By
From the Department of Immunology, Birmingham Medical School, Birmingham B15 2TT, United Kingdom
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
This report investigates the role of OX40 ligand (OX40L) and its receptor, OX40, expressed
on activated B and T cells, respectively, in promoting the differentiation of T helper type 2 (Th2) CD4 T cells. These molecules are expressed in vivo by day 2 after priming with T cell-
dependent antigens. Their expression coincides with the appearance of immunoglobulin (Ig)G
switch transcripts and mRNA for interleukin (IL)-4 and interferon (IFN)-, suggesting that
this molecular interaction plays a role in early cognate interactions between B and T cells. In
vitro, we report that costimulation of naive, CD62Lhigh CD4 T cells through OX40 promotes
IL-4 expression and upregulates mRNA for the chemokine receptor, blr-1, whose ligand is expressed in B follicles and attracts lymphocytes to this location. Furthermore, T cell stimulation
through OX40 inhibits IFN-
expression in both CD8 T cells and IL-12-stimulated CD4 T
cells. Although this signal initiates IL-4 expression, IL-4 itself is strongly synergistic. Our data
suggest that OX40L on antigen-activated B cells instructs naive T cells to differentiate into Th2
cells and migrate into B follicles, where T cell-dependent germinal centers develop.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The mammalian immune system has evolved to deal
with two principal groups of pathogens: extracellular
organisms, which are opsonized by antibody and complement
and are killed when ingested by phagocytes; and intracellular bacterial organisms like mycobacteria, which escape the
normal intracellular killing mechanisms and replicate inside
host cells. T cells play a crucial role in orchestrating host
defences against both types of pathogen. In mice and humans, two distinct patterns of Th cell have been described.
Th1 cells, by virtue of their capacity to secrete IFN-, play
a crucial role in eliminating intracellular bacteria in mice
and humans (1); Th2 CD4 T cells are more effective helpers for antibody responses.
Recent experiments suggest that commitment of CD4 T
cells to Th1 or Th2 subsets occurs at or shortly after T cell
priming on dendritic cells (DC)1 (2). It is well established
that IL-12 plays the key role in directing Th1 cell CD4 differentiation (3), and this cytokine can be secreted by activated DC (4, 5). The factors that initiate Th2 CD4 differentiation are less well understood. IL-4 promotes Th2
CD4 differentiation and inhibits Th1 cells by downregulating the chain of the IL-12 receptor (6). It has been suggested that NK1.1 cells (7) are the initial sources of IL-4,
but NK1.1-deficient mice make normal Th2 responses (8).
Alternatively, there is evidence that B cells evoke Th2 differentiation (9, 10). The appearance of IgG switch transcripts coincident with the appearance of mRNA for cytokines during immune responses to T cell-dependent antigens supports the notion that B cells interacting with T cells might play a role in initiating IL-4 secretion (2).
It has been reported previously that the expression of
OX40 on T cells in the T zone is maximal 3 d after priming (11). In this paper, we confirm that the B cell activation
antigen, OX40 ligand (OX40L), and the T cell activation
antigen, OX40, are expressed by day 2 at the time of T cell
priming in vivo. We report that costimulation of naive
CD62Lhigh T cells through OX40 promotes IL-4 expression and upregulates the chemokine receptor, CXCR5
(blr-1), whose ligand is expressed in B follicles (12). Although OX40L initiates IL-4 responses, subsequent differentiation is IL-4 dependent. In addition, IL-4 inhibits IFN-
expression in both CD8- and IL-12-stimulated CD4 T
cells. Our data suggests a mechanism whereby antigen-activated B cells promote the differentiation of Th2 cells and
their recruitment to B follicles, where T cell-dependent
germinal centers develop.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Construction of Murine OX40L Transfectant.
