* Medical Research Council, Laboratory of Molecular Biology, Cambridge CB2 2QH, United Kingdom; and Max-Planck-Institut fuer Immunbiologie, 79108 Freiburg, Germany
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The armadillo protein of Drosophila and its
vertebrate homologues, -catenin and plakoglobin, are
implicated in cell adhesion and wnt signaling. Here, we
examine the conservation of these two functions by assaying the activities of mammalian
-catenin and plakoglobin in Drosophila. We show that, in the female
germ line, both mammalian
-catenin and plakoglobin
complement an armadillo mutation. We also show that
shotgun mutant germ cells (which lack Drosophila
E-cadherin) have a phenotype identical to that of armadillo mutant germ cells. It therefore appears that armadillo's role in the germ line is solely in a complex with
Drosophila E-cadherin (possibly an adhesion complex),
and both
-catenin and plakoglobin can function in
Drosophila cadherin complexes. In embryonic signaling assays, we find that plakoglobin has no detectable activity whereas
-catenin's activity is weak. Surprisingly,
when overexpressed, either in embryos or in wing imaginal disks, both
-catenin and plakoglobin have dominant negative activity on signaling, an effect also obtained with COOH-terminally truncated armadillo. We
suggest that the signaling complex, which has been
shown by others to comprise armadillo and a member
of the lymphocyte enhancer binding factor-1/T cell factor-family, may contain an additional factor that normally binds to the COOH-terminal region of armadillo.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
WNT genes encode secreted glycoproteins required
for a large number of developmental processes
in a variety of species (for reviews see Nusse and
Varmus, 1992; Klingensmith and Nusse, 1994
; Parr and
McMahon, 1994
). In the developing fly, the wnt-1 homologue, wingless, is used at many times and places. Most notably, it is required for the patterning of each segment, and
for pattern formation and cell proliferation in imaginal
discs (Nusslein-Volhard et al., 1984
; Peifer et al., 1991
; Neumann and Cohen, 1996
). Downstream members of the
wingless signaling pathway have been identified and characterized genetically. They include disheveled, shaggy/zeste-white-3, armadillo, and pangolin. Vertebrate homologues
of all four genes have also been identified, and recent biochemical work has identified a potential wingless receptor
(D-frizzled2) (Bhanot et al., 1996
), which also has vertebrate homologues (Wang et al., 1996
). Most relevant to
this study, armadillo is homologous to both
-catenin and
plakoglobin, also known as
-catenin (Peifer and Wieschaus, 1990
; Peifer et al., 1992
).
In Xenopus laevis, overexpression of -catenin leads to
ectopic axis formation, an effect also obtained with overexpressed Xenopus wnt, implying that
-catenin is part of
the wnt pathway (Sokol et al., 1991
; Funayama et al.,
1995
).
-Catenin is clearly required for axis formation as
depletion of
-catenin messages leads to ventralization
and loss of dorsal structures (Heasman et al., 1994
). Overexpression of plakoglobin also induces ectopic axes in Xenopus (Karnovsky and Klymkowsky, 1995
), suggesting
that it too can act in the wnt pathway.
In addition to their roles in wnt signaling, -catenin and
plakoglobin are components of adherens junctions.
-Catenin forms complexes linking classical cadherins to the actin
cytoskeleton via
-catenin (Kemler, 1993
; Aberle et al., 1994
;
Oyama et al., 1994
), and formation of such complexes is
required for cell-cell adhesion (Nagafuchi and Takeichi,
1988
; Ozawa et al., 1990
; Hirano et al., 1992
). Mice missing
E-cadherin (Larue et al., 1994
; Riethmacher et al., 1995
)
or
-catenin (Haegel et al., 1995
) exhibit defects in adherens junction function during embryogenesis. Plakoglobin can also form similar cadherin complexes which might be
functionally significant (Franke et al., 1989
; Knudsen and
Wheelock, 1992
; Sacco et al., 1995
; Chitaev et al., 1996
).
Plakoglobin is best known for being a major component of
desmosomes, junctional structures mediating the interaction between desmosomal cadherins (desmogleins and
desmocollins) and intermediate filaments, and is the only known junctional component found in both desmosomes
and adherens junctions (Cowin et al., 1986
; Garrod, 1993
;
Koch and Franke, 1994
; Chitaev et al., 1996
). In contrast,
-catenin does not form complexes with desmosomal cadherins despite strong sequence similarity between classical
and desmosomal cadherins (Collins et al., 1991
; Mechanic
et al., 1991
; Wheeler et al., 1991
). There seems to be only
one armadillo gene in Drosophila. Apparently two distinct adhesion functions have evolved in vertebrates whereas
one suffices in Drosophila.
As expected from its homology with -catenin, armadillo appears to be required for cell-cell adhesion in Drosophila, and evidence so far suggests that the roles in signaling and cadherin complexes are separable (Peifer, 1995
;
Orsulic and Peifer, 1996
; Sanson et al., 1996
). Armadillo
interacts biochemically with both Drosophila E-cadherin
(DE-cadherin)1 (Oda et al., 1994
) and
-catenin (D
-catenin) (Oda et al., 1993
) and is believed to participate in the
adherens junction complex. Defects in cell-cell adhesion
and epithelial integrity can be seen in embryos depleted
for maternal and zygotic armadillo (Cox et al., 1996
). Likewise, an adhesion role has been suggested in the germline;
females lacking armadillo activity in the germ line do not
lay eggs and their ovaries are abnormal (Peifer et al., 1993
;
and this work). Because the shaggy/zeste-white-3 and dishevelled genes are not required for oogenesis, it appears
that these defects are not due to lack of wingless signaling.
Therefore, it was suggested that the defects of armadillo
mutant germ cells are due only to a lack of cell adhesion or
a cadherin-related function. In this paper we add support
to this conclusion by showing that an armadillo mutant
germline displays defects identical to those of a DE-cadherin (shotgun) mutant.
The sequence similarity between armadillo and its vertebrate counterparts is strong (71% overall identity with
-catenin and 63% with plakoglobin). Most of the similarity lies in a central "core" repeat region containing 13 42-
amino acid repeats, and in the
-catenin binding site at the
end of the NH2-terminal domain. The central repeats mediate interactions with a variety of proteins including adenomatous polyposis coli (Rubinfeld et al., 1993
), fascin
(Tao et al., 1996
), pangolin/T cell factor (TCF)/lymphocyte enhancer binding factor-1 (LEF) (Behrens et al.,
1996
; Brunner et al., 1997
; Riese et al., 1997
), and DE-cadherin (Oda et al., 1994
). The sequence similarity is significantly lower in the NH2- and COOH-terminal domains,
the COOH-terminal region of plakoglobin being only
36% identical to armadillo with large intervening gaps. (The plakoglobin COOH-terminal domain is less than half
as long as armadillo's and lacks the gly/pro rich region.)
In this paper we examine the functional homology between armadillo, -catenin, and plakoglobin in vivo, assaying both their signaling and adhesion activities. As there is
only one armadillo gene in Drosophila compared with two
in vertebrates, encoding
-catenin and plakoglobin, we
can assess the activities of these proteins individually without the potential complication arising from the presence of
other functional homologues. We find that despite their
normal participation in different junctions, both mammalian proteins can fulfill the adhesion (or cadherin-related) role of armadillo. In terms of signaling activity in the wingless pathway, we find that, in the absence of endogenous
armadillo, plakoglobin shows none whereas that of
-catenin is low. Surprisingly, in an overexpression assay, both
proteins act as dominant negatives on wingless signaling.
