* Department of Microbiology, Comprehensive Cancer Center, Duke University Medical Center, Durham, North Carolina
27710; § Institut für Saeugetiergenetik, GSF-Forschungsinstitut Neuherberg, D-85764 Oberschleissheim, Germany; and
Division
of Oral Biology, Faculty of Dentistry, The University of Western Ontario, London, Ontario, Canada N6A 5C1
Retinoic acid is a signaling molecule involved in the regulation of growth and morphogenesis
during development. There are three types of nuclear
receptors for all-trans retinoic acid in mammals,
RAR, RAR
, and RAR
, which transduce the retinoic acid signal by inducing or repressing the transcription of target genes (Leid, M., P. Kastner, and P. Chambon. 1992. Trends Biochem. Sci. 17:427-433). While
RAR
, RAR
, and RAR
are expressed in distinct but
overlapping patterns in the developing mouse limb,
their exact role in limb development remains unclear.
To better understand the role of retinoic acid receptors
in mammalian limb development, we have ectopically
expressed a modified RAR
with constitutive activity
(Balkan, W., G.K. Klintworth, C.B. Bock, and E. Linney. 1992. Dev. Biol. 151:622-625) in the limbs of transgenic mice. Overexpression of the transgene was associated with marked pre- and postaxial limb defects,
particularly in the hind limb, where expression of the
transgene was consistently seen across the whole anteroposterior axis. The defects displayed in these mice
recapitulate, to a large degree, many of the congenital
limb malformations observed in the fetuses of dams administered high doses of retinoic acid (Kochhar, D.M.
1973. Teratology. 7:289-295). Further analysis of these
transgenic animals showed that the defect in skeletogenesis resided at the level of chondrogenesis. Comparison of the expression of the transgene relative to that
of endogenous RAR
revealed that downregulation of
RAR
is important in allowing the chondrogenic phenotype to be expressed. These results demonstrate a
specific function for RAR
in limb development and
the regulation of chondroblast differentiation.
Retinoic acid (RA)1 is an important signaling molecule involved in the regulation of growth during
embryonic development and cell differentiation. In
the developing mammalian limb, RA affects the differentiation of many cell lineages, including those of mesenchymal and chondrogenic origin (Solursh and Meier, 1973 In the developing murine limb, the RARs are expressed
in distinct and sometimes overlapping spatiotemporal
patterns. The RARs Given the distinct spatiotemporal expression patterns
observed for each of the RARs during mouse embryogenesis and in adult tissues, it has been proposed that each receptor may perform unique functions during development
and homeostasis (for review see Chambon, 1994 To evaluate the function of RAR Gel Mobility Shift Assay
A RAR Generation of Transgenic Mice
The transgene was constructed in the pGEM9zf( Analysis of Transgenic Mice
Embryos were stained for Differential skeletal staining of embryos with alcian blue 8GS and alizarin red S was performed as described by McLeod (1980) Western analysis was performed using standard procedures. Hind limb
bud protein extracts were prepared from E11.5 animals. A cut parallel to
the body wall was made to release the limb buds, and hind limb bud pairs
from individual animals were transferred to 100 µl of treatment buffer
(0.125 M Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiled for 5 min with intermittent mixing. Protein extracts (10 µl
for J limbs, 20 µl for I limbs) were separated by SDS-PAGE and transferred to nitrocellulose. Blots were incubated with an anti- Preparation of Micromass Cultures
Hind limbs of E11.5 embryos were collected aseptically and teased apart
into small pieces with forceps in Puck's saline G buffer. Cells were dissociated by incubation in the presence of dispase (1 U/ml) (GIBCO BRL,
Gaithersburg, MD) with shaking at 37°C in Puck's saline A buffer containing 10% chicken serum. Digestion was terminated by resuspension in
SCM (60% Ham's F12, 40% DME supplemented with antibiotics and
10% FBS) followed by gentle trituration to obtain a fine cell suspension.
Cells were passed through a No. 20 Nitex (Tetko Co., Elmsford, NY)
mesh to remove cell clumps and to obtain a single cell suspension. Cell
number was adjusted to 1 × 107 cells/ml and micromass cultures were intiated by carefully placing 10 µl of the cell suspension into the center of a
well in a 24-well plate. Cultures were placed in a 37°C incubator containing a humidified atmosphere and 5% CO2. After attachment (~1.5 h), 1 ml
of SCM was added to each culture, and cultures were returned to the incubator. Media changes were performed at least once a day. Cultures were incubated for a period of 1 to 6 d, at which time they were processed for
Synthesis of Hybridization Probes
Single-stranded RNA probes with incorporated digoxigenin were transcribed from linear DNA templates according to manufacturer's instructions (Boehringer Mannheim Corp., Indianapolis, IN). Probes were quantified by spotting various dilutions of probe in 10× SSC (1.5 M NaCl, 150 mM
sodium citrate) and a control digoxigenin-labeled RNA on a nylon membrane; detection of probe using a sheep anti-digoxigenin conjugated alkaline phosphatase antibody (Boehringer Mannheim Corp.) was as described by the manufacturer.
