1 Department of Medicine, The University of Chicago, 5841 South Maryland Avenue, Chicago, IL 60637, USA
2 Department of Human Genetics, The University of Chicago, 5841 South Maryland Avenue, Chicago, IL 60637, USA
3 Wellcome Trust Centre for Cell-Matrix Research, School of Biological Sciences, University of Manchester, 2.205 Stopford Building, Oxford Road, Manchester, M13 9PT, UK
* Author for correspondence (e-mail: emcnally{at}medicine.bsd.uchicago.edu)
Accepted 23 March 2004
![]() |
Summary |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Sarcoglycan, Dystrophin, Integrin, Membrane, Muscle
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In striated muscle, the sarcoglycan complex is intimately associated with dystrophin and dystroglycan to form the dystrophin glycoprotein complex (DGC) (Ervasti, 1993). Dystrophin mutations lead to Duchenne Muscular Dystrophy (DMD) and secondarily destabilize the sarcoglycan complex from the skeletal muscle plasma membrane (Rafael and Brown, 2000). In humans, mutations in sarcoglycan genes lead to a Duchenne-like muscular dystrophy (Bonnemann, 1996
; Hack et al., 2000a
). Gene targeting of murine sarcoglycan genes recapitulates the human muscular dystrophy phenotype where muscle degeneration is accompanied by muscle regeneration (Allamand and Campbell, 2000
; Heydemann et al., 2001
; Ozawa et al., 2001
). Both
- and
-sarcoglycan bind the cytoplasmic actin binding protein, filamin C (Thompson et al., 2000
). Moreover, mutations that disrupt sarcoglycan cause redistribution of filamin C. Sarcoglycan also stabilizes the interaction of dystroglycan subunits (Durbeej et al., 2000
; Straub et al., 1998
). Dystroglycan is a broadly expressed transmembrane protein with its
subunit binding directly to the G domains of laminin-
2 in the ECM and its ß subunit binding dystrophin in the cytoplasm (Henry and Campbell, 1999
). Biochemical preparations of the DGC from sarcoglycan mutant muscle reveal a less tightly adherent
-dystroglycan subunit suggesting abnormal interaction between
- and ß-dystroglycan in the absence of sarcoglycan (Durbeej et al., 2000
; Straub et al., 1998
). Additionally, the absence of sarcoglycan alters membrane integrity in that the muscle membrane becomes abnormally permeable to small molecular mass tracers such as Evans blue dye (EBD) (Hack et al., 1998
; Matsuda et al., 1995
; Straub et al., 1997
). Thus, the sarcoglycan-dystroglycan complex mediates at least two links to the cytoskeleton, to dystrophin and filamin C, and coordinates interaction with laminin
2 in the ECM. Like the integrin complex, the sarcoglycan-dystroglycan complex mediates interactions between the ECM and membrane cytoskeleton.
Upregulation of integrin 7ß1 has been observed in DMD muscle biopsies (Hodges et al., 1997
). A transgenic mouse model of integrin
7BX2 overexpression was bred with mice lacking dystrophin and utrophin where it ameliorated the severe phenotype seen in these mice (Burkin et al., 2001
). The presence of the integrin
7BX2 transgene on the dystrophin/utrophin mutant background reduced phagocytic cell infiltration and embryonic myosin heavy chain expression and improved lifespan (Burkin et al., 2001
). Upregulation of integrin
7 produced from the transgene was relatively modest and the mechanism by which this increase reduced muscular dystrophy was not known.
