Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, UK1
Author for correspondence: Geoffrey Smith. Present address: WrightFleming Institute, Imperial College School of Medicine, St Marys Campus, Norfolk Place, London W2 1PG, UK. Fax +44 20 7594 3973. e-mail glsmith{at}ic.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The semaphorins are a family of secreted and membrane-bound proteins each containing a sema domain of approximately 500 amino acids (Van Vactor & Lorenz, 1999 ; Nakamura et al., 2000
; Tamagnone & Comoglio, 2000
). More than 20 semaphorins have been identified and these are classified into groups according to the presence of additional protein domains and the species of origin (Semaphorin Nomenclature Committee, 1999
). Most semaphorins are involved in the neurone guidance during development, but immunological semaphorins have also been identified. For example, CD100/SEMA4D is involved in the activation of B and T lymphocytes (Hall et al., 1996
; Kumanogoh et al., 2000
; Shi et al., 2000
), and a soluble version inhibits the migration of immunological cell types, a property shared by the SEMA3A protein (Delaire et al., 2001
). SEMA7A (CDw108) is also expected to have a role in the immune system because it is expressed by, and binds to, immunological cell types (Lange et al., 1998
; Xu et al., 1998
; Yamada et al., 1999
). Virus-encoded semaphorins, including those in alcelaphine herpesvirus-1 (Ensser & Fleckenstein, 1995
), fowlpox virus (Afonso et al., 2000
) and ectromelia virus (Comeau et al., 1998
), and the VV A39R protein (Kolodkin et al., 1993
), are all most closely related to the extracellular region of SEMA7A.
The A39R gene was identified in VV strain Copenhagen (COP) (Goebel et al., 1990 ) and the product of the VV Lister A39R gene was identified as a 55 kDa secreted protein (Comeau et al., 1998
). In VV strain Western Reserve (WR) a 13 bp deletion introduces a frameshift and a premature stop codon into the A39R gene (Smith et al., 1991
). Thus A39R from WR represents a truncated version of the VV semaphorin with a predicted molecular mass of 33·6 kDa (Fig. 1
).
|
Here, the VV A39R protein was characterized and its role in VV virulence was assessed. We report that COP A39R is a glycoprotein that is secreted late during infection. In addition, we show that A39R-like proteins are secreted by several orthopoxviruses, but that the truncated WR A39R protein is retained inside infected cells. In vivo analyses demonstrate that A39R expression affects the outcome of dermal infection by VV. Preliminary histological analyses with A39R recombinant viruses suggest a pro-inflammatory role for A39R.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plasmid construction.
Deletion versions of the A39R gene of VV COP and WR were assembled using splicing by overlap extension (SOE)PCR with Pfu DNA polymerase (Stratagene) and virus DNA from the appropriate VV strain as template. Two DNA fragments were amplified that contained sequence from either the 5' or 3' ends of the A39R ORF and flanking regions. The 5' fragment was generated using oligonucleotides A39R-1 (CCCCCAAGCTTAAGAATAAAGTAATGCCCG), containing a HindIII restriction site (underlined), and A39R-2 (TAGTCGCGCATCGACCCTTATCCGCATCCTCTAC), which contained complementary sequence to the 3' fragment (annealing regions are shown in bold). The 3' fragment was amplified using oligonucleotides A39R-3 (AGGATGCGGATAAGGGTCGATGCGCGACTATTTTC),which contained complementary sequence to the 5' fragment, and A39R-4 (GGGGGAATTCATTACGTCCTTCCTCCC), which introduced an EcoRI restriction site (underlined). The 5' and 3' fragments were joined by PCR using oligonucleotides A39R-1 and A39R-4 to form a deletion version of the A39R ORF that lacked 73% of the A39R gene (from strain COP), corresponding to the region between nucleotides 146918 and 147798 (numbering according to Goebel et al., 1990 ).
Plasmids pCOP A39R and pWR
A39R were generated by ligating the deletion fragments from VV strains COP or WR into pSJH7 (Hughes et al., 1991
). Plasmids pCOP A39R-rev and pWR A39R-rev were constructed by generating a wild-type copy of the COP or WR A39R gene using PCR with oligonucleotides A39R-1 and A39R-4 and virus genomic DNA as template, and then cloning the products into pSJH7. The VV DNA inserts in all plasmids were confirmed by DNA sequencing.
Construction of A39R recombinant viruses.
VV recombinants were generated by transient dominant selection using the Ecogpt gene as a selectable marker as described (Smith, 1993 ) with either pCOP
A39R and VV COP, or pWR
A39R and VV WR. Mycophenolic acid-resistant intermediate viruses were resolved into deletion (vCOP
A39R and vWR
A39R) or wild-type (vCOP A39R-wt and vWR A39R-wt) viruses on the hypoxanthine-guanine phosphoribosyl transferase (hgprt)-negative HeLa cell line D98OR in the presence of 6-thioguanine. Revertant viruses (vCOP A39R-rev and vWR A39R-rev) were constructed in a similar manner, using vCOP
A39R or vWR
A39R as parent virus and plasmid pCOP A39R-rev or pWR A39R-rev. All virus isolates were plaque-purified three times.
