Department of Cell Physiology and Metabolism, University Medical Center, Geneva, CH-1211, Switzerland
* Author for correspondence (e-mail: Haiyan.Wang{at}medecine.unige.ch)
Accepted 25 May 2005
![]() |
Summary |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: ER stress, SREBP-1c, Glucolipotoxicity, ß cell
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Elevated expression of SREBP-1c has been demonstrated in islets and liver of many animal models of diabetes (Kakuma et al., 2000; Lin et al., 2000
; Matsuzaka et al., 2004
; Riddle et al., 2001
; Shimomura et al., 1999a
; Shimomura et al., 1999b
; Shimomura et al., 1999c
; Shimomura et al., 2000
; Sun et al., 2002
; Takaishi et al., 2004
; Tobe et al., 2001
; Ueki et al., 2004
; Unger and Zhou, 2001
; Unger et al., 1999
; Werstuck et al., 2001
; Xu et al., 2004
; Yahagi et al., 2002
; You et al., 2002
) and patients with severe lipodystrophy (Bastard et al., 2002
; Petersen et al., 2002
). Lipid accumulation, impaired glucose-stimulated insulin secretion, defective ß-cell gene expression (insulin, Pdx1, glucokinase and Glut2), disorganized mitochondrial ultrastructure and `lipoapoptosis' have been reported in the ß cells of diabetic animals (Unger and Zhou, 2001
; Unger et al., 1999
). Moreover, preventing SREBP-1c overexpression and activation is common to leptin, metformin, adiponectin and PPAR
agonists. Thus there is a good correlation between suppression of SREBP-1c function and antidiabetic effects of these agents (Kakuma et al., 2000
; Lin et al., 2000
; Petersen et al., 2002
; Shimomura et al., 1999a
; Shimomura et al., 1999b
; Shimomura et al., 1999c
; Tobe et al., 2001
; Unger and Zhou, 2001
; Unger et al., 1999
; Wang, M. Y. et al., 1998
; Xu et al., 2004
; Zhou et al., 2001
). We and others have demonstrated that overexpression of a nuclear active form of SREBP-1c (naSREBP-1c) in insulinoma (INS-1 and MIN6) cells and isolated rat islets results in ß-cell lipotoxicity (Andreolas et al., 2002
; Diraison et al., 2004
; Wang et al., 2003
; Yamashita et al., 2004
). We have previously shown that long-term exposure of INS-1 cells to 30 mM glucose generated the mature nuclear form of SREBP-1c (Wang et al., 2003
). Glucose also raises SREBP-1c mRNA levels in rat ß cells (Flamez et al., 2002
). It is well known that chronic high glucose treatment causes glucolipotoxicity in both insulinoma cells and rat islets (Efanova et al., 1998
; Roche et al., 1998
). We hypothesise that SREBP-1c activation could play an essential role in development of ß-cell glucolipotoxicity. To further substantiate this notion we established an INS-1 stable cell line that allowed suppression of SREBP-1c function through induction of a dominant-negative mutant of SREBP-1c (DN-SREBP-1c) (Kim and Spiegelman, 1996
). Strong experimental evidence demonstrated that dominant-negative suppression of SREBP-1c activity markedly prevented ß-cell glucolipotoxicity. In addition, we found that ER-stress-generated SREBP-1c processing and activation could be the underlying mechanism in ß-cell glucolipotoxicity.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Establishment of INS-1 cells permitting inducible expression of DN-SREBP-1c
The first step stable INS-rß (also refer to as r9) cell line, which carries the reverse tetracycline/doxycycline-dependent transactivator (Gossen et al., 1995), was described previously (Wang and Iynedjian, 1997
; Wang et al., 2001
). The plasmid used in the secondary stable transfection was constructed by subcloning the cDNA encoding the dominant-negative form of SREBP-1c (DN-SREBP-1c/ADD1 1-403(Y320A) [(Kim and Spiegelman, 1996
) kindly supplied by B.M. Spiegelman] into the expression vector PUHD10-3 [(Gossen et al., 1995
) a generous gift from H. Bujard]. The procedures for stable transfection, clone selection and screening were described previously (Wang and Iynedjian, 1997
).
Immunofluorescence
Cells grown on polyornithine-treated glass coverslips were treated for 24 hours with or without 500 ng/ml doxycycline. Cells were then washed, fixed in 4% paraformaldehyde, permeabilized with 0.1% Triton X-100 in phosphate-buffered saline containing 1% BSA (PBS-BSA). The preparation was then blocked with PBS-BSA before incubating with the first antibody, anti-SREBP-1 (Santa Cruz, Basel, Switzerland; 1:100 dilution), followed by the second antibody labelling.
Nuclear protein extraction and electrophoretic mobility-shift assay (EMSA)
Nuclear extracts from INS-1 cells were prepared according to the method of Schreiber et al. (Schreiber et al., 1988). Rat islets were isolated by collagenase digestion as described previously (Rubi et al., 2001
) and their nuclear proteins were extracted as previously reported (Schreiber et al., 1988
). The double-stranded oligonucleotides corresponding to the sterol regulatory element (SRE) in the human insulin receptor substrate 2 (IRS2) promoter (Ide et al., 2004
), 5'cctgcgtaacgccgagtcacatgttgtt3', was used as a probe. EMSA procedures, including conditions for probe labelling and binding reactions were performed as in Wang et al. (Wang, H. et al., 1998
). Mouse monoclonal antibodies against SREBP-1 (NeoMarkers, Fremont CA, USA) and SREBP-2 (purified from the supernatant of the hybridoma cell line CRL2121, American Tissue Culture Collection, Rockville, MD, USA) were used for supershift experiments.