Because these proteins diverge most at their carboxy termini, we asked whether this dominant negative activity resulted from the absence of a functional COOH-terminal domain. We tested the effect of overexpressing a COOH-terminally truncated form of armadillo. We found that this
mutant also has dominant negative activity, thus implying
a role for the COOH terminus in the regulation of signaling.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Protein Interaction Assays
Expression and purification of maltose-binding protein (MBP)-fusion
proteins including -catenin and plakoglobin have been described in Aberle et al. (1996)
. D
-catenin was cloned in the prokaryotic expression
vector pQE60. Construction was as follows: Drosophila
-catenin carrying
a COOH-terminal histidine tag was cloned from pBS-DCT-EK (kind gift
of T. Uemura and M. Takeichi, Kyoto University, Kyoto, Japan) by PCR
using Pwo-polymerase (Boehringer Mannheim, Mannhein, Germany). An
NH2-terminal fragment was amplified with primer D
53 5
-TCAAGATCTATGCTGCAGCCAGCTCTC. One primer was sufficient for amplification since d
53 has a false priming site 18 bp in length on the sense
strand at position 942 of the cDNA. A COOH-terminal fragment was amplified with primers D
758 5
ATGCTTAAAAAACATTCAACTATGC and D
2856r 5
AGTCGGCCGTTAAGATCTAACAGCGTCAGCAGGACTC. The NH2-terminal fragment was cut with BglII/MroI and
the COOH-terminal fragment with MroI/MscI and MscI/BglII. All three
fragments were cloned simultaneously into the BglII site of the prokaryotic expression vector pQE60 (Qiagen Inc., Hilden, Germany). D
-catenin was expressed in Escherichia coli strain M15.
Cells were lysed in buffer H (PBS, pH 7.4, 10 mM imidazole, 0.25%
Triton X-100, 10 µ/ml of each DNaseI, PMSF, and leupeptin) using a
French pressure cell. His-tagged proteins were isolated from the soluble
fraction by affinity chromatography on a Ni2+ chelate resin equilibrated
with lysis buffer. After absorption of the proteins, the resin was washed
with buffer H containing 10, 20, 40, and 80 mM imidazole, pH 7.4. D-catenin was eluted stepwise with 250 mM imidazole in PBS. Protein fractions were pooled, adjusted to 50% glycerol, and stored at
20°C.
For in vitro reconstitution, recombinant proteins were mixed in PBS,
pH 7.4, containing 0.01% Triton-X100. Protein complexes were collected
with amylose agarose, as described in Aberle et al. (1996).
Immunoprecipitations to assay in vivo interactions were done according to Hoschuetzky et al. (1994), except that the lysates were obtained by
homogenizing the embryos in a Dounce homogenizer.
Drosophila Expression Constructs (under armadillo Promoter Control)
To express armadillo, -catenin, and plakoglobin under armadillo control,
the expression vector pCASV40 was constructed. An armadillo promoter
fragment was excised from pCaSpeR-arm-
-Gal (Vincent et al., 1994
)
with EcoRI and KpnI and transferred to pCaSpeR-4 (Thummel and Pirrotta, 1992
) digested with EcoRI and KpnI. An SV-40 polyA termination
sequence was ligated into the BamHI/StuI(blunt) sites of this vector.
cDNAs encoding armadillo and human plakoglobin were cut from the
prokaryotic expression vectors pGEXArm (Aberle et al., 1996
) and
pGEXPlako (Aberle et al., 1994
) as BamHI/NotI fragments and ligated
blunt ended (reverse orientation) into CASV40 digested with BamHI and
NotI. Mouse
-catenin cDNA was cut from pGEXBeta (Aberle et al.,
1994
) as an NdeI/NotI fragment and ligated blunt ended (reverse orientation) into pCASV40 digested with BamHI and NotI. These P-element
constructs were injected, and 10 homozygous transformant lines were established for each construct.
Drosophila Expression Constructs (under UAS/Gal4 Control)
UAS-armadillo.
An armadillo cDNA was transferred from the E9 plasmid
(E9 cDNA cloned into Bluescript KS(+); Riggleman et al., 1989) as a KpnI/NotI fragment into pUAST (Brand and Perrimon, 1993
) digested with KpnI and NotI.
UAS--catenin.
A cDNA encoding
-catenin was transferred from
pGEXBeta as an NdeI(klenow)/NotI fragment and ligated into pUAST digested with EcoRI(klenow) and NotI.
UAS-plakoglobin.
A cDNA encoding plakoglobin was transferred from
pGEXPlako as a BamHI(klenow)/NotI fragment and ligated into pUAST
as for -catenin.
UAS-armC.
A truncated form of an armadillo cDNA was inserted in
pUAST in such a way as to introduce an in frame stop codon. The site of
truncation was at the NdeI at position 2102 downstream of the ATG. This
leaves the first 31 residues of repeat 13 unaffected (the XM19 mutation introduces a stop codon at nucleotide 2043). The end generated by NdeI
was treated with Klenow and ligated blunt to the T4-polished KpnI end of
pUAST. This construction results in one unrelated amino acid (leu) and a
stop codon being introduced at the amino terminus of residue 31 of armadillo repeat 13.
UAS-wgts.
As described in Wilder and Perrimon (1995).
Stocks, Constructs, and Generation of Germline Clones
Phenotypes of armXM19, armXP33, and armXK22 have already been described
(Peifer et al., 1993; Cox et al., 1996
). yw flies were used in transformation
and as controls. Generation of germline clones to produce germlines and
embryos depleted of maternal product and containing armadilloXM19,
armadilloXP33, armadilloXK22, or shotgunIG29 mutant product only were
performed using the FLP recombinase-dominant female sterile technique
(Chou and Perrimon, 1992
). The stocks, XXy f/ovoD1 FRT101; hsflp-38, y
w hsflp-12; CyO/ScO, and FRT-G13 ovoD1/CyO are as described in Chou
and Perrimon (1992)
.
For the generation of armadilloXM19 and armadilloXP33 germline clones, second to third instar larvae generated from the cross between arm FRT101/FM7 females and ovoD1 FRT101; hsflp males were heat shocked in an air flow incubator at 37°C for 4 h. This induces site-specific homologous mitotic recombination at the FRT sequences. Due to the presence of the ovoD1 female sterile mutation, which allows only germ cells homozygous for the armadillo mutation to develop, the only fertile females hatching from this cross will have armadillo mutant germlines.
Germline clones homozygous for armadilloXK22 cannot complete oogenesis. Therefore, to assess the rescue of armadilloXK22 germline clones by any transgene, the following stock was constructed: armXK22 FRT101/ FM7; ** (where * denotes the required transgene). These stocks were then used as above to generate armXK22 FRT101/ovoD1 FRT101; */hsflp-38 females with armadilloXK22 mutant germlines and one copy of the required transgene. This method was also used with armadilloXM19 to provide the rescuing transgene or the arm-gal-4 driver maternally in armadilloXM19 germline clones.
For the generation of shotgun germline clones, a recombinant stock y w; shgIG29 FRT-G13/CyO was constructed. Second to third instar larvae from the cross between y w hsflp-12/Y;FRT-G13 ovoD1/CyO males and y w; shgIG29 FRT-G13/CyO females were heat shocked for 4 h at 37°C as above. From this cross, females lacking CyO (genotype y w; hsflp-12/+; FRT-G13 ovoD1/FRT-G13 shgIG29) will contain only shotgunIG29 germ cells.
Whole-Mount Immunocytochemistry and Actin/DNA Visualization
Embryos were dechorionated and fixed for 30 min at the interface of a
heptane/7.5% formaldehyde in PBS fix. (For staining with antiarmadillo,
anti--catenin or antiplakoglobin, the fix also contained Tween-20 to a final concentration of 0.1%.) The aqueous phase was removed and the embryos devitellinized by adding equal amounts of methanol and shaking
vigorously. Embryos were then washed for 30 min in PBS/0.1% Triton-X/
1%BSA/0.05% azide (PTX), and incubated with the primary antibody
overnight at 4°C. For antiengrailed staining, a biotinylated secondary followed by peroxidase histochemistry was used. Antiarmadillo, anti-
-catenin, or antiplakoglobin were detected with fluorescent secondaries. All
secondary antibodies were from Jackson Laboratory (West Grove, PA).
The following primary antibodies were used: antiengrailed (mAb 4D9
from the Developmental Studies Hybridoma Bank, University of Iowa,
Des Moines, IA), antiarmadillo (mAb N2 7A1 from the Developmental Studies Hybridoma Bank), anti-
-catenin (mAb C19220 from Transduction Laboratories, Lexington, KY), and antiplakoglobin (mAb C26220 from Transduction Laboratories).
For actin/DNA visualization, ovaries were fixed in 4% paraformaldehyde (PFA) in PBS, 0.1% Tween-20 (PBT) for 20 min, washed in PBT, and stained for 20 min in rhodamine-phalloidin (5% in PBT; Sigma Chemical Co., Poole, UK). They were then washed again in PBT, then in 0.1% Tween-20 in H2O, and stained for 3 min in Hoechst (Sigma B-2883, bis-BENZIMIDE, 10 mg/ml in H2O/0.1% Tween-20) and mounted in Fluoromount-G (Southern Technologies Associates, Birmingham, AL).
