Adolf-Butenandt-Institut/Zellbiologie, Universität München, Schillerstr. 42, D-80336 München, Germany
E-mail: ralph.graef{at}lrz.uni-muenchen.de
Accepted 16 February 2002
![]() |
Summary |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Dictyostelium, Centrosome, Spindle pole body, NIMA-related kinase, Nek2
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
However, serine/threonine kinases related to NIMA, but with other cellular
functions, have been identified in many organisms. In humans, at least six
NIMA-related kinases have so far been isolated as full-length or partial
sequences (Levedakou et al.,
1994; Lu and Hunter,
1995
; Schultz et al.,
1994
, Schultz and Nigg,
1993
). Among these, Nek2 is most closely related to NIMA. But
instead of promoting mitosis, it has a centrosomal function in centrosome
separation (Fry et al.,
1998b
). In animal cells, the first step of centrosome duplication
(Kochanski and Borisy, 1990
),
that is, the formation of daughter centrioles, is initiated at the G1/S
transition. In early prophase, the centrosome consists of two complete
centriole pairs and their pericentriolar matrix, defining two centrosomal
entities. The centriole pairs are linked by a fibrous structure
(Paintrand et al., 1992
) that
is associated with a long coiled coil protein called C-Nap1
(Fry et al., 1998a
;
Mayor et al., 2000
). C-Nap1
(which had been independently characterized as Cep250)
(Mack et al., 1998
) was
identified in a yeast two-hybrid screen using human Nek2 as a bait
(Fry et al., 1998a
). Nek2
plays a key role in centriole/centrosome separation in early mitosis by
phosphorylation of C-Nap1. This seems to trigger the dissociation of C-Nap1
from the centrosome, which in turn leads to a loss of centriole cohesion,
allowing the two centrosomal entities to separate and organize the mitotic
spindle (Fry et al., 1998a
;
Mayor et al., 2000
). Protein
phosphatase 1
(PP1
), another binding partner of Nek2, acts as a
physiological antagonist of Nek2 and seems to stabilize centrosome cohesion by
dephosphorylation of Nek2 and C-Nap1
(Helps et al., 2000
;
Meraldi and Nigg, 2001
).
Analysis of Nek2B in Xenopus embryos revealed an additional function
of Nek2 in centrosome maintenance and assembly. Nek2B inhibition by antibody
injection or overexpression of catalytically inactive, dominant-negative Nek2B
caused centrosome dispersal (Uto and
Sagata, 2000
), and Nek2B immunodepletion delayed the assembly of
components of the pericentriolar matrix, including
-tubulin and Nek2B,
at the sperm basal bodies in egg extracts
(Fry et al., 2000a
).
Dictyostelium discoideum amoebae have become an interesting model
system for the comparative analysis of centrosomes
(Daunderer et al., 1999)
because of their good structural characterization
(Moens, 1976
;
Roos, 1975
), the availability
of a centrosome isolation protocol
(Gräf et al., 1998
), the
genome project (Kay and Williams,
1999
) and the molecular characterization of centrosomal
components, such as
-tubulin
(Euteneuer et al., 1998
),
DdCP224 (Gräf et al.,
2000b
) and the homologues of centrin (DdCrp)
(Daunderer et al., 2001
), Spc97
and Spc98 (Gräf et al.,
2000a
). The Dictyostelium centrosome represents an
acentriolar centrosome type with a unique mode of duplication
(Ueda et al., 1999
). In
interphase, the Dictyostelium centrosome consists of a box-shaped,
layered core structure surrounded by an amorphous matrix called the corona.
The corona harbors electron-dense nodules containing
-tubulin and,
thus, the microtubule-nucleation sites
(Euteneuer et al., 1998
).
Centrosome duplication starts in early prophase with an enlargement of the
layered core and dissociation of the surrounding corona with its emanating
microtubules. In prometaphase, the central layer disappears and the two outer
layers peel apart and become inserted into the nuclear envelope. Microtubules
are nucleated from the inner surfaces of the two layers and form an elongating
spindle, which separates the two spindle poles. During the course of the
separation process, the edges of the plaque-like poles bend away from the
nucleus and each plaque folds back onto itself in telophase. The
microtubule-nucleating surface is now exposed to the outside, whereas the
former outside becomes buried inside. The new inner layer matures in late
telophase. Thus, similar to mammals but unlike yeast where the new spindle
pole body consists only of freshly assembled components
(Adams and Kilmartin, 2000
),
the Dictyostelium centrosome duplicates in a semiconservative manner,
as each daughter centrosome originates from one of the two former outer layers
(Gräf et al., 2000a
).
With regard to the time point of centrosome duplication,
Dictyostelium is unique because duplication starts late in the cell
cycle, in M-phase, and is not synchronized with the G1/S transition as in
budding yeast or animals. This raises the question of whether this process can
be regulated by a similar set of kinases (for a review, see
Fry et al., 2000b
).
To address this issue in Dictyostelium, this study describes the characterization of a NIMA-related kinase, which represents the first non-vertebrate homologue of Nek2. This kinase, named DdNek2, is structurally related to Nek2, is an integral centrosomal component and plays a role in the formation of MTOCs.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Protein expression and generation of polyclonal antibodies
Clone SLD805 from the Tsukuba cDNA project (kindly provided by Y. Tanaka)
was sequenced completely (MWG-Biotech, Ebersberg, Germany; the sequence can be
retrieved at
http://www.csm.biol.tsukuba.ac.jp/cDNAproject.html
). The complete coding sequence (position 53-1306) was cloned into the
bacterial expression vector pMAL-c2 (NEB, Schwalbach, Germany) as described
recently (Gräf, 2001b).
DdNek2, C-terminally fused to maltose-binding protein (MBP), was expressed in
E. coli XL-1 blue cells and purified on an amylose resin (NEB). The
purified fusion protein was used for the immunization of two rabbits (J.
