* Department of Molecular Oncology, Department of Pharmaceutical Sciences, and § Department of Molecular Biology,
Genentech, Inc., South San Francisco, California 94080; and ¶ Cell Cycle Control Laboratory, Institut Suisse Recherches
Expérimentales sur le Cancer, CH-1066 Epalinges, Switzerland
We have investigated proteins which interact with the PEST-type protein tyrosine phosphatase, PTP hematopoietic stem cell fraction (HSCF), using the yeast two-hybrid system. This resulted in the identification of proline, serine, threonine phosphatase interacting protein (PSTPIP), a novel member of the actin- associated protein family that is homologous to Schizosaccharomyces pombe CDC15p, a phosphorylated protein involved with the assembly of the actin ring in the cytokinetic cleavage furrow. The binding of PTP HSCF to PSTPIP was induced by a novel interaction between the putative coiled-coil region of PSTPIP and the COOH-terminal, proline-rich region of the phosphatase. PSTPIP is tyrosine phosphorylated both endogenously and in v-Src transfected COS cells, and cotransfection of dominant-negative PTP HSCF results in hyperphosphorylation of PSTPIP. This dominant-negative effect is dependent upon the inclusion of the COOH-terminal, proline-rich PSTPIP-binding region of the phosphatase. Confocal microscopy analysis of endogenous PSTPIP revealed colocalization with the cortical actin cytoskeleton, lamellipodia, and actin-rich cytokinetic cleavage furrow. Overexpression of PSTPIP in 3T3 cells resulted in the formation of extended filopodia, consistent with a role for this protein in actin reorganization. Finally, overexpression of mammalian PSTPIP in exponentially growing S. pombe results in a dominant-negative inhibition of cytokinesis. PSTPIP is therefore a novel actin-associated protein, potentially involved with cytokinesis, whose tyrosine phosphorylation is regulated by PTP HSCF.
THE control of cellular processes by tyrosine phosphorylation is a well-known aspect of eukaryotic
physiology (Fantl et al., 1993 The PEST family of PTPs are a group of enzymes about
which little functional information is known. The four examples of these enzymes, PTP PEST (Yang et al., 1993 The possible functions of PEST PTPs can be gleaned
from an examination of the proteins that interact with
these enzymes, the effects of overexpression of the phosphatases on cellular differentiation, and the possible
modes of regulation of the molecules. Transfection of
dominant-negative forms of PTP PEST into COS cells results in an endogenous, hyperphosphorylated protein that
has been identified as p130CAS, a cytoplasmic docking/
adaptor-type molecule that contains an SH3 domain, as
well as several potential tyrosine-phosphorylated SH2
binding sites (Garton et al., 1996 We have used the yeast two-hybrid system to identify
potential substrates for PTP HSCF. This has resulted in
the isolation of a novel member of the actin associated
protein family, termed proline, serine, threonine phosphatase interacting protein (PSTPIP), which is homologous to Schizosaccharomyces pombe CDC15, a phosphorylated, actin-associated protein involved with formation
of the cleavage furrow during cytokinesis (Fankhauser et al.,
1995 Two-hybrid Screening
Yeast two-hybrid screening was performed essentially as described in
Chien et al. (1991) Mapping of Interaction Domains
To obtain a cDNA encoding full-length PSTPIP tagged with the FLAG
epitope (DYKDDDDK) at the COOH terminus, PCR was performed using the 5 Analysis of Tyrosine Phosphorylation
Baf3 or PSTPIP-transfected COS cells were lysed in 1% Triton X-100, 50 mM Hepes, pH 7.2, 10% glycerol, and 5 mM EDTA containing 1 µm/ml
aprotinin, PMSF, leupeptin, and pepstatin with 1 mM sodium vanadate,
and 10 mM iodoacetic acid. A portion of cells were pretreated with 0.1 mM pervanadate for 4 h before lysis. Immunoprecipitations were performed in the vanadate-containing lysis buffer using 1 µg/ml anti-PSTPIP
polyclonal antibody and 400 µg of lysate protein at 4°C overnight. Western blots were performed using 1 µg/ml affinity-purified anti-PSTPIP or 2 µg/ml of commercial 4G10 anti-phosphotyrosine monoclonal (Upstate
Biotechnology Inc., Lake Placid, NY). Signal was detected by ECL (Amersham Corp., Arlington Heights, IL) reagents (Pierce Chemical Co.,
Rockford, IL). The C221-S mutant was as previously described (Cheng et
al., 1996 Confocal Microscopy of Endogenous and
Transfected PSTPIP
Rabbit polyclonal antibodies were produced against a PSTPIP-GST fusion protein. The complete PSTPIP-GST fusion protein was purified on
GSH-Sepharose and injected intramuscularly at two sites with 200 µg fusion protein, and subcutaneously at multiple sites with a total of 300 µg
PSTPIP-GST fusion protein in Complete Freunds Adjuvant (Sigma
Chemical Co., St. Louis, MO). Rabbits were boosted every 3 wk with
100 µg fusion protein in Incomplete Freunds. 15 ml of rabbbit sera was
reacted with 0.5 mg PSTPIP-GST-GSH-Sepharose for 3 h at 4°C with gentle rotation. The resin was collected by centrifugation and washed with 10 column volumes of PBS. Immunoglobulin was eluted from the affinity matrix with 100 mM acetic acid, 500 mM NaCl, neutralized with NaOH, and
then dialyzed overnight with PBS. NIH 3T3 cells were seeded at 100,000 cells per chamber slide and allowed to adhere overnight. The cells were
transfected using Lipofectamine (2 µg pRK.PIP.FLAG.C/12 µl lipofectamine in 0.8 ml OPTI-MEM) for 5 h. The DNA/Lipofectamine solution was removed and fresh serum-containing medium added. 48 h after
the start of transfection, the cells were fixed in 4% formaldehyde in
PHEM 6.1 (60 mM Pipes, 25 mM Hepes, 10 mM EGTA, and 2 mM
MgCl2) for 20 min, and then permeabilized in 0.2% Triton X-100, 300 mM
sucrose in PHEM 6.9 for 10 min. The cells were washed twice in PHEM
6.9 and then incubated with 10% FBS/PHEM 6.9 for 1 h to block nonspecific binding of the antibody. Cells were incubated for 1 h in 2% BSA/ PHEM 6.9 containing 10 µg/ml M2 (anti-FLAG monoclonal antibody; Eastman Kodak) or 10 µg/ml 12CA5 (anti-HA monoclonal antibody; Boehringer Mannheim Biochemicals) as an irrelevant antibody control. After washing cells twice with 2% BSA/PHEM 6.9, cells were incubated for 30 min with a 1:2,000 dilution of Cy3-conjugated AfinniPure sheep
anti-mouse IgG and a 1:200 dilution of fluorescein-phalloidin (Molecular
Probes Inc., Eugene, OR) in 2% BSA/PHEM 6.9. Cells were washed in
2% BSA/PHEM 6.9 and mounted in Vectashield Mounting Medium with
DAPI. NIH 3T3 cells were seeded at 200,000 cells per chamber slide and
allowed to adhere overnight. Cells were stained with 0.4 µg/ml rabbit anti-PIP or 0.4 µg/ml rabbit IgG and detected with Cy3-conjugated goat anti-
rabbit. Additionally, cells were costained with a 1:200 dilution of fluorescein-phalloidin. The samples were examined in a confocal microscope
(model 2001; Molecular Dynamics, Inc., Sunnyvale, CA); and analyzed
with the ImageSpace software (Molecular Dynamics, Inc).
Expression of PSTPIP in S. pombe
S. pombe were grown according to standard methods (Moreno et al.,
1991 Identification of a PTP HSCF Binding Protein
To identify potential substrates for PTP HSCF (Cheng et
al., 1996 Fig. 1 illustrates that the protein that interacts with PTP
HSCF is a novel 415-residue molecule (predicted molecular weight of ~47,590) with significant sequence homology
to the S. pombe cell cycle protein, CDC15p, a cytoskeletal
interacting protein involved with organization of the actin
ring at the cleavage furrow during cytokinesis (Fankhauser
et al., 1995
Northern blot analysis of the expression of PSTPIP during embryogenesis and in adult tissues is illustrated in Fig.
2. During embryogenesis, the transcript is most highly expressed in the day 7 embryo. The transcript is expressed at
relatively high levels in adult lung and spleen and at lower
levels in testis, muscle, kidney, brain, and heart. However,
the interacting protein is at far lower levels than actin,
since the actin blots were exposed for 4 h versus the 1 wk
exposure for the PSTPIP blots. Previously, we and others
have demonstrated that PTP HSCF is also expressed in
both adult lung and kidney (Cheng et al., 1996
Characterization of the Interaction between PTP HSCF
and PSTPIP
To characterize the regions involved with the binding between PTP HSCF and PSTPIP, a rapid and direct in vitro
binding assay was performed. In this assay, various GST
fusions of either the phosphatase or the interacting protein
were used to precipitate in vitro translation products of
the cognate binding proteins. Fig. 3 illustrates that precipitation of in vitro-translated PTP HSCF by GST fusion
proteins containing various SH3 domains as well as full-length PSTPIP demonstrated a high degree of specificity in the interaction between the GST PSTPIP and the phosphatase. The figure also illustrates that at this concentration of GST fusion protein (~1 µg/ml or ~1.5 µM), the
PSTPIP fusion protein appeared to be more efficient at
precipitating the phosphatase than a polyclonal antibody
directed against the enzyme or a monoclonal directed
against a hemagglutinin tag at the PTP NH2 terminus
(data not shown). This result is consistent with a relatively
high affinity interaction between the GST PSTPIP and the
in vitro-translated PTP HSCF.
The region of PTP HSCF that interacts with PSTPIP
was identified by producing deletion mutants of the enzyme missing either the 24-amino acid CTH domain,
which is highly conserved in all of the PEST PTPs (Matthews et al., 1992
To examine the region of PSTPIP that interacts with the
COOH-terminal homology region, GST fusions containing either the SH3 domain or the coiled-coil domain of the
interacting protein were used to immunoprecipitate in
vitro-translated PTP HSCF. The COOH terminal homology region that interacts with PSTPIP contains two overlapping consensus SH3 (PXXP) binding sites, consistent
with the possibility that the phosphatase-PSTPIP interaction was an SH3-type binding event (Pawson, 1995
PSTPIP Is a Substrate for PTP HSCF
Phosphatase Activity
The association between PTP HSCF and PSTPIP suggested that the interacting protein might be a substrate for
the phosphatase. In addition, the conservation of a number of tyrosines between PSTPIP and the phosphorylated
CDC15 protein was also consistent with the possibility
that the interacting protein was tyrosine phosphorylated.
As Fig. 6 A demonstrates, endogenous PSTPIP is indeed
tyrosine phosphorylated in Baf3 cells in the presence of the tyrosine phosphatase inhibitor vanadate (Dixon, 1995
As can be seen from Fig. 6, B and C, both PTP HSCF as
well as PSTPIP are tyrosine phosphorylated in response to
v-Src cotransfection. Transfection of wild-type, C-S, and
D-A mutants of PTP HSCF together with v-Src (Fig. 6 B)
demonstrates that the mutant forms of the enzyme were
hyperphosphorylated, while the wild-type PTP was not; this is consistent with the enzyme being a substrate for v-Src tyrosine phosphorylation. In addition, because only the
dominant-negative forms of the enzyme mediated PTP
HSCF hyperphosphorylation, these results also suggest
that PTP HSCF is a substrate for its own catalytic activity.
Fig. 6 B also illustrates that PSTPIP coprecipitates with
the dominant-negative forms of the enzyme and is hyperphosphorylated, consistent with the conclusion that PSTPIP is a substrate for the catalytic activity of PTP HSCF.
