Division of Gastroenterology, Center for Clinical Sciences Research, Room 3115, Stanford University School of Medicine, 300 Pasteur Drive, Stanford, CA 94305-5187, USA, and VA Palo Alto Health Care System, Palo Alto, CA 94304, USA1
Author for correspondence: Suzanne Matsui (mail to the Center for Clinical Sciences Research). Fax +1 650 852 3259. e-mail sumatsui{at}stanford.edu
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The complete sequences of HAstV-1 (L23513, Z25771), -2 (L13745), -3 (AF141381) and -8 (Mendez-Toss et al., 2000 ), sheep astrovirus (SAstV; Y15937, AF260508), turkey astrovirus (TAstV) (Koci et al., 2000
) and avian nephritis virus (ANV; an avian astrovirus) (Imada et al., 2000
) have been determined. The
6·8 kb polyadenylated viral genome is composed of three open reading frames (ORFs): 1a, 1b and 2. The structural proteins, encoded by ORF-2, are expressed from a 2·4 kb subgenomic RNA that is coterminal with the 3' end of the genome and detectable in infected cells (Lewis et al., 1994
; Matsui et al., 1993
; Monroe et al., 1993
; Willcocks & Carter, 1993
). Putative nonstructural proteins (NSPs), including a 3C-like serine protease motif and an RNA-dependent RNA polymerase (RdRp) motif, are encoded by ORF-1a and ORF-1b, respectively (Jiang et al., 1993
; Lewis et al., 1994
). Expression of the RdRp is regulated by (-1) ribosomal frameshifting (Lewis & Matsui, 1996
; Marczinke et al., 1994
), a mechanism used by HIV-1, other retroviruses and coronaviruses (Bredenbeek et al., 1990
; Jacks, 1990
). ORF-1a also encodes a putative nuclear localization signal (NLS) (Jiang et al., 1993
; Willcocks et al., 1999
), an immunoreactive epitope (Matsui et al., 1993
) and several transmembrane (TM) domains (Jiang et al., 1993
) (Fig. 1
).
|
Substrate cleavage by serine proteases involves the catalytic triad consisting of His, Asp and Ser. For serine proteases, the Ser serves as the nucleophile by contributing an electron to the carbonyl carbon of the hydrolysed peptide bond. It is unusually reactive and, like the His and Asp residues, has a conserved location in the spatial configuration of the active site of the protease (Dougherty & Semler, 1993 ).
At present, limited information is available about astrovirus NSPs, and the mechanisms by which they are processed are not known. In this report, we present evidence for proteolytic activity of the HAstV-1 3C-like serine protease encoded by ORF-1a. Among potential cleavage products detected by in vitro expression of ORF-1a, two major products the focus of this study were sensitive to mutations of the 3C-like serine protease: an N-terminal cleavage product (p64) and a C-terminal cleavage product (p38). N- and C-terminal deletion analyses were used to further characterize this proteolytic process. The results of this study provide a detailed view of the processing of the ORF-1a product in vitro.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
N-terminal deletion constructs, pAV1a/N1/N
5 (Fig. 1B
), were generated by PCR using one of five positive-sense oligonucleotides (AV1a-F1, 5' TATGGATCCATGGGAGCAGTGCTTAC 3', AV1a-F2, 5' TATGGATCCATGGCTGTTCTACCCA G 3', AV1a-F3, 5' TATGGATCCATGGTGCGAGTTGGAG 3', AV1a-F4, 5' TAAGGATCCATGGGTTTGATGTATG 3', AV1a-F5, 5' TAAGGATCCATGGCTTATGTGAATG 3') in conjunction with a 3' negative-sense primer, AV1a-R1 (5' TTCCACGCATCTAATGAGTGG 3'). The resulting PCR products were digested with NcoI, and ligated into the NcoI and StuI sites of pTM1.