Construction and expression of stable transfectants expressing murine (m)OX40L protein were carried out as follows. The primers used to amplify mOX40L were 5' (TATATAGAGCTCACCATGGAAGGGGAAGGGGTTCAACCCC) and 3' (ATATATAAGCTTACTTACCTCACAGTGGTACTTGGTTCACAGT). Reverse transcription (RT)-PCR using immunized mouse spleen cDNA as a template was used to amplify cDNA encoding mOX40L. The PCR product was subcloned into an expression plasmid containing prokaryotic (Ampicillin) and eukaryotic (histidinol) selection markers, and promoters and enhancers for murine B cells and plasma cells. The plasmid has been described elsewhere (13).Construction of mOX40-Human 1.
Transfection of Plasmids into J558L.
Plasmids containing the correct insert were linearized and electroporated into the mammalian plasmacytoma cell line, J558L, and selected in 10 mM Histidinol (Sigma Chemical Co., St. Louis, MO) for the OX40L transfectant, or mycophenolic acid and Xanthine (Sigma Chemical Co.) for mOX40-hPreparation of CD4CD62Lhigh and CD8CD62Lhigh T Cells.
6-12-wk-old female BALB/c or C57BL/6 mice were killed, and their spleen and LNs were removed. Cell suspensions were made by crushing the tissues between gauze. After separation with Ficoll-paque (Amersham Pharmacia Biotech, Herts, UK), the cell suspensions were pooled and incubated with FITC-conjugated anti-CD4 or anti-CD8 antibody (Southern Biotechnology Associates, Inc., Birmingham, AL) at 20 µl/108 cells, for 15 min at 4°C. FITC-stained single cells were positively selected using MACS® anti-FITC (isomer 1) Multisort kit (Miltenyi Biotec Ltd., Surrey, UK) and a miniMACS® separation unit according to the manufacturer's protocol. The resulting positive fraction was further separated according to expression of CD62L using MACs® anti- mouse CD62L microbeads (Miltenyi Biotec Ltd.), again according to the manufacturer's protocol. The resulting population was typically >95% positive for CD4 or CD8 and CD62L as determined by flow cytometry using a FACScan® (Becton Dickinson, Mountain View, CA).T Cell Stimulation, Cytokines, and Antibodies.
For cell culture, J558L and the mOX40L and hCD27L transfectants were fixed in 1% formaldehyde for 45 min at 4°C and washed thoroughly. Viability after fixation was undetectable, but OX40L transfectants could still be stained with the mOX40-hRestimulation of T Cells for FACS® Analysis for CD40L, IL-4,
and IFN-.
Semiquantitative RT-PCR.
To obtain cell samples for cDNA preparation, the above culture conditions were duplicated on rat anti-mouse CD3 (10 µg/ml)-coated 96-well plates. CD4+ CD62L+ cells were plated in triplicate at 105 cells/well with the addition of 3 × 104 cells/well of the fixed transfected cell line. Cell cultures were harvested without restimulation at time 0, and after 24, 48, and 72 h. The cells were washed in PBS, and the dry pellet was frozen at ![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
During immune responses to the nominal haptenated protein antigen NP-CG
and the infectious viral superantigen MMTV (2), T cell priming occurs around day 3. The predominant cytokine associated with MMTV is IFN-
, whereas IL-4 is secreted in response
to NP-C
G. Antigen presentation of the superantigen by
MMTV on B cells is associated with T cell-driven proliferation of large numbers of B cells. The response to NP-C
G is
of lower magnitude, with activation of antigen-specific B
cells. We examined mRNA expression of OX40L and OX40
during these two immune responses (see Fig. 1, A-D).
|
During immune responses to MMTV, which potently
activates B cells (19), OX40L is strongly induced. There is
a 10-fold increase in mRNA expression between days 2 and 3, and by day 5, the peak of the B cell response, there
is a further 5-fold increase in mRNA (Fig. 1 B). OX40
mRNA is also upregulated about fivefold by day 2 of the
immune response (Fig. 1 D). The response to the nominal
protein antigen NP-CG is less marked but exhibits similar kinetics. Increased OX40 and OX40L mRNA is in evidence by day 2 and peaks on day 3 of the immune response, coinciding with the early cognate interaction among
B cells, T cells, and DC. mRNA levels for OX40 and
OX40L remain elevated above baseline levels for several
weeks in both immune responses. The predominant site of
B-T interaction is within the light zone of germinal centers at these late time points. In summary, these results indicate that OX40 and its ligand are expressed from the time of B
and T cell priming in vivo, and could therefore play a role
in directing subsequent T and B cell differentiation.
