1 Department of Chemistry, Faculty of Science, Niigata University, Niigata
950-2181, Japan
2 Graduate School of Science and Technology, Niigata University, Niigata
950-2181, Japan
3 Center for Instrumental Analysis, Niigata University, Niigata 950-2181,
Japan
4 Division of Biological Science, Graduate School of Science, Nagoya University,
Nagoya 464-8602, Japan
5 The Laboratory of Biochemistry, Aichi Cancer Center Research Institute, Nagoya
464-8681, Japan
6 Department of Pharmacological Sciences, School of Medicine, University Medical
Center, State University of New York at Stony Brook, Stony Brook, New York
11794-8651, USA
* Author for correspondence (e-mail: furukawa{at}chem.sc.niigata-u.ac.jp)
Accepted 23 May 2003
![]() |
Summary |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: BAF, Cell cycle, Lamin, Nuclear envelope, Chromosome, Replication
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The nuclear lamina is a stable filamentous meshwork lining the inner
nuclear membrane (INM), consisting mainly of lamin polymers; lamins belong to
the intermediate filament (IF) protein super-family. In vertebrates, there are
two classes of lamins, A- and B-types, distinguished on the bases of their
amino acid sequence (reviewed by Stuurman
et al., 1998). Both types of nuclear lamins are known to bind
directly to chromatin components (reviewed by
Stuurman et al., 1998
;
Gruenbaum et al., 2000
).
Lamins are expressed in a wide range of cells. Moreover, it has been suggested
that they have a general role in the attachment of chromosomes to the NE as
well as in the maintenance of interphase nuclear organization. In addition to
the lamins, a number of less abundant INM proteins are also associated with
the nuclear lamina (reviewed by Gruenbaum
et al., 2000
; Worman and
Courvalin, 2000
). These include the lamin B receptor (LBR),
lamina-associated polypeptides (LAPs) 1 and 2, emerin and MAN1, all found in a
wide range of animal cells, as well as the young arrest (YA) protein and
otefin in Drosophila. Research has revealed that different INM
proteins are not only bound to specific nuclear lamins but also interact
directly with specific chromosomal components (reviewed by
Gruenbaum et al., 2000
;
Worman and Courvalin, 2000
;
Cohen et al., 2001
).
LAP2ß, a LAP2 isoform generated by alternative splicing, binds to
B-type lamin (Foisner and Gerace,
1993), chromosomes (Foisner and
Gerace, 1993
; Furukawa et al.,
1998
), DNA (Furukawa et al.,
1997
; Cai et al.,
2001
) and HA95 (Martins et
al., 2000
). LAP2ß also binds specifically to the DNA-bridging
protein, BAF (Furukawa, 1999
;
Shumaker et al., 2001
).
Moreover, microinjection into cultured cells of protein encompassing the
binding domains of LAP2ß to either B-type lamin or chromatin, or addition
to an in vitro nuclear assembly system, clearly revealed influences on DNA
replication as well as nuclear assembly
(Yang et al., 1997
;
Gant et al., 1999
). LAP2ß
accumulates at the surfaces of chromosomes prior to the assembly of B-type
lamin at the NE during late anaphase
(Foisner and Gerace, 1993
;
Moir et al., 2000
). Thus, in
addition to the nuclear lamins, other INM proteins may have functions in both
structural arrangement and individual dynamic processes within the cell
nucleus.
Recently a particular protein family was described, termed LEM-domain
proteins. The LEM domain, originally recognized in LAP2, emerin and MAN1, is a
conserved series of about 40 amino acid residues
(Lin et al., 2000), also found
in otefin and other Drosophila proteins (reviewed by
Gruenbaum et al., 2000
).
Structural characterization of the LEM domain of LAP2ß demonstrated one
short N-terminal
-helix and two larger parallel
-helices
(Lin et al., 2000
;
Cai et al., 2001
;
Laguri et al., 2001
).
Recently, Lee et al. (Lee et al.,
2001
) demonstrated that the LEM domain of emerin mediates direct
binding to BAF, supporting previous work on LAP2ß
(Furukawa, 1999
;
Shumaker et al., 2001
). Thus
there is now abundant evidence to support the notion that BAF binding is a
common property of several proteins containing LEM domains.
BAF was first identified as a cellular trans-acting factor involved in
protecting reverse-transcribed retroviral DNA against self-destructive
integration (Lee and Craigie,
1998). BAF dimers bind to double-stranded DNA (dsDNA), and high
concentrations form intermolecular bridges with naked DNA to generate
perceptible supramacromolecular complexes
(Lee and Craigie, 1998
;
Cai et al., 1998
). A BAF
dodecamer was demonstrated to form a discrete higher order nucleoprotein
complex in vitro with 21 bp dsDNA (Zheng
et al., 2000
). The cellular functions of BAF in vivo remain
unclear, but the BAF protein clearly co-localizes with cell nuclei during
interphase (Furukawa, 1999
;
Haraguchi et al., 2001
;
Wang et al., 2002
). A similar
distribution is also found in normal rat kidney cells expressing GFP-tagged
BAF (J. Ellenberg, personal communication). In a particularly high resolution
study performed using cultured cells, BAF was found to be enriched during
telophase in the central region of the assembling nuclear rim
(Haraguchi et al., 2001
). BAF
depletion by RNA interference (RNAi) in Caenorhabditis elegans causes
a defect in chromatin segregation during mitosis
(Zheng et al., 2000
).
Furthermore, BAF has now been demonstrated to be ubiquitously expressed in
many mammalian tissues and functions as a transcriptional repressor for the
paired-like homeodomain protein Cone-Rod Homeobox
(Wang et al., 2002
). These
findings imply that the interactions between LEM domain proteins and BAF/DNA
complexes might regulate chromosomal structure and thereby, function.
To elucidate BAF functions in vivo, genetic manipulation of Drosophila was performed. Characterization of the developmental and cellular phenotypes in baf null mutants provided direct in vivo evidence of its importance in organizing the architecture of both chromosomes and the NE as well as for the progression of the cell cycle.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Production of anti-BAF antiserum
Polyclonal rabbit anti-BAF antibodies were produced against an
overexpressed highly purified thioredoxin-his-tagged (TrH)-Drosophila
BAF fusion protein. To generate this BAF fusion protein, polymerase chain
reaction was performed with the primers ccg tgc gga tcc ATG TCG GGC ACA TCG
CAG AAA and cca gcg ctc gag AAC AGT GAA CAC GGC AAA TGC. After BamHI
and XhoI digestion, the BAF fragment was subcloned into the
BamHI and XhoI sites of the pET32 vector (Novagen, Madison,
WI, USA). The TrH-Drosophila BAF fusion protein was then purified
after bacterial expression and lysis using steps including chromatography on
Ni++-IDA agarose.