Constructs with C-terminal truncations, pAV1a/C1 and/C
2 (Fig. 1C
), were produced by digestion of pAV1a with SacI (nt 2720)/StuI and BglII (nt 1657)/StuI, respectively. For each digest, the fragment containing pTM1 and the 5' end of the astrovirus sequence was purified. T4 DNA polymerase was used to remove the 3' overhang in the SacI-digested fragment and to fill in the 5' overhang in the BglII-generated fragment. The resulting plasmids were then cyclized by ligating the blunt ends.
A pTM1 vector that allows for incorporation of a FLAG octapeptide (DYKDDDDK) in the N terminus of the expressed product was constructed by annealing two synthetic oligonucleotides (5' CATGATCGATCCCGGGATGGACTACAAGGACGACGATGACAAGGCCATGGAGCT 3' and 5' CCATGGCCTTGTCATCGTCGTCCTTGTAGTCCATCCCGGGATCGAT 3') to form a duplex containing NcoI and SacI overhangs, which was inserted into the NcoI and SacI sites of pTM1. The insertion of the duplex allowed for the original NcoI site of the pTM1 multiple cloning site to be destroyed, thereby facilitating the insertion of astrovirus sequence into a newly created NcoI site downstream of the FLAG marker. To facilitate future cloning, additional restriction sites (SmaI and ClaI) were also included upstream of the sequence encoding the FLAG epitope. The resulting construct, pFLG, was used to generate the clones pFLGAV1a and pFLGAV1a/prot by digesting pAV1a and pAV1a/
prot with NcoI and SalI and introducing the ORF-1a-containing fragments into the NcoI and SalI sites of pFLG.
DNA sequences of all plasmid constructs were confirmed by an ABI Prism 377 automated fluorescence-based Taq cycle sequencing system using dye-labelled terminators. Sequencing was performed by the VA/DDC Automated DNA Sequencing Facility.
Site-directed mutagenesis.
Mutations of the putative catalytic domain, the putative cleavage site and control sites were performed using the Transformer Site-Directed Mutagenesis kit (Clontech) according to the manufacturers instructions. The mutations were either directly introduced into pAV1a, or when size became a limitation, into a smaller shuttle plasmid containing a region of astrovirus sequence which encoded the 3C-like serine protease motif. To create the shuttle plasmid, pAV1a was digested with NheI (nt 1024) and the 5' overhangs of the linearized plasmid were filled using T4 DNA polymerase. The DNA was then digested with SacI (nt 2720) to release a 1696 bp fragment which was purified and inserted into the SmaI/SacI sites of pUC18. Mutations were made in the shuttle vector and digested with SnaBI(nt 1218) or BglII (nt 1657)/SacI(nt 2710) to excise the region of astrovirus sequence containing the desired mutation. This fragment was substituted for the same region of pAV1a containing the wild-type astrovirus sequence by restriction digestion with the corresponding restriction enzymes and ligation. All mutations were confirmed by DNA sequence analysis. Five constructs were produced by this method: pAV1a/H461L, pAV1a/D489V, pAV1a/S551A, pAV1a/Q567P and pAV1a/I578M/I579M.
In vitro transcriptiontranslation.
Non-linearized astrovirus plasmids were transcribed and translated in vitro using the TNT coupled in vitro transcriptiontranslation kit (Promega) with T7 RNA polymerase, as recommended by the manufacturer. Translated proteins were labelled with Tran35S-label (ICN) at 30 °C for 90 min. Input template and other conditions were standardized for all experiments.
Expression of ORF-1a fusion proteins in E. coli.
