998 ). Thus, with respect to RNA binding and localization to the plasmodesmata, this protein is similar to the MPs of other plant viruses, including CMV, which can move from cell to cell through modified plasmodesmata as a complex containing viral RNA and MP rather than in the form of a virion. However, in contrast to many other viral MPs, such as the CMV 3a MP, that bind RNA cooperatively and to near saturation, the GRV MP binds to RNA non-cooperatively and only to a limited extent, even at high protein:RNA ratios, forming beads-on-a-string structures. To the best of our knowledge, none of the known native viral MPs possesses such characteristics of RNA binding. The AMV 3a MP can bind RNA non-cooperatively, but at high protein:RNA ratios it forms fully retarded complexes (Schoumacher et al., 1992
). Giesman-Cookmeyer & Lommel (1993)
described several mutated forms of the MP of Red clover necrotic mosaic virus that bound RNA only to a limited extent in vitro, but were still able to transport the virus from cell to cell in vivo. Assuming that RNA-binding activity in vitro reflects the formation of transferable RNAMP complexes in vivo, they suggested that relatively little RNA binding is actually required for the cell-to-cell movement of Red clover necrotic mosaic virus. A high level of cooperative binding may be required under certain conditions or in some hosts or tissues. The formation of cooperative complexes containing fully and tightly packed RNA molecules has at least one obvious advantage, a high level of RNA protection, which may be particularly important under certain conditions. On the other hand, this advantage can also turn into a disadvantage, as it can make more difficult the process of RNA release from the dense complex for expression (translation) after transport from infected cells to healthy ones. For example, it has been demonstrated that TMV RNA, fully and cooperatively bound by TMV CP, cannot be translated in vitro and is uninfectious in protoplasts (Karpova et al., 1997
). Thus, these results suggested that a specific mechanism should operate to convert untranslatable, cooperatively bound TMV MPRNA complexes into a translatable form. In the case of TMV, such a conversion is probably regulated by MP phosphorylation (Karpova et al., 1999
).
The specific mode of limited RNA binding by the GRV MP may not need a specific regulatory mechanism for releasing RNA. Interaction of the exposed unbound RNA sequences with ribosomes might result in the uncoating of the RNA from the complex, thereby providing access for translation. Thus, taking into account the dimensions of the GRV MPRNA beads-on-a-string complex, we suggest that it may be able to move from cell to cell either through the plasmodesmata or through the ORF4-mediated tubules. In the latter case, the lack of cooperative binding would prevent absorption into tubules containing the GRV ORF4 protein.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
c Permanent address: A. N. Belozersky Institute of PhysicoChemical Biology, Moscow State University, Moscow 119899, Russia.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Blackman, L. M., Boevink, P., Santa Cruz, S., Palukaitis, P. & Oparka, K. J. (1998). The movement protein of cucumber mosaic virus traffics into sieve elements in minor veins of Nicotiana clevelandii. Plant Cell 10, 525-537.
Boccard, F. & Baulcombe, D. (1993). Mutational analysis of cis-acting sequences and gene function in RNA3 of cucumber mosaic virus. Virology 193, 563-578.[Medline]
Boyko, V., Ferralli, J., Ashby, J., Schellenbaum, P. & Heinlein, M. (2000). Function of microtubules in intercellular transport of plant virus RNA. Nature Cell Biology 2, 826-832.[Medline]
Bustamante, C. & Rivetti, C. (1996). Visualizing proteinnucleic acid interactions on a large scale with the scanning force microscope. Annual Review of Biophysics and Biomolecular Structure 25, 395-429.[Medline]
Canto, T. & Palukaitis, P. (1999). Are tubules generated by the 3a protein necessary for cucumber mosaic virus movement? Molecular PlantMicrobe Interactions 12, 985-993.
Canto, T., Prior, D. A. M., Hellwald, K.-H., Oparka, K. J. & Palukaitis, P. (1997). Characterization of cucumber mosaic virus. IV. Movement protein and coat protein are both essential for cell-to-cell movement of cucumber mosaic virus. Virology 237, 237-248.[Medline]
Carrington, J. C., Kasschau, K. D., Mahajan, S. K & Schaad, M. C. (1996). Cell-to-cell and long-distance transport of viruses in plants. Plant Cell 8, 1669-1681.
