By
From the * Julia McFarlane Diabetes Research Centre, Department of Microbiology and Infectious
Diseases, Faculty of Medicine, The University of Calgary, Calgary, Alberta, Canada T2N 4N1; the Laboratory of Endocrinology, Institute for Medical Science, Department of Endocrinology and Metabolism,
School of Medicine, Ajou University, Suwon, Korea 442-749; and the § Department of Cell Biology & Immunology, Faculty of Medicine, Free University, Amsterdam, The Netherlands 1081 BT
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We have shown previously that the inactivation of macrophages in nonobese diabetic (NOD)
mice results in the prevention of diabetes; however, the mechanisms involved remain unknown. In this study, we found that T cells in a macrophage-depleted environment lost their
ability to differentiate into cell-cytotoxic T cells, resulting in the prevention of autoimmune
diabetes, but these T cells regained their
cell-cytotoxic potential when returned to a macrophage-containing environment. To learn why T cells in a macrophage-depleted environment lose their ability to kill
cells, we examined the islet antigen-specific immune response and T cell activation in macrophage-depleted NOD mice. There was a shift in the immune
balance, a decrease in the T helper cell type 1 (Th1) immune response, and an increase in the
Th2 immune response, due to the reduced expression of the macrophage-derived cytokine
IL-12. As well, there was a deficit in T cell activation, evidenced by significant decreases in the
expression of Fas ligand and perforin. The administration of IL-12 substantially reversed the
prevention of diabetes in NOD mice conferred by macrophage depletion. We conclude that
macrophages play an essential role in the development and activation of
cell-cytotoxic T
cells that cause
cell destruction, resulting in autoimmune diabetes in NOD mice.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Insulin-dependent diabetes mellitus, also known as type I
diabetes, is a serious chronic childhood disorder caused
by the progressive loss of insulin-producing pancreatic cells, culminating in a state of hypoinsulinemia and hyperglycemia. Animal models used in the study of type I diabetes, such as the BioBreeding (BB)1 rat and the nonobese diabetic (NOD) mouse, have enhanced our understanding of
the pathogenic mechanisms of this disease. The diabetic
syndrome in these animals results from the destruction of
pancreatic
cells by cell-mediated immune responses.
Many studies have demonstrated the role of CD4+ and
CD8+ T cells in the development of autoimmune type I
diabetes in NOD mice (1). However, the role of macrophages in the pathogenesis of autoimmune diabetes in
these animals has not been well investigated. We and others
have shown that the major populations of cells infiltrating the islets during the early stage of insulitis in BB rats and NOD mice are macrophages and dendritic cells (13).
This infiltration precedes invasion of the islets by T lymphocytes, NK cells, and B lymphocytes (18). In addition,
electron microscopy has revealed that most of the single
cells present at an early stage of insulitis in BB rats are
macrophages (13). Intraperitoneal injections of silica, a
substance known to be toxic to macrophages, into cyclophosphamide (CY)-treated NOD mice or BB rats almost
completely prevents the development of diabetes and insulitis (19). This result suggests that macrophages play an
important role in the development of insulitis and diabetes
in NOD mice. However, the mechanisms involved in the
prevention of
cell destruction by the inactivation of macrophages in NOD mice remain unknown.
The purpose of this study is to determine the mechanisms involved in the prevention of T cell-mediated autoimmune diabetes in macrophage-depleted NOD mice.
We report that T cells in a macrophage-depleted environment lose their ability to differentiate into cell-cytotoxic T cells that can kill
cells. However, if these T cells are returned to an environment containing macrophages and/or
the macrophage-derived cytokine IL-12 for a sufficient period of time, they regain the ability to differentiate into
cell-cytotoxic cells. We conclude that macrophages are
primary contributors to the creation of the immune environment for the development and activation of
cell-specific Th1-type CD4+ T cells and CD8+ cytotoxic T cells
that cause autoimmune diabetes in NOD mice.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Animals.
NOD mice were originally obtained from Taconic Farms; NOD.scid mice were obtained from The Jackson Laboratory. The animals were bred and maintained under specific pathogen-free conditions and provided with sterile food and water ad libitum at the Animal Resource Centre, Faculty of Medicine, University of Calgary. Female NOD mice were used throughout the experiments, with the exception of the male animals used for the preparation of islets for transplantation. The use and care of the animals used in this study were approved by the Animal Care Committee, Faculty of Medicine, University of Calgary.Preparation and Administration of Liposomal Dichloromethylene Diphosphonate.
Phosphatidyl choline (86 mg; Lipoid GmbH, Ludwigshafen, Germany) and cholesterol (8 mg; Sigma Chemical Co., St. Louis, MO) were dissolved in chloroform as described previously (22). This solution was evaporated by rotation in a vacuum at 37°C and dispersed by mixing with 10 ml of PBS containing 2.5 g of Cl2MDP (a gift from Boehringer Mannheim GmBH). This mixture was sonicated for 3 min in a water bath sonicator at room temperature and then set aside for 2 h at room temperature. The resulting liposomes were centrifuged at 100,000 g for 30 min to remove the nonencapsulated Cl2MDP. The pellet was washed two to three times with PBS by centrifugation at 25,000 g for 30 min. The final liposomal dichloromethylene diphosphonate (lip-Cl2MDP) was suspended in 4 ml of PBS before use (22, 23).Treatment of NOD Mice with lip-Cl2MDP.
Female NOD mice were treated with lip-Cl2MDP (200 µl/mouse) by intraperitoneal administration once a week from 3 to 20 wk of age to deplete macrophages. As a control group, NOD mice were treated with PBS (200 µl/mouse). The incidence of diabetes was determined by measurement of urine glucose using Diastix (Miles, Etobicoke, ON, Canada) twice a week from 10 to 35 wk of age. Individual mice were classified as diabetic on the basis of positive glycosuria (>2) and hyperglycemia (blood glucose >16.7 mM) as described elsewhere (24).Flow Cytometric Analysis.