Recombinant ORF-1a fusion proteins were expressed from plasmid constructs pGEX1aC1 and pGEX1aC2 (kindly provided by the late Terry L. Lewis, PhD). The 1aC1 and 1aC2 expressed products span aa 706920 and aa 448691, respectively (Fig. 1) and together encompass the C-terminal half of the ORF-1a product. These proteins, which contain the 26 kDa glutathione S-transferase (GST) of Schistosoma japonicum as the fusion partner, were purified using glutathioneSepharose 4B (Pharmacia) as previously described (Smith & Johnson, 1988
). Induction of 1aC1 expression in Escherichia coli by IPTG (0·1mM) resulted in the production of milligram quantities of soluble protein. 1aC2 was insoluble and required solubilization from the bacterial pellet by the addition of 1·5% N-laurylsarcosine, 25 mM triethanolamine, 1 mM EDTA (Grieco et al., 1992
). 1aC2 remained bound to the column matrix, despite elution with 5 mM glutathione, and therefore was released by boiling in SDS sample buffer for gel analysis.
Antisera.
Anti-FLAG M2 monoclonal antibody (mAb; Sigma) was used for immunoprecipitation of N-terminal FLAG-tagged proteins. The recombinant glutathione S-transferase fusion proteins, 1aC1 and 1aC2 (Fig. 1), were used to immunize animals for production of polyclonal antisera anti-1aC1 and anti-1aC2. In the case of 1aC2, the glutathioneSepharose beads containing the bound proteins were used for immunization (see above).
Radioimmunoprecipitation and SDSPAGE.
To immunoprecipitate ORF-1a-derived radiolabelled products, immunoprecipitation buffer (50 mM TrisHCl, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, 0·2% deoxycholate, 0·1% SDS, pH 7·2), ORF-1a- or FLAG-specific antibody, and protein A immobilized on Sepharose CL-4B beads (Sigma) were added to the TNT reaction and mixed at 4 °C for 18 h. The immunoprecipitates were washed extensively with immunoprecipitation buffer, high salt immunoprecipitation buffer containing 0·65 M NaCl, and TNE buffer (10 mM TrisHCl, 100 mM NaCl, 1 mM EDTA, pH 8·0). Immunoprecipitated proteins were solubilized in equal volumes of 2xSDS sample buffer and separated by SDSPAGE (12% Trisglycine or 412% BisTris gradient where indicated). Except where noted, gels were processed for fluorography with Entensify (NEN) and exposed for autoradiography.
Alignment of amino acid sequences and prediction of protease cleavage site.
Regions of ORF-1a containing the 3C-like serine protease motifs of HAstV serotypes 13 and 8 (accession nos L23513, Z25771, L13745, AF141381 and AF260508), SAstV (Y15937), TAstV (AF206663) and ANV (AB033998) were aligned with those of equine arterivirus (P19811), tobacco etch virus (P04517), hepatitis C virus (P26664) and murine hepatitis virus (X73559) as well as the 3C protease of human rhinovirus type 14 (HRV14) (P03303) and hepatitis A virus (HAV, P26580) using the PILEUP program from SeqWeb v1.1, Wisconsin Package v10.0 (Genetics Computer Group, University of Wisconsin). The alignment was performed with a gap weight of 6, a gap extension penalty of 1 and a maximum sequence input range of 5000, using the blossum 62 scoring matrix. Amino acids predicted to be members of the 3C-like serine protease catalytic triads were assigned higher priority for alignment. Putative substrate-binding residues preceding the catalytic serine or cysteine were manually aligned.
Analysis of the HAstV-1 ORF-1a polypeptide sequence was performed using the NetPicoRNA prediction server (version 1.0, Center for Biological Sequence Analysis) to predict a cleavage site similar to picornaviral 3C proteases. Cleavage score output from the neural network is reported in the interval 0·0001·000 and scores above 0·5000 are considered as potential cleavage sites. Database searches for homologous proteins were performed with BLASTP and FASTA from the Wisconsin Package mentioned above or BLAST 2.0 from the National Center for Biotechnology Information, National Institutes of Health.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
To identify potential 3C serine protease cleavage sites which would result in p38 production, the HAstV-1 ORF-1a polypeptide sequence was analysed using the NetPicoRNA program (v1.0, Center for Biological Sequence Analysis). Based on the proteolytic activity of foot-and-mouth disease virus (FMDV) 3C protease, cleavage at Q567T568 of the HAstV-1 ORF-1a product was predicted (cleavage score: 0·586, range for entire ORF-1a is 0·1200·665). Cleavage at this site would result in a C-terminal protein fragment of
38·8 kDa which is consistent with the size of the cleavage product p38. Site-directed mutagenesis of Gln-567 to Pro (at the P1 position of the predicted cleavage site) resulted in no detectable p38 production (Fig. 4
, lane 6), suggesting that the protease is unable to process the pAV1a product containing this mutation. By contrast, mutations I578M and I579M (downstream of the cleavage site), which served as controls, did not suppress p38 (Fig. 4
, lane 5) production.