Staining of lipid accumulation by Oil Red O
Cells were cultured in standard (11.2 mM) or 30 mM glucose medium in the presence or absence of 500 ng/ml doxycycline for 48 hours. Cells were fixed and stained as previously reported (Kim and Spiegelman, 1996). Lipid droplets were visualized using phase-contrast microscopy (Nikon Diaphot).
Measurements of insulin secretion and cellular insulin content
Insulin secretion in INS-1E or DN-SREBP-1c#23 cells was measured in 24-well plates over a period of 30 minutes, in Krebs-Ringer-bicarbonate-Hepes buffer (KRBH, 140 mM NaCl, 3.6 mM KCl, 0.5 mM NaH2PO4, 0.5 mM MgSO4, 1.5 mM CaCl2, 2 mM NaHCO3, 10 mM Hepes, 0.1% BSA) containing the indicated concentrations of glucose. Cellular insulin content was determined after extraction with acid ethanol following the procedures of Wang et al. (Wang, H. et al., 1998). Insulin was detected by radio-immunoassay using rat insulin as a standard (Wang, H. et al., 1998
).
Total RNA isolation and northern blotting
Total RNA was extracted and blotted to nylon membranes as described previously (Wang and Iynedjian, 1997). The membrane was prehybridized and then hybridized to 32P-labelled random primer cDNA probes according to the method of Wang and Iynedijian (Wang and Iynedjian, 1997
). To ensure equal RNA loading and even transfer, all membranes were stripped and re-hybridized with a `house-keeping gene' probe, cyclophilin. cDNA fragments used as probes for SREBP-1c, ChREBP, glucokinase, GLUT2, L-pyruvate kinase, insulin, BIP, CHOP10 and PDX1 mRNA detection were digested from the corresponding plasmids. cDNA probes for rat mitochondrial uncoupling protein 2 (UCP2), aldolase B, fatty acid synthase, acetyl-CoA carboxylase, glycerol-phosphate acyltransferase, HMG-CoA reductase, P21WAF1/CIP1, BAD, APO1, BclXL, IRS2 and low density lipoprotein receptor (LDLR), were prepared by RT-PCR and confirmed by sequencing.
Cell proliferation/viability and apoptosis
Quantification of cell proliferation/viability was measured using a Quick Cell Proliferation Assay Kit (LabForce/MBL, Nunningen, Switzerland) according to manufacturer's protocol. This assay is based on the cleavage of a tetrazolium salt WST-1 to formazan by mitochondrial dehydrogenases. Expansion in the number of viable cells results in an increase in the overall activity of the mitochondrial dehydrogenases and subsequently an augmentation in the amount of formazan dye formed. The formazan dye produced by viable cells was quantified with a multiwell spectrophotometer by measuring the absorbance at 440 nm. Experiments for DNA fragmentation were performed using a Quick Apoptosis DNA Ladder Detection Kit (LabForce/MBL, Nunningen, Switzerland) following the manufacturer's protocol.
Statistics
Results are expressed as mean ± s.e.m. and statistical analyses were performed using Student's t-test.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
SREBP-1c rather than ChREBP is implicated in glucolipotoxicity in INS-1 cells
Differential gene expression patterns in INS-1 cells induced by ChREBP and naSREBP-1c are illustrated in Fig. 2A,B. Quantitative northern blotting was performed in two stable INS-1 cell lines previously established to express, respectively, ChREBP (Wang and Wollheim, 2002) and naSREBP-1c (Wang et al., 2003
) in a doxycycline-dependent manner. The results displayed in Fig. 2A indicate that ChREBP predominantly targeted L-PK and aldolase B, although induction of ChREBP also slightly enhanced the expression of fatty acid synthase and acetyl-CoA carboxylase. In contrast, induction of SREBP-1c drastically increased the lipogenic gene expression for proteins such as, fatty acid synthase, acetyl-CoA carboxylase, HMG-CoA reductase and LDL receptor, whereas it did not affect the mRNA levels of L-PK and aldolase B (Fig. 2B). It is noteworthy that the function of SREBP-1c may also overlap with the function of SREBP-2 on target gene expression in INS-1 cells since HMG-CoA reductase is regulated by naSREBP-1c. In addition, the expression of IRS2 was suppressed by naSREBP-1c but unaffected by ChREBP. It has been reported recently that SREBP-1c binds to the human IRS2 promoter and suppresses its activity in rat and mouse hepatocytes (Ide et al., 2004
).
|
Induction of ChREBP in INS-1 cells did not affect glucose-stimulated insulin secretion or cell growth. In contrast to the effect of naSREBP-1c, induction of ChREBP with 500 ng/ml doxycycline for 48 hours did not alter glucose-stimulated insulin secretion or cellular insulin content. To assess the impact of ChREBP on INS-1 cell growth and viability, we performed the WST-1 assay (Fig. 3B). This assay is based on the cleavage of a tetrazolium salt WST-1 to formazan by mitochondrial dehydrogenases. Expansion in the number of viable cells results in an increase in the overall activity of the mitochondrial dehydrogenases and subsequently an augmentation in the amount of formazan dye formed. Unlike overexpression of naSREBP-1c (Wang et al., 2003), maximum induction of ChREBP for 48 hours did not cause INS-1 cell growth arrest (Fig. 3B) or apoptosis as assessed by DNA fragmentation experiments (data not shown). We have previously shown that similar induction of SREBP-1c caused apoptosis in INS-1 cells (Wang et al., 2003
).