Because both integrin 7ß1 and the sarcoglycans are transmembrane proteins that mediate laminin interactions in muscle, upregulation of integrin may compensate for the loss of sarcoglycan. A conditional allele that targets the integrin ß1 gene in skeletal muscle results in late embryonic lethality (Schwander et al., 2003
). Integrin ß1 muscle displays delayed myoblast fusion and disorganized sarcomere structure. Dystroglycan, dystrophin and laminin
2 appear to be normally localized in integrin ß1 null muscle highlighting the importance of integrin complexes in muscle development. We found that integrin
7 was upregulated in mice lacking sarcoglycans. To determine whether integrin
7 upregulation is compensatory, we bred mice mutant for
-sarcoglycan (gsg/) with mice mutant for integrin
7 (Itg
7/) to create mice lacking both proteins (gxi). Double-mutant gxi mice die within one month of birth and examination of these mice showed pervasive muscle degeneration. gxi muscle showed more EBD uptake than gsg/ muscle indicating greater muscle degeneration. As loss of integrins may impair muscle regeneration, we determined that muscle regeneration was intact in gxi mice as gxi myoblasts showed normal in vitro and in vivo differentiation. These results argue that integrin and sarcoglycan have overlapping roles in maintaining muscle membrane stability and that integrin upregulation compensates for sarcoglycan loss.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Microsome preparation and immunoblotting
Heavy microsomes were purified as described (Ohlendieck and Campbell, 1991) with modifications (Duclos et al., 1998
; Hack et al., 2000b
). Microsomes were prepared from a minimum of three animals, using six distinct muscle groups from each animal (quadriceps, gastrocnemius, soleus, biceps, triceps and pectoralis). Microsomal protein content was determined for each sample using the BioRad (Hercules, CA) protein assay. Protein was subjected to denaturing and reducing conditions, resolved by SDS-PAGE using either 4-12% or 4-20% linear gradient gels (Novex, San Diego, CA) and transferred to Immobilon P membranes (Millipore, Bedford, MA). Equal loading was confirmed by Coomassie blue staining. Immunoblotting was performed as described previously (Hack et al., 1998
) with antibodies (listed below). Detection was performed with ECL-Plus (Amersham-Pharmacia, Piscataway, NJ) and visualized on film or using a Storm 860 (Molecular Dynamics, Sunnyvale, CA) and quantified using ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
For laminin 2 immunoblotting, laminin was extracted from muscle tissue essentially as described (Xu et al., 1994
). Briefly, 0.1 g (wet weight) of frozen quadriceps muscle was ground in liquid nitrogen and transferred into 1 ml extraction buffer without EDTA [150 mM NaCl, 50 mM Tris-HCl, pH 7.4 and protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany)]. This mixture was homogenized briefly and then centrifuged at 16,000 g for 15 minutes at 4°C. The supernatant was kept and frozen while the pellet was resuspended in 0.3 ml of extraction buffer with 10 mM EDTA and incubated on ice for 1 hour with periodic mixing. The mixture was centrifuged as before, and the supernatant was kept while the pellet was discarded. The protein content of the EDTA extract was quantified using the BioRad protein assay. 20 µg of protein was separated on 4-10% SDS/PAGE gradient gels under non-reducing conditions at 160V for approximately 20 hours and then transferred to Immobilon P membrane. The membrane was blocked in 10% dry milk in phosphate buffered saline with 0.1% Tween-20 and then incubated with polyclonal anti-laminin
2 at 1:500 (Ab 1301) (Kuang et al., 1998
) in fresh blocking buffer. Immunoreactive protein bands were visualized as described above.
Antibodies
Embryonic myosin heavy chain monoclonal antibody (F1.652) was obtained from the Developmental Studies Hybridoma Bank (Iowa City, IA). Integrin 7A (used at 1:2500) and
7B (used at 1:5000) affinity-purified polyclonal antibodies were previously described (Mayer et al., 1997
). The rabbit polyclonal antibody to dystrophin (AB6-10) was described previously (Lidov et al., 1990
) and used at a concentration of 1:1000. ß-dystroglycan was detected with NCL-b-DG (Novocastra, Newcastle upon Tyne, UK) and used at 1:50. The anti-skeletal muscle actin antibody was used at 1:1000 (Sigma-Aldrich, St Louis, MO), and the anti-integrin
5 antibody was used at 1:5000 for immunoblotting and 1:500 for immunostaining of acetone-fixed muscle sections (Chemicon, Temecula, CA). Secondary antibodies (Jackson ImmunoResearch, West Grove, PA) used were goat anti-rabbit conjugated to FITC (1:2500) for dystrophin, goat anti-mouse conjugated to Cy3 (1:2500) for embryonic myosin heavy chain, and goat anti-rabbit conjugated to horseradish peroxidase (1:2500).
Immunocytochemistry
Mice from representative genotypes were sacrificed, and skeletal muscle was dissected from gsg/, wild-type (WT), Itg7/ and gxi animals and frozen in liquid nitrogen-cooled isopentane. 7 µm sections were prepared using a cryostat at 20°C, fixed in ice-cold methanol for 2 minutes and blocked in a solution of phosphate buffered saline (PBS) with 5% fetal bovine serum (FBS) for one hour at room temperature (RT). Primary antibodies (see above) were diluted in blocking solution and incubated overnight at 4°C. Cy-3 and FITC-conjugated secondary antibodies (Jackson ImmunoResearch) were diluted in blocking solution at 1:2500 at RT for 2 hours. Sections were mounted with Vectashield containing DAPI (Vector Laboratories, Burlingame, CA) and photographed using a Zeiss Axiophot microscope equipped with an Axiocam (Carl Zeiss, Germany). Where double staining with a polyclonal and monoclonal antibody was necessary, serial sections were taken. In order to minimize the background caused by the anti-mouse secondary antibody, the mouse on mouse (MOM) immunodetection kit was used in conjunction with the avidin/biotin blocking kit (Vector Laboratories, Burlingame, CA). The experiment was carried out according to manufacturer's protocol.
Central nuclei quantification
Hematoxylin- and eosin-stained quadriceps sections of each genotype were analyzed for number of centralized nuclei. Sections from 6-12 animals were used for each genotype and two sections from each slide were counted. Eight random microscopic fields were analyzed per section, per slide. This resulted in 5000-7000 myofibers being analyzed per genotype.
