Sinsheimer Laboratories, Department of Biology, University of California, Santa Cruz, California 95064
Little is known about the pathways used by cyclins and cyclin-dependent kinases to induce the events of the cell cycle. In budding yeast, a protein called Nap1 binds to the mitotic cyclin Clb2, and Nap1 is required for the ability of Clb2 to induce specific mitotic events, but the role played by Nap1 is unclear. We have used genetic and biochemical approaches to identify additional proteins that function with Nap1 in the control of mitotic events. These approaches have both identified a protein kinase called Gin4 that is required for the ability of Clb2 and Nap1 to promote the switch from polar to isotropic bud growth that normally occurs during mitosis. Gin4 is also required for the ability of Clb2 and Nap1 to promote normal progression through mitosis. The Gin4 protein becomes phosphorylated as cells enter mitosis, resulting in the activation of Gin4 kinase activity, and the phosphorylation of Gin4 is dependent upon Nap1 and Clb2 in vivo. Affinity chromatography experiments demonstrate that Gin4 binds tightly to Nap1, indicating that the functions of these two proteins are closely tied within the cell. These results demonstrate that the activation of Gin4 is under the control of Clb2 and Nap1, and they provide an important step towards elucidating the molecular pathways that link cyclin-dependent kinases to the events they control.
Cell division requires the precise coordination of an
extraordinary number of events. Recent work has
demonstrated that these events are induced and
coordinated by two large families of proteins called cyclins
and cyclin-dependent kinases (for reviews see King et al.,
1994 Since cyclin-dependent kinases are bound to different
cyclins at each stage of the cell cycle, it seems likely that
the cyclins somehow function to provide cyclin-dependent
kinase complexes with specificity. To learn more about
how cyclins might function in this capacity, we used affinity chromatography to identify proteins that interact with
one kind of cyclin, but not with others. We reasoned that
such proteins would be likely to play a role in the specific
cell cycle events induced by the cyclin to which they bind
(Kellogg et al., 1995 We are interested in learning more about how the cyclin
Clb2 and Nap1 function to control mitotic events. The specific mitotic event that we have chosen to study is a switch
in the pattern of bud growth that occurs as yeast cells enter
mitosis. When a yeast cell begins to divide, a new bud
emerges from the mother cell during G1 phase and undergoes polar growth at its tip (Lew and Reed, 1995 Several factors make the pathway used by Clb2 and
Nap1 to control bud growth ideally suited for genetic analysis. In our previous work with Nap1, we found that the
proper control of bud growth during mitosis is not necessary for viability, so that cells with severe defects in this
pathway can be maintained and studied (Kellogg et al.,
1995 Analysis of mitotic control in budding yeast is complicated by the fact that there are four functionally redundant cyclins that appear during mitosis, Clb1, Clb2, Clb3,
and Clb4 (Fitch et al., 1992 In this report, we describe the use of both genetic and
biochemical approaches to identify and characterize additional proteins that function in the Nap1-dependent mitotic control pathway. Our experiments have identified a
kinase called Gin4 that is specifically activated during mitosis and functions with Nap1 in the control of mitotic
events.
Strains and Culture Conditions
Except where noted, all cells were grown in yeast/peptone/dextrose
(YPD)1 media. All strains are in the W303 strain background (leu2-3,112 ura3-52 can1-100 ade2-1 his3-11 trp1-1), with the exception of the JB811
protease-deficient strain. The additional features of the strains used in this
study are listed below. Strains carrying deletions of the CLB genes were
derived from crosses between strains K2652 and K3080 (Amon et al.,
1993 DK177: Mata
RA4: Mata DK131: Mata, DK186: Mata DK166: Mata DK212: Mata DK213: Mata DK214: Mata DK216: Mata gin4K48A DK247: Mata RSN31-8d: Mata RA16: Mata JB811: Mata prb1 pep4-3 trp1 leu2-3,112 ura3-52
Mutagenesis and Screening
Mutagenesis with ethylmethane sulfate was carried out as previously described using strain DK166 (Lawrence, 1991 Cloning and Deletion of the GIN4 Gene
To demonstrate that the GIN4 gene alone can rescue the ecm1 mutant phenotype, we used PCR to amplify and clone the GIN4 gene into YCplac111
to create pRA1 (oligos: GCGCAAGCTTGGAGTTTATTCATTCCCGCT and CGCGGTACCCTGTTACATAATTTATGTTTA). To further confirm that GIN4 is the rescuing gene, we deleted all sequences upstream of
the BamH1 site found 120 bases downstream of the starting ATG in the GIN4 coding region in pRA1.
