AIDS Research Centre1, Department of Viral Diseases and Vaccine Control2 and Division of Experimental Animal Research3, National Institute of Infectious Diseases, 4-7-1 Gakuen, Musashi-murayama, Tokyo 208-0011, Japan
Tsukuba Primate Research Centre, National Institute of Infectious Diseases, 1 Hachimandai, Tsukuba 305-0843, Japan2
Department of Microbiology, Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan3
Toyama Institute of Health, Nakataikou-yama 17-1, Kosugi-machi, Imizu-gun, Toyama 939-0363, Japan4
Author for correspondence: Tetsuro Matano at The University of Tokyo. Fax +81 3 5841 3374. e-mail matano{at}m.u-tokyo.ac.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Sendai virus (SeV) is an enveloped virus with a negative-sense RNA genome of about 15·3 kb. It causes fatal pneumonia in mice, the natural host, but is thought to be nonpathogenic in humans (Nagai, 1999 ). We previously established a system to rescue SeV from cDNA, which enabled us to engineer the SeV genome at will and use the virus as a vector to deliver foreign genes of interest (Hasan et al., 1997
; Yu et al., 1997
; Nagai & Kato, 1999
). Recent studies using animals such as mice and ferrets have shown an extremely high efficiency of SeV vector-based gene transfer in vivo (Yonemitsu et al., 2000
). Because SeV replication requires a proteinase that is localized in the airway epithelium for Env protein processing (Nagai, 1993
), the intranasal route would be the best for efficient delivery and this may be favourable for the induction of mucosal immune responses.
We previously knocked out the SeV V gene, an accessory gene, to obtain an attenuated SeV, V-SeV (Kato et al., 1997a , b
). V-SeV infection is not fatal in mice and the virus retains the ability to induce efficient gene transfer. Indeed, expression levels of HIV-1 Env gp120 from recombinant V-SeV-infected cells reached 6 µg per 106 cells, the highest among the vector systems available in mammalian cells (Yu et al., 1997
).
We then constructed a recombinant V-SeV expressing the simian immunodeficiency virus (SIV) Gag protein, SeV-Gag, to evaluate the protective efficacy of its immunization in macaque AIDS models. In two sets of macaque experiments, intranasal SeV-Gag immunization elicited resistance against a pathogenic SIV, strain mac239 (SIVmac239), and a pathogenic SIV/HIV strain, SHIV89.6PD (Kano et al., 2000 ; Matano et al., 2001
). The SeV-Gag-immunized macaques failed to control primary viraemia but greatly reduced the set-point plasma virus loads after challenge. These results prompted us to determine the pattern of SeV replication in nonhuman primates for utilizing this vector as a tool for an AIDS vaccine in humans effectively and safely. In this study, we examined primary SeV replication and SeV-specific immune responses in macaques following intranasal SeV immunization.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Animals.
Cynomolgus macaques (Macaca fascicularis) and rhesus macaques (Macaca mulatta) used in this study were maintained in accordance with the institutional guidelines for laboratory animals. These macaques tested negative for SeV and SIV before use. Monkey R010 received a control DNA vaccine, 800 µg pCMVN DNA (Matano et al., 2000 ) by intramuscular inoculation and 10 µg pCMVN DNA by gene gun (four times), from 12 to 6 weeks before the SeV-control immunization for another experiment. Blood collections, sampling of nasal swabs and immunizations were performed under ketamine anaesthesia.
SeV-Gag RNA expression in tissues.
Cells from the lymph nodes (LN), thymus and spleen were prepared by mincing the tissues. Cells from the nasal mucosa and lung were prepared after treatment with collagenase type I and dispase (Life Technologies). These cells were washed with PBS three times before RNA extraction. Peripheral blood mononuclear cells (PBMCs) were prepared from whole blood samples using FicollPaque Plus (Amersham-Pharmacia). RNA was extracted from cells using an RNA Extraction kit from Qiagen, according to the manufacturers instructions. Nested RTPCR was performed using SIV gag-specific primers (5' AGAAACTCCGTCTTGTCAGG and 5' TGATAATCTGCATAGCCGC for the first RTPCR and 5' GATTAGCAGAAAGCCTGTTGG and 5' TGCAACCTTCTGACAGTGC for the second PCR). The levels of gag RNA were quantified by limiting dilution of RNA samples to determine the end-point, as described before (Shibata et al., 1997 ).