Probes for mRAR Whole-Mount In Situ Hybridization
of Micromass Cultures
Whole-mount in situ hybridizations of micromass cultures were performed as described by Conlan and Rossant (1992) with modifications. Micromass cultures were washed twice with PBS and fixed in 4% paraformaldehyde overnight at 4°C. After fixation, cultures were washed
three times with cold PBS and dehydrated through a PBS/methanol series
to 100% methanol and stored in 75% methanol at 4°C until use. Before
hybridization, cultures were rehydrated in PBT (PBS, 0.05% Tween-20)
and treated with proteinase-K for 6 min, washed twice with 2 mg/ml glycine in PBT, and fixed for 20 min in 4% paraformaldehyde. Cultures were
washed three times with PBT and twice in hybridization buffer (50% formamide, 0.75 M NaCl, 10 mM Pipes, pH 6.8, 1 mM EDTA, 100 µg/ml
tRNA, 0.05% heparin, 0.01% BSA, 1% SDS) and prehybridized for at
least 1 h at 55°C. Hybridizations were carried out overnight at 55°C in a
programmable dry oven (Bellco Glass Inc., Vineland, NJ) with 1 µg/ml riboprobe. Conditions for washing and antibody incubation were similar to
that previously described (Conlon and Rossant, 1992 Construction of Hoxb-6hRAR Transgenic mice were generated that expressed a constitutively active human RAR
Transgenic mice carrying tgRAR
The expression of tgRAR Table I.
Summary of Transgenic Lines Generated
; Lewis et al., 1978
; Zimmerman and Tsambos, 1985
). RA is
important in normal limb ontogeny and in excess is a potent teratogen, causing characteristic perturbations of normal limb development in a stage- and dose-dependent
manner (Shenefelt, 1972
; Kochhar, 1973
; Kwasigroch and
Kochhar, 1980
). The timing of RA treatment and the resultant limb defects appear to coincide with the timing of
mesenchyme condensation and differentiation into chondrocytes between embryonic day (E) 11 and E14 (Kwasigroch and Kochhar, 1980
). RA treatment at earlier stages
(i.e., E9 to E10) has limited effects that are primarily restricted to the digits and that have been attributed to
changes in the apical ectodermal ridge and the associated
underlying mesenchyme (Sulik and Dehart, 1988
; Tickle et
al., 1989
). At later stages (i.e., >E14), RA treatment has
little or no effect on limb patterning and development.
Consistent with its role in mesenchyme growth and differentiation, RA has dramatic effects on chondrogenesis of
limb mesenchyme in vitro and in vivo. Most of these observed effects arise from changes in gene transcription mediated, in part, by the nuclear hormone receptors for RA.
There are two subfamilies of nuclear retinoid receptors
known to modulate the actions of RA. The RA receptors
(RARs)
,
, and
, and the retinoid X receptors (RXRs)
,
, and
, both of which act as ligand-dependent transcription factors through the formation of heterodimers
bound to specific RA response elements (RAREs) (for review see Leid et al., 1992a
; Linney, 1992
; Giguère, 1994
and references therein). Both the RARs and RXRs are
widely expressed in a number of fetal and adult tissues in
specific spatial and temporal patterns (Dollé et al., 1989
b;
Krust et al., 1989
; Zelent et al., 1989
; Dollé, 1990; Ruberte
et al., 1990
, 1991
, 1993; Dollé et al., 1994
).
and
are expressed in overlapping
regions during fore limb development from E9.5 to E11.5
(Dollé et al., 1989
b; Ruberte et al., 1990
). RAR
then
becomes preferentially localized to the precartilage condensation and cartilage. In contrast, RAR
expression appears to progressively decrease during this chondrogenic sequence and becomes primarily restricted to the
surrounding mesenchyme and interdigital zone, where it
is comparatively highly expressed (Dollé et al., 1989
b).
RAR
is expressed in the proximal mesenchyme early in
limb outgrowth and later is found in the interdigital zone
and in the interior, anterior, and posterior necrotic zones (Dollé 1989b; Mendelsohn et al., 1991
). Two of the presumptive heterodimeric partners for the RARs, RXR
,
and RXR
, are expressed ubiquitously throughout limb
development up to E16.5 (Dollé et al., 1994
). In the developing chick limb, RAR
1 and RAR
2 have been shown
to exhibit distinct expression patterns during the differentiation events associated with chondrogenesis. Initially, RAR
1 expression is ubiquitous and not specifically located to any region, while RAR
2 is restricted to the early
mesenchymal condensate in the limb core (Smith et al.,
1995
). At later stages, RAR
2 is no longer detected in the
limb core, where chondrocytes have formed, but is restricted to a thin cell layer lateral to the maturing cartilage.
