Institut de Génétique et de Biologie Moléculaire et Cellulaire (Centre National de la Recherche Scientifique/Institut National de la Santé et de la Recherche Medicale/Université Louis Pasteur), F-67404 ILLKIRCH Cedex C.U. de Strasbourg, France
STAT transcription factors are induced by a number of growth factors and cytokines. Within minutes of induction, the STAT proteins are phosphorylated on tyrosine and serine residues and translocated to the nucleus, where they bind to their DNA targets. The leukemia inhibitory factor (LIF) mediates pleiotropic and sometimes opposite effects both in vivo and in cultured cells. It is known, for example, to prevent differentiation of embryonic stem (ES) cells in vitro. To get insights into LIF-regulated signaling in ES cells, we have analyzed protein-binding and transcriptional properties of STAT recognition sites in ES cells cultivated in the presence and in the absence of LIF. We have detected a specific LIF-regulated DNA-binding activity implicating the STAT3 protein. We show that STAT3 phosphorylation is essential for this LIF-dependent DNA-binding activity. The possibility that ERK2 or a closely related protein kinase, whose activity is modulated in a LIF-dependent manner, contributes to this phosphorylation is discussed. Finally, we show that the multimerized STAT3-binding DNA element confers LIF responsiveness to a minimal thymidine kinase promoter. This, together with our observation that overexpression of STAT3 dominant-negative mutants abrogates this LIF responsiveness, clearly indicates that STAT3 is involved in LIF-regulated transcriptional events in ES cells. Finally, stable expression of such a dominant negative mutant of STAT3 induces morphological differentiation of ES cells despite continuous LIF supply. Our results suggest that STAT3 is a critical target of the LIF signaling pathway, which maintains pluripotent cell proliferation.
THE IL-6 cytokine family, including IL-6, leukemia
inhibitory factor (LIF)1, ciliary neurotrophic factor,
oncostatin M, and cardiotrophin-1, has wide pleiotropic effects on cell growth and differentiation. Signaling
by these cytokines is transduced by activation of composite receptors that share the common gp130 subunit (26, 28,
40, 56). The structural diversity of these receptors and the
cell type-dependent variability of expression of their subunits account, at least in part, for the specific and redundant functions of this class of hormones (11, 34, 52) . Characterization of the effectors of these cell signaling molecules
is an essential step towards the elucidation of the mechanisms underlying the pleiotropic effects they mediate.
The gp130 protein and the LIF receptor LIF plays a crucial role in vivo during preimplantation
of mammalian embryos and is essential for the maintenance of the pool of hematopoietic stem cells (16, 54). Antagonistic effects of LIF on cultured cell lines are also well
established: LIF inhibits differentiation of embryonic stem
(ES) cells and, on the contrary, induces differentiation of
other cell lines, such as the M1 myeloid cell line, the MAH
sympathoadrenal progenitor cells, and the NBFL neuroblastoma cell line (6, 21, 29). LIF is also a potent activator
of myoblast proliferation (36). Ciliary neurotrophic factor
and oncostatin M also have the property to maintain the pluripotentiality of ES cells in vitro (9, 41, 43).
Characterization of the effectors of LIF in ES cells may
provide insights into the mechanisms leading to early differentiation events in vitro. Thus, it would be of interest to
determine whether similar proteins can be activated by
LIF in cell lines in which this cytokine has opposite effects.
The STAT3 transcription factor, which is phosphorylated
on tyrosine upon LIF treatment in M1 myeloid cells, is
also activated in ES cells maintained in the presence of
LIF, but its specific effect on cell differentiation in ES cells
has not been addressed (1, 23). It has been shown recently, however, that STAT3 is a critical factor involved in IL-6-
and LIF-dependent differentiation of the M1 myeloid cell
line (37, 38). Activation of MAP kinases by LIF has been
reported, but its biological significance is yet unknown (15,
49, 61). Also, it has been shown that the low affinity LIF
receptor subunit can be phosphorylated in vitro by the
ERK2 serine/threonine kinase in the preadipocyte 3T3-L1
cell line. Phosphorylation of the LIF receptor, however, is
not crucial for LIF signaling in these cells (49).
In this study, we demonstrate that the SIE DNA-binding site of the c-fos promoter, which is a target for STAT1/
STAT3 in EGF-treated cells (17, 65), is specifically bound
by a STAT3-containing protein in ES cells maintained in
the presence of LIF. We examine the expression and phosphorylation of the STAT3 protein in these cells in response to LIF treatment or withdrawal. We show that the
c-fos promoter is LIF responsive in ES cells, and that the multimerized SIE element confers LIF-dependent transcription to the minimal TK promoter. We demonstrate
that STAT3 mutants, which behave as dominant negative
factors in the IL-6 pathway (38), can repress LIF-dependent transcription. We also show that stable expression of
one of these mutants (STAT3F) leads to morphological differentiation of the ES cells. Finally, we present evidence that the ERK2 serine/threonine kinase is involved
in the primary LIF response in ES cells.
Cells and Extracts
Embryonic cell lines were derived from the inner cell mass of mouse blastocysts as described (42). The cells were grown at 37°C, under 7% CO2, on
gelatinized plates in DME supplemented with 15% FCS, 0.1 mM Electrophoretic Band-Shift Assay
Gel retardation experiments were carried out in 20 µl final volume as described (44): 3 µg of nuclear extract was incubated with 1 µg of poly dI/dC
for 10 min at 4°C; competitor oligonucleotides (100-fold molar excess with
respect to probe) were added and further incubated for 10 min at 4°C. The
32P 5 For supershift experiments, nuclear lysates were preincubated with
specific antibodies (see above): 1 µg of polyclonal anti-STAT1, 3, or 5, or
0.5 µg of monoclonal anti-STAT6, or antiphosphoserine, antiphosphothreonine, and antiphosphotyrosine. After 30 min at 4°C, the reactions
were further processed as described above.
The synthetic, double-stranded oligonucleotides used as probes or
competitors in the band-shift reactions were as follows (only one strand is
represented, with the binding region italicized and mutations underlined):
SIE, high affinity binding site of the c-fos promoter element (SIE67; [58]):
5 mutated SIEm (SIE25; [58]): 5 ISRE, IFN- GAS, IFN- APRE, STAT3 high affinity binding site repeated twice (1): 5 ATF, ATF-binding site of the adenovirus-2 E2aE promoter (position
Antibodies and Immunoreactions
The polyclonal anti-STAT1 (directed against residues 688-710), anti-STAT3 (against residues 750-769), anti-STAT5 (against residues 5-24),
and anti-ERK2 (against residues 345-358) antibodies were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA); the monoclonal anti-STAT3 (against residues 1-172) and anti-STAT6 antibodies (against residues 1-272) were provided by Transduction Laboratories (Lexington,
KY); the antiphosphoserine, antiphosphothreonine, and antiphosphotyrosine antibodies used in the band-shift assays were from Sigma Chemical
Co. The antiphosphotyrosine antibody used in immunoprecipitation
experiments (supernatant of the 4G10 hybridoma) was a gift from D. Morrison. D.K. Morrison (National Cancer Institute, Frederick Cancer
Research and Development Center, Frederick, MD).
Total cell extracts (100 µg) were immunoprecipitated with 100 µl of the
4G10 antiphosphotyrosine antibody in the presence of protein A-Sepharose beads (Pharmacia Fine Chemicals, Piscataway, NJ) for 2 h at 4°C.
The beads were washed twice in TBStg buffer (20 mM Tris-HCl, pH 7.4, 125 mM NaCl, 1% Tween 20, 10% glycerol) and were resuspended in protein gel loading buffer.