Primary myoblast cultures
Primary myoblasts were isolated as described (Rando and Blau, 1997). Briefly, muscle was dissected from 1-3 day old mice and placed in PBS where it was minced using a razor blade. Approximately 2 ml collagenase/dispase/CaCl2 per gram of tissue was added and the mixture was incubated at 37°C for 30-45 minutes. This slurry was passed through an 80 µm nylon mesh filter and centrifuged for 5 minutes at 350 g. The pellet was resuspended in 8 ml F10-based primary myoblast growth medium and plated in a collagen-coated dish. The cells underwent a variable number of rounds of preplating to reduce fibroblast contamination and for enrichment of myoblasts. Differentiation was induced with Dulbecco's modified Eagle medium (DMEM) supplemented with 5% horse serum. Fusion indices were calculated as described (van der Putten et al., 2002
). Briefly, myoblast cultures were allowed to differentiate for 6 days prior to fusion index calculation. A minimum of six low-power microscopic fields was counted for each genotype. Fusion index was calculated as the number of nuclei in myotubes divided by the total number of nuclei. A myotube was defined as having three or more nuclei.
Phenotypic analysis, histology, terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and Evans blue staining
Animals were observed daily after birth for phenotypic abnormalities and identification of the gxi genotype. Tissues for histology were frozen in liquid nitrogen-cooled isopentane and cryosectioned, then placed directly in 10% neutral buffered formalin overnight. Tissues were then stained with hematoxylin and eosin (H&E) and Masson trichrome. TUNEL assays were performed on fixed, cryosectioned tissues using the ApoptagTM fluorescein kit (Intergen, Purchase, NY). Evans blue dye (EBD) (Sigma) staining of muscle in vivo was performed by injecting 5 µl EBD (10 mg/ml in PBS)/gram body weight intraperitoneally. Mice were sacrificed and skinned 10-12 hours after EBD injection. Approximately 1000-20,000 individual myofibers from quadriceps muscle were counted for each genotype for either presence or absence of EBD. All muscles were age-matched to 18-22 days.
Quantitative RT-PCR
Total RNA was prepared using 100 mg quadriceps tissue from each genotype. Frozen, powdered muscle was added directly to 1.5 ml Trizol reagent (Invitrogen, Carlsbad, CA). The mixture was homogenized through successively smaller needles (16, 18, 20 and 21 gauge). The remainder of the protocol followed the manufacturer's recommendations. 4 µg total RNA was added as a template for the Superscript II Reverse Transcription kit (Invitrogen, Carlsbad, CA). Following reverse transcription, 2 µl of a 1:4 dilution of each cDNA was used as a template for quantitative PCR using primers to integrin 7 (Itga7F GCTGATACCGCTGCTCTGTTC and Itga7R TCATGTTGGTGCTTCAGCCAC) and glyceraldehyde-3 phosphate dehydrogenase (G3PDH) G3PDHF ACCACAGTCCATGCCATCAC and G3PDHR TCCACCACCCTGTTGCTGTA. PCR was carried out using the DyNAmo SYBR Green qPCR kit using the manufacturer's recommended parameters (Finnzymes, Espoo, Finland) and an MJ Research Opticon Monitor. Cycle thresholds were determined for integrin
7 and GAPDH mRNA levels in wild-type and gsg/ muscle. The experiment was performed in duplicate.
Statistical methods
Comparisons between genotypic groups for EBD uptake, central nucleation and fusion indices were analyzed for statistical significance using GraphPad Instat 3.0 software. A nonparametric ANOVA Kruskal-Wallis test was followed by Dunn's multiple comparisons post-test to determine P values and significance.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Double-mutant (gxi) mice display early lethality
To determine if integrin 7 upregulation compensates for the absence of sarcoglycan, gsg/Itg
7/ double-mutant mice (gxi) were generated by crossing gsg+/Itg
7+/ mice. We chose
-sarcoglycan mice for this analysis as the defect in these mice derives wholly from a striated muscle-intrinsic defect, as opposed to a vascular smooth muscle defect as has been hypothesized for
-sarcoglycan null mice (Coral-Vazquez et al., 1999
). It was difficult to discern a phenotype in very young animals, as activity levels are very limited in all genotypes at this young age. By 10-14 days of age most gxi animals were smaller (Fig. 2A) than their littermates and began to display an abnormal `hopping' gait and evidence of kyphoscoliosis (see movie, http://jcs.biologists.org/supplemental/). In addition, gxi mice demonstrated little to no normal grooming behavior. The cervical-thoracic angle was more marked in gxi mice than in control mice (Fig. 2B). By 18-20 days after birth, all gxi animals were smaller and weighed about half as much as their littermates. The average lifespan of gxi mice was 21 days (Fig. 2C). gxi mice had reduced mobility in that their ability to walk on smooth surfaces was markedly compromised reflecting muscle weakness. Food and water were placed within reach of gxi mice, but despite this nearly all gxi mice died by 25 days of age.