Previous evidence has suggested that cross-linking of OX40L on B cells by T cell OX40 delivers a B cell differentiation signal (20). To dissect the effects of OX40L on signaling through T cell OX40, we developed an in vitro model to study naive CD4 T cell activation and differentiation.
CD4+CD62Lhigh T cells that were >95% pure were
compared with total or CD4+CD62Llow T cells for their
capacity to upregulate the expression of intracytoplasmic IL-4 and IFN- after activation through CD3 and CD28.
In our system, CD4 T cells are activated for short periods
(up to 3 d). This time frame was chosen to mimic as closely
as possible the in vivo situation (2).
Before staining for intracytoplasmic IL-4 and IFN-, T
cells were restimulated by immobilized mAb to CD3 for 4 h
in the presence of GolgiStopTM, which causes newly synthesized proteins to accumulate within the Golgi compartment. Without GolgiStopTM, cytokine expression could not
be detected. If GolgiStopTM was added to cultures without restimulating with anti-CD3 mAb, a similar pattern of cytokine expression was observed, but levels were much lower
(data not shown).
Results of a typical experiment are shown in Fig. 2. In
the absence of IL-12 or other costimuli besides CD3 and
CD28, a substantial fraction of CD62Llow-enriched CD4 T
cells are induced to express IL-4, but few express IFN-
(Fig. 2, A and B). In contrast, IFN-
was strongly expressed by ~30% of naive CD8+CD62Lhigh cells 72 h after
activation with the same CD3 and CD28 stimulus (Fig. 2
D). Almost no CD8 T cells expressed detectable levels of
IL-4 (Fig. 2 C).
|
Naive CD4+CD62Lhigh T cells activated in parallel failed
to express either IL-4 or IFN- (Fig. 2, E and F). This was
not because of lack of activation of these T cells, as they
were stimulated to divide and upregulate expression of
CD40L (see Fig. 3 A).
|
The above data indicated that
naive CD4 T cells need signals other than those through
their TCR and CD28 to upregulate expression of IL-4 or
IFN-. IL-12, which can be produced by activated DC (4,
5), has been shown to be the principal cytokine involved in
differentiation of Th1 CD4 T cells. Because we had observed that OX40L was upregulated at or about the time of
T cell priming, we investigated whether this molecule
could increase expression of IL-4 or IFN-
within the 3-d
time frame of priming of naive CD4 T cells in vivo. As can
be seen from Fig. 3 A, OX40L transfectants but not the parental cell line, J558L, induced substantial expression of IL-4
but not IFN-
by day 3. The effect of the OX40L transfectant could consistently be partially abrogated (~30%) by
preincubating the transfectant cell line with OX40-h
1 (10 µg/ml) before the addition of T cells. Because the T cells
are in contact with the OX40L transfectant for several days,
we found it impossible to obtain complete inhibition of the
OX40L effect with the Ig fusion protein (data not shown).
The effects of OX40L cannot simply be attributable to better
activation, as levels of CD40L induced on CD4 T cells were
comparable. CD4 T cells enriched for activated CD62Llow
cells expressed high levels of IL-4, irrespective of the costimulus (data not shown). A time course of induction of
expression of IL-4 by OX40L showed no expression until
day 2 (Fig. 3 B), a result consistent with the induction of
IL-4 in vivo (2). These experiments were performed in
both Balb/c and C57Bl/6 inbred strains of mice. The yield
of CD4+CD62Lhigh cells was consistently greater from
Balb/c mice (~30%), and these cells survived much better
in culture. In both strains of mice, OX40L induced expression of intracellular IL-4, although the proportion of CD4
T cells expressing IL-4 was less in the C57Bl/6 strain (~50% of that seen in Balb/c mice; three experiments).