Splenocytes were isolated from lip-Cl2MDP- or PBS-treated NOD mice (2-3 mice/group) at 15 wk of age, as described previously (24). Splenocytes (1 × 106 cells) were incubated with Abs against B220, CD4, and CD8 (PharMingen) for 30 min at 4°C in staining buffer composed of PBS containing 1% FCS and 0.1% sodium azide. After washing, the cells were incubated with FITC-labeled secondary Ab (anti- rat IgG) for 30 min at 4°C. For Mac1+ and CD11c+ cell staining, FITC-labeled anti-Mac1 and PE-labeled anti-CD11c Ab were used. The cells were then washed twice with staining buffer and analyzed using a FACS®. For analysis of Fas ligand (FasL) and perforin expression, splenic T cells (106 cells), purified using a T cell column (R&D Systems) were stimulated with irradiated islets (40 islets) for 3 d in complete RPMI 1640 medium, containing 10% FCS, 10 mM Hepes buffer, 1 mM sodium pyruvate, 2 mM L-glutamine, 100 U/penicillin, 0.1 mg/ml streptomycin, and 0.05 mMIn Vitro T Cell Proliferation Assay.
Single cell splenocytes were prepared from 8-10-wk-old female NOD mice, and T cells were purified using a T cell column (R&D Systems). The T cells (5 × 105 cells) were cultured with irradiated splenocytes (5 × 105 cells) from PBS- or lip-Cl2MDP-treated NOD mice, as APCs, in the absence or presence of irradiated islets (4 × 104 cells) or glutamic acid carboxylase (GAD; 20 µg/ml) in 200 µl of complete RPMI medium in a 96-well microplate for 96 h. The cells were pulsed with [3H]thymidine (1 µCi/well) for the last 16-18 h of the incubation and then harvested. The incorporation of [3H]thymidine was measured by liquid scintillation counting.Adoptive Transfer of Splenocytes into NOD.scid Mice.
Splenocytes were isolated from lip-Cl2MDP- and PBS-treated, nondiabetic female NOD mice at 20 wk of age, as previously described (24). The splenocytes from each donor were injected intravenously (2 × 107 cells/recipient) into 6-8-wk-old NOD.scid mice. The development of diabetes was determined by measurement of urine and blood glucose from day 3 to day 90 after the transfer of splenocytes, as described above. As a positive control, splenocytes from acutely diabetic mice were injected into age-matched NOD.scid mice. For long-term observations, recipient mice were kept up to 20 wk after the transfer of splenocytes and the incidence of diabetes was determined by the measurement of urine and blood glucose. To determine whether long-term treatment with lip-Cl2MDP affects establishedTransplantation of NOD Mouse Islets into lip-Cl2MDP-treated NOD Mice.
Intact pancreatic islets were isolated from 4-wk-old male NOD mice as previously described (27). To determine whether cytotoxic T cells that can destroyReverse Transcriptase PCR Analysis of Cytokine Gene Expression.
Total RNA was extracted from the total splenocytes or purified splenic T cells of lip-Cl2MDP- and PBS-treated NOD mice with a T cell column (R&D Systems) using Trizol (GIBCO BRL) according to the manufacturer's protocol. For analysis of mRNA of FasL and perforin, purified T cells were activated with irradiated NOD islets for 72 h before the extraction of RNA. 3 µg of total RNA was used to synthesize cDNA using Superscript II reverse transcriptase (GIBCO BRL) and oligo(dT)12-18. PCR was performed using specific primers for various cytokine genes, as previously described (28). The upstream and downstream primers used were as follows: IL-2: sense, CTTGCCCAAGCAGGCCACAG, antisense, GAGCCTTATGTGTTGTAAGC; IFN-Quantitative ELISA of Cytokine Production.
Splenic T cells (106 cells) were prepared from 15-wk-old lip-Cl2MDP- or PBS-treated mice (3 mice/group). The cells were washed with serum-free RPMI 1640 medium and incubated for 48 h in anti-CD3 Ab (10 µg/ml)-coated wells or for 72 h with irradiated NOD islets in complete RPMI 1640 medium. The supernatant was collected and cytokine release was measured using a Quantikine ELISA kit (R&D Systems) according to the manufacturer's protocol (28).Administration of rIL-12.
Recombinant mouse IL-12 (R&D Systems) (0.4 µg/200 µl of PBS, containing 1% syngeneic NOD mouse serum, per mouse for 1 wk followed by 0.2 µg/200 µl of PBS per mouse for 3 wk) was administered intraperitoneally each day commencing at 9 wk of age, to NOD mice which had been treated with lip-Cl2MDP or PBS from 3 wk of age. Control groups of lip-Cl2MDP or PBS treated NOD mice received 200 µl of PBS, containing 1% syngeneic mouse serum, in place of IL-12 each day. The development of diabetes was monitored by measuring glycosuria (>2) every second day (24) and confirmed by the measurement of blood glucose (>16.7 mM) (25, 26).Histology.
The pancreata were removed from lip-Cl2MDP- and PBS-treated NOD mice killed at 25 wk of age. Pieces of each pancreas were fixed with 10% buffered formalin, embedded in paraffin, sectioned at 4.5 µM, and stained with hematoxylin and eosin.Statistical Analysis.
The statistical significance of differences between groups was analyzed by Student's t test. A level of P < 0.05 was accepted as significant. Data are expressed as means ± SD. ![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Previously, we found that the depletion of macrophages by treatment with silica prevents the development of diabetes in CY-treated NOD mice (19). First, to confirm that the depletion of macrophages prevents the development of diabetes and to determine whether lip-Cl2MDP has the same effect as silica on the prevention of diabetes in NOD mice, we treated NOD mice from 3 to 20 wk of age with lip-Cl2MDP, which specifically depletes macrophages (22, 29, 30). We then examined the cumulative incidence of diabetes by 35 wk of age. We found that none of the lip-Cl2MDP-treated NOD mice developed diabetes. In contrast, 80% (8 out of 10) of the PBS-treated control NOD mice developed diabetes by the same age (Fig. 1). We also examined the development of insulitis in the lip-Cl2MDP- and PBS-treated NOD mice at 25 wk of age. 91% of the examined islets from the lip-Cl2MDP-treated mice were intact (Table I, Fig. 2 A). In contrast, 88% of the examined islets from the PBS-treated control mice showed moderate to severe insulitis (Table I, Fig. 2 B). These results indicate that macrophages are an absolute requirement for the development of autoimmune diabetes in NOD mice.