Pineda, Antikörperservice, Berlin, Germany). Antisera were taken on the
61st day, following five immunizations with
0.2 mg antigen each.
Antibodies were purified by affinity chromatography on columns with
immobilized MBP-DdNek2. The fusion protein was coupled to NHS-activated
Sepharose (NHS Sepharose 4B, Pharmacia). Specific antibodies were eluted with
100 mM glycine, pH 2.7 and neutralized immediately by addition of a droplet of
1 M Tris/Cl, pH 8.7.
The C-terminal deletion mutants MBP-315-N, MBP-
267-N and
MBP-
258-C were prepared as follows. The respective coding sequence was
amplified by the polymerase chain reaction (PCR) using an upstream
EcoRI-linker primer binding at base position 53-75 and downstream
XbaI-linker primers binding at base position 830-853
(MBP-
267-N) and 977-997 (MBP-
315-N), respectively. The binding
sites for EcoRI/XbaI linker primers for construction of the
N-terminal deletion construct MBP-
258-C were 830-854 (upstream) and
1287-1309 (downstream). Clone SLD805 was used as the template for PCR. The DNA
fragments were cloned into pMAL-c2 using the EcoRI and XbaI
restriction sites, and proteins were expressed and purified as described
above. If MBP-fusion proteins were used for kinase activity assays, a column
buffer containing 50 mM Hepes/K (pH 7.4), 150 mM Kcl, 2 mM MgCl2
and 1 mM dithiotreitol (DTT) was used, and fusion proteins were eluted with
kinase buffer (50 mM Hepes/K (pH 7.4), 5 mM MnCl2, 5 mM
ß-glycerophosphate, 1 mM DTT) containing 10 mM maltose.
Construction of GFP-expression vectors
C-terminal fusions of DdNek2 with GFP showed only a weak fluorescence and
were not detectable at the expected cellular localization. The phenotypes of
N-terminal GFP-fusion mutants were not affected by the vector system used. The
first vector used was pDGFPMCS (Weber et
al., 1999), where expression is driven by the actin 15 promoter.
The second was the Tet-off system, which was based on MB38/MB35
(Blaauw et al., 2000
). MB38 was
cut with BglII and MluI and modified by insertion of
superglow-GFP (Qbiogene, Heidelberg, Germany) followed by a
SalI-SacI-EcoRI-BamHI polylinker. The
third, a 7.75 kb plasmid named pDiscGFPSSEB2, drives expression of the protein
of interest by the discoidin promoter
(Wetterauer et al., 1995
). The
promoter is followed by superglow-GFP, the
SalI-SacI-EcoRI-BamHI linker, the actin 8
terminator, the V18-Tn5 selection cassette for G418 selection
(Wetterauer et al., 1996
) on
Klebsiella aerogenes lawns and an ampicillin resistance cassette. All
DdNek2 full-length and deletion constructs were inserted in these vectors
employing the SalI and EcoRI restriction sites, and all
DdNek2 fragments were generated by PCR using SalI- and
EcoRI-linker primers and the original SLD805 clone as a template. The
base positions for primer-binding sites on SLD805 for upstream and downstream
primers, respectively, were 53-75/1287-1309 for GFP-DdNek2 and GFP-K33R,
53-75/830-853 for GFP-
267-N, 53-75/977-997 for GFP-
315-N,
830-854/1287-1309 for GFP-
258-C and 986-1007 for GFP-
312-C.
Sequences were confirmed by custom sequencing (Delphiseq, Regensburg,
Germany).
Generation of the DdNek2-K33R point mutant
The DdNek2 K33R point mutation, where the A at base position 150 was
replaced with G, was generated by PCR in a two-step approach. Two fragments
were amplified, the first, using the mutagenesis primer
GATGGAAGAGTTTTAGTTTGGAGAGAAATTTGTTATG (base positions
128-164) and a downstream NsiI-linker primer (binding at base
position 1287-1309), and the second, using the complementary mutagenesis
primer and an BamHI upstream linker primer (binding at base position
53-75). The PCR products were purified with QiaQuick columns (Qiagen, Hilden,
Germany) and used as a template for the second PCR reaction with the
BamHI upstream and NsiI downstream primers only. Since the
single-stranded fragments from the first reaction are complementary to each
other in the mutagenesis primer sequence they will anneal in the first
annealing step, and the complete coding sequence including the point mutation
will be obtained in the first extension step. This is the only possible
template for the SalI upstream and EcoRI downstream primers,
since the mutagenesis primers have been removed in the purification step. The
resulting PCR product was cloned into p1ABsr8
(Gräf et al., 2000b)
using the BamHI and NsiI restriction sites. The complete
DdNek2-K33R sequence was then amplified using the EcoRI upstream and
XbaI downstream primer for cloning into pMAL-c2 or the SalI
upstream and EcoRI downstream primer (see above) for cloning into the
GFP-vectors. After these cloning steps, sequences were confirmed by custom
sequencing (Delphiseq, Regensburg, Germany).
Transformation into Dictyostelium cells
Plasmids were transformed into AX2 cells using electroporation
(Mann et al., 1998), and
clones were selected with 4 µg/ml blasticidin S in liquid culture in the
case of pDGFPMCS- and MB38-based constructs and with 100 µg/ml G418 on
Klebsiella aerogenes plates
(Wetterauer et al., 1996
) in
case of pDiscSSEB2-based constructs. In the latter case, mutant clones were
further grown in liquid medium containing 10 µg/ml G418 after the selection
step. At least three independent clones were analyzed for each transformant
and, except for minor differences in GFP fluorescence intensity, no
differences between corresponding clones were observed.
