1 Department of Cell and Developmental Biology, Sackler School of Medicine, Tel Aviv University, Tel Aviv 69978, Israel
2 Fukuda Initiative Research Unit, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan
* Author for correspondence (e-mail: histol3{at}post.tau.ac.il)
Accepted 20 June 2003
![]() |
Summary |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Endocytic recycling compartment, Endocytosis, Synaptotagmin, Transferrin, RBL-2H3 mast cells
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
To begin exploring the role of non-neural Syt homologues, we have chosen to study the role of Syts in mast cells, specialized secretory cells that belong to the immune system. Indeed, we have previously demonstrated that rat basophilic leukemia (RBL-2H3, hereafter referred to as RBL) cells, a mucosal mast cell line, endogenously express at least three distinct Syt homologues including Syt II, Syt III and Syt V (Baram et al., 1999). Detailed analyses of Syt II and Syt III revealed that these isoforms are associated with distinct localizations and discrete functions in the RBL cells. Syt II is localized to a secretory lysosomal compartment where it functions to negatively regulate Ca2+-triggered exocytosis (Baram et al., 1999
) but positively regulate down-regulation of endosomal cargo, such as protein kinase C
(Peng et al., 2002
). Syt III is distributed between early endosomes and the secretory granules (SG), where it functions as a critical factor for the generation of the perinuclear endocytic recycling compartment (ERC) and the biogenesis of SG (Grimberg et al., 2003
). Therefore, unlike the neural Syts, non-neural Syts are non-redundant and are functionally associated with the control of distinct steps along exo- or endocytic pathways.
Here we extend our studies and show that RBL cells endogenously express Syt IX. We show that Syt IX is localized to the perinuclear ERC, binds tubulin and is required for the export of internalized transferrin (Tfn) from the ERC to the cell surface. We therefore propose that Syt IX may function to link exit from the recycling endosomes with the microtubules network.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Reagents
Fluorescein isothiocyanate (FITC)- or Texas red (TR)-conjugated human Tfn were obtained from Molecular Probes (Eugene, OR, USA). Brefeldin A, taxol, Glutathione-Sepharose, holo human Tfn and deferoxamine mesylate were from Sigma, protein A-Sepharose was from Amersham Biosciences and DEAE Dextran was from Amersham Pharmacia Biotech.
Cell culture
RBL and Cos-7 cells were maintained in adherent cultures in DMEM supplemented with 10% FCS in a humidified atmosphere of 5% CO2 at 37°C.
Reverse transcription and PCR amplification of Syt IX cDNA
Total RNA was isolated using the TRIzolTM Reagent (Life Technologies). cDNA was synthesized for 1 hour at 42°C followed by 5 minutes at 99°C, using the Promega Reverse Transcription System kit (Promega, Madison, WI, USA). The first round of nested PCR was performed using primers A and B (A: 5' GTACTTGGGTACCTCTGCAG 3'; B: 5' AGAGACTGGGAGAAAGGAGATCA 3') and 1 µl of the reverse transcription reaction as template. For the first round of PCR, 30 cycles of 1 minute at 94°C, 1 minute at 56°C and 1 minute at 72°C were performed. One µl of the PCR product obtained and primers C and D (C: 5' CGCGGATCCGCGATGTTCCCGGAACCCCCGA 3'; D: 5' GGAATCCCTCAGGGTGCAGGTATTGGC 3') were subsequently used for a second round of PCR identical to the first, except that the annealing temperature was 55°C. The product of the second reaction was purified by agarose gel electrophoresis and ligated into BamH1/EcoR1 sites of the pcDNA3 vector (Invitrogen, San Diego, CA, USA). DH5 cells were transformed with the ligation mixture and colonies selected for sequencing.
Construction of tagged Syt IX cDNAs
Construction of T7- or Flag-Syts was performed by PCR as described previously (Fukuda and Mikoshiba, 2000). Briefly, the sequences encoding the T7 or Flag tags were inserted into the 5'-end of each Syt cDNA. To generate Flag-Syt IX-GFP the sequences encoding the Flag tag were inserted into the 5'-end of Syt IX mouse cDNA, whereas the 3'-end was ligated to the 5'-end of GFP cDNA to endcode a fusion protein. A glycine linker was inserted between Syt IX and GFP as described previously (Saegusa et al., 2002
). The tagged cDNAs were subcloned into pEF-BOS or pShooter vector (Invitrogen) and verified by DNA sequencing.