Citovsky, V., Knorr, D., Schuster, G. & Zambryski, P. (1990). The P30 movement protein of tobacco mosaic virus is a single-strand nucleic acid binding protein. Cell 60, 637-648.[Medline]
Citovsky, V., Wong, M. L., Shaw, A. L., Prasad, B. M. V. & Zambryski, P. (1992). Visualization and characterization of tobacco mosaic virus movement protein binding to single-stranded nucleic acids. Plant Cell 4, 397-411.
Ding, B., Li, Q., Nguyen, L., Palukaitis, P. & Lucas, W. J. (1995). Cucumber mosaic virus 3a protein potentiates cell-to-cell trafficking of CMV RNA in tobacco plants. Virology 207, 345-353.[Medline]
Donald, R. G. K., Lawrence, D. M. & Jackson, A. O. (1997). The barley stripe mosaic virus 58K-kilodalton b protein is a multifunctional RNA binding protein. Journal of Virology 71, 1538-1546.[Abstract]
Drygin, Yu. F., Bordunova, O. A., Gallyamov, M. O. & Yaminsky, I. V. (1998). Atomic force microscopy examination of tobacco mosaic virus and virion RNA. FEBS Letters 425, 217-221.[Medline]
Eggen, R., Verver, J., Wellink, J., de Jong, A., Goldbach, R. & Van Kammen, A. (1989). Improvements of the infectivity in vitro transcripts from cloned cowpea mosaic virus cDNA: impact of terminal nucleotide sequences. Virology 173, 447-455.[Medline]
Fritz, M., Radmacher, M., Cleveland, J. P., Allersma, M. W., Stewart, R. J., Gieselman, R., Janmey, P., Schmidt, C. F. & Hansma, P. K. (1995). Imaging globular and filamentous proteins in physiological buffer solutions with tapping mode atomic force microscopy. Langmuir 11, 3529-3535.
Fritz, J., Anselmetti, D., Jarchow, J. & Fernandez-Busquets, X. (1997). Probing single biomolecules with atomic force microscopy. Journal of Structural Biology 119, 165-171.[Medline]
Fujita, M., Mise, K., Kajiura, Y., Dohi., K. & Furusawa, I. (1998). Nucleic acid-binding properties and subcellular localization of the 3a protein of brome mosaic bromovirus. Journal of General Virology 79, 1273-1280.[Abstract]
Gal-On, A., Kaplan, I. B., Roossinck, M. J. & Palukaitis, P. (1994). The kinetics of infection of zucchini squash by cucumber mosaic virus indicate a function of RNA1 in virus movement. Virology 205, 280-289.[Medline]
Giesman-Cookmeyer, D. & Lommel, S. A. (1993). Alanine scanning mutagenesis of a plant virus movement protein identifies three functional domains. Plant Cell 5, 973-982.
Hansma, H. G., Kim, K. J., Laney, D. E., Garcia, R. A., Argaman, M., Allen, M. J. & Parsons, S. M. (1997). Properties of biomolecules measured from atomic force microscope images: a review. Journal of Structural Biology 119, 99-108.[Medline]
Heinlein, M., Epel, B. L., Padgett, H. S. & Beachy, R. N. (1995). Interaction of tobamovirus movement proteins with the plant cytoskeleton. Science 270, 1983-1985.[Abstract]
Jansen, K. A., Wolfs, C. J., Lohuis, H., Goldbach, R. W. & Verduin, B. J. (1998). Characterisation of the brome mosaic virus movement protein expressed in E. coli. Virology 242, 387-394.[Medline]
Kaplan, I. B., Zhang, L. & Palukaitis, P. (1998). Characterization of cucumber mosaic virus. V. Cell-to-cell movement requires capsid protein but not virions. Virology 246, 221-231.[Medline]
Karpova, O. V., Ivanov, K. I., Rodionova, N. P., Dorokhov, Yu. L. & Atabekov, J. G. (1997). Nontranslatability and dissimilar behaviour in plants and protoplasts of viral RNA and movement protein complexes formed in vitro. Virology 230, 11-21.[Medline]
Karpova, O. V., Rodionova, N. P., Ivanov, K. I., Kozlovsky, S. V., Dorokhov, Yu. L. & Atabekov, J. G. (1999). Phosphorylation of tobacco mosaic virus movement protein abolishes its translation repressing ability. Virology 261, 20-24.[Medline]
Kasteel, D. T. J., Van der Wel, N. N., Jansen, K. A. J., Goldbach, R. W. & van Lent, J. W. M. (1997a). Tubule-forming capacity of the movement proteins of alfalfa mosaic virus and brome mosaic virus. Journal of General Virology 78, 2089-2093.[Abstract]
Kasteel, D. T. J., Wellink, J., Goldbach, R. W. & van Lent, J. W. M. (1997b). Isolation and characterization of tubular structures of cowpea mosaic virus. Journal of General Virology 78, 3167-3170.[Abstract]
Keller, D. J. (1991). Reconstruction of STM and AFM images distorted by finite-size tips. Surfactant Science Series 253, 353-364.