Cuticle and Wing Preparations
Embryos collected overnight and aged 24 h were dechorionated, washed in PTX, and mounted in Hoyers' medium. In some cases the vitelline membranes were removed manually after attaching the embryos to double-sided sticky tape.
Wings were dissected in isopropanol and mounted in Euparal.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The core experiments described below involve testing the
ability of various transgenes to rescue armadillo mutations.
Three armadillo alleles (Fig. 1) were used to separate the
extent to which the transgenes could rescue either the adhesion and/or the signaling defects of armadillo mutations.
armadilloXM19 encodes the longest protein of the three and
is the weakest allele. Evidence suggests that it has little (if
any) signaling activity in the absence of wild-type maternal
product (Peifer and Wieschaus, 1990). However, the armadilloXM19 protein contains fully intact DE-cadherin and
D
-catenin-binding sites, and mutants show no adhesion
defects even in the absence of the wild-type maternal contribution. armadilloXP33 and armadilloXK22 are intermediate and strong alleles, respectively. Homozygotes show a
strong segment polarity phenotype indicating no signaling function. In addition, they show adhesion defects in the
germline (armadilloXK22; Peifer et al., 1993
) and embryo
(armadilloXP33; Cox et al., 1996
) when wild-type maternal
contribution is removed. These adhesion defects are believed to arise because of the inability of the mutant proteins to bind DE-cadherin.
|
In all experiments that required removal of maternal armadillo or DE-cadherin, we used the FLP recombinase-
dominant female sterile germline clone technique (Chou
and Perrimon, 1992). Females generated with this technique have mutant germlines but are viable because they
are somatically wild-type. These females were used either
to analyze the rescue of ovary phenotypes or to generate embryos lacking wild-type maternal contribution.
Loss of armadillo or DE-Cadherin (shotgun) Function Leads to Identical Phenotypes in the Germline
Localization of armadillo to adherens junctions in the follicle cells and the phenotype of mutant egg chambers has
suggested an adhesion function for armadillo in oogenesis
(Peifer et al., 1993). If armadillo mutant germ cells are
truly deficient for adhesion, we would expect germ cells
lacking DE-cadherin function (mutant for shotgun) to
look identical to armadillo mutant germ cells. We have examined the germline defects of a strong shotgun mutant,
shotgunIG29 (Nusslein-Volhard et al., 1984
), and compared
them to those of a strong armadillo mutant (armadilloXK22).
Egg chambers lacking armadillo function (armadilloXK22
germlines) show a variety of defects (Fig. 2; see also Peifer
et al., 1993). Defects include random positioning of the oocyte within the egg chamber, irregular shape and size of
nurse cells and nuclei, floating ring canals, and actin inclusions (Fig. 2, D and E). Cytoplasmic actin filaments in the
nurse cells do form, although they are somewhat disorganized and nurse cell dumping (the rapid transfer of nurse
cell contents into the oocyte occurring after stage 10) is inhibited. Egg chambers derived from shotgunIG29 germline
clones (lacking DE-cadherin function) show strikingly similar phenotypes (Fig. 2, F-I). The oocyte is often mispositioned, and nurse cells have an irregular size and shape
and can be multinucleate. Similar disruptions of the actin
cytoskeleton, such as floating ring canals (Fig. 2, arrowheads) and actin inclusions, are also visible. Again nurse
cell dumping is inhibited despite the formation of cytoplasmic actin filaments. Identical phenotypes exhibited by germ
cells mutant for armadillo and shotgun suggests that the two proteins act in the same complex there. This complex
is likely to function in cell adhesion, although we cannot
exclude yet another activity such as, for example, in organizing the cytoskeleton (see below). In accordance with
our analysis of mutant germ lines, it has been recently reported that embryos carrying weaker alleles of armadillo
and shotgun also display similar phenotypes. Germ cells
carrying either the armadilloXP33 mutation or shotgunP34-1
mutations can survive oogenesis, but the embryos display
a similar cuticle phenotype due to disruption of epithelial
integrity by loss of adhesion (Cox et al., 1996
; Tepass,
1996
; Tepass et al., 1996
).
|
The random positioning of the oocyte in armadillo and
shotgun mutants suggests that cell adhesion may play a
role in oocyte localization within the egg chamber. At the
same time, actin disruption in these mutants points to a
role for cadherin/catenin complexes in organizing the actin
cytoskeleton. Actin disruption is not universal, however,
because intact ring canals are still present. Maybe disruption occurs only in regions that contain DE-cadherin/catenin complexes, such as the cell membrane. The absence of
nurse cell dumping in armadillo germ lines might thus be
due to the failure of the cortex to provide the driving force
for dumping as it is believed to do in the wild-type (Gutzeit, 1986). It should be pointed out here that a common
reason for a dumpless phenotype is the blockage of ring
canals by floating nuclei as seen in mutants such as chickadee, singed, and quail (encoding Drosophila profilin, fascin, and villin, respectively). In such mutants, the cytoplasmic actin filaments that anchor the nurse cell nuclei to the
cell membrane fail to polymerize (Cooley et al., 1992
; Cant
et al., 1994
; Mahajan-Miklos and Cooley, 1994
). However,
the phenotype of armadillo and shotgun germ cells is distinct as we never observed nuclei blocking ring canals (Fig.
2, F and I). Clearly further work is required to assess the
role of cadherin complexes, if any, in organizing the actin
cytoskeleton. To leave open this possibility, we will refer
below to the "cadherin-related activity" of armadillo instead of its "adhesion function."
Mammalian -Catenin and Plakoglobin Can Form
Functional Complexes with Drosophila E-Cadherin
and
-Catenin
Before attempting to rescue armadillo mutations with the
mammalian homologues, we considered whether the cadherin-catenin and catenin-catenin interactions are conserved across species. First, we investigated the ability of
D-catenin to interact with mammalian
-catenin and plakoglobin in in vitro reconstitution assays. As can be seen
in Fig. 3 A, D
-catenin interacts with both
-catenin and
plakoglobin. This was expected because D
-catenin and
mouse
-catenin are 60% identical. The binding sites themselves seem to be conserved, because plako
128/139, which
contains an in frame deletion of its
-catenin binding site,
showed a strongly reduced affinity to D
-catenin. Second,
we determined whether mammalian
-catenin and plakoglobin can interact with D
-catenin and DE-cadherin in
vivo. We expressed
-catenin and plakoglobin in transgenic Drosophila embryos, prepared extracts from such embryos, and assayed protein interactions with immunoprecipitation experiments. Fig. 3 B shows that immunoprecipitates obtained with anti-
-catenin or antiplakoglobin antibodies do contain endogenous D
-catenin (Fig. 3 B,
lanes 4 and 6), although, in lesser amounts than immunoprecipitates obtained with antiarmadillo. Likewise, as can
be seen in Fig. 3 C, both
-catenin and plakoglobin expressed in transgenic flies interact in vivo with endogenous
DE-cadherin.
|
Next, we asked whether the interactions demonstrated
above are functional. We assayed the ability of transgenes
encoding -catenin and plakoglobin to rescue the germline and embryonic cadherin-related defects of armadillo
mutants. As a positive control, we used a transgene encoding wild-type armadillo that brings about complete rescue
(data not shown). First, to look at rescue in the germline, we used females with germlines carrying the strong allele
armadilloXK22 (see Materials and Methods for details) containing one copy of the relevant transgene. Transgenes encoding either
-catenin or plakoglobin completely rescue
the defects observed in armadilloXK22 ovarioles (>90% egg
chambers appeared wild-type). The oocyte is localized at
the posterior of the egg chamber (Fig. 4, A and B,
-catenin; D and E, plakoglobin). The nurse cells show regular positioning and shape and nurse cell dumping occurs normally.
|
Secondly, to look at rescue of adhesion in embryos, we
used the intermediate allele armadilloXP33 which, in the absence of wild-type armadillo (maternal and zygotic) can
complete oogenesis, but displays an embryonic phenotype
(Fig. 4, B-G) similar to that of intermediate shotgun mutants (also lacking wild-type maternal and zygotic contribution) (Cox et al., 1996; Tepass, 1996
; Tepass et al., 1996
).