About 20 µg of nuclear or cytosolic extracts from ES cells were electrophoresed on 10% acrylamide/SDS gels. Proteins were transferred onto nitrocellulose membranes and incubated with specific antibodies as recommended by the manufacturers. Protein-antibody complexes were visualized
by an enhanced chemiluminescence detection system (Amersham Corp.,
Arlington Heights, IL).
In Vitro Kinase Assay
About 150 µg of nuclear or cytosolic extracts were immunoprecipitated
with 0.8 µg of the anti-ERK2 antibody in the presence of protein A-Sepharose beads (Pharmacia Fine Chemicals) for 2 h at 4°C. The beads were
washed twice in TBStg buffer (20 mM Tris-HCl, pH 7.4, 127 mM NaCl,
1% Tween 20, 10% glycerol), once in kinase buffer (20 mM Hepes, pH
7.4, 5 mM EGTA, 10 mM MgCl2, 10 mM Expression Vectors
Synthetic oligonucleotides corresponding to the high affinity wild-type
(SIE67) or mutated (SIE25) SIF-binding sites (58) were trimerized and inserted into the SalI site of the pBLCAT5 vector (3), upstream of the minimal thymidine kinase (TK) promoter, generating the (SIE)3-TK and
(SIEm)3-TK CAT reporter vectors, respectively.
The c-Fos CAT vector bearing the human c-fos promoter sequences
between positions The pEF-BOS and pCAGGS-Neo series of STAT3 recombinants have
been described previously (38): pEF-BOS HA-STAT3 and pCAGGS-Neo-HA-STAT3 encode the hemagglutinin (HA)-tagged wild-type murine STAT3 protein; pEF-BOS HA-STAT3F and pCAGGS-Neo-HA-STAT3F encode a mutant version of STAT3 in which residue Y705 has
been replaced by a phenylalanine (F); pEF-BOS HA-STAT3D encodes a
STAT3 mutant in which residues E434 and E435 of the DNA-binding domain have been changed to aspartates (D).
Transfection Assay
ES cells, plated the day before in the presence or absence of LIF, were
transfected by calcium phosphate coprecipitation (8) with 2 or 5 µg of recombinant DNA vectors adjusted to 20 µg/9-cm petri plate, with the promoterless pBLCAT6 plasmid (3) used as carrier. 20 h after transfection,
the cells were washed once with PBS, and fresh medium, with or without
LIF, was added. The day after, the cells were harvested and extracts prepared in buffer A (15 mM Tris-HCl, pH 8, 60 mM KCl, 15 mM NaCl, 2 mM EDTA, 0.15 mM spermine, 1 mM DTT, and 1 mM Pefabloc). Aliquots, normalized by protein concentration, were assayed for CAT activity as described (19). The percentage of chloramphenicol acetylation was
determined from at least three independent experiments and was quantitated with a Bioimaging analyzer (Fuji Photo Film Co., Tokyo, Japan).
Selection of Stably Transformed Cells
To establish stable ES cell clones that produce the wild-type STAT3 or
mutated STAT3F proteins, ES cells, maintained on feeder cells in LIF-containing medium, were transfected with the pCAGGS-Neo-HA-STAT3 and pCAGGS-Neo-HA-STAT3F vectors (38). After 10 d of selection, in
the presence of 400 µg/ml of G418, individual clones were recovered and
plated on fresh feeder cells in LIF-containing medium. The medium was
changed every other day, and cells were divided every 4 d. Morphological
differentiation of the clones overexpressing STAT3F becomes apparent
after the third passage of the clones (i.e., ~4 wk after transfection).
A LIF-dependent DNA-binding Activity is Present in
ES Cells
To identify LIF-regulated DNA-binding activities, nuclear
lysates prepared from ES cell cultures that were constantly
maintained in the presence of LIF or from which LIF was
withdrawn for 12 h were used in band-shift experiments on
selected protein-binding sites (Fig. 1). Among the five
probes chosen, four corresponded to STAT-binding sites
(SIE, ISRE, GAS, and APRE), and one (ATF) was unrelated (11, 63). A major LIF-dependent DNA-binding activity was detected on the SIE probe, as revealed by specific complex formation in LIF-treated ES cell extracts
(Fig. 1, lane 2) compared to extracts from LIF-withdrawn
cells (Fig. 1, lane 4). By contrast, the specific complexes
detected with the other probes were not affected by the
LIF treatment. This result indicates that LIF mediates the
binding of specific proteins to the SIE element in ES cells.
The DNA-binding Activity of the
LIF-regulated Complex May Be Involved in the
Control of Cell Proliferation
LIF plays a key role in the maintenance of the pluripotential phenotype and active proliferation of ES cells (6, 21). We wondered whether induction of the LIF-dependent
DNA-binding activity is linked to the proliferative function mediated by LIF in these cells. If the DNA-binding
activity drops as a result of early differentiation commitment after a 2-3 d LIF withdrawal, no recovery of specific
complex formation would occur after LIF reinduction. By
contrast, if this binding activity is involved in cell growth
control, it should be reinduced by short treatments with
LIF in cells that can still proliferate. To test this possibility, we used the LIF-regulated SIE- and nonregulated APRE-binding sites as probes in band-shift experiments with nuclear extracts from ES cells that had been grown in the absence of LIF for increasing time periods and treated by
LIF for 10 min before cell harvesting. As shown in Fig. 2,
specific DNA-binding activity on the SIE was recovered
after a 10-min LIF reinduction, following a 12-h LIF deprivation (Fig. 2, lane 6). As reflected by the intensity of the
retarded complex, the binding activity is much stronger after LIF reinduction than in cells that had been grown in
the continuous presence of LIF (Fig. 2, compare lanes 2 and 6). Efficient complex reinduction also occurred 4 d after LIF withdrawal (not shown). Reinduction was much
weaker after 8 d of LIF deprivation (Fig. 2, lane 10), and
became undetectable after 11 d (Fig. 2, lane 14), a stage at
which the cell growth rate was reduced dramatically. By
contrast, no major modulation of the DNA-binding activities was detected on the APRE probe (Fig. 2, lanes 15-28).
Altogether, these results suggest that the DNA-binding
activity detected on the SIE probe is part of the proliferative signal mediated by LIF, and that modulators of this
activity are still present in ES cells during the first week after differentiation commitment.
The Steady-state Level of STAT Proteins in ES Cells Is
Not Dependent on LIF Treatment
We next examined the presence of STAT proteins in ES
cells and determined their overall levels as a function of
LIF treatment. To this end, nuclear lysates from cells that
had been maintained in the presence of LIF or cultivated
in its absence for increasing time periods were analyzed by
immunoblotting with specific STAT antibodies. As seen in
Fig. 3, STAT1, 3, 5, and 6 were readily detected in ES cells,
and their respective amounts were not affected significantly by LIF withdrawal: the level of each of these proteins remained unchanged, even after growing the ES cells
in the absence of LIF for 3 d, a time at which morphological differentiation of ES cells became apparent.
The LIF-regulated Complex Comprises a
Phosphoprotein Immunologically Related to STAT3
To determine which member of the STAT family generates the LIF-regulated complex detected in ES cells, we
examined the effect of antibodies specifically directed
against different STAT proteins. As shown in Fig. 4, only
the STAT3 antibody produced a clear supershift of the
LIF-dependent complex with the SIE probe (Fig. 4, lane 4), whereas antibodies to STAT1 (Fig. 4, lane 3), STAT5
(Fig. 4, lane 5), or STAT6 (not shown) had no effect on
this complex. Interestingly, the LIF-regulated complex
was supershifted only by an antibody directed against the
COOH-terminal part (residues 750-769) of STAT3
When nuclear lysates were prepared in the absence of
phosphatase inhibitors (like sodium vanadate or sodium
fluoride), formation of the LIF-dependent complex was
impaired (not shown), suggesting that phosphorylation of
this complex was important for its DNA-binding activity.