To generate a deletion of the GIN4 gene in the yeast genome, the
GIN4 gene was amplified by PCR and cloned into the KpnI and HindIII
sites of the bluescript cloning vector (oligos: GCGCAAGCTTGGAGTTTATTCATTCCCGCT and CGCGGTACCCTGTTACATAATTTATGTTTA). This vector was then used as a template for a second PCR reaction that amplified the bluescript vector with regions of homology to the
GIN4 gene on each end (oligos: GCGCGCGGGCCCCAATGAATTGCGTAAACAGAA and GCGCGCCCTAGGTGTATTGTGCTGCGAATATCT). A fragment carrying the LEU2 gene was then ligated into
this PCR product to produce a vector carrying the LEU2 gene flanked
by sequences homologous to the 5 Generation of Antibodies that Recognize Gin4
Antibodies that recognize Gin4 were raised by immunizing rabbits with a
COOH-terminal fragment of Gin4, purified from bacteria as a 6X-histidine fusion protein. The COOH-terminal fragment was amplified by PCR
and cloned into the vector pQE10 (QIAGEN, Inc., Chatsworth, CA; PCR
primers: GCGGGATCCCAGTTCGAACGATGAGAGATT and GCGCAAGCTTCTATTTTTGTAGAACGCCTT). Antibodies were affinity
purified from the serum using the Gin4 fusion protein as previously described (Kellogg and Alberts, 1992 Cell Cycle Arrests and Immunofluorescence Methods
For all experiments, strains that are BAR1 were arrested with 20 µg/ml
Affinity Purification of Nap1-binding Proteins
We affinity purify Nap1-binding proteins using essentially the same protocol that we used to purify cyclin-binding proteins (Kellogg et al., 1995
Coimmunoprecipitation of Gin4 and Nap1
Immunoaffinity beads for the precipitation of Gin4 are made by cross-linking anti-Gin4 antibody to protein A beads as previously described, using 1 µg of affinity-purified antibody for each microliter of protein A
beads (Kellogg et al., 1995 Construction of gin4K48A Strains
A 4.5-kb fragment containing the GIN4 gene was amplified by PCR and
cloned into the KpnI and HindIII sites of the integrating vector YIplac211
to create plasmid pDK46 (PCR primers: GCGCAAGCTTGGAGTTTATTCATTCCCGCT and CGCGGTACCCTGTTACATAATTTATGTTTA). A BamHI site lies 21 bases away from the codon for the conserved lysine in subdomain II of the kinase domain (Hanks and Quinn,
1991 Gin4 Kinase Assays
To measure Gin4 kinase activity during the cell cycle, 650 ml of strains
DK212 and DK213 cells are grown overnight at room temperature to ODs
of 0.8 and 0.85, respectively. Anti-Gin4 beads are prepared by binding affinity-purified anti-Gin4
antibody to protein A beads (Bio Rad Laboratories) in PBS for several
hours (5 µg antibody/20 µl beads). The beads are then washed several
times with lysis buffer (without PMSF), and 400 µl of each lysate is added to
20 µl of protein A beads in 0.6-ml tubes. The suspension is mixed for 1 h
on a rotator at 4°C. The beads are then washed three times in lysis buffer,
and three times in kinase buffer (50 mM K+-Hepes, pH 7.6, 1 mM EGTA,
2 mM MgCl2, 0.1% Tween-20, 10% glycerol) with a transfer to fresh tubes
after the fifth wash. After the final wash, the supernatant is completely removed and 20 µl of assay buffer is added (kinase buffer containing 1 mM
DTT, 0.25 mM ATP, 0.1 mCi/ml [
To measure Gin4-associated kinase activity in the cdc28-4 mutant background we carried out the same assay described above using log phase cultures of strains RSN31-8d and DK186. After the fifth wash, the immunoprecipitates from each strain are divided into two identical aliquots. After
the sixth wash, the supernatant is removed and one aliquot of beads from
each strain is preincubated at 37°C for 15 min. 40 µl of kinase assay buffer
is warmed to 37°C before adding 20 µl to each sample of beads, and the
tubes are vortexed gently and incubated at 37°C for 30 min, with gentle mixing every 10 min. The identical procedure is carried out at 25°C using
the other aliquots of beads from each strain.