Fig. 6 C illustrates that transfection of the wild-type PTP
HSCF into PSTPIP and v-Src-expressing cells resulted in
a decreased level of tyrosine phosphate on PSTPIP, consistent with the in vivo removal of the phosphate from
PSTPIP tyrosines by the phosphatase, a result that would
be expected if the interacting protein were a substrate for
the enzyme. Even more compellingly, Fig. 6 C also illustrates that cotransfection of either dominant-negative
form of PTP HSCF into PSTPIP and v-Src-transfected cells resulted in a dramatic increase in the levels of tyrosine phosphate on the interacting protein as well as on
the coprecipitating PTP HSCF. Analysis of total tyrosine-phosphorylated proteins in transfected cells demonstrated
that the dominant-negative forms of PTP HSCF showed
complete substrate specificity for both PTP HSCF itself
and PSTPIP (data not shown). These data thus confirm the conclusion that PSTPIP interacts with PTP HSCF in
vivo, and they suggest that this interaction allows the phosphatase to dephosphorylate tyrosine residues modified by
the v-Src kinase. Moreover, they imply that PTP HSCF is
a v-Src substrate for tyrosine phosphorylation, and that
these phosphotyrosine residues are substrates for the catalytic activity of the phosphatase. In addition, because tyrosine-phosphorylated PSTPIP was only observed in cells
that were transfected with v-Src, these results also suggest
that the dramatic overexpression of the protein in these
cells may have overwhelmed the endogenous tyrosine phosphorylation mechanism.
The in vitro mapping analysis described previously suggested that PSTPIP interacted with PTP HSCF via the
COOH-terminal 24-amino acid homology domain found in
all PEST PTPs. Previous work in the PEST PTP system
demonstrated that p130cas was a substrate for this enzyme,
and the recognition of this substrate appeared to be predominantly dependent upon the catalytic domain (Garton
et al., 1996
Subcellular Localization of PSTPIP
S. pombe CDC15p is associated with the cleavage furrow
localized F-actin during cytokinesis (Fankhauser et al.,
1995
Importantly, examination of cells undergoing cytokinesis reveals that endogenous PSTPIP is predominantly associated with the cleavage furrow (Fankhauser et al., 1995 Filopodial Induction by Overexpressed PSTPIP
One role that PSTPIP might play in the cleavage furrow is
the reorganization of polymerized actin (Cao et al., 1990a;
Fishkind and Wang, 1993
Overexpression of PSTPIP in Exponentially Growing
S. pombe
To examine the function of PSTPIP in a readily controlled,
genetically defined in vivo system, we overexpressed the
protein in the fission yeast S. pombe using the thiamine inducible promoter system (Basi et al., 1993
We have isolated a novel member of the actin-associated
protein family, PSTPIP, which binds to the PTP HSCF tyrosine phosphatase via an interaction between the proline-rich CTH domain of the PTP and the potential coiled-coil
domain of the interacting protein. Like many other proteins associated with the cytoskeleton, PSTPIP is tyrosine
phosphorylated in v-Src-transfected cells, and these phosphorylated residues appear to be substrates for the catalytic activity of the bound PTP HSCF. PSTPIP is localized
to the cortical cytoskeleton, as well as in lamellipodia and
it appears to migrate to the actin-rich cleavage furrow during cytokinesis. Overexpression of the protein in 3T3 cells
induces long filopodial structures, consistent with a role
for PSTPIP in the reorganization of the cytoskeleton. High
level expression of the mammalian protein in the fission
yeast S. pombe resulted in a dominant-negative inhibition of the completion of cytokinesis. These data suggest that
PSTPIP is likely to be a cytoskeletal-associated protein,
potentially involved with cytokinesis, whose physiological
function is potentially regulated by its degree of tyrosine
phosphorylation.
Analysis of the protein database for sequences with homology to PSTPIP suggests potential functions for this
novel protein. Most of the sequences with significant homology to PSTPIP fall into the actin-associated family of
proteins, and it is clear from the confocal studies reported
here that PSTPIP is also associated with actin. While a
number of other actin-interacting proteins, including myosin, fodrin, and spectrin, show homology to PSTPIP, the
bulk of these homologies are within the SH3 domain, with
little or no match in other regions of the protein. This is
also true for cortactin (Wu et al., 1991 Phosphorylation, especially of serine and threonine residues, has been previously shown to play important roles in
regulating events in cytokinesis and reorganization of the
cytoskeletal (Mabuchi and Talcano-Ohmuro, 1990; Satterwhite et al., 1992 The use of dominant-negative forms of PTPs has previously been used to identify substrates for several enzymes,
most notably PTP PEST (Garton et al., 1996 The v-Src-mediated tyrosine phosphorylation of PTP
HSCF, together with the demonstration that dominant-negative forms of the enzyme induce a hyperphosphorylated state, strongly suggest that this PTP mediates its own
autodephosphorylation. As expected, while the dominant-negative effect of the PTP on PSTPIP phosphorylation requires the COOH-terminal 24-amino acid homology domain, the dominant-negative hyperphosphorylation of the
PTP does not require this region, further supporting the
hypothesis that the interaction between PSTPIP and PTP
HSCF is required for substrate recognition. Other PTPs,
including SHP-1 (Bouchard et al., 1994 The nature of the high affinity binding between the proline-rich CTH domain and the coiled-coil region is reminiscent of that previously described for the SH3-proline-rich core interaction (Pawson, 1995 The mechanism by which PSTPIP migrates from the
cortical actin, lamellipodia and stress fiber regions in resting cells to the cytokinetic cleavage furrow in dividing cells
can only be speculated upon (Strome et al., 1993; Fishkind
et al., 1995). One possibility is that this protein binds tightly
to actin, and when the actin is reoriented to the cleavage
plane, the PSTPIP accompanies it passively (Cao et al.,
1990a,b; Fishkind et al., 1993). However, experiments in
yeast where cdc15p is deleted revealed that cortical actin
did not migrate to the cleavage plane in the absence of this
protein, suggesting that cdc15p actively traverses to this
site and mediates the assembly of the actin ring (Fankhauser et al., 1995 A possible mechanism by which PSTPIP functions is
suggested by the results of overexpression studies in murine 3T3 cells. The extended filopodial structures in many
of these transfected cells are consistent with the possibility
that the unregulated expression of the protein mediates an
ectopic and organized assembly of actin filaments, thus resulting in a cellular protrusion containing PSTPIP and
F-actin. While the striking level of lysine residues in the
predicted coiled-coil domain of this protein is consistent with previously described actin binding sites (Vandekerckhove, 1990 The results of overexpression of mammalian PSTPIP in
exponentially growing S. pombe provide support for a role
for this protein in cytokinesis. Fission yeast cells grow
mainly by elongation at their tips, and divide by binary fission after forming a centrally placed actin-rich septum. In
S. pombe, F-actin is seen as patches or dots at sites of cell
growth or division. During interphase, it is found at the
growing ends of the cell, and, after the onset of mitosis, it
relocates to form an equatorial ring whose position anticipates the site of septum formation (Marks and Hyams,
1985 The results reported here describe PSTPIP, a novel member of the cytoskeleton-associated protein family, which is
a substrate for the PTP HSCF. The homology of PSTPIP
with the fission yeast cdc15 protein, together with the
demonstration of in vivo tyrosine phosphorylation of the
interacting protein, association with the cortical cytoskeleton and cellular cleavage furrow, the induction of cytoskeletal alterations, and the dominant-negative inhibition of S. pombe cytokinesis are all consistent with the possibility that PSTPIP is a mammalian homologue of the yeast
cleavage furrow regulatory protein. Because this protein
interacts with and is an enzymatic substrate for the PTP
HSCF, this hypothesis suggests that the control of tyrosine
phosphorylation of PSTPIP by this PTP may provide for a
novel mechanism for the control of cleavage furrow formation during cytokinesis.
; Hunter, 1994
). While
much information has accumulated regarding the functions of many tyrosine kinases, far less is understood about
the physiological roles of protein tyrosine phosphatases (PTPs).1 Approximately 50 PTPs have now been described, but the functions of just a handful are only beginning to be comprehended (Tonks, 1993
; Dixon, 1996
). In
general, it appears that many of the PTPs are involved
with the modulation of positive or negative signals induced by various tyrosine kinases. This function is most
completely understood in the case of Src Homology (SH)
PTP1, where mutations in the murine gene result in a
number of hematopoietic abnormalities that are best explained by hyperactivity of diverse tyrosine kinases (Shultz, et al., 1993; Klingmuller et al., 1995
). In another
example, various members of the µ/
/
receptor PTP family may regulate the tyrosine phosphorylation levels of the
cadherin-catenin complex, suggesting that these PTPs are
involved with the control of cell adhesion (Brady-Kalnay
et al., 1995
; Fuchs et al., 1996
; Cheng et al., 1997
). The
level of tyrosine phosphorylation of cyclin-dependent kinase is regulated by the CDC25 PTP, and this cyclical dephosphorylation is involved with the control of the cell
cycle (Gautier et al., 1991
). Finally, dual specific phosphatases, enzymes that are capable of dephosphorylating
serine and threonine as well as tyrosine, may be involved
with the regulation of MAP kinase phosphorylation, and
are therefore critical for the regulation of disparate signaling phenomenon (Muda et al., 1996
). While these data
provide a number of compelling examples of the importance of PTPs, it is likely that these enzymes are involved
with a far greater diversity of cellular processes, which remain to be defined.
),
PTP PEP (Matthews et al., 1992
), PTP HSCF (Cheng et
al., 1996
) (also known as PTP-K1 [Huang et al., 1996
],
PTP20 [Aoki et al., 1996
], fetal liver phosphatase (FLP)1
[Dosil et al., 1996
]), and PTP brain-derived phosphatase (BDP)1 (Kim et al., 1996
), contain an NH2-terminal phosphatase domain followed by a variably sized region that is
rich in proline, serine, and threonine. Initially, these noncatalytic COOH-terminal regions were thought to contain
"PEST" motifs, which have been proposed to shorten intracellular protein half lives (Rogers et al., 1986
). However, recent data have demonstrated that PEST PTPs do
not appear to have extraordinarily short intracellular lifetimes (Flores et al., 1994
; Charest et al., 1995
), suggesting
that these COOH-terminal regions may have other functions. Interestingly, the very COOH-termini of the PEST
PTPs contain a 24-amino acid proline-rich region that is
highly conserved in all four members of this family. Initially, it was proposed that this region was involved with
the nuclear targeting of the PEP PTP (Flores et al., 1994
),
but subsequent data have demonstrated that this PTP (Cloutier et al., 1996), as well as PTP PEST (Yang et al.,
1993
; Charest et al., 1995
), are both localized to the cytoplasm. In the case of PTP HSCF, one group has demonstrated that the enzyme is predominantly cytoplasmically
localized (Huang et al., 1996
), while another group demonstrated primarily nuclear localization using a different
technique (Dosil et al., 1996
). With respect to cell type expression, the PTP PEST is ubiquitously expressed (Yang
et al., 1993
); the PTP PEP is expressed in lymphoid cells (Matthews et al., 1992
); the PTP HSCF is expressed in hematopoietic stem/progenitor cells and fetal thymus (Cheng
et al., 1996
; Dosil et al., 1996
), as well as a subset of adult
tissues, particularly, bone marrow (Huang et al., 1996
);
and the PTP BDP 1 is expressed at low levels in brain as
well as other adult tissues (Kim et al., 1996
).