|
|
Induction of DN-SREBP-1c diminished chronic high-glucose-induced lipid accumulation, apoptosis and impaired insulin secretion in INS-1 cells. As shown by Oil-Red-O staining (Fig. 5A), 30 mM glucose treatment of DN-SREBP-1c*23 cells for 48 hours resulted in massive lipid accumulation, which was largely prevented by induction of DN-SREBP-1c. Similarly, treatment of DN-SREBP-1c*23 cells for 48 and 72 hours with 30 mM glucose caused typical DNA fragmentation (Fig. 5B), a characteristic hallmark of cells undergoing apoptosis. DN-SREBP-1c largely protected INS-1 cells from apoptosis (Fig. 5B).
|
DN-SREBP-1c corrected defective gene expression in INS-1 cells treated with chronic high glucose
As demonstrated in Fig. 6, treatment of DN-SREBP-1c*23 cells with 30 mM glucose for 48 hours increased the mRNA levels of L-PK, aldolase B and ChREBP, which were not affected by induction of DN-SREBP-1c. These results suggest that high glucose may promote the expression of L-PK and aldolase B through a SREBP-1c-independent but ChREBP-dependent pathway. In contrast, the protective effects of DNSREBP-1c in high-glucose-treated DN-SREBP-1c*23 cells revealed the SREBP-1c-dependent gene expression patterns, including upregulation of fatty acid synthase, HMG-CoA reductase, LDLR and P21, as well as downregulation of GLUT2, glucokinase, PDX1, IRS2 and BCLXL (Fig. 6). These data further substantiate the notion that SREBP-1c-target genes are implicated in chronic high-glucose-mediated ß-cell glucolipotoxicity. Ucp2 is also a downstream target gene of SREBP-1c in INS-1 cells (Wang et al., 2003; Yamashita et al., 2004
). Interestingly, induction of DN-SREBP-1c suppressed UCP2, which may account for the increased basal insulin secretion observed (Fig. 5C).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
To elucidate the molecular mechanisms underlying ß-cell glucolipotoxicity, we first investigated the quantitative gene expression patterns in INS-1 cells treated chronically with high-glucose. The drastically reduced expression of essential ß-cell genes such as IRS2, insulin, Pdx1, Glut2, glucokinase and Bclxl, and markedly increased mRNA levels of lipogenic and proapoptotic genes should contribute to the glucolipotoxicity. Interestingly, this gene expression profile is strikingly similar to what we have reported in the INS-1 cell line expressing naSREBP-1c (Wang et al., 2003). In contrast, the characteristics of these gene expression patterns as well as typical glucolipotoxicity were not observed in the INS-1 cell line overexpressing another lipogenic transcription factor ChREBP. Similar negative results were obtained in INS-1 cells expressing, PPAR
or C/EBPß (H.W. and C.B.W., unpublished data), suggesting that SREBP-1c is the predominant transcription factor responsible for ß-cell glucolipotoxicity.
To further substantiate this hypothesis, we established an INS-1 stable cell line with inducible expression of DN-SREBP-1c. Induction of DN-SREBP-1c diminished the chronic high-glucose-induced SREBP-1 binding to the SRE fragment of the IRS2 promoter. Consequently, the inhibitory effects of chronic high glucose on IRS2 expression were largely attenuated by DN-SREBP-1c. It has been reported that SREBP-1c binds to the IRS2 promoter and suppresses IRS2 expression in rodent hepatocytes (Ide et al., 2004). Our results suggest a similar mechanism in pancreatic ß cells. Deletion of IRS2 in mouse hypothalamus and ß cells has recently been shown to cause a type 2 diabetes-like syndrome (Kubota et al., 2004
; Lin et al., 2004
). IRS2 is also known to promote ß cell growth/survival (Withers et al., 1998
). We therefore propose that suppression of IRS2 expression by SREBP-1c should contribute, at least in part, to ß-cell glucolipotoxicity.
We also demonstrated that dominant-negative suppression of SREBP-1c activation largely prevented glucolipotoxicity in INS-1 cells, including lipid accumulation, impaired glucose-stimulated insulin secretion and apoptosis. The protective effects of DN-SREBP-1c could be explained by nomalized expression of fatty acid synthase, HMG-CoA reductase, LDLR, P21, GLUT2, glucokinase, PDX1, IRS2 and BCLXL. In addition, DN-SREBP-1c also suppressed the expression of UCP2. In contrast, DN-SREBP-1c did not affect the expression of L-PK and aldolase B, which were targeted by ChREBP. Glucokinase is the rate-limiting enzyme for glycolysis and serves as the ß-cell glucose sensor (Wang and Iynedjian, 1997). PDX1 is required for maintaining ß-cell-specific gene expression and the ß-cell phenotype (Ahlgren et al., 1998
; Wang et al., 2001
). Mouse islets deficient in LDLR have been shown to be resistant to LDL-induced apoptosis (Roehrich et al., 2003
). Deletion of Ucp2 restores ß-cell function in ob/ob mice and in animals fed a high-fat diet (Chan et al., 2004
; Joseph et al., 2002
; Zhang et al., 2001
). In addition, mouse islets deficient in UCP2 are protected from fatty acid-induced lipotoxicity (Joseph et al., 2004
), whereas its overexpression leads to impaired glucose-stimulated insulin secretion (Lameloise et al., 2001
; Yamashita et al., 2004
). Therefore, chronic high glucose may act through SREBP-1 to target multiple genes, causing ß-cell glucolipotoxicity.