Construction of GST fusion proteins
GST-Syt IX-C2A and GST-Syt IX-C2B were constructed by PCR. GST-Syt IX-C2A was constructed as described previously (Fukuda et al., 1996). GST-Syt IX-C2B was constructed using the sense primer 5' CGCGGATCCGCGAAAGAGGAGCAGGAGAAACT 3', the antisense primer 5' GGAATCCCTCAGGGTGCAGGTATTGGC 3' and RBL Syt IX cDNA as a template. The PCR product was subcloned into the BamH1/EcoR1 sites of the pGEX vector and transformed into TOP10 cells. Fusion proteins were induced by 1 mM IPTG at 30°C for 3 hours and immobilized on Glutathione-Sepharose beads.
Cell transfection
Stable transfection of RBL cells: RBL cells (8x106) were transfected with 20 µg of either recombinant vector (pcDNA3-Syt IX, pcDNA3-antisense-Syt IX or pShooter-Syt IX-GFP) or empty pcDNA3 vector by electroporation (0.25 V, 960 µF). Cells were immediately replated in tissue culture dishes containing growth medium (supplemented DMEM). G418 (1 mg/ml) was added 24 hours after transfection and stable transfectants selected within 14 days.
Transient transfection of RBL cells: RBL cells (6x107) were transfected with 40 µg of Rab 11-GFP cDNA (a generous gift from Dr M. Zerial, Max Plank Institute, Dresden, Germany) by electroporation (0.4 V, 960 µF). Cells were immediately replated in tissue culture dishes containing supplemented DMEM.
Transient transfection of Cos-7 cells: Cos-7 cells were cultured to 60% confluence and were transiently transfected using DEAE dextran/chloroquine methods with 10 µg of plasmid containing the appropriate cDNA (Aruffo and Seed, 1987).
Subcellular fractionation of RBL cells
RBL cells were serum-starved for 1 hour and incubated for 1 hour with biotin-conjugated Tfn (20 µg/ml). Cells were then fractionated as previously described (Baram et al., 1999). Briefly, RBL cells (7x107) were washed with PBS and suspended in homogenization buffer [0.25 M sucrose, 1 mM MgCl2, 800 U/ml DNase I (Sigma-Aldrich), 10 mM Hepes, pH 7.4, 1 mM PMSF, and a cocktail of protease inhibitors (Boehringer Mannheim, Germany)]. Cells were subsequently disrupted by 3 cycles of freezing and thawing, followed by 20 passages through a 21-gauge needle and 10 passages through a 25-gauge needle. Unbroken cells and nuclei were removed by centrifugation for 10 minutes at 500 g and the supernatants subjected to sequential filtering through 5- and 2-µm filters (Poretics). The final filtrate was then loaded onto a continuous, 0.45-2.0 M sucrose gradient (10 ml), which was layered over a 0.3 ml cushion of 70% (wt/wt) sucrose and centrifuged for 18 hours at 100,000 g.
Cell lysates
RBL or Cos-7 cells (1x107) were lysed in lysis buffer comprising 50 mM Hepes, pH 7.4, 150 mM NaCl, 10 mM EDTA, 2 mM EGTA, 1% Triton X-100, 0.1% SDS, 50 mM NaF, 10 mM NaPPi, 2 mM NaVO4, 1 mM PMSF and a cocktail of protease inhibitors (Boehringer Mannheim, Germany). Following 10 minutes incubation on ice, lysates were cleared by centrifugation at 9000 g for 15 minutes at 4°C. The cleared supernatants were mixed with 5x Laemmli sample buffer, boiled for 5 minutes and subjected to SDS-PAGE and immunoblotting as described previously (Baram et al., 1999).
Immunoprecipitation
Cells were lysed in buffer A [50 mM Hepes, pH 7.4, 150 mM NaCl, 1 mM MgCl2, 1% Triton X-100, 1 mM PMSF and a cocktail of protease inhibitors (Boehringer Mannheim, Germany)]. After solubilization at 4°C for 10 minutes, supernatants were cleared by centrifugation at 9000 g for 15 minutes at 4°C. Aliquots of cleared supernatants containing 500 µg protein were incubated for 18 hours at 4°C with the desired antibody. The immune complexes were captured by adding 25 µl of protein A-Sepharose (50% v/v) and incubating for 1.5 hours at 4°C. Immune complexes were washed four times with lysis buffer A, suspended in Laemmli sample buffer, boiled for 5 minutes, resolved by 10% SDS-PAGE under reducing conditions and transferred into nitrocellulose papers for Western blotting with the appropriate antibodies. Immunoblotting was performed as described previously, using the appropriate secondary antibodies. Immunoreactive bands were visualized by the enhanced chemiluminescence method according to manufacturer's instructions.