Treatment of Gin4 with Phosphatase
For experiments involved in treatment of Gin4 with phosphatase, Gin4 is
immunoprecipitated from DK186 cells arrested in mitosis using the same
procedure described above for coimmunoprecipitation of Gin4 and Nap1,
except that the IP buffer contains 1.0 M NaCl. The anti-Gin4 beads are
washed three times with IP buffer followed by two times with phosphatase
buffer (50 mM Tris-HCl, pH 7.5, 5 mM DTT, 2 mM MnCl2, 100 µg/ml
BSA). After the fourth wash, the beads are split into two identical aliquots, and after the final wash, the supernatant is removed leaving a total
volume of 25 µl in each tube. 1.5 µl of lambda phosphatase (New England
Biolabs Inc., Beverly, MA) is added to one tube and both tubes are incubated at 30°C for 30 min. The beads are then washed once in IP buffer containing 1.0 M NaCl and twice in kinase buffer before adding 15 µl of
assay buffer. The tubes are mixed gently and incubated at 30°C for 30 min,
with gentle mixing every 10 min. The reaction is stopped by the addition
of 20 µl of 2× sample buffer. 15 µl is loaded onto a 15% SDS-polyacrylamide gel for the kinase assay, and 2 µl is loaded onto a 9% gel for a Gin4
Western blot. To ensure that all phosphatase was washed away before the
kinase assay, we carried out controls in which we mixed phosphatase-treated Gin4 beads with untreated Gin4 beads, and observed no inhibition of Gin4 kinase activity (not shown).
Expression of Clb2 To induce expression of Clb2 PAGE and Western Blotting
PAGE and Western blotting are carried out as previously described
(Anderson et al., 1973
Identification of Mutations That Disrupt the Mitotic
Control of Bud Growth
In our previous work with Nap1, we found that cells with
defects in the switch from polar to isotropic bud growth
have a characteristic elongated bud morphology and form
colonies that have a rough surface. To identify mutations
in genes that are involved in the control of bud growth
during mitosis, we mutagenized cells with ethylmethane sulfate to 80% lethality and screened through 80,000 colonies using a dissecting microscope to look for rough colonies. As a secondary screen, we examined the cells from
these colonies under a microscope to determine which
ones have the elongated bud morphology that is characteristic of a defect in the control of bud growth during mitosis. Since we wanted to identify mutations that affect the
pathway used by Clb2 to control bud growth, we carried
out our genetic screen in a strain carrying deletions of the
genes for the redundant cyclins CLB1, CLB3, and CLB4.
Throughout this paper we refer to this strain as a CLB2-dependent strain, or We identified 40 mutations and subjected these to backcrossing and complementation analysis. We found 6 alleles
of nap1, 12 alleles of a gene we named ecm1, for elongated
cell morphology, and 5 alleles of a gene we named ecm2.
Examples of the cellular and colony morphology observed
for the ecm1 complementation group are shown in Fig. 1.
10 of the original mutations either lost their phenotype
upon backcrossing or were judged to have a phenotype that is too weak for further characterization at this time.
Analysis of the remaining seven mutations is in progress.
We cloned the gene corresponding to the ecm1 complementation group by transforming a mutant strain with a
low copy genomic library to find plasmids that rescue the
rough colony phenotype. We identified a plasmid carrying
a genomic fragment that completely rescues the ecm1 phenotype, and found two open reading frames within the
fragment. One open reading frame encoded a protein with
homology to metabolic enzymes, whereas the other encoded a previously identified protein that causes morphological abnormalities and inhibits the growth of cells when
its COOH-terminal end is overexpressed (growth inhibitory gene 4, GIN4; these sequence data are available from
EMBL/GenBank/DDBJ under accession number D28142).
To test whether GIN4 represents the rescuing gene, we used PCR to amplify the GIN4 gene by itself, and cloned it
into a centromere-containing vector. The resulting plasmid gave complete rescue of the ecm1 mutant phenotype.
As a further test, we showed that deletion of the 5 The GIN4 gene encodes a protein of 1,143 amino acids
that has strong homology to serine/threonine protein kinases. The kinase domain of Gin4 is located within the
NH2-terminal 300 amino acids and is most homologous to
the kinase domains found in members of the SNF1 and
nim1 protein kinase families.