Immunohistological analyses
For immunostaining, larval tissues were fixed for 25 minutes in 3.7%
formaldehyde, permeabilized for 10 minutes in 0.2% Triton X-100, blocked for 1
hour in PBS with 3% goat serum, and reacted for 24 hours at 4°C with
antibodies to Drosophila lamin Dm0 and derivatives [either
mouse monoclonal antibody (m-mAb) ADL 84
(Stuurman et al., 1995) or
highly specific rabbit antiserum] and/or to Drosophila lamin C [m-mAb
LC28 (Riemer et al., 1995
)],
BrdU [m-mAb G3G4 from the Developmental Studies Hybridoma Bank (DSHB) at the
University of Iowa], NPC proteins containing FG-repeats (m-mAb414 from BabCO,
USA), cyclin E (rat serum provided by Dr H. Richardson, Peter MacCallum Cancer
Institute, Melbourne, Australia), cyclins A and B (for A, m-mAb A12 and for B,
m-mAb F2F4; both from the DSHB), histone H2A (rabbit antiserum provided by Dr
R. Glaser, Wadsworth Center, Albany, NY, USA) and histone H3 phosphopeptides
[for phospho-Ser28, rat mAb HTA28; and for
phospho-Ser10, rabbit antiserum PH10
(Goto et al., 1999
)].
Subsequently, larval tissues were incubated with dichlorotriazinyl
aminofluorescein (DTAF) or Cy3-conjugated secondary antibodies and mounted in
90% glycerol. DNA was visualized with propidium iodide (PI). Before beginning
the immunostaining with the anti-BrdU antibody, larval tissues were treated
with 2 N HCl for 30 minutes, and then neutralized in 0.1 M borate for 5
minutes. Immunofluorescence images were captured by confocal microscopy using
a Radiance 2000 instrument (Bio-Rad Laboratories). To establish specificity of
the anti-BAF antiserum, aliquots were incubated for 12 hours before
immunostaining with either thioredoxin-his-tag alone
(Fig. 1A TrH tag) or
thioredoxin-his-tagged (TrH)-Drosophila BAF fusion protein
(Fig. 1A TrH-BAF); they were
then used directly for immunostaining (see
Fig. 1A). Anti-BAF antisera
that were pre-incubated with TrH tag protein were routinely used in
immunofluorescence experiments. Antiserum specificity was also established
using both standard western blotting and immunostaining to compare immune with
pre-immune sera, both from the same animal (data not shown). By western blot
analyses, anti-BAF antisera were strongly and specifically immunoreactive with
recombinant BAF. When cell extracts were analyzed, a relatively faint 10 kDa
band was detected in both egg and larval as well as Schneider tissue culture
cell extracts using anti-BAF antibodies. However, a band of
42 kDa was
apparently detected as well. Both the 10 kDa and the
42 kDa species,
although weak in intensity, were seen specifically, i.e. they were not seen
with pre-immune serum. Similar difficulties with BAF staining on blots have
previously been reported by others (e.g.
Segura-Totten et al., 2002
).
By immunofluorescence, pre-immune serum showed only weak non-specific
background staining.
|
To examine the interior structures of brain hemispheres, larval tissues were fixed in Bodian's fixative, dehydrated in ethanol, cleared in xylene, mounted in Canada balsam and directly observed by phase contrast microscopy. For thin section EM, larval tissues were directly fixed with 2% glutaraldehyde in 0.1 M cacodylate buffer on ice. Embedding, sectioning and microphotography were carried out at the Hanaichi Electron Microscopic Laboratory, Inc. (Okazaki, Aichi, Japan).
Molecular characterization and rescue of baf null
mutants
For genomic analyses, 30 homozygous baf null mutant third instar
larvae were directly lysed and homogenized at room temperature in 0.5 ml of
buffer H (10 mM Tris, pH 7.5; 60 mM NaCl; 10 mM EDTA; 1% SDS). After addition
of proteinase K to a final concentration of 100 µg/ml, homogenates were
incubated at 50°C for 1 hour, and then genomic DNA was purified by
phenol/chloroform extraction and ethanol precipitation. The baf
genomic region of mutants was amplified by polymerase chain reaction (PCR)
using the primers GGACGTTATTCTGCGACTGG and ATTGGTTCACGTCGCTCTCA, and PCR
products were mapped with several restriction enzymes. The nucleotide
sequences of these PCR fragments were subsequently determined at both ends by
the dideoxy direct sequencing method
(Sanger et al., 1977) (also
see instructions of ABI cycle sequencing ready reaction kits) with primers
TTCAGCGATGGCTATGT and GCTTACACATAATCCCC for
baf1/baf1, and
GAACTGGATCACCCATT and GCTTACACATAATCCCC for
baf2/baf2, using an
Applied Biosystems 320 Genetic Analyzer (Foster City, CA, USA). For rescue
experiments, baf genomic fragments (gBAF) were generated by
PCR from the BAC clone, BACR08I01 (Drosophila Genome Center,
Berkeley, CA) using the primers GGACGTTATTCTGCGACTGG and ATTGGTTCACGTCGCTCTCA,
digested with BamHI and XhoI
(Fig. 2A), and subcloned into
the BamHI and XhoI sites of the pP{lacW} vector. The
resultant plasmid was introduced by P-element-mediated transformation, and
independent lines were established, each carrying genomic baf
(gBAF) on chromosomes 1 (C1) or 3 (C3-2b or C3-4). Rescue of the
baf null mutant phenotype with gBAF was analyzed in the
larval CNS from animals of four different genotypes: (1)
baf1/baf1;
gBAF(C1)/gBAF(C1); (2)
baf1/baf1;
gBAF(C3-2b)/gBAF(C3-2b); (3)
baf1/baf1;
gBAF(C3-4/gBAF(C3-4); and (4)
baf2/baf2;
gBAF(C3-4)/gBAF(C3-4).
|
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
To study the subcellular distribution of Drosophila BAF, confocal
immunostaining analyses of the CNS, imaginal disc and salivary gland tissues
were performed. Specific anti-BAF antiserum was used together with either
antibodies highly specific for Drosophila B type lamins [lamin
Dm0 derivatives usually referred to lamin Dm0 hereafter
(see Smith et al., 1987;
Smith and Fisher, 1989
)] or
antibodies specifically raised against histone H3 phosphopeptides (PH10 or
HTA28 recognizing the Ser10 or Ser28 phospho-epitopes,
respectively) (Goto et al.,
1999
). Histone H3 phosphorylation at both Ser10 and
Ser28 is known to occur only coincident with chromosome
condensation during mitosis, and throughout the transition from prophase to
telophase (Goto et al., 1999
;
Giet and Glover, 2001
).