We looked at the ability of transgenes encoding
-catenin
and plakoglobin to rescue this embryonic "adhesion" phenotype (see Materials and Methods for details). Both
-catenin and plakoglobin bring about complete rescue
(Fig. 4, H and J): there are no holes in either the dorsal or
ventral cuticle faces. However, although the integrity of
the cuticle is restored, patterning is abnormal: the ventral
epidermis forms a denticle lawn resembling that of wingless mutants (Fig. 4, H-J, arrows; wgcx4). Thus, when provided zygotically, both
-catenin and plakoglobin have
enough activity to form adherens junctions in the embryo and rescue the adhesion phenotype while not appearing to
rescue signaling.
Although -catenin and plakoglobin clearly have the ability to function as adhesion molecules, they do not appear
to be as active as wild-type armadillo. This is apparent
when we consider the rescue of the germline cadherin-
related defects of the strong armadilloXK22 allele. In addition
to this rescue, females can lay eggs, and a small percentage
of them (2%
-catenin, 1% plakoglobin) are fertilized.
(These embryos [Fig. 4, C and F] cannot usually be obtained because of the requirement for armadillo in the
germ line.) Although development begins in these embryos, the transgenes are not sufficient for a normal pattern. The head regions and parts of the cuticle are missing
much like in a strong zygotic shotgun mutant, suggesting a
possible lack of adherens junction function during embryonic development. Thus, whereas there is sufficient activity from
-catenin and plakoglobin to rescue the cadherin-related defects of armadilloXK22 germ lines, there appears
to be insufficient activity for the formation of wild-type adherens junctions in the embryo. This is reminiscent of what
is seen with the armadilloXP33 allele. In the absence of maternal and zygotic wild-type contribution, the armadilloXP33
allele encodes a protein that has sufficient activity to support oogenesis but insufficient activity for embryogenesis
leading to a phenotype similar to that of strong shotgun
mutants. This implies that there is a higher requirement
for the cadherin-related function of armadillo in the embryo than in the germline. Adding extra doses of the transgene does not improve the phenotype, indicating that expression level of the transgene is probably not the limiting factor. Rather, it is likely that cross-species protein-protein interactions are not as stable as those within a species.
Indeed, the cytoplasmic domain of DE-cadherin is only
30% identical to mouse E-cadherin, and this may explain
why it binds less tightly to
-catenin and plakoglobin than
to armadillo (as shown in Fig. 3).
-Catenin and Plakoglobin as Signaling Molecules
We looked at the ability of -catenin and plakoglobin to
replace the second function of armadillo
its transduction
of the wingless signal. We assayed their ability to rescue a
strong segment polarity phenotype. This phenotype was
obtained either by removing zygotic function with a strong
allele (armadilloXK22; as in Fig. 5) or by removing wild-type maternal function in a weak allele (germline clones of
armadilloXM19; as in Fig. 6). Neither of these conditions
seem to lead to adhesion defects (Peifer and Wieschaus,
1990
).
|
|
We first looked at the rescue of armadilloXK22 embryos
by zygotic expression of transgenes encoding -catenin or
plakoglobin. Both
-catenin (Fig. 5 C) and plakoglobin
(Fig. 5 D) show rescue of the strong segment polarity phenotype to that of a weak phenotype. For
-catenin, 86% of
the embryos are rescued to the phenotype shown and 58%
for plakoglobin, indicating that
-catenin is slightly more
active. Adding an extra dose of the transgene does not
ameliorate the phenotype, suggesting that the level of expression is not a determining factor in the degree of rescue
observed. We also considered the length of the embryos as
a measure of pattern rescue (see Lawrence et al., 1996
)
and noted that both
-catenin and plakoglobin can rescue
the length of armadilloXK22 embryos from about 1/3 of wild-type length to at least 3/4.
-Catenin often rescues to full
wild-type length.
We wanted to test whether the activity observed above
depends on the presence of wild-type maternal armadillo.
To address this issue we analyzed embryos from germline
clones containing only armadilloXM19, which appears to
have no signaling activity (see Materials and Methods for
details), and assayed the rescue of their strong segment polarity phenotype by zygotic expression of -catenin or
plakoglobin (Fig. 6). Expression of engrailed in the ectoderm (used as an indicator of wingless signaling) is completely lost in embryos derived from armadilloXM19 germline clones (Fig. 6 C, expression in the central nervous system is still present), confirming that armadilloXM19 has
no signaling function. (The strong segment polarity cuticle phenotype also indicates this [Fig. 6 E].) One copy of the
plakoglobin transgene provided zygotically does not rescue engrailed expression (Fig. 6 D), and one copy of
-catenin shows a slight rescue indicated by patches of engrailed expression on the lateral surfaces of the embryo
(Fig. 6 B). When these embryos are allowed to make cuticle, the pattern seen is in accordance with the analysis of engrailed expression: no rescue by plakoglobin and slight
rescue by
-catenin (data not shown). To eliminate the
possibility that the lack of rescue by zygotically provided
plakoglobin might be due to expression of the rescuing
transgene occurring too late, we repeated the experiments,
but this time providing the rescuing transgene maternally
(Fig. 6, E-H). Results support the evidence obtained from
the zygotic rescue experiments and show that whereas a
control armadillo transgene rescues to wild-type (Fig. 6 F), plakoglobin does not rescue the strong segment polarity
cuticle phenotype (Fig. 6 H), and
-catenin shows only
partial rescue (Fig. 6 G).
The evidence from rescue of armadilloXM19 mutants suggests that, in the absence of wild-type maternal contribution, plakoglobin cannot function in the Drosophila wingless pathway, and -catenin has only slight activity. This
evidence is further supported by the rescue of armadilloXP33
germline clones (see above; Fig. 4 b) where both
-catenin
and plakoglobin can fully rescue the adhesion phenotype,
but the cuticles obtained are identical to that of wingless
null mutants.
To ensure that the near lack of rescue by -catenin and
plakoglobin is not due to insufficient expression, we also
assayed the activity of these two proteins expressed at
high levels with the Gal-4/UAS system (Brand and Perrimon, 1993
). We made females with a germline carrying
armadilloXM19 as well as one copy of the arm-gal-4 driver and
crossed them to males homozygous for UAS-
-catenin
or UAS-plakoglobin (Fig. 7; see Materials and Methods
for detail). This enables us to add high levels of
-catenin
or plakoglobin in embryos lacking wild-type armadillo
activity. There are four equally possible genotypes arising from this cross (Fig. 7). These include heterozygote
armadilloXM19, which are viable (column 1), and hemizygote armadilloXM19 males, which show a strong segment
polarity phenotype (column 3, maternal contribution is absent). In the case of overexpressed
-catenin, we observe
four phenotypic classes, each making up ~25% of the
progeny. To each we can assign a genotype as indicated in
Fig. 7. We find that, as seen in column 2, overexpressed
-catenin leads to a weak segment polarity phenotype (extra
denticles in the naked cuticle regions) in armadilloXM19
heterozygous embryos. These embryos are normally identical to wild-type; therefore this indicates a dominant negative effect. Nevertheless, armadilloXM19 mutant embryos
are partially rescued by overexpressed
-catenin (column
4) showing that
-catenin has some positive signaling activity as well. In the case of plakoglobin, this phenotypic class (partial rescue) is absent while the proportion of
armadilloXM19-like embryos goes to ~50%, indicating that
plakoglobin has no rescuing activity but like
-catenin, it
has dominant negative activity (column 2).
|
These results support our earlier conclusion that in the
absence of maternal contribution, plakoglobin has no signaling activity and -catenin has only slight activity. They
also suggest that, when overexpressed, both
-catenin and
plakoglobin have a dominant negative effect.