Data is shown for Balb/c mice, which were used in most
experiments because of the increased yield and better survival in culture of purified T cells.
The above experiments indicated that OX40L upregulated
the expression of IL-4 in naive CD4 T cells. It is well established that IL-4 itself promotes CD4 Th2 differentiation. To test whether OX40L was dependent on IL-4 for
its effect, T cells were stimulated for 3 d in the presence of
neutralizing IL-4 and IFN- mAb. Cells were washed extensively before restimulation to remove excess mAb that
could interfere with the intracellular staining process. As
can be seen from Fig. 4 A, anti-IL-4 mAb blocked the induction of intracytoplasmic IL-4 in CD4 T cells. mAb to
IFN-
partially blocked IL-4 expression, but this effect was
much less marked.
|
A substantial proportion of
naive CD8 (Fig. 2 D) but not CD4 (Fig. 2 F) T cells expresses IFN- when costimulated with CD3 and CD28
alone. However, if IL-12 is added to cultures, IFN-
is
strongly upregulated within activated CD62Lhigh CD4 T
cells (Fig. 4 B, a). In the presence of IL-12, substantial numbers (~25%) of activated CD4 cells express IFN-
by
day 3, and this is substantially inhibited in the presence of
OX40L (5%). OX40-h
1 abrogated the effect of OX40L
on IFN-
expression, confirming that the effects were attributable to this molecule (data not shown). The effect of
OX40L on IFN-
expression is inhibited when blocking
IL-4 mAbs are added (Fig. 4 B, e), suggesting that its effects
on CD4 Th1 differentiation are mediated by IL-4. IFN-
blocking mAbs also inhibit CD4 Th1 differentiation (Fig. 4
B, g), confirming a previous report (6). Qualitatively similar experimental results were obtained using C57Bl/6 mice,
but the inhibition of IFN-
expression was less marked,
correlating with the lower induction of IL-4.
OX40L also inhibits induction of IFN- from 45 to 16%
in naive CD8 T cells (Fig. 4 B, g). This effect is resistant to
blocking mAbs to either IL-4 or IFN-
(Fig. 4 B, f and h).
Differentiation of CD4 T cells is associated not only with distinct cytokines but also with the propensity to migrate to different sites. Th1 cells express adhesion molecules which allow them to migrate to where endothelium is inflamed (21). In contrast, Th2 cells express the eotaxin receptor (CCR3), which perhaps allows them to migrate to sites of allergic responses (22). Another chemokine receptor, blr-1 (CXCR5), is implicated in the migration of B and T cells into follicles (23) where the ligand is expressed (12). We examined the expression of mRNA for this chemokine receptor in parallel with cytokine expression on CD4 T cells activated with and without OX40L.
Blr-1 was not expressed on naive CD4 T cells, but after 3 d costimulation with OX40L but not the parental line, J558L, blr-1 mRNA was strongly upregulated (Fig. 5). Expression of this mRNA was blocked only partially by neutralizing mAb to IL-4.
|
The expression of mRNA for IFN- and IL-4 mRNA
paralleled that seen by staining for intracellular cytokines,
even though cells had not been restimulated. This confirms
that restimulation does not alter the pattern of cytokines
expressed. In these experiments, blocking mAb to IL-4 inhibits mRNA expression, showing that the effects of OX40L
on IL-4 expression are dependent on IL-4.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
T and B cell immune responses to protein antigens are
initiated in the T zone (24, 25). Some B cells differentiate
locally to plasma cells, while others are induced to migrate
into B follicles and form germinal centers with the help of
antigen-specific T cells. Recent data have shown that T
cell cytokine commitment starts ~2 d after immunization:
soluble protein antigens evoke predominantly Th2 CD4 T
cell responses, whereas responses to viral antigens are more
complex and show a mixture of Th1 and Th2 cytokines (2). It is crucial that CD4 T cells make the appropriate cytokine response, as resistance to intracellular bacterial infections like mycobacteria is dependent on IFN- production.