Gin4 Is Required for the Proper Control of Bud Growth
As a first step towards learning more about the function of
the Gin4 protein, we generated a deletion of the GIN4
gene. We were particularly interested in comparing the
phenotype of
Table I.
Summary of Elongated Bud Phenotypes
; Murray and Hunt, 1993
; Norbury and Nurse, 1992
). The cyclins appear at specific times during the cell cycle to bind and activate cyclin-dependent kinases, thereby inducing cell cycle events. Although much has been learned
about how cyclin-dependent kinases are turned on and off
during the cell cycle, we still know virtually nothing about
the mechanisms used by these kinases to induce cell cycle
events (Nigg, 1993
). This problem is of particular interest
in simple organisms like budding yeast, which uses a single
cyclin-dependent kinase called p34CDC28 to induce both interphase and mitosis. This demonstrates that the same kinase is somehow able to induce different events when activated at different times. The mechanisms that make such
specificity possible are not understood, and in no case do
we know the pathway leading from activation of a cyclin-dependent kinase to the execution of a specific cell cycle
event.
a; Kellogg and Murray, 1995
). Using this
approach, we found that members of the Nap/Set family of proteins interact specifically with mitotic cyclins in organisms as evolutionarily divergent as budding yeast and
Xenopus. Further experiments in budding yeast demonstrated that one member of this family, a protein called
Nap1, is required for the ability of the mitotic cyclin Clb2
to execute a subset of its normal mitotic activities. Without
Nap1, Clb2 is unable to properly induce mitotic events
even though it activates cyclin-dependent kinase activity to normal levels. These results indicate that Nap1 plays a
role in the induction of mitotic events by an activated cyclin-dependent kinase complex, and they provide a starting point for understanding how cyclin-dependent kinase
complexes induce specific cell cycle events.
). As the
cell enters mitosis, the Clb cyclins appear and induce a
switch from polar bud growth to isotropic growth, so that
the bud begins to grow over its entire surface. (Lew and Reed, 1993
, 1995
). Cells that lack Clb function fail to make
this switch and continue polar bud growth during mitosis,
giving rise to highly elongated buds (Amon et al., 1993
;
Lew and Reed, 1993
; Richardson et al., 1992
). Nap1 is required for the ability of Clb2 to induce this switch (Kellogg
and Murray, 1995
), demonstrating that it is an essential
part of a pathway initiated by Clb2 that controls bud
growth during mitosis.
a; Kellogg and Murray, 1995
). We also found that loss of bud growth control during mitosis causes cells to have
characteristic elongated buds and to form unusual colonies
that have a rough surface and an irregular shape. Mutations that disrupt this pathway can therefore be easily
identified simply by screening for this unusual colony morphology.
; Richardson et al., 1992
). However, analysis of cyclin function can be simplified by deleting the genes for CLB1, CLB3, and CLB4, thereby creating a strain that is completely dependent upon CLB2 for
survival. In previous studies, we used this CLB2-dependent strain background to study the role played by Nap1 in
the induction of mitotic events by Clb2 (Kellogg and Murray, 1995
). We found that the control of bud growth during
mitosis in CLB2-dependent cells occurs through Clb2 and
Nap1, whereas in wild-type cells there appear to be additional pathways that work through the other redundant
Clb cyclins (Kellogg et al., 1995
a; Lew and Reed, 1993
).
Materials and Methods
; Fitch et al., 1992
). Strain RSN31-8d was a gift from Robert Nash
(University of California, San Francisco, CA).
gin4::LEU2
nap1::LEU2
bar1
clb1
clb3::TRP1
clb4::HIS3
bar1
clb1
clb3::TRP1
clb4::HIS3
nap1::LEU2
clb1
clb3::TRP1
clb4::HIS3
bar1
gin4::LEU2
clb1
clb3::TRP1
clb4::HIS3
bar1
clb1
clb3::TRP1
clb4::HIS3
bar1
bar1 ura::gal-Clb2
176
bar1 cdc28-4
gin4::LEU2
nap1::LEU2
clb1::URA3
clb3::TRP1
clb4::HIS3
). After mutagenesis, cells
were plated on YPD media at a density of 2,000 colonies per 100-mm plate
and were grown at 30°C for 2 d before screening colonies with a dissecting
microscope.
and 3
ends of the GIN4 gene (pRA5). A linearized fragment carrying the disrupted GIN4 gene was transformed into yeast, and disruptions of the GIN4 gene were confirmed both by PCR
and by Western blotting with antibodies that recognize the COOH terminus.