|
Severe muscle degeneration results from loss of both integrin 7 and
-sarcoglycan
Histological examination of quadriceps skeletal muscle demonstrated a severe degenerative process in all muscle groups of gxi mice (Fig. 3). Muscular dystrophy is characterized by ongoing necrosis accompanied by regeneration giving rise to variation in myofiber size. An increase in the number of myofibers with centrally placed nuclei is consistent with regeneration. The degenerative process exceeds the regenerative potential so that replacement by connective and adipose tissue ensues. In dystrophin and sarcoglycan mutant muscle, the degenerative process is focal in nature. That is, normal-appearing areas of muscle are found neighboring foci of degeneration (Fig. 3, pale blue area, lower left panel). In contrast, gxi muscle showed widespread degeneration and virtually no normal-appearing areas of muscle in any of the muscle groups examined. Fig. 3 is representative of the typical appearance of gxi muscle with interspersed fibrosis seen throughout the myofibers. Age-matched normal muscle showed homogeneity in myofiber appearance, as did age-matched Itg7/ muscle, consistent with the very mild degenerative process associated with deletion of the Itg
7 locus (Fig. 3, upper panels).
|
Enhanced muscle degeneration in gxi mice
The severe muscular dystrophy in gxi muscle may arise from increased degeneration from lack of muscle membrane integrity or decreased regeneration, or a combination thereof. To distinguish these possibilities, we studied gxi mice using the vital tracer EBD. Normal muscle is impermeable to EBD whereas muscle that lacks sarcoglycan or dystrophin becomes abnormally permeable to this tracer (Matsuda et al., 1995). Since gxi mice do not survive beyond 21-25 days, we studied 21-day-old gxi mice and gsg/ mice and found significant uptake of EBD in gxi muscles and comparatively little EBD uptake in gsg/ muscle (Fig. 4). Normal mice and 3-week-old Itg
7/ mice show no EBD uptake grossly (data not shown) or microscopically (Fig. 4A, upper panels and Fig. 4B). The loss of both sarcoglycan and integrin
7 results in enhanced membrane permeability and degeneration.
|
To determine whether the major extracellular matrix attachment for integrin was present, we evaluated expression of laminin 2 (Fig. 5). Laminin
2 upregulation is seen in gsg/ muscle, and this increase may be functional as it can couple to the increased integrin
7 complex. As both integrin and sarcoglycan are absent in gxi mice, the upregulation of laminin
2 may be unable to function. In gxi muscle, scattered myofibers with decreased laminin
2 can be seen (asterisk, Fig. 5B) and are likely to represent those fibers undergoing degeneration. In both gxi and Itg
7/ muscle, ß-dystroglycan was upregulated. Since muscle degeneration is mild in Itg
7/ muscle, upregulation of ß-dystroglycan may be functional. Thus, in the setting of an intact sarcoglycan complex, as is present in Itg
7/ muscle, ß-dystroglycan upregulation may partially compensate for the loss of the integrin transmembrane linkage.
|
Regenerative properties of gxi muscle are intact
To evaluate whether doubly deficient gxi mice have impaired muscle regeneration, we quantified the number of central nuclei in the myofibers of each genotype since centrally placed nuclei indicate myofibers that have undergone regeneration. We found that gsg/ and gxi muscle had a statistically significant increase in centrally nucleated myofibers compared to either wild-type or Itg7/ muscle (Fig. 6). We also studied the expression of embryonic myosin heavy chain (eMyHC) as expression of this myosin isoform reflects myofiber regeneration. In gsg/ muscle, expression of eMyHC is noted surrounding regions of degeneration (Fig. 7A, lower left panel). In contrast, eMyHC expression was present diffusely throughout gxi muscle reflecting regeneration in concert with diffuse degeneration (Fig. 7A, lower right panel). This pattern parallels the widespread degeneration seen with histology and reflects the close coupling of degeneration and regeneration. Normal muscle displays no eMyHC expression and Itg
7/ muscle taken from young mice also does not express eMyHC (Fig. 7A, upper panels).
|
|
We evaluated the contribution of programmed cell death to the gxi phenotype with TUNEL labeling. An increase in TUNEL-positive nuclei characterizes dystrophin and sarcoglycan mutant muscle compared to normal muscle (Hack et al., 1998; Matsuda et al., 1995
). The number of TUNEL-positive nuclei appears insufficient to account for the degree of degeneration seen in sarcoglycan or dystrophin mutants, but the increase is nonetheless a consistent feature that occurs near regions of muscle degeneration. In gxi muscle, TUNEL-positive nuclei were seen dispersed throughout the entire muscle consistent with an enhanced and widespread degenerative process (Fig. 7B).