Confocal microscopy indicated that a significant amount of BAF was nuclear in both CNS and imaginal disc tissues as well as in salivary glands (Fig. 1). Within smaller nuclei, punctate anti-BAF staining was often found (Fig. 1C). Plasma membrane staining was also seen in salivary glands, but this staining was variable and of unclear specificity; it was never detected in other endocyclic larval tissues, the imaginal discs or the CNS (Fig. 1C,D). Incubation of anti-BAF antiserum with the thioredoxin-his-tagged (TrH)-Drosophila BAF fusion protein substantially reduced and/or eliminated nuclear staining; in contrast staining with anti-lamin Dm0 was relatively unaffected (Fig. 1A). Cytoplasmic (non-nuclear) BAF staining was also somewhat reduced by pre-incubation of anti-BAF antiserum with the TrH-Drosophila BAF fusion protein (see Fig. 1A, salivary glands). Pre-immune serum showed only non-specific background fluorescence (not shown) whereas substantial specific staining was seen with our anti-BAF antiserum.
In interphase salivary gland cell nuclei, BAF exhibited a heterogeneous
though clearly chromosomal localization pattern
(Fig. 1E). Significant
`banding' was seen (Fig. 1E).
When CNS and imaginal disc tissues, both containing mitotic cells, were
stained with both anti-BAF and HTA28 antibodies, significant BAF staining was
observed coincident with HTA28 staining of condensed mitotic chromosomes;
cytoplasmic staining was also seen (Fig.
1B,D). BAF cytoplasmic staining increases substantially during
M-phase (relative to that of interphase), suggesting that BAF is also
solubilized from and released from interphase DNA. BAF solubilization was
reported by others (Haraguchi et al.,
2001). Only BAF staining disappeared after pre-incubation of both
BAF and HTA28 antibodies with TrH-Drosophila BAF (data not shown).
Thus, although BAF behavior during M phase is complex, we suggest that a
portion of BAF binds to chromosomes throughout the cell cycle.
Production of baf null mutants
l(2)k10210 is a recessive lethal strain from the Berkeley
Drosophila Genome Gene Disruption Project
(Spradling et al., 1999) with
an artificial P element (pP{lacW}) inserted approximately 350 bp downstream of
the baf termination codon. The P element was confirmed to be single
by Southern hybridization (data not shown). To produce baf null
mutants, the integrated pP{lacW} (Fig.
2A) was excised by mating with a Drosophila line carrying
a
2-3 transposase. A total of 49 lines were established based on
reversion to white eye color of the red-eye color characteristic of
pP{lacW}-bearing flies; three of these reverted to complete viability while
the others (46) remained homozygous lethal. The complete reversion in the
three lines indicates that the lethal phenotype of l(2)k10210 depends
only on the pP{lacW} insertion. To identify baf null mutants,
restriction mapping of baf genomic regions from the 46 lethal lines
was performed (data not shown). For 2 of these lines,
baf1/baf1 and
baf2/baf2, we
determined the genomic sequence flanking the P{lacW} insertion site. In each
case, a small deletion (
1 kb and
3 kb, respectively) that removed
the entire baf gene was found, together with remnants of the P{lacW}
inserts (Fig. 2A; remnants
indicated by black bars with lengths shown in parentheses). The
1 kb
deletion of the baf1 allele was found to remove
only BAF, but the
3 kb deletion of the baf2
allele included the ORF of the Drosophila homolog of mouse pancreatic
triacylglycerol lipase (38% identity) in addition to the baf ORF.
Furthermore, the major start site for mRNA transcription of a connector of
kinase to AP-1 (Cka) protein was found near the P{lacW} integration site in
l(2)k10210 animals (Fig.
2A). To establish the relationship to this Cka protein, we
determined that l(2)k10210, baf1 and
baf2 could all complement available mutants
(l(2)05836 and l(2)s1883) of the cka gene (data not
shown). We therefore conclude that the l(2)k10210,
baf1 and baf2
mutations are all independent of the cka gene.
Comparison of l(2)k10210/l(2)k10210 animals and baf
null mutants
l(2)k10210/l(2)k10210,
baf1/baf1 and
baf2/baf2 animals
all exhibited lethality relatively late in development, but at stages which
were different for l(2)k10210/l(2)k10210 than for
baf1/baf1 and
baf2/baf2. While
l(2)k10210/l(2)k10210 animals survived up to the late pupal stage
just before eclosion, both
baf1/baf1 and
baf2/baf2 were not
able to develop beyond the larval-pupal transition, adult structures never
being formed (data not shown). It is known that larval growth is driven almost
exclusively by increases in cell size with endocyclic DNA replication
(replication without mitosis or cell division), and mitosis during larval
development is restricted primarily to the imaginal discs and central nervous
system (CNS) (Glover, 1989;
Gatti and Baker, 1989
). In the
baf null mutants, endocyclic larval tissues grew normally (data not
shown), but the precursors for adult structures were considerably smaller,
including the imaginal discs and the CNS of third instar larvae just before
pupation (Fig. 2B, for
baf1/baf1 and
baf2/baf2, compared
with the baf1/+ heterozygote and
l(2)k10210/l(2)k10210). Imaginal discs were completely absent, and
cell proliferation and differentiation were not detectable in the thoracic
ganglia and the brain hemispheres of the
baf1/baf1 and
baf2/baf2 CNS.
Typically the brain hemispheres of baf1/+ control animals
form a complex optic lobe anlagen (Fig.
2C). These structures were also observed in the brain hemispheres
of l(2)k10210/l(2)k10210 and
white1/white1
(w1/w1) animals (the
latter as a wild-type control; data not shown). However, the small hemispheres
of baf1/baf1 and
baf2/baf2 larvae did
not show any significant complexity (Fig.
2C). Even just before pupation, the CNS structure of baf
null mutants resembled that of late first or early second instar larval brain
hemispheres isolated from wild-type animals
(Hofbauer and Campos-Ortega,
1990
). Based on these observations, we would suggest that in
Drosophila baf null mutants, maternal BAF becomes insufficient during
early larval development (see also Fig.