Affinity chromatography on GST fusion proteins
Cells were lysed in buffer A as described above. Aliquots of cleared supernatants containing 500 µg protein were incubated for 4 hours at 4°C with 20 µg of GST, GST-Syt IX-C2A or GST-Syt IX-C2B. At the end of the incubation period, beads were sedimented by centrifugation at 5000 g for 4 minutes at 4°C. Beads were washed 4 times with buffer A and finally suspended in 1x Laemmli sample buffer and boiled for 5 minutes and subjected to SDS-PAGE and immunoblotting.
Immunofluorescence microscopy
RBL cells (2x105 cells/ml) were grown on 12-mm round glass coverslips. For immunofluorescence processing cells were washed twice with PBS and fixed for 15 minutes at room temperature in 3% paraformaldehyde/PBS. Cells were subsequently washed three times with PBSCM (PBS supplemented with 1 mM CaCl2 and 1 mM MgCl2) and permeabilized on ice for 5 minutes with 100 µg/ml digitonin. After two washes with PBSCM, cells were permeabilized for an additional 15 minutes at room temperature with 0.1% saponin in PBSCM. Cells were subsequently incubated for 1 hour at room temperature with the primary antibodies diluted in PBSCM/5% FCS/2% BSA, washed 3 times in PBSCM/0.1% saponin and incubated for 30 minutes in the dark with the appropriate secondary antibody (Rhodamine- or FITC-conjugated donkey anti-rabbit or anti-mouse IgG, at 1/200 dilution in PBSCM/5% FCS/2% BSA). Coverslips were subsequently washed in PBSCM/0.1% saponin and mounted with Gel Mount mounting medium (Biomedica, Foster City, CA, USA). Samples were analyzed using a Zeiss laser confocal microscope (Oberkochen, Germany). The average fluorescence intensity was determined using the LSM image analysis software (Zeiss, Oberkochen, Germany).
Tfn internalization
RBL cells (mock or Syt IX sense or antisense cDNA transfected) were grown on glass coverslips, serum starved for 1 h at 37°C in DMEM supplemented with 0.2% BSA and 50 mM Hepes, pH 7.4, followed by 1 hour of incubation at 4°C with Texas Red or FITC-conjugated Tfn (50 µg/ml) to allow binding. Unbound Tfn was removed by washing with ice-cold PBS. To allow endocytosis the cells were transferred to 37°C for the desired time periods. The reaction was stopped by placing the cells on ice. Cells were subsequently processed for immunofluorescence as described above.
Tfn recycling
RBL cells (mock or Syt IX sense or antisense cDNA transfected) were grown on glass coverslips, serum starved for 1 hour in DMEM supplemented with 0.2% BSA and 50 mM Hepes, pH 7.4, followed by incubation with TR-Tfn (50 µg/ml) for 1 hour at 37°C. Cells were washed twice in PBS and unlabeled Tfn (100 µg/ml) and deferoxamine mesylate (100 µM) were added. At selected times, incubations were stopped by placing the dishes on ice and cells were processed for immunofluorescence as described above.
Data presentation
Data represent one of at least three separate experiments.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
To study the expression of Syt IX at the protein level we used an antibody generated against a sequence present at the amino terminal domain of Syt IX (anti-N-Syt IX) (Fukuda et al., 2002). The specificity of these antibodies was established by testing their immunoreactivity against epitope-tagged Syt isoforms that were transiently transfected into Cos-7 cells. Indeed, the anti-N-terminal antibodies decorated a 50 kDa protein that was expressed in Cos-7 cells transfected with either flag or T7-tagged-Syt IX cDNA (Fig. 2A). As expected, this 50 kDa protein could be detected on immunoblots probed with antibodies directed against the flag or T7 epitope, respectively (Fig. 2A). In contrast, the anti-N-terminal antibodies failed to exhibit any significant signal when used to probe lysates derived from mock transfected Cos-7 cells or from cells bearing other tagged Syt isoforms, including Syt I, Syt II, Syt III and Syt V (Fig. 2B).
|
The anti-N-Syt IX antibodies decorated three proteins of 50, 40 and 25 kDa, present in RBL cell lysates (Fig. 2C). Incubation of the antibodies with the antigenic peptide inhibited binding to all three proteins, thus indicating the specificity of binding (Fig. 2C). However, stable transfection with sense or antisense full-length Syt IX cDNAs respectively increased or decreased only the expression of the 50 and 40 kDa proteins, whereas the expression level of the 25 kDa protein remained unaltered (Fig. 2C). These results therefore confirmed that the 50 and 40 kDa immunoreactive proteins indeed corresponded to endogenously expressed Syt IX, however the 25 kDa protein is probably unrelated.