Kinase activity assays
In vitro kinase activity of the MBP-fusion proteins was assayed according
to Fry and Nigg (Fry and Nigg,
1997) as described recently
(Gräf, 2001b
). In brief,
100 µl reactions in kinase buffer contained 5 µg of dephosphorylated
/ß-casein (Sigma, Deisenhofen, Germany) or BSA as a negative
control, 5 µg of the purified fusion protein, 2 µg/ml heparin, 4 µM
ATP and 10 µCi of
-[32P]-ATP (3000 Ci/mmol; ICN
Biomedicals, Eschwege, Germany). After incubation for 1 hour at 30°C,
proteins were concentrated by trichloroacetic acid precipitation
(Bollag et al., 1996
) and
subjected to SDS gel electrophoresis. The dried gel was exposed overnight on
X-ray film (Kodak X-OMAT AR5) at -70°C.
Image processing
Confocal microscopic image stacks were processed with the Huygens 2.2
deconvolution software (Bitplane AG, Zürich, Switzerland) using a
computed theoretical point spread function and the Maximum Likelihood
Estimation algorithm.
Other methods
SDS polyacrylamide electrophoresis, immunoblotting, light microscopy,
indirect immunofluorescence labeling, centrosome isolation and preparation of
cytosolic protein extracts were performed as described recently
(Daunderer et al., 2001;
Gräf, 2001a
).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Catalytic activity of recombinant DdNek2 requires the leucine zipper
domain
The catalytic properties of DdNek2 and several deletion constructs were
tested by in vitro kinase assays. This was facilitated by the fact that DdNek2
expressed as a MBP-fusion protein in E. coli was catalytically
active, unlike its human homologue, which could not be functionally expressed
in bacteria using the same system (Fry and
Nigg, 1997). In these assays, DdNek2 exhibited the typical
properties of Nek2 kinases, that is, it underwent autophosphorylation and was
able to phosphorylate the artificial substrates casein
(Fig. 2), histone H1 and myelin
basic protein (not shown). As expected, activity was stronger with
ß-casein than with
-casein. The catalytically inactive DdNek2-K33R
point mutant (MBP-K33R) corresponding to the human K37R mutant
(Fry et al., 1995
), where a
critical lysine in the catalytic domain was replaced by an arginine residue,
showed a higher electrophoretic mobility owing to the lack of phosphate groups
(Fig. 2B). The requirement of
the leucine zipper and C-terminal domain for kinase activity was investigated
with DdNek2 deletion mutants (Fig.
2A). The catalytic domain alone (MBP-
267-N) was inactive,
whereas the mutant consisting of the catalytic and dimerization domains
(MBP-
315-N) retained a weak ß-casein kinase activity but no
autophosphorylation activity. This suggests that the leucine zipper is
essential for catalytic activity and that autophosphorylation increases kinase
activity, as in human Nek2, where the leucine zipper is required for
dimerization and each catalytic domain within the Nek2 dimer
trans-autophosphorylates the C-terminus
(Fry et al., 1999
). Since the
MBP-
315-N mutant, where the C-terminal domain was deleted, was not
autophosphorylated, this domain is likely to contain the autophosphorylation
target site, similar to human Nek2. This hypothesis was supported by
experiments where a deletion mutant lacking the catalytical domain
(MBP-
258-C) was used as a substrate for MBP-DdNek2 in the kinase
activity assay. Phosphorylation of MBP-
258-C was relatively weak
compared with autophosphorylation of MBP-DdNek2. This is not surprising, since
the mechanism of trans-autophosphorylation within the kinase dimer does not
require binding of a substrate, whereas MBP-
258-C needs to bind to the
active dimer before it can be phosphorylated. The affinity of MBP-DdNek2 for
MBP-
258-C is likely to be rather low since, in vivo, the mechanism of
trans-autophosphorylation requires no binding site for the C-terminal domain
within the complete, dimerized kinase.
|
DdNek2 is a genuine centrosomal component and localized to the
centrosome throughout the entire cell cycle
Two rabbits (rabbit 1 and 2) were immunized with recombinant MBP-DdNek2.
Both antisera showed similar staining patterns in western blots and
immunofluorescence microscopy; however, the rabbit 1 serum turned out to be
more specific and was used in all experiments presented here. Preimmune
antibodies and anti-MBP antibodies showed no crossreactions or background
staining when used at a comparable concentration (data not shown). On western
blots of cytosolic extracts and isolated centrosome preparations, anti-DdNek2
antibodies stained a single band of 46 kDa, which was close to the
calculated molecular mass of DdNek2 (Fig.
3A). Furthermore, the antibodies clearly stained isolated
centrosomes in immunofluorescence microscopy
(Fig. 3B,C). Since isolated
Dictyostelium centrosomes are devoid of microtubules
(Gräf et al., 1998
),
centrosomal localization of DdNek2 is independent of microtubules.
Furthermore, anti-Dd-Nek2 stained the centrosome throughout the entire cell
cycle in immunofluorescence microscopy of vegetative AX2 cells
(Fig. 4A). This localization
pattern was confirmed when DdNek2 was expressed as a GFP-fusion protein in AX2
cells (Fig. 4B). Taken
together, these results demonstrate that DdNek2 is a genuine centrosomal
component. The existence of a large cytosolic DdNek2 pool does not contradict
this finding since it is also the case for human Nek2 and common for many, if
not most, centrosomal proteins, including classical centrosomal components
such as
-tubulin (Moudjou et al.,
1996
) and centrin (Paoletti et
al., 1996
). However, it may argue for further cytosolic functions
of this kinase as well.
|
|
GFP-DdNek2 overexpression causes formation of supernumerary
MTOCs
Many of the cells expressing GFP-DdNek2 were only weakly fluorescent and
rarely showed a mutant phenotype other than faintly green-fluorescent
centrosomes. However, the majority of cells exhibiting a high level of
GFP-DdNek2 expression in fluorescence microscopy (20% of all cells)
displayed aberrations in centrosome number and morphology, nuclear size and
shape, or contained multiple GFP foci (Fig.