In vitro fusion is normal in gxi myoblasts
To evaluate myofiber regeneration in gxi muscle further, we cultured primary myoblasts from normal, gsg/, Itg7/ and gxi muscle. In each case myoblasts were cultured from neonatal mice and upon serum starvation showed normal properties of differentiation and fusion to myotubes. These differentiated cultures were immunostained using antibodies directed against both eMyHC (red) and dystrophin (green) as expression of these proteins reflects normal differentiation of myotubes in culture (Fig. 8A). Normal and mutant cultures from each of the genotypes were able to express eMyHC and dystrophin in developing myotubes, indicating that gxi mice retained the ability to regenerate damaged muscle. We determined the fusion index for each genotype to measure the timeframe of myotube development. We found no statistically significant difference between any of the genotypes examined consistent with intact regenerative potential of gxi myotubes (Fig. 8B).
|
Upregulation of integrin 5
Integrin 5 is highly expressed in developing myotubes and serves as the major fibronectin linkage for myofibers (Muschler and Horwitz, 1991
). We found that integrin
5 was increased in both dystrophin and sarcoglycan mutant mice (Fig. 9A). We examined the expression of integrin
5 in gxi,
-sarcoglycan and integrin
7 mutant muscle and found that integrin
5 was upregulated more in gxi compared to gsg/ muscle. Immunostaining of gsg/ and gxi muscle revealed that integrin
5 upregulation was seen in fibers positive for embryonic myosin heavy chain expression (Fig. 9D). In gxi muscle, the increase in integrin
5 expression was also seen in areas with increased connective tissue deposition as can be noted by the cluster of DAPI positive nuclei in the right hand side of the image taken from gxi muscle (Fig. 9D, lower right panel). As integrin
5 upregulation is generally not associated with mature myotubes, it is less likely to contribute to myofiber stability or instability in this model.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The severe phenotype seen in gxi double-mutant mice provides genetic evidence that integrin and sarcoglycan are parallel pathways for the maintenance of muscle membrane integrity. This point is underscored by recent work showing the phenotype of integrin ß1-null muscle. Integrin ß1-null muscle has aberrant sarcomere patterning and is defective in myofiber development despite normal expression and localization of dystroglycan, dystrophin and laminin-2 (Schwander et al., 2003). Therefore, it may be that sarcoglycan and integrin
7ß1 are compensatory proteins with regard to mature muscle membrane integrity but that integrin has a unique additional role in muscle development. Additional support for this assertion is the observed upregulation of the DGC protein
-sarcoglycan seen in integrin
7-deficient muscle as assayed by immunoblot (data not shown). Taken together, the available data seem to point to a functional redundancy between sarcoglycan and integrin for maintenance of muscle membrane integrity but not for actual fusion of myoblasts and development into myotubes. In the absence of both transmembrane linkages, widespread degeneration occurs. In dystrophin or sarcoglycan-deficient muscle, there is focal necrosis with normal-appearing muscle immediately adjacent to areas of muscle damage. In contrast, muscle damage is seen spread throughout gxi muscle with little evidence of spared areas of muscle. gxi double-mutant muscle showed marked EBD uptake consistent with enhanced muscle damage. The early lethality in gxi mice appears to be the result of muscle weakness itself and probably involves a decline in the function of respiratory muscles. Examination of the hearts from gxi mice did not reveal evidence of focal necrosis like that seen in older gsg/ mice (Heydemann et al., 2001
) (data not shown). In the case of gsg/ mice, cardiomyopathy typically develops by 6 months of age and often is associated with sudden unpredictable death probably arising from cardiac arrhythmias. In contrast, gxi mice appear unwell with reduced ambulation and an increased respiratory rate. The absence of overt cardiomyopathy may be explained because the mice do not survive long enough for focal degenerative cardiomyopathy to develop.
Within a myofiber, there may be regional roles for sarcoglycan and integrin in the maintenance of muscle membranes. Shear-type injury of muscle resulted in increased integrin expression at the ends of myofibers where integrins participate in forming myotendinous junctions. Shear stress that disrupted the long axis of the myofiber membrane produced upregulation of integrin and sarcoglycan, suggesting that these transmembrane linkages may both be important to lateral interactions of myofibers with the extracellular matrix and neighboring myofibers (Kaariainen et al., 2000; Kaariainen et al., 2001
). The severe phenotype in gxi mice may arise from a fully defective ECM attachment along the lateral aspects of myofibers, although based on the known functions of integrins and the hypothesized roles of sarcoglycan, downstream signaling is likely to be impaired. Normal signals, transmitted perhaps through the nucleus and gene expression, are unable to respond and repair in the face of the fully defective ECM connection.