To validate further the identification of the 50/40 kDa proteins as Syt IX, RBL cells were probed with a second anti-Syt IX antibody that was raised against the C2A domain of Syt IX (anti-C2A-Syt IX) (Fukuda et al., 2002). This antibody failed to recognize any endogenous proteins (not shown), however it did bind to 50 and 40 kDa proteins present in Syt IX overexpressing cells (RBL-Syt IX+), although with some preferences for the 50 kDa protein (Fig. 2D). Finally, stable transfection of the RBL cells with a GFP tagged-version of Syt IX yielded the expression of two proteins of 80 and 70 kDa which could be immunoblotted by either anti-GFP, anti-N- or anti-C2A-Syt IX antibodies (Fig. 2E). Notably, in their GFP-tagged versions, both the larger and smaller forms of Syt IX were recognized by the anti-C2A-Syt IX antibodies (Fig. 2E). We do not currently know what causes this discrepancy, however, members of the Syt family undergo post-translational modifications (e.g. palmitoylation and O-glycosylation) which may affect Syt size and immunoreactivity.
Cellular distribution of Syt IX
Fractionation of RBL or RBL-Syt IX+ cells on continuous sucrose gradients revealed that the endogenous 50/40 kDa proteins, detected by the anti-N-Syt IX antibodies, as well as the overexpressed 50/40 kDa proteins, detected by the anti-C2A antibodies, comigrated with fractions 19-24, at 1.4 M sucrose (Fig. 3). These results therefore confirmed that both the endogenous and the overexpressed Syt IX protein(s) were targeted to the same cellular compartment. A small fraction of these proteins migrated at fractions 11-14 at
1 M sucrose (Fig. 3), which contain the plasma membrane (Grimberg et al., 2003
). In contrast, the 25 kDa protein that immunoreacted only with the anti-N-Syt IX antibodies comigrated with fractions 15-19 at 1.2 M sucrose (Fig. 3).
|
Consistent with previous results, fractions 19-24, which contain both the endogenous and the overexpressed Syt IX protein(s), also contained histamine and ß-hexosaminidase activity (not shown), suggesting that these fractions contain the SG (Baram et al., 1999; Grimberg et al., 2003
). However, probing the gradient fractions with the anti-G
i2 antibody demonstrated that fractions 19-24 also contained p100, the Gi-related protein, which we have previously shown to localize to the recycling endosomes (Traub et al., 1990
). Therefore, to confirm the association of recycling endosomes with these fractions, cells were allowed to internalize biotin-conjugated Tfn before fractionation on linear sucrose gradients. As shown in Fig. 3, biotin-Tfn was detected in 3 peaks. The first peak comigrated with light-density fractions that we have previously shown to contain the early endosomes (Grimberg at al., 2003
). The second peak colocalized with the plasma membrane, whereas the third peak comigrated with p100 as well as with the 50/40 kDa Syt IX immunoreactive proteins (Fig. 3). These results therefore suggested that Syt IX may localize to either the SG or the recycling endosomes.
Visualization of Syt IX localization
To identify the cellular compartment with which Syt IX was associated we used confocal microscopy and the anti-C2A antibodies that react specifically with Syt IX. As shown in Fig. 4A, these antibodies stained a major perinuclear structure and also faintly stained the plasma membrane of RBL-Syt IX+ cells. No granular pattern was detected, therefore excluding the SG as the site at which Syt IX resides. Notably, the anti-N-Syt IX antibodies also labeled a perinuclear structure in control RBL cells (Fig. 4B), consistent with the finding that the endogenous and overexpressed Syt IX colocalize (Fig. 3). However, these antibodies also labeled peripheral vesicles (Fig. 4B) that did not overlap with the SG marker serotonin (Fig. 4C), and their relevance to Syt IX is therefore currently uncertain.
|
We also investigated the localization of the GFP-tagged Syt IX protein in stably transfected RBL cells. Consistent with the localization of Syt IX in RBL-Syt IX+ cells, Syt IX-GFP, detected by either its GFP fluorescence (Fig. 4D) or by staining with the anti-C2A antibodies (Fig. 4E), was distributed between the plasma membrane and the perinuclear structure (Fig. 4D-F).