7). Preliminary results with both Acridine Orange and TUNEL
staining of the CNS of baf null mutant animals suggested that there
was no increase in apoptosis (data not shown).
|
To confirm whether the deletion of baf actually causes these phenotypes in baf1/baf1 and baf2/baf2 larvae, the wild-type baf genomic sequence (Fig. 2A, B*-Xh*DNA fragment; gBAF) was introduced by P-element-mediated germline transformation. In all baf1/baf1 and baf2/baf2 animals carrying gBAF, development was extended to the late pupa (data not shown), and both the imaginal discs and CNS developed normally (Table 1, gBAF; see also Fig. 6A). After transformation, the stage of lethality as well as the appearance of both the CNS and imaginal discs resembled those seen for the l(2)k10210/l(2)k10210 parent line, indicating that differences of both baf1/baf1 and baf2/baf2 in comparison to l(2)k10210/l(2)k10210 reflect baf function.
|
|
Mitoses are reduced and abnormal in baf null mutants
To assess cell cycle progression in baf null mutants, CNS tissues
from late third instar larvae were examined. Initially, condensed chromosomes
of l(2)k10210/l(2)k10210, baf1/+ and
baf1/baf1 larvae
were visualized with the PH10 and HTA28 antibodies specifically raised against
histone H3 phosphopeptides containing the Ser10 and
Ser28 phospho-epitopes, respectively
(Goto et al., 1999).
PH10-positive staining was detected throughout the CNS of
baf1/+ control third instar larvae just before pupation
(Fig. 3A). Prominent labeling
was located within distinct proliferating zones in the ventral regions of
thoracic ganglia as well as in the brain hemispheres. PH10 immunostaining of
whole mitotic chromosomes was apparent from prophase to telophase, but not in
interphase (Fig. 3C). Similar
results were found with l(2)k10210/l(2)k10210
(Fig. 3A) as well as with
baf1/baf1 rescued by
gBAF (data not shown). In contrast, in the CNS of
baf1/baf1, most
cells were not recognized by the PH10 antibodies, very little signal being
seen overall (Fig. 3B; several
specimens are shown). Similar results were obtained when mitoses were observed
in DAPI-stained brain squashes of
baf1/baf1 larvae in
which an M-phase block had been introduced by colchicine (data not shown),
suggesting that most cells in
baf1/baf1 larvae
never entered M phase. Therefore, the reduced brain size is most likely the
result of a stop in cell cycle progression rather than delayed proliferation,
and the arrest most likely occurs primarily outside of M phase as most
baf1/baf1
neuroblasts apparently do not enter prophase. Those few positive mitotic cells
that were seen in the
baf1/baf1 CNS
stained with PH10 antibodies displayed grossly abnormal chromosomal morphology
(Fig. 3D). These aberrations
were also observed in the CNS of early- and mid-third instar
baf1/baf1 larvae
(data not shown), and suggest that M phase does not progress normally in
baf null mutants.
|
Other phenotypic characteristics of baf null mutants
In mitotically cycling cells, completion of S phase is essential for
nuclear division. As M-phase progression was shown to be almost totally absent
in animals lacking the baf gene, BrdU incorporation was examined to
evaluate DNA synthesis. Upon continuous labeling for 15-20 hours just before
dissection of late third instar larvae, neuroblasts in the CNS of
baf1/+ and l(2)k10210/l(2)k10210 exhibited
substantial incorporation of BrdU (Fig.
4A). This was similar to BrdU incorporation seen in
w1/w1 control
larvae. BrdU was distributed in the ventral region of thoracic ganglia as well
as in particular regions of the brain hemispheres. These patterns of
incorporation were coincident with the cell proliferation patterns reported
for the CNS (Truman and Bate,
1988; Hofbauer and
Campos-Ortega, 1990
). In the case of
baf1/baf1 animals,
BrdU incorporation during late larval development was reduced compared to that
in the control baf1/+ CNS; labeled cells were scattered
throughout the CNS, with some concentrations in the brain hemispheres
(Fig. 4A,B). To test further
the rate of BrdU incorporation in late third instar larvae, dissected
baf1/baf1 CNS
samples were directly incubated (for 1.5 hours) in medium containing BrdU.
Incorporation of BrdU was dramatically reduced, but was still detected in
individual baf1/baf1
nuclei (Fig. 4C).
|
To monitor cell cycle progression further, CNS cells were studied for
expression of cyclins. Immunostaining was performed separately with
anti-cyclin A, anti-cyclin B, or anti-cyclin E antibodies
(Fig. 5). Both cyclin A and
cyclin B act synergistically during the G2-M phase transition
(Knoblich and Lehner, 1993),
whereas cyclin E is required for progression through S phase of the cell cycle
(Knoblich et al., 1994
). All
were readily detected in the baf1/+ control CNS
(Fig. 5, right). However,
although large numbers of
baf1/baf1 larvae
were incubated with anti-cyclin A antibodies (43 larvae), anti-cyclin B
antibodies (63 larvae) or anti-cyclin E antibodies (68 larvae), little or no
staining was seen in the CNS of any late third instar larvae
(Fig. 5, left). Thus cyclins A,
B and E all seem to be down-regulated in
baf1/baf1
larvae.
|
To summarize, loss of the BAF gene (baf1/baf1) apparently leads both to a cell-cycle block before M phase and aberrant BrdU incorporation (see Discussion).
Loss of the baf gene influences nuclear lamin
distribution
As BAF is known to interact directly with the LEM domain proteins, the loss
of BAF would be expected to influence nuclear architecture globally. Therefore
the nuclear lamina of CNS cells was investigated with anti-lamin
Dm0 (the Drosophila B-type lamin) antibodies. The
Drosophila A-type lamin was not investigated because it was
undetectable in larval neuroblasts with a specific antibody (m-mAb LC28;
Reimer et al., 1995), and thus may not be expressed in this tissue; A-type
lamins were detected in other tissues (data not shown).
Both thoracic and abdominal ganglia as well as brain hemispheres of baf1/+ control larvae all showed uniform staining when viewed at low magnification (Fig. 6A); distinct nuclear `rim' staining was seen by confocal microscopy (Fig. 6B). Uniform nuclear rim staining was also observed in the CNS of both baf1/baf1 rescued with gBAF (Fig. 6A,B) and the l(2)k10210/l(2)k10210 parent line (data not shown). In contrast, conspicuous heterogeneity of intensity was seen when nuclei of the baf1/baf1 larval CNS were stained with the anti-lamin Dm0 antibodies (Fig. 6A). More intensely stained nuclei were distributed throughout the CNS, with some tendency for accumulation. By confocal microscopy, cell heterogeneity was even more conspicuous (compare Fig. 6B [baf1/+] with C [baf1/baf1]). Quantitative analyses of baf1/baf1 mutant animals suggested that lamin distribution was obviously unusual in about 30% of brain hemisphere nuclei (n=180). Highly convoluted structures and/or intranuclear accumulation of lamin-containing structures were commonly observed.