SeV recovery from nasal swabs or nasal mucosa.
The nasal swab sample diluted in RPMI-1640 (Life Technologies) was injected into the allantoic cavity of chickens eggs for recovery of SeV. In case of SeV recovery from the cells prepared from the nasal mucosa, the cells were freeze-thawed twice and 105 cells suspended in RPMI-1640 were injected into the allantoic cavity of chickens eggs. After 72 h of incubation, the allantoic fluid was harvested and subjected to a haemagglutination (HA) assay to detect SeV, as described before (Kato et al., 1996 ).
Antibody ELISA.
An ELISA to measure plasma levels of anti-SeV antibodies was performed using inactivated SeV (Watanabe et al., 2000 ).
Flow cytometry analysis of antigen-specific interferon-
(IFN-
) induction.
Autologous herpesvirus papio-immortalized B lymphoblastoid cell lines (B-LCLs) (Voss et al., 1992 ) were infected with a control vaccinia virus (VV) vector (Vv-control) (Mackett et al., 1982
), SeV-control, a recombinant VV vector expressing SIV Gag (Vv-Gag) or SeV-Gag at an m.o.i. of 5 and, 1 day later, used as a nonspecific control, an SeV-specific, a Gag-specific or an SeV-Gag-specific stimulator. For stimulation, 106 PBMCs were cocultured with 105 stimulator cells in the presence of GolgiStop (monensin) (Pharmingen) for 6 h. Then, intracellular IFN-
staining was performed using Cytofix-Cytoperm kit (Pharmingen), according to the manufacturer's protocol, as described before (Matano et al., 2001
).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Restimulation of Gag-specific CD8+ T cells by SeV-Gag-infected cells in vitro
Using flow cytometry analysis of antigen-specific intracellular IFN- induction (Lavini et al., 1997
; Butz & Bevan, 1998
; Murali-Krishna et al., 1998
; Donahoe et al., 2000
; Gea-Banacloche et al., 2000
), we examined if SeV-Gag-infected cells can really restimulate Gag-specific CD8+ T cells in vitro (Fig. 1d
). We used PBMCs derived from a rhesus macaque chronically infected with SIV as a source of Gag-specific CD8+ T cells. This animal received a proviral DNA vaccine, followed by SIVmac239 challenge, as described before (Matano et al., 2000
).
Coculture of PBMCs with autologous B-LCLs infected with recombinant VV expressing SIV Gag (Vv-Gag) showed SIV Gag-specific intracellular IFN- induction in CD8+ T cells. Similar frequencies of CD8+IFN-
+ T cells were observed in PBMCs cocultured with SeV-Gag-infected B-LCLs. No significant induction of CD8+IFN-
+ T cells was found in the PBMCs cocultured with SeV-control-infected B-LCLs. These results indicate that the SeV-Gag-infected B-LCLs restimulated Gag-specific CD8+ T cells efficiently, confirming the potential of our SeV vector system for inducing specific T cell responses.
SeV-Gag expression in the nasal mucosa after its intranasal immunization into macaques
The first in vivo experiment was performed to examine the primary replication of SeV-Gag in macaques. Six cynomolgus macaques were inoculated intranasally with 108 CIU SeV-Gag. None of the monkeys showed apparent clinical symptoms. Two of them (C3880 and C4325) were euthanized at day 4, two (C3993 and C4240) at day 7 and two (C3882 and C4324) at day 13 after the inoculation, respectively. Cells were prepared from each tissue taken at autopsy and RNA was extracted from the cells. Histological analysis showed only a slight inflammatory change in the nasal mucosa but no pathological change in other tissues, including the lung (data not shown).