Association of Syt IX with the ERC
We have previously shown that in RBL cells the ERC, to which internalized Tfn is delivered from the early endosomes (EE), is a perinuclear structure (Peng et al., 2002; Grimberg et al., 2003
). Therefore we investigated whether Syt IX was localized to the ERC in the RBL cells. For this purpose, control and RBL-Syt IX+ cells were allowed to internalize FITC-conjugated Tfn (FITC-Tfn) to label the ERC and Syt IX was labeled with either the anti-N-Syt IX antibodies in the control cells or with anti-C2A antibodies in the RBL-Syt IX+ cells. As shown in Fig. 5, under these conditions internalized Tfn was delivered to a perinuclear structure where it significantly colocalized with Syt IX, stained with either antibody. Furthermore, Syt IX also colocalized with GFP-tagged Rab 11, a small GTPase known to associate with the ERC (Ren et al., 1998
; Sheff et al., 1999
; Trischler et al., 1999
; Sonnichsen et al., 2000
) (Fig. 5G-I).
|
To substantiate further the localization of Syt IX to the ERC rather than to the Golgi, we compared the effect of Brefeldin A (BFA), which causes collapse of the Golgi into the ER (Orci et al., 1991), on the localization of the Golgi marker mannosidase, Syt IX and internalized Tfn. Indeed, in sharp contrast to the Golgi enzyme mannosidase, whose perinuclear stain (Fig. 6C) was completely lost in BFA-treated cells (Fig. 6D), both Syt IX (Fig. 6A) and Tfn (Fig. 6E) also maintained their perinuclear localization in BFA-treated RBL cells (Fig. 6B,F).
|
Association of Syt IX with microtubules
ERC is made up of tubules assembled near the microtubule organizing center (MTOC) (Hopkins and Trowbridge, 1983). Indeed, double stain for Syt IX and tubulin demonstrated a complete overlap between the perinuclear localized Syt IX and the MTOC (Fig. 7A-D). Taxol treatment resulted in fragmentation of the MTOC and the concomitant formation of several tubulin clusters (Fig. 7F). In these cells, Syt IX translocated from its original perinuclear localization to the taxol-induced tubulin clusters (Fig. 7E,G). In marked contrast, both Tfn (Fig. 7I) and Rab 11 (Fig. 7J) were rather excluded from these taxol-formed tubulin clusters. These results therefore suggested that under conditions in which taxol treatment prevented transport and fusion of EE-derived vesicles with the ERC, Syt IX-containing membranes remained associated with stabilized tubulin clusters.
|
Syt IX associates with tubulin both in vitro and in vivo
The close association between Syt IX and microtubules in both non-treated as well as taxol-treated cells suggested that Syt IX was able to interact with tubulin. To investigate this possibility, GST fusion proteins comprising either the C2A or C2B domains of Syt IX were used as affinity matrices and their ability to pull down tubulin from an RBL cell extract was evaluated. Both the C2A and the C2B domains pulled down both ß (Fig. 8A) and tubulin (Fig. 8B) in this in vitro assay. This binding required no Ca2+, although Ca2+ significantly increased binding of tubulin by the C2A, but not the C2B domain (Fig. 8A,B). However, because only millimolar concentrations of Ca2+ affected tubulin binding to Syt IX-C2A, the physiological relevance of this finding is presently uncertain. Notably, neither the C2A nor the C2B domain of Syt IX bound any actin, suggesting that Syt IX may interact specifically with microtubules but not with microfilaments.
|
We could further demonstrate that Syt IX and tubulin co-immunoprecipitated from intact cells, thus indicating that Syt IX and tubulin also formed a complex in vivo. As shown in Fig. 9, an antibody directed against Syt IX was able to co-immunoprecipitate ß tubulin (Fig. 9B), and conversely, anti-ß tubulin co-immunoprecipitated Syt IX (Fig. 9C). This in vivo interaction did not require any Ca2+ and was not influenced by treating the cells with a Ca2+ ionophore (not shown).
|
Suppression of Syt IX slows recycling from the ERC
The localization of Syt IX to the ERC suggested that it might be involved in regulating transport to or from this compartment. To explore this possibility, we investigated if and how overexpression or suppression of Syt IX may affect the morphology, delivery to and export from the ERC. To this end we first monitored the internalization route of Texas Red-conjugated Tfn (TR-Tfn) in control (empty vector transfected), in Syt IX-overexpressing (RBL-Syt IX+) and in Syt IX-suppressed (RBL-Syt IX) cells. Following 1 hour of incubation at 4°C, TR-Tfn was bound to the cell surface of all three cell-types (Fig. 10A-C), indicating that binding to the membranal Tfn receptor was not affected. To permit endocytosis the cells were warmed up and the uptake of Tfn was monitored. After 5 minutes of uptake, significant amounts of TR-Tfn were localized to small vesicles scattered throughout the cytoplasm in all three cell-types (Fig. 10D-F). These results therefore suggested that Syt IX was not required for the internalization of Tfn into the EE. After 30 minutes of uptake, most of TR-Tfn was found clustered around the cell nucleus (Fig. 10G-I), suggesting that Syt IX did not affect delivery to the ERC. Indeed, GFP-tagged Rab 11 transiently transfected into control, RBL-Syt IX+ or RBL-Syt IX cells, localized to the perinuclear region in all cell types (not shown). Therefore modulation of Syt IX expression had no impact on the morphology or formation of the ERC.