5A-E; Table 1). These defects also occurred in combination. The segregation into a weakly and
a strongly fluorescent cell population was independent of the promoter used
for expression (see Materials and Methods). Most likely, overexpression of the
kinase affects cell division and, thus, there is a permanent selective
pressure in favor of cells with an attenuated GFP-DdNek2 expression. Among the
overexpressing cells only
30% are more or less normal, that is, they had
only one green, nucleus-associated centrosome. In contrast, if cells were
transformed with a GFP-vector without an insert, almost 95% of all cells were
normal (Table 1). About 25% of
all GFP-DdNek2 cells contained GFP-fluorescent dots, often more than 10, which
did not stain with
-tubulin antibodies
(Fig. 5E) but which might
include other centrosomal proteins in addition to GFP-DdNek2. Misshapen
centrosomes that do not occur in wild-type cells were also observed
(Fig. 5D). In some cases, cells
also contained unusually large nuclei or additional, very small nuclei
(Fig. 5C), both indicating
defects in proper chromosome segregation. About 40% of the strongly
fluorescent cells contained supernumerary MTOCs that could be stained with
anti-
-tubulin antibodies. The presence of the four centrosomal markers
-tubulin (Euteneuer et al.,
1998
), DdCP224 (Gräf et
al., 2000b
), DdNek2 and the NAB350 antigen
(Kalt and Schliwa, 1996
) as
well as the capacity to nucleate microtubules suggest that these MTOCs
represent complete centrosomes (Figs
5 and
6). Furthermore, confocal
microscopy revealed that both extra MTOCs and normal, nucleus-associated
centrosomes appear as doughnut-like structures of approximately the same size
when stained with anti-DdCP224 antibodies
(Fig.
6A',D'-F'). This staining pattern appears
because DdCP224 is part of the centrosomal corona that surrounds the
centrosomal core (Gräf et al.,
2000b
). In merged confocal images of DdCP224 and DdNek2
localization (Fig. 6D'')
and in tracings of fluorescence intensity along a line through the center of
the centrosomes (Fig.
6D'''), it becomes evident that the DdNek2-labeled part of
the centrosome is surrounded by the corona. This suggests that DdNek2 is
associated with the centrosomal core structure. This staining pattern is
indistinguishable in normal centrosomes and supernumerary MTOCs. Taken
together, overexpression of GFP-DdNek2 causes the formation of
centrosome-like, supernumerary MTOCs.
|
|
|
The defects of GFP-DdNek2 cells are not dependent on catalytic
activity but are linked to overexpression of the C-terminal domain
It was tempting to speculate that the observed abnormalities were caused by
an increase of DdNek2 activity owing to overexpression. Therefore,
catalytically inactive DdNek2-K33R was also expressed in
Dictyostelium as a GFP-fusion protein. Surprisingly, the phenotypes
of the GFP-K33R mutants were indistinguishable from the GFP-DdNek2 mutants in
all their aspects, including the occurrence of supernumerary MTOCs, misshapen
centrosomes, multiple GFP-foci and nuclear abnormalities
(Fig. 5;
Table 1). Again, there was no
dependence on the promoters used. Thus, the mutant phenotype cannot be caused
by an overdose of catalytic activity. To elucidate the cause of the mutant
phenotype, GFP fusions with DdNek2 deletion mutants were created
(Fig. 3).
Dictyostelium mutants expressing only the catalytic domain with GFP
(GFP-267-N) showed no centrosomal labeling but they had high overall
cytosolic fluorescence (Fig.
7A,B). If the leucine zipper sequence was present as well, the
resulting fusion protein (GFP-
315-N) clearly localized to the
centrosome (Fig. 7C,D).
Supernumerary MTOCs or other striking abnormalities were detected neither in
GFP-
267-N nor in GFP-
315-N mutants
(Fig. 7A-D). However, two
further deletion mutants, GFP-
258-C and GFP-
312-C, which
expressed the C-terminus/leucine zipper construct and the C-terminus alone,
respectively, localized to centrosomes and exhibited the same mutant
phenotypes as GFP-DdNek2 and GFP-K33R cells
(Fig. 7E-H). Thus, the
supernumerary MTOCs, misshapen centrosomes, multiple GFP-foci and nuclear
abnormalities were provoked by overexpression of the C-terminal domain.
Furthermore, these results indicate the existence of two centrosomal targeting
domains for DdNek2, one within the C-terminal domain and one within the
catalytic or leucine zipper domain.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In vitro kinase assays revealed that the catalytic properties of
bacterially expressed DdNek2 were very similar to those of human Nek2
expressed in insect cells. This is also reflected by similar structural
properties, that is, both proteins are approximately the same length and have
a catalytic domain that is followed by an unusual leucine zipper motif. In
human Nek2, the leucine zipper motif consists of five heptad repeats with
leucines at the d position, acidic instead of hydrophobic residues at
the a and basic residues at the g position. Owing to this
arrangement, the leucines are flanked by alternating basic and acidic residues
within the -helix (Fry et al.,
1999
). This seems to favor the formation of Nek2 homodimers via a
very stable parallel coiled coil. Fry et al.