Activation of the wingless pathway leads to the stabilization and cytoplasmic accumulation of armadillo (Van
Leeuwen et al., 1994). A 54-amino acid region of armadillo
containing a glycogen synthase kinase-3 consensus phosphorylation site has been shown to be required for the
control of stability by wingless (Pai et al., 1997). Cytoplasmic accumulation can be seen in stripes in embryos stained
with antiarmadillo antibodies (Peifer et al., 1994
). To find out
if
-catenin and plakoglobin are also stabilized in wingless-responding cells, we stained embryos carrying a
-catenin or plakoglobin transgene with the appropriate
antibodies. As can be seen in Fig. 8 B,
-catenin does accumulate in stripes like armadillo does (although not as
clearly), indicating that
-catenin responds to the upstream components of the pathway despite its relative
inability to transduce the signal further downstream. In
contrast, we were unable to detect stripes of plakoglobin
accumulation in the cytoplasm. This was surprising since
the region surrounding the glycogen synthase kinase-3 consensus is highly conserved between armadillo and plakoglobin (even more so than between armadillo and
-catenin). Our antibody against plakoglobin clearly recognizes plakoglobin in situ since we do see membrane staining. It
may be that the antibody does not recognize modified, stabilized plakoglobin. Alternatively, plakoglobin may not be
stabilized by wingless because another, less conserved region of the protein, possibly in the COOH teminus, is required for stabilization. If the second alternative is correct,
one would conclude that plakoglobin does not respond to
upstream components of the wingless pathway. In any
case, we suggest that it cannot act downstream since it has
no rescuing activity even when overexpressed in embryos
at levels known to lead to dominant negative effects on endogenous armadillo activity.
|
Overexpression of -Catenin and Plakoglobin in
Wing Primordia
Studies from Xenopus have shown that both -catenin
(Funayama et al., 1995
) and plakoglobin (Karnovsky and
Klymkowsky, 1995
) can induce ectopic axes when overexpressed in early (4-32 cell) embryos, and that the central
core region is both necessary and sufficient for this activity. Considering the high degree of homology in the core
region, we were surprised by the poor signaling activity of
the mammalian proteins in Drosophila. To confirm our
findings in embryos, we have assayed the activity of these
proteins in another region of the fly. We asked whether
-catenin and plakoglobin could activate the wingless
pathway when overexpressed in wild-type Drosophila
wings. We used the MS1096-Gal-4 driver (Capdevila and Guerrero, 1994
) to direct expression of UAS-
-catenin
and UAS-plakoglobin in wing discs. For comparison, we
also overexpressed armadillo and wingless with the same
driver.
Overexpression of both wingless and armadillo in the
wing induces ectopic vein material and the formation of
margin bristles in the blade (Fig. 9). These effects are also
observed upon overexpression of Dishevelled suggesting
that they represent activation of the wingless pathway. For
both wingless and armadillo, we have assessed the dose response; in the case of wingless by driving the expression of
a temperature-sensitive protein at different temperature
(UAS-wgts) and in the case of armadillo by driving transgenes of various strengths (as determined by position in a
phenotypic series). At a low activity, wingless overexpression induces ectopic vein material, whereas at high activity, ectopic bristles form (Fig. 9 D). In the case of armadillo, ectopic veins and bristles appear simultaneously
throughout the phenotypic range (Fig. 9 G). The effects of
overexpressed -catenin (Fig. 9, B and C) and plakoglobin (Fig. 9, E and F) differ somewhat from those of overexpressed wingless and armadillo. We do see ectopic vein
formation throughout the wing blade, but instead of extra
bristles, there is a loss of both anterior and posterior margin bristles (Fig. 9, C and F, arrows). At high levels of
overexpression, we see loss of the margin altogether leading to a smaller wing blade (Fig. 9 E). The loss of margin
structures, including bristles, is a characteristic of weak
wingless loss of function (Couso et al., 1994
) and therefore confirms our previous conclusion that
-catenin and plakoglobin have dominant negative activity on wingless signaling.
|
It is difficult to explain the ectopic vein formation seen
in wings expressing either -catenin or plakoglobin. All
the evidence we have obtained so far suggests that, in the
absence of maternal contribution, plakoglobin has no signaling activity in the wingless pathway. It is possible, however, that plakoglobin and
-catenin can potentiate the
pathway when overexpressed in the presence of wild-type
maternal contribution, and that this ability is reflected by
the ectopic vein material (see also Discussion). Or, it could be that another signaling pathway affecting veins is at work, possibly mediated by the core domain, which exhibits the
highest sequence similarity within the armadillo/
-catenin/
plakoglobin family.
The COOH-terminal Domain of Armadillo Is Required for Signaling
The sequence similarity between plakoglobin/-catenin
and armadillo is significantly lower in the COOH-terminal
domain. To ask whether this divergence might explain the
dominant negative activity (and thus indicate a requirement for the COOH terminal in signaling), we overexpressed a COOH terminally deleted form of armadillo
(arm
C; see Materials and Methods) (Fig. 9, H and I). Like
-catenin and plakoglobin, overexpression of arm
C in wing discs causes a loss of margin bristles indicating dominant negative activity. However, arm
C also induces ectopic bristles and veins in the wing blade, although at a
frequency lower than wild-type armadillo (Fig. 9 I, arrowhead). Thus we conclude that, like
-catenin, arm
C does
have a dominant negative effect on wingless signaling
while at the same time and somewhat paradoxically, retaining some positive activity. This result is confirmed in embryos where overexpression of arm
C in armadilloXM19
germline clones showed slight rescue of the strong segment polarity phenotype (Fig. 7, column 4), but also a
dominant negative effect (column 2) similar to that seen
with
-catenin and plakoglobin.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The Role of Armadillo in the Germline
In the germline, the function of armadillo seems to be
solely as part of a complex with E-cadherin insofar as shotgun (DE-cadherin) mutants look identical to armadillo
mutants. This, and the fact that the wingless pathway does
not seem to operate in the germline (Baker, 1988; Peifer
et al., 1993
) is consistent with an adhesion function for armadillo in the germ line. We have suggested that, in addition to the potential role of cadherin-mediated adhesion in
localizing the oocyte, the armadillo/cadherin complex may
be required for a functional actin network in the cortex of
germline cells. The observation that germline cells lack well-defined adherens junctions and that armadillo protein shows
only a low level punctate distribution along the cell surfaces (Peifer et al., 1993
) instead of the expected dense
staining at sites resembling classical adherens junctions
also suggests a more diverse role for armadillo in the cortical actin network.
-Catenin and Plakoglobin Can Act as Adhesion
Molecules in Drosophila
Both -catenin and plakoglobin provide a link between
junctional complexes and the cytoskeleton in vertebrate
cells. Plakoglobin is believed to be primarily a component
of desmosomes that link to intermediate filaments (Cowin
et al., 1986
) whereas
-catenin participates in adherens
junctions that connect to the actin cytoskeleton. Because
neither desmosomes nor intermediate filaments have yet been identified in Drosophila (Tepass and Hartenstein,
1994
), it may be that plakoglobin arose from a
-catenin-
like molecule and took up a specialized role in desmosomes, in the process retaining its ability to participate in
adherens junctions. In vitro binding studies have shown
that in addition to interacting with desmosomal cadherins,
plakoglobin can bind to the adherens junction components E-cadherin (Ozawa et al., 1989
; McCrea et al., 1991) and
-catenin (Hinck et al., 1994
), although with considerably
lower affinity than
-catenin (McCrea and Gumbiner,
1991
; Aberle et al., 1994
). We have assayed the ability of
plakoglobin and
-catenin to form functional adherens
junction complexes in Drosophila. We show that both plakoglobin and
-catenin bind in vitro to D
-catenin as well
as to DE-cadherin suggesting that the molecular assembly at adhesion complexes has been extensively conserved
through evolution. We next applied functional tests of
conservation in the armadilloXK22 (strong allele) female
germline and in embryos derived from armadilloXP33 (intermediate allele) germline clones. Both conditions lead to phenotypes believed to reflect defects in a cadherin-related
function. In accordance with our in vitro results, we find
that both
-catenin and plakoglobin rescue these armadillo mutations in flies. Therefore, plakoglobin has the
ability to interact functionally with DE-cadherin and D
-catenin, most likely in a similar way as has been shown for
vertebrate cadherin complexes. It has never been demonstrated that E-cadherin/plakoglobin/
-catenin complexes
are sufficient for adhesion in the absence of
-catenin; our
results show that plakoglobin could replace
-catenin if
expressed appropriately, although its main functional requirement would be in desmosomes.