A WR virus containing the full-length COP A39R gene (vWR COPA39R) was generated using vWR A39R and pCOP A39R-rev. As a control, the full-length A39R gene was deleted from this virus by infecting cells with vWR COPA39R and transfecting with pCOP
A39R, forming virus vWR
A39R-rev.
The virus genomes were analysed by Southern blotting and PCR using DNA extracted from virus cores (Esposito et al., 1981 ). These analyses confirmed that the genomic structure of each virus was as expected and that no other detectable alterations had occurred (data not shown).
Production and purification of polyclonal antiserum.
The COP A39R ORF (amino acids 28403) was cloned after PCR amplification into pET 16b (Novagen) such that translated products carried a 10-His tag at the N terminus. The primers used were A39R-5 (GGGGGCATATGTCTACTTACTTATTAGACGAC) and A39R-6 (GGGGGGGATCCCTCGATTAAGATTACATTTTAAG), which contained NdeI and BamHI restriction sites respectively (underlined). The protein was expressed in E. coli and purified from inclusion bodies under denaturing conditions (using 6 M guanidine hydrochloride; Sigma) with His-bind resin (Novagen) according to the manufacturers instructions.
A polyclonal antiserum (-A39R) was obtained by immunizing a New Zealand White rabbit with the His-tagged COP A39R protein according to standard protocols (Harlow & Lane, 1988
). The IgG fraction was purified using Protein G Sepharose 4 Fast Flow gel (Pharmacia Biotech) according to the manufacturers instructions. To improve the specificity of the antibody, the purified IgG was adsorbed at 4 °C for 1 h against a 10% packed cell volume of TK-143B cells that had been infected for 24 h with vCOP
A39R (data not shown).
Immunoblotting.
BS-C-1 or TK-143B cells were infected at 10 p.f.u. per cell or mock-infected in MEM containing 10% FBS and, where indicated, 40 µg/ml -D-arabinofuranoside (AraC), 1 µg/ml tunicamycin or 1 µM monensin (all Sigma). At 24 h post-infection (p.i.) (except where specified) cells were harvested, washed in PBS and cellular material was dissolved in Laemmli buffer (Laemmli, 1970
) containing
-mercaptoethanol, heated at 95 °C for 5 min and sonicated to shear DNA. Proteins in the culture supernatant were precipitated in 10% (vol/vol) trichloroacetic acid overnight at 4 °C, recovered by centrifugation (15000 r.p.m., 30 min, 4 °C), washed in methanol, separated by SDSPAGE (10% gel), transferred to nitrocellulose (Sambrook et al., 1989
) and incubated with
-A39R (diluted 1:1000) or
-A41L (diluted 1:2500) (Ng et al., 2001
). Bound IgG was detected by incubation with a horseradish peroxidase-conjugated goat anti-rabbit IgG (Sigma) (diluted 1:2000) followed by the enhanced chemiluminescence detection system (Amersham). Typically, virus proteins were detected using extracts from 1·5x105 cells and the supernatant from 1·8x106 cells.
Virulence assays in mice.
For intranasal infections, groups of five female BALB/c mice (6 weeks old) were inoculated under general anaesthesia with viruses in 20 µl PBS. Each day, mice were weighed individually and monitored for signs of illness, and those suffering a severe infection or having lost 30% of their original body weight were sacrificed. For the intradermal infection model, groups of seven female BALB/c mice (810 weeks old) were anaesthetized and injected intradermally into left ear pinnae with 104 p.f.u. of viruses diluted in 10 µl of MEM. The diameter of lesions was estimated daily to the nearest 0·5 mm using a micrometer. Infectious virus was determined by plaque assay using extracts from ears prepared by grinding in a glass tissue homogenizer, followed by three freezethaw cycles and sonication for 1 min.
Histological analysis of VV-infected mouse ears.