In the cells prepared from the nasal mucosa, quantitative RTPCR detected 1·7x104 or 2·6x105 copies of gag RNA per 106 cells at day 4 (Fig. 2a). Expression levels were less prominent but still significant at days 7 and 13. These results indicate efficient SeV-Gag expression in the nasal mucosa after intranasal SeV-Gag inoculation.
|
|
SeV-Gag expression in other tissues after immunization
We also examined the expression of gag in the lung, thymus, spleen and inguinal LN but found no expression in any of them (Table 1).
SeV-specific immune responses in immunized macaques
The second in vivo experiment was performed to examine SeV-specific immune responses in macaques after intranasal SeV immunization. Two rhesus macaques (R010 and R014) received 108 CIU SeV-control and three (R013, R015 and R017) received 108 CIU SeV-Gag. The former group showed no IFN- induction after Gag-specific stimulation, while the latter group showed significant levels of Gag-specific T cell responses (Matano et al., 2001
). None of them showed apparent clinical symptoms after immunization.
Then, we examined SeV-specific T cell responses by flow cytometry analysis of antigen-specific intracellular IFN- induction. SeV-specific T cell responses were induced quickly in all animals after immunization (Fig. 3
). Significant levels of SeV-specific T cells were detected in PBMCs at week 1. Especially, efficient induction of specific CD4 T cells was observed. At week 3, all animals showed higher frequencies of SeV-specific CD8+ T cells.
|
|
We measured plasma anti-SeV antibody levels to examine the possibility of SeV transmission (Fig. 5). Similar to the second in vivo experiment, plasma anti-SeV antibodies were clearly detectable at week 2 in both of the SeV-immunized macaques. In contrast, none of the naive macaques showed significant levels of anti-SeV antibodies. These results indicate inefficient SeV transmission from SeV-infected macaques to naive ones.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In macaque experiments, SIV gag RNA was detected dominantly in the nasal mucosa and its local LN after intranasal SeV-Gag immunization. The detected RNA consists of the genomic RNA and the mRNA but we confirmed mRNA expression by quantitative RTPCR using primers that discriminate SeV mRNA from SeV genomic RNA (Kato et al., 2001 ) (data not shown). Efficient gag expression in the local LN as well as the nasal mucosa after immunization suggests its potential for induction of mucosal as well as systemic immune responses.
None of the monkeys in either the previous studies (Hurwitz et al., 1997 ; Kano et al., 2000
) or the present study showed significant pathological symptoms after intranasal SeV immunization. SeV-Gag expression was localized in the nasal mucosa and its local LN and its expression levels reached the peak within a week after immunization. Such tissue restriction is compatible with its replication pattern in mice, which is localized in the airway epithelium. In contrast to the case in mice, we found neither pathological changes nor SeV-Gag expression in the lung in macaques, indicating that the spread of the virus was more restricted in macaques than that in mice.
In general, the proliferation of SeV-control is not slower than that of recombinant SeVs carrying inserted genes in vitro. However, no clinical symptoms were observed even in the SeV-control-immunized macaques. Furthermore, we found no significant differences in the efficiency of SeV recovery from the nasal swabs between SeV-control- and SeV-Gag-immunized macaques (data not shown), indicating that even SeV-control can be well controlled in macaques. Therefore, the SeV vector system could be used safely for the expression of various kinds of antigens in primates.
An intranasal SeV-Gag immunization into macaques induced anti-SeV antibodies and SeV-specific T cells quickly. Especially, all immunized macaques showed SeV-specific T cells at week 1, suggesting the potential of the specific T cells for controlling SeV replication. In spite of these responses specific to the virus vector itself, significant levels of Gag-specific T cell induction were also detected (Matano et al., 2001 ). We found no relationship between SeV-specific and Gag-specific immune responses.
One of the characteristics of the SeV vector system is that the inserted gene is expressed more promptly and efficiently than any other SeV-specific genes derived from the vector because its accommodation is close to the 3' terminus of the SeV genome (Nagai, 1999 ). In addition, the inserted gene fragment has been shown to be stable in the vector both in vitro (Yu et al., 1997
) and in vivo (in mice) (Akaike et al., 2000
). We confirmed expression of Gag as well as SeV in the cells infected with the recovered virus from the swabs in the SeV-Gag-immunized macaques used in our previous experiment (Kano et al., 2000), indicating that the recovered vector still expressed the antigen, Gag. These characteristics of the SeV vector system may contribute to the efficient induction of immune responses specific to the target antigen in the presence of strong immune responses specific to the virus vector itself.