). The function of p130CAS
is incompletely understood, but it appears to be associated
with focal adhesions and phosphorylated by the p125FAK
(Petch et al., 1995
) and the RAFTK (Astier et al., 1997
) tyrosine kinases, suggesting that it may play a role in integrin-mediated signal transduction. Because dominant-negative PTP PEST inhibits dephosphorylation of p130CAS, it
is likely that this phosphoprotein is a substrate for this PTP, and it has been demonstrated that the recognition of
p130CAS by PTP PEST is through the catalytic domain
(Garton et al., 1996
). It also has been shown recently that
the PTB domain of the cytoplasmic adaptor protein SHC
interacts with a nonphosphorylated, PTB-related binding
site in the COOH-terminal region PTP PEST (Charest et al., 1996
). Recent data have demonstrated that Csk, a cytoplasmic tyrosine kinase which inactivates Src family kinases, associates with the PEP PTP via an interaction between the Csk SH3 domain and one of the four proline-rich potential SH3 binding sites in the COOH-terminal region of the enzyme (Cloutier et al., 1996). Together, these
results suggest that PTP PEST and PTP PEP both interact
with critical cytoplasmic signaling proteins involved with
the transmission of information from various cell surface receptors. Overexpression of PTP HSCF in PC12 cells resulted in a more rapid and robust neurite formation in response to NGF, suggesting that this PTP may be involved
with cytoskeletal reorganization (Aoki et al., 1996
). In
support of this supposition, overexpression of a dominant-negative form of this enzyme in K562 hematopoietic progenitor cells resulted in an inhibition of cell spreading and substrate adhesion in response to phorbol ester (Dosil et
al., 1996
). With respect to regulation of these PTPs, analysis of PTP PEST revealed that phosphorylation of an NH2-terminal serine residue (conserved in all members of the
PEST PTP family) by protein kinase A resulted in the inhibition of phosphatase specific activity (Garton et al.,
1994). These data suggest that serine, and potentially tyrosine phosphorylation of PEST PTPs may influence their
catalytic activity.
). PSTPIP binds to PTP HSCF via a novel, high affinity interaction between the coiled-coil region of PSTPIP
and the proline-rich COOH-terminal domain of the phosphatase. Endogenous PSTPIP is tyrosine phosphorylated in Baf3 cells and the v-Src tyrosine kinase induces the tyrosine phosphorylation of both PSTPIP as well as PTP
HSCF. This phosphorylation is dramatically enhanced by
coexpression of dominant-negative forms of PTP HSCF,
suggesting that both of these proteins are substrates for
the enzyme. The dominant-negative increase of PSTPIP tyrosine phosphorylation is dependent upon the inclusion
of the COOH-terminal 24-amino acid PSTPIP binding
site of the phosphatase. In Swiss 3T3 cells, endogenous
PSTPIP is associated with both the cortical actin cytoskeleton and lamellipodia during interphase and also colocalizes with the actin ring of the cleavage furrow during cytokinesis. Overexpression of PSTPIP in Swiss 3T3 cells results
in the formation of extended filopodial structures in a subset of the transfected cells, consistent with the possibility that this protein provokes actin reorganization. Interestingly, overexpression of PSTPIP in exponentially growing S. pombe results in a dominant-negative inhibition of cytokinesis. These data suggest that PSTPIP is a tyrosine-phosphorylated, cytoskeletal-associated protein, possibly involved with the control of cytokinesis, which is a substrate
for the tyrosine phosphatase activity of PTP HSCF.
Materials and Methods
and Bartel et al. (1995). A C221-S active site mutant of
PTP HSCF (Cheng et al., 1996
) was cloned in frame with the Gal binding
domain in the plasmid pPC97. A library of 6 × 106 individual cDNA
clones was produced from Baf3 lymphoid progenitor cells in the Gal activation domain plasmid, pPC86, using standard procedures. Yeast were
transformed with both plasmids and were incubated on histidine minus
plates for 3 d at 30°C. Colonies that grew under these conditions were restreaked onto histidine minus plates and were tested for
-galactosidase
activity (Bartel et al., 1995). Colonies that manifested various levels of
-galactosidase activity were isolated, and the cDNA inserts in the pPC86
vector were isolated by PCR and sequenced using standard procedures. Clones encoding PSTPIP were tested for dependence on the PTP interaction by transfection into cells with and without the original PTP HSCF- containing pPC97 plasmid and subsequent analysis for growth on histidine
minus plates and
-galactosidase activity.
PSTPIP-specific primer 48.BAMHI.F (CGCGGATCCACCATGATGGCCCAGCTGCAGTTC) and the 3
PSTPIP-specific primer
48.SAL.FLAG.R (GTACGCGTCGACTCACTTGTCATCGTCGTCCTTGTAGTCGAGCTT). The resulting pcr fragment was digested with
BamHI and SalI, and subcloned into the BamHI and SalI sites of pRK.tkneo, an expression plasmid containing the cytomegalovirus promoter, thus
creating plasmid pRK.PIP.FLAG.C. The PTP HSCF deletion mutants
were derived from a construct containing the influenza hemagglutinin
epitope at its NH2 terminus and were made as follows: PCR was performed on PRK.HSCF using primers prkr (TGCCTTTCTCTCCACAGG) and 38.SPE.mid.R (CTCCTTGAGGTTCTACTAGTGGGGGCTGGTGTCCTG). The resulting pcr fragment encoding the phosphatase
domain (amino acids 1-302) was digested with ClaI and SpeI and subcloned into pRK.tk.neo digested with ClaI and XbaI resulting in plasmid
pRK.HSCF.PTP domain. Similarly, a PTP HSCF cDNA missing the
COOH-terminal homology (CTH) domain was produced by PCR using
primers prkr and 39.SPE. endR (GCGGCCGCACTAGTATCCAGTCTGTGCTCCATCTGTTAC), and the resulting fragment encoding amino
acids 1-430 of PTP HSCF was digested with ClaI and SpeI and subcloned
into the ClaI and XbaI sites of pRKtkneo resulting in pRK HSCF
24.
Glutathione-S-transferase (GST) fusion proteins were prepared essentially according to the manufacturer (Pharmacia LKB Biotechnology, Inc.,
Piscataway, NJ) in DH5-
bacterial cells. A SalI to NotI fragment containing the full-length cDNA for PSTPIP (amino acids 2-415) was subcloned into pGEX-4T-2 (Pharmacia LKB Biotechnology Inc.) cleaved at the SalI
and NotI sites. To obtain a DNA fragment encoding the coiled-coil domain of PSTPIP, PCR was performed using primers PC86F (GCGTTTGGAATCACTAC) and pip48.1706R (TTATAGTTTAGCGGCCGCTCACCGGTAGTCCTGGGCTGATG). The PCR fragment was digested
with SalI and NotI and subsequently cloned into the SalI and NotI sites of
pGEX-4T-2. To obtain a cDNA fragment encoding the SH3 domain of
PSTPIP, PCR was performed using primers pip48.1673.F (GTACGCGTCGACCGCACTCTACGACTACACTGCACAG) and PC86R (CTCTGGCGAAGAAGTCC), and the resulting product was digested with
SalI and NotI and subcloned into the SalI and NotI sites of pGEX-4T-2.
To obtain a cDNA fragment encoding the PST-rich region and CTH domain of PTP HSHCF (amino acids 304-453), PCR was performed using
primers PST38-RI (GATCGAATTCCCAGAACCTCAAGGAGAACTGC) and PST38-XHOI (GATCCTCGAGTTACACCCGTGTCCACTCTGCTGGAGGA). The resulting pcr product was digested with
EcoRI and XhoI, and then subcloned into the EcoRI and Sal sites of
pGEX-4T-2. Protein determinations were carried out according to the
Couprus assay with a kit from Geno Technology (St Louis, MO). The
binding was carried out according to the method of Wong and Johnson
(1996)
. Briefly, 1 µg of plasmid with either the PSTPIP protein or HSCF
PTP under the control of the Sp6 promoter was in vitro-transcribed/translated using the Promega TnT Rabbit Reticulocyte system (Promega
Corp., Madison, WI). Samples were diluted in 50 mM Hepes, pH 7.2, 1%
Triton X-100, 10% glycerol, 100 mM NaCl, 5 mM EDTA, and 2 µm/ml
each of leupeptin, pepstatin, aprotinin, and PMSF. Samples were pre-cleared with resin for 1 h and 1 µg GST fusion protein was added along
with 30 µl of GSH-Sepharose that was previously blocked in 3% BSA for 1 h. This was reacted for 1 h at 4°C and then the resin washed six times in
Hepes/Triton X-100 binding buffer before SDS gel electrophoresis. The
peptides were synthesized on an automated Milligen 9050 Peptide Synthesizer (Applied Biosystems, Inc., Foster City, CA) using standard solid
phase chemistry with FMOC-protected amino acids on a p-alkoxybenzyl
alcohol resin. Dried peptides were resuspended in the Hepes/Triton
X-100 binding buffer at a concentration of 10 mg/ml. Peptide inhibition
was performed by adding the peptide first to the in vitro translation product, and then to the GST fusion, followed by the GSH-Sepharose. The binding/washing steps were done as previously described. The peptides synthesized and the PTPs they were derived from were: PXXP-HSCF: 432GFNLRIGRPKGPRDPPAEWT451 (PTP HSCF), PXXP-PEP:782GFG-NRFSKPKGPRNPPSAW800 (PTP PEP), PXXP-PEST:761GFGNRC-GKPKGPRDPPSEWT780 (PTP PEST), PXXP-CONTROL:334GGVLRS-ISVPAPPTLPMADT353 (PTP HSCF).
). The PTP HSCF D197-A mutant was generated using PCR. Mutagenesis primer D197A.F (GTATATGTCCTGGCCAGCCCATGGGGTTCCCAGCAG), corresponding to nucleotide 591, and primer
D197A.R (GCAGGTCGACTCTAGATTACACCCGTGTCCACTCTG), which corresponds to the stop codon, were used in PCR to generate a
fragment that could be cut with MscI and XbaI. pRK.HA.38 WT, a plasmid that encoded the wild-type enzyme under the control of the cytomegalovirus promoter (Cheng et al., 1996
), was digested with ClaI and MscI
and the resulting 600-bp fragment was ligated with the MscI-XbaI pcr
fragment into the ClaI and XbaI sites of pRK.tkneo. A plasmid encoding
the v-Src oncogene under the control of the Sv40 early promoter was the
kind gift of A. Levinson (Genentech, Inc., South San Francisco, CA). National Institutes of Health 3T3 cells and COS-7 cells were cultured in high
glucose DME supplemented with 10% FBS, 2 mM L-Glutamine, 10 mM
Hepes, pH 7.2, and pen-strep. COS-7 cells were transfected by electroporation. Briefly, 1.5 × 10
6 COS-7 cells were mixed with 24 µg total DNA
in PBS and electroporated at 960 microfarod, 0.22 V (Gene Pulsar; Bio
Rad, Hercules, CA). After electroporation cells were seeded in 10-cm
dishes and incubated for 3 d. 10-cm dishes of transfected COS cells were
washed twice with ice-cold PBS, and then lysed in 1 ml of M-RIPA (50 mM Tris 7.4, 1% NP-40, 0.25% deoxycholate, 150 mM NaCl, 1 mM sodium ortho-vanadate, 1 mM NaF plus CompleteTM Protease Inhibitors
[Boehringer Mannheim Biochemicals, Indianapolis, IN]). Lysates were incubated for 15 min with 100 µl UltraLink Immobilized Protein A/G
(Pierce Chemical Co.) at 4°C, followed by centrifugation for 5 min. Supernatants were collected and stored at
70°C, or directly immunoprecipitated. 5 µg of M2 (Eastman Kodak, Inc., Rochester, NY) or 12CA5 (Boehringer Mannheim, Inc.) was added to 500 µl of lysate and incubated
overnight at 4°C. Ultralink Protein A/G was added and incubation continued for 2 h at 4°C. The immune complexes were washed three times with
M-RIPA. The proteins were subjected to SDS-PAGE and transferred to
nitrocellulose in 2× transfer Buffer, 20% methanol (Novex, San Diego,
CA). Immunoblots were blocked at room temperature for 1 h in 3% milk/
PBS. To detect FLAG-tagged PIP, blots were incubated overnight with 10 µg/ml Bio-M2 (Biotinylated anti-FLAG monoclonal Ab; Eastman
Kodak), followed by incubation in 10 µg/ml streptavidin-HRP (Upstate
Biotechnology Inc.). To detect hemagglutanin (HA)-tagged PTPhscf, blots
were incubated in anti-HA-peroxidase (Boehringer Mannheim, Inc.) as per
manufacturer's instructions. To detect phosphotyrosine, blots were incubated in HRP-conjugated 4G10 (anti-phosphotyrosine monoclonal; Upstate
Biotechnology, Inc.) as per manufacturer's instructions.