Most intriguingly, we found that chronic high glucose treatment caused ER stress response in INS-1 cells, evidenced by elevated expression of two characteristic genes, CHOP and BIP. It has been reported that glucose stimulates protein synthesis in pancreatic ß cells through dephosphorylation of the eukaryotic elongation factor (eEF2) (Yan et al., 2003) and initiation factor (eIF2
) (Gomez et al., 2004
) and activation of the guanine nucleotide exchange factor eIF2B (Gilligan et al., 1996
). We, therefore, postulate that chronic high glucose could induce ER stress through overloading protein synthesis. Our data suggest that chronic high-glucose-induced ER stress could be the underlying mechanism in SREBP-1 processing/activation. Indeed, we found that treatment of isolated rat islets with chronic high glucose and two ER stress inducers, thapsigargin and tunicamycin, markedly increased the SREBP-1 binding activity to the IRS2 promoter. It has been well established that ER stress causes SREBP processing through S1P and S2P (Werstuck et al., 2001
; Ye et al., 2000
). SREBP-1c activation induced by ER stress has also been implicated in hyperhomocysteinemia-induced liver steatosis (Werstuck et al., 2001
). Increased ER stress has been incriminated in ob/ob mice and in mice fed on a high-fat diet and proposed as the cause of insulin resistance (Ozcan et al., 2004
). Likewise, response to ER stress has been reported in rat ß cells treated with fatty acids (Kharroubi et al., 2004
). Therefore, prolonged ER stress and SREBP-1c activation could be a common mechanism underlying both ß-cell dysfunction and insulin resistance in type 2 diabetes.
It is noteworthy that the genetic studies have associated SREBP-1c polymorphisms with obesity, insulin resistance and type 2 diabetes (Eberle et al., 2004; Laudes et al., 2004
). SREBP-1c is the upstream suppressor of IRS2 (Ide et al., 2004
), and the transactivator of Ucp2, Ldlr, stearoyl-CoA desaturase 1 and many lipogenic genes (Bene et al., 2001
; Horton et al., 2003
; Medvedev et al., 2002
; Wang et al., 2003
; Yahagi et al., 1999
). In addition to the aforementioned genes (IRS2, Ucp2 and Ldlr), stearoyl-CoA desaturase 1 (SCD1) deficiency has been shown to increase insulin sensitivity, fatty acid oxidation and energy expenditure, as well as promoting resistance to diet-induced obesity (Dobrzyn et al., 2004
). We, therefore, propose that SREBP-1c is one of the causative genes for development of both ß-cell dysfunction and insulin resistance in type 2 diabetes. In fact, SREBP-1c over-activation has been associated with liver steatosis, lipodystrophy, diabetic renal disease and/or ß-cell lipotoxicity in many animal models of type 2 diabetes, such as ob/ob, db/db, IRS2-/- and ap2-nSREBP-1c mice, streptozotocin-induced diabetic rats, Zucker diabetic fatty rats, and mice with liver overexpression of Socs-1/-3 (Kakuma et al., 2000
; Lin et al., 2000
; Matsuzaka et al., 2004
; Riddle et al., 2001
; Shimomura et al., 1999a
; Shimomura et al., 1999b
; Shimomura et al., 1999c
; Shimomura et al., 2000
; Sun et al., 2002
; Takaishi et al., 2004
; Tobe et al., 2001
; Ueki et al., 2004
; Unger and Zhou, 2001
; Unger et al., 1999
; Werstuck et al., 2001
; Xu et al., 2004
; Yahagi et al., 2002
; You et al., 2002
), as well as in patients with severe lipodystrophy (Bastard et al., 2002
; Petersen et al., 2002
). Treatment with some antidiabetic drugs or hormones including metformin, troglitazone, leptin and adiponectin could prevent the diabetes-associated lipotoxicity in these animals and patients through inhibition of SREBP-1c activation (Lin et al., 2000
; Petersen et al., 2002
; Shimomura et al., 1999c
; Xu et al., 2004
). Genetic manipulations to suppress SREBP-1c function are shown to be equally effective (Engelking et al., 2004
; Takaishi et al., 2004
; Ueki et al., 2004
).
In summary, we found that chronic high glucose treatment alone could cause typical glucolipotoxicity and a gene expression profile resembling that caused by naSREBP-1c expression in INS-1 cells (Wang et al., 2003). This gene expression profile (Wang et al., 2003
) has also been most recently confirmed in mice with ß-cell-specific overexpression of SREBP-1c (Takahashi et al., 2005
), suggesting that the results in our INS-1 cell model correlate well with native ß cells in vivo. However, it remains to be determined whether naSREBP-1c-induced apoptosis and impaired glucose-stimulated insulin secretion occurs via lipid accumulation or through an independent mechanism. Most importantly, we found that dominant-negative suppression of SREBP-1c function could prevent glucolipotoxicity in INS-1 cells. We have further implicated ERnstress in the activation of SREBP-1c, leading to ß-cell glucolipotoxicity. Therefore, the present study should help to clarify the molecular mechanisms underlying development of ß-cell glucolipotoxicity, a process thought to cause the loss of both ß-cell mass and insulin secretory response to glucose in type 2 diabetes. Prevention of excessive ER stress and SREBP-1c action should be considered for therapy aimed at protection of ß-cell function in type 2 diabetes.
![]() |
Acknowledgments |
---|
The authors declare no conflict of interest.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ahlgren, U., Johnson, J., Johnson, L., Simu, K. and Edlund, H. (1998). Beta-cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta-cell phenotype and maturity onset diabetes. Genes Dev. 12, 1763-1768.
Andreolas, C., da Silva Xavier, G., Diraison, F., Zhao, C., Varadi, A., Lopez-Casillas, F., Ferre, P., Foufelle, F. and Rutter, G. A. (2002). Stimulation of acetyl-CoA carboxylase gene expression by glucose requires insulin release and sterol regulatory element binding protein 1c in pancreatic MIN6 beta-cells. Diabetes 51, 2536-2545.