|
Next we examined whether Syt IX affected the recycling of Tfn from the ERC to the cell surface. For this purpose, control, RBL-Syt IX+ and RBL-Syt IX cells were allowed to internalize TR-Tfn for 1 hour. The cells were subsequently washed and subjected to a chase in the presence of an excess of unlabeled Tfn. After a 30-minute chase, TR-Tfn was almost completely absent from both the control (Fig. 11E) and the RBL-Syt IX+ cells (Fig. 11F). In sharp contrast, in the RBL-Syt IX cells a large amount of TR-Tfn was retained (Fig. 11D). After a 1-hour chase most of TR-Tfn was also lost from the RBL-Syt IX cells (Fig. 11G). Quantitative analysis of the average fluorescence intensity per cell for more than 100 cells revealed that 30% of the total TR-Tfn were retained in RBL-Syt IX cells at the end of the 30-minute chase, as opposed to only 15% that were retained in control and RBL-Syt IX+ cells (Fig. 12). At the end of a 1-hour chase, 10-14% of Tfn were retained in all three cell-types (Fig. 12). These results therefore indicated that suppression of Syt IX substantially slowed the recycling of internalized Tfn from the ERC to the cell surface.
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
To characterize Syt IX at the protein level we used two antibodies that react specifically with Syt IX, one directed against an N-terminal sequence and the second against the C2A domain (Fukuda et al., 2002). The first antibody bound to three proteins (50, 40 and 25 kDa) present in RBL cells lysates (Fig. 2). However, although binding to all three proteins was specific and could be displaced by incubating the antibody with the immunizing peptide, only the expression level of the 50 and 40 kDa proteins was modulated upon transfecting the RBL cells with sense or antisense Syt IX cDNA, therefore questioning the relevance of the 25 kDa immunoreactive protein to Syt IX (Fig. 2).
The second anti-C2A antibody failed to detect the endogenous Syt IX, but did recognize the overexpressed 50 and 40 kDa proteins present in Syt IX-overexpressing cells (Fig. 2), therefore further supporting the notion that the 25 kDa immunoreactive protein is probably unrelated to Syt IX. Whether the 50 and 40 kDa immunoreactive proteins represent two differently post-translationally modified forms of Syt IX or whether the 40 kDa is a degradation product is presently unknown.
Because of the cross-reactivity of the anti-N-Syt IX antibodies with the 25 kDa Syt IX-unrelated protein, it was necessary to use the anti-C2A antibodies and Syt IX-overexpressing cells (RBL-Syt IX+) to define the cellular localization of Syt IX. Therefore we first investigated whether the overexpressed and the endogenous Syt IX protein(s) were indeed targeted to the same intracellular localization. This was achieved by fractionating control and RBL-Syt IX+ cells on linear sucrose gradients and comparing the migration of the 50/40 kDa proteins recognized by the anti-N-ter antibodies in control cells with that of the 50/40 kDa proteins recognized by the anti-C2A antibodies in the RBL-Syt IX+ cells. Indeed, this analysis confirmed that both the transfected and the endogenous Syt IX are associated with similar fractions that also contain the SG and the recycling endosomes (Fig. 3). However, visualization of Syt IX using the anti-C2A antibodies revealed that Syt IX localizes mainly to a single perinuclear structure where it significantly overlaps with both internalized Tfn and Rab11 rather than with serotonin-containing vesicles (Fig. 4). Hence, in marked contrast to Syt IX localization in PC12 cells where it localizes to the dense-core secretory vesicles (Fukuda et al., 2002), in RBL cells Syt IX localizes to the ERC. In the RBL-Syt IX+ cells, Syt IX was also detected at the plasma membrane (Figs 3, 4). This observation raises the possibility that the plasma membrane is an intermediate in the biosynthetic route of Syt IX, or that Syt IX function involves cycling between the ERC and the cell surface.