). The antibodies do not recognize any proteins in extracts from strains carrying a deletion of the GIN4 gene.
-factor, whereas bar1
strains were arrested with 1 µg/ml
-factor. Arrest with
factor was generally carried out for 3-3.5 h at room temperature, with the exception of the experiment shown in Fig. 3, which was carried out for 5 h at 30°C. Cells were arrested in mitosis by incubation in 30 µg/ml benomyl for 3 h at room temperature, as previously described (Li
and Murray, 1991
). Staining of mitotic spindles was carried out as previously described (Pringle et al., 1991
).
Fig. 3.
Deletion of the GIN4 gene causes a prolonged mitotic
arrest in cells that are dependent upon Clb2 for survival. Cells
were grown overnight at 30°C until they reached an OD of 0.5 (control cells) or 0.8 (gin4,
clb1,3,4,
bar1 cells), and
-factor
was then added to 2 µg/ml at t = 0. At each time point, 1.5 ml of
culture was removed and analyzed for Clb2 levels or for the presence of mitotic spindles, as previously described (Kellogg and
Murray, 1995
; Pringle et al., 1991
). The strains used in this experiment carry deletions of the BAR1 gene to prevent them from
breaking through the
-factor arrest. (A) A plot of the percentage of cells with a mitotic spindle as a function of time after the
addition of
-factor to log phase cultures of a
gin4,
clb1,3,4,
bar1 strain and a
clb1,3,4,
bar1 control strain. The percentage
of cells with mitotic spindles was determined by counting spindles
in random fields of cells. Over 200 cells were counted for each
data point. After 3 h, the spindles began to appear unusually
thick and bent, and it became difficult to accurately count the
number of cells with spindles. (B) A Western blot showing the
amount of Clb2 present as a function of time after the addition of
-factor to log phase cultures of the same strains shown in A. (C)
Examples of the short spindles observed in the
gin4,
clb1,3,4,
bar1 strain 2 h after addition of
-factor to a log phase culture.
[View Larger Version of this Image (40K GIF file)]
a).
Briefly, Nap1 is expressed and purified from Escherichia coli as a glutathione-S-transferase fusion, and is then coupled to Affigel 10 beads (Bio
Rad Laboratories, Hercules, CA) to make an affinity column matrix. An
extract is made from 7.5 g of log phase JB811 protease-deficient cells in
extract buffer (50 mM K+-Hepes, pH 7.6, 275 mM KCl, 1 mM MgCl2, 1 mM
EGTA, 0.15% Tween-20, 1 mM PMSF, 1 mM leupeptin, 1 mM chymostatin, 1 mM pepstatin, 1 mM DTT). The cells are broken open by extensive
grinding under liquid nitrogen using a mortar and pestle. The crude extract is centrifuged at 20,000 g for 10 min, followed by 100,000 g for 90 min. The supernatant from the first spin is labeled "LS Supernatant" in
Fig. 5, and the supernatant from the second spin is labeled "HS Supernatant". The final supernatant is first passed through a 5-ml precolumn filter
made by coupling BSA to Affigel 10, and the flowthrough from the precolumn is loaded directly onto a 2-ml affinity column containing 6 mg of
Nap1. After loading, the column is washed with 30 ml of extract buffer
containing 10% glycerol, 0.05% Tween-20, and no PMSF. The column is
eluted with a salt gradient going from 0.3 M to 1.0 M KCl. The gradient is
made by pipetting 400-µl aliquots of elution buffer onto the top of the column, with each aliquot increasing in KCl concentration by 50 mM. During
elution, 400-µl fractions are collected. The fractions are concentrated by
TCA precipitation, resuspended in 1× protein gel sample buffer, and 1/10
of each fraction is loaded onto each lane of an SDS-polyacrylamide gel.
Fig. 5.
Affinity purification of
Nap1-binding proteins. (A) Crude
extracts from log phase yeast cells
were loaded onto a Nap1 affinity column. After washing with
buffer, the column was eluted
with a gradient of KCl, and samples from each fraction were precipitated with TCA and loaded
onto a 12.5% SDS-polyacrylamide gel. The first few fractions
before the start of the salt gradient show the final fractions of the
wash. The gel is stained with Coomassie blue. (B) The same fractions shown in A were loaded
onto a 10% SDS-polyacrylamide gel and transferred to nitrocellulose, which was then probed with an anti-Gin4 antibody. For the affinity column elution fractions we
loaded 1/10 the amount of protein that was loaded onto the gel
shown in A.