Mice were infected intradermally as described above and at the indicated days p.i., two mice were sacrificed and the infected ears were removed. Cryosections (10 µm) of infected ears were incubated with antibodies specific for CD3 (goat polyclonal, diluted 1:100; Santa Cruz Biotechnology), F4/80 and class II major histocompatibility complex (rat monoclonals, used at 1:5 dilution and obtained from Sir William Dunn School of Pathology, University of Oxford, UK) or the VV B5R protein (a concentrated stock of rat monoclonal 19C2 used at a 1:100 dilution; Schmelz et al., 1994
). Bound antibodies were detected with an appropriate biotinylated secondary antibody, AB enzyme reagent (Santa Cruz Biotechnology) and a peroxidase substrate (diaminobenzidine; Park Scientific). Digital images of histological sections were obtained using a Zeiss Axioplan microscope under bright field illumination and SPOT software, version 2.2.2 (Diagnostic Instruments). The width of infected ears was measured from digital images using SPOT. Measurements were made from the widest points of five sections taken at intervals in infected regions, and the three highest values were used to calculate a mean maximum width for each mouse at each time-point. To determine the proportions of positive-staining cells, histological sections were analysed using MetaMorph software, version 4.5 (Universal Imaging Corporation). By altering the RGB colour threshold settings, the software could measure selectively the proportion of positive (dark brown) coloration within digital images of infected ears. Typically, three areas of infiltrate of 2500050000 µm2 were analysed at each time-point to obtain a mean positive value for each mouse.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Growth properties of mutant viruses
To determine if the A39R gene affected virus growth in cell culture the plaque phenotypes of representative viruses were analysed and found to be indistinguishable (see JGV Online for supplementary data, http://vir.sgmjournals.org). The production of intracellular and extracellular virus by these groups of viruses were also analysed after low and high m.o.i. and found to be similar (data not shown; see JGV Online for supplementary data, http://vir.sgmjournals.org). These data demonstrated that the A39R gene was non-essential for replication in vitro.
Characterization of the A39R protein
To detect the A39R protein, a rabbit polyclonal antiserum (-A39R) was raised against a His-tagged version of the COP A39R protein expressed in E. coli (see Methods). Immunoblotting with this antibody detected a single band of 5055 kDa in the supernatants of cells infected by vCOP A39R-wt, vCOP A39R-rev and vWR COPA39R (Fig. 2a
). No band was detected in the supernatants from vCOP
A39R, vWR A39R-wt, vWR
A39R, vWR A39R-rev or vWR
A39R-rev. As a control, blots were stripped and re-probed with an antibody specific for A41L, a VV secretory protein (Ng et al., 2001
). The detection of A41L in each sample confirmed that all cells had been infected. Although the deletion viruses were not expected to express A39R, these data demonstrated that WR-infected cells did not secrete the truncated version of A39R. The experiment also confirmed the secretion of the COP A39R protein from a WR background (vWR COPA39R).
|
The presence of a potential late transcription initiation motif (TAAAATG) overlapping the A39R putative start codon and early transcription termination signals (TTTTTNT) 16 bp before this ATG and approximately 400 bp before the stop codon suggested that A39R might be transcribed late during infection. To examine this experimentally, cells were infected with vCOP A39R-wt in the presence or absence of AraC, an inhibitor of DNA synthesis and, therefore, intermediate and late viral gene expression. Immunoblotting detected the A39R protein in supernatants from 8 h p.i. and levels continued to increase until 22 h (Fig. 2b). AraC inhibited A39R expression. In contrast, A41L was detected in the same blots after 4 h and was not inhibited by AraC. In infected cells A39R was detectable by 6 h p.i. (data not shown). The time of initial synthesis, the increase in amounts of protein in the supernatant over time and the inhibition of expression by AraC indicated that A39R is expressed late during infection.
The COP A39R contains three potential sites for N-linked glycosylation (NXS/T, where X represents any amino acid). To determine if the A39R protein is modified by glycosylation, cells were infected with vCOP A39R-wt in the presence or absence of either tunicamycin (an inhibitor of N-linked glycosylation) or monensin (which disrupts the trans-Golgi apparatus and affects lysosome and acidic endosome function, thereby inhibiting O-linked glycosylation). Cells and supernatants were analysed at 24 h p.i. by immunoblotting with antibodies to detect A39R or A41L. In the presence of monensin, the size of the major form of A39R in supernatant fractions decreased (Fig. 2c). Tunicamycin further reduced the A39R protein to 45 kDa and prevented its secretion. The A41L protein was also decreased in size by both glycosylation inhibitors, but its secretion was not inhibited by tunicamycin, as reported previously (Ng et al., 2001
). In Fig. 2(c)
, some of the A39R protein was associated with the cellular fraction (even in the absence of drug treatment), but further experiments showed this was not the case for untreated B-SC-1 or RK13 cells (data not shown). These results show that A39R contains N-linked carbohydrate that is essential for its secretion. The reduction in size of the A39R protein could be due to direct inhibition of O-linked glycosylation or indirect effects on the maturation of N-glycans.
Supernatants from cells infected with vCOP A39R-wt and vCOP A39R were also analysed by immunoblotting after electrophoresis under reducing and non-reducing conditions. In reducing conditions, A39R ran slower than under non-reducing conditions (data not shown). This suggests that disulphide bridges exist between some of the eight cysteines that are present within this protein.