|
|
|
It is known that the development of autoimmune diabetes in NOD mice is T cell mediated. To determine
whether macrophages are required for the development of
cell-cytotoxic T cells, we transfused splenocytes from either lip-Cl2MDP- or PBS-treated control NOD mice into
6-8-wk-old NOD.scid mice. None (0 out of 6) of the recipients of lip-Cl2MDP-treated NOD splenocytes developed diabetes, whereas 83% (5 out of 6) of the recipients of
splenocytes from PBS-treated control NOD mice became
diabetic within 8 wk of transfusion. Similarly, 100% (7 out
of 7) of the recipients of splenocytes from newly diabetic
NOD mice became diabetic by 9 wk after transfer of the splenocytes (Fig. 3).
|
To determine whether T lymphocytes in lip-Cl2MDP-
treated NOD mice can destroy pancreatic cells, we transplanted intact, syngeneic NOD mouse pancreatic islets into
the renal capsule of lip-Cl2MDP-treated NOD mice (20 wk
of age). A majority of the grafted islets remained intact >3 wk
after transplantation (Table II, Fig. 4 A). In contrast, most
of the syngeneic islets transplanted into age-matched, PBS-treated NOD mice were destroyed within 3 wk of transplantation (Table II, Fig. 4 B). These results indicate that
macrophages are required for the development of cytotoxic T cells that can cause
cell destruction in NOD mice.
|
|
To determine
whether splenic T cells from macrophage-depleted NOD
mice are able to recover their ability to differentiate into cell-cytotoxic T cells in the presence of macrophages, we
transfused splenocytes isolated from macrophage-depleted
NOD mice into NOD.scid mice and made observations for
a prolonged period of time (13-20 wk). None of the recipients developed diabetes earlier than 13 wk after splenocyte
transfer; however 71% (5 out of 7) developed diabetes between 14 and 17 wk after the transfusion (Fig. 5). In contrast, 86% (6 out of 7) of the recipients of splenocytes from
PBS-treated NOD mice became diabetic within 8 wk of
transfusion and 100% (5 out of 5) of the recipients of splenocytes from newly diabetic NOD mice became diabetic
within 7 wk of the transfusion (Fig. 5). This suggests that
prolonged exposure to the endogenous macrophages in
NOD.scid mice can provide the necessary immune environment required to differentiate the splenic T cells from macrophage-depleted mice into
cell-cytotoxic T cells.
|
To determine whether treatment with lip-Cl2MDP
alters the function of established cell-cytotoxic T cells in
NOD mice, we treated NOD mice with lip-Cl2MDP or
PBS, as a control, weekly for a short period (3 wk) and a
longer period (9 wk) at the age of ~20 wk (19-21 and
16-25 wk of age, respectively). These particular age ranges
were chosen because
cell-cytotoxic T cells have developed in NOD mice by around these ages. We isolated
splenic T cells from short-term or long-term PBS- or lip-Cl2MDP-treated NOD mice, transfused them into 6-8-wk-old NOD.scid mice, and examined the incidence of diabetes in the NOD.scid mice. We found no difference in the
incidence of diabetes between the NOD.scid recipients of T cells from PBS-treated NOD mice and the recipients of
T cells from lip-Cl2MDP-treated NOD mice (Table III).
In addition, no statistically significant difference was found
in the incidence of diabetes between NOD.scid recipients
of T cells from short-term lip-Cl2MDP-treated (3 wk) and
long-term lip-Cl2MDP-treated (9 wk) NOD mice. This result indicates that neither short- nor long-term treatment
with lip-Cl2MDP alters the function of established
cell-
cytotoxic T cells in NOD mice, since these T cells are able
to induce diabetes.
|
As Th1 development may be mediated by
macrophage-derived cytokines, particularly IL-12, we determined whether the depletion of macrophages would result in a change in the Th1 and Th2 immune responses by
examining the expression of cytokine mRNAs (IL-2 and
IFN- for the Th1 response and IL-4 and IL-10 for the
Th2 response) in the splenic T cells from lip-Cl2MDP- or
PBS-treated NOD mice. The expression of both IL-2 and
IFN-
mRNA was decreased in splenic T cells from lip-Cl2MDP-treated NOD mice as compared with that in
PBS-treated control NOD mice. In contrast, the expression of both IL-4 and IL-10 mRNA was increased in the
splenic T cells from lip-Cl2MDP-treated NOD mice as
compared with the expression in PBS-treated controls (Fig.
6 A).
|
To ascertain the islet antigen-specific cytokine secretion,
we activated splenic T cells isolated from lip-Cl2MDP- or
PBS-treated NOD mice using anti-CD3 Ab or NOD
mouse pancreatic islets, and measured the IFN- and IL-4
cytokine secretion. A low level of IFN-
secretion, but a
high level of IL-4 secretion, was found in lip-Cl2MDP-
treated NOD mice as compared with the levels in PBS-treated control NOD mice when the splenic T cells were
activated with anti-CD3 Ab (Fig. 6 C) or NOD mouse
pancreatic islets (Fig. 6 D). These results indicate that the
inactivation of macrophages in NOD mice results in a decrease in the Th1 immune response along with an increase
in a Th2-type immune response after both antigen-specific and nonspecific stimulation.
It has been found that the IL-12R2 subunit, but not
the IL-12R
1 subunit, is preferentially expressed in Th1-type CD4+ T cells (31). To determine whether there is any
change in the expression of the IL-12R
2 subunit in
splenic T cells from lip-Cl2MDP-treated NOD mice, we
examined the expression of the IL-12R in splenic T cells
from these mice and PBS-treated control NOD mice. The expression of the IL-12R
2 subunit was significantly decreased in lip-Cl2MDP-treated NOD mice as compared
with that in the PBS-treated control animals (Fig. 6 B).
This result supports the finding that the depletion of macrophages results in a decrease in the Th1 immune response
in NOD mice.