How do CD4 T cells decide? We present evidence in this
paper that effector cells play an important role in the decision-making process by interacting with CD4 T cells at the
time of T cell priming.
It has been reported previously that cross-linking of Ig
receptors or CD40 ligation of B cells upregulates the expression of OX40L (20), and there is experimental evidence that blocking this interaction abrogates B cell differentiation in the T zone in vivo (11). We have found that
OX40L and its receptor, OX40, are upregulated between
days 2 and 3, when T and B cells are primed in vivo. To
study whether OX40L induces differentiation of naive T
cells, an in vitro system was developed. In this model, signals through CD28 and the TCR were insufficient to induce either IL-4 or IFN- expression during the first 3 d of
priming of naive CD4 cells, which nevertheless proliferated
(data not shown) and expressed CD40L. This time frame
was chosen because it reflected the commitment of CD4 T
cells to IL-4 or IFN-
production in vivo. The addition of
fixed OX40L but not control transfectants induced IL-4
expression that was detectable by day 2 and strongly expressed by day 3. This temporal expression coincided with
that seen in vivo. This effect was inhibited if IL-4 was neutralized during the priming process, suggesting that OX40L
initiates Th2 differentiation but IL-4 plays the dominant
role thereafter. In addition, OX40L upregulated the expression of blr-1, a chemokine receptor implicated in the migration of T and B cells into follicles (12, 23).
In contrast to naive CD4 T cells, naive CD8 T cells produced IFN- when costimulated through CD28 and TCR
alone. IFN-
expression in naive CD4 T cells could be
readily induced by IL-12, but expression was substantially
inhibited by OX40L. This effect was mediated in part by
IL-4, as neutralizing IL-4 antibodies mitigated this effect.
There is increasing evidence that the type of antigen or the
way in which it is presented to the immune system can regulate subsequent cytokine responses by CD4 T cells (2, 5).
It has been shown previously that antigen dosage can regulate commitment to Th1 or Th2 CD4 pathways in vitro
(26). However, the cytokine IL-12 must play the crucial
role in Th1 differentiation, as IL-12-deficient mice and
humans cannot mount effective IFN- responses to intracellular pathogens. IL-6 has been proposed be the Th2 cytokine equivalent of IL-12, as it is able to initiate IL-4 secretion in CD4 T cells (27). However, the phenotype of
IL-6-deficient mice, which make Th2 responses, suggests
that this cannot be an exclusive mechanism (28).
Our data are consistent with a model where CD4 T cells
are not committed initially to make either IL-4 or IFN-
when they are activated by signals through CD28 and the
TCR on DC. Instead, their differentiation is guided by
secondary signals from the effector cell with which they interact. We show here that OX40L is a sufficient accessory
signal to initiate early Th2 differentiation in naive CD4 T
cells. We propose that antigen-activated B cells, which are
programmed to migrate to T cell areas (29), engage CD4 T
cells around the time of their priming. Signaling through CD40 or surface Ig on B cells upregulates the expression of
OX40L, which engages OX40 on the activated cognate
CD4 T cell. This signal sets in motion a self-reinforcing IL-4
loop in primed CD4 T cells that further promotes Th2 differentiation. IL-12 can be produced by DC (4, 5), and a recent report suggests that human DC can express OX40L
(30). By inducing IL-12 or OX40L, respectively, antigens
might effectively evoke Th1- and Th2-promoting DC.
Th1 differentiation is associated with the upregulation of chemokine receptors CXCR3 and CCR5 (31) and the expression of adhesion molecules that allow them to migrate into inflamed tissue (21). In contrast, Th2 cells express the eotaxin receptor, CCR3, which allows them to migrate to allergic sites (22). Some T cells express CXCR5 (blr-1), a chemokine receptor whose ligand is expressed in follicles. Our data show that OX40L upregulates blr-1, and therefore directs not only Th2 differentiation but also migration of T cells into follicles to help B cells. Although blocking OX40 interactions in vivo does not abrogate germinal center development (11), this probably reflects redundancy within the CD40 family of receptor ligands. We have found that CD27L, which can be expressed on activated B cells (32) and whose receptor is expressed on T cells, induces similar effects on naive CD4 T cells (our unpublished observations).