). Cells were fixed and stained as for F-actin as described in Marks
and Hyams (1985)
. The PSTPIP gene was expressed from nmt 1 promoter
plasmid, REP3 (Basi et al., 1993
). For induction, a culture in mid-exponential growth in minimal medium containing 2 mM thiamine was washed
twice, and then reinoculated into fresh medium without thiamine to induce expression from the nmt1 promoter at 25°C. Cell number was determined with a CASY-1 cell counter (Coulter Immunology, Hialeah, FL).
Results
), we performed a yeast two-hybrid screen using a
catalytically inactive form of the enzyme as bait and a library derived from murine Baf3 hematopoietic progenitor
cells, a cell type that has been previously demonstrated to
express high levels of this phosphatase (Cheng et al.,
1996
). The catalytically inactive form of the enzyme was
used to decrease the potential toxicity of the overexpressed protein for the cells. This resulted in the isolation
of ~70 yeast clones that grew in the absence of histidine
and expressed variable levels of
-galactosidase. Sequence
analysis of the clones revealed that ~40% encoded related
sequences with slightly divergent 5
in-frame fusions with
the Gal 4 activating domain. The sequences of the remainder of the clones suggested that they were likely due to artifactual interactions. Analysis of histidine growth and
-galactosidase expression of all two-hybrid clones containing these related sequences revealed an absolute dependence on the inclusion of the phosphatase bait construct in the same cells (data not shown). The longest two-hybrid clone was used to isolate a full-length cDNA from
the original Baf3 two-hybrid library.
). This homology (~26% sequence similarity)
stretches over the entire length of both molecules, with the
exception of an insertion of ~500 residues in the yeast
molecule, and the yeast protein is the highest scoring homologue in the protein sequence database. A number of
features are conserved in these two proteins. For example,
both have an SH3 domain at their COOH termini (Pawson, 1995
; Feng et al., 1995
), and the mammalian SH3 domain appears to be homologous to those found in a number of known cytoskeletal regulatory proteins including myosin heavy chain, spectrin, fodrin, hematopoietic specific protein (HSP) and cortactin (Fig. 1). In addition, both
the mammalian and yeast proteins contain a potential
coiled-coil domain at their NH2 termini, which is predicted
both on the basis of sequence homology as well as an analysis of the mammalian sequence using the "Coil" program
(data not shown). Within these coiled-coil domains is a region with an extraordinary content of acidic and basic residues (positions 99-180 of the mammalian protein). Because the mammalian protein was isolated on the basis of
an interaction with a tyrosine phosphatase, it is possible
that the protein is tyrosine phosphorylated (see below),
and examination of the mammalian and yeast sequences
revealed seven conserved tyrosine residues (positions 53, 144, 191, 287, 363, 367, and 369 of the mammalian protein)
in addition to a number of non-conserved tyrosine residues. Finally, examination of the proteins for proline-rich regions that might function as SH3 binding sites (PXXP) revealed one such conserved site in these proteins (starting
at position 278 of the mammalian protein) (Pawson, 1995
;
Feng et al., 1995
). Cortactin (Wu et al., 1991
) and HSP 1 (Kitamura et al., 1989
) are two other mammalian proteins
that contain potential coiled-coil and SH3 domains that
also bear a more distant relationship to the PTP-interacting protein, although both these proteins contain homologous 37-amino acid repeats, which are absent from the interacting protein. Because the mammalian sequence was
isolated based upon its ability to interact with the PEST
phosphatase PTP HSCF, it has been termed PSTPIP.
Fig. 1.
Protein sequence and putative domain structure of
PSTPIP. (A) The comparison of the protein sequences of murine
PSTPIP and S. pombe cdc15p. The asterisks illustrate the conserved tyrosine residues and the + shows the conserved potential
SH3 binding site. The predicted coiled-coil and SH3 domains are
overlined. (B) Sequence comparisons of the SH3 domains of
PSTPIP and several different proteins known to interact with the
cytoskeleton. (C) Domain structure of PSTPIP and cdc15p including the predicted coiled-coil regions containing regions rich
in basic and acidic residues (+), the conserved tyrosines (*), the
conserved potential SH3 binding site (
) and the conserved SH3
domains. Also shown is the large region in the S. pombe protein
that contains predicted PEST degradation signals and which is
missing from the mammalian homologue. These sequence data
are available from EMBL/GenBank/DDBJ under accession number U87814.
[View Larger Versions of these Images (56 + 19 + 23K GIF file)]
; Huang et
al., 1996
).
Fig. 2.
Northern blot analysis of the expression of PSTPIP transcript. (A) Expression of PSTPIP and actin in
heart (a), brain (b), spleen
(c), lung (d), liver (e), muscle
(f), kidney (g), and testis (h).
(B) Expression of PSTPIP
and actin in 7 (a), 11 (b), 15 (c), and 17-d (d) murine embryos.
[View Larger Version of this Image (49K GIF file)]
Fig. 3.
Interaction between PTP HSCF and GST-PSTPIP. Precipitations of in
vitro-transcribed and -translated PTP HSCF phosphatase
with: GST-p85 SH3 (a); GST alone (b); GST-Src SH3 (c); GST-Grb2 N-SH3 (d); GST-PSTPIP (e); GST-Abl SH3 (f); GST-PLC
SH3 (g); anti-PTP HSCF (h) polyclonal antibody; and GST-Spectrin SH3 (i).
[View Larger Version of this Image (37K GIF file)]
; Yang et al., 1993
; Aoki et al., 1996
;
Cheng et al., 1996
; Dosil et al., 1996
; Huang et al., 1996
;
Kim et al., 1996
) or both this domain as well as the longer
proline, serine, threonine (PST)-rich region COOH terminal to the catalytic domain. Fig. 4 reveals that deletion of
the COOH-terminal 24-amino acid homology domain of
PTP HSCF completely abolished the interaction between
these two proteins. Because this region is conserved in all
PEST PTPs, it is possible that both PTP PEST (Yang et
al., 1993
) as well as PTP PEP (Matthews et al., 1992
) also
interact with PSTPIP. To examine this possibility, and also to examine if the COOH terminal region is sufficient for
this interaction, 20-residue long peptides derived from the
homologous COOH terminal domains of three PEST
PTPs were used to compete with the interaction between
PTP HSCF and PSTPIP. In this form of the assay, a GST
fusion derived from the PST-rich and COOH CTH regions of the phosphatase was used to precipitate in vitro- translated PSTPIP in the presence of varying amounts of
peptides (Fig. 4 C). Fig. 4 illustrates that all three peptides
effectively block the interaction at concentrations as low
as ~800 nM, while a control peptide derived from a different proline-rich region of PTP HSCF is unable to block
the interaction. These data suggest that this small proline-rich region of the PEST PTPs is sufficient for mediating
the high affinity interaction between the phosphatase and
PSTPIP, and furthermore indicate the possibility that all of these PTPs may interact with PSTPIP via their CTH domains.
Fig. 4.
Mapping of the
PSTPIP interaction site on
PTP HSCF. (A) PTP HSCF
constructs containing full-length, CTH and PST-rich
domain deletion mutants
used for in vitro transcription
and translation were precipitated with a GST fusion protein containing the full-length PSTPIP sequence. (B)
Precipitation of in vitro-transcribed and -translated forms
of PTP HSCF with GST-PSTPIP or anti-PTP HSCF polyclonal antibody: full-length PTP HSCF with anti-PTP HSCF polyclonal antibody (a); full-length PTP
HSCF with GST-PSTPIP (b);
PST-rich+CTH-deleted PTP
HSCF with anti-PTP HSCF
polyclonal antibody (c); PST-rich+CTH deleted PTP
HSCF with GST-PSTPIP (d);
PST-rich+CTH-deleted PTP HSCF with GST-Spectrin
SH3 domain (e); CTH-deleted PTP HSCF with GST-Spectrin SH3 domain (f);
CTH-deleted PTP HSCF
with GST-PSTPIP (g); CTH-deleted PTP HSCF with anti-PTP HSC polyclonal antibody (h); full-length PTP
HSCF with anti-PTP HSCF
polyclonal antibody (i). (C)
Precipitation of in vitro-transcribed and -translated full-length PSTPIP with anti-PSTPIP polyclonal antibody
(a) or 10 µg (b); 5 (c); 2 (d);
or 1 µg (e) of GST-PST-rich+CTH PTP HSCF (a GST construct
containing the PST-rich and CTH domains including amino acids
304-453 of the phosphatase), preimmune antibody (f), or 10 (g),
5 (h); 2 (i) or 1 µg (j) of GST alone. (D) Precipitation of in vitro-
transcribed and -translated PSTPIP with GST-PST-rich+CTH PTP HSCF in the presence of decreasing amounts of proline-rich peptides derived from the COOH-terminal homology regions of
PTPs HSCF, PEST, and PEP or a control proline-rich peptide
from PTP HSCF (see Materials and Methods for peptide sequences).
[View Larger Versions of these Images (35 + 41K GIF file)]
; Feng
et al., 1995
). However, the affinity of the interaction as
measured in the peptide experiment described above was
significantly greater than many of those previously reported for SH3 domain-PXXP interactions (Feng et al.,
1995
), and as Fig. 5 illustrates, the interaction between
these proteins was surprisingly mediated by the coiled-coil
domain and not the SH3 region. This outcome is consistent with the results of the two-hybrid clones, all of which
began at a site very close to the NH2 terminus of the
coiled-coil domain, suggesting that the PSTPIP site that interacts with the COOH terminal proline-rich domain requires the NH2 terminus. Finally, Fig. 5 also illustrates that
these two proteins interact in vivo in transfected COS
cells, confirming the in vitro binding data. Thus, these data
define a novel high affinity in vivo interaction between the
COOH-terminal proline-rich domain of PTP HSCF, and
the potential coiled-coil domain of PSTPIP.
Fig. 5.
Mapping of PTP
HSCF interaction site on
PSTPIP. (A) GST fusions
containing the full-length,
coiled-coil, or SH3 domains
of PSTPIP were used to precipitate in vitro-transcribed
and -translated full-length
PTP HSCF. (B) Precipitation
of full-length PTP HSCF with: GST full-length PSTPIP (a); anti-hemagglutinin
monoclonal antibody (b) (directed against a hemagglutinin epitope tag at the NH2-terminus of the PTP HSCF);
GST-Grb 2 SH3 domain (c);
GST-Spectrin SH3 domain
(d); GST full-length PSTPIP
(e); GST-SH3 PSTPIP (f); and GST-coiled-coil PSTPIP (g). (C) Cos cells were
transfected with the indicated
plasmids containing hemagglutinin (HA)-tagged, wild-type (wt HSCF), or dominant-negative (DA HSCF)
forms of PTP HSCF and
FLAG-tagged PSTPIP. Precipitation of PSTPIP (anti-FLAG-tagged) brings down
PTP HSCF (anti-HA tagged)
and precipitation of PTP HSCF (anti-HA tagged)
brings down PSTPIP (anti-FLAG tagged).