[View Larger Version of this Image (58K GIF file)]
b). 1.5-liter cultures of strains DK186 and RA4
are grown to an OD of 0.7 and the cells are pelleted and frozen on liquid
nitrogen. The cells are then broken open by extensive grinding under liquid
nitrogen as previously described (Kellogg et al., 1995
a), and approximately 0.3-g aliquots of the frozen cell powder are stored at
80°C. To
make a cell extract, 400 µl of IP buffer (50 mM K+-Hepes, pH 7.6, 400 mM NaCl, 1 mM EGTA, 1 mM MgCl2, 0.1% Tween-20, 2 µg/ml leupeptin, 2 µg/ml pepstatin, 2 µg/ml chymostatin, 2 mM PMSF, 10% glycerol) is
added to an aliquot of cells from each strain. After a 5-min incubation on
ice, the extract is centrifuged for 10 min in a microfuge at 4°C, and 450 µl
of the supernatant from each strain is added to a tube containing 40-50 µl
of anti-Gin4 beads. The tubes are gently mixed end over end at 4°C for
1.5 h, and the beads are then washed three times with 500 µl of IP buffer. At the end of these washes, the beads from each strain are equally split
into two new tubes, and one set of tubes from each strain is washed three
more times with IP buffer, while the other set is washed in IP buffer containing 1.0 M NaCl. At the end of the washes, 100 µl of 1× protein gel
sample buffer is added to each tube and the tubes are placed in a boiling
water bath for 5 min to release proteins from the beads. For Western
blots, 10 µl of each sample are loaded onto a 10% SDS-polyacrylamide gel.
). A PCR primer was made that incorporates this BamHI site and
changes the conserved lysine to an alanine (AATGGATCCACAGGACAAGAGGCGGCAGTTGCGGTAATATCAAAAGCAG). A second
primer was made that includes a HpaI site that occurs 683 bases downstream of the BamHI site, and these two primers were used to amplify a
fragment that carries the kinase domain mutation, which was then used to
replace the wild-type fragment in pDK46 to create pDK49. This plasmid
was cut with HpaI to target integration at GIN4 in strains DK186 or
DK166, creating a duplication of the GIN4 gene, with one mutant copy
and one wild-type copy. Recombination events between these two copies
were selected by plating cells on 5-fluoroorotic acid, and events that leave
the kinase domain mutation in the genome were identified by looking for
the altered cellular morphology characteristic of mutant gin4 strains. The
phenotype of the gin4K48A,
clb1,3,4 mutation is not quite as severe as the
gin4,
clb1,3,4 phenotype, perhaps because of the presence of residual kinase activity.
-Factor is added to 1 µg/ml, and the cells are
incubated at room temperature for 4 h. The
-factor is removed by washing the cells once with 500 ml of YPD media prewarmed to 30°C, followed
by two washes with 50 ml of prewarmed media. At each time point after
release from arrest, 50 ml of culture is removed and the cells are pelleted at 3,000 rpm for 2 min. The cells are resuspended in 1 ml YPD, transferred
to a 1.8-ml screw-top tube, and then pelleted by centrifugation for 1 min in
a microfuge. After removal of the supernatant, the tube containing the
cell pellet is frozen in liquid nitrogen. To each tube containing frozen cells,
500 µl of acid-washed glass beads (0.5 mm diam; Biospec Products, Inc.,
Bartlesville, OK) is added, followed by 300 µl of ice-cold Lysis Buffer (50 mM K+-Hepes, pH 7.6, 1M NaCl, 1 mM EGTA, 1 mM MgCl2, 0.1%
Tween-20, 2 µg/ml leupeptin, 2 µg/ml pepstatin, 2 µg/ml chymotrypsin,
2 mM PMSF, 10% glycerol), and the tubes are immediately placed in a
Biospec Multibeater-8 and beaten at top speed for 25 s. The tubes are removed and cooled in an ice water bath before a 5-min spin in a microfuge.
300 µl of supernatant is removed and replaced with 200 µl of fresh buffer
and the tubes are beaten again for 25 s. The supernatants are pooled and
centrifuged again for 5 min. 25 µl is removed from each sample and used
for Clb2-associated kinase assays as previously described (Kellogg and
Murray, 1995
).