Cell heterogeneity with normal and abnormal lamin distribution appears to be a phenotype specific to baf1/baf1 CNS tissues. We hypothesized that baf1/baf1 mutant embryos were endowed with substantial BAF stores (either protein or mRNA), presumably of maternal origin, and that continuous division of neuroblasts, in contrast to non-dividing differentiated cells, during larval development might cause the depletion of maternal BAF supplies in nuclei. These nuclei appear morphologically abnormal as revealed by aberrant lamin staining. To test whether BAF is specifically absent from these unusual nuclei of the baf1/baf1 CNS, double-label confocal immunofluorescence was performed. Wherever lamin staining was grossly aberrant, BAF could not be detected with anti-BAF antiserum (Fig. 7). In the baf1/baf1 mutant used for this analysis, residual BAF protein was also detected in endocyclic tissues (data not shown). Thus loss of BAF was directly correlated with abnormal lamin distribution and misshapen nuclei.
Furthermore, in the baf1/baf1 CNS, abnormal nuclei appeared with a similar distribution to the pattern of BrdU incorporation. Lamina distortion and BrdU incorporation were directly compared by double immunostaining with anti-lamin Dm0 and anti-BrdU antibodies in dissected late third instar larval baf1/baf1 CNS, which were directly incubated for 1.5 hours in medium containing BrdU. While active DNA synthesis and apparently normal nuclear structure were routinely observed in the baf1/+ control CNS (Fig. 8), intense BrdU incorporation seen in baf1/baf1 nuclei usually appeared to coincide with substantial lamina distortion (see particularly Fig. 8, Merge), in spite of lack of detectable cyclin E (Fig. 5). This observation was certainly unexpected and raises several key questions. In addition, although we assume that the bulk of BrdU incorporation results from DNA replication, repair synthesis cannot be excluded.
|
Loss of the baf gene leads to changes in other aspects of
nuclear structure
The abnormal nuclear lamin staining of the
baf1/baf1 CNS
suggested that there might be other changes in nuclear structure. To evaluate
this possibility, the
baf1/baf1 CNS was
further examined both by immunostaining for nuclear pore complex (NPC)
proteins and histones, and by transmission electron microscopy (TEM) of
ultra-thin sections.
When the baf1/baf1 CNS was stained with mAb414 for NPC antigens, in nuclei in which lamin staining appeared normal (bright rim staining with relatively dark central regions), mAb414 labeling was comparable in appearance (Fig. 9). Similar staining was also observed in the baf1/+ control CNS cells (data not shown). However, when abnormal lamin staining was seen in the baf1/baf1 CNS, abnormal mAb 414 staining was seen as well. Abnormalities of both distribution and intensity were observed (Fig. 9). To investigate further, lamin Dm0 distribution was compared with chromatin distribution, the latter being visualized with anti-histone H2A antibodies. When lamin distribution appeared grossly abnormal in baf1/baf1 nuclei, colocalization with chromatin was evident; in addition, these nuclei showed prominent chromatin staining that extended well beyond that of lamin Dm0 (Fig. 9, arrows). Similar images were also obtained after double staining for lamin Dm0 and DNA, respectively (data not shown).
|
The uniform distribution of chromatin seen in baf1/+ control nuclei (Fig. 10A) by TEM was revealed in many instances in baf1/baf1 nuclei to be lost, and heterochromatin-like clumps appeared (Fig. 10B). Moreover, in another baf1/baf1 nucleus, the NE was highly folded, particularly in regions where clumped chromatin was most prominent (Fig. 10C-E, white arrowheads). This folding was similar to the heavily convoluted pattern that was observed by immunostaining with anti-lamin Dm0 antibodies. At the EM level, about 58% of the nuclei of the baf1/baf1 mutant brain hemispheres showed clumped chromatin and convoluted NE. Despite dramatic NE distortions, higher magnification revealed that both nuclear pore complexes and a complete double membrane appeared morphologically normal (Fig. 10D,E, black arrowheads).
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Two different fly lines deleted for the baf gene are almost identical phenotypically, and gBAF rescues all their specific defects. Thus it is highly likely that the phenotypic characteristics described in this article represent effects specifically due to BAF depletion during normal development. However, it remains a formal possibility that effects seen result from BAF depletion only when combined with the l(2)k10210/l(2)k10210 genotype. In either case, the differences of both mutants with the parental line can be considered to reflect the function of the baf gene.
Confocal immunofluorescence demonstrated that a major fraction of
Drosophila BAF localized to nuclei (chromatin) during interphase
(Fig. 1A,C,E) and that a
portion still binds chromosomes throughout mitosis
(Fig. 1B,D). Similar
immunolocalization was reported for the endogenous BAF in rat FRSK cells
(Furukawa, 1999) and after
expression of GFP-tagged BAF, in normal rat kidney cells (Ellenberg, personal
communication). Nuclear localization of BAF was also demonstrated in HeLa
cells (Haraguchi et al., 2001
)
and in a Xenopus in vitro assay
[(Segura-Totten et al., 2002
),
also see the online supplement]. Our observation of chromosomal localization
of BAF during M phase is apparently at odds with that of others (e.g.
Haraguchi et al., 2001
) and
raises the possibility that during the cell cycle, BAF is regulated somewhat
differently between different animals and/or cell types. Drosophila
baf null mutants exhibited typical mitotic defect phenotypes with a
conspicuous abnormality in interphase nuclear morphology but without a
significant accumulation of nuclei blocked in M phase. In addition, in the
grossly abnormal nuclei defined as characteristic of baf null mutants
by immunofluorescence microscopy with anti-lamin antibodies, BAF could not be
detected immunocytochemically with anti-BAF antibodies. Thus, we suggest that
BAF may be essential in cell cycle progression via its involvement in nuclear
organization.
The role of BAF in chromosomal organization
We have demonstrated that mitotic chromosomal abnormalities occur in
baf1/baf1 animals.