; Underhill et al., 1995
and references therein). Boylan et al. (1993, 1995), for example, have recently shown that targeted disruption of RAR
and RAR
in F9 embryonal carcinoma
cells results in receptor-specific alterations in RA-mediated differentiation and RA metabolism. In the whole animal, however, the absence of any obvious abnormalities in
homozygous null fetuses for a number of receptors and
their isoforms suggests that there may be a high degree of
functional redundancy among members of the RAR family (Li et al., 1993
; Lohnes et al., 1993
, 1994; Lufkin et al.,
1993
; Kastner et al., 1994
; Mendelsohn, 1994a,b; Sucov et
al., 1994
). Their importance in limb development was
demonstrated by the observation that compound homozygotes of null alleles of RAR
and RAR
exhibited a range
of limb abnormalities from reductions to duplications (Lohnes et al., 1994
). Hence, it appears that in early limb
development RAR
is able to substitute for RAR
and
vice versa, but at least one of the receptors is minimally required for proper limb development.
in limb development,
we have generated transgenic mice that ectopically express a constitutively active form of human RAR
1 in the
developing limb under the control of a Hoxb-6 promoter
fragment. We have previously shown that mice expressing
this modified receptor in the eye under the control of the
A-crystallin promoter develop microphthalmia and cataracts, both of which are observed in mice treated with RA
in utero (Balkan et al., 1992
b). Analysis of transgene expression in Hoxb-6 animals revealed two levels of expression in the developing limb. High levels of transgene expression throughout the limb bud produced a range of
phenotypic abnormalities that recapitulate many of the
congenital limb malformations observed in the fetuses of
dams administered high levels of RA, whereas animals
with low levels of transgene expression appeared normal.
Further analysis of these animals as described herein has
revealed that RAR
is important in regulating chondrogenesis in vivo.
Materials and Methods
2 RARE double-stranded oligonucleotide probe was prepared
by annealing the following oligos: 5
TCGAGGGTAGGGTTCACCGAAAGTTCAC 3
and 3
CCCATCCCAAGTGGCTTTCAAGTGAGCT 5
. The probe was filled in using [32P]dCTP and Klenow DNA
polymerase. All proteins were purified using the pGEX-2T bacterial expression system (Pharmacia LKB Biotechnology, Piscataway, NJ) according to the manufacturer's instructions. Protein-DNA binding reactions
were carried out in 20 µl of binding buffer (10% glycerol, 10 mM Hepes,
pH 8.0, 50 mM KCl, 2.5 mM MgCl2, 1 mM ZnCl2, 1 mM DTT) containing
1 µg poly dI-dC and 0.15 µg of hRAR
or hRAR
-CB with or without
0.15 µg of mRXR
on ice for 10 min. After this preincubation, 0.1 ng of
labeled probe (67,000 cpm) was added to each tube, and the reactions
were allowed to proceed for an additional 20 min at room temperature.
Unlabeled probe (50 ng, 500×) was included in some reactions as a specific competitor. The samples were resolved on a prerun 4% nondenaturing polyacrylamide gel at 4°C.
) derivative, pW1,
which contains a BamHI restriction site juxtaposed between the HindIII
and SpeI restriction sites and the polyadenylation sequence from SV-40 in
the NsiI site (Balkan et al., 1992a
). A 3.3-kb fragment of the Hoxb-6 promoter that contains sequences immediately upstream of the transcriptional start site was liberated from pKSIIHoxb-6 (Schughart et al., 1991
)
by restriction endonuclease digestion with EcoRI and BamHI and directionally subcloned into pW1, thereby generating pW1Hoxb-6. pW1Hoxb6tgRAR
1 was made by subcloning the constitutively active RAR
1
(Balkan et al., 1992
b) into the BamHI restriction site of pW1Hoxb-6.
Hoxb-6tgRAR
1 DNA for microinjection was released from the vector
backbone using NotI and SfiI, separated on agarose gel, and gel purified
using geneclean (BIO 101, La Jolla, CA) according to the manufacturer's instructions. Transgenic mice were made by microinjection of C57Bl6F1/J- (Jax Laboratories, Bar Harbor, ME) fertilized mouse eggs with DNA at a
concentration of 2-3 ng/µl. Mice that carried the transgene were identified
by slot-blot hybridization of tail DNA with an Escherichia coli
-galactosidase DNA probe.
-galactosidase activity using a protocol described by Balkan et al. (1992a)
. The morning of the day of the copulation
plug was considered E0.5.
. Postterm mice
were stained using a similar protocol with extended periods of incubation.
-galactosidase
antibody (Promega Corp., Madison, WI) for 2 h and washed, and an anti-
mouse secondary antibody conjugated to alkaline phosphatase was added
for 1 h. Alkaline phosphatase activity was detected using a mixture of nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Promega
Corp.) according to the manufacturer's instructions.
-galactosidase activity, and duplicate cultures were stained for the presence of sulfated glycosaminoglycans found in cartilage matrix using alcian
blue at acidic pH (Lev and Spicer, 1964
). Alcian blue staining was carried
out as follows. Cells were washed twice with PBS, fixed for 15 min in
Kahle's fixative, washed once with 0.1 N HCl, and stained overnight with
0.1% alcian blue in 0.1 N HCl. After staining, the cultures were washed
twice with 70% ethanol and stored in the same. Nodule numbers were determined by counting the number of alcian blue-stained nodules within a fixed area (3 mm2). Statistics were determined using the Student's t-test.
and mRAR
were produced from templates that
included part of the 3
coding and 3
untranslated region of mRAR
and
the 3
DEF region of RAR
. Hybridization probes were synthesized from
linearized plasmid DNA templates using in vitro transcription. An ~600bp riboprobe for mRAR
was made using T3 RNA polymerase and a
pKSII (Stratagene, La Jolla, CA) plasmid cleaved with EcoRV (cleaves internally) that carried a 2.2-kb mRAR
insert. mRAR
riboprobe was synthesized from a pBS (Stratagene) template containing a 1.0-kb mRAR
insert that had been linearized with EcoRI.