Signaling Activity of -Catenin and Plakoglobin
We have assayed the signaling activity of -catenin and
plakoglobin in Drosophila by looking at their ability to
rescue the segment polarity phenotype of armadillo mutants. In the absence of wild-type armadillo, plakoglobin
has no signaling activity regardless of whether it is provided maternally or zygotically and in the same assay,
-catenin has weak activity. In the presence of maternal
armadillo (zygotic rescue of the strong armadilloXK22 allele), plakoglobin does show some activity. It could be
that, by virtue of its ability to form functional adhesion
complexes, plakoglobin competes with wild-type maternal
armadillo for binding to DE-cadherin creating a larger cytoplasmic pool of armadillo that can act in the signaling
pathway (see also below). Alternatively, or in addition, it
could compete with armadillo for its negative regulator
shaggy/zeste-white-3 thus preventing phosphorylation/ degradation of maternal armadillo, leading to a cytoplasmic enrichment available for signaling. The weak signaling
activity of
-catenin in Drosophila (even in the absence of
wild-type armadillo) as opposed to the total lack of signaling by plakoglobin confirms the suggestion, based on sequence comparison that
-catenin is the true homologue
of armadillo (Peifer et al., 1992
). However, from the high
sequence identity between
-catenin and armadillo, and
the demonstrated ability of Drosophila dishevelled to induce ectopic axis formation in Xenopus (Rothbacher et
al., 1995
), one might have expected more complete rescue.
Homologues of upstream components such as dishevelled
and shaggy/zeste-white-3 have been identified and shown
to be conserved in frogs and mice. Recently, potential
downstream components (LEF-1, XTCF-3 [xenopus T cell factor]) have been uncovered in frogs (Behrens et al., 1996
;
Molenaar et al., 1996
) and a fly homologue, pangolin, has
been shown to be involved in wingless signaling (Brunner
et al., 1997
).
LEF-1 and XTCF-3 are transcription factors that have
been shown in vitro to interact with the central repeat region of -catenin and induce its translocation to the nucleus. Interestingly, LEF-1 and XTCF-3 also interact with
plakoglobin and translocate it to the nucleus in a similar
fashion (Behrens et al., 1996
; Molenaar et al., 1997) suggesting that plakoglobin might be a signaling molecule as
well. Moreover, wnt signaling in mammalian tissue culture
cells leads to an increase in plakoglobin levels (and, of
course, of
-catenin as well; Bradley et al., 1993
; Hinck et al., 1994
). Consistent with this, plakoglobin contains a region matching a consensus GSK-3 phosphorylation site
implying that it might be under wnt control. This contrasts
with the complete lack of signaling by plakoglobin (even
when overexpressed) that we report as well as with the apparent insensitivity of plakoglobin levels to wingless in
Drosophila (Fig. 8). Also, the loss of plakoglobin function
in mouse or Xenopus does not indicate a signaling function. In mouse, plakoglobin knock-out leads to a loss of desmosomes in heart tissues and skin defects (Bierkamp et
al., 1996
; Ruiz et al., 1996
) whereas depletion of plakoglobin in Xenopus results in partial adhesion defects (Kofron
et al., 1997
). More work is needed to determine whether
plakoglobin is indeed regulated by GSK-3 and whether its
interaction with LEF-1 is functionally significant.
We found that, in an overexpression assay, both -catenin and plakoglobin have a dominant negative effect in
embryos and on bristle formation in the wing margin
(where wingless signaling is required). This was surprising
in the case of
-catenin because it partially rescues the signaling defect of armadillo mutations. A similarly paradoxical result was obtained with the overexpression of a
COOH-terminal deletion of armadillo (arm
C). Arm
C
encodes a protein that is truncated within the 13th (and last)
armadillo repeat, the same repeat where the armadilloXM19
mutation introduces a nonsense codon (although the truncation is not at an identical position and arm
C is longer
by 21 residues; see Materials and Methods). Homozygous
armadilloXM19 embryos display a rather weak segment polarity phenotype, indicating that in the presence of wild-type maternal armadillo, this truncated protein makes
some positive contribution to wingless signaling. Likewise,
arm
C shows a positive effect on signaling in adult precursors where, when overexpressed, it induces margin bristles in the wing blade. However, in apparent contradiction
with these positive effects, overexpressed arm
C has a
dominant negative effect at the margin where it suppresses
bristle formation. We have suggested that an adhesion-competent protein (such as
-catenin, plakoglobin, or
arm
C) could have a positive effect at low level by freeing
up residual maternal armadillo from the membrane, making it available for signaling. However,
-catenin and
arm
C clearly have signaling activity even in the absence
of maternal wild-type armadillo. This activity is weak, and
when either protein is expressed at a high level it brings
down the level of signaling, probably by titrating away one
or more components required for a fully active signaling
complex. For example,
-catenin, plakoglobin, and arm
C
are likely to have retained the ability to bind Drosophila LEF-1/TCF/pangolin, as this interaction is mediated by
the central repeat region. But, this complex may not be
sufficient to fully activate transcription of target genes due
to loss of, or a nonfunctional COOH-terminal domain. In
this way, pangolin would be titrated out of the wingless
pathway and into a nonsignaling (or weakly signaling) complex leading to the dominant negative effects observed.
Our results suggest that a factor binding to the COOH-terminal domain of armadillo is required for maximum
signaling activity. We anticipate that the COOH-terminal
domain of -catenin is equally important in vertebrates,
although this proposal appears inconsistent with the findings in Xenopus that the core region is sufficient to activate
the pathway when overexpressed. One possible explanation for the discrepancy is that at very high expression levels, as often attained in Xenopus (e.g., Heasman et al.,
1994
), the core is weakly active on its own and that once
the axis-specifying process has been initiated, it is self-
enhanced by endogenous wild-type protein. Nevertheless,
it is clear from the low signaling activity and dominant
negative effect of arm
C that the COOH-terminal region
of armadillo is crucial to transduce the signal.
It appears that the different domains of armadillo and
-catenin required for signaling have been differentially
conserved in evolution: The central core region and its interaction with pangolin is highly conserved (Drosophila
armadillo core binds to mouse LEF-1; Riese et al., 1997
),
while the COOH-terminal domain and its interaction with
other factors is more diverged. In contrast, the various domains required for cell adhesion (such as the domains of
interaction with
-catenin and cadherin) have been coordinately conserved. The signaling domains that have not
been conserved may correspond to those that are not required for adhesion. This appears true for the COOH-terminal region that, while being required for signaling, is
poorly conserved and completely dispensable for cell adhesion (Orsulic and Peifer, 1996
).
![]() |
Footnotes |
---|
Received for publication 24 March 1997 and in revised form 31 October 1997.
Address all correspondence to Jean-Paul Vincent, Medical Research Council, National Institute for Medical Research, The Ridgeway Mill Hill, London NW7 1AA, United Kingdom. Tel.: (44) 181 959 3666 ext. 2004. Fax: (44) 181 913 8543. E-mail: JP.Vincent{at}nimr.mrc.ac.ukWe are grateful to Jose Casal, Matthew Freeman (both, Medical Research Council), and Daniel St. Johnston (Wellcome Institute, Cambridge, UK) for critical reading of the manuscript, and Acaimo Gonzalez-Reyes (Wellcome Institute) for advice. We would also like to thank Mariann Bienz (MRC), Anthony Bretscher (Cornell University, Ithaca, New York), Peter Lawrence, Hugh Pelham, and Benedicte Sanson (all, MRC) for comments.
![]() |
Abbreviations used in this paper |
---|
DE-cadherin, Drosophila E-cadherin; LEF, lymphocyte enhancing binding factor; MBP, maltose-binding protein; TCF, T cell factor; XTCF, xenopus T cell factor.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. |
Aberle, H.,
S. Butz,
J. Stappert,
H. Weissig,
R. Kemler, and
H. Hoschuetzky.
1994.
Assembly of the cadherin-catenin complex in vitro with recombinant
proteins.
J. Cell Sci.
107:
3655-3663
|
2. |
Aberle, H.,
H. Schwartz,
H. Hoschuetzky, and
R. Kemler.
1996.
Single amino
acid substitutions in proteins of the armadillo gene family abolish their binding to ![]() |
3. | Baker, N.. 1988. Embryonic and imaginal requirements for wingless, a segment-polarity gene in Drosophila. Dev. Biol. 125: 96-108 |
4. |
Behrens, J.,
J. von Kries,
M. Kuhl,
L. Bruhn,
D. Wedlich,
R. Grosschedl, and
W. Birchmeier.
1996.