To determine whether there is any change in the number of immunocytes in the spleens from lip-Cl2MDP-treated NOD mice, FACS® analysis of immunocytes was carried out. Mac1+ cells were clearly decreased in lip-Cl2MDP-treated NOD mice. There was no significant difference in the number of B220-positive B cells or CD4+ T cells between lip-Cl2MDP- and PBS-treated NOD mice. The number of CD8+ T cells appears to have declined in the lip-Cl2MDP-treated NOD mice as compared with the PBS-treated control mice (15% in PBS-treated control mice versus 11% in lip-Cl2MDP-treated mice). However, there was no statistically significant difference (P > 0.05) between the macrophage-depleted and control animals (Table IV). Similarly, CD11c+ cells, a marker for dendritic cells, appear to have declined in lip-Cl2MDP-treated NOD mice (2.7%) as compared with PBS-treated control mice (3.6%). However, there was no statistically significant difference (P = 0.067) between the lip-Cl2MDP- and PBS-treated groups (Table IV).
|
To determine whether a shift in the immune
response of macrophage-depleted mice, specifically a decrease in the Th1 immune response and an increase in the
Th2 immune response, is due to changes in the macrophage-derived cytokine IL-12, we examined the expression
of IL-12 in splenic macrophages from lip-Cl2MDP- and
PBS-treated NOD mice using reverse transcriptase PCR
analysis. We found that the gene expression of IL-12 was
significantly decreased in the lip-Cl2MDP-treated NOD
mice as compared with that in the PBS-treated controls
(Fig. 7). In addition, the expression of other macrophage-derived cytokines, IL-1 and TNF-
, also were decreased
in the lip-Cl2MDP-treated NOD mice (Fig. 7). This result suggests that a shift from a Th1 immune response to Th2
immune response may be due to the decreased expression
of macrophage-derived cytokines, particularly IL-12.
|
The treatment of NOD mice with lip-Cl2MDP results in a significant decrease in the expression of the macrophage-derived cytokine IL-12 and in the decrease of Th1-type immune responses. To determine whether IL-12, which is known to play an important role in the induction of Th1-type immune responses, reverses the preventive effect of lip-Cl2MDP in NOD mice, we treated NOD mice with lip-Cl2MDP with or without IL-12. 43% (3 out of 7) of the IL-12 co-injected NOD mice developed diabetes, whereas none (0 out of 9) of the mice treated with lip-Cl2MDP alone developed the disease (Fig. 8). In contrast, 83% (5 out of 6) of the age-matched PBS-treated control mice (no lip-Cl2MDP treatment) that were injected with IL-12 developed diabetes by 8 wk after IL-12 injection (17 wk of age at the time of onset of diabetes). 60% (6 out of 10) of the mice that were treated with PBS alone developed diabetes by 22 wk of age (Fig. 8). These results indicate that IL-12 substantially reverses the preventive effect of lip-Cl2MDP in NOD mice, probably due to the induction of Th1-type immune responses.
|
One role of macrophages is the
processing and presentation of antigens to CD4+ helper T
cells in association with MHC class II molecules. If these
antigen-processing and presenting functions are decreased, then CD4+ T cell activation also would be reduced. Thus,
we determined the T cell proliferative response to islet
antigens and GAD, a well known cell autoantigen, in
the presence of irradiated splenocytes from either lip-Cl2MDP- or PBS-treated NOD mice. The T cell proliferative response against islets and GAD was significantly decreased in the presence of lip-Cl2MDP-treated splenocytes,
as compared with the response in the presence of PBS-treated splenocytes (Fig. 9). These results indicate that the
function of antigen presentation in macrophage-depleted
NOD mice is significantly impaired.
|
FasL and perforin are known to show increased expression in activated T cells (32). To determine whether there is any change in the expression level of FasL and perforin in the splenic T cells in macrophage-depleted NOD mice, we measured the mRNA expression of FasL and perforin in splenic T cells from lip-Cl2MDP-treated NOD mice after stimulation with NOD islets. We found a significant decrease in expression as compared with that in PBS-treated control NOD mice (Fig. 10 A). To confirm this result at the protein level, we analyzed the expression of FasL and perforin after activation with syngeneic NOD islets, using flow cytometry. We found that the expression of FasL and perforin in T cells were also significantly downregulated in lip-Cl2MDP- treated NOD mice as compared with PBS-treated control NOD mice (Fig. 10, B and C).
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Type I diabetes is a T cell-mediated autoimmune disease
found both in humans and in animal models. The role of T
cells in the pathogenesis of autoimmune type I diabetes in
NOD mice has been studied extensively (1). Activated
Th1-type CD4+ and CD8+ T cells are believed to kill cells by apoptosis induced by TNF-
-TNF-
receptor interactions (33) and Fas-FasL and/or perforin-granzyme pathways (1, 3). However, the mechanisms by which these cytotoxic T cells develop are not well understood. The depletion of macrophages results in the complete prevention
of T cell-mediated autoimmune type I diabetes in CY-treated NOD mice (19). Thus, it has been suggested that
macrophages play an important role in the pathogenesis of
autoimmune type I diabetes (3). However, the role of macrophages in the T cell-mediated autoimmune process has
not been elucidated.
The first question posed in this study was whether macrophages are required for the development of cytotoxic T
cells that can destroy cells. We transfused splenocytes
from macrophage-depleted NOD mice into NOD.scid
mice, and found that none of the recipients developed diabetes, whereas the majority of the NOD.scid recipients of
splenocytes from age-matched, PBS-treated control NOD
mice became diabetic within 8 wk of transfer. These results
clearly indicate that macrophages are an absolute requirement for the development of
cell-cytotoxic T cells in
NOD mice. Next, to determine whether T lymphocytes
from macrophage-depleted NOD mice can destroy pancreatic
cells, we transplanted insulitis-free islets into the
renal capsule of macrophage-depleted NOD mice at 20 wk
of age. The T cells in the macrophage-depleted NOD mice recipients did not destroy the transplanted islets, whereas
the T cells in age-matched control NOD mice recipients
destroyed the transplanted islet cells within 3 wk after
transplantation. These results confirm that T cells in a macrophage-depleted environment lose their ability to differentiate into cytotoxic T cells that can destroy pancreatic
cells.
The second question posed in this study was whether
long-term treatment of NOD mice with lip-Cl2MDP affects the established cell-cytotoxic T cells, resulting in a
loss of their ability to destroy
cells. To answer this question, we treated NOD mice with lip-Cl2MDP for a prolonged period (9 wk) after the development of
cell-cytotoxic T cells in these animals, and transfused T cells from
these mice into NOD.scid mice. We found that the transfused T cells were able to induce diabetes as did the T cells
from PBS-treated control NOD mice. This result indicates
that long-term treatment with lip-Cl2MDP does not alter
the function of the established
cell-cytotoxic T cells in
NOD mice.