Although cells of the
baf1/baf1 CNS were
never seen undergoing normal mitosis (see
Fig. 3), in at least the few
cells that enter M phase, irregular chromosomal shapes are easily found by
propidium iodide staining as well as with phosphorylation-specific
anti-histone H3 antibodies. Furthermore, individual chromosomes, seen commonly
in normal cells, were almost never detected
(Fig. 3C compare with D).
However, we did not detect any anaphase-bridged structures as reported by
Zheng et al. (Zheng et al.,
2000) for C. elegans. These findings suggest that
abnormal chromosome condensation and/or improper segregation can be induced by
BAF depletion.
The effects of BAF on mitotic chromosome structure in vitro are quite
complex. For example, the addition of small amounts of bacterially expressed
BAF to a Xenopus egg extract cell-free nuclear assembly assay was
recently shown to enhance chromatin decondensation, whereas addition of much
greater amounts caused BAF accumulation at chromosome surfaces and inhibited
decondensation (Segura-Totten et al.,
2002). Similar defects of chromosome decondensation after mitosis
have also been demonstrated in vivo in cells overexpressing GFP-tagged BAF
(Ellenberg, personal communication). These effects of BAF on mitotic
chromosome structure agree with the mitotic chromosomal abnormalities observed
in Drosophila bearing the baf null mutation. Together, these
observations imply that the DNA bridging protein BAF has a role in both
assembly and disassembly of mitotic chromosomes.
In addition, our genetic analyses demonstrated abnormal interphase
chromosomal structures (chromatin `clumps') seen preferentially in
Drosophila baf null mutant cells
(Fig. 10B). Apparently similar
clumps were reported in Drosophila embryos mutated for lamin
Dm0 (Harel et al.,
1998). Since anti-phospho-histone H3 antibodies (PH10 and HTA28)
barely label CNS cells from baf null mutant larvae, it would appear
that these chromatin clumps do not represent chromosomal regions prematurely
condensed for mitosis. Rather we suggest that the abnormal clumping observed
reflects some sort of normal interphase condensation process, such as
heterochromatin formation, that has gone awry.
Although mitotic defects were not the only phenotype observed herein,
substantial chromatin localization of BAF was demonstrated both in this work
and by others (e.g. Segura-Totten et al.,
2002). In addition, recent findings in vertebrate systems showed
that BAF concentrates to the NE
(Segura-Totten et al., 2002
)
(J. Ellenberg, personal communication). Together, these and our current
observations suggest that the DNA binding and bridging functions of BAF
(Lee and Craigie, 1998
;
Zheng et al., 2000
), as well
as interactions between chromatin and the NE are all required for normal
interphase chromosomal organization.
The role of BAF in nuclear architecture
From the perspective of NE organization, the results presented here show
that loss of the baf gene actually leads to significant distortion of
the nuclear lamina in the cells of a living animal
(Fig. 6). This observation
could be anticipated from studies in vitro and in cultured cells, but explicit
demonstration nevertheless seems important. Results obtained after
manipulation and transfection of lamin genes
(Furukawa and Hotta, 1993;
Lenz-Bohme et al., 1997
;
Harel et al., 1998
;
Sullivan et al., 1999
;
Liu et al., 2000
;
Schirmer et al., 2001
)
indicate that nuclear lamins have primary roles in the determination of
nuclear shape. For example, transfection of somatic tissue culture cells with
a lamin B1 mutant lacking most of the protein's rod domain (B1
rod)
(Schirmer et al., 2001
) and
mammalian spermatocyte lamin B3 (Furukawa
and Hotta, 1993
) are of particular interest. Both lamins lack the
domains for interaction with multiple proteins including that which putatively
binds LAP2ß (Furukawa and Kondo,
1998
) and induce distortion of nuclear structure in somatic tissue
culture cells. Moreover, fly embryos deficient in lamin Dm0 were
reported to lack the normal attachment of peripheral chromatin to the NE
(Harel et al., 1998
).
Together, these observations suggest that chromatin not only anchors on the NE
but also that normal chromatin-NE interactions are needed to establish and/or
maintain nuclear lamina structure.
Many LEM domain-containing proteins, including otefin are expressed in
Drosophila. In this context, it is noteworthy that BAF interacts with
LEM domain-containing proteins in general
(Furukawa, 1999;
Shumaker et al., 2001
;
Lee et al., 2001
;
Haraguchi et al., 2001
). As
LEM domain-containing proteins are also known to interact directly with
nuclear lamins (Foisner and Gerace,
1993
; Lee et al.,
2001
) (reviewed by Worman and
Courvalin, 2000
), the NE distortion apparently brought on by the
loss of BAF (e.g. see Fig. 7)
might result from abrogation of structural interactions between BAF/DNA
complexes and LEM domain-containing proteins interacting with nuclear lamins.
The hypothetical BAF-otefin-lamin Dm0 interaction is a candidate
for this role (see Gruenbaum et al.,
2000
) in Drosophila brain neuroblasts, particularly since
lamin C (the other fly lamin) was not detected in these cells (data not
shown). Alternatively, it is certainly possible that BAF interacts with lamin
Dm0 directly and this interaction is needed for normal lamina
morphology; recently a BAF-lamin A interaction was demonstrated in vitro
(Holaska et al., 2003
).
The role of BAF in progression through the cell cycle
BAF loss causes lethality and morphological changes in the nuclei as
expected for the depletion of a protein that mediates interactions between the
nuclear envelope and chromatin. Staining for histone H3 phosphorylation showed
a reduction rather than an accumulation of mitotic figures
(Fig. 3) suggesting that cell
cycle defects were likely to be occurring outside of M phase. Interestingly,
the few cells that seem to enter mitosis appear to be abnormal during M phase
(Fig. 3D) as has been reported
from baf RNA interference experiments in C. elegans
(Zheng et al., 2000). The
difference between the vast majority of cells that arrest outside mitosis and
those few that enter may depend on levels of residual maternal BAF.
Specifically some cells may retain enough BAF to proceed into M phase, albeit
aberrantly. Immunolocalization with our current anti-BAF antiserum has not
proved sufficiently sensitive to evaluate this possibility rigorously.
After 1.5 hours of in vitro BrdU labeling of CNS tissues dissected from
late third instar larvae, the number of cells in which BrdU incorporation was
observed was reduced significantly in the
baf1/baf1 animals.