(Fry et al., 1999
) provided
compelling evidence that autophosphorylation occurs at the C-terminal domain
and requires dimerization and that each catalytic domain can
trans-autophosphorylate the C-terminus. The leucine zipper motif of DdNek2 is
longer than the usual four to five heptads. It extends over six heptad repeats
and, if one accepts the isoleucine at position 314 as a conservative
substitution for leucine, there are even eight heptads (amino-acid position
270-339; Fig. 1A). All
a positions of these heptads are occupied by an acidic amino acid
with the only exception being a tyrosine in the second heptad, and the
g positions contain basic amino acids in five heptads and neutral
ones (at physiological pH) in three heptads. Thus, the overall concept of the
unusual Nek2 leucine zipper, which leads to dimerization, is evident in DdNek2
as well. This was supported by the kinase activity assays, which showed that
the leucine zipper is required for enzymatic activity and that the C-terminal
domain contains the target site for autophosphorylation. Therefore, at least
some of the functions of the C-terminal domain seem to be conserved in
Dictyostelium and humans, and it is likely that the tertiary
structures of both proteins are comparable, although the amino-acid sequences
of this region are only weakly conserved. However, a second coiled coil region
followed by a cyclin A-type extended destruction box (D-box) at the very
C-terminus of the vertebrate Nek2 proteins
(Hames et al., 2001
) is
missing in DdNek2. This region also includes PEST-like motifs for rapid
degradation (Rechsteiner and Rogers,
1996
; Rhee and Wolgemuth,
1997
; Uto et al.,
1999
). The A-type extended D-box seems to be responsible for the
rapid degradation of Xenopus and mammalian Nek2A in early mitosis
(Hames et al., 2001
). DdNek2
does not contain this D-box, and there were no PEST sequences found using the
PESTfind program. An investigation of cell-cycle-dependent changes of the
DdNek2 expression level is not possible since Dictyostelium cells
cannot be synchronized efficiently. Yet, the absence of PEST sequences and the
A-type extended D-box suggests a high protein stability, similar to that of
Xenopus Nek2B, which represents a more stable variant where these
sequences are missing owing to alternative splicing
(Uto and Sagata, 2000
).
DdNek2 seems to be a component of the centrosomal core structure
None of the NIMA-related kinases in lower eukaryotes has so far been
localized to the centrosome or spindle pole body. By contrast, using specific
antibodies, DdNek2 was detected at the Dictyostelium centrosome
during the entire cell cycle. Furthermore, it is a component of isolated
centrosomes, which contain no microtubules
(Gräf et al., 1998).
Thus, DdNek2 is a genuine centrosomal component. Moreover, for the first time
the localization of a Nek2 protein could be confirmed with a GFP-mutant.
Deconvoluted confocal microscopy images clearly revealed that the
GFP-DdNek2-labeled structure is surrounded by the corona and, thus, DdNek2 is
likely to be the first known component of the centrosomal core structure in
Dictyostelium.
DdNek2 is involved in formation of new MTOCs
The high amino-acid sequence similarity and similar localization pattern of
DdNek2 and human Nek2 suggest comparable centrosomal functions. In human
cells, overexpression of Nek2 causes centrosome splitting or centrosome
dispersal (Fry et al., 1998b),
suggesting two possibly independent functions in centrosome separation and
centrosome maintenance. The former function is dependent on catalytic activity
and presumably involves phosphorylation of C-Nap1, whereas the latter function
is independent of catalytic activity since overexpression of catalytically
inactive Nek2-K33R induces only centrosome dispersal. In Xenopus
embryos, centrosome dispersal seems to be caused by Nek2B inhibition, since it
was observed after injection of either mRNA encoding catalytically inactive
Nek2B or inhibitory antibodies (Uto and
Sagata, 2000
). The dispersed centrosomal fragments contained
-tubulin and were active as MTOCs. The occurrence of multiple GFP foci
in some of the GFP-DdNek2 cells is independent of kinase activity and might be
comparable to centrosome dispersal in human cells and frog embryos, but these
GFP foci did not contain any Dictyostelium centrosome markers (not
shown) and, thus, their significance remains elusive. Possibly they represent
GFP-DdNek2 aggregates that are formed upon high overexpression of the fusion
protein.
The supernumerary MTOC phenotype is the major phenotype of GFP-DdNek2,
GFP-DdK33R, GFP-258-C and GFP-
312-C mutants. It is clearly
distinguished from the centrosome-dispersal and centrosome-splitting phenotype
in human and Xenopus cells (Fry
et al., 2000a
; Fry et al.,
1998b
). First, in the Dictyostelium mutants, the normal
nucleus-associated centrosome is still intact, and there are usually no more
than two supernumerary MTOCs per nucleus. Second, the supernumerary MTOCs
possess many features of normal, nucleus-associated centrosomes. They exhibit
approximately the same size, seem to have a corona surrounding an inner core,
include at least four centrosomal marker proteins and carry a microtubule
aster. The observed nuclear aberrations in these mutants are most probably
caused by supernumerary MTOCs, which are still associated with the nuclear
envelope and interfere with chromosome segregation, unlike the majority of
supernumerary MTOCs, which are free in the cytosol and have no access to the
chromosome masses owing to the closed mitosis in Dictyostelium.
In human cells, Nek2 overexpression causes centrosome splitting but no
increase in centrosome number, as an overdose of Nek2 seems to affect only
cells in late S or G2, which have already duplicated their centriole pairs
and, thus, have two centrosomal entities. Furthermore, this process seems to
be strictly dependent on kinase activity
(Fry et al., 1998b). By
contrast, the presence of supernumerary MTOCs in DdNek2 mutants is clearly
independent of catalytic activity and provoked by overexpression of the
C-terminal domain alone. This observation may be explained by recent results
obtained with Xenopus egg extracts. Fry et al.