Distribution of the A39R protein in orthopoxviruses
Sequence information indicates that the A39R gene is broken into three segments in all sequenced variola virus strains (Aguado et al., 1992 ; Shchelkunov et al., 1993
, 2000
; Massung et al., 1994
) as well as camelpox virus (C. Gubser & G. L. Smith, unpublished data) and VV strain MVA (Antoine et al., 1998
). The A39R gene of VV strain Tian Tan is truncated in an identical manner to strain WR (Jin et al., 1998
). Consequently, secretion of an A39R protein would not be expected by cells infected with any of these viruses. A previous study found that the A39R protein of VV strain Lister is secreted (Comeau et al., 1998
). To determine if the A39R protein was secreted by other orthopoxviruses, supernatants were collected at 24 h p.i. and analysed by immunoblotting. A secreted A39R protein was expressed by VV strains COP, Evans, King Institute, Lister, Patwadangar, USSR, buffalopox and rabbitpox, and two strains of cowpox virus (Brighton red and elephantpox) (Fig. 3
). The buffalopox virus A39R protein was a doublet, with both bands of a higher molecular mass than other A39R proteins. No protein was detected in supernatants with the other VV strains, including WR and Tian Tan, as predicted from DNA sequence data. As a control, blots were stripped and re-probed using an A41L-specific antibody and A41L was detected for each virus.
|
|
Viruses were studied initially using a murine intranasal model of infection; however, no differences in either weight loss or signs of illness were noted among sets of COP or WR viruses (data not shown). Viruses were then compared using a murine intradermal infection model (Tscharke & Smith, 1999 ). Mice were infected in their ear pinnae with 104 p.f.u. of the A39R recombinant viruses, and lesion sizes were measured daily (Fig. 5
). Apart from a slightly quicker resolution of lesions in vCOP
A39R, no difference was observed in terms of lesion size resulting from infection with vCOP A39R-wt, vCOP
A39R or vCOP A39R-rev (Fig. 5a
). However, a difference was seen in the lesions induced by vWR COPA39R compared to vWR A39R-wt, vWR
A39R and vWR
A39R-rev. The vWR COPA39R-infected mice developed larger lesions, and the difference between the pooled mean values of the lesions sizes was statistically significant between days 6 and 14 p.i. compared to those of vWR A39R-wt, vWR
A39R and vWR
A39R-rev (P<0·02, MannWhitney test) (Fig. 5b
). In a repeat experiment, the maximum size of lesions was not different between the three groups, but the mean lesion size of mice infected with vWR COPA39R remained at its maximum value for longer than the other groups (Fig. 5c
). Furthermore, the lesions of control groups were healed fully by day 13, compared to day 17 for vWR COPA39R-infected mice (Fig. 5c
). The similar maximum lesion sizes observed in the second intradermal infection experiment with WR A39R recombinant viruses were most likely due to the use of older mice, a variable that has been shown to affect lesion development in other experiments (D. C. Tscharke & G. L. Smith, unpublished observations). Both experiments showed the lesions obtained with vWR COPA39R were more pronounced than those obtained with controls.
|
Histological examination of infected mouse ears
The cellular events occurring during the intradermal infection process were examined further in cryosections of infected ears from 4, 7 and 10 days p.i. All ear lobes infected with VV showed the marked increase in thickness noted previously in this model (Tscharke & Smith, 1999 ), but interestingly, ears infected with vWR COPA39R were thicker than those infected with control viruses at 4 days p.i. (Fig. 6
). Quantification (see Methods, Fig. 7a
) showed that ears infected with vWR COPA39R had a mean maximum width of almost 900 µm, compared to less than 700 µm for vWR
A39R and vWR
A39R-rev at 4 days p.i. This difference was not seen at day 7 and 10 p.i. These data correlated with observations made at early time-points that ears infected with vWR COPA39R appeared more red and inflamed than those infected with vWR
A39R or vWR
A39R-rev (data not shown). Upon closer observation, it appeared that the increased thickness of ears infected with vWR COPA39R was due both to increased infiltration and oedema. This finding suggests that the secretion of the A39R protein may have a pro-inflammatory effect during VV intradermal infections.
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Immunoblotting showed that the A39R protein was secreted by cells infected with eight of 15 strains of VV and two strains of cowpox virus. It is notable that a secreted A39R protein is encoded by VV strains that have been isolated from identified hosts (i.e. buffalopox and rabbitpox), as well as other orthopoxviruses found in nature (both cowpox strains and ectromelia virus). Therefore, secretion of A39R may be a selective advantage during natural infections. The lack of an intact A39R ORF in all sequenced strains of variola virus is contradictory, but there are other examples of moderately well conserved orthopoxvirus immunomodulatory genes that are fragmented in variola virus (Alcamí & Smith, 1992 ; Moore & Smith, 1992
).