Functional interaction of ![]() |
5. | Bhanot, P., M. Brink, C. Samos, J.-C. Hsieh, Y. Wang, J. Macke, D. Andrew, J. Nathans, and R. Nusse. 1996. A new member of the frizzled family from Drosophila functions as a wingless receptor. Nature. 382: 225-230 |
6. | Bierkamp, C., K. McLaughlin, H. Schwarz, O. Huber, and R. Kemler. 1996. Embryonic heart and skin defects in mice lacking plakoglobin. Dev. Biol. 180: 780-785 |
7. | Bradley, R.S., P. Cowin, and A.M. Brown. 1993. Expression of wnt-1 in PC12 cells results in modulation of plakoglobin and E-cadherin and increased cellular adhesion. J. Cell Biol. 123: 1857-1865 [Abstract]. |
8. |
Brand, A.H., and
N. Perrimon.
1993.
Targeted gene expression as a means of
altering cell fates and generating dominant phenotypes.
Development (Camb.).
118:
401-415
|
9. | Brunner, E., O. Peter, L. Schweizer, and K. Basler. 1997. pangolin encodes a LEF-1 homologue that acts downstream of armadillo to transduce the wingless signal in Drosophila. Nature. 385: 829-833 |
10. | Cant, K., B.A. Knowles, M.S. Mooseker, and L. Cooley. 1994. Drosophila singed, a fascin homolog, is required for actin bundle formation during oogenesis and bristle extension. J. Cell Biol. 125: 369-380 [Abstract]. |
11. | Capdevila, J., and I. Guerrero. 1994. Targeted expression of the signaling molecule decapentaplegic induces pattern duplications and growth alterations in Drosophila wings. EMBO (Eur. Mol. Biol. Organ.) J. 13: 4459-4468 [Abstract]. |
12. | Chitaev, N.A., R.E. Leube, R.B. Troyanovsky, L.G. Eshkind, W.W. Franke, and S.M. Troyanovsky. 1996. The binding of plakoglobin to desmosomal cadherins: patterns of binding sites and topogenic potential. J. Cell Biol. 133: 359-369 [Abstract]. |
13. |
Chou, T.B., and
N. Perrimon.
1992.
Use of a yeast site-specific recombinase to
produce female germline chimeras in Drosophila.
Genetics.
131:
643-653
|
14. | Collins, J.E., P.K. Legan, T.P. Kenny, J. MacGarvie, J.L. Holton, and D.R. Garrod. 1991. Cloning and sequence analysis of desmosomal glycoproteins 2 and 3 (desmocollins): cadherin-like desmosomal adhesion molecules with heterogeneous cytoplasmic domains. J. Cell Biol. 113: 381-391 [Abstract]. |
15. | Cooley, L., E. Verheyen, and K. Ayers. 1992. chickadee encodes a profilin required for intercellular cytoplasm transport during Drosophila oogenesis. Cell. 69: 173-184 |
16. |
Couso, J.P.,
S.A. Bishop, and
A. Martinez-Arias.
1994.
The wingless signaling
pathway and the patterning of the wing margin in Drosophila.
Development (Camb.).
120:
621-636
|
17. | Cowin, P., H.P. Kapprell, W.W. Franke, J. Tamkun, and R.O. Hynes. 1986. Plakoglobin: a protein common to different kinds of intercellular adhering junctions. Cell. 46: 1063-1073 |
18. | Cox, R.T., C. Kirkpatrick, and M. Peifer. 1996. Armadillo is required for adherens junction assembly, cell polarity, and morphogenesis during Drosophila embryogenesis. J. Cell Biol. 134: 133-148 [Abstract]. |
19. | Franke, W.W., M.D. Goldschmidt, R. Zimbelmann, H.M. Mueller, D.L. Schiller, and P. Cowin. 1989. Molecular cloning and amino acid sequence of human plakoglobin, the common junctional plaque protein. Proc. Natl. Acad. Sci. USA. 86: 4027-4031 [Abstract]. |
20. |
Funayama, N.,
F. Fagotto,
P. McCrea, and
B.M. Gumbiner.
1995.
Embryonic axis induction by the armadillo repeat domain of ![]() |
21. | Garrod, D.R.. 1993. Desmosomes and hemidesmosomes. Curr. Opin. Cell Biol. 5: 30-40 |
22. | Gutzeit, H.O.. 1986. The role of microfilaments in cytoplasmic streaming in Drosophila follicles. J. Cell Sci. 80: 159-169 [Abstract]. |
23. |
Haegel, H.,
L. Larue,
M. Ohsugi,
L. Fedorov,
K. Herrenknecht, and
R. Kemler.
1995.
Lack of ![]() |
24. |
Heasman, J.,
A. Crawford,
K. Goldstone,
H.P. Garner,
B. Gumbiner,
P. McCrea,
C. Kintner,
C.Y. Noro, and
C. Wylie.
1994.
Overexpression of cadherins and underexpression of ![]() |
25. | Hinck, L., I.S. Nathke, J. Papkoff, and W.J. Nelson. 1994. Dynamics of cadherin/catenin complex formation: novel protein interactions and pathways of complex assembly. J. Cell Biol. 125: 1327-1340 [Abstract]. |
26. |
Hirano, S.,
N. Kimoto,
Y. Shimoyama,
S. Hirohashi, and
M. Takeichi.
1992.
Identification of a neural ![]() |
27. |
Hoschuetzky, H.,
H. Aberle, and
R. Kemler.
1994.
![]() |
28. | Karnovsky, A., and M.W. Klymkowsky. 1995. Anterior axis duplication in Xenopus induced by the over-expression of the cadherin-binding protein plakoglobin. Proc. Natl. Acad. Sci. USA. 92: 4522-4526 [Abstract]. |
29. | Kemler, R.. 1993. From cadherins to catenins: cytoplasmic protein interactions and regulation of cell adhesion. Trends Genet. 9: 317-321 |
30. | Klingensmith, J., and R. Nusse. 1994. Signaling by wingless in Drosophila. Dev. Biol. 166: 396-414 |
31. |
Knudsen, K.A., and
M.J. Wheelock.
1992.
Plakoglobin, or an 83-kD homologue
distinct from ![]() |
32. | Koch, P.J., and W.W. Franke. 1994. Desmosomal cadherins: another growing multigene family of adhesion molecules. Curr. Opin. Cell. Biol. 6: 682-687 |
33. |
Kofron, M.,
A. Spagnuolo,
M. Klymkowsky,
C. Wylie, and
J. Heasman.
1997.
The roles of maternal ![]() |
34. | Larue, L., M. Ohsugi, J. Hirchenhain, and R. Kemler. 1994. E-cadherin null mutant embryos fail to form a trophectoderm epithelium. Proc. Natl. Acad. Sci. USA. 91: 8263-8267 [Abstract]. |
35. |
Lawrence, P.A.,
B. Sanson, and
J.-P. Vincent.
1996.
Compartments, wingless
and engrailed: patterning the ventral epidermis of Drosophila embryos.
Development (Camb.).
122:
4095-4103
|
36. | Mahajan-Miklos, S., and L. Cooley. 1994. The villin-like protein encoded by the Drosophila quail gene is required for actin bundle assembly during oogenesis. Cell. 78: 291-301 |
37. |
McCrea, P.D., and
B.M. Gumbiner.
1991.
Purification of a 92-kD cytoplasmic
protein tightly associated with the cell-cell adhesion molecule E-cadherin
(uvomorulin). Characterization and extractability of the protein complex
from the cell cytostructure.
J. Biol. Chem.
266:
4514-4520
|
38. | Mechanic, S., K. Raynor, J.E. Hill, and P. Cowin. 1991. Desmocollins form a distinct subset of the cadherin family of cell adhesion molecules. Proc. Natl. Acad. Sci. USA. 88: 4476-4480 [Abstract]. |
39. |
Molenaar, M.,
M. van de Wetering,
M. Oosterwegel,
M.J. Peterson,
S. Godsave,
V. Korinek,
J. Roose,
O. Destree, and
H. Clevers.
1996.
XTcf-3 transcription
factor mediates ![]() |
40. | Nagafuchi, A., and M. Takeichi. 1988. Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO (Eur. Mol. Biol. Organ.) J. 7: 3679-3684 [Abstract]. |
41. |
Neumann, C.J., and
S.M. Cohen.