However, the amount of BrdU incorporation seen in some
baf1/baf1 cells
apparently resembled levels in baf1/+ cells
(Fig. 8). Curiously, BrdU
incorporation is most prominent in nuclei with distorted lamin distribution
(Fig. 8). These nuclei seem not
to be able to progress into M phase. Indeed, distorted nuclei (30% from
confocal immunofluorescence observation) in the
baf1/baf1 brain
hemispheres are seen considerably more frequently than cells with grossly
abnormal M phase chromosomes. Furthermore, our immunofluorescence studies of
baf1/baf1 larvae
suggest both that these distorted nuclei lack BAF
(Fig. 7) and that the S phase
inducing cyclin E is down-regulated. We therefore suggest that the BrdU
incorporation observed may represent abnormal DNA replication that is a
specific feature of the baf loss-of-function phenotype. If this is
the case it would suggest that BAF has a role in events leading to or
including S phase, and combined with the fact that others have demonstrated
that BAF is localized in both the nuclear rim and nucleoplasm
(Segura-Totten et al., 2002)
and directly interacts with LEM domain proteins, supports the interpretation
that BAF is directly involved in interphase nuclear functions including DNA
replication. Recent reports that BAF has an additional interphase function in
transcriptional repression (Wang et al.,
2002
) may be relevant in this respect.
In conclusion, the results obtained in this work demonstrate for the first time in vivo that BAF is required for the organization of the nuclear envelope and interphase chromosomes. This requirement probably affects the progression of the cell cycle during Drosophila development.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cai, M., Huang, Y., Zheng, R., Wei, S. Q., Ghirlando, R., Lee, M. S., Craigie, R., Gronenborn, A. M. and Clore, G. M. (1998). Solution structure of the cellular factor BAF responsible for protecting retroviral DNA from autointegration. Nat. Struct. Biol. 5, 903-909.[CrossRef][Medline]
Cai, M., Huang, Y., Ghirlando, R., Wilson, K. L., Craigie, R.
and Clore, G. M. (2001). Solution structure of the constant
region of nuclear envelope protein LAP2 reveals two LEM-domain structures: one
binds BAF and the other binds DNA. EMBO J.
20,
4399-4407.
Cohen, M., Lee, K. K., Wilson, K. L. and Gruenbaum, Y. (2001). Transcriptional repression, apoptosis, human disease and the functional evolution of the nuclear lamina. Trends Biochem. Sci. 26, 41-47.[CrossRef][Medline]
Foisner, R. and Gerace, L. (1993). Integral membrane proteins of the nuclear envelope interact with lamins and chromosomes, and binding is modulated by mitotic phosphorylation. Cell 73, 1267-1279.[Medline]
Furukawa, K. (1999). LAP2 binding protein 1
(L2BP1/BAF) is a candidate mediator of LAP2-chromatin interaction.
J. Cell Sci. 112,
2485-2492.
Furukawa, K. and Hotta, Y. (1993). cDNA cloning of a germ cell specific lamin B3 from mouse spermatocytes and analysis of its function by ectopic expression in somatic cells. EMBO J. 12, 97-106.[Abstract]
Furukawa, K. and Kondo. T. (1998). Identification of the lamina-associated polypeptide 2 binding domain of B-type lamin. Eur. J. Biochem. 251, 729-733.[Abstract]
Furukawa, K., Glass, C. and Kondo, T. (1997). Characterization of the chromatin binding activity of lamina-associated polypeptide (LAP) 2. Biochem. Biophys. Res. Commun. 238, 240-246.[CrossRef][Medline]
Furukawa, K., Fritze, C. E. and Gerace, L.
(1998). The major nuclear envelope targeting domain of LAP2
coincides with its lamin binding region but is distinct from its chromatin
interaction domain. J. Biol. Chem.
273,
4213-4219.
Gant, T. M., Harris, C. A. and Wilson, K. L.
(1999). Roles of LAP2 proteins in nuclear assembly and DNA
replication: Truncated LAP2beta proteins alter lamina assembly, envelope
formation, nuclear size, and DNA replication efficiency in Xenopus laevis
extracts, J. Cell Biol.
144,
1083-1096.
Gatti, M. and Baker, B. S. (1989). Genes controlling essential cell-cycle functions in Drosophila melanogaster. Genes Dev. 3, 438-453.[Abstract]
Giet, R. and Glover, D. M. (2001). Drosophila
aurora B kinase is required for histone H3 phosphorylation and condensin
recruitment during chromosome condensation and to organize the central spindle
during cytokinesis. J. Cell Biol.
152,
669-682.
Glover, D. M. (1989). Mitosis in Drosophila. J. Cell Sci. 92, 137-146.[Abstract]
Goto, H., Tomono, Y., Ajiro, K., Kosako, H., Fujita, M.,
Sakurai, M., Okawa, K., Iwamatsu, A., Okigaki, T., Takahashi, T. and Inagaki,
M. (1999). Identification of a novel phosphorylation site on
histone H3 coupled with mitotic chromosome condensation. J. Biol.
Chem. 274,
25543-25549.
Gruenbaum, Y., Wilson, K. L., Harel, A., Goldberg, M. and Cohen, M. (2000). Nuclear lamins-structural proteins with fundamental functions. J. Struct. Biol. 129, 313-323.[CrossRef][Medline]
Haraguchi, T., Koujin, T., Segura, M., Lee, K. K., Matsuoka, Y., Yoneda, Y., Wilson, K. L. and Hiraoka, Y. (2001). BAF is required for emerin assembly into the reforming nuclear envelope. J. Cell Sci. 114, 4575-4585.[Medline]
Harel, A., Goldberg, M., Ulitzur, N. and Gruenbaum, Y. (1998). Structural organization and biological roles of the nuclear lamina. In Textbook of Gene Therapy and Molecular Biology: From Basic Mechanism to Clinical Applications Vol. 1 (ed. T. Boulikas), pp. 529-542. Palo Alto, CA: Gene Therapy Press.
Hofbauer, A. and Campos-Ortega, J. A. (1990). Proliferation pattern and early differentiation of the optic lobes in Drosophila melanogaster. Rouxs Arch. Dev. Biol. 198, 264-274.
Holaska, J. M., Lee, K. K., Kowalski, A. K. and Wilson, K.
L. (2003). Transcriptional repressor germ cell-less (GCL) and
barrier to autointegration factor (BAF) compete for binding to emerin in
vitro. J. Biol. Chem.
278,
6969-6975.