Identification of an ORF-1a-derived N-terminal cleavage product
KyteDoolittle hydropathy plots of the ORF-1a product (Kyte & Doolittle, 1982 ) indicate that the N terminus is very hydrophobic. Attempts to produce adequate quantities of substrates for antibody production proved difficult. In the absence of specific antibodies to the N-terminal regions of ORF-1a, an 8 aa FLAG epitope was placed at the N terminus of the ORF-1a product. This epitope was chosen because its hydrophilic nature helps retain native conformation and function of the target protein. Immunoprecipitation of ORF-1a products containing the N-terminal FLAG epitope with anti-FLAG M2 mAb (Sigma) resulted in the detection of major bands at 101 and 64 kDa (p64) and minor bands at p48 and p41 (Fig. 5
, lane 1). Bands corresponding to p101, p48 and p41, but not p64, were detectable when the pFLGAV1a/
prot products were immunoprecipitated with the same antibody (Fig. 5
, lane 2), indicating that generation of p64 is also dependent on the HAstV 3C-like serine protease. The faint band at
38 kDa (Fig. 5
, lane 1) may be due to some cross-reactivity between the anti-FLAG M2 mAb and an epitope in p38. (According to the manufacturer, cross-reactivity may be encountered with this mAb.) Anti-1aC2 antibodies specific for a more central region of the ORF-1a product than anti-1aC1 (Fig. 1
) antibodies immunoprecipitated major bands at p101 and p64 and to a lesser degree p48, p41 and p38, from lysates derived from the expression of wild-type pFLGAV1a (Fig. 5
, lane 3). p64 and p38 were undetectable when pFLGAV1a/
prot products were detected with anti-1aC2 (Fig. 5
, lane 4).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Although astrovirus is known to contain a well-conserved 3C-like serine protease motif, little information is available regarding the processing of astrovirus NSPs. Gibson et al. (1998) observed a lack of processing of HAstV-2 (serotype 2) ORF-1a proteins containing the 3C-like serine protease motif in vitro, while Willcocks et al. (1999)
detected proteins of 75, 34, 20, 6·5 and 5·5 kDa in HAstV-1-infected Caco-2 cells. The lack of consensus between these two studies may be attributable to the differences in the systems examined and antisera used.
In the current study, we demonstrated using a cell-free system that HAstV-1 ORF-1a encodes a protease that cleaves the full-length product p101 into an N-terminal p64 fragment and a C-terminal p38 fragment. The cleavage site between Gln-567 and Thr-568, predicted by an algorithm based on the FMDV 3C protease, was confirmed.
To characterize the viral protease encoded in ORF-1a of HAstV-1, we relied primarily on mutagenesis studies, as described for other viruses (Chambers et al., 1990 ; Snijder et al., 1996
; Ziebuhr et al., 1997
). We showed that when wild-type ORF-1a was expressed, products of 101 (full-length), 48, 46, 41, 37 and 38 kDa were identified using polyclonal antisera (anti-1aC1) specific for the C terminus of p101. Of the five fragments potentially derived by cleavage by the viral protease, the 38 kDa band was the only one that appeared to be sensitive to perturbation of the protease. p38 was undetectable after: (1) mutation of the protease motif by a
prot mutation that replaced a region of 9 aa, containing Ser-551 and two substrate-binding amino acids (Thr-546 and Gln-547), with the 9 aa HA epitope (Fig. 3
); (2) mutation of individual residues, Ser-551, His-461 and Asp-489, implicated as the catalytic triad (Fig. 4
). Of note, each of the single amino acid mutations of the catalytic triad residues yielded no detectable p38 band, in contrast to the poliovirus 3C protease which displayed a certain tolerance for a His to Leu change (Baum et al., 1991
).