). Color development
was carried out overnight in the dark in 10% polyvinyl alcohol (Aldrich,
average mol wt 13,000-23,000) (Barth and Ivarie, 1994
). Addition of polyvinyl alcohol was found to increase signal to noise ratio.
Results
-LacZ Transgenic Mice
1 (a chimeric receptor with
-galactosidase fused to the carboxy terminus, denoted
tgRAR
herein) (Balkan et al., 1992
b) to high levels in the
developing limb. In vitro analysis of tgRAR
binding to a
DNA probe containing the
RARE showed that efficient
binding was dependent upon the presence of an RXR heterodimer partner (Fig. 1), consistent with that observed for wild-type RARs (Yu et al., 1991
; Leid et al., 1992b
).
The murine Hoxb-6 (Hox 2.2) promoter fragment, which
has been shown previously to direct expression of a LacZ
reporter gene to the developing limbs (Schughart et al.,
1991
), was used to target expression of the fusion receptor
in the transgenic animals.
Fig. 1.
hRAR and tgRAR
exhibit similar DNA-binding properties. The ability of equivalent amounts of hRAR
- and tgRAR
(hRAR
-CB)-purified protein to shift a
RARE oligonucleotide
probe in the absence or presence of a RXR
partner are shown.
Note that on a molar basis, there is ~2/3 less tgRAR
than
hRAR
protein and that the larger tgRAR
protein results in reduced band mobility relative to hRAR
.
[View Larger Version of this Image (56K GIF file)]
under the control of
the murine Hoxb-6 promoter fragment were generated by
injecting one-cell embryos with the construct shown in Fig.
2 A. Owing to the presence of RAREs in several Hox promoters (Langston and Gudas, 1992
; Popperl and Featherstone, 1993
; Marshall et al., 1994
), we checked the ability of
both hRAR
and tgRAR
to trans-activate the Hoxb-6 promoter fragment in transient expression assays. Neither
hRAR
nor tgRAR
was able to trans-activate the Hoxb-6
promoter fragment in the absence or presence of 500 nM
all-trans RA (data not shown). Screening of transgenic
mice was done by slot-blot hybridization of DNA isolated
from mouse tails. 12 founders were generated and used to
establish eight lines of transgenic mice. Of the 12 founders generated, four exhibited similar congenital limb malformations (A-D, see below), while eight (E-L) appeared
phenotypically normal. Original founders as well as male
and female progeny from all eight lines have been studied
extensively, and a range of phenotypic abnormalities have
been observed, depending on the level of transgene expression in the developing limbs.
Fig. 2.
Structure and expression of the Hoxb-6tgRAR fusion
gene construct. (A) A 9-kb linear DNA fragment containing the
Hoxb-6tgRAR
fusion gene was excised from a pGEM9zf(
)
parent plasmid with SfiI and NotI and used for microinjection
into fertilized eggs. (B-E) Expression patterns of the transgene in
E10.5 and E11.5 mouse embryos. (B and C) tgRAR
is expressed
at high levels within the developing limbs at E10.5 (B) and E11.5
(C) in the three transgenic lines in which limb malformations
were seen. A representative progeny from founder male J is
shown. (D and E) The chimeric receptor is expressed at a lower
level in the developing limbs at E10.5 (D) and E11.5 (E) in the
five transgenic lines in which no limb malformations were observed. A representative progeny from founder male I is shown.
[View Larger Versions of these Images (12 + 53K GIF file)]
in the developing limbs of
embryos derived from the eight phenotypically normal
transgenic founders was analyzed in detail. At E10.5, the
transgene was expressed in the mesenchyme of the emerging limb buds and in the ventrolateral mesenchyme between the limb buds. In the fore limb bud,
-galactosidase activity was restricted to the posterior region whereas the
entire hind limb bud expressed tgRAR
(Fig. 2, B and D).
While no differences in the transgene expression pattern
were seen between the eight lines, significant differences
in tgRAR
expression levels were observed. In three of
the eight lines (J, K, and L), tgRAR
was expressed at
high levels in the posterior half of the fore limb and across
the entire hind limb (Fig. 2 B). In the other five lines (E-I),
however, low levels of transgene expression were seen in
both the fore and hind limbs (Fig. 2 D). At E11.5, differences between the two levels of transgene expression persisted, which was further confirmed by Western analysis
with an anti-
-galactosidase antibody (data not shown).
Specifically, in the hind limbs of embryos derived from
high expressing founders, transgene expression was seen
across the whole anteroposterior axis and extended distally into the progress zone (Fig. 2 C). In embryos derived
from low expressors, tgRAR
expression was restricted to
anterior and posterior stripes in the mesenchyme of the
developing hind limb with no significant expression of the
transgene in the progress zone of the fore or hind limb
(Fig. 2 E). Tissue sections from E12.5 high expressor hind
limbs confirmed that transgene expression was not present
in the ectoderm but was present in chondrogenic condensations that will become the tibia and fibula and strongly
expressed in the underlying mesenchyme, including the
progress zone (data not shown). These results are summarized in Table I. Furthermore, a transgenic line that expressed a potent dominant-negative RAR to a level similar to that of the high transgene-expressing lines described
herein exhibited no perceptible phenotype suggesting that
the tgRAR
is not functioning in a dominant-negative
manner (our unpublished observations).