In the third in vivo experiment, SeV transmission from acutely SeV-infected macaques to naive ones was not detected but a little increase in anti-SeV antibody levels below the cut-off line was observed. Thus, the possibility of its transmission was not excluded completely. However, our results indicate that SeV transmission between macaques was inefficient.
In summary, we first analysed primary SeV replication and immune responses in macaques after intranasal immunization with a recombinant SeV. SeV replication was localized around the nasal mucosa and was well controlled. Furthermore, SeV transmission from SeV-immunized macaques to others was inefficient. These results may support the idea that our system can be safely used in primates, including humans. Also, a safer, replication-defective SeV vector lacking F gene is available now (Li et al., 2000 ). In combination with our previous results, the present study indicates that the SeV vector system can induce effective cellular immune responses against pathogenic virus infections, while it is well controlled by strong immune responses against the vector itself in primates. Thus, this system may be a promising, safe and effective tool for vaccines against infections with various kinds of micro-organisms.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Brander, C. & Walker, B. D. (1999). T lymphocyte responses in HIV-1 infection: implications for vaccine development. Current Opinion in Immunology 11, 451-459.[Medline]
Butz, E. A. & Bevan, M. J. (1998). Massive expansion of antigen-specific CD8+ T cells during an acute virus infection. Immunity 8, 167-175.[Medline]
Donahoe, S. M., Moretto, W. J., Samuel, R. V., Metzner, K. J., Marx, P. A., Hanke, T., Connor, R. I. & Nixon, D. F. (2000). Direct measurement of CD8+ T cell responses in macaques infected with simian immunodeficiency virus. Virology 272, 347-356.[Medline]
Gea-Banacloche, J. C., Migueles, S. A., Martino, L., Shupert, W. L., McNeil, A. C., Sabbaghian, M. S., Ehler, L., Prussin, C., Stevens, R., Lambert, L., Altman, J., Hallahan, C. W., de Quiros, J. C. & Connors, M. (2000). Maintenance of large numbers of virus-specific CD8+ T cells in HIV-infected progressors and long-term nonprogressors. Journal of Immunology 165, 1082-1092.
Hasan, M. K., Kato, A., Shioda, T., Sakai, Y., Yu, D. & Nagai, Y. (1997). Creation of an infectious recombinant Sendai virus expressing the firefly luciferase gene from the 3 proximal first locus. Journal of General Virology 78, 2813-2820.[Abstract]
Hurwitz, J. L., Soike, K. F., Sangster, M. Y., Portner, A., Sealy, R. E., Dawson, D. H. & Coleclough, C. (1997). Intranasal Sendai virus vaccine protects African green monkeys from infection with human parainfluenza virus-type one. Vaccine 15, 533-540.[Medline]
Jin, X., Bauer, D. E., Tuttleton, S. E., Lewin, S., Gettie, A., Blanchard, J., Irwin, C. E., Safrit, J. T., Mittler, J., Weinberger, L., Kostrikis, L. G., Zhang, L., Perelson, A. S. & Ho, D. D. (1999). Dramatic rise in plasma viremia after CD8+ T cell depletion in simian immunodeficiency virus-infected macaques. Journal of Experimental Medicine 189, 991-998.
Kano, M., Matano, T., Nakamura, H., Takeda, A., Kato, A., Ariyoshi, K., Mori, K., Sata, T. & Nagai, Y. (2000). Elicitation of protective immunity against simian immunodeficiency virus infection by a recombinant Sendai virus expressing the Gag protein. AIDS 14, 1281-1282.[Medline]
Kato, A., Sakai, Y., Shioda, T., Kondo, T., Nakanishi, M. & Nagai, Y. (1996). Initiation of Sendai virus multiplication from transfected cDNA or RNA with negative or positive sense. Genes to Cells 1, 569-579.