[View Larger Versions of these Images (42 + 41K GIF file)]
),
consistent with the supposition that the protein is dephosphorylated in vivo by a PTP, possibly PTP HSCF which is
coexpressed in these cells (Cheng et al., 1996
). In addition,
tyrosine phosphorylation of transfected PSTPIP can also
be demonstrated to occur in COS cells in the presence of
vanadate (Fig. 6 A). A potential tyrosine kinase that might
phosphorylate PSTPIP in vivo is one of the Src family kinases. Previous data suggested that the v-Src tyrosine kinase is associated with the cytoskeleton, modulates cytoskeletal elements that resulted in profound morphological
changes (Cooper et al., 1993; Kaplan et al., 1994
; Thomas
et al., 1995
), and mediates the tyrosine phosphorylation of
cortactin (Wu et al., 1991
; Okamura et al., 1995; Vuori et
al., 1995; Dehio et al., 1995
), an SH3-, coiled-coil-containing
actin binding protein that bore a distant structural similarity to PSTPIP. In addition, HSP 1, another SH3-containing protein that is also structurally similar to PSTPIP, is tyrosine phosphorylated by various Src family kinases (Yamanashi et al., 1993
; Nada et al., 1994
; Takemoto et al.,
1995
; Takemoto et al., 1996
). These results implied that
v-Src, a constituitively active form of the enyzme, might
mediate the tyrosine phosphorylation of PSTPIP, thus allowing for an analysis of the possible substrate interactions
between the interacting protein and PTP HSCF. To test
this possibility, PSTPIP was transfected into COS cells together with the v-Src tyrosine kinase and either wild-type
or dominant-negative forms of PTP HSCF. Dominant-negative phosphatases were produced by mutating either
the active site cysteine to a serine (C229-S), which abolishes
the ability of the enzyme to form a covalent transition state intermediate with the phosphate attached to the tyrosine, or by mutating a critical active site aspartate residue to alanine (D197-A), which inhibits the catalytic removal of the phosphate (Dixon, 1995
; Jia et al., 1995
;
Garton et al., 1996
). In both cases, these mutants will
tightly bind to the substrate but not dephosphorylate it,
with the result that the substrate will be hyperphosphorylated. This procedure has been previously used to characterize substrates for a number of different PTPs, including PTP PEST (Garton et al., 1996
) and PTP SHP-2 (Herbst
et al., 1996
), and it has revealed that these mutant enzymes
show exquisite substrate specificity in vivo.
Fig. 6.
In vivo tyrosine phosphorylation of PSTPIP. (A) The
left panel shows the immunoprecipitation of endogenous PSTPIP
from Baf3 cells (BAF3) with anti-PSTPIP polyclonal antibody in
control cells or cells pretreated with the PTP inhibitor pervanadate. Precipitates were blotted with either anti-PSTPIP or anti-phosphotyrosine antibodies. Note that the protein in the absence
of pervanadate is lower molecular weight and not tyrosine phosphorylated. The right panel illustrates the results of pervanadate
treatment in mock-transfected or PSTPIP transfected COS cells
(Cos). The transfected PSTPIP is tyrosine phosphorylated in cells
pretreated with pervanadate, although the stoichiometry of phosphorylation appears less than in Baf3 cells. (B) Immunoprecipitations and blots were done with the indicated antibodies on COS
cells transfected with the combinations of plasmids shown at the
top of the figure. (a) Immunoprecipitation of PTP HSCF with
anti-HA antibody directed against an NH2-terminal HA epitope
and blotted with anti-phosphotyrosine. Note that both PSTPIP as
well as PTP HSCF are highly tyrosine phosphorylated in the
presence of the dominant-negative PTP mutants (C-S and D-A),
but not in the presence of the wild type (wt) PTP. (b) Immunoprecipitation of PTP HSCF with anti-HA antibody and blotting
with anti-HA antibody. (C) Immunoprecipitations and blots were
done with the indicated antibodies on COS cells transfected with
the combinations of plasmids shown at the top of the figure. (a)
Immunoprecipitation of PSTPIP with anti-FLAG antibody directed against a COOH-terminal FLAG epitope on PSTPIP and
blotting with anti-phosphotyrosine. Note that both the coprecipitated PTP HSCF as well as PSTPIP are hyperphosphorylated in
the presence of dominant-negative PTPs. (b) Immunoprecipitation of PSTPIP with anti-FLAG antibody and blotting with anti-FLAG. The absence of visible protein in the lanes containing
highly tyrosine phosphorylated PSTPIP may be due to phosphorylation of the tyrosine in the FLAG epitope. The proteins are
clearly visible in the anti-phosphotyrosine blot, however. (c) Immunoprecipitation of PTP HSCF with anti-HA antibody directed
against an NH2-terminal hemagglutinin epitope and blotting with
the same antibody.
[View Larger Versions of these Images (19 + 29 + 55K GIF file)]
). To test for the dependence of the PTP HSCF
CTH domain on PSTPIP substrate recognition, wild-type and dominant-negative forms of the enzyme were produced that lacked the COOH terminal 24 amino acids.
These deletion mutants were then tested for their ability
to hyperphosphorylate PSTPIP in the presence of v-Src.
Fig. 7 illustrates that the deletion of the COOH CTH domain of the two catalytically inactive, dominant-negative PTPs resulted in a complete lack of hyperphosphorylation
of PSTPIP in the presence of v-Src. In addition, these experiments confirm the in vitro mapping studies by demonstrating that PSTPIP cannot interact with forms of PTP
HSCF that are missing the COOH CTH domain. These
data thus indicate that the interaction between PSTPIP and
the dominant-negative forms of PTP HSCF that mediates the hyperphosphorylation of the interacting protein is not
due to the catalytic domain, as is the case for the hyperphosphorylation of p130cas by dominant-negative PEST PTPs,
but is instead induced by the interaction between the coiled-coil domain and the COOH-terminal homology region.
Fig. 7.
Analysis of PTP HSCF mutants with deletions of the
24-amino acid COOH-terminal homology domain. Immunoprecipitations and blots were done with the indicated antibodies on
COS cells transfected with plasmids shown at the top of the figure. The left panels illustrate the immunoprecipitation of FLAG-tagged PSTPIP, while the right panels show the immunoprecipitation of HA-tagged PTP HSCF. The mutants with deletions of
the COOH-terminal 24-amino acid homology domain are shown
as WT, wild type; CS, Cys229-Ser; and DA, Asp197-Ala 24. Note
that hyperphosphorylation of PSTPIP by the dominant-negative
PTPs only occurs when the COOH-terminal 24-amino acids are
included in the proteins. In addition, note that PSTPIP only coprecipitates with forms of PTP HSCF that include the COOH-terminal 24-amino acid homology domain.
[View Larger Version of this Image (30K GIF file)]
). To analyze the subcellular localization of endogenous PSTPIP, 3T3 cells were stained with an affinity-purified polyclonal antibody directed against a GST fusion of
the protein and were imaged using confocal microscopy.
Fig. 8 illustrates that the interacting protein is colocalized
to several F-actin-containing sites in the cell. A majority
of the protein appears to be associated with the cortical actin cytoskeleton. The protein also appears to colocalize
with the actin stress fibers as well as in lamellipodial regions of the cell. In addition, transfection of PSTPIP into
CHO cells revealed expression at sites of focal contact
(data not shown). These results are in contrast with the
PSTPIP-related protein cortactin, which shows localization on cortical actin and at the ends of the stress fibers but
not the fibers themselves (Wu et al., 1991
). These data
clearly suggest that PSTPIP is associated with cytoskeletal actin during interphase.
Fig. 8.
Localization of endogenous PSTPIP in 3T3 cells. Confocal images of two different groups of 3T3 cells viewed at different focal planes stained with affinity-purified anti-PSTPIP polyclonal antibody (Cy3 labeled) and phalloidin-FITC (a-d). Sites of colocalization appear yellow and are the cortical actin (c.a.), the lamellipodia (lam.), and the stress fibers (s.f.). e and f illustrate a low magnification
and high magnification views of interphase cells and cells undergoing cytokinesis stained with the same reagents. The interphase cells
show colocalization predominantly in the cortical actin (c.a.) region at this focal plane, while the cells undergoing cytokinesis show colocalization predominantly at the cleavage furrow (c.f.) at both focal planes shown. Bars: (a and b) 10 µm; (c and d) 20 µm; (e) 5 µm; (f
and g) 2 µm.
[View Larger Version of this Image (29K GIF file)]
;
Fishkind and Wang, 1995
). As Fig. 8 shows, both PSTPIP
and the actin ring colocalize to this region of the dividing
cells. This figure also illustrates that the PSTPIP in the
cleavage furrow is predominantly associated with the
membrane-bound F-actin, which acts to constrict the cleavage furrow (Fishkind et al., 1995), and examination of sections taken perpendicular to the cleavage furrow support
this, showing a donutlike structure containing both PSTPIP and actin attached to the constricting plasma membrane of the cleavage furrow (data not shown). It also appears from this figure that much of the cortically
associated actin and PSTPIP migrate to the cleavage furrow during cytokinesis, a result that is similar to that observed for yeast CDC15p and actin (Fankhauser et al.,
1995
). These subcellular localization data are thus consistent with the conclusion that PSTPIP is an actin binding
protein that is potentially involved with the regulation of
the cleavage furrow.
, 1995
). To examine the possible
function of PSTPIP in actin assembly, 3T3 cells were transfected with an epitope-tagged version of the protein under
the control of the powerful cytomegalovirus promoter,
and the transfected cells were subsequently examined for
expression of transfected PSTPIP as well as F-actin. As
can be seen in Fig. 9, 3T3 cells with normal morphology
that expressed transfected PSTPIP showed colocalization
of the protein at the cortical surface with F-actin as well as
in lamellipodial structures and the F-actin stress fibers; this
is in agreement with data obtained examining endogenous
PSTPIP localization (Fig. 8). In addition, this figure shows
that PSTPIP colocalizes with PTP HSCF in cotransfected
3T3 cells. Fig. 9 also illustrates that the overexpression of
the protein often induced a remarkable morphological
change in a high percentage of 3T3 cells. These cells contained extended, filopodial-like structures that were filled
with polymerized actin. In many cases, the structures were
up to ~150 µm in length, and they often showed a knoblike morphology. In addition, the majority of cells contained a single extended filapodial structure. It appears
that this structure was probably produced in the absence of significant cell growth or plasma membrane synthesis,
since the overall size of the cell body appeared to decrease
dramatically concomitant with the lengthening of the filapodial structure. This type of cell morphology is never observed with transfection of the green fluorescent protein
(data not shown), and Fig. 9 illustrates that it is very different from the morphology of normally elongated, nontransfected cells. In summary, these results suggest that the unregulated expression of PSTPIP in vivo results in the induction of extended filopodial-like structures, consistent
with the possibility that the overexpressed protein may induce an inappropriate polymerization of the cortical cytoskeleton.
Fig. 9.
Expression of PSTPIP in transfected 3T3 cells. (a) A group of 3T3 cells transfected with an expression plasmid containing a
COOH-terminal FLAG version of PSTPIP under the control of the strong cytomegalovirus promoter. Cells were stained with anti-FLAG antibody (Cy3 labeled) and phalloidin-FITC. PSTPIP colocalizes with actin at the cortical region (c.a.), the stress fibers (s.f.), and
the lamellipodia (lam.). (b) A 3T3 cell contransfected with PSTPIP-FLAG and HA-PTP HSCF, and stained with anti-FLAG (Cy3- labeled) and anti-HA (FITC-labeled). Note the colocalization of staining at the cell's cortex (arrowhead). (c and d). Two cells with abnormal morphology expressing PSTPIP. Note that these filopodial structures are greater than 100 µm in length. Bars: (a and b) 20 µm;
(c and d) 50 µm.
[View Larger Version of this Image (31K GIF file)]
). Initial studies
demonstrated that the mammalian protein was incapable
of rescuing previously described CDC15 null mutants
(Fankhauser et al., 1995
). After induction of PSTPIP expression in wild-type cells, cell number increased more
slowly than in nonexpressing cells, but division did not cease. The doubling time increased from 3 to 3.5 h. However, we noted a significant increase in the number of septated cells one generation after induction (the promoter
takes three and one-half generations to induce). The number of septated cells increased from ~12% in the uninduced control, to ~36% (Fig. 10, 5 gen). At later times, a
second phenotype appeared: cells did not cleave, but resumed growth from the tips, becoming elongated (Fig. 10, 6 gen, right-hand cell). These cells then formed a pair of
septa after mitosis, producing a cell with three septa separating four nuclei (Fig. 10, 6 gen, left-hand cell). Approximately one-third of the septated cells displayed this phenotype. The block to cell cleavage was not absolute, since
the number of septated cells did not exceed 36%, cell
number continued to increase, though at a reduced rate,
and cells were seen to cleave (Fig. 10, 8 gen, right-hand
cell). Actin staining of cells overexpressing PSTPIP showed
that in interphase, it is seen as dots at the tips, while in mitosis, it forms a ring, then associates with the growing septum, as expected (data not shown). FLAG staining for
PSTPIP showed that the epitope localizes to the tips in interphase and to the cell equator at mitosis (Fig. 10). It thus
has very similar localization to actin, in support of the data
obtained for PSTPIP localization in mammalian cells.