Kikkert, M., van Poelwijk, F., Storms, M., Kassies, W., Bloksma, H., van Lent, J., Kormelink, R. & Goldbach, R. W. (1997). A protoplast system for studying tomato spotted wilt virus infection. Journal of General Virology 78, 1755-1763.[Abstract]
Kiselyova, O. I., Yaminsky, I. V., Karger, E. M., Frolova, O. Yu., Dorokhov, Y. L. & Atabekov, J. G. (2001). Visualization by atomic force microscopy of tobacco mosaic virus movement proteinRNA complexes formed in vitro. Journal of General Virology 82, 1503-1508.
Klinov, D. V., Lagutina, I. V., Prokhorov, V. V., Neretina, T., Khil, P. P., Lebedev, Yu. B., Cherny, D. I., Demin, V. V. & Sverdlov, E. D. (1998). High resolution mapping DNAs by R-loop atomic force microscopy. Nucleic Acids Research 26, 4603-4610.
Li, Q. & Palukaitis, P. (1996). Comparison of the nucleic acid- and NTP-binding properties of the movement protein of cucumber mosaic cucumovirus and tobacco mosaic tobamovirus. Virology 216, 71-79.[Medline]
Lucas, W. J. (1995). Plasmodesmata: intercellular channels for macromolecular transport in plants. Current Opinion in Cell Biology 7, 637-680.
Lyubchenko, Y. L., Oden, P. I., Lampner, D., Lindsay, S. M. & Dunker, K. A. (1993a). Atomic force microscopy of DNA and bacteriophage in air, water and propanol: the role of adhesion forces. Nucleic Acids Research 21, 1117-1123.[Abstract]
Lyubchenko, Y., Shlyakhtenko, L., Harrington, R., Oden, P. & Lindsay, S. (1993b). Atomic force microscopy of long DNA: imaging in air and under water. Proceedings of the National Academy of Sciences, USA 90, 2137-2140.[Abstract]
Lyubchenko, Y. L., Jacobs, B. L., Lindsay, S. M. & Stasiak, A. (1995). Atomic force microscopy of nucleoprotein complexes. Scanning Microscopy 9, 705-727.[Medline]
McLean, B. G., Zupan, J. & Zambryski, P. (1995). Tobacco mosaic virus movement protein associates with the cytoskeleton in tobacco cells. Plant Cell 7, 2101-2114.
Mayo, M., Ryabov, E., Fraser, G. & Taliansky, M. (2000). Mechanical transmission of Potato leafroll virus. Journal of General Virology 81, 2791-2795.
Murant, A. F., Roberts, I. M. & Goold, R. A. (1973). Cytopathological changes and extractable infectivity in Nicotiana clevelandii leaves infected with carrot mottle virus. Journal of General Virology 21, 269-283.
Perbal, M. C., Thomas, C. L. & Maule, A. (1993). Cauliflower mosaic virus gene I product (P1) forms tubular structures which extend from the surface of infected protoplasts. Virology 195, 281-285.[Medline]
Power, J. B. & Chapman, J. V. (1985). Isolation, culture and genetic manipulation of plant protoplasts. In Plant Cell Culture , pp. 37-66. Edited by R. A. Dixon. Oxford:ICR Press.