Kato, A., Kiyotani, K., Sakai, Y., Yoshida, T. & Nagai, Y. (1997a). The paramyxovirus, Sendai virus, V protein encodes a luxury function required for viral pathogenesis. EMBO Journal 16, 578-587.
Kato, A., Kiyotani, K., Sakai, Y., Yoshida, T., Shioda, T. & Nagai, Y. (1997b). Importance of the cysteine-rich carboxyl-terminal half of V protein for Sendai virus pathogenesis. Journal of Virology 71, 7266-7272.[Abstract]
Kato, A., Ohnishi, Y., Kohase, M., Saito, S., Tashiro, M. & Nagai, Y. (2001). Y2, the smallest of the Sendai virus C proteins, is fully capable of both counteracting the antiviral action of interferons and inhibiting viral RNA synthesis. Journal of Virology 75, 3802-3810.
Kestler, H., Kodama, T., Ringler, D., Marthas, M., Pedersen, N., Lackner, A., Regier, D., Sehgal, P., Daniel, M., King, N. & Desrosiers, R. (1990). Induction of AIDS in rhesus monkeys by molecularly cloned simian immunodeficiency virus. Science 248, 1109-1112.[Medline]
Kiyotani, K., Takao, S., Sakaguchi, T. & Yoshida, T. (1990). Immediate protection of mice from lethal wild-type Sendai virus (HVJ) infections by a temperature-sensitive mutant, HVJpi, possessing homologous interfering capacity. Virology 177, 65-74.[Medline]
Lavini, A., Brookes, R., Hambleton, S., Britton, W. J., Hill, A. V. & McMichael, A. J. (1997). Rapid effector function in CD8+ memory T cells. Journal of Experimental Medicine 186, 859-865.
Li, H. O., Zhu, Y. F., Asakawa, M., Kuma, H., Hirata, T., Ueda, Y., Lee, Y. S., Fukumura, M., Iida, A., Kato, A., Nagai, Y. & Hasegawa, M. (2000). A cytoplasmic RNA vector derived from nontransmissible Sendai virus with efficient gene transfer and expression. Journal of Virology 74, 6564-6569.
Mackett, M., Smith, G. L. & Moss, B. (1982). Vaccinia virus: a selectable eukaryotic cloning and expression vector. Proceedings of the National Academy of Sciences, USA 79, 7415-7419.[Abstract]
Matano, T., Odawara, T., Ohshima, M., Yoshikura, H. & Iwamoto, A. (1993). Trans-dominant interference with virus infection at two different stages by a mutant envelope protein of Friend murine leukemia virus. Journal of Virology 67, 2026-2033.[Abstract]
Matano, T., Shibata, R., Siemon, C., Connors, M., Lane, H. C. & Martin, M. A. (1998). Administration of an anti-CD8 monoclonal antibody interferes with the clearance of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques. Journal of Virology 72, 164-169.
Matano, T., Kano, M., Odawara, T., Nakamura, H., Takeda, A., Mori, K., Sato, T. & Nagai, Y. (2000). Induction of protective immunity against pathogenic simian immunodeficiency virus by a foreign receptor-dependent replication of an engineered avirulent virus. Vaccine 18, 3310-3318.[Medline]
Matano, T., Kano, M., Nakamura, H., Takeda, A. & Nagai, Y. (2001). Rapid appearance of secondary immune responses and protection from acute CD4 depletion after a highly pathogenic immunodeficiency virus challenge in macaques vaccinated with a DNA prime/Sendai viral vector boost regimen. Journal of Virology 75, 11891-11896.