Localization of the protease-sensitive p38 product to the C terminus was demonstrated by its detection with C-terminal-specific antibodies (anti-1aC1 and -1aC2, Fig. 1) and N- and C-terminal deletion analysis (Fig. 6
). The N-terminal fragment, a protease-sensitive p64 product, was detected with anti-1aC2 and the anti-FLAG mAb which detected the FLAG epitope introduced at the N terminus of p101. Marked hydrophobicity of the N terminus of p101 precluded production of antibodies to this region and necessitated introduction of a tag to enable detection of N-terminal cleavage products.
The specific site at which cleavage occurs to yield p64 and p38 was estimated to be between aa 560 and 590, based on the sizes of the cleavage products. The canonical catalytic triad and the conserved substrate-binding Thr-546 and His-566 residues found in the astrovirus protease motif are also found in other viral 3C-like proteases, suggesting that astrovirus may share similar cleavage specificity. The typical cleavage site for 3C-like proteases follows Gln or Glu residues at the P1 position. Within the roughly estimated cleavage region suggested above, cleavage after Glu-567 (P1) would result in proteins of approximately 62·2 kDa (N-terminal fragment) and 38·8 kDa (C-terminal fragment). The NetPicoRNA program that identifies FMDV 3C protease cleavage sites predicted cleavage of p101 at the dipeptide Gln-567Thr-568. Mutation of Gln-567 to Pro resulted in no detectable p38 production, indicating that integrity at this site (i.e. preservation of the conserved Gln-567 at the P1 position) is required for proteolytic processing. In contrast, production of p38 was not affected by mutations introduced at nearby sites (e.g. I568M/I579M). Of note, Gln-567
Thr-568 is conserved among all the mammalian astrovirus sequences available for comparison: HAstV serotypes 13 and 8 and sheep astrovirus. Avian strains, TAstV and ANV, have a possible Gln
Gly cleavage site in a similar region of their ORF-1a product. Taken collectively, these data strongly support cleavage at the HAstV-1 dipeptide Gln-567
Thr-568.
The N-terminal boundary of the protease was also studied. We found that proteolytic activity was preserved despite deletion of up to 420 N-terminal amino acids. Further deletions that extend into the protease motif resulted in loss of proteolytic activity as manifested by undetectable levels of p38.
In summary, these studies provide evidence that the 3C-like serine protease motif encoded in ORF-1a is functional and mediates cleavage of p101 (full-length ORF-1a product) to p64 and p38. The predicted cleavage site, between Gln-567 and Thr-568, is at the C-terminal end of the 3C-like serine protease motif. The N-terminal cleavage product, p64, is predicted to encompass the four transmembrane helices previously described (Jiang et al., 1993 ) and the 3C-like serine protease motif. The transmembrane domains have been suggested to anchor the HAstV RNA replication complex to the membrane (Jiang et al., 1993
). Membrane association may also lead to post-translational modifications. The C-terminal cleavage product, p38, contains an NLS (Dingwall & Laskey, 1991
) and an immunoreactive epitope identified by antibodies to purified HAstV (Matsui et al., 1993
). The NLS appears to be functional (Willcocks et al., 1999
), but its role in the astrovirus life-cycle is not known. More work is needed to elucidate the precise function of p38 and p64 in infected cells. Given that the regions recognized by anti-1aC1 and anti-NAR (Willcocks et al., 1999
) may overlap, it is very likely that p38 and the 34 kDa product identified by Willcocks et al. in astrovirus-infected Caco-2 cells may be related. Work is currently ongoing to address the origins of the p48, p46, p41 and p37 products, which appear to be derived from the C terminus of ORF-1a, but are insensitive to 3C-like serine protease mutations. Given the increasing recognition that human astroviruses are important enteric pathogens, further studies of the nonstructural genes are essential to an understanding of virus replication, polyprotein processing and ultimately pathogenesis.