Rizzo, T. M. & Palukaitis, P. (1990). Construction of full-length cDNA clones of cucumber mosaic virus RNAs 1, 2, and 3: generation of infectious RNA transcripts. Molecular and General Genetics 222, 249-256.[Medline]
Ryabov, E. V., Oparka, K. J., Santa Cruz, S., Robinson, D. J. & Taliansky, M. E. (1998). Intracellular location of two groundnut rosette umbravirus proteins delivered by PVX and TMV vectors. Virology 242, 303-313.[Medline]
Ryabov, E. V., Robinson, D. J. & Taliansky, M. E. (1999a). A plant virus encoded protein facilitates long distance movement of heterologous viral RNA. Proceedings of the National Academy of Sciences, USA 96, 1212-1217.
Ryabov, E. V., Roberts, I. M., Palukaitis, P. & Taliansky, M. E. (1999b). Host-specific cell-to-cell and long-distance movements of cucumber mosaic virus are facilitated by the movement protein of groundnut rosette virus. Virology 260, 98-108.[Medline]
Schoumacher, F., Erny, C., Berna, A., Godefroy-Colburn, T. & Stussi-Garaud, C. (1992). Nucleic acid binding properties of the alfalfa mosaic virus movement protein produced in yeast. Virology 188, 896-899.[Medline]
Smith, B. L., Gallie, D. R., Le, H. & Hansma, P. K. (1997). Visualization of poly(A)-binding protein complex formation with poly(A) RNA using atomic force microscopy. Journal of Structural Biology 119, 109-117.[Medline]
Storms, M., Kormelink, R., Peters, D., van Lent, J. & Goldbach, R. W. (1995). The nonstructural protein of tomato spotted wilt virus induces tubular structures in plant and insect cells. Virology 214, 485-493.[Medline]
Suzuki, M., Kuwata, S., Kataoka, J., Masuta, C., Nitta, N. & Takanami, Y. (1991). Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcriptional system. Virology 183, 106-113.[Medline]
Taliansky, M. E., Robinson, D. J. & Murant, A. F. (1996). Complete nucleotide sequence and genome organization of the RNA genome of groundnut rosette umbravirus. Journal of General Virology 77, 2335-2345.[Abstract]
Taliansky, M. E., Robinson, D. J. & Murant, A. F. (2000). Groundnut rosette disease virus complex: biology and molecular biology. Advances in Virus Research 55, 357-402.[Medline]
Thomas, C. L. & Maule, A. G. (1995). Identification of the cauliflower mosaic virus movement protein RNA-binding domain. Virology 206, 1145-1149.[Medline]
Tomenius, K., Clapham, D. & Meshi, T. (1987). Localization by immunogold cytochemistry of the virus-encoded 30K protein in plasmodesmata of leaves infected with tobacco mosaic virus. Virology 160, 363-371.
van Lent, J., Wellink, J. & Goldbach, R. W. (1990). Evidence for the involvement of the 58K and 48K proteins in the intercellular movement of cowpea mosaic virus. Journal of General Virology 71, 219-224.
van Lent, J., Storms, M., van der Meer, F., Wellink, J. & Goldbach, R. W. (1991). Tubular structures involved in movement of cowpea mosaic virus are also formed in infected cowpea protoplasts. Journal of General Virology 72, 2615-2623.[Abstract]
Vaquero, C., Sanz, A. I., Serra, M. T. & Garcia-Luque, I. (1996). Accumulation kinetics of CMV RNA 3-encoded proteins and subcellular localization of the 3a protein in infected and transgenic tobacco plants. Archives of Virology 141, 987-999.[Medline]
Vaquero, C., Liao, Y.-C., Nähring, J. & Fischer, R. (1997). Mapping of the RNA-binding domain of the cucumber mosaic virus movement protein. Journal of General Virology 78, 2095-2099.[Abstract]
Wolf, S., Deom, C. M., Beachy, R. N. & Lucas, W. J. (1989). Movement protein of tobacco mosaic virus modifies plasmodesmata size exclusion limit. Science 246, 377-379.
Zheng, H., Wang, G. & Zhang, L. (1997). Alfalfa mosaic virus movement protein induces tubules in plant protoplasts. Molecular PlantMicrobe Interactions 10, 1010-1014.
Received 28 March 2001;
accepted 8 June 2001.