Asfari, M., Janjic, D., Meda, P., Li, G., Halban, P. A. and Wollheim, C. B. (1992). Establishment of 2-mercaptoethanol-dependent differentiated insulin-secreting cell lines. Endocrinology 130, 167-178.[Abstract]
Bastard, J. P., Caron, M., Vidal, H., Jan, V., Auclair, M., Vigouroux, C., Luboinski, J., Laville, M., Maachi, M., Girard, P. M. et al. (2002). Association between altered expression of adipogenic factor SREBP1 in lipoatrophic adipose tissue from HIV-1-infected patients and abnormal adipocyte differentiation and insulin resistance. Lancet 359, 1026-1031.[CrossRef][Medline]
Bene, H., Lasky, D. and Ntambi, J. M. (2001). Cloning and characterization of the human stearoyl-CoA desaturase gene promoter: transcriptional activation by sterol regulatory element binding protein and repression by polyunsaturated fatty acids and cholesterol. Biochem. Biophys. Res. Commun. 284, 1194-1198.[CrossRef][Medline]
Bonner-Weir, S., Trent, D. F. and Weir, G. C. (1983). Partial pancreatectomy in the rat and subsequent defect in glucose-induced insulin release. J. Clin. Invest. 71, 1544-1553.[Medline]
Brown, M. S. and Goldstein, J. L. (1997). The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 89, 331-340.[CrossRef][Medline]
Butler, A. E., Janson, J., Bonner-Weir, S., Ritzel, R., Rizza, R. A. and Butler, P. C. (2003). Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes. Diabetes 52, 102-110.
Chan, C. B., Saleh, M. C., Koshkin, V. and Wheeler, M. B. (2004). Uncoupling protein 2 and islet function. Diabetes 53, S136-S142.
Dentin, R., Pegorier, J. P., Benhamed, F., Foufelle, F., Ferre, P., Fauveau, V., Magnuson, M. A., Girard, J. and Postic, C. (2004). Hepatic glucokinase is required for the synergistic action of ChREBP and SREBP-1c on glycolytic and lipogenic gene expression. J. Biol. Chem. 279, 20314-20326.
Diraison, F., Parton, L., Ferre, P., Foufelle, F., Briscoe, C. P., Leclerc, I. and Rutter, G. A. (2004). Over-expression of sterol-regulatory-element-binding protein-1c (SREBP1c) in rat pancreatic islets induces lipogenesis and decreases glucose-stimulated insulin release: modulation by 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR). Biochem. J. 378, 769-778.[CrossRef][Medline]
Dobrzyn, P., Dobrzyn, A., Miyazaki, M., Cohen, P., Asilmaz, E., Hardie, D. G., Friedman, J. M. and Ntambi, J. M. (2004). Stearoyl-CoA desaturase 1 deficiency increases fatty acid oxidation by activating AMP-activated protein kinase in liver. Proc. Natl. Acad. Sci. USA 101, 6409-6414.
Eberle, D., Clement, K., Meyre, D., Sahbatou, M., Vaxillaire, M., Le Gall, A., Ferre, P., Basdevant, A., Froguel, P. and Foufelle, F. (2004). SREBF-1 gene polymorphisms are associated with obesity and type 2 diabetes in French obese and diabetic cohorts. Diabetes 53, 2153-2157.
Efanova, I. B., Zaitsev, S. V., Zhivotovsky, B., Kohler, M., Efendic, S., Orrenius, S. and Berggren, P. O. (1998). Glucose and tolbutamide induce apoptosis in pancreatic beta-cells. A process dependent on intracellular Ca2+ concentration. J. Biol. Chem. 273, 33501-33507.
Engelking, L. J., Kuriyama, H., Hammer, R. E., Horton, J. D., Brown, M. S., Goldstein, J. L. and Liang, G. (2004). Overexpression of Insig-1 in the livers of transgenic mice inhibits SREBP processing and reduces insulin-stimulated lipogenesis. J. Clin. Invest. 113, 1168-1175.
Flamez, D., Berger, V., Kruhoffer, M., Orntoft, T., Pipeleers, D. and Schuit, F. C. (2002). Critical role for cataplerosis via citrate in glucose-regulated insulin release. Diabetes 51, 2018-2024.
Gilligan, M., Welsh, G. I., Flynn, A., Bujalska, I., Diggle, T. A., Denton, R. M., Proud, C. G. and Docherty, K. (1996). Glucose stimulates the activity of the guanine nucleotide-exchange factor eIF-2B in isolated rat islets of Langerhans. J. Biol. Chem. 271, 2121-2125.
Gomez, E., Powell, M. L., Greenman, I. C. and Herbert, T. P. (2004). Glucose-stimulated protein synthesis in pancreatic beta-cells parallels an increase in the availability of the translational ternary complex (eIF2-GTP.Met-tRNAi) and the dephosphorylation of eIF2 alpha. J. Biol. Chem. 279, 53937-53946.
Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W. and Bujard, H. (1995). Transcriptional activation by tetracyclines in mammalian cells. Science 268, 1766-1769.[Medline]
Harmon, J. S., Gleason, C. E., Tanaka, Y., Poitout, V. and Robertson, R. P. (2001). Antecedent hyperglycemia, not hyperlipidemia, is associated with increased islet triacylglycerol content and decreased insulin gene mRNA level in Zucker diabetic fatty rats. Diabetes 50, 2481-2486.
Horton, J. D., Goldstein, J. L. and Brown, M. S. (2002). SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 109, 1125-1131.