To investigate the role of the VV A39R protein in vivo, sets of COP and WR A39R recombinant viruses were compared in murine models of infection. Following inoculation via the intranasal route, which causes a systemic infection, no differences were associated with the expression of COP A39R in either the COP or the WR background. In contrast, while mice infected intradermally with the A39R deletion mutant of COP had only slightly more rapidly resolving lesions and no difference in lesion size, significantly larger or more prolonged lesions were seen when COP A39R was expressed by WR. The reason why A39R was associated with more severe lesions when expressed by WR but not by COP is unclear but may be influenced by expression of other proteins unique to either virus, or to the replicative ability of either parent virus in this model. By analogy, the VV IL-1R (gene B15R) prevented enhanced weight loss and induction of fever in some circumstances only (Alcamí & Smith, 1992
, 1996
; Spriggs et al., 1992
).
To determine whether the increased lesion sizes associated with A39R expression were caused by increased virus replication or immunopathology, we quantified infectious virus and examined infected ears histologically and immunohistochemically. At no time after infection could we find any influence of A39R on virus titres in infected ears. However, histological analysis at 4 day p.i. found that COP A39R expression by WR was associated with greater thickening of the ears due to increased cellular infiltration and oedema. Taken together, these results suggest that A39R secretion is associated with increased immunopathology and not with damage caused by enhanced virus replication. The observed increases in immunopathology and cellular infiltration suggest that the A39R protein has direct or indirect pro-inflammatory properties.
Work with the A39R-like protein of ectromelia virus suggested that this virus product might affect monocyte migration (Spriggs, 1999 ). Monocytes and macrophages can cause tissue damage mediated by enzymes and reactive oxygen species (Chensue & Ward, 1996
) and T cells have also been implicated in virus-induced immunopathology. Therefore, infected ear sections were stained with antibodies to detect F4/80 and CD3
. The proportions of cells expressing these markers were the same for all viruses, indicating that increased infiltration of these cell types was not likely to be the cause of greater immunopathology associated with A39R expression. Increased activation of these cells cannot be ruled out, although equally, other inflammatory cells such as neutrophils might be involved. The ectromelia A39R protein was found to inhibit migration of monocytes and induce secretion of TNF-
, IL-6 and IL-8 from these cells (Comeau et al., 1998
; Spriggs, 1999
). While we found no evidence for A39R-induced attenuation of monocyte migration in vivo, TNF-
and IL-6 are potent activators of a variety of cells, and IL-8 is chemotactic for neutrophils. Thus, increased levels of these cytokines in the presence of A39R would be consistent with our data. Furthermore, ectromelia A39R was found to bind to most primary immune cell types and immunological cell lines (Comeau et al., 1998
), suggesting that multiple cell types may be affected.
VV secretes a variety of proteins that are likely to be anti-inflammatory, for example soluble receptors for IL-1, TNF, IFN-
and chemokines, and the secretion of an apparently pro-inflammatory molecule might seem counter-intuitive. However, there are examples of other viruses that secrete proteins to recruit subsets of immune cells that favour virus infection. The murine cytomegalovirus (CMV) m131/129 protein attracts macrophages in vitro and mutant viruses lacking the encoding gene have a decreased dissemination within mice (Fleming et al., 1999
; Saederup et al., 1999
). Functional chemokines are also encoded by human CMV and human herpesvirus-6 (Penfold et al., 1999
; Zou et al., 1999
). VV is unable to disseminate from cutaneous inoculation sites in mice, but other orthopoxviruses do disseminate from this site during infection of their natural host and a role for phagocytes in this process has been proposed (Buller & Palumbo, 1991
). Possibly, the A39R protein might aid VV dissemination within or between hosts during natural infection.
Studying viral immunomodulators can also help elucidate the functions of their ligands (Alcamí & Smith, 1996 ). The VV A39R protein is more closely related to SEMA7A than other known host proteins, including those in the recently published human genome (data not shown) (International Human Genome Sequencing Consortium, 2001
; Venter et al., 2001
). A39R and SEMA7A bind to the same receptor, plexin-C1, with a similar affinity (Comeau et al., 1998
; Tamagnone et al., 1999
) and therefore data presented here and elsewhere (Comeau et al., 1998
) suggest that cellcell interactions between SEMA7A and plexin-C1 may be involved in the process of inflammation. Consequently, blocking this molecular interaction may be useful during chronic inflammation, and A39R or SEMA7A may be beneficial during immunization by stimulating an inflammatory response. Human immunodeficiency virus causes up-regulation of SEMA7A on the surface of infected cells (Frank et al., 1996
), which also suggests a role for these molecules during viral disease.