Several reports have shown that lip-Cl2MDP selectively depletes macrophages without affecting nonphagocytic cells (22, 29, 30, 34). The large liposomes (>0.8 µm) used in this study are selectively phagocytosed by macrophages, whereas small liposomes (<0.2 µm) may be internalized by nonphagocytic cells. In fact, macrophages phagocytose lip-Cl2MDP, and the phospholipid bilayers of the liposomes are disrupted by lysosomal phospholipase. Cl2MDP is then released intracellularly, and kills macrophages by apoptosis. Therefore, only cell populations that possess both phagocytic activity and phospholipase can be affected. Thus, we cannot exclude the possibility that lip-Cl2MDP treatment may have some effect on a certain dendritic cell population, which possesses both a phagocytic function and lysosomal phospholipase. However, CD4+ and CD8+ T and B cells, which have neither a phagocytic function nor lysosomal phospholipase, are not affected by treatment with lip-Cl2MDP. It had been thought that free Cl2MDP released from dying macrophages may be toxic to other immune cells. However, free Cl2MDP is rapidly excreted by the kidneys (<10 min) (van Rooijen, N., unpublished observation). Furthermore, lip-Cl2MDP has a very short half-life in circulation and within body fluids, explaining why it does not affect nonphagocytic cells (35). Finally, the specific depletion of macrophages by lip-Cl2MDP treatment has been confirmed by immunocytochemical and electron microscopic methods and by functional assays (36, 37).
The third question posed in this study was whether T
cells from macrophage-depleted NOD mice would recover
their ability to differentiate into cytotoxic T cells when
transferred into a macrophage-containing environment. To
answer this question, we transfused splenocytes from macrophage-depleted NOD mice into NOD.scid mice (which
contain endogenous macrophages but lack T cells) and
monitored urine glucose for a prolonged time period. In
agreement with the previous experiment, none of the mice
became diabetic up to 13 wk after transfusion, but ~70%
became diabetic between 14 and 17 wk after the transfer of
splenocytes. This supports our findings that macrophages
are a major contributor to the creation of the immune environment required for the development of cell-cytotoxic T cells.
The fourth question posed in this study was why T cells
from a macrophage-depleted environment lose their ability
to destroy cells. One possible cause for the impaired capability of T cells to kill
cells in macrophage-depleted
NOD mice is a change in the finely tuned balance of
immunoregulatory T cells, involving a decrease in the Th1
immune response along with an increase in the Th2 immune response. As macrophage-derived IL-12 is a dominant factor in directing the development of Th1 cells, the
depletion of macrophages would be expected to impair the
production of IL-12 and suppress the Th1 immune response. It has been suggested that Th1-type T cells play a
pathogenic role in the autoimmune destruction of
cells in
autoimmune diabetes (12, 40), whereas Th2-type T
cells play a nondestructive or preventive role in the disease (12, 42). Thus, it is thought that the destruction of
cells may depend on which way the finely tuned balance of
immunoregulatory T cells (i.e., Th1- and Th2-type T cells)
and/or immunoregulatory cytokines (i.e., IFN-
and IL-2
secreted from Th1-type T cells or IL-4 secreted from Th2-type T cells) is tipped. If this balance is tipped in favor of
Th1-type effector T cells and/or their immune-activating cytokines, the autoimmune process leading to
cell
destruction may be enhanced. In contrast, Th2-type T cells
and/or their immunosuppressive cytokines may protect the
cells against immune-activating effector T cell-mediated
damage when the immune balance is tipped in their favor,
blocking the autoimmune destructive process. We found
that the level of IL-4 secreted from Th2-type T cells increased, whereas IFN-
secreted from Th1-type T cells decreased in macrophage-depleted NOD mice.
In addition, a recent study shows that the IL-12R2 subunit is preferentially expressed in Th1-type T cells, whereas
the IL-12R
1 subunit is expressed in both Th1- and Th2-type T cells (31). Therefore, we examined the expression of
IL-12R
2 in the splenic T cells to confirm our finding of a
decrease in the Th1 immune response in T cells from macrophage-depleted NOD mice. We found that the expression of IL-12R
2 was significantly decreased in these T
cells, as compared with the expression in the T cells of control NOD mice that were not depleted of macrophages.
Thus, the decrease in the Th1 immune response along with
an increase in the Th2 immune response in macrophage-depleted mice may be one major factor contributing to the
impairment of the capability of T cells to kill
cells.
The IL-12 expressed in macrophages is known to play an
important role in the development of Th1-type CD4+ T
cells, leading to a T cell-mediated immune response (45, 46). Therefore, we examined whether the decrease of the
Th1 immune response is due to the decrease of IL-12 expression in lip-Cl2MDP-treated NOD mice. We found
that the expression of IL-12 in macrophage-depleted NOD
mice was significantly decreased as compared with age-matched, control NOD mice. The fifth question posed in
this study was whether the administration of IL-12 would negate the protective effect of macrophage depletion in
NOD mice. We found that the administration of IL-12
substantially, but not completely, reversed the prevention
of diabetes in macrophage-depleted NOD mice. These results suggest that the downregulation of IL-12 indirectly
protects cells from destruction in macrophage-depleted NOD mice by changing the finely tuned balance of the
Th1/Th2 immune response.
We also considered other factors that might protect cells from destruction in macrophage-depleted mice. These
include macrophage-derived soluble mediators such as oxygen free radicals and other cytokines including IL-1
,
TNF-
, and IFN-
. We found that the expression of the
cytokines IL-1
, TNF-
, and IFN-
was significantly decreased in macrophage-depleted NOD mice as compared
with PBS-treated control NOD mice. These cytokines,
which are released from activated macrophages, are believed to be toxic to
cells (47). The toxic effect produced by activated macrophages on
cells is thought to be
mediated by the superoxide anion and hydrogen peroxide.
The
cell is very sensitive to the production of free radicals because islet cells exhibit very low free radical scavenging activity (51, 52). Cytokines produced by islet-infiltrating
macrophages may contribute to
cell damage by inducing
the production of oxygen free radicals in the islets (53, 54).
Our recent studies have shown that the viral infection of
cells results in the recruitment of macrophages into the pancreatic islets, and that the soluble mediators IL-1
, TNF-
,
and inducible nitric oxide synthase, known to be major factors produced by activated macrophages, contribute to the
destruction of
cells (55). Therefore, we cannot exclude
the possibility that the downregulation of these macrophage-derived soluble mediators also may play a role in the
protection of
cells in macrophage-depleted NOD mice.