To examine this possibility in further detail, we tested the
effect of antibodies directed against phosphorylated amino acids on specific complex formation. Antibodies against
phosphotyrosine (Fig. 4, lane 6) and phosphoserine (Fig. 4,
lane 7) supershifted the LIF-specific complex, whereas antiphosphothreonine antibodies had no effect (Fig. 4, lane
8). In agreement with the earlier finding that STAT proteins are rapidly phosphorylated on serine and tyrosine
residues after cytokine or growth factor treatment (50, 60,
64), this result strongly suggests that the STAT3-containing complex is phosphorylated on these residues within
the LIF-regulated complex.
STAT3 Is Present in Tyrosine-phosphorylated
Complexes Only upon LIF Treatment
To determine if STAT3 is present in a tyrosine-phosphorylated complex in LIF-treated ES cells, we have performed immunoprecipitation experiments with the 4G10
antiphosphotyrosine antibody. Western blot analysis of
the tyrosine-phosphorylated immune complexes is shown
in Fig. 5. STAT3 protein is detected in tyrosine-phosphorylated complexes only in LIF-treated cells, with a higher
pool of STAT3 protein in LIF-reinduced cells, compared
to cells continuously maintained in the presence of LIF
(Fig. 5, compare lanes 4 and 6). Phosphorylation of the
STAT3 complex correlates with its DNA-binding activity
(Fig. 2, compare lanes 2, 4, and 6).
Protein Kinase Inhibitors Impair the
DNA-binding of the LIF-dependent STAT3 Complex
and Alter Cell Morphology
We next examined the dependence of the LIF-induced
complex on protein phosphorylation. ES cells, maintained
in the presence of LIF, were treated for 20 h with specific
tyrosine kinase inhibitors (Genistein and Herbimycin A)
or with a more general protein kinase inhibitor (Staurosporine; 2, 32, 47 and references therein). As shown in Fig.
6 A, Genistein treatment did not prevent specific complex
formation (Fig. 6 A, compare lanes 2 and 4). Control experiments have been performed in the epidermoid A 431 cell line treated with EGF, in which the formation of the
STAT1/STAT3 heterodimeric complex is completely
abolished by Genistein, as expected from earlier studies
(17, 45; data not shown). By contrast, treatment of the
cells with Herbymicin A completely abolished formation of the STAT3-containing complex (Fig. 6 A, compare
lanes 14 and 16). In the presence of Staurosporine, formation of the LIF-dependent complex was also severely impaired (Fig. 6 A, lane 6). No detectable effect was observed on the APRE-specific complexes in the presence of
either inhibitor (Fig. 6 A, lanes 7-12 and 17-20). Together with the effect of the antibodies against specific phosphorylated amino acids, these results indicate that phosphorylation of the STAT3-containing complex on serine and tyrosine residues is essential for its competence to bind DNA.
We have also observed that ES cells treated with Staurosporine and Herbimycin A undergo striking changes in
their morphology reminiscent of alterations that occur
during cell differentiation (see Fig. 6 B). In the presence of
these inhibitors, cells no longer grow as clumps characteristic of undifferentiated cells, but become flattened in the
presence of Herbimycin A and are completely individualized in the presence of Staurosporine. This result suggests that impairment of the formation of the STAT3-dependent complex may lead to morphological cell differentiation.
The ERK2 Serine/Threonine Kinase Activity Is Induced
by LIF
The ERK2 serine/threonine kinase has recently been shown
to interact with STAT1 in IFN-
Multimerized SIE Elements Confer LIF
Responsive Transcriptional Activity to Chimeric
Promoters in ES Cells
Multimerized STAT-binding elements have previously
been shown to behave as cytokine-inducible elements
when inserted upstream of a minimal promoter (33). We
examined whether formation of the LIF-dependent complex on the SIE element could be correlated, in the context of ES cells, with the transcriptional activation of a reporter gene harboring this element.
To this end, ES cells cultivated in the absence or presence of LIF were transfected with chloramphenicol acetyl
transferase (CAT) reporter plasmids differing in their promoter elements. The results of a typical CAT analysis is
shown in Fig. 8 A, along with the mean values of similar independent experiments (Fig. 8 B). It clearly appears that
the high-affinity SIE element, when linked as a trimer to
the minimal TK promoter [(SIE)3-TK], confers LIF responsiveness to the CAT reporter. The specificity of these results was further substantiated by the observation that,
under the same conditions, the TK promoter, whether
alone or fused to a mutated SIE element [(SIEm)3-TK],
showed no or very low LIF-responsiveness. Interestingly,
insertion of a single SIE element in front of the TK promoter did not generate a LIF-responsive construct (not
shown, [33]), while in the context of the natural c-fos promoter, a single low-affinity SIE element (present at position
STAT3 Is a Key Mediator of the LIF-regulated
Transcription in ES Cells
To further investigate the contribution of STAT3 to LIF
responsiveness, we attempted to compete for the endogenous protein by overexpressing STAT3 dominant negative
mutants in ES cells. We used STAT3 vectors (STAT3F, in
which residue Y705 has been mutated to phenylalanine,
and STAT3D, in which two critical residues in the DNA-binding domain, E434 and E435, have been changed to alanine [24]) whose expression had previously been shown
to impair IL-6-dependent transcription and cell differentiation (38). These vectors were transfected into ES cells
maintained in the presence of LIF, together with the LIF-responsive or nonresponsive CAT reporters. The results
of a typical CAT analysis are shown in Fig. 9 A, along with
the compiling of the results of similar independent experiments (Fig. 9 B). As expected from Fig. 8, the LIF-responsive (SIE)3-TK promoter exhibited the highest reporter activity when transfected with the empty STAT vector
(Fig. 9, lane 5 and corresponding column). Coexpression
of the wild-type STAT3 protein ("3") had no significant
effect on this reporter activity (Fig. 9, compare lanes 5 and
6 and corresponding columns), although slight variations
were observed from one experiment to the other, probably
reflecting fluctuations of the pool of active STAT3 in the
transfected cells. Under conditions where nearly identical
amounts of recombinant STAT3 proteins were produced (as monitored by Western blot analysis, not shown), coexpression of the mutant STAT3 proteins severely repressed
the LIF-dependent reporter activity (Fig. 9, lanes 7 and 8 and corresponding columns), whereas it had virtually no
effect on basal reporter activity (Fig. 9, compare lanes 1-4
and 9-12 and corresponding columns). These results
clearly support the conclusion that STAT3 mediates LIF-dependent transcriptional activation in ES cells.
Stable Expression of a Dominant-Negative STAT3
Mutant Induces ES Cell Differentiation in the Presence
of LIF
If, as suggested by the experiments described above,
STAT3 is an essential intermediate in LIF signaling in ES
cells, the expression of a dominant-negative allele that
blocks the effect of the endogenous STAT3 should impair
the action of LIF and thereby allow the cells to differentiate. To examine this possibility, we established ES cell
lines that were stably transformed with vectors expressing
either the wild-type STAT3 sequence or the dominant-negative mutant STAT3F. Both constructs generated neomycin-resistant clones with similar efficiencies. 10 clones
of each type were picked, and STAT3 and STAT3F expression levels were examined by Western blot analysis:
all clones overexpressed the STAT3 proteins compared to
untransfected cells. The cells overexpressing STAT3F, however, had a much greater propensity to differentiate
than the STAT3 transformants, although they were grown
under identical conditions, on feeder cells and in the presence of LIF. Specifically, 1 mo after the transfection and
selection procedure, all STAT3F-transformed ES cells had
undergone morphological differentiation, whereas <5%
of the STAT3-transformed cells exhibited an altered morphology. As expected, the clones exhibiting the highest
levels of STAT3F expression were the first to differentiate. A typical analysis with two clones, one of each type, is
shown in Fig. 10. These results clearly indicate that the
STAT3 protein is chiefly involved in the keeping of ES cell
pluripotentiality.