In muscle development, the fusion of myoblasts to myotubes is associated with an increase in integrin expression, notably integrin 5ß1 (McDonald et al., 1995
). In mature muscle, integrin
7ß1 predominates (Crawley et al., 1997
), although integrin
5 may also be important for a fibronectin interaction that stabilizes muscle membrane integrity (Taverna et al., 1998
). We noted an increase in the fibronectin receptor, integrin
5, in sarcoglycan-deficient muscle. This receptor may also be capable of compensating for the loss of a functional sarcoglycan-dystrogycan unit, or alternatively, the increase in integrin
5 could be pathologic to muscle. Immunolocalization data demonstrated that integrin
5 expression is predominantly coincident with embryonic myosin heavy chain expression and therefore reflects regeneration. While it could be expected that gxi muscle derives its phenotype in part from ineffective regeneration, gxi muscle development does not appear significantly impaired since in vivo features of regeneration are normally present. Furthermore, in vitro myoblast fusion of gxi myoblast cultures was indistinguishable from normal muscle making ineffective regeneration unlikely to account for the severe muscle findings in gxi mice.
The compensatory role of integrin was suggested by recent work showing that overexpression of rat integrin 7ß1 can ameliorate the muscular dystrophy phenotype as well as increase the life span of mdx/utr/ DKO mice (Burkin et al., 2001
). Interestingly, only a modest upregulation of integrin subunits was necessary to produce this improvement in phenotype (2.3-fold upregulation of integrin
7B and 1.5-fold upregulation of ß1D integrin). Integrin
7ß1 RNA levels are upregulated in both mdx mice and human Duchenne and Becker muscular dystrophy patients (Hodges et al., 1997
). More recently, integrin
7B was shown to be upregulated in muscle fibers deficient in dystroglycan, despite dystrophin being present in some of the fibers (Cote et al., 2002
). The sarcoglycan complex is secondarily destabilized in dystrophin deficiency. Thus, it is likely that upregulation of integrin is compensating for the secondary loss of sarcoglycan in each of these cases.
The role of integrins as mechanosignaling molecules for cell adhesion has been established. Signals from extracellular matrix proteins such as laminin and fibronectin are transmitted through integrin complexes to intracellular proteins such as focal adhesion kinase (FAK) and phosphatidylinositol (PtdIns) 3-kinase (Howe et al., 2002; Schwartz, 2001
). Like the integrins, the sarcoglycan complex may participate in both mechanical and signaling roles at the plasma membrane. Supporting this, the cytoplasmic tails of
- and
-sarcoglycan have conserved tyrosine residues that can be phosphorylated. Furthermore, the cytoplasmic domains of
- and
-sarcoglycan bind filamin C (Thompson et al., 2000
). In other tissues, filamins have been shown to interact with integrin subunits, specifically to the ß1 subunit of integrin. Thus, filamin may be one of the signaling mechanisms onto which both integrins and sarcoglycans converge. The synthetic lethal phenotype produced by the combined sarcoglycan and integrin loss from the surface of myofibers highlights not only the downstream signaling mechanisms that may function in parallel between these two cellular attachments, but also emphasizes the extracellular component, laminin, with which each of these complexes interacts. These findings help elucidate the role of the sarcoglycan complex, drawing parallels to the integrin complex, in its role in cytoskeletal-membrane-matrix interactions.
![]() |
Acknowledgments |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Allamand, V. and Campbell, K. P. (2000). Animal models for muscular dystrophy: valuable tools for the development of therapies. Hum. Mol. Genet. 9, 2459-2467.
Bonnemann, C. G., McNally, E. M. and Kunkel, L. M. (1996). Beyond dystrophin: current progress in the muscular dystrophies. Curr. Opin. Pediatr. 8, 569-582.[Medline]
Burkin, D. J., Wallace, G. Q., Nicol, K. J., Kaufman, D. J. and Kaufman, S. J. (2001). Enhanced expression of the alpha 7 beta 1 integrin reduces muscular dystrophy and restores viability in dystrophic mice. J. Cell Biol. 152, 1207-1218.
Coral-Vazquez, R., Cohn, R. D., Moore, S. A., Hill, J. A., Weiss, R. M., Davisson, R. L., Straub, V., Barresi, R., Bansal, D., Hrstka, R. F. et al. (1999). Disruption of the sarcoglycan-sarcospan complex in vascular smooth muscle: a novel mechanism for cardiomyopathy and muscular dystrophy. Cell 98, 465-474.[Medline]
Cote, P. D., Moukhles, H. and Carbonetto, S. (2002). Dystroglycan is not required for localization of dystrophin, syntrophin, and neuronal nitric-oxide synthase at the sarcolemma but regulates integrin alpha 7B expression and caveolin-3 distribution. J. Biol. Chem. 277, 4672-4679.
Crawley, S., Farrell, E. M., Wang, W., Gu, M., Huang, H. Y., Huynh, V., Hodges, B. L., Cooper, D. N. and Kaufman, S. J. (1997). The alpha7beta1 integrin mediates adhesion and migration of skeletal myoblasts on laminin. Exp. Cell Res. 235, 274-286.[CrossRef][Medline]
Duclos, F., Straub, V., Moore, S. A., Venzke, D. P., Hrstka, R. F., Crosbie, R. H., Durbeej, M., Lebakken, C. S., Ettinger, A. J., van der Meulen, J. et al. (1998). Progressive muscular dystrophy in alpha-sarcoglycan-deficient mice. J. Cell Biol. 142, 1461-1471.