The ERC that is involved in receptor and lipid recycling (Nichols et al., 2001) is characterized by its tubulovesicular morphology and dependence on intact microtubules for localization (Hopkins and Trowbridge, 1983
). In particular, the perinuclear endocytic recycling compartment is clustered around the centrosome, where it is tightly associated with the MTOC. Indeed, Syt IX also colocalizes with tubulin at the MTOC (Fig. 7). Moreover, several observations indicate that Syt IX is tightly associated with tubulin. First, Syt IX remains associated with tubulin clusters formed in taxol-treated cells (Fig. 7). This is in sharp contrast to Tfn or Rab 11 that are rather excluded from tubulin in taxol-treated cells (Fig. 7). Second, Syt IX co-immunoprecipitates with tubulin from intact cells (Fig. 9), and finally, chimeric GST fusion proteins, comprising the C2A or C2B domains of Syt IX, bind tubulin in pull-down assays (Fig. 8). Thus, unlike Syt I, which requires Ca2+ concentrations in the millimolar range to bind tubulin (Honda et al., 2002
), Ca2+ is not required for tubulin binding by Syt IX. However, it is important to note that although our data clearly establish an association between Syt IX and tubulin, this association might be indirect and involve intervention by as yet unidentified adaptor proteins.
The localization of Syt IX to the ERC and its ability to associate with tubulin have raised the possibility that Syt IX might play a role in linking or coordinating ERC-dependent transport with the microtubules. Previous studies have demonstrated that the export of cargo from the ERC to the cell surface depends on microtubules (Lin et al., 2002). This, together with our observation that in overexpressing cells Syt IX can also be detected at the plasma membrane, therefore suggested that Syt IX may control microtubules-dependent recycling from the ERC. To explore this possibility we compared the recycling process of internalized Tfn in control, RBL-Syt IX+ and RBL-Syt IX cells. Our results provide unequivocal evidence for an active role for Syt IX in controlling the export from the ERC to the cell surface. We demonstrate that suppression of Syt IX by 90% by stable transfection with Syt IX antisense cDNA significantly decreases the rate of Tfn recycling (Figs 11, 12). Notably, this effect is specific as neither internalization of Tfn from the plasma membrane to the EE, nor the delivery of Tfn or recruitment of Rab 11 to the ERC are affected by Syt IX suppression. This is in marked contrast to Syt III, whose suppression prevented Tfn and Rab 11 from reaching the ERC (Grimberg et al., 2003
). Based on the active role of Syt IX in controlling export from the ERC together with its ability to associate with tubulin, we hypothesize that Syt IX may play a role in linking ERC-dependent transport with the microtubules.
In conclusion, our results provide further support for the notion that non-neural Syts display distinct cellular localizations and unique functions. Specifically, we have previously shown that Syt III regulates delivery of internalized Tfn from the EE to the ERC (Grimberg et al., 2003), and we now show that Syt IX regulates the export of internalized Tfn from the ERC to the cell surface.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Aruffo, A. and Seed, B. (1987). Molecular cloning of a CD28 cDNA by the high-efficiency COS cell expression system. Proc. Natl. Acad. Sci. USA 84, 8573-8577.[Abstract]
Baram, D., Adachi, R., Medalia, O., Tuvim, M., Dickey, B., Mekori, Y. and Sagi-Eisenberg, R. (1999). Synaptotagmin II negatively regulates Ca2+-triggered exocytosis of lysosomes in mast cells. J. Exp. Med. 189, 1649-1658.
Chapman, E. R. (2002). Synaptotagmin: a Ca2+ sensor that triggers exocytosis? Nat. Rev. Mol. Cell Biol. 3, 498-508.[CrossRef][Medline]
Craxton, M. and Goedert, M. (1995). Synaptotagmin V: a novel synaptotagmin isoform expressed in rat brain. FEBS Lett. 361, 196-200.[CrossRef][Medline]
Fukuda, M. and Mikoshiba, K. (2000). Distinct self-oligomerization activities of synaptotagmin family: unique calcium-dependent oligomerization properties of synaptotagmin VII. J. Biol. Chem. 275, 28180-28185.
Fukuda, M. and Mikoshiba, K. (2001). Characterization of KIAA1427 protein as an atypical synaptotagmin (Syt XIII). Biochem. J. 354, 249-257.[CrossRef][Medline]
Fukuda, M., Kanno, E. and Mikoshiba, K. (1999). Conserved N-terminal cysteine motif is essential for homo- and heterodimer formation of synaptotagmins III, V, VI, and X. J. Biol. Chem. 274, 31421-31427.
Fukuda, M., Kojima, T. and Mikoshiba, K. (1996). Phospholipid composition dependence of Ca2+-dependent phospholipid binding to the C2A domain of synaptotagmin IV. J. Biol. Chem. 271, 8430-8434.
Fukuda, M., Kowalchyk, J. A., Zhang, X., Martin, T. F. and Mikoshiba, K. (2002). Synaptotagmin IX regulates Ca2+-dependent secretion in PC12 cells. J. Biol. Chem. 277, 4601-4604.