The LIF cytokine plays a key role in the maintenance of
the pluripotential phenotype and proliferation of ES
cells in vitro. We have investigated how the LIF regulates
the specific binding and transcriptional properties of a
STAT3-based complex in ES cells. We present evidence
suggesting that phosphorylation of this complex is the primary response of LIF-induced cell proliferation, and we
demonstrate that STAT3 is a critical component of LIF-dependent transcription in ES cells.
In an earlier study, Hocke et al. (23) detected a LIF-
inducible DNA-binding activity on the IL-6 response element of the rat Inhibition of STAT3 Phosphorylation
Correlates with the Loss of DNA-binding Activity
and with Morphological Alterations of ES Cells
We have shown that the level of the STAT3 protein remains constant in ES cells whether or not they were
treated with LIF, but that tyrosine-phosphorylated complexes containing STAT3 are detected only in the presence of LIF. Our data demonstrate that DNA-binding activity correlates with phosphorylation on tyrosine and with
the activation of the ERK2 serine/threonine kinase, whose activity is dependent on tyrosine phosphorylation (39, 57). Two lines of evidence suggest that ERK kinases may phosphorylate STAT3 despite the fact that we could not visualize any interaction between STAT3 and ERK2 (not shown):
(a) the sensitivity of the STAT3-containing complex to
Herbimycin A, a potent inhibitor of tyrosine kinases that
alters MAP kinase function in vivo; and (b) the finding
that Ras, a known MAP kinase inducer, is involved in LIF
signaling in ES cells (15, 47, 61). We did not detect any significant alteration in the relative nuclear and cytoplasmic distribution of ERK2 after LIF treatment. This is in contrast to PC12 cells, in which sustained MAP kinase activation by NGF leads to the nuclear translocation of the kinase and to cell differentiation, whereas upon short-lived
activation by EGF, which triggers cell proliferation, the kinase remains essentially cytosolic (35). The differentiation
program, which settles in ES cells in the absence of LIF,
may therefore not require relocation of ERK2 in different
cell compartments. On the other hand, the possibility that
a distinct but related protein kinase(s) is implicated in ES
cells cannot be formally excluded.
The tyrosine kinases of the Jak and Src families involved
in gp130-dependent signaling are also potential candidates
for STAT3 phosphorylation (14, 34, 52). In fact, members
of these families of tyrosine kinases play essential roles in
ES cells: clones of ES cells that overexpress the oncogenic
form of the v-Src protein exhibit LIF-independent growth
(4); the Hck tyrosine kinase is activated upon LIF signaling in ES cells, and LIF requirement decreases in cells that
constitutively express an activated form of Hck (14); the
activity of JAK1 and JAK2 tyrosine kinases is induced
upon LIF treatment in ES cells, and it has been suggested that Hck and Jak kinases induce two alternative LIF-
dependent pathways (15). Our experiments suggest that
STAT3 is probably a common target of both pathways,
with MAP kinases playing an essential role during the LIF
reinduction process.
Interestingly, in cells treated with Staurosporine, a general kinase inhibitor known to block cells in both G1 and
G2-M phases (32), formation of the STAT3-dependent
complex is impaired, and the cells undergo morphological
changes that mimic cell differentiation. Similarly, in cells
treated with Herbimycin A, a drug that blocks mainly the
activity of cytoplasmic tyrosine kinases (47), there is also a
correlation between the disappearance of the STAT3-containing complex and an alteration in cell morphology.
These results suggest that LIF-dependent STAT3 activation is linked to the maintenance of ES cell pluripotentiality, a conclusion that is further substantiated by the observation that overexpression of the STAT3F dominant negative mutant in ES cells triggers their morphological
differentiation in the presence of LIF.
The STAT3 Transcription Factor Is a Key
LIF-signaling Intermediate
STAT3 is induced by IL-6 and LIF during myeloid cell differentiation. The impairment of STAT3 signaling by expression of dominant-negative mutants of STAT3 (STAT3F
and STAT3D) leads to transcriptional repression and affects the differentiation program in these cells (37, 38).
These mutants prevent proper tyrosine phosphorylation of
the endogenous STAT3 protein, probably by blocking the
wild-type protein's access to the gp130 receptor (37, 38).
Repression of IL-6-dependent transcription has also been
reported in HepG2 cells expressing the STAT3F mutant
(30). We show that STAT3F and, to a lesser extent,
STAT3D repress LIF-dependent transcription in ES cells.
These data, together with results obtained with the kinase
inhibitors, clearly emphasize the critical contribution of
the tyrosine Y705 residue of STAT3 (a residue that is
phosphorylated upon STAT3 activation) to STAT3 transcriptional efficiency.
Differential Behavior of STAT3 Recognition Sites
The APRE-binding site is a STAT3 recognition element that
has originally been used to purify STAT3 In conclusion, together with earlier findings (23, 37, 38),
this report demonstrates that STAT3 is a LIF-dependent
transcription factor that exerts opposite effects in ES cells
and in the M1 myeloid cells. It is tempting to speculate
that STAT3 is a common component of larger complexes
that may mediate variable responses. The characterization
of the partners of this common effector will ultimately
help us to better understand the control mechanisms that
are involved in each of these specific responses.
Together with the essential contribution of STAT3 in
liver regeneration (10) and in antiapoptotis (18), the recent observation that STAT3 genetic disruption leads to
embryonic lethality (55) stresses the essential function of
STAT3 in early cell differentiation programs. The establishment of stable ES cell lines in which the expression of
STAT3 dominant negative mutants is inducible should help us to further analyze the contribution of STAT3 to
the maintenance of ES cell pluripotentiality.
(LIFR
) constitutively interact with the Jak1 and Jak2 tyrosine kinases.
Activation of these kinases occurs as a result of LIF-
induced dimerization of the receptor components (gp130-LIFR
) and leads to their phosphorylation (22, 31, 34, 52,
53). Transcription factors from the STAT family can also
be phosphorylated and recruited by the receptor, as shown
in HepG2 cells treated with IL-6 (34). Different combinations of Jak kinases and STAT transcription factors are activated, depending on both the ligand and cell line (52).
The members of the STAT family of transcription factors
have first been described as effectors in the IFN-
/
and
IFN-
signaling pathways (25, 50). These dual-function
factors, which contain SH2 and SH3 domains as well as a
DNA-binding domain, are activated by growth factors
(such as EGF and PDGF) and by cytokines (20, 50, 51).
The STAT proteins are regulated by tyrosine and serine
phosphorylation, a necessary step for dimerization, nuclear translocation, DNA-binding, and transcriptional activation (27, 59, 60). Tyrosine kinases of the Jak and of the
Src families, as well as serine/threonine kinases of the mitogen-activated protein (MAP) kinase family, have been
involved in STAT regulation (7, 13, 14, 62, 64). The
STAT3 transcription factor, originally cloned as an EGF-
and IL-6-induced transcription factor, is activated in many cell types by a broad range of cytokines (1, 5, 12, 65). A
natural truncated form of STAT3, named STAT3
, behaves as a constitutive transcription factor whose activity
is synergized by association with Jun (48).