Durbeej, M., Cohn, R. D., Hrstka, R. F., Moore, S. A., Allamand, V., Davidson, B. L., Williamson, R. A. and Campbell, K. P. (2000). Disruption of the beta-sarcoglycan gene reveals pathogenetic complexity of limb-girdle muscular dystrophy type 2E. Mol. Cell 5, 141-151.[Medline]
Ervasti, J. M. and Campbell, K. P. (1993). A role for the dystrophin-glycoprotein complex as a transmembrane linker between laminin and actin. J. Cell Biol. 122, 809-823.[Abstract]
Fassler, R. and Meyer, M. (1995). Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev. 9, 1896-1908.[Abstract]
Hack, A. A., Ly, C. T., Jiang, F., Clendenin, C. J., Sigrist, K. S., Wollmann, R. L. and McNally, E. M. (1998). Gamma-sarcoglycan deficiency leads to muscle membrane defects and apoptosis independent of dystrophin. J. Cell Biol. 142, 1279-1287.
Hack, A. A., Groh, M. E. and McNally, E. M. (2000a). Sarcoglycans in muscular dystrophy. Microsc. Res. Tech. 48, 167-180.[CrossRef][Medline]
Hack, A. A., Lam, M. Y., Cordier, L., Shoturma, D. I., Ly, C. T., Hadhazy, M. A., Hadhazy, M. R., Sweeney, H. L. and McNally, E. M. (2000b). Differential requirement for individual sarcoglycans and dystrophin in the assembly and function of the dystrophin-glycoprotein complex. J. Cell Sci. 113, 2535-2544.
Harper, S. Q., Hauser, M. A., DelloRusso, C., Duan, D., Crawford, R. W., Phelps, S. F., Harper, H. A., Robinson, A. S., Engelhardt, J. F., Brooks, S. V. et al. (2002). Modular flexibility of dystrophin: implications for gene therapy of Duchenne muscular dystrophy. Nat. Med. 8, 253-261.[CrossRef][Medline]
Hayashi, Y. K., Chou, F. L., Engvall, E., Ogawa, M., Matsuda, C., Hirabayashi, S., Yokochi, K., Ziober, B. L., Kramer, R. H., Kaufman, S. J. et al. (1998). Mutations in the integrin alpha7 gene cause congenital myopathy. Nat. Genet. 19, 94-97.[Medline]
Henry, M. D. and Campbell, K. P. (1999). Dystroglycan inside and out. Curr. Opin. Cell Biol. 11, 602-607.[CrossRef][Medline]
Heydemann, A., Wheeler, M. T. and McNally, E. M. (2001). Cardiomyopathy in animal models of muscular dystrophy. Curr. Opin. Cardiol. 16, 211-217.[CrossRef][Medline]
Hirsch, E., Lohikangas, L., Gullberg, D., Johansson, S. and Fassler, R. (1998). Mouse myoblasts can fuse and form a normal sarcomere in the absence of beta1 integrin expression. J. Cell Sci. 111, 2397-2409.
Hodges, B. L., Hayashi, Y. K., Nonaka, I., Wang, W., Arahata, K. and Kaufman, S. J. (1997). Altered expression of the alpha7beta1 integrin in human and murine muscular dystrophies. J. Cell Sci. 110, 2873-2881.
Howe, A. K., Aplin, A. E. and Juliano, R. L. (2002). Anchorage-dependent ERK signaling mechanisms and consequences. Curr. Opin. Genet. Dev. 12, 30-35.[CrossRef][Medline]
Hynes, R. O. (1992). Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69, 11-25.[Medline]
Kaariainen, M., Kaariainen, J., Jarvinen, T. L., Nissinen, L., Heino, J., Jarvinen, M. and Kalimo, H. (2000). Integrin and dystrophin associated adhesion protein complexes during regeneration of shearing-type muscle injury. Neuromuscul. Disord. 10, 121-132.[CrossRef][Medline]
Kaariainen, M., Liljamo, T., Pelto-Huikko, M., Heino, J., Jarvinen, M. and Kalimo, H. (2001). Regulation of alpha7 integrin by mechanical stress during skeletal muscle regeneration. Neuromuscul. Disord. 11, 360-369.[CrossRef][Medline]
Kuang, W., Xu, H., Vachon, P. H., Liu, L., Loechel, F., Wewer, U. M. and Engvall, E. (1998). Merosin-deficient congenital muscular dystrophy: partial genetic correction in two mouse models. J. Clin. Invest. 102, 844-852.