A role of macrophages is the processing and presentation
of antigens to CD4+ helper T cells in association with
MHC class II molecules (56, 57). Activation of CD4+ T
cells can be through the processing and presentation of antigens by APCs. Therefore, the sixth question posed in this
study was whether depletion of macrophages would affect
the antigen-presenting function in NOD mice. We measured the T cell proliferation response to islet antigens and
GAD (a well-known cell autoantigen) in the presence of
splenocytes, as APCs, from macrophage-depleted or control
NOD mice. We found that the T cell proliferation response was significantly decreased when we used splenocytes from
macrophage-depleted NOD mice as APCs. This result suggests that the depletion of macrophages results in the downregulation of antigen-specific CD4+ T cell activation.
Recent studies have shown that activated CD8+ T cells
are capable of performing cytotoxic functions through the
use of perforin and granzymes as well as by the induction of
apoptosis through Fas-FasL interactions. Perforin-deficient
NOD mice showed a significantly decreased incidence of
diabetes and a delayed onset of the disease (58). In addition,
NODlpr/lpr mice, in which Fas is not expressed, do not develop diabetes or insulitis (59, 60). Thus, the final question
put forth in this study was whether the depletion of macrophages would influence the level of T cell activation. We
determined the level of expression of FasL and perforin in
splenic T cells from macrophage-depleted NOD mice. We
found that there was a significant decrease in the expression
of FasL and perforin in splenic T cells from lip-Cl2MDP- treated NOD mice as compared with PBS-treated controls.
These results suggest that macrophages are required for the
activation of the cytotoxic T cells that can destroy pancreatic cells. The precise mechanism for the involvement of
macrophages in T cell activation is not known. The IL-12
secreted by macrophages could activate Th1-type CD4+ T
cells, and subsequently, the IL-2 and IFN-
produced by
these activated CD4+ T cells may help with the maximal
activation of CD8+ T cells. The downregulation of islet
cell-specific T cell activation may be another major factor
contributing to the impairment of the capability of T cells
to kill
cells in macrophage-depleted NOD mice.
In conclusion, macrophages are primary contributors to
the creation of the immune environment for the development and activation of cytotoxic T cells that destroy pancreatic cells, resulting in the development of autoimmune diabetes in NOD mice.
![]() |
Footnotes |
---|
Address correspondence to Ji-Won Yoon, Laboratory of Viral Immunopathogenesis of Diabetes, Julia McFarlane Diabetes Research Centre, Faculty of Medicine, The University of Calgary, 3330 Hospital Dr. Northwest, Calgary, Alberta, Canada T2N 4N1. Phone: 403-220-4569; Fax: 403-270-7526; E-mail: yoon{at}acs.ucalgary.ca
Received for publication 1 May 1998 and in revised form 7 July 1998.
The authors gratefully acknowledge the excellent technical assistance of Ms. L. Bryant for FACS® analyses and the editorial assistance of Ms. Karen Clarke and Dr. A.L. Kyle.This work was supported by grants MA9584 and MTI3224 from the Medical Research Council of Canada to J.W. Yoon. J.W. Yoon is a Heritage Medical Scientist awardee of the Alberta Heritage Foundation for Medical Research.
Abbreviations used in this paper BB, BioBreeding; CY, cyclophosphamide; FasL, Fas ligand; GAD, glutamic acid decarboxylase; HPRT, hypoxanthine phosphoribosyl transferase; lip-Cl2MDP, liposomal dichloromethylene diphosphonate; NOD, nonobese diabetic.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Wong, F.S., and C.A. Janeway. 1997. The role of CD4+ and CD8+ T cells in type I diabetes in the NOD mouse. 7th Forum in Immunology. 327-332. |
2. | Delovitch, T.L., and S. Bhagirath. 1997. The nonobese diabetic mouse as a model of autoimmune diabetes: immune dysregulation gets the NOD. Immunity. 7: 727-738 [Medline]. |
3. |
Yoon, J.W.,
H.S. Jun, and
P.S. Santamaria.
1998.
Cellular
and molecular mechanisms for the initiation and progression
of ![]() |
4. |
Nagata, M., and
J.W. Yoon.
1992.
Studies on autoimmunity
for T-cell-mediated ![]() ![]() |
5. | Haskins, K., and M. McDuffie. 1990. Acceleration of diabetes in young NOD mice with a CD4+ islet-specific T cell clone. Science. 249: 1433-1436 [Medline]. |
6. | Haskins, K., M. Portas, B. Bradley, D. Wegmann, and K. Lafferty. 1988. T-lymphocyte clone specific for pancreatic islet antigen. Diabetes. 37: 1444-1448 [Abstract]. |
7. | Wong, S., L. Wen, I. Visintin, R.A. Flavell, and C.A. Janeway Jr.. 1996. CD8 T cell clones from young nonobese diabetic (NOD) islets can transfer rapid onset of diabetes in the absence of CD4 T cells. J. Exp. Med. 183: 67-76 [Abstract]. |
8. |
Nagata, M.,
P. Santamaria,
T. Kawamura,
T. Utsugi, and
J.W. Yoon.
1994.
Evidence for the role of CD8+ cytotoxic
T cells in the destruction of pancreatic beta cells in NOD
mice.
J. Immunol.
152:
2042-2050
|
9. | Utsugi, T., J.W. Yoon, B.J. Park, M. Imamura, N. Averil, S. Kawazu, and P. Santamaria. 1996. Major histocompatibility complex class I-restricted infiltration and destruction of pancreatic islets by NOD mouse-derived beta cell cytotoxic CD8+ T cell clones in vivo. Diabetes. 45: 1121-1131 [Abstract]. |
10. | Katz, J.D., B. Wang, K. Haskins, C. Benoist, and D. Mathis. 1993. Following a diabetogenic T cell from genesis through pathogenesis. Cell. 74: 1089-1100 [Medline]. |
11. |
Verdaguer, J.,
J.W. Yoon,
N. Averil,
T. Utsugi,
B.J. Park, and
P. Santamaria.
1996.