32P]ATP, 50 µg/ml histone H1, 2 µg/ml
leupeptin, 2 µg/ml pepstatin, 2 µg/ml chymotrypsin). The tubes are vortexed gently and incubated at 30°C for 30 min, with gentle mixing every
10 min. The reaction is stopped by the addition of 10 µl of 4× protein gel
sample buffer, and 10 µl is loaded onto each lane of a 15% SDS-polyacrylamide gel. For Western blotting, 10 µl of the lysate used for immunoprecipitation is diluted into 90 µl of 1× sample buffer and incubated in a
boiling water bath for 3 min, and 10 µl of each sample is loaded onto an
SDS-polyacrylamide gel. The assays shown in Figs. 7 and 9 were carried
out the same as above, except that we used cells arrested either in mitosis
with benomyl, or in interphase with
-factor.
Fig. 7.
Gin4 from mitotic
cells phosphorylates histone
H1 and undergoes autophosphorylation in vitro. (A)
Cells from the indicated strains were arrested in G1
with -factor or in mitosis
with benomyl. Extracts were
then made from the arrested
cells and Gin4 was immunoprecipitated and assayed for
kinase activity using histone
H1 as a substrate. (B) A control showing that the kinase
activity present in Gin4 immunoprecipitates is not due
to Cdc28. Wild-type or
cdc28-4 cells were grown at
22°C and arrested in mitosis
with benomyl. Gin4 was then
immunoprecipitated from
the arrested cells and kinase activity was measured either
at 22°C or 37°C.
[View Larger Version of this Image (35K GIF file)]
Fig. 9.
The kinase activity
of Gin4 is activated by phosphorylation. (A) The Gin4
protein was immunoprecipitated from mitotic cells and
then split into two samples.
One sample was treated with
lambda phosphatase (New
England Biolabs Inc.), while
the other sample was treated
identically, but with no
added phosphatase. The precipitated protein was then resolved on a 9% SDS-polyacrylamide gel and detected by Western blotting. (B) The Gin4 protein was immunoprecipitated and
treated with lambda phosphatase as in A. The immunoprecipitate was then washed with kinase buffer several times and assayed for kinase activity.
[View Larger Version of this Image (57K GIF file)]
176 in Interphase Cells
176 in cells arrested in interphase, a 30-ml
culture of strain DK247 is grown overnight to an OD of 0.65 in yeast extract peptone (YEP) media containing 2% raffinose. The cells are arrested in interphase by the addition of 1.5 µg/ml
-factor followed by incubation at 30°C for 3 h. The culture is divided in half, and the cells are
pelleted and resuspended in the same volume of YEP media containing
1.5 µg/ml
-factor and either galactose or raffinose. At each time point after addition of galactose, 1.6-ml samples of each culture are taken and
probed for the Gin4 protein by Western blotting, as described below.
; Harlow and Lane, 1988
). For the experiments
shown in Figs. 3, 10, and 11, 1.6-ml samples of culture are taken at each of
the indicated time points. The cells are then rapidly pelleted in a 1.8-ml
screw-top tube, the supernatant is removed, and the tube is frozen on liquid nitrogen. After all of the samples have been collected, 300 µl of glass
beads are added to each tube, followed by 125 µl of 1× protein gel sample buffer containing 2 mM PMSF, 2 µg/ml leupeptin, 2 µg/ml pepstatin, 2 µg/ml
chymotrypsin. The tubes are immediately placed in a Biospec Multibeater-8 and beaten at top speed for 90 s, centrifuged briefly, and immediately incubated in a boiling water bath for 5 min. After centrifugation in a
microfuge for 3 min, 10 µl of each sample is loaded onto gels for Western
blotting. To see the phosphorylation-induced shift in the electrophoretic
mobility of Gin4, samples are electrophoresed for 2.5 h at 170 V on 9%
SDS-polyacrylamide gels.
Fig. 10.
The Gin4 protein appears to undergo autophosphorylation in vivo. gin4K48A, clb1,3,4 cells and
clb1,3,4 control cells were
released from an
-factor arrest, and samples were taken at the
indicated time points and probed for the Gin4 protein by Western blotting.
[View Larger Version of this Image (35K GIF file)]
Fig. 11.