1996.
Distinct mitogenic and cell fate specification functions of wingless in different regions of the wing.
Development (Camb.).
122:
1781-1789
|
42. | Nusse, R., and H.E. Varmus. 1992. wnt genes. Cell. 69: 1073-1087 |
43. | Nusslein-Volhard, C., E. Wieschaus, and H. Kluding. 1984. Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. - I. Zygotic loci on the second chromosome. Roux's Arch. Dev. Biol. 193: 267-282 . |
44. |
Oda, H.,
T. Uemura,
K. Shiomi,
A. Nagafuchi,
S. Tsukita, and
M. Takeichi.
1993.
Identification of a Drosophila homologue of ![]() |
45. | Oda, H., T. Uemura, Y. Harada, Y. Iwai, and M. Takeichi. 1994. A Drosophila homolog of cadherin associated with armadillo and essential for embryonic cell-cell adhesion. Dev. Biol. 165: 716-726 |
46. |
Orsulic, S., and
M. Peifer.
1996.
An in vivo structure-function study of armadillo, the ![]() |
47. |
Oyama, T.,
Y. Kanai,
A. Ochiai,
S. Akimoto,
T. Oda,
K. Yanagihara,
A. Nagafuchi,
S. Tsukita,
S. Shibamoto, and
F. Ito.
1994.
A truncated ![]() ![]() |
48. | Ozawa, M., H. Baribault, and R. Kemler. 1989. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO (Eur. Mol. Biol. Organ.) J. 8: 1711-1717 [Abstract]. |
49. | Ozawa, M., M. Ringwald, and R. Kemler. 1990. Uvomorulin-catenin complex formation is regulated by a specific domain of the cytoplasmic region of the cell adhesion molecule. Proc. Nat. Acad. Sci. USA. 87: 4246-4250 [Abstract]. |
50. |
Pai, L.-M.,
S. Orsulic,
A. Bejsovec, and
M. Peifer.
1997.
Negative regulation of
armadillo, a wingless effector in Drosophila.
Development (Camb.).
124:
2255-2266
|
51. | Parr, B.A., and A.P. McMahon. 1994. wnt genes and vertebrate development. Curr. Opin. Genet. Dev. 4: 523-528 |
52. | Peifer, M.. 1995. Cell adhesion and signal transduction: The armadillo connection. Trends Cell Biol. 5: 224-229 . |
53. | Peifer, M., and E. Wieschaus. 1990. The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin. Cell. 63: 1167-1176 |
54. | Peifer, M., C. Rauskolb, M. Williams, B. Riggleman, and E. Wieschaus. 1991. The segment polarity gene armadillo interacts with the wingless signaling pathway in both embryonic and adult pattern formation. Development (Camb.). 111: 1029-1043 [Abstract]. |
55. |
Peifer, M.,
P.D. McCrea,
K.J. Green,
E. Wieschaus, and
B.M. Gumbiner.
1992.
The vertebrate adhesive junction proteins ![]() |
56. |
Peifer, M.,
S. Orsulic,
D. Sweeton, and
E. Wieschaus.
1993.
A role for the
Drosophila segment polarity gene armadillo in cell adhesion and cytoskeletal integrity during oogenesis.
Development (Camb.).
118:
1191-1207
|
57. |
Peifer, M.,
D. Sweeton,
M. Casey, and
E. Wieschaus.
1994.
Wingless signal and
zeste-white 3 kinase trigger opposing changes in the intracellular distribution
of armadillo.
Development (Camb.).
120:
369-380
|
58. | Riese, J., X. Yu, A. Munnerlyn, S. Eresh, S.-C. Hsu, R. Grosschedl, and M. Bienz. 1997. LEF-1 a nuclear factor coordinating signaling inputs from wingless and decapentaplegic. Cell. 88: 777-787 |
59. | Riethmacher, D., V. Brinkmann, and C. Birchmeier. 1995. A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development. Proc. Natl. Acad. Sci. USA. 92: 855-859 [Abstract]. |
60. | Riggleman, B., E. Wieschaus, and P. Schedl. 1989. Molecular analysis of the armadillo locus: uniformly distributed transcripts and a protein with novel internal repeats are associated with a Drosophila segment polarity gene. Genes Dev. 3: 96-113 [Abstract]. |
61. | Rothbacher, U., M.N. Laurent, I.L. Blitz, T. Watabe, J.L. Marsh, and K.W. Cho. 1995. Functional conservation of the wnt signaling pathway revealed by ectopic expression of Drosophila dishevelled in Xenopus. Dev. Biol. 170: 717-721 |
62. |
Rubinfeld, B.,
B. Souza,
I. Albert,
O. Muller,
S.H. Chamberlain,
F.R. Masiarz,
S. Munemitsu, and
P. Polakis.
1993.
Association of the APC gene product
with ![]() |
63. | Ruiz, P., V. Brinkmann, B. Ledermann, M. Behrend, C. Grund, C. Thalhammer, F. Vogel, C. Birchmeier, U. Gunthert, W.W. Franke, and W. Birchmeier. 1996. Targeted mutation of plakoglobin in mice reveals essential functions of desmosomes in the embryonic heart. J. Cell Biol. 135: 215-225 [Abstract]. |
64. |
Sacco, P.A.,
T.M. McGranahan,
M.J. Wheelock, and
K.R. Johnson.
1995.
Identification of plakoglobin domains required for association with N-cadherin and ![]() |
65. | Sanson, B., P. White, and J.-P. Vincent. 1996. Uncoupling cadherin-based adhesion from wingless signaling in Drosophila. Nature. 383: 627-630 |
66. | Sokol, S., J.L. Christian, R.T. Moon, and D.A. Melton. 1991. Injected wnt RNA induces a complete body axis in Xenopus embryos. Cell. 67: 741-752 |
67. |
Tao, Y.S.,
R.A. Edwards,
B. Tubb,
S. Wang,
J. Bryan, and
P.D. McCrea.
1996.
![]() |
68. | Tepass, U.. 1996. Crumbs, a component of the apical membrane, is required for zonula adherens formation in primary epithelia of Drosophila. Dev. Biol. 177: 217-225 |
69. | Tepass, U., and V. Hartenstein. 1994. The development of cellular junctions in the Drosophila embryo. Dev. Biol. 161: 563-596 |
70. | Tepass, U., D.E. Gruszynski, T.A. Haag, L. Omatyar, T. Torok, and V. Hartenstein. 1996. shotgun encodes Drosophila E-cadherin and is preferentially required during cell rearrangement in the neurectoderm and other morphogenetically active epithelia. Genes Dev. 10: 672-685 [Abstract]. |
71. | Thummel, C.S., and V. Pirrotta. 1992. Technical notes: new pCasper P-element vectors. D.I.S. (Drosophila Information Service) 71: 150 . |
72. | van Leeuwen, F., C.H. Samos, and R. Nusse. 1994. Biological activity of soluble wingless protein in cultured Drosophila imaginal disc cells. Nature. 368: 342-344 |
73. | Vincent, J.-P., C.H. Girdham, and P.H. O'Farrell. 1994. A cell-autonomous, ubiquitous marker for the analysis of Drosophila genetic mosaics. Dev. Biol. 164: 328-331 |
74. |
Wang, Y.,
J.P. Macke,
B.S. Abella,
K. Andreasson,
P. Worley,
D.J. Gilbert,
N.G. Copeland,
N.A. Jenkins, and
J. Nathans.
1996.
A large family of putative transmembrane receptors homologous to the product of the Drosophila
tissue polarity gene frizzled.
J. Biol. Chem.
271:
4468-4476
|
75. | Wheeler, G.N., A.E. Parker, C.L. Thomas, P. Ataliotis, D. Poynter, J. Arnemann, A.J. Rutman, S.C. Pidsley, F.M. Watt, D.A. Rees, et al . 1991. Desmosomal glycoprotein DGI, a component of intercellular desmosome junctions, is related to the cadherin family of cell adhesion molecules. Proc. Natl. Acad. Sci. USA. 88: 4796-4800 [Abstract]. |
76. |
Wilder, E.L., and
N. Perrimon.
1995.
Dual functions of wingless in the Drosophila leg imaginal disc.
Development (Camb.).
121:
477-488
|