These data are thus consistent with the suggestion that
mammalian PSTPIP acts as a dominant-negative inhibitor
of cytokinesis in S. pombe.
Fig. 10.
Overexpression of
PSTPIP in S. pombe. (A) The
graph illustrates the percentage of septated cells observed at the indicated generations following induction
of PSTPIP expression by removal of thiamine. In this
system, expression of genes
under the control of the thiamine promoter begins at
~3.5 generations after removal of thiamine. The micrographs illustrate typical
cells seen at each generation
with their nuclei stained with
DAPI and septa stained with
calcofluor. Note the accumulation of septated cells at five
generations and the appearance of multi-compartmented cells at six and eight generations. (B) Staining of PSTPIP
overexpressing cells for PSTPIP with anti-FLAG antibody (top) and DAPI (bottom). Note the accumulation of the PSTPIP antigen in the cleavage furrow of the
postmitotic cell. The inset shows accumulation of PSTPIP at the ends of the post-cleavage cells, a region previously shown to contain
cortical actin. Bar, 10 µm.
[View Larger Version of this Image (65K GIF file)]
Discussion
), another protein
that binds to the actin cytoskeleton in a similar manner, although there is additional weak homology in a small region of the coiled-coil domain in addition to the SH3 region. This is in contrast to the protein with the greatest
degree of homology, the yeast S.pombe cdc15p, which
shows significant sequence conservation in both the SH3
as well as the coiled-coil domains (Fankhauser et al., 1995
). Cdc 15p is a highly phosphorylated protein that is
absolutely required for the formation of the actin ring at
the cleavage furrow of the postmitotic cell, and mutations
in this protein result in an inability to assemble the actin
ring over the postmitotic nucleus, thus resulting in multinucleate cells (Fankhauser et al., 1995
). As with PSTPIP,
cdc15p is localized to the cortical actin cytoskeleton until
anaphase, when it migrates over the postmitotic nucleus
and presumably mediates the reorganization of the cytoskeleton to the cleavage plane (Fankhauser et al., 1995
; Simanis, 1995
; Chang and Nurse, 1996
). While the timing of
PSTPIP migration to the cleavage furrow remains to be
determined, its striking colocalization with the actin ring at
this site during cytokinesis is analogous to what is observed with cdc15p (Fankhauser et al., 1995
). In addition,
the cdc15p is hyperphosphorylated until the onset of anaphase and the formation of the F-actin cytokinetic
cleavage ring, when it becomes significantly dephosphorylated. Interestingly, the yeast protein regains its high state
of phosphorylation at the conclusion of cell division, suggesting that phosphorylation regulates its association with
the cleavage furrow. While the type of phosphorylation of
cdc 15p has not yet been described, this suggests that tyrosine- and/or serine-threonine phosphatases must be involved with the regulation of the function of cdc 15p, and
provides a mechanism whereby the binding and catalytic
activity of a phosphatase such as PTP HSCF might function to control cytokinesis. Again, while the timing of tyrosine phosphorylation of PSTPIP during the cell cycle has
yet to be determined, both the exact conservation of seven
tyrosine residues between PSTPIP and cdc15p as well as
the vanadate-sensitive tyrosine phosphorylation of the endogeneous interacting protein in Baf3 cells are suggestive of possible modulation of phosphotyrosine levels during
the cell cycle. Thus, the sequence, cellular localization, and
phosphorylation of both PSTPIP and cdc15p suggest that
the mammalian protein is a potential homologue of cdc15p.
; Tan et al., 1992
; Egelhoff et al., 1993
; Yamakita et al., 1994
; Fishkind et al., 1995). To date, however, the possibility that tyrosine phosphorylation may
play a role in these functions has been incompletely examined. The data reported in this paper suggest that the regulation of tyrosine phosphorylation on PSTPIP by PTP
HSCF may play a role in aspects of cytoskeletal control including, possibly, cytokinesis. While the possible kinases
involved in such tyrosine phosphorylation are numerous,
the information described here, as well as elsewhere, suggests that a member of the Src family of tyrosine kinases
may be involved with the phosphorylation of this interacting protein by either direct or indirect means. Two other
PSTPIP-related proteins, cortactin and HSP 1, are both
known to be tyrosine phosphorylated in v-Src-transformed cells, and cortactin, and potentially HSP 1 as well
(Yamanashi et al., 1993
), appear to interact with the cytoskeleton in a manner similar to PSTPIP (Wu et al., 1991
;
Dehio et al., 1995
; Okamura et al., 1995; Vuori et al., 1995;
Takemoto et al., 1996
). In addition, a plethora of other
proteins that are involved with the cytoskeleton are also
tyrosine phosphorylated in v-Src-transformed cells (Schaller
et al., 1993
). Interestingly, the tyrosine phosphorylation of
cortactin is also dramatically enhanced in cells isolated
from mice deficient in the Csk kinase (Thomas et al.,
1995
), a tyrosine kinase which phosphorylates the COOH-terminal inhibitory tyrosine on c-Src, suggesting that cortactin is either a direct or indirect c-Src substrate in vivo. In
addition, it has been demonstrated that HSP 1 can bind to
the SH3 and SH2 domains of Src or Src family kinases in
vitro, and it is also tyrosine phosphorylated by these kinases in vitro and in vivo (Takemoto et al., 1995
, 1996
).
Although PSTPIP is only distantly related to cortactin and
HSP 1, the tyrosine phosphorylation of this protein by
v-Src in transfected cells may therefore have physiological
relevance. In addition, previous data have demonstrated that c-Src associates with the focal adhesions and lamellipodia, as well as other actin-containing sites, consistent
with the possibility that it could phosphorylate PSTPIP,
which also localizes to these regions (Kaplan et al., 1994
).
Finally, v-Src is known to induce cytoskeletal changes in
transformed cells, and it has been clearly shown that cortactin, an actin binding protein, becomes reoriented from
the ends of the stress fibers to the podosomes of these
v-Src-transformed cells, consistent with the possibility that
phosphorylation of such actin-associated proteins might
mediate changes in their cellular localization (Wu et al.,
1991
). Further analysis of the PSTPIP tyrosines phosphorylated in v-Src-transfected cells as well as by the endogenous tyrosine kinase will shed additional light on whether
Src family kinases may mediate the phosphorylation of
this interacting protein.
) and the
corkscrew PTP Src homology phosphatase-2 (SHP-2)
(Herbst et al., 1996
). In general, these studies have demonstrated that these dominant-negative mutants enhance the
tyrosine phosphorylation of a surprisingly limited number
of substrates in vivo, in contrast to the relatively promiscuous behavior of these enzymes in vitro. In the case of the
dephosphorylation of p130cas by PTP PEST, it appears that
the substrate recognition is in large part due to the catalytic domain (Garton et al., 1996
). The demonstration here
that coexpression of two different dominant-negative forms of PTP HSCF mediates a dramatic increase in
v-Src-induced PSTPIP tyrosine phosphorylation, together
with the observation that this effect requires the COOH-terminal 24-amino acid homology domain, is thus consistent with several conclusions. The first is that these two
proteins clearly interact in vivo, probably through the
CTH domain, and the coiled-coil region interaction determined from the in vitro binding studies and the coprecipitation analyses (Figs. 5-7) supports such a physical interaction. This provides another example of the use of a
noncatalytic region by a PTP to bring the catalytic domain
in close proximity to the substrate (Tonks, 1993
). In the
case of the interaction described here, it appears that the
juxtaposition of these proteins mediated by this interaction is required for substrate recognition, since the removal of the interaction domain from the PTP results in a
complete lack of substrate recognition. The second is that
it is possible that tyrosine-phosphorylated PSTPIP is an in
vivo substrate for the PTP HSCF; and it also suggests that
the enzyme inhibited by vanadate in the endogenous phosphotyrosine experiment in Baf3 cells, where both PSTPIP
and PTP HSCF are expressed, is likely to be PTP HSCF
(Cheng et al., 1996
). While it is possible to test such a hypothesis by coprecipitation studies, we have found that the
level of PTP HSCF expressed by Baf3 cells is insufficient for detection by Western blotting. Finally, if we assume
that the mutant forms of PTP HSCF are endowed with the
same degree of substrate specificity that has been found
with other dominant-negative PTPs (Dixon, 1995
; Garton
et al., 1996
; Herbst et al., 1996
), then the v-Src cotransfection studies further suggest that either Src or a related
family member may be kinases that are involved with the
tyrosine phosphorylation of PSTPIP in vivo in nontransfected cells.
; Lorenz et al.,
1994
), SHP-2 (Lechleider et al., 1993
; Vogel et al., 1993
; Feng et al., 1993
, 1994
; Stein-Gerlach et al., 1995
), and PTP
(den Hertog et al., 1994
) also appear to be tyrosine phosphorylated in response to a number of different stimuli.
Interestingly, like PTP HSCF, SHP-2 appears to modulate
its own phosphotyrosine levels (Stein-Gerlach et al., 1995
),
and these levels appear to modestly modulate enzymatic
activity (Vogel et al., 1993
). SHP-1 (Lorenz et al., 1994
)
and SHP-2 (Feng et al., 1994
) are tyrosine phosphorylated in vivo by two Src family kinases, Lck and v-Src, respectively; this is consistent with results reported here that demonstrate tyrosine phosphorylation of PTP HSCF by v-Src.
Moreover, tyrosine phosphorylation of SHP-2 and PTP
both result in the association of the GRB2 adaptor protein
(den Hertog et al., 1994
; Vogel et al., 1996). Together,
these data suggest that modification of tyrosines on PTPs
is a potential regulatory mechanism, and it should prove
interesting to examine the role of phosphatase tyrosine phosphorylation in the system described here.
; Feng et al., 1995
). In
this latter case, proline helices induce the formation of
highly structured small peptide domains that bind with relatively high affinity and specificity to the binding pocket of
the SH3 domain, and various interactions, including salt
bridges, mediate the specificity and directionality of peptide binding (Feng et al., 1995
). Analysis of the proline-rich CTH domains of three PEST PTPs, all of which appear to inhibit the PSTPIP-PTP HSCF binding interaction
with similar 50% inhibitory concentrations (<1 µM), reveals that they share a proline-rich core region that would
be predicted to form a proline helix similar to that seen for
SH3 binding sites (Matthews et al., 1992
; Yang et al., 1993
;
Cheng et al., 1996
). This region contains a number of
charged residues, and it appears that the potential helical nature of this domain positions these residues in an appropriate binding conformation for interaction with a site
within the coiled-coil domain (Dowbenko, D., and L. Lasky, unpublished observations). Because all of the
PEST PTPs are predicted to bind to PSTPIP via this proline-rich region, it is possible that the interacting protein's
phosphotyrosine content is modulated by different PEST PTPs in different cell types. Along these lines, it is interesting to note that the only hyperphosphorylated protein
observed in COS cells transfected with dominant-negative
(Asp-Ala) PTP PEST was p130cas (Garton et al., 1996
).
These results suggest that, if PSTPIP is highly expressed in
COS cells, it is either not tyrosine phosphorylated or is not
a substrate for this PTP in this cell line.