Knoblich, J. A. and Lehner, C. F. (1993). Synergistic action of Drosophila cyclins A and B during the G2-M transition. EMBO J. 12, 65-74.[Abstract]
Knoblich, J. A., Sauer, K., Jones, L., Richardson, H., Saint, R. and Lehner, C. F. (1994). Cyclin E controls S phase progression and its down-regulation during Drosophila embryogenesis is required for the arrest of cell proliferation. Cell 77, 107-120.[Medline]
Laguri, C., Gilquin, B., Wolff, N., Romi-Lebrun, R., Courchay, K., Callebaut, I., Worman, H. J. and Zinn-Justin, S. (2001). Structural characterization of the LEM motif common to three human inner nuclear membrane proteins. Structure 9, 503-511.[Medline]
Lee, K. K., Haraguchi, T., Lee, R. S., Koujin, T., Hiraoka, Y. and Wilson, K. L. (2001). Distinct functional domains in emerin bind lamin A and DNA bridging protein BAF. J. Cell Sci. 114, 4567-4573.[Medline]
Lee, M. S. and Craigie, R. (1998). A previously
unidentified host protein protects retroviral DNA from autointegration.
Proc. Natl. Acad. Sci. USA.
95,
1528-1533.
Lenz-Bohme, B., Wisma, J., Fuchs, S., Reifegerste, R., Buchner,
E., Betz, H. and Schmitt, B. (1997). Insertional mutation of
the Drosophila nuclear lamin Dm0 gene results in defective nuclear
envelopes, clustering of nuclear pore complexes, and accumulation of annulate
lamellae. J. Cell Biol.
137,
1001-1016.
Lin, F., Blake, D. L., Callebaut, I., Skerjanc, I. S., McBurney, M. W., Pauline-Levasseur, M. and Worman, H. J. (2000). MAN1: an integral protein of the inner nuclear membrane that shares the LEM domain with lamina associated polypeptide2/thymopoietin, emerin and proteins of Caenorhabditis elegans. J. Biol. Chem. 275, 4080-4087.
Liu, J., Ben-Shahar, T. R., Riemer, D., Treinin, M., Spann, P.,
Weber, K., Fire, A. and Gruenbaum, Y. (2000). Essential roles
for Caenorhabditis elegans lamin gene in nuclear organization, cell
cycle progression, and spatial organization of nuclear pore complexes.
Mol. Biol. Cell 11,
3937-3947.
Martins, S. B., Eide, T., Steen, R. L., Jahnsen, T., Skalhegg,
B. S. and Collas, P. (2000). HA95 is a protein of the
chromatin and nuclear matrix regulating nuclear envelope dynamics.
J. Cell Sci. 113,
3703-3713.
Moir, R. D., Yoon, M., Khuon, S. and Goldman, R. D.
(2000). Nuclear lamins A and B1. Different pathways of assembly
during nuclear envelope formation in living cells. J. Cell
Biol. 151,
1155-1168.
Riemer, D., Stuurman, N., Berrios, M., Hunter, C., Fisher, P. A.
and Weber, K. (1995). Expression of Drosophila lamin C is
developmentally regulated: analogies with vertebrate A-type lamins.
J. Cell Sci. 108,
3189-3198.
Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463-5467.[Abstract]
Schirmer, E. C., Guan, T. and Gerace, L.
(2001). Involvement of the lamin rod domain in heterotypic lamin
interactions important for nuclear organization. J. Cell
Biol. 153,
479-489.
Segura-Totten, M., Kowalski, A. K., Craigie, R. and Wilson, K.
L. (2002). Barrier-to-autointegration factor: major roles in
chromatin decondensation and nuclear assembly. J. Cell
Biol. 158,
475-485.
Shumaker, D. K., Lee, K. K., Tanhehco, Y. C., Craigie, R. and
Wilson, K. L. (2001). LAP2 binds to BAF-DNA complexes:
requirement for the LEM domain and modulation by variable regions.
EMBO J. 20,
1754-1764.
Smith, D. E., Gruenbaum, Y., Berrios, M. and Fisher, P. A. (1987). Biosynthesis and interconversion of Drosophila nuclear lamin isoforms during normal growth and in response to heat shock. J. Cell Biol. 105, 771-790.[Abstract]
Smith, D. E. and Fisher, P. A. (1989). Interconversion of Drosophila nuclear lamin isoforms during oogenesis, early embryogenesis, and upon entry of cultured cells into mitosis. J. Cell Biol. 108, 255-265.[Abstract]
Spradling, A. C., Stern, D., Beaton, A., Rhem, E. J., Laverty,
T., Mozden, N., Misra, S. and Rubin, G. M. (1999). The
Berkeley Drosophila genome project gene disruption project: single
P-element insertions mutating 25% of vital Drosophila genes.
Genetics 153,
135-177.
Stuurman, N., Maus, N. and Fisher, P. A.
(1995). Interphase phosphorylation of the Drosophila nuclear
lamin: site-mapping using a monoclonal antibody. J. Cell
Sci. 108,
3137-3144.
Stuurman, N., Heins, S. and Aebi, U. (1998). Nuclear lamins: their structure, assembly and interactions. J. Struct. Biol. 122, 42-66.[CrossRef][Medline]
Sullivan, T., Escalante-Alcalde, D., Bhatt, H., Anver, M., Bhat,
N., Nagashima, K., Stewart, C. L. and Burke, B. (1999). Loss
of A-type lamin expression compromises nuclear envelope integrity leading to
muscular dystrophy. J. Cell Biol.
147,
913-920.
Truman, J. W. and Bate, M. (1988). Spatial and temporal patterns of neurogenesis in the central nervous system of Drosophila melanogaster. Dev. Biol. 125, 145-157.[Medline]
Wang, X., Xu, S., Rivolta, C., Li, L. Y., Peng, G.-H., Swain, P.
K., Sung, C.-H., Swaroop, A., Berson, E. L., Dryja, T. P. and Chen, S.
(2002). Barrier-to-autointegration factor (Baf) interacts
with the cone-rod homeobox (Crx) and represses its transactivation function.
J. Biol. Chem. 277,
43288-43300.
Worman, H. J. and Courvalin, J.-C. (2000). The inner nuclear membrane. J. Membr. Biol. 177, 1-11.[CrossRef][Medline]
Yang, L., Guan, T. and Gerace, L. (1997).
Lamin-binding fragment of LAP2 inhibits increase in nuclear volume during the
cell cycle and progression into S phase. J. Cell Biol.
139,
1077-1087.
Zheng, R., Ghirlando, R., Lee, S., Mizuuchi, M. K., Krause, M.
and Craigie, R. (2000). Barrier-to-autointegration factor
(BAF) bridges DNA in a discrete, higher-order nucleoprotein complex.
Proc. Natl. Acad. Sci. USA
97,
8997-9002.