While founders J, K, and L were phenotypically normal,
they did pass the transgene in a Mendelian fashion to their
progeny, and all transgene positive offspring exhibited
limb malformations like those seen in the four affected
founders (Fig. 3). Because some founder males with limb
malformations had difficulty mating, lines established
from male J and female L were relied upon for most of the
analysis of the effects of ectopic tgRAR expression on
limb development. Interestingly, no limb malformations
were observed in the offspring of the five phenotypically
normal founders (E-I) with the lower levels of tgRAR
expression, suggesting that high level expression of the fusion receptor is required for alterations in normal limb development.
Consequences of Hoxb-6tgRAR Transgene Expression
The limb malformations associated with expression of the
transgene were analyzed in detail in embryos and animals
derived from a representative line (J) (Figs. 4 and 5); similar malformations were seen in four founders and two
other independent transgenic lines. Pronounced bilateral
defects were always present in the hind limb, whereas defects in the fore limb were variable. In the affected animals, there was a predilection towards the loss of postaxial
structures, and, in general, the degree of postaxial deflection in the fore limb appeared to be a good indicator of the
severity of the defect.
Malformations in the fore limb (Fig. 4) were primarily restricted to the field of transgene expression that included the ulna, ulna carpal bone, and their respective articulating bones. Although the transgenic animals exhibited a marked variability in the severity of the defect in the fore limbs, all the transgenic animals contained a deformed ulna, which varied from mild with a slight postaxial curvature to severe. The ulna in the severely affected animals was dramatically thickened (in some cases to twice that of the size of the radius), postaxially deflected, and foreshortened (compare Fig. 4, A and E). In comparison, the radius and humerus appeared to be only mildly affected. Furthermore, the radius was always found to be longer than the ulna, and the degree of this disparity appeared to correlate well with the amount of postaxial bending, suggesting that the disproportionate growth of the ulna and the radius in the proximodistal axis most likely contributed to the postaxial deflection. Malformations in the wrist consisted of a reduction in the size of the ulnar carpal and fourth carpal bone with the loss of the fourth carpal-fifth metacarpal articulating surface (Fig. 4, D and E). The pisiform bone also appeared to be sometimes absent or not mineralized. Most of the metacarpals were shortened, and in some of the mildly affected animals, metacarpal 5 was reduced to a mineralized nodule with no corresponding phalanx (Fig. 4 D). Additionally, in some of the more severely affected animals we periodically observed a very broad fourth medial phalanx with a complete duplication of the fourth distal phalanx (Fig. 4 E).
Founders A, B, C, and D, as well as those transgenic animals derived from founder J, all exhibited bilateral hind limb malformations (Fig. 5). In all animals examined, the fibula was malformed; this ranged from complete absence, except for a small distal nodule, to thickened partial fibulas that extended more proximally (Fig. 5, B and D). In addition, the extent of the fibular defect was found to be nearly perfectly symmetrical and to be 100% penetrant, with variability in the degree of severity of the effect on the foot and ankle. No proximal fibula-associated structures were observed using alizarin red or alcian blue staining. In contrast, the tibia was found to be only marginally affected, exhibiting a dorsal curvature and slight shortening and thickening. The calcaneus was found to be reduced in size, displaced laterally to the outside of the fibula, and missing an articulation surface for the fifth metatarsal. In some animals, the navicular and the cuboidum were found to be fused to the second and third tarsals, respectively. Occasionally, the fifth proximal and medial phalanges were missing, with the presence of the distal phalanx (Fig. 5 F). As observed in the fore limb, the defects in the hind limb appear to be primarily restricted to the posterior half of the limb and to involve the distal long bones and proximal foot bones.
To establish that the transgene does not have nonautonomous effects on chondrogenesis in regions where it is not expressed, the axial bones of transgenic and control animals were stained with alizarin red and alcian blue. No significant differences were observed in these bones between control and transgenic animals of similar embryonic age (data not shown).
To understand what changes have occurred during development of the limb to give rise to the aforementioned
malformations, a series of E13.5 through E18 fetuses were
collected and stained with alizarin red and alcian blue (Fig.
6). Transgenic animals were readily distinguishable from
their nontransgenic littermates as early as E11.5. The hind
limbs of the transgenic animals were somewhat smaller
and contained a disproportionately large outgrowth in the
region of the anterior margin, which will give rise to digit 1 (data not shown). Similar outgrowths are also observed in
the chick limb bud after placement of an RA-soaked bead
in the anterior margin (Summerbell, 1983). At later times
in development, digit 1 was found to be duplicated,
thereby generating a 1, 1, 2, 3, 4, 5 digit pattern (Fig. 6 B,
E15.5, E17, and E17.5). This duplication was seen in
~40% of the animals, and the extent of the duplication
correlated well with the size of the outgrowth. In most instances, this duplicated digit was not maintained, as an
analysis of many (n > 200) adult animals revealed no such
digit duplication. As can be seen from the embryonic
panel, the digit duplication appears to be lost during the
course of development with the duplicated digit 1
becoming fused with digit 1 (Fig. 6 B, E17 and E18). This was evident in the hind limbs of the adult animals, where digit 1 appeared to be composed of several individual and overlapping bones (Fig. 5 F).