Materials and Methods
-mercaptoethanol, and 1 mM sodium pyruvate. Recombinant murine LIF
(~1,000 U/ml) was added when appropriate. Where indicated, the cells
were treated with 100 nM Staurosporine (Sigma Chemical Co., St. Louis,
MO), 27 µg/ml Genistein, or 1 µg/ml Herbimycin A (BIOMOL Research
Laboratories, Plymouth Meeting, PA) for 20 h. Cytosolic and nuclear extracts were prepared as described (44).
end-labeled probe (~10,000 cpm, 5 fmol per reaction) was then
added, and the mixture was incubated at 25°C for 15 min. The reactions
were loaded on nondenaturing 4.5% polyacrylamide gels. After electrophoresis, the gels were dried and exposed for autoradiography.
AGCTTCATTTCCCGTAAATCCCTA 3
.
AGCTTCAGATCCCGTCATTCCCTA 3
.
-stimulated response element from the ISG54 gene promoter (11): 5
AGCTAGTTTCACTTTCCC 3
.
activation site from the guanylate binding protein gene (11):
5
AGCTTTACTCTAATTTCCC 3
.
ATCCTTCCGGGAATTCTGATCCTTCCGGGAATTCTG 3
.
65/
84) (63): 5
TCGGGAAAACTACGTCATCTCCAGC 3
.
-glycerol-phosphate, 10% glycerol), and finally resuspended in 20 µl of kinase buffer supplemented with
20 µM ATP, 1 µCi[32P]
-ATP, and 20 µg myelin basic protein (Sigma
Chemical Co.). After incubation for 30 min at 30°C, the reactions were
stopped in SDS sample buffer, and electrophoresed on a 10% acrylamide/ SDS gel, and processed for autoradiography.
711 and +42 has been described previously (FC3 recombinant [46]).
Results
Fig. 1.
A LIF-dependent DNA-binding activity is detected in
ES cells. Nuclear extracts from ES cells constantly maintained in
the presence of LIF (+) or grown in the absence of LIF for 12 h
() were used in standard band-shift assays with the 5
end-
labeled SIE, ISRE, GAS, APRE, or ATF probes as indicated
(see Materials and Methods). A 100-fold molar excess of each
corresponding unlabeled wild-type oligonucleotide (wt) or of the
mutated SIE oligonucleotide (m) was added as competitor to the
binding reactions. F, the unbound probe. The arrowhead in lane 2 points to the LIF-regulated complex.
[View Larger Version of this Image (87K GIF file)]
Fig. 2.
The LIF-dependent DNA-binding complex
is reinducible by LIF up to 8 d
without LIF. Nuclear extracts were prepared from
ES cells that were maintained with LIF or without
LIF for 12 h and 8 or 11 d
(12h,
8d, or
11d, respectively) and reinduced
with LIF for 10 min where indicated. Standard band-shift
assays were run with the 5
end-labeled SIE or APRE
probes in the presence of
wild-type (wt) or mutant (m)
SIE competitors, as indicated. The arrowheads refer to the
LIF-regulated complexes.
[View Larger Version of this Image (67K GIF file)]
Fig. 3.
STAT protein expression remains constant in the presence and absence of LIF. Nuclear extracts were prepared from
ES cell cultures that were maintained in the presence of LIF (+)
or those from which LIF was removed for 12, 48, or 72 h, as indicated. Immunoblot analyses were performed with specific anti-STAT antibodies, as described in Materials and Methods.
[View Larger Version of this Image (45K GIF file)]
(Fig.
4, lane 4), but not by an antibody directed against residues
628-640 (not shown) that recognizes both STAT3
and
STAT3
(48). It is possible therefore that this latter
epitope is hidden within the folded molecule or by association with yet unknown proteins. Similar experiments with
the APRE probe revealed that none of these antibodies
could supershift any of the specific retarded complexes
(not shown), further stressing the specificity of the LIF-
dependent complex assembled on the SIE site.
Fig. 4.
The LIF-dependent complex contains a STAT3-related
protein and is phosphorylated both on tyrosine and serine residues. Nuclear extracts from ES cells maintained in the presence
of LIF were preincubated for 30 min with 1 µg of anti-STAT1,
anti-STAT3, or anti-STAT5 ( stat 1,
stat 3, or
stat 5, respectively), or with 0.5 µg of the antiphosphotyrosine, antiphosphoserine, or antiphosphothreonine (
pY,
pS, or
pT, respectively), as indicated. Standard band-shift assays were then
performed with the 5
end-labeled SIE probe and wild-type (wt)
or mutant (m) SIE competitors, as indicated. The arrowhead
points to the position of the LIF-dependent complex.
[View Larger Version of this Image (64K GIF file)]
Fig. 5.
STAT3 is present in tyrosine-phosphorylated complexes only upon LIF treatment. Whole-cell extracts were prepared from ES cells that were maintained with LIF (+) or without LIF for 12 h (12h) and reinduced or not with LIF for 10 min, as indicated. The extracts (20 µg) were loaded, either directly (Lysate) or after immunoprecipitation with the antiphosphotyrosine antibody [IP(
pY)], on SDS-polyacrylamide gels,
and were analyzed with the anti-STAT3 antibody. Arrows point to bands corresponding to STAT3. The heavy (H) and light (L)
chains of the anti-pY Igs are also revealed.
[View Larger Version of this Image (39K GIF file)]
Fig. 6.
LIF-dependent complex is sensitive to Staurosporine
and Herbimycin A. (A) The 5 end-labeled SIE or APRE probes
were used in the presence of wild-type (wt) or mutant (m) SIE
competitors in standard band-shift assays with nuclear extracts
derived from ES cells maintained with LIF and treated for 20 h
with 27 µg/ml of Genistein (G), 100 nM Staurosporine (S), or 1 µg/ml Herbimycin A (H) when indicated. Arrowheads point to
the LIF-regulated complexes. (B) Phase contrast micrographs of
ES cells treated or not (control) with the different kinase inhibitors. Bar, 40 µm.
[View Larger Version of this Image (83K GIF file)]
/
-induced cells (13). Similarly, serine/threonine kinases of this family play critical
roles during the differentiation of PC12 cells (35). In addition, it has been shown that LIF stimulates ERK2 activity
in 3T3 fibroblasts (49, 61). We tested the possibility that
ERK2 is associated with STAT3 in ES cells, and determined the activity of this particular kinase as a function of
LIF treatment. Nuclear and cytoplasmic extracts from ES
cells cultivated in the presence or absence of LIF for 12 h
and reinduced by LIF for 10 min were immunoprecipitated with an anti-ERK2 antibody. As revealed by immunoblot analysis (Fig. 7), the level of ERK2 remained constant in ES cells whether they were treated or not with
LIF. Under our immunoprecipitation conditions, neither
STAT1 nor STAT3 were found to be associated with the
ERK2 kinase in the different cell lysates (not shown). Similarly, ERK2 could not be detected in STAT3 immunoprecipitates (not shown), indicating that no stable interactions
exist between these proteins in ES cells and, if they do exist,
that such interactions occur only transiently. The in vitro
kinase activity, as measured by phosphorylation of the exogenous MBP substrate, was not significantly affected by
LIF withdrawal (Fig. 7, lanes 1 and 2). When these cells
were reinduced by LIF for 10 min before extract preparation, however, a strong increase in ERK2 kinase activity
was reproducibly observed. Very similar results were obtained whether ERK2 was analyzed in nuclear (Fig. 7) or
in cytoplasmic (not shown) extracts. These results indicate
that ERK2 is modulated in a LIF-dependent manner in ES
cells without altering its subcellular distribution. In agreement with the more efficient complex formation after LIF reinduction after 12 h (see Fig. 2, lane 6) they also suggest that ERK2 or a closely related serine/threonine kinase may
be part of the primary signal mediated by LIF in these cells.
Fig. 7.
An ERK2-related MAP kinase is activated in ES cells
reinduced by LIF. Nuclear extracts from ES cells maintained with
LIF or without LIF for 12 h (12h) and reinduced by LIF for 10 min, as indicated, were immunoprecipitated with the anti-ERK2
antibody, as described in Materials and Methods. Two thirds of
the reaction were assayed in an in vitro kinase assay using MBP
as an exogenous substrate (top). The remaining third of the reaction was analyzed by immunoblot with the anti-ERK2 antibody
(bottom). The asterisk refers to the heavy chains of the Igs. Numbers on the right-hand side indicate the position of protein size
markers (kD).
[View Larger Version of this Image (28K GIF file)]
346), was sufficient to confer LIF responsiveness to
a c-Fos CAT reporter (Fig. 8 B). This observation stresses
the importance of the relative position of the SIE element
with respect to the start site or to the surrounding promoter elements. It is possible, therefore, that trimerization of the SIE element, as in the (SIE)3-TK CAT construct,
somehow compensates for the artificial structure of this
synthetic promoter.
Fig. 8.
The SIE element confers LIF responsiveness to a heterologous promoter in ES cells. (A) ES cells maintained with (+)
or without () LIF were transfected with 2 (odd lanes) or 5 µg
(even lanes) of the CAT reporters: pBLCAT5 (referred to as
TK), (SIE)3-TK, and (SIEm)3-TK, as indicated. The results of a
typical CAT assay with corresponding quantification are presented. (B) Transfection experiments were performed as described above, but using 5 µg of each of the indicated CAT reporters and including the c-Fos CAT reporter. The mean (±SD)
of four independent experiments performed with different plasmid preparations is plotted.
[View Larger Version of this Image (43K GIF file)]
Fig. 9.
Dominant negative mutants of STAT3 negatively interfere with LIF-dependent promoter activity. (A) ES cells maintained
with LIF were cotransfected with 5 µg of the CAT reporters
[pBLCAT5 (referred to as TK), (SIE)3-TK, and (SIEm)3-TK], together with 3 µg of the empty pEF-BOS vector (lanes 1, 5, and 9),
the pEF-BOS HA-STAT3 (lanes 2, 6, and 10), the pEF-BOS
HA-STAT3F (lanes 3, 7, and 11), or the pEF-BOS HA-STAT3D
(lanes 4, 8, and 12), as indicated. The results of a typical CAT assay with corresponding quantification are presented. (B) The
mean (±SD) of three independent experiments performed as described above, with different plasmid preparations, is plotted.
Depending on the experiment, cotransfection of the (SIE)3-TK
CAT reporter with the pEF-BOS HA-STAT3 vector resulted either in a slight stimulation or slight repression of CAT activity
compared to cotransfection with the empty pEF-BOS vector.
This variation, probably reflecting differences in recipient cell
conditions, generated artificially elevated SD values: the misleading error bar was therefore omitted on the corresponding column.
[View Larger Version of this Image (54K GIF file)]
Fig. 10.
Stable expression of STAT3F dominant negative mutant induces ES cell differentiation. Phase contrast micrographs
of Neomycin-resistant ES cell clones stably expressing the wild-type STAT3 (A) or the dominant negative STAT3F mutant (B).
The selected clones were grown on feeder layers of mouse embryo fibroblasts (visible in A between the clumps of undifferentiated ES cells) and continuously maintained in the presence of
LIF. (C) Western blot analysis of equivalent amounts of whole-cell extracts of STAT3- (lane 1) or STAT3F-transformed cells
(lane 2), or untransformed ES cells (lane 3). The arrow points to
the specific signal obtained with the monoclonal anti-STAT3 antibody. Bar, 100 µm.
[View Larger Version of this Image (66K GIF file)]
Discussion
2-macroglobulin (
2 M) gene and showed
that STAT3 is part of this complex. These authors also
demonstrated that the downregulation of the LIF receptor
in LIF-deprived cells correlates with the loss of the LIF-dependent complex. Similarly, we show that the DNA-binding activity detected on the SIE probe dropped rapidly after LIF deprivation. We further extend this observation by
showing that regulators which activate STAT3 DNA-binding capacity remain reinducible by the LIF within the first
week of LIF deprivation. The extent of reinduction decreases progressively, however, together with the slackening of cell growth.
from the rat
liver (1). In our study, the APRE-specific complexes are
not modulated by LIF, and their formation is not altered
in lysates derived from cells treated with kinase inhibitors.
In addition, as opposed to the (SIE)3-TK-CAT and of the
c-fos-CAT reporter activities, the APRE-TK-CAT reporter activity was not responsive to LIF treatment (not
shown). Interestingly, these APRE-specific complexes
were not supershifted by an anti-STAT3 antibody directed
against the COOH-terminal part of STAT3
(our unpublished observation). It is therefore possible that in ES cell
extracts, these complexes contain STAT3
, a natural truncated form of STAT3 lacking the COOH-terminal part of
STAT3
. In IL-6-treated cells, this particular form of
STAT3 behaves as a constitutive transcription factor (48). It is therefore tempting to speculate that, in ES cells, a
constitutive STAT3
-containing complex interacts with
the APRE site, while a LIF-inducible STAT3
activity
binds to the SIE site.
Received for publication 15 May 1997 and in revised form 7 July 1997.
Please address all correspondence to Claude Kedinger, IGBMC, B.P. 163, 67404 Illkirch, France. Tel.: (33) 3-88-65-34-46; Fax: (33) 3-88-65-32-01; E-mail: kedinger{at}igbmc.u-strasbg.frWe thank A. Dierich, M. Digelmann, and D. Queuche for ES cells and expert advice, and B. Chatton and M. Vigneron for helpful discussions and gifts of different materials. We are grateful to the following people for their generous gifts: T. Hirano and K. Nakajima for the pEF-BOS and pCAGGS-NEO STAT3 derivatives, P. Sassone-Corsi for the c-fos-CAT reporter construct, and B. Groner for the anti-STAT5 antibody. We also thank I. Lotz for the initial characterization of anti-STAT antibodies. We are grateful to the staffs of the cell culture, chemistry, and artwork facilities for providing help and materials.
This work was supported by funds from the Centre National de la Recherche Scientifique, the Institut National de la Santé et de la Recherche Médicale, the Centre Hospitalier Universitaire Régional, the Human Frontier Science Program, the Association pour la Recherche sur le Cancer, the Ligue Nationale contre le Cancer, and the Université Louis Pasteur de Strasbourg.
CAT, chloramphenicol acetyl transferase; ES, embryonic stem (cells); HA, hemagglutinin; LIF, leukemia inhibitory factor; MAP, mitogen-activated protein; TK, thymidine kinase.
1. | Akira, S., Y. Nishio, M. Inoue, X.J. Wang, S. Wei, T. Matsusaka, K. Yoshida, T. Sudo, M. Naruto, and T. Kishimoto. 1994. Molecular cloning of APRF, a novel IFN-stimulated gene factor 3 p91-related transcription factor involved in the gp130-mediated signaling pathway. Cell. 77: 63-71 |
2. |
Akiyama, T,
J. Ishida,
S. Nakagawa,
H. Ogawara,
S. Watanabe,
N. Itoh,
M. Shibuya, and
Y. Fukami.
1987.
Genistein, a specific inhibitor of tyrosine-specific protein kinases.
J. Biol. Chem.
262:
5592-5595
|
3. | Boschart, M., M. Kluppel, A. Schmidt, G. Schutz, and B. Luckow. 1992. Reporter constructs with low background activity utilizing the CAT gene. Gene (Amst.). 110: 129-130 |
4. | Boulter, C.A., A. Agguzi, R.L. Williams, E.F. Wagner, M.J. Evans, and R. Beddington. 1991. Expression of v-src induces aberrant development and twinning in chimaeric mice. Development (Camb.). 111: 357-366 [Abstract]. |
5. | Boulton, T.G., Z. Zhong, Z. Wen, J.E. Darnell Jr., and N. Stahl. 1995. STAT3 activation by cytokines utilizing gp130 and related transducers involves a secondary modification requiring an H7-sensitive kinase. Proc. Natl. Acad. Sci. USA. 92: 6915-6919 [Abstract]. |
6. | Bradley, A.. 1990. Embryonic stem cells: proliferation and differentiation. Curr. Opin. Cell Biol. 2: 1013-1017 |
7. | Cao, X., A. Tay, R.G. Graeme, and Y.H. Tan. 1996. Activation and association of STAT3 with Src in V-src-transformed cell lines. Mol. Cell. Biol. 16: 1595-1603 [Abstract]. |
8. | Chen, C., and H. Okayama. 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7: 2745-2752 |
9. | Conover, J.C., N.Y. Ip, W.T. Poueymirou, B. Bates, M.P. Goldfarb, T.M. De Chiara, and G.D. Yancopoulos. 1993. Ciliary neurotrophic factor maintains the pluripotentiality of embryonic stem cells. Development (Camb.). 1|:559-565. |
10. |
Cressman, D.E.,
L.E. Greenbaum,
R.A. De Angelis,
G. Ciliberto,
E.E. Furth,
V. Poli, and
R. Taub.
1996.
Liver failure and defective hepatocyte
regeneration in interleukin-6-deficient mice.
Science (Wash. DC).
274:
1379-1383
|
11. | Darnell, J.E. Jr., I.M. Kerr, and G.R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science (Wash. DC). 264: 1415-1421 |
12. |
Darnell, J.E. Jr..
1996.
Reflections on STAT3, STAT5, and STAT6 as fat
STATs.
Proc. Natl. Acad. Sci. USA.
93:
6221-6224
|
13. | David, M., E. Petricoin, C. Benjamin, R. Pine, M.J. Weber, and A.C. Larner. 1995. Requirement for MAP kinase (ERK2) activity in interferon alpha- and interferon beta-stimulated gene expression through STAT proteins. Science (Wash. DC). 269: 1721-1723 |
14. | Ernst, M., D.P. Gearing, and A.R. Dunn. 1994. Functional and biochemical association of Hck with the LIF/IL-6 receptor signal transducing subunit gp130 in embryonic stem cells. EMBO J. 13: 1574-1584 [Abstract]. |
15. |
Ernst, M.,
A. Oates, and
A.R. Dunn.
1996.
Gp130-mediated signal transduction in embryonic stem cells involves activation of Jak and Ras/mitogen-activated protein kinase pathways.
J. Biol. Chem.
271:
30136-30143
|
16. | Escary, J.L., J. Perreau, D. Dumenil, S. Ezine, and P. Brulet. 1993. Leukaemia inhibitory factor is necessary for maintenance of haematopoietic stem cells and thymocyte stimulation. Nature (Lond.). 363: 361-364 |
17. | Fu, X.Y., and J.J. Zhang. 1993. Transcription factor p91 interacts with the epidermal growth factor receptor and mediates activation of the c-fos promoter. Cell. 74: 1135-1145 |
18. | Fukada, T., M. Hibi, Y. Yamanaka, M. Takahashi-Tezuka, Y. Fujitani, T. Yamaguchi, K. Nakajima, and T. Hirano. 1996. Two signals are necessary for cell proliferation induced by a cytokine receptor gp130: involvement of STAT3 in anti-apoptosis. Immunity. 5: 449-460 |
19. | Gorman, C.M., L.F. Moffat, and B.H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyl transferase in mammalian cells. Mol. Cell. Biol. 2: 1044-1051 |
20. | Gouilleux, F., C. Pallard, I. Dusanter-Four, H. Wakao, L.A. Haldosen, G. Norstedt, D. Levy, and B. Groner. 1995. Prolactin, growth hormone, erythropoietin and granulocyte-macrophage colony stimulating factor induce MGF-STAT5 DNA binding activity. EMBO J. 14: 2005-2013 [Abstract]. |
21. | Hilton, D.J.. 1992. LIF: a lot of interesting functions. Trends Biochem. Sci. 17: 72-76 |
22. | Hirano, T., T. Matsuda, and K. Nakajima. 1994. Signal transduction through gp130 that is shared among the receptors for the interleukin-6 related cytokine subfamily. Stem Cells. 12: 262-277 [Abstract]. |
23. |
Hocke, G.M.,
M.Z. Cui, and
G.H. Fey.
1995.
The LIF response element of
the ![]() |
24. | Horvath, C.M., Z. Wen, and J.E. Darnell Jr.. 1995. A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain. Genes Dev. 9: 984-994 [Abstract]. |
25. | Horvath, C.M., and J.E. Darnell Jr.. 1997. The state of the STATs: recent developments in the study of signal transduction to the nucleus. Curr. Opin. Cell Biol. 9: 233-239 |
26. | Ihle, J.N.. 1995. Cytokine receptor signaling. Nature (Lond.). 377: 591-594 |
27. | Ihle, J.N.. 1996. STATs and MAPKs: obligate or opportunistic partners in signaling. BioEssays. 18: 95-98 |
28. | Ihle, J.N., B.A. Witthuhn, F.W. Quelle, K. Yamamoto, W.E. Thierfelder, B. Kreider, and O. Silvennoinen. 1994. Signaling by the cytokine receptor superfamily: JAKs and STATs. Trends Biochem. Sci. 19: 222-227 |
29. | Ip, N.Y., S.H. Nye, T.G. Boulton, S. Davis, T. Taga, Y. Li, S.J. Birren, K. Yasukawa, T. Kishimoto, D.J. Anderson, et al . 1992. CNTF and LIF act on neuronal cells via shared signaling pathways that involve the IL-6 signal transducing receptor component gp130. Cell. 69: 1121-1132 |
30. |
Kaptein, A.,
V. Paillard, and
M. Saunders.
1996.
Dominant negative stat3
mutant inhibits interleukin-6-induced Jak-STAT signal transduction.
J.
Biol. Chem.
271:
5961-5964
|
31. | Kishimoto, T., T. Taga, and S. Akira. 1994. Cytokine signal transduction. Cell. 76: 253-262 |
32. | Kwon Kyu, T., M.A. Buchholz, F.J. Chrest, and A.A. Nordin, . 1996. Staurosporine-induced G1 arrest is associated with the induction and accumulation of cyclin-dependent kinase inhibitors. Cell Growth Differ. 7: 1305-1313 [Abstract]. |
33. | Lamb, P., H.M. Seidel, J. Haslam, L. Milocco, L.V. Kessler, R.B. Stein, and J. Rosen. 1995. STAT protein complexes activated by interferon-gamma and gp130 signaling molecules differ in their sequence preferences and transcriptional induction properties. Nucleic Acids Res. 23: 3283-3289 [Abstract]. |
34. | Lutticken, C., U.M. Wegenka, J. Yuan, J. Buschmann, C. Schindler, A. Ziemiecki, A.G. Harpur, A.F. Wilks, K. Yasukawa, T. Taga, et al . 1994. Association of transcription factor APRF and protein kinase Jak1 with the interleukin-6 signal transducer gp130. Science (Wash. DC). 263: 89-92 |
35. | Marshall, C.J.. 1995. Specificity of receptor tyrosine kinase signaling: transient versus sustained extracellular signal-regulated kinase activation. Cell. 80: 179-185 |
36. | Megeney, L.A., R.L.S. Perry, J.E. Lecouter, and M.A. Rudnicki. 1996. bFGF and LIF signaling activates STAT3 in proliferating myoblasts. Dev. Genet. 19: 139-145 |
37. |
Minami, M.,
M. Inoue,
S. Wei,
K. Takeda,
M. Matsumoto,
T. Kishimoto, and
S. Akira.
1996.