Murali-Krishna, K., Altman, J. D., Suresh, M., Sourdive, D. J., Zajac, A. J., Miller, J. D., Slansky, J. & Ahmed, R. (1998). Counting antigen-specific CD8 T cells: a reevaluation of bystander activation during viral infection. Immunity 8, 177-187.[Medline]
Nagai, Y. (1993). Protease-dependent virus tropism and pathogenicity. Trends in Microbiology 1, 81-87.[Medline]
Nagai, Y. (1999). Paramyxovirus replication and pathogenesis. Reverse genetics transforms understanding. Reviews in Medical Virology 9, 83-99.[Medline]
Nagai, Y. & Kato, A. (1999). Paramyxovirus reverse genetics is coming of age. Microbiology and Immunology 43, 613-624.[Medline]
Ogg, G. S., Jin, X., Bonhoeffer, S., Dunbar, P. R., Nowak, M. A., Monard, S., Segal, J. P., Cao, Y., Rowland-Jones, S. L., Cerundolo, V., Hurley, A., Markowitz, M., Ho, D. D., Nixon, D. F. & McMichael, A. J. (1998). Quantitation of HIV-1-specific cytotoxic T lymphocytes and plasma load of viral RNA. Science 279, 2103-2106.
Rowland-Jones, S. L., Dong, T., Fowke, K. R., Kimani, J., Krausa, P., Newell, H., Blanchard, T., Ariyoshi, K., Oyugi, J., Ngugi, E., Bwayo, J., MacDonald, K. S., McMichael, A. J. & Plummer, F. A. (1998). Cytotoxic T cell responses to multiple conserved HIV epitopes in HIV-resistant prostitutes in Nairobi. Journal of Clinical Investigation 102, 1758-1765.
Sakai, Y., Kiyotani, K., Fukumura, M., Asakawa, M., Kato, A., Shioda, T., Yoshida, T., Tanaka, A., Hasegawa, M. & Nagai, Y. (1999). Accommodation of foreign genes into the Sendai virus genome: sizes of inserted genes and viral replication. FEBS Letters 456, 221-226.[Medline]
Schmitz, J. E., Kuroda, M. J., Santra, S., Sasseville, V. G., Simon, M. A., Lifton, M. A., Racz, P., Tenner-Racz, K., Dalesandro, M., Scallon, B. J., Ghrayeb, J., Forman, M. A., Montefiori, D. C., Rieber, E. P., Letvin, N. L. & Reimann, K. A. (1999). Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283, 857-860.
Seder, R. A. & Hill, A. V. S. (2000). Vaccines against intracellular infections requiring cellular immunity. Nature 406, 793-798.[Medline]
Shibata, R., Maldarelli, F., Siemon, C., Matano, T., Parta, M., Miller, G., Fredrickson, T. & Martin, M. A. (1997). Infection and pathogenicity of chimeric simianhuman immunodeficiency viruses in macaques: determinants of high virus loads and CD4 cell killing. Journal of Infectious Diseases 176, 362-373.[Medline]
Suen, J. Y. & Stern, S. J. (1996). Cancer of the Neck. In Cancer of the Head and Neck , pp. 462-484. Edited by E. N. Myers & J. Y. Suen. Philadelphia: W. B. Saunders.
Voss, G., Nick, S., Stahl-Hennig, C., Ritter, K. & Hunsmann, G. (1992). Generation of macaque B lymphoblastoid cell lines with simian EpsteinBarr-like viruses: transformation procedure, characterization of the cell lines and occurrence of simian foamy virus. Journal of Virological Methods 39, 185-195.[Medline]
Watanabe, T., Nakamura, K., Wakugawa, M., Kato, A., Nagai, Y., Shioda, T., Iwamoto, A. & Tamaki, K. (2000). Antibodies to molluscum contagiosum virus in the general population and susceptible patients. Archives of Dermatology 136, 1518-1522.
Yonemitsu, Y., Kitson, C., Ferrari, S., Farley, R., Griesenbach, U., Judd, D., Steel, R., Scheid, P., Zhu, J., Jeffery, P. K., Kato, A., Hasan, M. K., Nagai, Y., Masaki, I., Fukumura, M., Hasegawa, M., Geddes, D. M. & Alton, E. W. F. W. (2000). Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nature Biotechnology 18, 970-973.[Medline]
Yu, D., Shioda, T., Kato, A., Hasan, M. K., Sakai, Y. & Nagai, Y. (1997). Sendai virus-based expression of HIV-1 gp120: reinforcement by the V- version. Genes to Cells 2, 457-466.
Received 11 December 2001;
accepted 5 March 2002.