Grimberg, E., Peng, Z., Hammel, I. and Sagi-Eisenberg, R. (2003). Synaptotagmin III is a critical factor for the formation of the perinuclear endocytic recycling compartment and determination of secretory granules size. J. Cell Sci. 116, 145-154.
Honda, A., Yamada, M., Saisu, H., Takahashi, H., Mori, K. J. and Abe, T. (2002). Direct Ca2+-dependent interaction between tubulin and synaptotagmin I: a possible mechanism for attaching synaptic vesicles to microtubules. J. Biol. Chem. 277, 20234-20242.
Hopkins, C. R. and Trowbridge, I. S. (1983). Internalization and processing of transferrin and the transferrin receptor in human carcinoma A431 cells. J. Cell Biol. 97, 508-521.[Abstract]
Hudson, A. W. and Birnbaum, M. J. (1995). Identification of a nonneuronal isoform of synaptotagmin. Proc. Natl. Acad. Sci. USA 92, 5895-5899.
Li, C., Ullrich, B., Zhang, J. Z., Anderson, R. G. W., Brose, N. and Sudhof, T. C. (1995). Ca(2+)-dependent and -independent activities of neural and non-neural synaptotagmins. Nature 375, 594-599.[CrossRef][Medline]
Lin, S. X., Gundersen, G. G. and Maxfield, F. R. (2002). Export from pericentriolar endocytic recycling compartment to cell surface depends on stable, detyrosinated (glu) microtubules and kinesin. Mol. Biol. Cell 13, 96-109.
Nichols, B. J., Kenworthy, A. K., Polishchuk, R. S., Lodge, R., Roberts, H., Hirschberg, K., Phair, R. D. and Lippincott-Schwartz, J. (2001). Rapid cycling of lipid raft markers between the cell surface and Golgi complex. J. Cell Biol. 153, 529-541.
Orci, L., Tagaya, M., Amherdt, M., Perrelet, A., Donaldson, J., Lippincott-Schwartz, J., Klausner, R. D. and Rothman, J. E. (1991). Brefeldin A, a drug that blocks secretion, prevents the assembly of non-clathrin-coated buds on Golgi cisternae. Cell 64, 1183-1195.[Medline]
Peng, Z., Grimberg, E. and Sagi-Eisenberg, R. (2002). Suppression of Synaptotagmin II restrains phorbol ester-induced down-regulation of protein kinase C by diverting the kinase from a degradative pathway to the recycling endocytic compartment. J. Cell Sci. 115, 3083-3092.
Ren, M., Xu, G., Zeng, J., De, L. C. C., Adesnik, M. and Sabatini, D. D. (1998). Hydrolysis of GTP on rab11 is required for the direct delivery of transferrin from the pericentriolar recycling compartment to the cell surface but not from sorting endosomes. Proc. Natl. Acad. Sci. USA 95, 6187-6192.
Saegusa, C., Fukuda, M. and Mikoshiba, K. (2002). Synaptotagmin V is targeted to dense-core vesicles that undergo calcium-dependent exocytosis in PC12 cells. J. Biol. Chem. 277, 24499-24505.
Sheff, D. R., Daro, E. A., Hull, M. and Mellman, I. (1999). The receptor recycling pathway contains two distinct populations of early endosomes with different sorting functions. J. Cell Biol. 145, 123-139.
Shin, O. H., Rizo, J. and Sudhof, T. C. (2002). Synaptotagmin function in dense core vesicle exocytosis studied in cracked PC12 cells. Nat. Neurosci. 5, 649-656.[Medline]
Sonnichsen, B., De, R. S., Nielsen, E., Rietdorf, J. and Zerial, M. (2000). Distinct membrane domains on endosomes in the recycling pathway visualized by multicolor imaging of Rab4, Rab5, and Rab11. J. Cell Biol. 149, 901-914.
Sugita, S., Shin, O. H., Han, W., Lao, Y. and Sudhof, T. C. (2002). Synaptotagmins form a hierarchy of exocytotic Ca2+ sensors with distinct Ca2+ affinities. EMBO J. 21, 270-280.
Traub, L. M., Evans, H. W. and Sagi-Eisenberg, R. (1990). A novel 100 kDa protein, localized to receptor enriched endosomes, is immunologically related to the signal transducing G proteins Gt and Gi. Biochem. J. 272, 453-458.[Medline]
Trischler, M., Stoorvogel, W. and Ullrich, O. (1999). Biochemical analysis of distinct Rab5- and Rab11-positive endosomes along the transferrin pathway. J. Cell Sci. 112, 4773-4783.
Related articles in JCS: