Article |
Address correspondence to David Ron, Skirball Institute of Biomolecular Medicine, New York University School of Medicine, SI 3-10, 540 First Ave., New York, NY 10016. Tel.: (212) 263-7786. Fax: (212) 263-8951. email: ron{at}saturn.med.nyu.edu
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: signal transduction; protein folding; pre-conditioning; somatic cell genetics; translation control
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Four eIF2 kinases responsive to distinct stress signals have been discovered to date and experimental manipulation of their activity has provided insight into the physiological significance of regulated eIF2
phosphorylation in vertebrates. PKR (protein kinase repressor) is activated by double-stranded RNA produced during viral infection and plays an important role in translational inhibition and apoptosis of virally infected cells (Kaufman, 2000). But other eIF2
kinases protect cells against the impact of their cognate activating stress. GCN2, which responds to uncharged tRNAs, adapts cells to amino acid starvation (Natarajan et al., 2001; Zhang et al., 2002b). The heme-repressed kinase, HRI, protects developing erythroid precursors against the proteotoxic stress of free globin chains in iron-deficient vertebrates (Han et al., 2001). Whereas the ER localized eIF2
kinase PERK (PKR-like ER kinase), which is activated when ER chaperones are saturated by an excess of client proteins, protects cells against ER stress (Harding et al., 1999, 2000b, 2001a; Zhang et al., 2002a).
Mutant cells in which serine 51 of eIF2 has been replaced by alanine reveal that much of the protective effect of the aforementioned kinases is attributed to signaling through eIF2
phosphorylation (Scheuner et al., 2001). The diversity of the upstream signals that activate eIF2
kinases has led us to propose that the downstream response, coordinated by the phosphorylation of eIF2
on serine 51 be termed an integrated stress response (ISR), because it integrates signaling in multiple stress pathways (Harding et al., 2002; Ron, 2002). Gene expression profiling showed that eIF2
phosphorylation induces a gene expression program with a special role in promoting resistance to oxidative stress, which commonly accompanies conditions that activate eIF2
kinases (Harding et al., 2003). It has been further demonstrated that genetic manipulations that reduce eIF2 activity, and thereby mimic the effect of eIF2
phosphorylation, also promote resistance to oxidative stress (Tan et al., 2001b). This last paper even suggested that eIF2
phosphorylation and activation of its downstream ISR might promote preemptive resistance to oxidative stress in otherwise normal cells.
Specific phosphatase complexes can counteract phosphorylation of eIF2 on serine 51. The first such complex to be identified consists of a viral regulatory subunit encoded by the herpes simplex virus
134.5 gene and a cellular catalytic subunit, protein phosphatase-1 (PP1c). By dephosphorylating eIF2
,
134.5 enables the virus to escape the inhibitory effect of PKR activation (He et al., 1997, 1998). GADD34 is a stress-induced cellular homologue of
134.5, which recruits PP1c to specifically dephosphorylate eIF2
(He et al., 1996; Connor et al., 2001; Novoa et al., 2001). GADD34 is not detected in unstressed cells, but stressful conditions associated with eIF2
phosphorylation promote GADD34 gene expression (Novoa et al., 2001; Ma and Hendershot, 2003). Under severely stressful conditions, cells lacking GADD34 accumulate high levels of phosphorylated eIF2
, and the resulting sustained inhibition of protein synthesis interferes with stress-induced gene expression programs (Kojima et al., 2003; Novoa et al., 2003). Thus, GADD34 is part of a negative feedback loop, promoting translational recovery during the later phases of diverse stress responses.
In unstressed GADD34 mutant cells, eIF2 phosphorylation was indistinguishable from that of wild-type cells, suggesting that GADD34 does not regulate basal levels of eIF2
phosphorylation. Here, we report on identification of a regulatory subunit of a constitutive eIF2
phosphatase complex that regulates basal levels of eIF2
phosphorylation. Our observations suggest that this novel complex may serve as a target for therapeutic inhibition to activate the ISR and elicit a stress-resistant state in cultured cells.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
We found that successive cycles of FACsorting of GFP-dull cells selected for reduced reporter gene activity independent of retroviral transduction. To circumvent this background, we "rescued" the integrated, replication defective, retroviruses from pools of CHO cells with reduced CHOP::GFP expression by transient transfection of GAG, ENV, and POL, and infected parental CHOP::GFP cells with this rescued pool of recombinant retroviruses enriched in genetic suppressors of the ISR. Three rounds of enrichment for pools of recombinant retroviruses that suppressed CHOP::GFP activation by tunicamycin, yielded clonal populations of transduced cells; the retroviral inserts of which were sequenced. Most recombinant retroviruses identified by this method encoded the COOH terminus of GADD34, as predicted (Novoa et al., 2001); however one clone, named CD, contained an insert from a novel gene.
Constitutive repressor of eIF2 phosphorylation (CReP)
Transduction of the CD retrovirus markedly attenuated CHOP::GFP activation by tunicamycin and arsenite, an agent that activates the ISR independently of ER stress (Fig. 2 A). The inhibitory effect of the CD retrovirus extended to the endogenous CHOP gene (Fig. 2 B) and correlated with a profound defect in eIF2 phosphorylation (Fig. 2 C).
|
|
Unlike GADD34, whose expression is tightly regulated by stress and whose basal level of expression is almost undetectable (Novoa et al., 2001, 2003), CReP is constitutively present in cells (Fig. 4 A). Pulse-chase labeling followed by immunoprecipitation showed that CReP is a relatively short-lived protein, whose t1/2 in cells is 45 min (Fig. 4 B). Inhibition of protein synthesis with cycloheximide led to rapid disappearance of the CReP protein, as predicted by its short t1/2. Interestingly, disappearance of CReP correlated with accumulation of phosphorylated eIF2
in the cycloheximide-treated cells (Fig. 4 C). This last observation is consistent with a role for CReP in maintaining low levels of eIF2
phosphorylation basally in unstressed cells.
|
|
Interfering with eIF2 expression by antisense RNA had been noted to promote resistance to oxidative stress in HT22 cells (Tan et al., 2001b). This protective effect was specifically sought in HT22 cells because they are exquisitely sensitive to cell death caused by oxidative glutamate toxicity (Tan et al., 2001a). In these cells glutamate exposure promotes massive accumulation of reactive oxygen species and cell death that can be prevented by knockdown of eIF2
protein level (Tan et al., 2001b). Therefore, we examined the impact of CReP RNAi on the resistance of HT22 cells to glutamate and to other stressful conditions.
Immunoblot of HT22 cells transiently transfected with the CReP siRNA oligonucleotide revealed loss of CReP protein 2436 h after transfection, with protein levels recovering to near normal levels by 48 h (Fig. 6 A). Total eIF2, serving as a reference protein in the treated cell lysates, did not change with CReP RNAi and GFP RNAi (or CD2 RNAi) did not affect CReP protein levels (Fig. 6 A and not depicted). After a 7-h exposure to 5 or 10 mM glutamate, only 43 and 20%, respectively, of nontransfected HT22 cells survived. Mock transfection or transfection of GFP siRNA did not increase cell survival, however after transfection with CReP siRNA, >80% of the cells exposed to either dose of glutamate survived. The survival benefit of CReP RNAi was also noted in cells treated with H2O2, the nitric oxide donor SIN-1, and to a lesser extent in response to the ER stress-causing agent tunicamycin (Fig. 6 B).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Here, we report on a novel protein identified as the product of a gene whose overexpression blocks the eIF2 phosphorylation-dependent ISR. The protein, which we named CReP, has sequence similarity to GADD34 in the region that binds PP1c. The ISR-suppressing retrovirus isolated in our screen encoded the COOH-terminal half of CReP, which binds PP1c and is sufficient to promote eIF2
dephosphorylation in vivo. A similar fragment of GADD34, which contains the region of similarity to CReP, also possesses eIF2
-directed phosphatase activity (He et al., 1996; Novoa et al., 2001; Brush et al., 2003). Like GADD34, CReP also forms a stable complex with PP1c that specifically dephosphorylates eIF2
. Both proteins have extended NH2-terminal portions of unknown function that are dispensable to eIF2
phosphatase activity of the overexpressed COOH-terminal portion.
CReP expression was not altered by stressful stimuli that promote eIF2 phosphorylation and the phosphatase activity of the immunoprecipitated endogenous CReP-containing complex was unaffected by ER stress (Fig. 3 C and not depicted). CReP overexpressing cells had lower levels of both basal and stress-inducible phosphorylated eIF2
, and markedly attenuated signaling in the ISR. Knockdown of CReP by RNAi led to reduced basal eIF2
-directed phosphatase activity and induced CHOP::GFP, a stable marker of the ISR. These findings point to CReP as a constitutively active counterpart to GADD34 that contributes to regulation of basal levels of eIF2
phosphorylation. We were unable to reliably detect induction of other ISR markers in CReP RNAi cells, but this may not be too surprising, as the effects of CReP RNAi on basal levels of eIF2
phosphorylation are likely to be transient and resisted by various homeostatic mechanisms. Furthermore, the ISR markers are for the most part short-lived proteins and the uptake of siRNA oligonucleotides may be rather asynchronic, rendering detection of an endogenous ISR marker difficult. Of note, CReP itself is a labile protein, and its disappearance from cells in which protein synthesis has been inhibited may contribute to elevated levels of eIF2
phosphorylation noted under these conditions.
The ISR, a gene expression program activated by eIF2 phosphorylation, has strong pro-survival benefits in certain circumstances. ISR target genes encode ER chaperones (Scheuner et al., 2001; Harding et al., 2003), amino acid transporters, enzymes involved in metabolism of thiol-containing amino acids to glutathione and proteins like HMOX1 and SQSTM1 with known antioxidant properties (Tan et al., 2001b; Harding et al., 2003). The significance of this gene activation program to cell survival is revealed by the phenotype of cells and animals lacking key components of the ISR (Harding et al., 2000b, 2003; Han et al., 2001; Scheuner et al., 2001; Zhang et al., 2002a), indicating that the ISR is required for survival of cells and tissues exposed to physiological levels of stress.
Recent work suggests that activation of the ISR can also promote additional stress resistance in otherwise wild-type cells, a phenomenon referred to as preconditioning. For example, Tan and colleagues have shown that either stable knockdown of eIF2 protein levels by expression of an antisense RNA (a manipulation presumed to phenocopy certain aspects of eIF2
phosphorylation on serine 51) or expression of a phospho-mimetic form of eIF2
(S51D), promote resistance to oxidative stress (Tan et al., 2001b). We have found that eIF2
phosphorylation by a genetically engineered, conditionally active, PERK kinase that was uncoupled from its cognate upstream signal, ER stress, promoted preemptive resistance to oxidative stress, peroxynitrite stress, and to a lesser degree ER stress in cultured HT22 cells (Lu et al., 2004). These experiments suggested that preemptive activation of the ISR might pharmacologically precondition cells to stress. However, modified PERK, expressed as a transgene, or knockdown of eIF2
levels, are not practical means of exploiting this phenomenon. Neither, for that matter, are manipulations that activate endogenous eIF2
kinases, as these likely expose cells to destructive stressful stimuli. However, inactivation of an endogenous phosphatase that controls basal levels of eIF2
phosphorylation might access the ISR, without promoting cell stress. Support for this idea is provided by the observation that CReP inactivation was markedly protective against subsequent application of oxidative, nitrosative, or ER stress.
Elevated levels of phosphorylated eIF2 have been linked to apoptosis, but this association seems particularly important in virally infected cells (Der et al., 1997; Clemens, 2001; Williams, 2001). In many other physiological contexts eIF2
phosphorylation is cytoprotective. One of the more dramatic examples of this association is the finding of markedly elevated levels of phosphorylated eIF2
during hibernation, a naturally stress-resistant state (Frerichs et al., 1998). The properties of CReP described here suggest that it might serve as a target for inhibiting eIF2
dephosphorylation effecting a transient pharmacologically induced stress-resistant state resembling hibernation. This could be applied as a therapeutic modality in circumstances where acute tissue injury by reactive oxygen species can be anticipated, with applications ranging from organ procurement for transplantation to vascular surgery.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cell survival assays were based on MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide; Sigma-Aldrich) cleavage. HT22 cells were plated at a density of 2.55.0 x 103 cells/96 well. Cells were exposed to the indicated concentrations of L-glutamic acid, tunicamycin, H2O2, or SIN-1 for the indicated period of time; at the end of which the cells were switched to media containing 0.5 mg/ml MTT for 4 h, and the reaction was stopped by the addition of an equal volume of stop buffer (50% isopropanol, 10% SDS, and 10 µM HCl). The formazan crystals were allowed to dissolve during a 16-h incubation at 37°C and the OD was read at 550 nm. Background correction values were subtracted from each sample. Experiments were performed in triplicate.
FACScanTM analysis to detect in vivo conversion of dichlorodihydrofluoroscein to DCF and cellular permeability to PI was performed after exposing the cells to the indicated concentration of glutamate. The media were removed to collect floating cells and these were pooled with the adherent cells trypsinized from the dishes. The cells were pelleted and resuspended in fresh media containing 10 µM 2'7'dichloro-dihydrofluoroscein diacetate (Molecular Probes) and incubated for 15 min at 37°C. Cells were pelleted, washed once in ice-cold PBS-2% FCS, and resuspended in PBS-2% FCS containing 1 µg/ml PI (Roche). After a 5-min incubation on ice, the cells were analyzed for DCF fluorescence (FL-1, green channel) and PI positivity (FL-3, red channel) by a FACScanTM (BD Biosciences). 10,000 ungated cells were counted.
Immunoblot, metabolic labeling immunoprecipitation, and in vitro dephosphorylation assays
Cell lysates and methods to detect total and phosphorylated eIF2, endogenous GADD34, PERK, and CHOP have been described previously in detail (Harding et al., 2001b; Novoa et al., 2001, 2003). The antiserum to CReP was raised in rabbit against a His-tagged bacterially expressed protein corresponding to the 280 COOH-terminal residues of the murine protein. It was used in immunoblot at a dilution of 1:1,000. In immunoprecipitation reactions, 1 µl of the crude serum was bound to 10 µl of protein ASepharose resin and used to purify the endogenous CReP from whole cell lysates containing 280 µg of total protein. HT22 cells were metabolically labeled with 33 µCi/ml of TransLabel (ICN Biomedicals) for 30 min, followed by cold chase in complete, unlabeled media. The immunoprecipitates containing labeled CReP were washed three times in RIPA buffer before being resolved on a 8% SDS-PAGE gel.
Methods to radiolabel the eIF2 in reticulocyte lysates using recombinant bacterially expressed PERK have been described previously (Harding et al., 1999; Novoa et al., 2001). The radiolabeled eIF2
was incubated with endogenous CReP or GADD34 immunopurified from cell lysate (3 mg of total protein) with anti-CReP or anti-GADD34 antiserum (20 µl of antiserum were bound to 40 µl of protein A Sepharose) as described previously (Novoa et al., 2001). The labeled proteins resolved on a 10% SDS PAGE before exposure to autoradiography. Similar in vitro dephosphorylation assays were performed in crude detergent lysates of parental CHO cells and CD-transduced cells as described previously (Novoa et al., 2001).
Isolation of the CReP-encoding genetic suppressor element and construction of expression plasmids
The procedure for isolating recombinant retrovirus encoding genetic suppressor element that interfere with stress-induced activation of CHOP::GFP has been described previously (Gudkov and Roninson, 1997; Novoa et al., 2001) and was modified in this screen. In brief, a retrovirally expressed CHO cDNA library constructed in pBABEpuro was transduced in batches of 105 clones into a CHO line stably expressing CHOP::GFP. The cells were treated with 1.75 µg/ml tunicamycin for 3 h, followed by overnight recovery in the absence of tunicamycin and the 1% dullest cells were FACsorted. The pool of dull cells obtained by FACsorting was expanded and the resident replication defective retroviruses were rescued by transient transfection of plasmids encoding the helper functions: VSV-G protein (pseudo ENV), GAG, and POL, as described previously (Landau and Littman, 1992). This pool of retroviruses, enriched in genetic suppressor elements, was used to transduce the parental CHOP::GFP cells, and the process of selection of dull cells and viral rescue was repeated three times. After the third cycle of enrichment, sub-clones of transduced cells selected from those pools of retrovirus that effected a significant (>50%) reduction of GFP in 50% of the transduced cells were procured, examined by FACScanTM to confirm that they had impaired induction of CHOP::GFP, and the retroviral insert was amplified from the genomic DNA by PCR and sequenced. 19 of the 20 pools evaluated by this method encoded different COOH-terminal fragments of GADD34 (an observation consistent with the fact that the cDNA library was constructed from mRNA obtained from ER stressed cells). One pool, CD, harbored a retrovirus encoding the COOH terminus of CReP.
The CReP cDNA expression plasmids were constructed by ligating the cDNA coding region, amplified by RT-PCR from mouse mRNA (aa residues 24698 for the "full length" and 314698 for the "COOH terminus"), in frame with FLAG epitope tag in pFLAG-CMV2.
CReP RNAi
The double-stranded CReP siRNA oligonucleotide, 5' AAGGGAUGGAUGCAGGUUCCA 3', corresponds to a sequence conserved in mouse, hamster, and human CReP. The sequences used for the control RNAi experiments were: 5' GGUGCAGUCUCCAAAGAGA 3' (human CD2 gene) and 5' GCAGCACGACUUCUUCAAG 3' (GFP). The annealed double-stranded siRNA oligonucleotide (Dharmacon) was transfected following the manufacturer's instructions. Cells growing in 35-mm wells (50 x 103/well) were incubated with 1 µM double-stranded oligonucleotide in 200 µl serum-free media and 3 µl OligofectamineTM (Invitrogen) for 4 h followed by addition of serum to 10% and further incubation until analysis.
Stable knockdown of CReP in ES cells was obtained by transfection of W4 ES cells with a pTU6.puro plasmid (a gift of X. Wang, Northwestern University Medical School, Chicago, IL) containing a CReP shRNA insert of the following sequence: 5' tttGAACCTGCATCCATCCCTTGCAgaagcttgTGCGAGGGGTGGATGTAGGTTCtttttc 3'. The scrambled control shRNA sequence was 5' tttGAACCTCCATGCATCCGTTCCAgaagcttgTGGGACGGGTGTATGGAGGTTCtttttc 3'. The position of the sequence substitutions in the predicted scrambled hairpin is underlined.
![]() |
Acknowledgments |
---|
This work was supported by National Institutes of Health grants ES08681 and DK47119. C. Jousse was supported in part by a postdoctoral fellowship from the Institut Francais de Nutrition. D. Ron is a Scholar of the Ellison Medical Foundation.
Submitted: 13 August 2003
Accepted: 9 October 2003
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bertolotti, A., Y. Zhang, L. Hendershot, H. Harding, and D. Ron. 2000. Dynamic interaction of BiP and the ER stress transducers in the unfolded protein response. Nat. Cell Biol. 2:326332.[CrossRef][Medline]
Brush, M.H., D.C. Weiser, and S. Shenolikar. 2003. Growth arrest and DNA damage-inducible protein GADD34 targets protein phosphatase 1alpha to the endoplasmic reticulum and promotes dephosphorylation of the alpha subunit of eukaryotic translation initiation factor 2. Mol. Cell. Biol. 23:12921303.
Clemens, M.J. 2001. Initiation factor eIF2 alpha phosphorylation in stress responses and apoptosis. Prog. Mol. Subcell. Biol. 27:5789.[Medline]
Connor, J.H., D.C. Weiser, S. Li, J.M. Hallenbeck, and S. Shenolikar. 2001. Growth arrest and DNA damage-inducible protein GADD34 assembles a novel signaling complex containing protein phosphatase 1 and inhibitor 1. Mol. Cell. Biol. 21:68416850.
Der, S.D., Y.L. Yang, C. Weissmann, and B.R. Williams. 1997. A double-stranded RNA-activated protein kinase-dependent pathway mediating stress-induced apoptosis. Proc. Natl. Acad. Sci. USA. 94:32793283.
Fawcett, T.W., J.L. Martindale, K.Z. Guyton, T. Hai, and N.J. Holbrook. 1999. Complexes containing activating transcription factor (ATF)/cAMP-responsive-element-binding protein (CREB) interact with the CCAAT/enhancer-binding protein (C/EBP)-ATF composite site to regulate Gadd153 expression during the stress response. Biochem. J. 339:135141.[CrossRef][Medline]
Frerichs, K.U., C.B. Smith, M. Brenner, D.J. DeGracia, G.S. Krause, L. Marrone, T.E. Dever, and J.M. Hallenbeck. 1998. Suppression of protein synthesis in brain during hibernation involves inhibition of protein initiation and elongation. Proc. Natl. Acad. Sci. USA. 95:1451114516.
Gudkov, A.V., and I.B. Roninson. 1997. Isolation of genetic suppressor elements (GSEs) from random fragment cDNA libraries in retroviral vectors. Methods Mol. Biol. 69:221240.[Medline]
Han, A.P., C. Yu, L. Lu, Y. Fujiwara, C. Browne, G. Chin, M. Fleming, P. Leboulch, S.H. Orkin, and J.J. Chen. 2001. Heme-regulated eIF2alpha kinase (HRI) is required for translational regulation and survival of erythroid precursors in iron deficiency. EMBO J. 20:69096918.
Harding, H.P., Y. Zhang, and D. Ron. 1999. Protein translation and folding are coupled by an endoplasmic-reticulum-resident kinase. Nature. 397:271274.[CrossRef][Medline]
Harding, H.P., I. Novoa, Y. Zhang, H. Zeng, R.C. Wek, M. Schapira, and D. Ron. 2000a. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol. Cell. 6:10991108.[Medline]
Harding, H.P., Y. Zhang, A. Bertolotti, H. Zeng, and D. Ron. 2000b. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol. Cell. 5:897904.[CrossRef][Medline]
Harding, H.P., H. Zeng, Y. Zhang, R. Jungreis, P. Chung, H. Plesken, D. Sabatini, and D. Ron. 2001a. Diabetes mellitus and exocrine pancreatic dysfunction in perk-/- mice reveals a role for translational control in survival of secretory cells. Mol. Cell. 7:11531163.[CrossRef][Medline]
Harding, H.P., I. Novoa, A. Bertolotti, H. Zeng, A. Zhang, F. Urano, C. Jousse, and D. Ron. 2001b. Translational regulation in the cellular response to biosynthetic load on the endoplasmic reticulum. Cold Spring Harb. Symp. Quant. Biol. 66:499508.[Medline]
Harding, H.P., M. Calfon, F. Urano, I. Novoa, and D. Ron. 2002. Transcriptional and translational control in the mammalian unfolded protein response. Annu. Rev. Cell Dev. Biol. 18:575599.[CrossRef][Medline]
Harding, H.P., Y. Zhang, H. Zeng, I. Novoa, P. Lu, M. Calfon, N. Sadri, C. Yun, B. Popko, R. Paules, et al. 2003. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol. Cell. 11:619633.[Medline]
He, B., J. Chou, D.A. Liebermann, B. Hoffman, and B. Roizman. 1996. The carboxyl terminus of the murine MyD116 gene substitutes for the corresponding domain of the gamma(1)34.5 gene of herpes simplex virus to preclude the premature shutoff of total protein synthesis in infected human cells. J. Virol. 70:8490.[Abstract]
He, B., M. Gross, and B. Roizman. 1997. The gamma(1)34.5 protein of herpes simplex virus 1 complexes with protein phosphatase 1alpha to dephosphorylate the alpha subunit of the eukaryotic translation initiation factor 2 and preclude the shutoff of protein synthesis by double-stranded RNA-activated protein kinase. Proc. Natl. Acad. Sci. USA. 94:843848.
He, B., M. Gross, and B. Roizman. 1998. The gamma134.5 protein of herpes simplex virus 1 has the structural and functional attributes of a protein phosphatase 1 regulatory subunit and is present in a high molecular weight complex with the enzyme in infected cells. J. Biol. Chem. 273:2073720743.
Hinnebusch, A.G. 1997. Translational regulation of yeast GCN4. A window on factors that control initiator-tRNA binding to the ribosome. J. Biol. Chem. 272:2166121664.