(Fry et al., 2000a
) showed
that Xenopus Nek2A plays a role in centrosome assembly: incubation of
Nek2B-immunodepleted extracts with demembranated sperm nuclei retarded
assembly of the pericentriolar matrix to the sperm basal body. Furthermore,
Nek2B was one of the first proteins assembling to the nascent centrosome when
spermheads were incubated with egg extracts. In correspondence to this Nek2B
function, it could be that overexpression of the C-terminal domain in
Dictyostelium induces assembly of centrosome components, finally
resulting in the formation of complete centrosomes. Together with other
cytosolic binding partners, the DdNek2 C-terminus could serve a seed function
for the assembly of centrosomal components. This would explain the presence of
DdNek2 in the center of supernumerary MTOCs and centrosomes. Alternatively,
the overdose of C-terminal domain could competitively inhibit the interaction
of endogenous DdNek2 with a binding partner required for proper centrosome
duplication. This could result in centrosome/MTOC amplification. So far, no
DdNek2-binding proteins are known, but in case of human Nek2 two interactors
and substrates, C-Nap1 and protein phosphatase 1c (PP1c), have been identified
by two-hybrid screening (Fry et al.,
1998a
; Helps et al.,
2000
). C-Nap1 is involved in centriole cohesion and dissociates
from the centrosome after phosphorylation by Nek2, which seems to be a key
step in centrosome separation (Fry et al.,
1998a
; Mayor et al.,
2000
). The role of a possible Dictyostelium homologue of
C-Nap1 might be different owing to the structural divergence of human and
Dictyostelium centrosomes and owing to the different mode and cell
cycle stage of their duplication. The other Nek2 interactor, PP1c, regulates
Nek2 and seems to be an effector of CDK1-cyclinB
(Helps et al., 2000
;
Meraldi and Nigg, 2001
). So
far, it has been impossible to demonstrate an interaction of
Dictyostelium PP1c (da Silva et
al., 1999
) with DdNek2 (A. M. da Silva and R. G., unpublished).
This might be because of the fact that in humans PP1c interacts with the Nek2
C-terminal domain via the (R/K)(V/I)XF-motif
(Helps et al., 2000
), which is
conserved in most PP1c-binding proteins but not in DdNek2.
DdNek2 possesses at least two centrosome-binding domains
At least two centrosomal DdNek2-interacting proteins can be postulated,
since the localization of GFP-DdNek2 deletion constructs revealed the
existence of at least two independent centrosomal targeting domains. The first
resides in the C-terminal domain because the corresponding GFP-312-C
mutant clearly localized to normal and supernumerary MTOCs. The second is
present in the complementary part of DdNek2, comprising the catalytic and
leucine zipper domain, which is represented by GFP-
315-N. Since the
GFP-
267-N mutant, which is devoid of the leucine zipper, failed to
localize to the centrosome, the centrosomal binding domain could be a part of
the coiled coil domain. However, for sterical reasons, it is hard to imagine
that the leucine zipper, which seems to be necessary for dimerization of Nek2
proteins, serves a further function as a centrosomal targeting domain. It
appears more likely that the centrosome-binding determinant lies within the
catalytic domain that can only interact with its centrosomal binding partner
as a dimer. Owing to the similarities with DdNek2, it seems likely that human
Nek2 contains two centrosomal targeting domains as well. A myc-tagged deletion
mutant (Nek2
LZ), which cannot dimerize and has the C-terminal domain
fused directly to the catalytic domain, still localized to centrosomes
(Fry et al., 1999
), but this
could be mediated alone by a dimerization-independent C-terminal targeting
domain as in DdNek2.
Conclusions
DdNek2 is the first centrosomal NIMA-related kinase identified in a
non-vertebrate species, and it is targeted to the centrosome by two
independent determinants. Both DdNek2 and vertebrate Nek2 proteins seem to be
involved in the assembly of MTOCs; however, the exact functions reflected by
the phenotypes of Nek2 mutants in Dictyostelium and vertebrates could
be different. The role in MTOC assembly is independent of catalytic activity.
Certainly there should also be a DdNek2 function requiring catalytic activity,
which could be related to the role of vertebrate Nek2 in centrosome
separation. However, as most of the protein is found in the cytosol, this
could also be a cytosolic function, which does not affect centrosome
duplication or mitosis. Conversly, Nek2 of mammals and Xenopus may
have unknown tasks in the centrosome duplication cycle that are independent of
catalytic activity. In the future, a much broader spectrum of Nek2 functions
can be expected from the identification and analysis of new binding partners
and from the continuation of the comparative study of Nek2 proteins in higher
animals and lower eukaryotes.
![]() |
Acknowledgments |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Adams, I. R. and Kilmartin, J. V. (2000). Spindle pole body duplication: a model for centrosome duplication? Trends Cell Biol. 10,329 -335.[Medline]
Blaauw, M., Linskens, M. H. and van Haastert, P. J. (2000). Efficient control of gene expression by a tetracycline-dependent transactivator in single Dictyostelium discoideum cells. Gene 252, 71-82.[Medline]
Bollag, D. M., Rozycki, M. D. and Edelstein, S. J. (eds) (1996). Protein Methods. New York: Wiley-Liss, Inc.
da Silva, A. M., Zapella, P. D., Andrioli, L. P., Campanha, R. B., Fiorini, L. C., Etchebehere, L. C., da-Costa-Maia, J. C. and Terenzi, H. F. (1999). Searching for the role of protein phosphatases in eukaryotic microorganisms. Braz. J. Med. Biol. Res. 32,835 -839.[Medline]
Daunderer, C., Schliwa, M. and Gräf, R. (1999). Dictyostelium discoideum: a promising centrosome model system. Biol. Cell 91,313 -320.[Medline]
Daunderer, C., Schliwa, M. and Gräf, R. (2001). Dictyostelium centrin-related protein (DdCrp), the most divergent member of the centrin family, possesses only two EF-hands and dissociates from the centrosome during mitosis. Eur. J. Cell Biol. 80,621 -630.[Medline]
Euteneuer, U., Gräf, R., Kube-Granderath, E. and Schliwa,
M. (1998). Dictyostelium -tubulin: molecular
characterization and ultrastructural localization. J. Cell
Sci. 111,405
-412.
Fry, A. M. and Nigg, E. A. (1997). Characterization of mammalian NIMA-related kinases. Methods Enzymol. 283,270 -282.[Medline]
Fry, A. M., Schultz, S. J., Bartek, J. and Nigg, E. A.
(1995). Substrate specificity and cell cycle regulation of the
Nek2 protein kinase, a potential human homolog of the mitotic regulator NIMA
of Aspergillus nidulans. J. Biol. Chem.
270,12899
-12905.
Fry, A. M., Mayor, T., Meraldi, P., Stierhof, Y. D., Tanaka, K.
and Nigg, E. A. (1998a). C-Nap1, a novel centrosomal
coiled-coil protein and candidate substrate of the cell cycle-regulated
protein kinase Nek2. J. Cell Biol.