Acceleration of diabetes in NOD
mice expressing beta cell-cytotoxic T cell-derived TCR![]() |
12. | Katz, J.D., C. Benoist, and D. Mathis. 1995. T helper cell subsets in insulin-dependent diabetes. Science. 268: 1185-1190 [Medline]. |
13. | Kolb, H., G. Kantwerk, U. Treichel, T. Kurner, U. Kiesel, T. Hoppe, and V. Kolb-Bachofen. 1986. Prospective analysis of islet lesions in BB rats. Diabetologia. 29(Suppl. 1):A559. |
14. | Lee, K.U., M.K. Kim, K. Amano, C.Y. Pak, M.A. Jaworski, J.G. Mehta, and J.W. Yoon. 1989. Preferential infiltration of macrophages during early stages of insulitis in diabetes-prone BB rats. Diabetes. 37: 1053-1058 [Abstract]. |
15. | Voorbij, H.A.M., P.H.M. Jeucken, P.J. Kabel, M. DeHaan, and H.A. Drexhage. 1989. Dendritic cells and scavenger macrophages in pancreatic islets of prediabetic BB rats. Diabetes. 38: 1623-1629 [Abstract]. |
16. | Walker, R., A.J. Bone, A. Cooke, and J.D. Baird. 1988. Distinct macrophage subpopulations in pancreas of prediabetic BB/E rats: possible role for macrophages in pathogenesis of IDDM. Diabetes. 37: 1301-1304 [Abstract]. |
17. | Jasen, A., R. Homo-Delarche, H. Hooijkaas, P.J. Leenen, M. Dardenne, and H.A. Drexhage. 1994. Immunohistochemical characterization of monocyte-macrophages and dendritic cells involved in the initiation of insulitis and beta-cell destruction in NOD mice. Diabetes. 43: 667-675 [Abstract]. |
18. | Amano, K., and J.W. Yoon. 1990. Studies on autoimmunity for initiation of beta-cell destruction. V. Decrease of macrophage dependent T-effector cells and natural killer cytotoxicity in silica-treated BB rats. Diabetes. 39: 590-596 [Abstract]. |
19. | Lee, K.U., K. Amano, and J.W. Yoon. 1988. Evidence for initial involvement of macrophage in development of insulitis in NOD mice. Diabetes. 37: 989-991 [Abstract]. |
20. | Oschilewski, U., U. Kiesel, and H. Kolb. 1985. Administration of silica prevents diabetes in BB rats. Diabetes. 34: 197-199 [Abstract]. |
21. | Lee, K.U., C.Y. Pak, K. Amano, and J.W. Yoon. 1988. Prevention of lymphocytic thyroiditis and insulitis in diabetes-prone BB rats by the depletion of macrophages. Diabetologia. 31: 400-402 [Medline]. |
22. | van Rooijen, N., and A. Sanders. 1994. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J. Immunol. Methods. 174: 83-93 [Medline]. |
23. | Chung, Y.H., H.S. Jun, Y. Kang, K. Hirasawa, B.R. Lee, N. Van Rooijen, and J.W. Yoon. 1997. Role of macrophages and macrophage-derived cytokines in the pathogenesis of Kilham rat virus-induced diabetes in diabetes-resistant BB rats. J. Immunol. 159: 466-471 [Abstract]. |
24. |
Kawamura, T.,
M. Nagata,
T. Utsugi, and
J.W. Yoon.
1993.
Prevention of autoimmune type I diabetes by CD4+ suppressor T cells in superantigen-treated non-obese diabetic
mice.
J. Immunol.
151:
4362-4370
|
25. | Yoon, J.W., P.R. McClintock, T. Onodera, and A.L. Notkins. 1980. Virus-induced diabetes mellitus. XVIII. Inhibition by a nondiabetogenic variant of encephalomyocarditis virus. J. Exp. Med. 152: 878-892 [Abstract]. |
26. | Yoon, J.W., M.M. Rodriguez, C. Currier, and A. Notkins. 1982. Long-term complications of virus-induced diabetes mellitus in mice. Nature. 296: 566-569 [Medline]. |
27. | Utsugi, T., M. Nagata, T. Kawamura, and J.W. Yoon. 1994. Prevention of recurrent diabetes in syngeneic islet-transplanted NOD mice by transfusion of autoreactive T lymphocytes. Transplantation. 57: 1799-1804 [Medline]. |
28. | Han, H.S., H.S. Jun, T. Utsugi, and J.W. Yoon. 1996. A new type of CD4+ suppressor T cell completely prevents spontaneous autoimmune diabetes and recurrent diabetes in syngeneic islet-transplanted NOD mice. J. Autoimmunity. 9: 331-339 [Medline]. |
29. | Naito, M., N. Hirotaka, S. Kawano, H. Umezu, H. Zhu, H. Moriyama, T. Yamomoto, H. Takatsuka, and Y. Takei. 1996. Liposome-encapsulated dichloro-methylene diphosphonate induces macrophage apoptosis in vivo and in vitro. J. Leukocyte Biol. 60: 337-344 [Abstract]. |
30. | van Rooijen, N., A.M. Sanders, and T.K. van den Berg. 1996. Apoptosis of macrophages induced by liposome-mediated intracellular delivery of clodronate and propamidine. J. Immunol. Methods. 193: 93-99 [Medline]. |
31. |
Szabo, S.J.,
A.S. Dighe,
U. Gubler, and
K.M. Murphy.
1997.
Regulation of the IL-12R ![]() |
32. | Bretscher, P.. 1992. The two-signal model of lymphocyte activation twenty-one years later. Immunol. Today. 13: 74-76 [Medline]. |
33. |
Kurrer, M.O.,
S.V. Pakala,
H.L. Hanson, and
J.D. Katz.
1997.