Hinnebusch, A.G. 2000. Mechanism and regulation of initiator methionyl-tRNA binding to ribosomes. Translational Control of Gene Expression. N. Sonenberg, J.W.B. Hershey, and M.B. Mathews, editors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 185243.
Kaufman, R.J. 2000. The double-stranded RNA-activated protein kinase PKR. Translational Control of Gene Expression. N. Sonenberg, J.W.B. Hershey, and M.B. Mathews, editors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 503527.
Kojima, E., A. Takeuchi, M. Haneda, F. Yagi, T. Hasegawa, K.I. Yamaki, K. Takeda, S. Akira, K. Shimokata, and K.I. Isobe. 2003. The function of GADD34 is a recovery from a shutoff of protein synthesis induced by ER stress-elucidation by GADD34-deficient mice. FASEB J. 17:15731575.
Landau, N., and D. Littman. 1992. Packaging system for rapid production of murine leukemia virus vectors with variable tropisim. J. Virol. 66:51105113.[Abstract]
Lu, P.D., C. Jousse, S.J. Marciniak, Y. Zhang, I. Novoa, D. Scheuner, R.J. Kaufman, D. Ron, and H.P. Harding. 2004. Cytoprotection by pre-emptive conditional phosphorylation of translation initiation factor 2. EMBO J. In press.
Ma, Y., J.W. Brewer, J.A. Diehl, and L.M. Hendershot. 2002. Two distinct stress signaling pathways converge upon the CHOP promoter during the mammalian unfolded protein response. J. Mol. Biol. 318:13511365.[CrossRef][Medline]
Ma, Y., and L.M. Hendershot. 2003. Delineation of a negative feedback regulatory loop that controls protein translation during endoplasmic reticulum stress. J. Biol. Chem. 278:3486434873.
Maher, P., and J.B. Davis. 1996. The role of monoamine metabolism in oxidative glutamate toxicity. J. Neurosci. 16:63946401.
Natarajan, K., M.R. Meyer, B.M. Jackson, D. Slade, C. Roberts, A.G. Hinnebusch, and M.J. Marton. 2001. Transcriptional profiling shows that Gcn4p is a master regulator of gene expression during amino acid starvation in yeast. Mol. Cell. Biol. 21:43474368.
Novoa, I., H. Zeng, H. Harding, and D. Ron. 2001. Feedback inhibition of the unfolded protein response by GADD34-mediated dephosphorylation of eIF2. J. Cell Biol. 153:10111022.
Novoa, I., Y. Zhang, H. Zeng, R. Jungreis, H.P. Harding, and D. Ron. 2003. Stress-induced gene expression requires programmed recovery from translational repression. EMBO J. 22:11801187.
Ron, D. 2002. Translational control in the endoplasmic reticulum stress response. J. Clin. Invest. 110:13831388.
Scheuner, D., B. Song, E. McEwen, P. Gillespie, T. Saunders, S. Bonner-Weir, and R.J. Kaufman. 2001. Translational control is required for the unfolded protein response and in-vivo glucose homeostasis. Mol. Cell. 7:11651176.[CrossRef][Medline]
Tan, S., D. Schubert, and P. Maher. 2001a. Oxytosis: a novel form of programmed cell death. Curr. Top. Med. Chem. 1:497506.[Medline]
Tan, S., N. Somia, P. Maher, and D. Schubert. 2001b. Regulation of antioxidant metabolism by translation initiation factor 2. J. Cell Biol. 152:9971006.
Williams, B.R. 2001. Signal integration via PKR. Sci STKE. 2001:RE2.
Zhang, P., B. McGrath, S. Li, A. Frank, F. Zambito, J. Reinert, M. Gannon, K. Ma, K. McNaughton, and D.R. Cavener. 2002a. The PERK eukaryotic initiation factor 2 alpha kinase is required for the development of the skeletal system, postnatal growth, and the function and viability of the pancreas. Mol. Cell. Biol. 22:38643874.
Zhang, P., B.C. McGrath, J. Reinert, D.S. Olsen, L. Lei, S. Gill, S.A. Wek, K.M. Vattem, R.C. Wek, S.R. Kimball, et al. 2002b. The GCN2 eIF2alpha kinase is required for adaptation to amino acid deprivation in mice. Mol. Cell. Biol. 22:66816688.