In conclusion, the VV A39R gene of strain COP encodes a secreted glycoprotein that is non-essential for virus replication but affects the outcome of infection in a murine intradermal model.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
b Present address: Nuffield Department of Clinical Laboratory Sciences, University of Oxford, John Radcliffe Hospital, Headington, Oxford OX3 9DU, UK.
c Present address: Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20852, USA.
d Present address: WrightFleming Institute, Imperial College School of Medicine, St Marys Campus, Norfolk Place, London, W2 1PG, UK.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Aguado, B., Selmes, I. P. & Smith, G. L. (1992). Nucleotide sequence of 21·8 kbp of variola major virus strain Harvey and comparison with vaccinia virus. Journal of General Virology 73, 2887-2902.[Abstract]
Alcamí, A. & Koszinowski, U. H. (2000). Viral mechanisms of immune evasion. Immunology Today 21, 447-455.[Medline]
Alcamí, A. & Smith, G. L. (1992). A soluble receptor for interleukin-1 beta encoded by vaccinia virus: a novel mechanism of virus modulation of the host response to infection. Cell 71, 153-167.[Medline]
Alcamí, A. & Smith, G. L. (1995). Vaccinia, cowpox, and camelpox viruses encode soluble gamma interferon receptors with novel broad species specificity. Journal of Virology 69, 4633-4639.[Abstract]
Alcamí, A. & Smith, G. L. (1996). A mechanism for the inhibition of fever by a virus. Proceedings of the National Academy of Sciences, USA 93, 11029-11034.
Antoine, G., Scheiflinger, F., Dorner, F. & Falkner, F. G. (1998). The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244, 365-396.[Medline]
Bugert, J. J. & Darai, G. (2000). Poxvirus homologues of cellular genes. Virus Genes 21, 113-133.
Buller, R. M. & Palumbo, G. J. (1991). Poxvirus pathogenesis. Microbiological Reviews 55, 80-122.
Chensue, S. W. & Ward, P. A. (1996). Inflammation. In Andersons Pathology , pp. 387-415. Edited by I. Damjanov & J. Linder. St Louis:Mosby.
Comeau, M. R., Johnson, R., DuBose, R. F., Petersen, M., Gearing, P., VandenBos, T., Park, L., Farrah, T., Buller, R. M., Cohen, J. I., Strockbine, L. D., Rauch, C. & Spriggs, M. K. (1998). A poxvirus-encoded semaphorin induces cytokine production from monocytes and binds to a novel cellular semaphorin receptor, VESPR. Immunity 8, 473-482.[Medline]
Delaire, S., Billard, C., Tordjman, R., Chédotal, A., Elhabazi, A., Bensussan, A. & Boumsell, L. (2001). Biological activity of soluble CD100. II. Soluble CD100, similarly to H-semaIII, inhibits immune cell migration. Journal of Immunology 166, 4348-4354.
Engelstad, M., Howard, S. T. & Smith, G. L. (1992). A constitutively expressed vaccinia gene encodes a 42-kDa glycoprotein related to complement control factors that forms part of the extracellular virus envelope. Virology 188, 801-810.[Medline]
Ensser, A. & Fleckenstein, B. (1995). Alcelaphine herpesvirus type 1 has a semaphorin-like gene. Journal of General Virology 76, 1063-1067.[Abstract]
Esposito, J., Condit, R. & Obijeski, J. (1981). The preparation of orthopoxvirus DNA. Journal of Virological Methods 2, 175-179.[Medline]
Fleming, P., Davis-Poynter, N., Degli-Esposti, M., Densley, E., Papadimitriou, J., Shellam, G. & Farrell, H. (1999). The murine cytomegalovirus chemokine homolog, m131/129, is a determinant of viral pathogenicity. Journal of Virology 73, 6800-6809.
Frank, I., Stoiber, H., Godar, S., Stockinger, H., Steindl, F., Katinger, H. W. & Dierich, M. P. (1996). Acquisition of host cell-surface-derived molecules by HIV-1. AIDS 10, 1611-1620.[Medline]
Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P. & Paoletti, E. (1990). The complete DNA sequence of vaccinia virus. Virology 179, 247266, 517563.[Medline]
Hall, K. T., Boumsell, L., Schultze, J. L., Boussiotis, V. A., Dorfman, D. M., Cardoso, A. A., Bensussan, A., Nadler, L. M. & Freeman, G. J. (1996). Human CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation. Proceedings of the National Academy of Sciences, USA 93, 11780-11785.
Harlow, E. & Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Hughes, S. J., Johnston, L. H., de Carlos, A. & Smith, G. L. (1991). Vaccinia virus encodes an active thymidylate kinase that complements a cdc8 mutant of Saccharomyces cerevisiae. Journal of Biological Chemistry 266, 20103-20109.