Production of IFN-IL-12 and IFN- play
a crucial role in responses to intracellular bacterial antigens.
Although the immune system may have evolved to recognize specific intracellular pathogens (5), it seems likely that
there is some default mechanism for recognizing such infections. Differential processing of antigen by DC might determine whether they produced IL-12.
Alternatively, the experiments described here raise a second possibility. During responses to extracellular antigens,
CD8 T cells are not generally primed as antigen is presented in association with MHC class II molecules. This is
not the case with intracellular infections where both CD8
and CD4 T cells are activated by antigens presented on
MHC class I and II molecules, respectively. Most CD8 responses require Th1 CD4 help (IL-2), but unlike B cells, CD8 lymphocytes do not engage cognately with CD4 T
cells. The default expression of IFN- (which promotes
Th1 differentiation [6]) by naive CD8 T cells during T cell
priming perhaps offers a mechanism for instructing naive
CD4 T cells to remain responsive to IL-12 (6), and DC to
produce IL-12 (33). This idea is supported by recent data
suggesting that CD8 T cells play an important role in the
generation of protective Th1 CD4 responses (34), and in
particular IFN-
produced by these CD8 T cells (35).
Most intracellular infections, particularly viruses,
require a combination of high affinity antibody and cytotoxic CD8 T cells for the best protective immunity. We
show here that OX40L will inhibit Th1 differentiation
promoted by IL-12. This suggests a mechanism whereby B
cells can efficiently evoke Th2 cytokines from CD4 T cells
in an environment where IL-12 is inducing IFN-. This is
demonstrated in the response to MMTV, where IL-4 production after IFN-
is associated with the development of
germinal centers (2) and the production of neutralizing antiviral envelope antibodies (19).
![]() |
Footnotes |
---|
Address correspondence to Peter Lane, Department of Immunology, Birmingham Medical School, Vincent Dr., Birmingham B15 2TT, UK. Phone: 44-121-4144078; Fax: 44-121-4143599; E-mail: p.j.l.lane{at}bham.ac.uk
Received for publication 26 March 1998 and in revised form 1 May 1998.
The authors would like to thank Ian MacLennan, Matt Cook, Lucy Walker, and Carola Garcia for their comments on the manuscript.
This work was supported by grants from The Royal Society and from the Wellcome Trust to P. Lane. S. Flynn is supported by a Medical Research Council Ph.D. studentship.
Abbreviations used in this paper
DC, dendritic cell(s);
h, human;
L, ligand;
m, murine;
MMTV, Swiss-type mouse mammary tumor virus;
NP-CG, (4-hydroxy-3-nitrophenyl) acetyl-chicken
globulin;
RT, reverse transcription.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. |
Kumararatne, D.S..
1997.
Tuberculosis and immunodeficiency![]() |
2. |
Toellner, K.,
S. Luther,
D.M.-Y. Sze,
R.K.-W. Choy,
D.R. Taylor,
I.C.M. MacLennan, and
H. Acha-Orbea.
1998.
Th1
and Th2 characteristics start to develop during T cell priming
and are associated with an immediate ability to induce immunoglobulin class switching.
J. Exp. Med.
187:
1193-1201
|
3. | Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13: 251-276 [Medline]. |
4. | Cella, M., D. Scheidegger, K. Palmer-Lehman, P. Lane, A. Lanzavecchia, and G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell costimulatory capacity: T-T help via APC activation. J. Exp. Med. 184: 747-752 [Abstract]. |
5. |
Sousa, C.R.,
S. Hieny,
T. Scharton-Kersten,
D. Jankovic,
H. Charest,
R.N. Germain, and
A. Sher.
1997.
In vivo microbial stimulation induces rapid CD40 ligand-independent production of interleukin 12 by dendritic cells and their redistribution to T cell areas.