Lidov, H. G., Byers, T. J., Watkins, S. C. and Kunkel, L. M. (1990). Localization of dystrophin to postsynaptic regions of central nervous system cortical neurons. Nature 348, 725-728.[CrossRef][Medline]
Matsuda, R., Nishikawa, A. and Tanaka, H. (1995). Visualization of dystrophic muscle fibers in mdx mouse by vital staining with Evans blue: evidence of apoptosis in dystrophin-deficient muscle. J. Biochem. (Tokyo) 118, 959-964.[Abstract]
Mayer, U., Saher, G., Fassler, R., Bornemann, A., Echtermeyer, F., von der Mark, H., Miosge, N., Poschl, E. and von der Mark, K. (1997). Absence of integrin alpha 7 causes a novel form of muscular dystrophy. Nat. Genet. 17, 318-323.[Medline]
McDonald, K. A., Lakonishok, M. and Horwitz, A. F. (1995). Alpha v and alpha 3 integrin subunits are associated with myofibrils during myofibrillogenesis. J. Cell Sci. 108, 2573-2581.
Muschler, J. L. and Horwitz, A. F. (1991). Down-regulation of the chicken alpha 5 beta 1 integrin fibronectin receptor during development. Development 113, 327-337.[Abstract]
Ohlendieck, K. and Campbell, K. P. (1991). Dystrophin-associated proteins are greatly reduced in skeletal muscle from mdx mice. J. Cell Biol. 115, 1685-1694.[Abstract]
Ozawa, E., Nishino, I. and Nonaka, I. (2001). Sarcolemmopathy: muscular dystrophies with cell membrane defects. Brain Pathol. 11, 218-230.[Medline]
Petrof, B. J., Shrager, J. B., Stedman, H. H., Kelly, A. M. and Sweeney, H. L. (1993). Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc. Natl. Acad. Sci. USA 90, 3710-3714.[Abstract]
Rafael, J. A. and Brown, S. C. (2000). Dystrophin and utrophin: genetic analyses of their role in skeletal muscle. Microsc. Res. Tech. 48, 155-166.[CrossRef][Medline]
Rando, T. A. and Blau, H. M. (1997). Methods for myoblast transplantation. Methods Cell Biol. 52, 261-272.[Medline]
Schwander, M., Leu, M., Stumm, M., Dorchies, O. M., Ruegg, U. T., Schittny, J. and Muller, U. (2003). Beta1 integrins regulate myoblast fusion and sarcomere assembly. Dev. Cell 4, 673-685.[Medline]
Schwartz, M. A. (2001). Integrin signaling revisited. Trends Cell Biol. 11, 466-470.[CrossRef][Medline]
Sicinski, P., Geng, Y., Ryder-Cook, A. S., Barnard, E. A., Darlison, M. G. and Barnard, P. J. (1989). The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 244, 1578-1580.[Medline]
Straub, V., Rafael, J. A., Chamberlain, J. S. and Campbell, K. P. (1997). Animal models for muscular dystrophy show different patterns of sarcolemmal disruption. J. Cell Biol. 139, 375-385.
Straub, V., Duclos, F., Venzke, D. P., Lee, J. C., Cutshall, S., Leveille, C. J. and Campbell, K. P. (1998). Molecular pathogenesis of muscle degeneration in the delta-sarcoglycan-deficient hamster. Am. J. Pathol. 153, 1623-1630.
Taverna, D., Disatnik, M. H., Rayburn, H., Bronson, R. T., Yang, J., Rando, T. A. and Hynes, R. O. (1998). Dystrophic muscle in mice chimeric for expression of alpha5 integrin. J. Cell Biol. 143, 849-859.
Thompson, T. G., Chan, Y. M., Hack, A. A., Brosius, M., Rajala, M., Lidov, H. G., McNally, E. M., Watkins, S. and Kunkel, L. M. (2000). Filamin 2 (FLN2): a muscle-specific sarcoglycan interacting protein. J. Cell Biol. 148, 115-126.
Vachon, P. H., Xu, H., Liu, L., Loechel, F., Hayashi, Y., Arahata, K., Reed, J. C., Wewer, U. M. and Engvall, E. (1997). Integrins (alpha7beta1) in muscle function and survival. Disrupted expression in merosin-deficient congenital muscular dystrophy. J. Clin. Invest. 100, 1870-1881.
van der Putten, H. H., Joosten, B. J., Klaren, P. H. and Everts, M. E. (2002). Uptake of tri-iodothyronine and thyroxine in myoblasts and myotubes of the embryonic heart cell line H9c2(2-1). J. Endocrinol. 175, 587-596.
von der Mark, H., Durr, J., Sonnenberg, A., von der Mark, K., Deutzmann, R. and Goodman, S. L. (1991). Skeletal myoblasts utilize a novel beta 1-series integrin and not alpha 6 beta 1 for binding to the E8 and T8 fragments of laminin. J. Biol. Chem. 266, 23593-23601.
Xu, H., Christmas, P., Wu, X. R., Wewer, U. M. and Engvall, E. (1994). Defective muscle basement membrane and lack of M-laminin in the dystrophic dy/dy mouse. Proc. Natl. Acad. Sci. USA 91, 5572-5576.[Abstract]