International Human Genome Sequencing Consortium (2001). Initial sequencing and analysis of the human genome. Nature 409, 860921.[Medline]
Jin, Q., Hou, Y. D., Cheng, N. H., Yao, E. M., Cheng, S. X., Yang, X. K., Jing, D. Y., Yu, W. H., Yuan, J. S. & Ma, X. J. (1998). Complete genomic sequence of vaccinia virus (Tian Tan strain). Genbank accession no. NC 002170.
Kolodkin, A. L., Matthes, D. J. & Goodman, C. S. (1993). The semaphorin genes encode a family of transmembrane and secreted growth cone guidance molecules. Cell 75, 1389-1399.[Medline]
Kumanogoh, A., Watanabe, C., Lee, I., Wang, X., Shi, W., Araki, H., Hirata, H., Iwahori, K., Uchida, J., Yasui, T., Matsumoto, M., Yoshida, K., Yakura, H., Pan, C., Parnes, J. R. & Kikutani, H. (2000). Identification of CD72 as a lymphocyte receptor for the class IV semaphorin CD100. A novel mechanism for regulating B cell signaling. Immunity 13, 621-631.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.[Medline]
Lange, C., Liehr, T., Goen, M., Gebhart, E., Fleckenstein, B. & Ensser, A. (1998). New eukaryotic semaphorins with close homology to semaphorins of DNA viruses. Genomics 51, 340-350.[Medline]
Massung, R. F., Liu, L. I., Qi, J., Knight, J. C., Yuran, T. E., Kerlavage, A. R., Parsons, J. M., Venter, J. C. & Esposito, J. J. (1994). Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975. Virology 201, 215-240.[Medline]
Moore, J. B. & Smith, G. L. (1992). Steroid hormone synthesis by a vaccinia enzyme: a new type of virus virulence factor. EMBO Journal 11, 19731980; erratum 3490.[Abstract]
Nakamura, F., Kalb, R. G. & Strittmatter, S. M. (2000). Molecular basis of semaphorin-mediated axon guidance. Journal of Neurobiology 44, 219-229.[Medline]
Ng, A., Tscharke, D. C., Reading, P. & Smith, G. L. (2001). The vaccinia virus A41L protein is a soluble 30 kDa glycoprotein that affects virus virulence. Journal of General Virology 82, 20952105.
Penfold, M. E., Dairaghi, D. J., Duke, G. M., Saederup, N., Mocarski, E. S., Kemble, G. W. & Schall, T. J. (1999). Cytomegalovirus encodes a potent alpha chemokine. Proceedings of the National Academy of Sciences, USA 96, 9839-9844.
Saederup, N., Lin, Y. C., Dairaghi, D. J., Schall, T. J. & Mocarski, E. S. (1999). Cytomegalovirus-encoded beta chemokine promotes monocyte-associated viremia in the host. Proceedings of the National Academy of Sciences, USA 96, 10881-10886.
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Schmelz, M., Sodeik, B., Ericsson, M., Wolffe, E. J., Shida, H., Hiller, G. & Griffiths, G. (1994). Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans Golgi network. Journal of Virology 68, 130-147.[Abstract]
Semaphorin Nomenclature Committee (1999). Unified nomenclature for the semaphorins/collapsins. Cell 97, 551552.[Medline]
Shchelkunov, S. N., Resenchuk, S. M., Totmenin, A. V., Blinov, V. M., Marennikova, S. S. & Sandakhchiev, L. S. (1993). Comparison of the genetic maps of variola and vaccinia viruses. FEBS Letters 327, 321-324.[Medline]
Shchelkunov, S. N., Totmenin, A. V., Loparev, V. N., Safronov, P. F., Gutorov, V. V., Chizhikov, V. E., Knight, J. C., Parsons, J. M., Massung, R. F. & Esposito, J. J. (2000). Alastrim smallpox variola minor virus genome DNA sequences. Virology 266, 361-386.[Medline]
Shi, W., Kumanogoh, A., Watanabe, C., Uchida, J., Wang, X., Yasui, T., Yukawa, K., Ikawa, M., Okabe, M., Parnes, J. R., Yoshida, K. & Kikutani, H. (2000). The class IV semaphorin CD100 plays nonredundant roles in the immune system. Defective B and T cell activation in CD100-deficient mice. Immunity 13, 633-642.[Medline]
Smith, G. L. (1993). Expression of genes by vaccinia virus vectors. In Molecular Virology: A Practical Approach , pp. 257-283. Edited by A. J. Davison & R. Elliott. Oxford:Oxford University Press.
Smith, G. L. (2000). Secreted poxvirus proteins that interact with the immune system. In Effects of Microbes on the Immune System , pp. 491-507. Edited by M. W. Cunningham & R. S. Fujinami. Philadelphia:Lippincott Williams & Wilkins.