STAT3 activation is a critical step in gp130-mediated
terminal differentiation and growth arrest of a myeloid cell line.
Proc.
Natl. Acad. Sci. USA.
93:
3963-3966
|
38. | Nakajima, K., Y. Yamanaka, K. Nakae, H. Kojima, M. Ichiba, N. Kiuchi, T. Kitaoka, T. Fukada, M. Hibi, and T. Hirano. 1996. A central role for Stat3 in IL-6-induced regulation of growth and differentiation in M1 leukemia cells. EMBO J. 15: 3651-3658 [Abstract]. |
39. | Nishida, E., and Y. Gotoh. 1993. The MAP kinase cascade is essential for diverse signal transduction pathways. Trends. Biochem. Sci. 18: 128-131 |
40. | Pennica, D., W.I. Wood, and K.R. Chien. 1996. Cardiotrophin-1: a multifunctional cytokine that signals via LIF receptor-gp 130 dependent pathways. Cytokine Growth Factor Rev. 7: 81-91 . |
41. | Piquet-Pellorce, C., L. Grey, A. Mereau, and J.K. Heath. 1994. Are LIF and related cytokines functionally equivalent? Exp. Cell Res. 213: 340-347 |
42. | Robertson, E.J. 1987. Embryo-derived stem cell lines. In Teratocarcinomas and Embryonic Stem Cells: A Practical Approach. E.J. Robertson, editor. IRL Press, Oxford. 71 pp. |
43. | Rose, T.M., D.M. Weiford, N.L. Gunderson, and A.G. Bruce. 1994. Oncostatin M (OSM) inhibits the differentiation of pluripotent embryonic stem cells in vitro. Cytokine. 6: 48-54 |
44. | Sadowski, H.B., and M.Z. Gilman. 1993. Cell-free activation of a DNA-binding protein by epidermal growth factor. Nature (Lond.). 362: 79-83 |
45. | Sadowski, H.B., K. Shuai, J.E. Darnell Jr., and M.Z. Gilman. 1993. A common nuclear signal transduction pathway activated by growth factor and cytokine receptors. Science (Wash. DC). 261: 1739-1744 |
46. | Sassone-Corsi, P., J.C. Sisson, and I.M. Verma. 1988. Transcriptional autoregulation of the proto-oncogene fos. Nature (Lond.). 334: 314-319 |
47. |
Satoh, T.,
Y. Uehara, and
Y. Kaziro.
1992.
Inhibition of interleukin 3 and
granulocyte-macrophage colony-stimulating factor stimulated increase of
active Ras-GTP by Herbimycin A, a specific inhibitor of tyrosine kinases.
J. Biol. Chem.
267:
2537-2541
|
48. | Schaefer, T.S., L.K. Sanders, and D. Nathans. 1995. Cooperative transcriptional activity of Jun and Stat3b, a short form of STAT3. Proc. Natl. Acad. Sci. USA. 92: 9097-9101 [Abstract]. |
49. | Schiemann, W.P., L.M. Graves, H. Baumann, K.K. Morella, D.P. Gearing, M.D. Nielsen, E.G. Krebs, and N.M. Nathanson. 1995. Phosphorylation of the human leukemia inhibitory factor (LIF) receptor by mitogen-activated protein kinase and the regulation of LIF receptor function by heterologous receptor activation. Proc. Natl. Acad. Sci. USA. 92: 5361-5365 [Abstract]. |
50. | Schindler, C., and J.E. Darnell Jr.. 1995. Transcriptional responses to polypeptide ligands: the JAK/STAT pathway. Annu. Rev. Biochem. 64: 621-651 |
51. | Shuai, K., C.M. Horvath, L.H. Huang, S.A. Qureshi, D. Cowburn, and J.E. Darnell Jr.. 1994. Interferon activation of the transcription factor Stat91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell. 76: 821-828 |
52. | Stahl, N., T.G. Boulton, T. Farruggela, N.Y. Ip, S. Davis, B.A. Witthuhn, F.W. Quelle, O. Silvennoinen, G. Barbieri, S. Pellegrini, J. Ihle, and G.D. Yancopoulos. 1994. Association and activation of Jak-Tyk kinases by CNTF-LIF-OSM-IL6b receptor components. Science (Wash. DC). 263: 92-95 |
53. | Stahl, N., T.J. Farruggella, T.G. Boulton, Z. Zhong, J.E. Darnell Jr., and G.D. Yancopoulos. 1995. Choice of STATs and other substrates specified by modular tyrosine-based motifs in cytokine receptors. Science (Wash. DC). 267: 1349-1353 |
54. | Stewart, C.L., P. Kaspar, L.J. Brunet, H. Bhatt, I. Gadi, F. Köntgen, and S.J. Abbondanzo. 1992. Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature (Lond.). 359: 76-79 |
55. |
Takeda, K.,
K. Noguchi,
W. Shi,
T. Tanaka,
M. Matsumoto,
N. Yoshida,
T. Kishimoto, and
S. Akira.
1997.
Targeted disruption of the mouse Stat3
gene leads to early embryonic lethality.
Proc. Natl. Acad. Sci. USA.
94:
3801-3804
|
56. | Taniguchi, T.. 1995. Cytokine signaling through nonreceptor protein tyrosine kinases. Science (Wash. DC). 268: 251-255 |
57. | Treisman, R.. 1996. Regulation of transcription by MAP kinase cascades. Curr. Opin. Cell Biol. 8: 205-215 |
58. | Wagner, B.J., T.E. Hayes, C.J. Hoban, and B.H. Cochran. 1990. The SIF binding element confers sis-PDGF inducibility onto the c-fos promoter. EMBO J. 9: 4477-4484 [Abstract]. |
59. | Watanabe, S., and K. Arai. 1996. Roles of the JAK-STAT system in signal transduction via cytokine receptors. Curr. Opin. Genet. Dev. 6: 587-596 |
60. | Wen, Z., Z. Zhong, and J.E. Darnell Jr.. 1995. Maximal activation by STAT1 and STAT3 requires both tyrosine and serine phosphorylation. Cell. 82: 241-250 |
61. |
Yin, T., and
Y.C. Yang.
1994.
Mitogen-activated protein kinases and ribosomal S6 protein kinases are involved in signaling pathways shared by interleukin-11, interleukin-6, leukemia inhibitory factor, and oncostatin M
in mouse 3T3-L1 cells.
J. Biol. Chem.
269:
3731-3738
|
62. | Yu, C.L., D.J. Meyer, G.S. Campbell, A.C. Larner, C. Carter-Su, J. Schwartz, and R. Jove. 1995. Enhanced DNA-binding activity of a STAT-3 related protein in cells transformed by the Src oncoprotein. Science (Wash. DC). 269: 81-83 |
63. | Zajchowski, D.A., H. Boeuf, and C. Kedinger. 1985. The adenovirus-2 early EIIa transcription unit possesses two overlapping promoters with different sequence requirements for EIa-dependent stimulation. EMBO J. 5: 1293-1300 . |
64. | Zhang, X.K., J. Blenis, H.C. Li, C. Schindler, and S. Chenkiang. 1995. Requirement of serine phosphorylation for formation of STAT-promoter complexes. Science (Wash. DC). 267: 1990-1994 |
65. | Zhong, Z., Z. Wen, and J.E. Darnell Jr.. 1994. Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science (Wash. DC). 264: 95-98 |