Horton, J. D., Shah, N. A., Warrington, J. A., Anderson, N. N., Park, S. W., Brown, M. S. and Goldstein, J. L. (2003). Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc. Natl. Acad. Sci. USA 100, 12027-12032.
Ide, T., Shimano, H., Yahagi, N., Matsuzaka, T., Nakakuki, M., Yamamoto, T., Nakagawa, Y., Takahashi, A., Suzuki, H., Sone, H. et al. (2004). SREBPs suppress IRS-2-mediated insulin signalling in the liver. Nat. Cell Biol. 6, 351-357.[CrossRef][Medline]
Iizuka, K., Bruick, R. K., Liang, G., Horton, J. D. and Uyeda, K. (2004). Deficiency of carbohydrate response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis. Proc. Natl. Acad. Sci. USA 101, 7281-7286.
Ishii, S., Iizuka, K., Miller, B. C. and Uyeda, K. (2004). Carbohydrate response element binding protein directly promotes lipogenic enzyme gene transcription. Proc. Natl. Acad. Sci. USA 101, 15597-15602.
Joseph, J. W., Koshkin, V., Zhang, C. Y., Wang, J., Lowell, B. B., Chan, C. B. and Wheeler, M. B. (2002). Uncoupling protein 2 knockout mice have enhanced insulin secretory capacity after a high-fat diet. Diabetes 51, 3211-3219.
Joseph, J. W., Koshkin, V., Saleh, M. C., Sivitz, W. I., Zhang, C. Y., Lowell, B. B., Chan, C. B. and Wheeler, M. B. (2004). Free fatty acid-induced beta-cell defects are dependent on uncoupling protein 2 expression. J. Biol. Chem. 279, 51049-51056.
Kakuma, T., Lee, Y., Higa, M., Wang, Z., Pan, W., Shimomura, I. and Unger, R. H. (2000). Leptin, troglitazone, and the expression of sterol regulatory element binding proteins in liver and pancreatic islets. Proc. Natl. Acad. Sci. USA 97, 8536-8541.
Kharroubi, I., Ladriere, L., Cardozo, A. K., Dogusan, Z., Cnop, M. and Eizirik, D. L. (2004). Free fatty acids and cytokines induce pancreatic beta-cell apoptosis by different mechanisms: role of nuclear factor-kappaB and endoplasmic reticulum stress. Endocrinology 145, 5087-5096.
Kim, J. B. and Spiegelman, B. M. (1996). ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Genes Dev. 10, 1096-1107.[Abstract]
Kubota, N., Terauchi, Y., Tobe, K., Yano, W., Suzuki, R., Ueki, K., Takamoto, I., Satoh, H., Maki, T., Kubota, T. et al. (2004). Insulin receptor substrate 2 plays a crucial role in beta cells and the hypothalamus. J. Clin. Invest. 114, 917-927.
Lameloise, N., Muzzin, P., Prentki, M. and Assimacopoulos-Jeannet, F. (2001). Uncoupling protein 2, a possible link between fatty acid excess and impaired glucose-induced insulin secretion? Diabetes 50, 803-809.
Laudes, M., Barroso, I., Luan, J., Soos, M. A., Yeo, G., Meirhaeghe, A., Logie, L., Vidal-Puig, A., Schafer, A. J., Wareham, N. J. et al. (2004). Genetic variants in human sterol regulatory element binding protein-1c in syndromes of severe insulin resistance and type 2 diabetes. Diabetes 53, 842-846.
Lin, H. Z., Yang, S. Q., Chuckaree, C., Kuhajda, F., Ronnet, G. and Diehl, A. M. (2000). Metformin reverses fatty liver disease in obese, leptin-deficient mice. Nat. Med. 6, 998-1003.[CrossRef][Medline]
Lin, X., Taguchi, A., Park, S., Kushner, J. A., Li, F., Li, Y. and White, M. F. (2004). Dysregulation of insulin receptor substrate 2 in beta cells and brain causes obesity and diabetes. J. Clin. Invest. 114, 908-916.
Loftus, T. M. and Lane, M. D. (1997). Modulating the transcriptional control of adipogenesis. Curr. Opin. Genet. Dev. 7, 603-608.[CrossRef][Medline]
Matsuzaka, T., Shimano, H., Yahagi, N., Amemiya-Kudo, M., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Tomita, S., Sekiya, M. et al. (2004). Insulin-independent induction of sterol regulatory element-binding protein-1c expression in the livers of streptozotocin-treated mice. Diabetes 53, 560-569.
Medvedev, A. V., Robidoux, J., Bai, X., Cao, W., Floering, L. M., Daniel, K. W. and Collins, S. (2002). Regulation of the uncoupling protein-2 gene in INS-1 beta-cells by oleic acid. J. Biol. Chem. 277, 42639-42644.
Ozcan, U., Cao, Q., Yilmaz, E., Lee, A. H., Iwakoshi, N. N., Ozdelen, E., Tuncman, G., Gorgun, C., Glimcher, L. H. and Hotamisligil, G. S. (2004). Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science 306, 457-461.
Petersen, K. F., Oral, E. A., Dufour, S., Befroy, D., Ariyan, C., Yu, C., Cline, G. W., DePaoli, A. M., Taylor, S. I., Gorden, P. et al. (2002). Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J. Clin. Invest. 109, 1345-1350.
Poitout, V. and Robertson, R. P. (2002). Minireview: Secondary beta-cell failure in type 2 diabetes - a convergence of glucotoxicity and lipotoxicity. Endocrinology 143, 339-342.