J. Exp. Med.
186:
1819-1829
|
6. |
Szabo, S.J.,
A.S. Dighe,
U. Gubler, and
K.M. Murphy.
1997.
Regulation of the interleukin (IL)-12R beta 2 subunit expression in developing T helper 1 (Th1) and Th2 cells.
J.
Exp. Med.
185:
817-824
|
7. | Bendelac, A.. 1995. Mouse NK1+ T cells. Curr. Opin. Immunol 7: 367-74 [Medline]. |
8. |
von der Weid, T.,
A.M. Beebe,
D.C. Roopenian, and
R.L. Coffman.
1996.
Early production of IL-4 and induction of
Th2 responses in the lymph node originate from an MHC
class I-independent CD4+NK1.1![]() |
9. | Stockinger, B., T. Zal, A. Zal, and D. Gray. 1995. B cells solicit their own help from T cells. J. Exp. Med. 183: 891-899 [Abstract]. |
10. | Mason, D.. 1996. The role of B cells in the programming of T cells for IL-4 synthesis. J. Exp. Med. 183: 717-719 [Medline]. |
11. | Stüber, E., and W. Strober. 1996. The T cell-B cell interaction via OX40-OX40L is necessary for the cell-dependent humoral immune response. J. Exp. Med. 183: 979-989 [Abstract]. |
12. | Gunn, M.D., V.N. Ngo, K.M. Ansel, E.H. Ekland, J.G. Cyster, and L.T. Williams. 1998. A B-homing chemokine made in lymphoid follicles activates Burkitt's lymphoma type receptor-1. Nature 391: 799-802 [Medline]. |
13. | Traunecker, A., F. Oliveri, and K. Karjalainen. 1991. Myeloma based expression system for production of large mammalian proteins. Trends Biotechnol. 9: 109-113 [Medline]. |
14. |
Calderhead, D.M.,
J.E. Buhlmann,
A.J.M. Vandeneertwegh,
E. Claassen,
R.J. Noelle, and
H.P. Fell.
1993.
Cloning of
mouse Ox40: a T cell activation marker that may mediate T-B
cell interactions.
J. Immunol.
151:
5261-5271
|
15. |
Lane, P.,
W. Gerhard,
S. Hubele,
A. Lanzavecchia, and
F. McConnell.
1993.
Expression and functional properties of
mouse B7/BB1 using a fusion protein between mouse CTLA4
and human ![]() |
16. |
Svetic, A.,
F.D. Finkelman,
Y.C. Jian,
C.W. Dieffenbach,
D.E. Scott,
K.F. McCarthy,
A.D. Steinberg, and
W.C. Gause.
1991.
Cytokine gene expression after in vivo primary
immunization with goat antibody to mouse IgD antibody.
J.
Immunol.
147:
2391-2397
|
17. |
Forster, R.,
T. Emrich,
E. Kremmer, and
M. Lipp.
1994.
Expression of the G-protein-coupled receptor BLR1 defines
mature, recirculating B cells and a subset of T-helper memory cells.
Blood
84:
830-840
|
18. | Weibel, E.R.. 1963. Principles and methods for the morphometric study of the lung and other organs. Lab. Invest. 12: 131-155 . |
19. | Luther, S.A., I. Maillard, F. Luthi, L. Scarpellino, H. Diggelmann, and H. Acha-Orbea. 1997. Early neutralizing antibody response against mouse mammary tumor virus: critical role of viral infection and superantigen-reactive T cells. J. Immunol. 159: 2807-2814 [Abstract]. |
20. | Stüber, E., M. Neurath, D. Calderhead, H.P. Fell, and W. Strober. 1995. Cross-linking of OX40 ligand, a member of the TNF/NGF cytokine family, induces proliferation and differentiation in murine splenic B cells. Immunity 2: 507-521 [Medline]. |
21. | Austrup, F., D. Vestweber, E. Borges, M. Lohning, R. Brauer, U. Herz, H. Renz, R. Hallmann, A. Scheffold, A. Radbruch, and A. Hamann. 1997. P- and E-selectin mediate recruitment of T-helper-1 but not T-helper-2 cells into inflamed tissues. Nature 385: 81-83 [Medline]. |
22. |
Sallusto, F.,
C.R. Mackay, and
A. Lanzavecchia.
1997.