; Simanis, 1995
). Thus these data suggest that if PSTPIP is a mammalian homologue of cdc15p, that dominant-negative mutants in this protein should affect the assembly of actin at the vertebrate cleavage furrow, and we
are currently testing this possibility. Interestingly, it appears that deletion mutants of cdc15p that lack the SH3
domain are incapable of rescuing the cdc15 mutants, suggesting a critical role for this COOH-terminal domain in
assembling the cytokinetic actin ring (Fankhauser et al.,
1995
). It will therefore be important to determine the proteins which bind to this domain in PSTPIP, since they may
provide additional insights into its physiological function.
; Friederich et al., 1992
), we have been unable
to demonstrate a stable association between PSTPIP and
F-actin in vitro (Wu, Y., and L.A. Lasky, unpublished data).
Interestingly, many of the transfected cells contained a single filopodial-like structure, suggesting that this morphological feature is rapidly formed and is likely to have a
negative influence on cell viability. The apparent small
size of many of these cells suggests that this actin-containing spike is formed in the absence of plasma membrane synthesis, also consistent with a rapid formation of the structure. The evident heterogeneity in penetrance of this morphological entity may either be due to diverse expression
levels or differences in posttranslational modifications of
the transfected proteins. If these suppositions are correct,
then it would appear that PSTPIP may play a role in the
rapid assembly of a highly organized F-actin-containing structure.
; for review see Robinow and Hyams, 1989
). At the
end of mitosis, when the daughter nuclei are well separated and the spindle begins to break down, the septum
grows inwards from the cell cortex. Secondary septa are
formed on either side of the primary septum, which is subsequently dissolved to effect cell separation. F-actin is then
relocated to the old (preexisting) end of the cell, from which growth resumes. Some of the proteins that control
the onset of septum formation and cytokinesis in fission
yeast have been identified. The products of the cdc3, cdc4,
cdc8, cdc12, cdc15, and rng2 genes are required for actin
rearrangement and/or to stabilize the actin ring (Nurse et
al., 1976
; Balasubramanian et al., 1992
, 1994
; Fankhauser
et al., 1995
; McCollum et al., 1995
; Chang et al., 1996). Immunofluorescence studies have shown that the products of
the dmf1, cdc3, cdc4, cdc8, and cdc15 genes are associated
with the medial ring (Balasubramanian et al., 1992
, 1994
;
Fankhauser et al., 1995
; McCollum et al., 1995
), a cellular localization similar to that observed for PSTPIP in both
mammalian cells and yeast. At the end of mitosis, the cdc7
kinase and the activities of Cdc11p and Cdc14p are required for septation (Nurse et al., 1976
; Fankhauser and
Simanis, 1993
, 1994
). The plo1 kinase appears to be required for both actin ring formation and septation, and can
induce septum formation from G1 and G2, if expressed at a very high level. These data are consistent with the hypothesis that protein phosphorylation is involved with the
regulation of cytokinesis. The dominant-negative phenotype observed here is similar to that seen in fission yeast
that are null for the expression of the calcineurin-like phosphatase, ppb 1, although this is presumably a serine/threonine phosphatase, while PSTPIP binds to a tyrosine phosphatase (Yoshida et al., 1994
). Nevertheless, the data are consistent with the possibility that PSTPIP titrates out an
important component of the S. pombe cytokinetic machinery, with the result that cleavage is inhibited.
Received for publication 4 March 1997 and in revised form 6 June 1997.
Please address all correspondence to L.A. Lasky, Department of Molecular Oncology, Genentech, Inc., 460 Point San Bruno Boulevard, South San Francisco, CA 94080. Tel.: (415) 225-1123. Fax: (415) 225-6127. e-mail: lal{at}gene.comWe thank L. Tamayo and D. Wood for help with the figures, C. Quan for peptide synthesis, and O.K.L. Lasky for helpful discussions at the beginning of this project.
CTH, COOH-terminal homology; GST, glutathione-S-transferase; HA, hemagglutanin; HSCF, hematopoietic stem cell fraction; HSP, hematopoietic specific protein; PSTPIP, proline, serine, threonine phosphatase interacting protein; PTP, protein tyrosine phosphatases.
1. |
Aoki, N.,
Y. Yamaguchi-Aoki, and
A. Ullrich.
1996.
The novel protein-tyrosine
phosphatase PTP20 is a positive regulator of PC12 cell neuronal differentiation.
J. Biol. Chem.
271:
29422-29426
|
2. |
Astier, A.,
H. Avraham,
S. Manie,
J. Groopman,
T. Canty,
S. Avraham, and
A. Freedman.
1997.
The related adhesion focal tyrosine kinase is tyrosine phosphorylated after beta 1 integrin stimulation in B cells and binds to p130cas.
J.
Biol. Chem.
272:
228-232
|
3. | Balasubramanian, M.K., D.M. Helfman, and S.M. Hemmingsen. 1992. A new tropomyosin essential for cytokinesis in the fission yeast S. pombe. Nature (Lond.). 360: 84-87 |
4. | Balasubramanian, M.K., B.R. Hirani, J.D. Burke, and K.L. Gould. 1994. The Schizosaccharomyces pombe cdc3 gene encodes a profilin essential for cytokinesis. J. Cell Biol. 125: 1289-1301 [Abstract]. |
5. | Bartel, P., and S. Fields. 1995. Analyzing protein-protein using the two-hybrid system. Methods Enzymol. 254: 241-263 |
6. | Basi, G., E. Schmid, and K. Maundrell. 1993. TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene. 123: 131-36 |
7. |
Bouchard, P.,
Z. Zhao,
D. Banville,
F. Dumas,
E. Fischer, and
S. Shen.
1994.
Phosphorylation and identification of a major tyrosine phosphorylation site
in protein tyrosine phosphatase 1C.
J. Biol. Chem.
269:
19585-19589
|
8. | Brady-Kalnay, S.M., D.L. Rimm, and N.K. Tonks. 1995. Receptor protein tyrosine phosphatase PTPmu associates with cadherins and catenins in vivo. J. Cell Biol. 130: 977-986 [Abstract]. |
9. | Cao, L., and Y. Wang. 1990a. Mechanism of the formation of contractile ring in dividing cultured animal cells. I. Recruitment of preexisting actin filaments into the cleavage furrow. J. Cell Biol. 110: 1089-1095 [Abstract]. |
10. | Cao, L., and Y. Wang. 1990b. Mechanism of the formation of contractile ring in dividing animal cells. II. Cortical movement of microinjected actin filaments. J. Cell Biol. 111: 1905-1911 [Abstract]. |
11. | Chang, F., and P. Nurse. 1996. How fission yeast fission in the middle. Cell. 84: 191-194 |
12. | Charest, A., J. Wagner, S.H. Shen, and M.L. Tremblay. 1995. Murine protein tyrosine phosphatase-PEST, a stable cytosolic protein tyrosine phosphatase. Biochem. J. 308: 425-432 |
13. |
Charest, A.,
J. Wagner,
S. Jacob,
C.J. McGlade, and
M.L. Tremblay.
1996.
Phosphotyrosine-independent binding of SHC to the NPLH sequence of
murine protein-tyrosine phosphatase-PEST. Evidence for extended phosphotyrosine binding phosphotyrosine interaction domain recognition specificity.
J. Biol. Chem.
271:
8424-8429
|
14. |
Cheng, J.,
L. Daimaru,
C. Fennie, and
L.A. Lasky.
1996.
A novel protein tyrosine phosphatase expressed in linlocd34hiscahi hematopoietic progenitor
cells.
Blood.
88:
1156-1167
|
15. |
Cheng, J.,
K. Wu,
M. Armanini,
N. O'Rourke,
D. Dowbenko, and
L.A. Lasky.
1997.
A novel protein tyrosine phosphatase related to the homotypically adhering ![]() |
16. | Chien, C.T., P.L. Bartel, R. Sternglanz, and S. Fields. 1991. The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. Proc. Natl. Acad. Sci. USA. 88: 9578-9582 [Abstract]. |
17. | Cloutier, J., and A. Veillette. 1996. Association of inhibitory tyrosine kinase p50csk with protein tyrosine phosphatase PEP in T cells and other hemopoietic cells. EMBO (Eur. Mol. Biol. Organ.) J. 15: 4909-4918 [Abstract]. |
18. | Cooper, J., and B. Howell. 1993. The when and how of Src regulation. Cell. 73: 1051-1054 |
19. | Dehio, C., M. Prevost, and P. Sansonetti. 1995. Invasion of epithelial cells by Shigella flexneri induces tyrosine phosphorylation of cortactin by a pp60c-src-mediated signalling pathway. EMBO (Eur. Mol. Biol. Organ.) J. 14: 2741-2782 . |
20. | den Hertog, J., S. Tracy, and T. Hunter. 1994. Phosphorylation of receptor protein tyrosine phosphatase alpha on Tyr 789, a binding site for the SH3-SH2-SH3 adaptor protein GRB2 in vivo. EMBO (Eur. Mol. Biol. Organ.) J. 13: 3020-3032 [Abstract]. |
21. | Dixon, J.E.. 1995. Structure and catalytic properties of protein tyrosine phosphatases. Annu. NY Acad. Sci. 766: 18-22 |
22. | Dixon, J.. 1996. Protein tyrosine phosphatases: their roles in signal transduction. Recent Prog. Horm. Res. 51: 405-414 |
23. |
Dosil, M.,
N. Leibman, and
I. Lemischka.
1996.
Cloning and characterization of
fetal liver phosphatase 1, a nuclear protein tyrosine phosphatase isolated
from hematopoietic stem cells.
Blood.
88:
4510-4525
|
24. | Egelhoff, T., R. Lee, and J. Spudich. 1993. Dictyostelium myosin heavy chain phosphorylation sites regulate myosin filament assembly and localization in vivo. Cell. 75: 363-371 |
25. | Fankhauser, C., and V. Simanis. 1993. The Schizosaccharomyces pombe cdc14 gene is required for septum formation and can also inhibit nuclear division. Mol. Biol. Cell. 4: 531-539 [Abstract]. |
26. | Fankhauser, C., and V. Simanis. 1994. The cdc7 protein kinase is a dosage- dependent regulator of septum formation in fission yeast. EMBO (Eur. Mol. Biol. Organ.) J. 13: 3011-3019 [Abstract]. |
27. | Fankhauser, C., J. Marks, A. Reymond, and V. Simanis. 1993. The S. pombe cdc16 gene is required both for maintenance of p34cdc2 kinase activity and regulation of septum formation, a link between mitosis and cytokinesis? EMBO (Eur. Mol. Biol. Organ.) J. 12: 2697-2704 [Abstract]. |
28. | Fankhauser, C., A. Raymond, L. Cerutti, S. Utzig, K. Hofmann, and V. Simanis. 1995. The S. pombe cdc15 gene is a key element in the reorganization of F-actin at mitosis. Cell. 82: 435-444 |
29. | Fantl, W.J., D.E. Johnson, and L.T. Williams. 1993. Signalling by receptor tyrosine kinases. Annu. Rev. Biochem. 62: 453-481 |
30. | Feng, G., C. Hiu, and T. Pawson. 1993. SH2-containing phosphotyrosine phosphatase as a target for protein-tyrosine kinases. Science (Wash. DC). 259: 1607-1611 |
31. | Feng, G., R. Shen, H. Heng, L. Tsui, A. Kazlauskas, and T. Pawson. 1994. Receptor binding, tyrosine phosphorylation and chromosome localization of the mouse SH2-containing phosphotyrosine phosphatase Syp. Oncogene. 9: 1545-1550 |
32. | Feng, S., C. Kasahara, R. Rickles, and S. Schreiber. 1995. Specific interactions outside the proline-rich core of two classes of Src homology 3 ligands. Proc. Natl. Acad. Sci. USA. 92: 12408-12415 [Abstract]. |
33. | Fishkind, D., and Y. Wang. 1993. Orientation and three-dimensional organization of actin filaments in dividing cultured cells. J. Cell Biol. 123: 837-848 [Abstract]. |
34. | Fishkind, D., and Y. Wang. 1995. New horizons for cytokinesis. Curr. Opin. Cell Biol. 7: 23-31 |
35. | Flores, E., G. Roy, D. Patel, A. Shaw, and M.L. Thomas. 1994. Nuclear localization of the PEP protein tyrosine phosphatase. Mol. Cell Biol. 14: 4938-4946 [Abstract]. |
36. | Friederich, E., K. Vancompernolle, C. Huet, M. Goethals, J. Finidori, J. Vandekerckhove, and D. Louvard. 1992. An actin-binding site containing a conserved motif of charged amino acid residues is essential for the morphogenic effect of villin. Cell. 70: 81-92 |
37. |
Fuchs, M.,
T. Muller,
M. Lerch, and
A. Ullrich.
1996.