Development of the various elements of the hind limb
of transgenic animals was significantly delayed in comparison to wild-type animals. This was most apparent at later
embryonic stages, where ossification of the proximal phalanges of the hind limbs from transgenic animals was observed to be at least 0.75-1 d behind that of wild-type animals. However, earlier in development the disparity in the
size of the limbs was also evident; in this case, the bone
primordia were shortened and slightly misshapen. Analysis of hind limb histological sections prepared from E13.5
fetuses revealed that chondrogenesis of the tibia and fibula was delayed in transgenic animals (Fig. 7). The primitive fibula of the wild-type animals contained maturing
chondrocytes circumscribed by a well-defined perichondrium. In contrast, the fibula from transgenic animals was
not as well organized. The fibula was primarily composed
of closely packed chondroprogenitor cells with a lower cytoplasmic/nuclear ratio with a morphology consistent with
condensed mesenchymal cells. Chondrogenesis of the digital rays were also found to be delayed in the transgenic animals (data not shown). Hence, overexpression of tgRAR
appeared to inhibit or interfere with chondrogenesis in the
hind limb by delaying chondroprogenitor differentiation.
Assessment of Chondrogenic Potential of Transgene-expressing Mesenchymal Cells
To examine more thoroughly the defect in transgenic animals that interferes with chondrogenesis in endochondral
bone formation, the ability of the mesenchyme from transgenic limbs to form cartilage nodules was assayed in vitro
using micromass culturing methods. Limb mesenchyme
cultured under micromass conditions closely follows the
progression of limb mesenchyme in vivo, precartilaginous
condensations are first evident after 2 d in culture with
cartilage nodules appearing ~1 d later (Ahrens et al.,
1977). Cultures were seeded at high density (1 × 105 cells/
10 µl) in a 24-well plate with dissociated limb mesenchyme pooled from either fore or hind limbs of E11-11.25 transgenic or non-transgenic embryos. These cultures were allowed to grow for up to 3, 4, or 6 d. Cartilage matrix production was assayed for by fixing and staining the cultures
with alcian blue at low pH , while both the extent and distribution of transgene-expressing cells were determined by
staining fixed cultures with X-gal.
Within 3 d, cultures initiated from wild-type fore or hind limb buds showed numerous well-defined alcian blue- stained cartilage nodules (Fig 8, A and B). No alcian blue nodules were observed in cultures after 2 d; instead, both fore limb and hind limb cultures contained numerous condensations (data not shown). Similar to wild-type cultures, transgenic fore and hind limb micromass cultures after 2 d displayed many condensations (data not shown). Transgene-expressing cells were found to be distributed throughout the cultures and within condensations. In the hind limb cultures, the transgene-expressing cell was the predominant cell type found within the condensations, while in the fore limb there was a mixture of cells, with some condensations being devoid of transgene-expressing cells. The number of transgene-expressing cells from fore limb- derived cultures were much lower than those of the hind limb cultures, which is consistent with the differences observed in transgene expression between the fore and hind limb buds in vivo.
In contrast to wild-type cultures, cultures initiated from
the hind limb buds of transgenic animals exhibited few if
any alcian blue-stained nodules at 4 d (Fig. 8 C) and only
slightly more nodules (<5) at 6 d postinitiation (Fig. 8 G).
Examination of these cultures with dark-field microscopy
confirmed the absence of any apparent nodules or discrete
condensations (data not shown). In contrast, cultures initiated from the fore limbs of transgenic animals displayed
numerous well-defined alcian blue-stained cartilage nodules after 4 d (Fig. 8 A) and slightly more after 6 d (Fig. 8
G). However, their appearance was delayed and their
number was significantly reduced in comparison to wildtype cells (Fig. 8 G). In addition, the nodules were mostly
confined to those regions containing nontransgene-expressing cells (Fig. 8 E). Furthermore, the differences in chondrogenesis observed between the cultures of fore and hind
limb buds from transgenic animals correlated well with the
observed differences in the severity of fore and hind limb
malformations seen in these animals. It should be noted that the transgene continued to be abundantly expressed
throughout the culture period in both fore- and hind limb-
derived cultures (Fig. 8, E and F), and that there was no
significant growth disparity between wild-type and transgenic cultures. Consistent with the above in vivo observations, these results suggest that expression of tgRAR delayed or inhibited chondroblast differentiation subsequent to condensation.
Analysis of RAR and RAR
Gene Expression in
Micromass Cultures
Previous studies have shown that RAR and RAR
are
expressed throughout the fore limb mesenchyme between
E9.5-E11.5, at which time RAR
expression becomes restricted to precartilage and cartilage (Dollé et al., 1989
b;
Ruberte et al., 1990
). Whole-mount in situ hybridization
methodologies were adapted to the analysis of gene expression in micromass cultures so that the expression of
endogenous RAR
could be compared to tgRAR
. In
agreement with previous studies, by day 4 of culture,
RAR
was found to be expressed in the core of the nodule, where chondroblasts surrounded by cartilaginous extracellular matrix were observed (Fig. 9, B and D). RAR
,
on the other hand, was found to be expressed in the peripheral region of the nodule in condensed mesenchymal
cells that had not yet differentiated into chondroblasts
(Fig. 9, A and C). RAR
expression was either absent or
expressed at very low levels within the core of the nodule,
in chondroblasts (Fig. 9, A and C).