Riddle, T. M., Kuhel, D. G., Woollett, L. A., Fichtenbaum, C. J. and Hui, D. Y. (2001). HIV protease inhibitor induces fatty acid and sterol biosynthesis in liver and adipose tissues due to the accumulation of activated sterol regulatory element-binding proteins in the nucleus. J. Biol. Chem. 276, 37514-37519.
Rishi, V., Gal, J., Krylov, D., Fridriksson, J., Boysen, M. S., Mandrup, S. and Vinson, C. (2004). SREBP-1 dimerization specificity maps to both the helix-loop-helix and leucine zipper domains: use of a dominant negative. J. Biol. Chem. 279, 11863-11874.
Roche, E., Farfari, S., Witters, L. A., Assimacopoulos-Jeannet, F., Thumelin, S., Brun, T., Corkey, B. E., Saha, A. K. and Prentki, M. (1998). Long-term exposure of beta-INS cells to high glucose concentrations increases anaplerosis, lipogenesis, and lipogenic gene expression. Diabetes 47, 1086-1094.[Abstract]
Roehrich, M. E., Mooser, V., Lenain, V., Herz, J., Nimpf, J., Azhar, S., Bideau, M., Capponi, A., Nicod, P., Haefliger, J. A. et al. (2003). Insulin-secreting beta-cell dysfunction induced by human lipoproteins. J. Biol. Chem. 278, 18368-18375.
Rubi, B., Ishihara, H., Hegardt, F. G., Wollheim, C. B. and Maechler, P. (2001). GAD65-mediated glutamate decarboxylation reduces glucose-stimulated insulin secretion in pancreatic beta cells. J. Biol. Chem. 276, 36391-36396.
Schreiber, E., Matthias, P., Muller, M. M. and Schaffner, W. (1988). Identification of a novel lymphoid specific octamer binding protein (OTF-2B) by proteolytic clipping bandshift assay (PCBA). EMBO J. 7, 4221-4229.[Abstract]
Shimomura, I., Bashmakov, Y. and Horton, J. D. (1999a). Increased levels of nuclear SREBP-1c associated with fatty livers in two mouse models of diabetes mellitus. J. Biol. Chem. 274, 30028-30032.
Shimomura, I., Bashmakov, Y., Ikemoto, S., Horton, J. D., Brown, M. S. and Goldstein, J. L. (1999b). Insulin selectively increases SREBP-1c mRNA in the livers of rats with streptozotocin-induced diabetes. Proc. Natl. Acad. Sci. USA 96, 13656-13661.
Shimomura, I., Hammer, R. E., Ikemoto, S., Brown, M. S. and Goldstein, J. L. (1999c). Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature 401, 73-76.[CrossRef][Medline]
Shimomura, I., Matsuda, M., Hammer, R. E., Bashmakov, Y., Brown, M. S. and Goldstein, J. L. (2000). Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob/ob mice. Mol. Cell 6, 77-86.[CrossRef][Medline]
Sun, L., Halaihel, N., Zhang, W., Rogers, T. and Levi, M. (2002). Role of sterol regulatory element-binding protein 1 in regulation of renal lipid metabolism and glomerulosclerosis in diabetes mellitus. J. Biol. Chem. 277, 18919-18927.
Takahashi, A., Motomura, K., Kato, T., Yoshikawa, T., Nakagawa, Y., Yahagi, N., Sone, H., Suzuki, H., Toyoshima, H., Yamada, N. et al. (2005). Transgenic mice overexpressing nuclear SREBP-1c in pancreatic {beta}-cells. Diabetes 54, 492-499.
Takaishi, K., Duplomb, L., Wang, M. Y., Li, J. and Unger, R. H. (2004). Hepatic insig-1 or -2 overexpression reduces lipogenesis in obese Zucker diabetic fatty rats and in fasted/refed normal rats. Proc. Natl. Acad. Sci. USA 101, 7106-7111.
Tobe, K., Suzuki, R., Aoyama, M., Yamauchi, T., Kamon, J., Kubota, N., Terauchi, Y., Matsui, J., Akanuma, Y., Kimura, S. et al. (2001). Increased expression of the sterol regulatory element-binding protein-1 gene in insulin receptor substrate-2(-/-) mouse liver. J. Biol. Chem. 276, 38337-38340.
Tontonoz, P., Kim, J. B., Graves, R. A. and Spiegelman, B. M. (1993). ADD1: a novel helix-loop-helix transcription factor associated with adipocyte determination and differentiation. Mol. Cell. Biol. 13, 4753-4759.[Abstract]
Ueki, K., Kondo, T., Tseng, Y. H. and Kahn, C. R. (2004). Central role of suppressors of cytokine signaling proteins in hepatic steatosis, insulin resistance, and the metabolic syndrome in the mouse. Proc. Natl. Acad. Sci. USA 101, 10422-10427.
Unger, R. H. (2002). Lipotoxic diseases. Annu. Rev. Med. 53, 319-336.[CrossRef][Medline]
Unger, R. H. and Zhou, Y. T. (2001). Lipotoxicity of beta-cells in obesity and in other causes of fatty acid spillover. Diabetes 50, S118-S121.
Unger, R. H., Zhou, Y. T. and Orci, L. (1999). Regulation of fatty acid homeostasis in cells: novel role of leptin. Proc. Natl. Acad. Sci. USA 96, 2327-2332.
Wang, H. and Iynedjian, P. B. (1997). Modulation of glucose responsiveness of insulinoma beta-cells by graded overexpression of glucokinase. Proc. Natl. Acad. Sci. USA 94, 4372-4377.