Association of human
protein tyrosine phosphatase kappa with members of the armadillo family.
J.
Biol. Chem.
271:
16712-16719
|
38. | Garton, A.J., and N.K. Tonks. 1994. PTP-PEST: A protein tyrosine phosphatase regulated by serine phosphorylation. EMBO (Eur. Mol. Biol. Organ.) J. 13: 3763-3771 [Abstract]. |
39. | Garton, A., A. Flint, and N. Tonks. 1996. Identification of p130cas as a substrate for the cytosolic protein tyrosine phosphatase PTP-PEST. Mol. Cell. Biol. 16: 6408-6418 [Abstract]. |
40. | Gautier, M., J. Solomone, R.N. Booher, J.F. Bazan, and M.W. Kirschner. 1991. cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell. 67: 197-211 |
41. | Herbst, R., J.D. Allard, J. Schilling, T. Raabe, and M.A. Simon. 1996. Daughter of sevenless is a substrate of the phosphotyrosine phosphatase Corkscrew and functions during sevenless signaling. Cell. 85: 899-909 |
42. | Huang, K., C. Sommers, A. Grinberg, C. Kozak, and P. Love. 1996. Cloning and characterization of PTP-K1, a novel nonreceptor protein tyrosine phosphate expressed in bone marrow. Oncogene. 13: 1567-1573 |
43. |
Hunter, T..
1994.
1001 protein kinases redux![]() |
44. | Jia, Z., D. Barford, A.J. Flint, and N.K. Tonks. 1995. Structural basis for phosphotyrosine peptide recognition by protein tyrosine phosphatase 1B. Science (Wash. DC). 268: 1754-1758 |
45. | Kaplan, K., K. Bibbins, J. Swedlow, M. Arnaud, D. Morgan, and H. Varmus. 1994. Association of the amino terminal half of C-src with focal adhesions alters their properties and is regulated by phosphorylation of tyrosine 527. EMBO (Eur. Mol. Biol. Organ.) J. 13: 4745-4756 [Abstract]. |
46. | Kim, Y., H. Wang, I. Sures, R. Lammers, K. Martell, and A. Ullrich. 1996. Characterization of the PEST family protein tyrosine phosphatase BDP1. Oncogene. 13: 2275-2279 |
47. | Kitamura, D., H. Kaneko, Y. Miyagoe, T. Ariyasu, and T. Watanabe. 1989. Isolation and characterization of a novel human gene expressed specifically in the cells of hematopoietic lineage. Nucleic Acids Res. 17: 9367-9379 [Abstract]. |
48. | Klingmuller, U., U. Lorenz, L.C. Cantley, B.G. Neel, and H.F. Lodish. 1995. Specific recruitment of SH-PTP1 to the erythropoietin receptor causes inactivation of JAK2 and termination of proliferative signals. Cell. 80: 729-738 |
49. |
Lechleider, R.,
R. Freeman, and
B. Neel.
1993.
Tyrosyl phosphorylation and
growth factor receptor activation of the human corkscrew homologue, SH-PTP 2.
J. Biol. Chem.
268:
13434-13438
|
50. | Lorenz, U., K. Ravichandran, D. Pei, C. Walsh, S. Burakoff, and B. Neel. 1994. Lck-dependent tyrosyl phosphorylation of the phosphotyrosine phosphatase SH-PTP 1 in murine T cells. Mol. Cell. Biol. 14: 1824-1834 [Abstract]. |
51. | Mabuchi, I., and H. Takano-Ohmuro. 1990. Effects of inibitors of myosin light chain kinase and other protein kinases on the first cell division of sea urchin eggs. Dev. Growth Differ. 32: 549-556 . |
52. | Marks, J., and J.S. Hyams. 1985. Localization of F-actin through the cell division cycle of Schizosaccharomyces pombe. Eur. J. Cell Biol. 39: 27-32 . |
53. | Matthews, R.J., D.B. Bowne, E. Flores, and M.L. Thomas. 1992. Characterization of hematopoietic intracellular protein tyrosine phosphatases: description of a phosphatase containing an SH2 domain and another enriched in proline-, glutamic acid-, serine-, and threonine-rich sequences. Mol. Cell. Biol. 12: 2396-2405 [Abstract]. |
54. | McCollum, D., M.K. Balasubramanian, L.E. Pelcher, S.M. Hemmingsen, and K.L. Gould. 1995. The Schizosaccharomyces pombe cdc4 + gene encodes a novel EF-hand protein essential for cytokinesis. J. Cell Biol. 130: 651-660 [Abstract]. |
55. | Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194: 795-823 |
56. |
Muda, M.,
A. Theodosius,
N. Rodrigues,
U. Bischert,
M. Camps,
C. Gillieron,
K. Davies,
A. Ashworth, and
S. Arkinstall.
1996.
The dual specificity phosphatases M3/6 and MKP-3 are highly selective for inactivation of distinct mitogen-activated protein kinases.
J. Biol. Chem.
271:
27205-27208
|
57. | Nada, S., M. Okada, S. Aizawa, and H. Nakagawa. 1994. Identification of major tyrosine-phosphorylated proteins in Csk-deficient cells. Oncogene. 9: 3571-3578 |
58. | Nurse, P., P. Thuriaux, and K. Nasmyth. 1976. Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146: 167-178 |
59. |
Okamura, H., and
M. Resh.
1995.
p80/85 cortactin associates with Src SH2 domain and colocalizes with V-Src in transformed cells.
J. Biol. Chem.
270:
26613-26618
|
60. | Pawson, T.. 1995. Protein modules and signalling networks. Nature (Lond.). 373: 573-580 |
61. |
Petch, L.,
I. Larsen, and
K. Burridge.
1995.
Adhesion-induced tyrosine phosphorylation of the p130 SRC substrate.
J. Cell Sci.
108:
1371-1379
|
62. | Robinow, C.F., and J.S. Hyams. 1989. General cytology of fission yeasts. In The Molecular Biology of the Fission Yeast. (A. Nasim, P.G. Young, and B.F. Johnson, editors). Academic Press Inc., New York 273-331. |
63. | Rogers, S., R. Wells, and M. Rechsteiner. 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science (Wash. DC). 234: 364-368 |
64. | Satterwhite, L., M. Lohka, K. Wilson, T. Scherson, L. Cisek, J. Corden, and T. Pollard. 1992. Phosphorylation of myosin-II regulatory light chain by cyclin-p34cdc2: A mechanism for the timing of cytokinesis. J. Cell Biol. 118: 565-605 . |
65. | Schaller, M., A. Bouton, D. Flynn, and J.T. Parsons. 1993. Identification and characterization of novel substrates for protein tyrosine kinases. Prog. Nucleic Acid Res. Mol. Biol. 44: 205-227 |
66. | Shultz, L.D., P.A. Schweitzer, T.V. Rajan, T. Yi, J.N. Ihle, R.J. Matthews, M.L. Thomas, and D.R. Beier. 1993. Mutations at the murine motheaten locus are within the hematopoietic cell protein-tyrosine phosphatase (Hcph) gene. Cell. 73: 1445-1454 |
67. | Simanis, V.. 1995. The control of septum formation and cytokinesis in fission yeast. Semin. Cell Biol. 6: 79-87 |
68. |
Stein-Gerlach, M.,
A. Kharitonenkov,
W. Vogel,
S. Ali, and
A. Ullrich.
1995.
Protein tyrosine phosphatase 1D modulates its own state of tyrosine phosphorylation.
J. Biol. Chem.
270:
24635-24637
|
69. | Strome, S.. 1993. Determination of cleavage planes. Cell. 72: 3-6 |
70. | Takemoto, Y., M. Furuta, X. Li, J. Strong-Sparks, and Y. Hashimoto. 1995. LckBP1, a proline-rich protein expressed in haematopoietic lineage cells directly associates with the SH3 domain of protein tyrosine kinase p56lck. EMBO (Eur. Mol. Biol. Organ.) J. 14: 3403-3414 [Abstract]. |
71. | Takemoto, Y., M. Sato, M. Furuta, and Y. Hashimoto. 1996. Distinct binding patterns of HS1 to the Src SH2 and SH3 domains reflect possible mechanisms of recruitment and activation of downstream molecules. Int. Immunol. 8: 1699-1705 [Abstract]. |
72. | Tan, J., S. Ravid, and J. Spudich. 1992. Control of nonmuscle myosins by phosphorylation. Annu. Rev.Biochem. 61: 721-759 |
73. | Thomas, S., P. Soriano, and A. Imamoto. 1995. Specific and redundant roles of Src and Fyn in organizing the cytoskeleton. Nature (Lond.). 376: 267-271 |
74. | Tonks, N.. 1993. Protein tyrosine phosphatases. Semin. Cell Biol. 4: 373-453 |
75. | Vandekerckhove, J.. 1990. Actin-binding proteins. Curr. Opin. Cell Biol. 2: 41-50 |
76. | Vogel, W., and A. Ullrich. 1996. Multiple in vivo phosphorylated tyrosine phosphatase SHP-2 engages binding to GRB2 via tyrosine 584. Cell Growth Differ. 7: 1589-1597 [Abstract]. |
77. | Vogel, W., R. Lammers, and A. Ullrich. 1993. Activation of a tyrosine phosphatase by tyrosine phosphorylation. Science (Wash. DC). 259: 1611-1614 |
78. |
Vuori, K., and
E. Ruoslahti.
1995.
Tyrosine phosphorylation of p130cas and
cortactin accompanies integrin-mediated cell adhesion to extracellular matrix.
J. Biol. Chem.
270:
22259-22262
|
79. |
Wong, L., and
G.R. Johnson.
1996.
Epidermal growth factor induces coupling
of protein-tyrosine phosphatase 1D to GRB2 via the COOH-terminal SH3
domain of GRB2.
J. Biol. Chem.
271:
20981-20984
|
80. | Wu, H., A. Reynolds, S. Kanner, R. Vines, and J.T. Parsons. 1991. Identification of a novel cytoskeletal-associated pp60src substrate. Mol. Cell. Biol. 11: 5113-5124 |
81. | Yamakita, Y., S. Yamashiro, and F. Matsumara. 1994. In vivo phosphorylation of regulatory light chain of myosin-II during mitosis of cultured cells. J. Cell Biol. 124: 129-137 [Abstract]. |
82. | Yamanashi, Y., M. Okada, T. Semba, T. Yamori, H. Umemori, S. Tsunasawa, K. Toyoshima, D. Kitamura, T. Watanabe, and T. Yamamoto. 1993. Identification of HS1 protein as a substrate of protein tyrosine kinases(s) upon B-cell antigen receptor-mediated signalling. Proc. Natl. Acad. Sci. USA. 90: 3631-3635 [Abstract]. |
83. |
Yang, Q.,
D. Co,
J. Sommercorn, and
N.K. Tonks.
1993.
Cloning and expression of PTP-PEST. A novel, human, nontransmembrane protein tyrosine
phosphatase.
J. Biol. Chem.
268:
17650
|
84. |
Yoshida, T.,
T. Toda, and
M. Yanagida.
1994.
A calcineurin-like gene ppb1 in
fission yeast: mutant defects in cytokinesis, cell polarity, mating and spindle
pole body positioning.
J. Cell Sci.
107:
1725-1735
|