Selective expression of the eotaxin receptor CCR3 by human T
helper 2 cells.
Science
277:
2005-2007
|
23. | Forster, R., A.E. Mattis, E. Kremmer, E. Wolf, G. Brem, and M. Lipp. 1996. A putative chemokine receptor, BLR1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87: 1037-1047 [Medline]. |
24. | Jacob, J., R. Kassir, and G. Kelsoe. 1991. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. I. The architecture and dynamics of responding cell populations. J. Exp. Med. 173: 1165-1175 [Abstract]. |
25. | Liu, Y.J., J. Zhang, P.J. Lane, E.Y. Chan, and I.C. MacLennan. 1991. Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell-independent antigens. Eur. J. Immunol. 21: 2951-2962 [Medline]. |
26. | Constant, S., C. Pfeiffer, A. Woodard, T. Pasqualini, and K. Bottomly. 1995. Extent of T cell receptor ligation can determine the functional differentiation of naive CD4+ T cells. J. Exp. Med. 182: 1591-1596 [Abstract]. |
27. |
Rincon, M.,
J. Anguita,
T. Nakamura,
E. Fikrig, and
R.A. Flavell.
1997.
Interleukin (IL)-6 directs the differentiation of
IL-4-producing CD4+ T cells.
J. Exp. Med.
185:
461-469
|
28. | Kopf, M., G. Legros, A.J. Coyle, M. Koscovilbois, and F. Brombacher. 1995. Immune responses of IL-4, IL-5, IL-6 deficient mice. Immunol. Rev. 148: 45-69 [Medline]. |
29. | Cyster, J.G., S.B. Hartley, and C.C. Goodnow. 1994. Competition for follicular niches excludes self-reactive cells from the recirculating B-cell repertoire. Nature 371: 389-395 [Medline]. |
30. | Ohshima, Y., Y. Tanaka, H. Tozawa, Y. Takahashi, C. Maliszewski, and G. Delespesse. 1997. Expression and function of OX40 ligand on human dendritic cells. J. Immunol. 159: 3838-3848 [Abstract]. |
31. |
Bonecchi, R.,
G. Bianchi,
P.P. Bordignon,
D. Dambrosio,
R. Lang,
A. Borsatti,
S. Sozzani,
P. Allavena,
P.A. Gray,
A. Mantovani, and
F. Sinigaglia.
1998.
Differential expression of
chemokine receptors and chemotactic responsiveness of type
1 T helper cells (Th1s) and Th2s.
J. Exp. Med.
187:
129-134
|
32. | Lens, S.M.A., R.L. Dejong, B. Hooibrink, B. Koopman, S.T. Pals, M.H.J. Vanoers, and R.A.W. Vanlier. 1996. Phenotype and function of human B-cells expressing CD70 (CD27 ligand). Eur. J. Immunol. 26: 2964-2971 [Medline]. |
33. |
Hilkens, C.M.U.,
P. Kalinski,
M. deBoer, and
M.L. Kapsenberg.
1997.
Human dendritic cells require exogenous interleukin-12-inducing factors to direct the development of naive T-helper
cells toward the Th1 phenotype.
Blood
90:
1920-1926
|
34. |
Srikiatkhachorn, A., and
T.J. Braciale.
1997.
Virus-specific
CD8+ T lymphocytes downregulate T helper cell type 2 cytokine secretion and pulmonary eosinophilia during experimental murine respiratory syncytial virus infection.
J. Exp.
Med.
186:
421-432
|
35. |
Tascon, R.E.,
E. Stavropoulos,
K.V. Lukacs, and
M.J. Colston.
1998.
Protection against Mycobacterium tuberculosis infection by CD8+ T cells requires the production of gamma interferon.
Infect. Immun.
66:
830-834
|