Smith, G. L., Chan, Y. S. & Howard, S. T. (1991). Nucleotide sequence of 42 kbp of vaccinia virus strain WR from near the right inverted terminal repeat. Journal of General Virology 72, 1349-1376.[Abstract]
Smith, G. L., Symons, J. A., Khanna, A., Vanderplasschen, A. & Alcamí, A. (1997). Vaccinia virus immune evasion. Immunological Reviews 159, 137-154.[Medline]
Spriggs, M. K. (1999). Shared resources between the neural and immune systems: semaphorins join the ranks. Current Opinion in Immunology 11, 387-391.[Medline]
Spriggs, M. K., Hruby, D. E., Maliszewski, C. R., Pickup, D. J., Sims, J. E., Buller, R. M. & VanSlyke, J. (1992). Vaccinia and cowpox viruses encode a novel secreted interleukin-1-binding protein. Cell 71, 145-152.[Medline]
Tamagnone, L. & Comoglio, P. M. (2000). Signalling by semaphorin receptors: cell guidance and beyond. Trends in Cell Biology 10, 377-383.[Medline]
Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G. I., Song, H., Chedotal, A., Winberg, M. L., Goodman, C. S., Poo, M., Tessier-Lavigne, M. & Comoglio, P. M. (1999). Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99, 71-80.[Medline]
Tortorella, D., Gewurz, B. E., Furman, M. H., Schust, D. J. & Ploegh, H. L. (2000). Viral subversion of the immune system. Annual Review of Immunology 18, 861-926.[Medline]
Tscharke, D. C. & Smith, G. L. (1999). A model for vaccinia virus pathogenesis and immunity based on intradermal injection of mouse ear pinnae. Journal of General Virology 80, 2751-2755.
Van Vactor, D. V. & Lorenz, L. J. (1999). Neural development: the semantics of axon guidance. Current Biology 9, R201-R204.[Medline]
Venter, J. C., Adams, M. D., Myers, E. W., Li, P. W., Mural, R. J., Sutton, G. G., Smith, H. O., Yandell, M., Evans, C. A., Holt, R. A., Gocayne, J. D., Amanatides, P., Ballew, R. M., Huson, D. H., Wortman, J. R., Zhang, Q., Kodira, C. D., Zheng, X. H., Chen, L., Skupski, M., Subramanian, G., Thomas, P. D., Zhang, J., Gabor Miklos, G. L., Nelson, C., Broder, S., Clark, A. G., Nadeau, J., McKusick, V. A., Zinder, N., Levine, A. J., Roberts, R. J., Simon, M., Slayman, C., Hunkapiller, M., Bolanos, R., Delcher, A., Dew, I., Fasulo, D., Flanigan, M., Florea, L., Halpern, A., Hannenhalli, S., Kravitz, S., Levy, S., Mobarry, C., Reinert, K., Remington, K., Abu-Threideh, J., Beasley, E., Biddick, K., Bonazzi, V., Brandon, R., Cargill, M., Chandramouliswaran, I., Charlab, R., Chaturvedi, K., Deng, Z., Di Francesco, V., Dunn, P., Eilbeck, K., Evangelista, C., Gabrielian, A. E., Gan, W., Ge, W., Gong, F., Gu, Z., Guan, P., Heiman, T. J., Higgins, M. E., Ji, R. R., Ke, Z., Ketchum, K. A., Lai, Z., Lei, Y., Li, Z., Li, J., Liang, Y., Lin, X., Lu, F., Merkulov, G. V., Milshina, N., Moore, H. M., Naik, A. K., Narayan, V. A., Neelam, B., Nusskern, D., Rusch, D. B., Salzberg, S., Shao, W., Shue, B., Sun, J., Wang, Z., Wang, A., Wang, X., Wang, J., Wei, M., Wides, R., Xiao, C., Yan, C. and others (2001). The sequence of the human genome. Science 291, 13041351.
Xu, X., Ng, S., Wu, Z. L., Nguyen, D., Homburger, S., Seidel-Dugan, C., Ebens, A. & Luo, Y. (1998). Human semaphorin K1 is glycosylphosphatidylinositol-linked and defines a new subfamily of viral-related semaphorins. Journal of Biological Chemistry 273, 22428-22434.
Yamada, A., Kubo, K., Takeshita, A., Harashima, N., Kawano, K., Mine, T., Sagawa, K., Sugamura, K. & Itoh, K. (1999). Molecular cloning of a glycosylphosphatidylinositol-anchored molecule CDw108. Journal of Immunology 162, 4094-4100.
Zou, P., Isegawa, Y., Nakano, K., Haque, M., Horiguchi, Y. & Yamanishi, K. (1999). Human herpesvirus 6 open reading frame U83 encodes a functional chemokine. Journal of Virology 73, 5926-5933.
Received 11 May 2001;
accepted 21 June 2001.