Wang, H. and Wollheim, C. B. (2002). ChREBP Rather than USF2 regulates glucose stimulation of endogenous L-pyruvate kinase expression in insulin-secreting cells. J. Biol. Chem. 277, 32746-32752.
Wang, H., Maechler, P., Hagenfeldt, K. A. and Wollheim, C. B. (1998). Dominant-negative suppression of HNF-1alpha function results in defective insulin gene transcription and impaired metabolism-secretion coupling in a pancreatic beta-cell line. EMBO J. 17, 6701-6713.
Wang, H., Maechler, P., Ritz-Laser, B., Hagenfeldt, K. A., Ishihara, H., Philippe, J. and Wollheim, C. B. (2001). Pdx1 level defines pancreatic gene expression pattern and cell lineage differentiation. J. Biol. Chem. 276, 25279-25286.
Wang, H., Maechler, P., Antinozzi, P. A., Herrero, L., Hagenfeldt-Johansson, K. A., Bjorklund, A. and Wollheim, C. B. (2003). The transcription factor SREBP-1c is instrumental in the development of beta-cell dysfunction. J. Biol. Chem. 278, 16622-16629.
Wang, M. Y., Koyama, K., Shimabukuro, M., Mangelsdorf, D., Newgard, C. B. and Unger, R. H. (1998). Overexpression of leptin receptors in pancreatic islets of Zucker diabetic fatty rats restores GLUT-2, glucokinase, and glucose-stimulated insulin secretion. Proc. Natl. Acad. Sci. USA 95, 11921-11926.
Weir, G. C. (1982). Non-insulin-dependent diabetes mellitus: interplay between B-cell inadequacy and insulin resistance. Am. J. Med. 73, 461-464.[CrossRef][Medline]
Weir, G. C., Laybutt, D. R., Kaneto, H., Bonner-Weir, S. and Sharma, A. (2001). Beta-cell adaptation and decompensation during the progression of diabetes. Diabetes 50, S154-S159.
Werstuck, G. H., Lentz, S. R., Dayal, S., Hossain, G. S., Sood, S. K., Shi, Y. Y., Zhou, J., Maeda, N., Krisans, S. K., Malinow, M. R. et al. (2001). Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J. Clin. Invest. 107, 1263-1273.
Withers, D. J., Gutierrez, J. S., Towery, H., Burks, D. J., Ren, J. M., Previs, S., Zhang, Y., Bernal, D., Pons, S., Shulman, G. I. et al. (1998). Disruption of IRS-2 causes type 2 diabetes in mice. Nature 391, 900-904.[CrossRef][Medline]
Xu, A., Yin, S., Wong, L., Chan, K. W. and Lam, K. S. (2004). Adiponectin ameliorates dyslipidemia induced by the human immunodeficiency virus protease inhibitor ritonavir in mice. Endocrinology 145, 487-494.
Yahagi, N., Shimano, H., Hasty, A. H., Amemiya-Kudo, M., Okazaki, H., Tamura, Y., Iizuka, Y., Shionoiri, F., Ohashi, K., Osuga, J. et al. (1999). A crucial role of sterol regulatory element-binding protein-1 in the regulation of lipogenic gene expression by polyunsaturated fatty acids. J. Biol. Chem. 274, 35840-35844.
Yahagi, N., Shimano, H., Hasty, A. H., Matsuzaka, T., Ide, T., Yoshikawa, T., Amemiya-Kudo, M., Tomita, S., Okazaki, H., Tamura, Y. et al. (2002). Absence of sterol regulatory element-binding protein-1 (SREBP-1) ameliorates fatty livers but not obesity or insulin resistance in Lep(ob)/Lep(ob) mice. J. Biol. Chem. 277, 19353-19357.
Yamashita, T., Eto, K., Okazaki, Y., Yamashita, S., Yamauchi, T., Sekine, N., Nagai, R., Noda, M. and Kadowaki, T. (2004). Role of uncoupling protein-2 up-regulation and triglyceride accumulation in impaired glucose-stimulated insulin secretion in a beta-cell lipotoxicity model overexpressing sterol regulatory element-binding protein-1c. Endocrinology 145, 3566-3577.
Yan, L., Nairn, A. C., Palfrey, H. C. and Brady, M. J. (2003). Glucose regulates EF-2 phosphorylation and protein translation by a protein phosphatase-2A-dependent mechanism in INS-1-derived 832/13 cells. J. Biol. Chem. 278, 18177-18183.
Ye, J., Rawson, R. B., Komuro, R., Chen, X., Dave, U. P., Prywes, R., Brown, M. S. and Goldstein, J. L. (2000). ER stress induces cleavage of membrane-bound ATF6 by the same proteases that process SREBPs. Mol. Cell 6, 1355-1364.[CrossRef][Medline]
You, M., Fischer, M., Deeg, M. A. and Crabb, D. W. (2002). Ethanol induces fatty acid synthesis pathways by activation of sterol regulatory element-binding protein (SREBP). J. Biol. Chem. 277, 29342-29347.
Zhang, C. Y., Baffy, G., Perret, P., Krauss, S., Peroni, O., Grujic, D., Hagen, T., Vidal-Puig, A. J., Boss, O., Kim, Y. B. et al. (2001). Uncoupling protein-2 negatively regulates insulin secretion and is a major link between obesity, beta cell dysfunction, and type 2 diabetes. Cell 105, 745-755.[CrossRef][Medline]
Zhou, G., Myers, R., Li, Y., Chen, Y., Shen, X., Fenyk-Melody, J., Wu, M., Ventre, J., Doebber, T., Fujii, N. et al. (2001). Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Invest. 108, 1167-1174.
Related articles in JCS:
|