![]() |
Acknowledgments |
---|
This work was supported by the Office of Research and Development, Department of Veterans Affairs (Merit Review to S.M.M.) and United States PHS grant DK56339 (awarded to the Stanford Digestive Center). D.K. was supported by Stanford University Medical Center Deans Postdoctoral Fellowship Awards (1HAG303, 1HAG376) and PHS grants DK07056 (institutional training grant) and DK09829 (awarded to D.K.)
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Appleton, H. & Higgins, P. G. (1975). Viruses and gastroenteritis in infants. Lancet i, 1297.
Baum, E. Z., Bebernitz, G. A., Palant, O., Mueller, T. & Plotch, S. J. (1991). Purification, properties, and mutagenesis of poliovirus 3C protease. Virology 185, 140-150.[Medline]
Bazan, J. F. & Fletterick, R. J. (1988). Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proceedings of the National Academy of Sciences, USA 85, 7872-7876.[Abstract]
Bredenbeek, P. J., Pachuk, C. J., Noten, A. F., Charite, J., Luytjes, W., Weiss, S. R. & Spaan, W. J. (1990). The primary structure and expression of the second open reading frame of the polymerase gene of the coronavirus MHV-A59; a highly conserved polymerase is expressed by an efficient ribosomal frameshifting mechanism. Nucleic Acids Research 18, 1825-1832.[Abstract]
Chambers, T. J., Weir, R. C., Grakoui, A., McCourt, D. W., Bazan, J. F., Fletterick, R. J. & Rice, C. M. (1990). Evidence that the N-terminal domain of nonstructural protein NS3 from yellow fever virus is a serine protease responsible for site-specific cleavages in the viral polyprotein. Proceedings of the National Academy of Sciences, USA 87, 8898-8902.[Abstract]
Cruz, J. R., Bartlett, A. V., Herrmann, J. E., Caceres, P., Blacklow, N. R. & Cano, F. (1992). Astrovirus-associated diarrhea among Guatemalan ambulatory rural children. Journal of Clinical Microbiology 30, 1140-1144.[Abstract]
Dingwall, C. & Laskey, R. A. (1991). Nuclear targeting sequences a consensus? [see comments]. Trends in Biochemical Sciences 16, 478-481.[Medline]
Dougherty, W. G. & Semler, B. L. (1993). Expression of virus-encoded proteinases: functional and structural similarities with cellular enzymes. Microbiological Reviews 57, 781-822.[Abstract]
Gaggero, A., ORyan, M., Noel, J. S., Glass, R. I., Monroe, S. S., Mamani, N., Prado, V. & Avendano, L. F. (1998). Prevalence of astrovirus infection among Chilean children with acute gastroenteritis. Journal of Clinical Microbiology 36, 3691-3693.
Geigenmüller, U., Ginzton, N. H. & Matsui, S. M. (1997). Construction of a genome-length cDNA clone for human astrovirus serotype 1 and synthesis of infectious RNA transcripts. Journal of Virology 71, 1713-1717.[Abstract]
Gibson, C. A., Chen, J., Monroe, S. A. & Denison, M. R. (1998). Expression and processing of nonstructural proteins of the human astroviruses. Advances in Experimental Medicine and Biology 440, 387-391.[Medline]
Grieco, F., Hay, J. M. & Hull, R. (1992). An improved procedure for the purification of protein fused with glutathione S-transferase. Biotechniques 13, 856-858.[Medline]
Herrmann, J. E., Taylor, D. N., Echeverria, P. & Blacklow, N. R. (1991). Astroviruses as a cause of gastroenteritis in children. New England Journal of Medicine 324, 1757-1760.[Abstract]
Imada, T., Yamaguchi, S., Mase, M., Tsukamoto, K., Kubo, M. & Morooka, A. (2000). Avian nephritis virus (ANV) as a new member of the family Astroviridae and construction of infectious ANV cDNA. Journal of Virology 74, 8487-8493.
Jacks, T. (1990). Translational suppression in gene expression in retroviruses and retrotransposons. Current Topics in Microbiology and Immunology 157, 93-124.[Medline]
Jiang, B., Monroe, S. S., Koonin, E. V., Stine, S. E. & Glass, R. I. (1993). RNA sequence of astrovirus: distinctive genomic organization and a putative retrovirus-like ribosomal frameshifting signal that directs the viral replicase synthesis. Proceedings of the National Academy of Sciences, USA 90, 10539-10543.[Abstract]
Jore, J., De Geus, B., Jackson, R. J., Pouwels, P. H. & Enger-Valk, B. E. (1988). Poliovirus protein 3CD is the active protease for processing of the precursor protein P1 in vitro. Journal of General Virology 69, 1627-1636.[Abstract]
Koci, M. D., Seal, B. S. & Schultz-Cherry, S. (2000). Molecular characterization of an avian astrovirus. Journal of Virology 74, 6173-6177.
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology 157, 105-132.[Medline]
Lee, T. W. & Kurtz, J. B. (1994). Prevalence of human astrovirus serotypes in the Oxford region 197692, with evidence for two new serotypes. Epidemiology and Infection 112, 187-193.[Medline]
Lewis, T. L. & Matsui, S. M. (1996). Astrovirus ribosomal frameshifting in an infection-transfection transient expression system. Journal of Virology 70, 2869-2875.[Abstract]
Lewis, T. L., Greenberg, H. B., Herrmann, J. E., Smith, L. S. & Matsui, S. M. (1994). Analysis of astrovirus serotype 1 RNA, identification of the viral RNA-dependent RNA polymerase motif, and expression of a viral structural protein. Journal of Virology 68, 77-83.[Abstract]
Lopez, L., Castillo, F. J., Fernandez, M. A., Clavel, A., Rubio, M. C., Gomez-Lus, R. & Cutillas, B. (2000). Astrovirus infection among children with gastroenteritis in the city of Zaragoza, Spain. European Journal of Clinical Microbiology & Infectious Diseases 19, 545-547.[Medline]
McIver, C. J., Palombo, E. A., Doultree, J. C., Mustafa, H., Marshall, J. A. & Rawlinson, W. D. (2000). Detection of astrovirus gastroenteritis in children. Journal of Virological Methods 84, 99-105.[Medline]
Madeley, C. R. & Cosgrove, B. P. (1975). Viruses in infantile gastroenteritis. Lancet ii, 124.
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Marczinke, B., Bloys, A. J., Brown, T. D., Willcocks, M. M., Carter, M. J. & Brierley, I. (1994). The human astrovirus RNA-dependent RNA polymerase coding region is expressed by ribosomal frameshifting. Journal of Virology 68, 5588-5595.[Abstract]
Matsui, S. M., Kim, J. P., Greenberg, H. B., Young, L. M., Smith, L. S., Lewis, T. L., Herrmann, J. E., Blacklow, N. R., Dupuis, K. & Reyes, G. R. (1993). Cloning and characterization of human astrovirus immunoreactive epitopes. Journal of Virology 67, 1712-1715.[Abstract]
Matthews, D. A., Smith, W. W., Ferre, R. A., Condon, B., Budahazi, G., Sisson, W., Villafranca, J. E., Janson, C. A., McElroy, H. E. & Gribskov, C. L. (1994). Structure of human rhinovirus 3C protease reveals a trypsin-like polypeptide fold, RNA-binding site, and means for cleaving precursor polyprotein. Cell 77, 761-771.[Medline]
Medina, S. M., Gutierrez, M. F., Liprandi, F. & Ludert, J. E. (2000). Identification and type distribution of astroviruses among children with gastroenteritis in Colombia and Venezuela. Journal of Clinical Microbiology 38, 3481-3483.
Mendez-Toss, M., Romero-Guido, P., Munguia, M. E., Mendez, E. & Arias, C. F. (2000). Molecular analysis of a serotype 8 human astrovirus genome. Journal of General Virology 81, 2891-2897.
Mitchell, D. K., Matson, D. O., Cubitt, W. D., Jackson, L. J., Willcocks, M. M., Pickering, L. K. & Carter, M. J. (1999). Prevalence of antibodies to astrovirus types 1 and 3 in children and adolescents in Norfolk, Virginia. Pediatric Infectious Disease Journal 18, 249-254.[Medline]
Monroe, S. S., Jiang, B., Stine, S. E., Koopmans, M. & Glass, R. I. (1993). Subgenomic RNA sequence of human astrovirus supports classification of Astroviridae as a new family of RNA viruses. Journal of Virology 67, 3611-3614.[Abstract]
Monroe, S. S., Carter, M. J., Herrmann, J. E., Kurtz, J. B. & Matsui, S. M. (1995). Family Astroviridae. In Virus Taxonomy. Sixth Report of the International Committee on Taxonomy of Viruses , pp. 364-367. Edited by F. A. Murphy, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo & M. D. Summers. Vienna & New York:Springer-Verlag.
Moss, B., Elroy-Stein, O., Mizukami, T., Alexander, W. A. & Fuerst, T. R. (1990). Product review. New mammalian expression vectors. Nature 348, 91-92.[Medline]
Naficy, A. B., Rao, M. R., Holmes, J. L., Abu-Elyazeed, R., Savarino, S. J., Wierzba, T. F., Frenck, R. W., Monroe, S. S., Glass, R. I. & Clemens, J. D. (2000). Astrovirus diarrhea in Egyptian children. Journal of Infectious Diseases 182, 685-690.[Medline]
Palmenberg, A. C. (1990). Proteolytic processing of picornaviral polyprotein. Annual Review of Microbiology 44, 603-623.[Medline]
Smith, D. B. & Johnson, K. S. (1988). Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67, 31-40.[Medline]
Snijder, E. J., Wassenaar, A. L., van Dinten, L. C., Spaan, W. J. & Gorbalenya, A. E. (1996). The arterivirus nsp4 protease is the prototype of a novel group of chymotrypsin-like enzymes, the 3C-like serine proteases. Journal of Biological Chemistry 271, 4864-4871.
Steele, A. D., Basetse, H. R., Blacklow, N. R. & Herrmann, J. E. (1998). Astrovirus infection in South Africa: a pilot study. Annals of Tropical Paediatrics 18, 315-319.[Medline]
Taylor, M. B., Walter, J., Berke, T., Cubitt, W. D., Mitchell, D. K. & Matson, D. O. (2001). Characterisation of a South African human astrovirus as type 8 by antigenic and genetic analyses. Journal of Medical Virology 64, 256-261.[Medline]
Willcocks, M. M. & Carter, M. J. (1993). Identification and sequence determination of the capsid protein gene of human astrovirus serotype 1. FEMS Microbiology Letters 114, 1-7.[Medline]
Willcocks, M. M., Boxall, A. S. & Carter, M. J. (1999). Processing and intracellular location of human astrovirus non-structural proteins. Journal of General Virology 80, 2607-2611.
Ypma-Wong, M. F., Dewalt, P. G., Johnson, V. H., Lamb, J. G. & Semler, B. L. (1988). Protein 3CD is the major poliovirus proteinase responsible for cleavage of the P1 capsid precursor. Virology 166, 265-270.[Medline]
Ziebuhr, J., Heusipp, G. & Siddell, S. G. (1997). Biosynthesis, purification, and characterization of the human coronavirus 229E 3C-like proteinase. Journal of Virology 71, 3992-3997.[Abstract]
Received 18 April 2001;
accepted 18 September 2001.