Transgenic animals that ectopically express a constitutively active hRAR1 in the developing murine limb exhibited a spectrum of defects that included polydactyly,
syndactyly, ectrodactyly, fibular deficiencies, and tarsal
and carpal fusions. The phenotypes observed in these animals are similar to those that have been observed in a
number of vertebrate systems in which embryos were administered systemic or localized doses of RA (Shenefelt,
1972
; Kochhar and Aydelotte, 1973; Summerbell, 1983
;
Tickle et al., 1985
, 1989). A number of different roles have
been proposed for the function of the RARs during limb
development (Mendelsohn et al., 1991
, 1992
), some of
which include precartilage and cartilage formation, apoptosis, and patterning of the limb. We have found that
RAR
is an important regulator of chondrogenesis during
limb development.
Transgene Expression and Chondrogenesis
The RARs are ligand-activated receptors that function as
heterodimers. Hence, transgene activity would rely on the
presence of a suitable heterodimeric partner. This condition is satisfied during the period of transgene expression
before overt cytodifferentiation (E13-13.5) within the
limb. RXR and RXR
are expressed throughout the limb
mesenchyme at these stages and as such could provide a
suitable heterodimeric partner for the transgene.
Postnatal transgenic lines that expressed the transgene to high levels during limb development (E9.5-E15) presented with a number of paraxial skeleton deficits, while no apparent phenotype was observed in transgenic lines expressing the transgene to a lower level. Although the expression patterns for the transgene in the two lines were similar, the transgene in the high expressing lines is expressed to a much greater level relative to that of the low expressing lines in the core mesenchyme (along the median axis). This mesoderm will contribute to the future skeletal elements, suggesting that transgene expression in this region may intefere with skeletogenesis and contribute to the observed defects. Consistent with these observations, the limb defects became first evident during embryogenesis within the early stages of skeletogenesis (E13.5) during formation of the cartilaginous template. Furthermore, histological sections prepared from E13.5 limbs from transgenic and a nontransgenic littermate confirmed that development of the limb cartilage was significantly delayed in the transgenic animals. Taken together, these observations suggested that expression of the transgene interfered with chondrogenesis.
Micromass cultures have been previously shown to closely follow those events of chondrogenesis in vivo and have been used to study the role of various molecules in chondrogenesis during endochondral bone formation. Cartilage nodules are first evident as a coalescence of mesoderm cells that form a condensation. These aggregates continue to expand both by cell division and selective recruitment of neighboring cells. After a period of cellular growth, cells within the interior of the condensation begin to differentiate and elaborate cartilage matrix that can be specifically stained with alcian blue. Micromass cultures derived from wild-type and transgenic hind limbs appear similar up to ~2-2.5 d. Before this time, there is a similar number of well-defined condensations in both cultures. It is at the onset of chondroblast differentiation when differences between the two cultures become readily visible. In the wild-type cultures, chondroblasts begin to appear within the core of the condensations after 3 d in culture as shown by alcian blue staining for cartilage matrix. Whereas, in transgene-expressing cultures, especially those from hind limbs, little or no alcian blue staining is observed after 4 or 6 d in culture, which is indicative of an absence of chondroblast differentiation and elaboration of extracellular cartilage matrix. Hence, transgene expression appears to interfere with the transition from a committed chondroprogenitor cell, found within condensing mesoderm, to a chondroblast located within the core of the nodule.
Analysis of RAR gene expression in micromass cultures after 4 d has shown that RAR
mRNA is absent in
the core of the nodules but is abundantly expressed in the
condensing mesoderm. Therefore, RAR
mRNA is downregulated during chondroblast differentiation. In contrast,
RAR
appears to be upregulated in the core of the nodules in concert with chondroblast differentiation. In cultures initiated from transgene-expressing limb mesenchyme, RAR
is found to be abundantly expressed in
condensing mesoderm throughout the culture period and
continues to be expressed within the core of condensations
well after endogenous RAR
expression is downregulated. Together these results suggest that continued expression of RAR
during mesoderm-chondroblast differentiation interferes with the appearance of chondroblasts.
Hence, downregulation of RAR
appears to be a necessary step in chondroblast differentiation (Fig. 10). This
model has consequences for both understanding the role
of the receptors in teratogenesis as well as in the phenotypes observed in RAR null mutants.
Transgenic Mice Exhibit Phenotypes Consistent with RA Treatment
RA has been shown to modify limb development in a
number of phylogenetically distinct species (Tabin, 1991;
White et al., 1994
). Many of the phenotypes associated
with overexpression of tgRAR
in the developing limb
are similar to those observed in the fetuses of dams treated
with teratogenic doses of RA. RA teratogenesis causes a
spectrum of defects within the limbs that are most commonly reductionist in nature and are thought to be, in part,
a consequence of a delay in chondrogenesis (Kwasigroch
and Kochhar, 1980
; Zimmerman and Tsambos, 1985
; Kwasigroch et al., 1986
). These malformations include, within
the hind limb, fibular agenesis, brachypodism, syndactyly,
ectrodactyly, bowing of the tibia, and syntosis of the
zeugopods (Shenefelt, 1972
; Kochhar, 1973
; Kochhar and
Aydelotte, 1974
). All of these defects are found to varying
extents in the hind limbs of the tgRAR
transgenic mice
described herein.