![]() |
34. | van Rooijen, N., J. Bakker, and A.M. Sanders. 1997. Transient suppression of macrophage functions by liposome- encapsulated drugs. Trends Biotechnol. 15: 178-185 [Medline]. |
35. | van Rooijen, N., and A.M. Sanders. 1997. Elimination, blocking, and activation of macrophages: three of a kind? J. Leukocyte Biol. 62: 702-709 [Abstract]. |
36. | van Rooijen, N., and R. van Nieuwmegen. 1984. Elimination of phagocytic cells in the spleen after intravenous injection of liposome encapsulated dichloromethylene diphosphonate. An enzyme histochemical study. Cell Tissue Res. 238: 355-358 [Medline]. |
37. | van Rooijen, N., R. van Nieuwmegen, and E.W.A. Kamperdijk. 1985. Elimination of phagocytic cells in the spleen after intravenous injection of liposome encapsulated dichloromethylene diphosphonate. Ultra-structural aspects of elimination of marginal zone macrophages. Virchows Arch. B Cell Pathol. 49: 375-383 [Medline]. |
38. | Fraser, C.C., B.P. Chen, S. Webb, N. van Rooijen, and G. Kraal. 1990. Circulation of human hematopoietic cells in severe combined immunodeficient mice after Cl2MDP-liposome-mediated macrophage depletion. J. Immunol. Methods. 134: 153-161 [Medline]. |
39. |
Claassen, I.,
N. van Rooijen, and
E. Claassen.
1995.
A new
method for removal of mononuclear phagocytes from heterogeneous cell populations in vitro, using the liposome-mediated `suicide' technique.
Blood.
86:
183-192
|
40. | Liblau, R.S., S.M. Singer, and H.O. McDevitt. 1995. Th1 and Th2 CD4+ T cells in the pathogenesis of organ-specific autoimmune diseases. Immunol. Today. 16: 34-38 [Medline]. |
41. |
Zipris, D.,
D.L. Greiner,
S. Malkani,
B. Whalen,
J.P. Mordes, and
A.A. Rossini.
1996.
Cytokine gene expression
in islets and thyroids of BB rats: IFN-![]() |
42. | Rabinovitch, A.. 1994. Immunoregulatory and cytokine imbalances in the pathogenesis of IDDM: therapeutic intervention by immunostimulation? Diabetes. 43: 613-621 [Abstract]. |
43. | Fox, C.J., and J.S. Danska. 1997. IL-4 expression at the onset of islet inflammation predicts nondestructive insulitis in nonobese diabetic mice. J. Immunol. 158: 2414-2424 [Abstract]. |
44. | Cameron, M.J., G.A. Arreaza, P. Zucker, S.W. Chensue, R.M. Strieter, S. Chakrabart, and T.L. Delovitch. 1997. IL-4 prevents insulitis and insulin-dependent diabetes mellitus in nonobese diabetic mice by potentiation of regulatory T helper-2 cell function. J. Immunol. 159: 4686-4692 [Abstract]. |
45. | Trinchieri, G.. 1993. Interleukin-12 and its role in the generation of Th1 cells. Immunol. Today. 14: 335-337 [Medline]. |
46. | Kennedy, M.K., K.S. Picha, K.D. Shanebeck, D.M. Anderson, and K.H. Grabstein. 1994. Interleukin-12 regulates the proliferation of Th1, but not Th2 or Th0 clones. Eur. J. Immunol. 24: 2271-2278 [Medline]. |
47. | Pankewycz, O.G., J.X. Guan, and J.F. Benedict. 1995. Cytokines as mediators of autoimmune diabetes and diabetic complications. Endocrinol. Rev. 16: 164-176 [Abstract]. |
48. |
Mandrup-Poulsen, T.,
K. Bendtzen,
C. Dinarello, and
J. Nerup.
1987.
Human tumor-necrosis factor potentiates human interleukin 1-mediated rat pancreatic beta cell-cytotoxicity.
J. Immunol.
139:
4077-4082
|
49. |
Appels, B.,
V. Burkart,
M. Kantwerk-Funke,
J. Funda,
V. Kolb-Bachofen, and
H. Kolb.
1989.
Spontaneous cytotoxicity of macrophages against pancreatic islet cells.
J. Immunol.
142:
3803-3808
|
50. | Pukel, C., H. Baquerizo, and A. Rabinovitch. 1988. Destruction of rat islet cell monolayers by cytokines. Synergistic interactions of interferon-gamma, tumor necrosis factor, lymphotoxin, and interleukin-1. Diabetes. 37: 133-136 [Abstract]. |
51. | Faust, A., R. Kleemann, H. Rothe, and H. Kolb. 1996. Role
of macrophages and cytokines in ![]() |
52. | Asayama, K., N.W. Kooy, and I.M. Burr. 1986. Effect of vitamin E deficiency and selenium deficiency on insulin secretory reserve and free radical scavenging systems in islets; decrease of islet manganosuperoxide dismutase. J. Lab. Clin. Med. 107: 4559-4564 . |
53. |
Malaisse, W.J.,
F. Malaisse-Lagae,
A. Sener, and
D.G. Pipeleers.
1982.
Determinants of the selective toxicity of alloxan
to the pancreatic ![]() |
54. |
Corbett, J.A., and
M.L. McDaniel.
1992.
Does nitric oxide
mediate autoimmune destruction of ![]() |
55. | Hirasawa, K., H.S. Jun, K. Maeda, Y. Kawaguchi, S. Itagaki, T. Mikami, H.S. Baek, K. Doi, and J.W. Yoon. 1997. Possible role of macrophage-derived soluble mediators in the pathogenesis of EMC virus-induced diabetes in mice. J. Virol. 71: 4024-4031 [Abstract]. |
56. | Unuaue, E.R.. 1984. Antigen-presenting function of the macrophage. Annu. Rev. Immunol. 2: 395-428 [Medline]. |
57. | Unuaue, E.R., and P.M. Allen. 1987. The basis for the immunoregulatory role of macrophages and other accessory cells. Science. 236: 551-557 [Medline]. |
58. |
Kagi, D.,
B. Odermatt,
P. Seiler,
R.M. Zinkernagel,
T.W. Mak, and
H. Hengartner.
1997.
Reduced incidence and delayed onset of diabetes in perforin-deficient nonobese diabetic mice.
J. Exp. Med.
186:
989-997
|
59. |
Itoh, N.,
A. Imagawa,
T. Hanafusa,
M. Waguri,
K. Yamamoto,
H. Iwahashi,
M. Moriwaki,
H. Nakajima,
J. Miyagawa,
M. Namba, et al
.
1997.
Requirement of Fas for the
development of autoimmune diabetes in nonobese diabetic
mice.
J. Exp. Med.
186:
613-618
|
60. | Chervonsky, A.V., Y. Wang, F.S. Wong, I. Visintin, R.A. Flavell, C.A. Janeway Jr., and L. Matis. 1997. The role of Fas in autoimmune diabetes. Cell. 89: 17-24 [Medline]. |