141,1563
-1574.
Fry, A. M., Meraldi, P. and Nigg, E. A.
(1998b). A centrosomal function for the human Nek2 protein
kinase, a member of the NIMA family of cell cycle regulators. EMBO
J. 17,470
-481.
Fry, A. M., Arnaud, L. and Nigg, E. A. (1999).
Activity of the human centrosomal kinase, Nek2, depends on an unusual leucine
zipper dimerization motif. J. Biol. Chem.
274,16304
-16310.
Fry, A. M., Descombes, P., Twomey, C., Bacchieri, R. and Nigg,
E. A. (2000a). The NIMA-related kinase X-Nek2B is required
for efficient assembly of the zygotic centrosome in Xenopus laevis.
J. Cell Sci. 113,1973
-1984.
Fry, A. M., Mayor, T. and Nigg, E. A. (2000b). Regulating centrosomes by protein phosphorylation. Curr. Top. Dev. Biol. 49,291 -312.[Medline]
Gale, M., Jr and Parsons, M. (1993). A Trypanosoma brucei gene family encoding protein kinases with catalytic domains structurally related to Nek1 and NIMA. Mol. Biochem. Parasitol. 59,111 -121.[Medline]
Gräf, R. (2001a). Isolation of centrosomes from Dictyostelium. Methods Cell Biol. 67,337 -357.[Medline]
Gräf, R. (2001b). Maltose-binding protein as a fusion tag for the localization and purification of cloned proteins in Dictyostelium. Anal. Biochem. 289,297 -300.[Medline]
Gräf, R., Brusis, N., Daunderer, C., Euteneuer, U., Hestermann, A., Schliwa, M. and Ueda, M. (2000a). Comparative structural, molecular and functional aspects of the Dictyostelium discoideum centrosome. Curr. Top. Dev. Biol. 49,161 -185.[Medline]
Gräf, R., Daunderer, C. and Schliwa, M. (1999). Cell cycle-dependent localization of monoclonal antibodies raised against isolated Dictyostelium centrosomes. Biol. Cell 91,471 -477.[Medline]
Gräf, R., Daunderer, C. and Schliwa, M.
(2000b). Dictyostelium DdCP224 is a
microtubule-associated protein and a permanent centrosomal resident involved
in centrosome duplication. J. Cell Sci.
113,1747
-1758.
Gräf, R., Euteneuer, U., Ueda, M. and Schliwa, M. (1998). Isolation of nucleation-competent centrosomes from Dictyostelium discoideum. Eur. J. Cell Biol. 76,167 -175.[Medline]
Hames, R. S., Wattam, S. L., Yamano, H., Bacchieri, R. and Fry,
A. M. (2001). APC/C-mediated destruction of the centrosomal
kinase Nek2A occurs in early mitosis and depends upon a cyclin A-type D-box.
EMBO J. 20,7117
-7127.
Helps, N. R., Luo, X., Barker, H. M. and Cohen, P. T. (2000). NIMA-related kinase 2 (Nek2), a cell-cycle-regulated protein kinase localized to centrosomes, is complexed to protein phosphatase 1. Biochem. J. 349,509 -518.[Medline]
Kalt, A. and Schliwa, M. (1996). A novel
structural component of the Dictyostelium centrosome. J.
Cell Sci. 109,3103
-3112.
Kay, R. R. and Williams, J. G. (1999). The Dictyostelium genome project: an invitation to species hopping. Trends Genet. 15,294 -297.[Medline]
Kochanski, R. S. and Borisy, G. G. (1990). Mode of centriole duplication and distribution. J. Cell Biol. 110,1599 -1605.[Abstract]
Levedakou, E. N., He, M., Baptist, E. W., Craven, R. J., Cance, W. G., Welcsh, P. L., Simmons, A., Naylor, S. L., Leach, R. J., Lewis, T. B. et al. (1994). Two novel human serine/threonine kinases with homologies to the cell cycle regulating Xenopus MO15, and NIMA kinases: cloning and characterization of their expression pattern. Oncogene 9,1977 -1988.[Medline]
Lu, K. P. and Hunter, T. (1995). The NIMA kinase: a mitotic regulator in Aspergillus nidulans and vertebrate cells. Prog. Cell Cycle Res. 1, 187-205.[Medline]
Lupas, A., VanDyke, M. and Stock, J. (1991). Predicting coiled coils from protein sequences. Science 252,1162 -1164.[Medline]
Mack, G. J., Rees, J., Sandblom, O., Balczon, R., Fritzler, M. J. and Rattner, J. B. (1998). Autoantibodies to a group of centrosomal proteins in human autoimmune sera reactive with the centrosome. Arthritis Rheum. 41,551 -558.[Medline]
Mann, S. K. O., Devreotes, P. N., Eliott, S., Jermyn, K., Kuspa, A., Fechheimer, M., Furukawa, R., Parent, C. A., Segall, J., Shaulsky, G. et al. (1998). Cell biological, molecular genetic, and biochemical methods used to examine Dictyostelium. In Cell Biology: A Laboratory Handbook, vol. 1 (ed. J. E. Celis), pp. 431-465. San Diego: Academic Press.
Mayor, T., Stierhof, Y. D., Tanaka, K., Fry, A. M. and Nigg, E.
A. (2000). The centrosomal protein C-Nap1 is required for
cell cycle-regulated centrosome cohesion. J. Cell
Biol. 151,837
-846.
Meraldi, P. and Nigg, E. A. (2001). Centrosome
cohesion is regulated by a balance of kinase and phosphatase activities.
J. Cell Sci. 114,3749
-3757.
Moens, P. B. (1976). Spindle and kinetochore morphology of Dictyostelium discoideum. J. Cell Biol. 68,113 -122.[Abstract]
Morio, T., Urushihara, H., Saito, T., Ugawa, Y., Mizuno, H., Yoshida, M., Yoshino, R., Mitra, B. N., Pi, M., Sato, T. et al. (1998). The Dictyostelium developmental cDNA project: generation and analysis of expressed sequence tags from the first-finger stage of development. DNA Res. 5, 335-340.[Medline]
Moudjou, M., Bordes, N., Paintrand, M. and Bornens, M.
(1996). -Tubulin in mammalian cells: the centrosomal and
the cytosolic forms. J. Cell Sci.
109,875
-887.
O'Connell, M. J., Norbury, C. and Nurse, P. (1994). Premature chromatin condensation upon accumulation of NIMA. EMBO J. 13,4926 -4937.[Abstract]
Osmani, S. A., Pu, R. T. and Morris, N. R. (1988). Mitotic induction and maintenance by overexpression of a G2-specific gene that encodes a potential protein kinase. Cell 53,237 -244.[Medline]
Osmani, A. H., O'Donnell, K., Pu, R. T. and Osmani, S. A. (1991). Activation of the nimA protein kinase plays a unique role during mitosis that cannot be bypassed by absence of the bimE checkpoint. EMBO J. 10,2669 -2679.[Abstract]
Paintrand, M., Moudjou, M., Delacroix, H. and Bornens, M. (1992). Centrosome organization and centriole architecture: their sensitivity to divalent cations. J. Struct. Biol. 108,107 -128.[Medline]
Paoletti, A., Moudjou, M., Paintrand, M., Salisbury, J. L. and
Bornens, M. (1996). Most of centrin in animal cells is not
centrosome-associated and centrosomal centrin is confined to the distal lumen
of centrioles. J. Cell Sci.
109,3089
-3102.
Pu, R. T., Xu, G., Wu, L., Vierula, J., O'Donnell, K., Ye, X. S.
and Osmani, S. A. (1995). Isolation of a functional homolog
of the cell cycle-specific NIMA protein kinase of Aspergillus
nidulans and functional analysis of conserved residues. J.
Biol. Chem. 270,18110
-18116.
Rechsteiner, M. and Rogers, S. W. (1996). PEST sequences and regulation by proteolysis. Trends Biochem. Sci. 21,267 -271.[Medline]
Rhee, K. and Wolgemuth, D. J. (1997). The
NIMA-related kinase 2, Nek2, is expressed in specific stages of the meiotic
cell cycle and associates with meiotic chromosomes.
Development 124,2167
-2177.
Roos, U. P. (1975). Mitosis in the cellular
slime mold Polysphondylium violaceum. J. Cell
Biol. 64,480
-491.
Schultz, S. J. and Nigg, E. A. (1993). Identification of 21 novel human protein kinases, including 3 members of a family related to the cell cycle regulator nimA of Aspergillus nidulans. Cell Growth Differ. 4, 821-830.[Abstract]
Schultz, S. J., Fry, A. M., Sutterlin, C., Ried, T. and Nigg, E. A. (1994). Cell cycle-dependent expression of Nek2, a novel human protein kinase related to the NIMA mitotic regulator of Aspergillus nidulans. Cell Growth Differ. 5, 625-635.[Abstract]
Tanaka, K., Parvinen, M. and Nigg, E. A. (1997). The in vivo expression pattern of mouse Nek2, a NIMA-related kinase, indicates a role in both mitosis and meiosis. Exp. Cell Res. 237,264 -274.[Medline]
Ueda, M., Schliwa, M. and Euteneuer, U. (1999).
Unusual centrosome cycle in Dictyostelium: correlation of dynamic
behavior and structural changes. Mol. Biol. Cell
10,151
-160.
Uto, K. and Sagata, N. (2000). Nek2B, a novel
maternal form of Nek2 kinase, is essential for the assembly or maintenance of
centrosomes in early Xenopus embryos. EMBO J.
19,1816
-1826.
Uto, K., Nakajo, N. and Sagata, N. (1999). Two structural variants of Nek2 kinase, termed Nek2A and Nek2B, are differentially expressed in Xenopus tissues and development. Dev. Biol. 208,456 -464.[Medline]
Wang, S., Nakashima, S., Sakai, H., Numata, O., Fujiu, K. and Nozawa, Y. (1998). Molecular cloning and cell-cycle-dependent expression of a novel NIMA (never-in-mitosis in Aspergillus nidulans)-related protein kinase (TpNrk) in Tetrahymena cells. Biochem. J. 334,197 -203.[Medline]
Weber, I., Gerisch, G., Heizer, C., Murphy, J., Badelt, K.,
Stock, A., Schwartz, J. M. and Faix, J. (1999). Cytokinesis
mediated through the recruitment of cortexillins into the cleavage furrow.
EMBO J. 18,586
-594.
Wetterauer, B. W., Salger, K., Carballometzner, C. and Macwilliams, H. K. (1995). Cell-density-dependent repression of discoidin in Dictyostelium discoideum. Differentiation 59,289 -297.[Medline]
Wetterauer, B., Morandini, P., Hribar, I., Murgia-Morandini, I., Hamker, U., Singleton, C. and MacWilliams, H. K. (1996). Wild-type strains of Dictyostelium discoideum can be transformed using a novel selection cassette driven by the promoter of the ribosomal V18 gene. Plasmid 36,169 -181.[Medline]
Wu, L., Osmani, S. A. and Mirabito, P. M.
(1998). A role for NIMA in the nuclear localization of cyclin B
in Aspergillus nidulans. J. Cell Biol.
141,1575
-1587.
Ye, X. S., Xu, G., Pu, R. T., Fincher, R. R., McGuire, S. L., Osmani, A. H. and Osmani, S. A. (1995). The NIMA protein kinase is hyperphosphorylated and activated downstream of p34cdc2/cyclin B: coordination of two mitosis promoting kinases. EMBO J. 14,986 -994.[Abstract]