Several studies have shown that RA inhibits chondrogenesis and that this inhibition is most likely RAR-mediated (Eckhardt and Schmitt, 1994; Von Schroeder et al.,
1994). Further studies with receptor-specific agonists have
shown that an RAR
-specific agonist is significantly more
potent in inducing limb malformations than either RAR
-
or RAR
-specific agonists (Elmazar et al., 1996
). RAR
is
expressed during chondrocyte maturation, whereas RAR
and RAR
are not; RAR
appears to be expressed in
most other tissues of the developing limb. Therefore, under conditions of retinoid excess where expression of
RAR
(Mendelsohn et al., 1991
; Jiang et al., 1994
) and
possibly RAR
(both genes are RA responsive) are elevated within the limb mesenchyme, a delay or inhibition of
chondroprogenitor differentiation could ensue, thereby interfering with normal skeletogenesis. No differences in the
expression of RAR
were observed between the limbs of
tgRAR
transgenic mice and wild-type animals (our unpublished observations), and expression was restricted to
the anterior and posterior necrotic zones and in the interdigital spaces, suggesting that RAR
is not contributing to
the observed phenotype in the transgenic mice.
Application of RA to the anterior margin of the developing chick limb has been shown to induce digit and skeletal element duplications (Tickle et al., 1982). Minor digit
duplications are apparent in the transgenic animals described herein. Duplications were observed in the fourth
distal phalanx within the forelimb and digit 1 in the hind
limb. Both of these duplications occurred at the anterior
boundary of transgene expression: digit 4 in the fore limb
and digit 1 in the hind limb. Numerous genes have been shown to be important in outgrowth and patterning of the
vertebrate limb, and some of these include sonic hedgehog
(Riddle et al., 1993
), HoxD cluster (Dollé et al., 1989a
),
and fibroblast growth factors (Niswander et al., 1993
,
1994). Analysis of the expression patterns of sonic hedgehog, fibroblast growth factor 4, and Hoxd9 through d12
mRNAs with whole-mount in situ hybridization showed no dramatic changes between transgenic and control animals; staining patterns were found to be consistent with
those reported by others (our unpublished observations).
These results suggest that the change in patterning observed in the transgenic animals may not involve changes
in the expression of one of these gene products, or because
the duplications are relatively minor (fourth distal phalanx
in the fore limb and periodic partial digit 1 duplication in
the hind limb), any changes in expression of these genes
might be fairly subtle and therefore difficult to detect.
Recently, mice have been made with null alleles of
RAR, RAR
, RAR
, and RXR
(Lohnes et al., 1993
;
Lufkin et al., 1993
; Sucov et al., 1994
; Luo et al., 1995
).
Mice homozygous for either mutant allele do not show any
phenotype in the paraxial skeleton, whereas mice homozygous for both, (RAR
/
, RAR
/
), have severe limb malformations (Lohnes et al., 1994
). The limbs of these
animals display proper anteroposterior symmetry, suggesting that the primary defect is not at the level of pattern
formation (Lohnes et al., 1994
). With the exception of the
RXR
null mice, treatment of RAR null embryos with
teratogenic doses of RA results in limb defects comparable to that seen in heterozygous or wild-type embryos. The
observation that RXR
null mutants are resistant to RAinduced limb defects underscores the importance of
RXR
as an integral component of the RA signaling cascade in vivo (Sucov et al., 1995
). It is interesting to note
that in both RAR
/RAR
2 and RAR
/RAR
null mice,
the mice display ectopic cartilages in a number of sites
throughout the animal. Furthermore, ectopic cartilages
were sometimes present in the interdigital region, and the
synovial joints were poorly defined in RAR
/RAR
null
mice. Given that the presence of RAR
and possibly the
other RARs may be important in regulating cartilage formation, this suggests that their absence creates permissive
conditions and could be expected to give rise to ectopic
cartilages, as observed in these animals.
We have provided evidence that the loss of RAR expression appears to be an important regulatory component of mesoderm differentiation into chondroblasts in
that chondroprogenitor cells that express RAR
failed to
differentiate into chondroblasts. Continued expression of
RAR
in cells destined to become chondroblasts contributes to a different cellular fate, which is currently under investigation. Overall, downregulation of the RARs may be
an important determinant in regulating cellular differentiation which has practical implications in understanding
their role in normal and abnormal development.
Received for publication 4 April 1996 and in revised form 21 June 1996.
D. Cash has been supported by Public Health Service (PHS) predoctoral training grant CA09111. This research was supported by a PHS grant CA39066 to E. Linney and a Medical Research Council of Canada grant MT-13676 to T.M. Underhill. The transgenic mice were produced by the shared transgenic mouse resource of the Duke University Comprehensive Cancer Center. All experiments conducted with animals were performed in accordance with the Duke University Institutional Animal Care & Use Committee Protocol.The authors would like to thank Drs. T.J. Montine, M.C. Colbert, A.L. Darrow, and L.E. Kotch for helpful discussions, as well as J. Burchette.
E, embryonic day;
RA, retinoic acid;
RAR, RA receptor;
RXR, retinoid X receptor;
tgRAR, transgenic
RAR
.