Expression of
Clb2 in cells arrested in interphase leads to phosphorylation of Gin4. A bar1 strain
carrying an integrated copy
of Clb2176 under the control
of the gal1 promoter was grown in raffinose and arrested in interphase by incubation in the presence of
-factor for 3 h. The culture was then divided in half, and Clb2
176 expression was induced in one half by transferring the cells to media containing
galactose and
-factor. At the times indicated, samples were
taken from each culture and used for an anti-Gin4 Western blot.
[View Larger Version of this Image (42K GIF file)]
Fig. 1.
An example of the cellular morphology observed for
the ecm1 complementation group.
[View Larger Version of this Image (101K GIF file)]
Results
clb1,3,4.
end of
the GIN4 gene completely eliminated the ability of this
plasmid to rescue the ecm1 phenotype. To demonstrate that the GIN4 gene actually corresponds to ecm1, we integrated a marker near the GIN4 gene and showed that it
segregated with the ecm1 mutation in 32 spores. Finally,
we found that deletion of the GIN4 gene causes a phenotype that is indistinguishable from the phenotype of the
original ecm1 mutant alleles (see below).
gin4 cells with the phenotype of
nap1 cells
as a means of determining whether these two proteins are
involved in similar functions within the cell. An important
aspect of the
nap1 phenotype is that it is most severe in
cells that are dependent upon CLB2 for survival (Kellogg
et al., 1995
a). To determine whether the same is true for
GIN4, we deleted the GIN4 gene in a diploid strain heterozygous for deletions of the CLB1, CLB3, and CLB4
genes. Sporulation of this diploid generated all possible
haploid combinations of the GIN4 deletion and the CLB
deletions. We found that deletion of the GIN4 gene in a
wild-type background causes a mild elongated bud phenotype and some cell clumping, although colonies form at a
normal rate and have a smooth appearance (Fig. 2 B). This
is similar to the phenotype seen for a NAP1 deletion in a
wild-type background (Kellogg et al., 1995
a). Deletion of
the GIN4 gene in a CLB2-dependent background (
gin4,
clb1,3,4) causes a severe phenotype that is indistinguishable from the phenotype of the original ecm1 mutant alleles that we identified in our genetic screen (Fig. 2 C).
The cells grow as large interconnected clumps and have a
highly elongated bud morphology that is identical to the
morphology observed for a NAP1 deletion in the same genetic background (Fig. 2 D). The phenotype of the
gin4,
clb1,3,4 strain is also similar to the
nap1,
clb1,3,4 strain in
that the cells grow very slowly at 30°C, and wild-type copies of CLB1 or CLB3 partially rescue the elongated bud
phenotype, whereas wild-type CLB4 has no effect. The
bud growth phenotypes of the strains described above are
summarized in Table I.
Fig. 2.
Deletion of the GIN4 gene causes cells to have an elongated bud morphology. Cells were grown to log phase in YPD liquid
media at 30°C, and were photographed using a ×100 objective with Nomarski optics. The genotype of each strain is indicated above
each picture.
[View Larger Version of this Image (111K GIF file)]
These results demonstrate that both Gin4 and Nap1 are required for the repression of polar bud growth. Since the loss of either Gin4 or Nap1 in the Clb2-dependent background can be largely rescued by the presence of the other mitotic Clb cyclins, we can argue that Gin4 and Nap1 are mediating the functions of Clb2. This result also argues that the other Clbs are able to control bud growth through alternative pathways. We found that deletion of the genes for both NAP1 and GIN4 in a CLB2-dependent background causes a phenotype that is no different from either single deletion, further arguing that Gin4 and Nap1 work together. However, deletion of the genes for both NAP1 and GIN4 in a wild-type background causes an elongated bud phenotype that is more severe than either single deletion (see Table I). This result argues that Clb2 may not be the only mitotic cyclin that exerts its effects through Gin4 and Nap1. For example, the other Clb cyclins might control bud growth through alternative pathways that also work through Gin4 or Nap1. In this case, deletion of the genes for both GIN4 and NAP1 in a wild-type background could affect the function of more than one pathway.
gin4,
clb1,3,4 Cells Undergo a Prolonged
Mitotic Delay
To further test whether or not Gin4 and Nap1 are involved
in similar functions, we determined whether gin4,
clb1,3,4
cells undergo a mitotic delay in a manner similar to
nap1,
clb1,3,4 cells. In our previous studies we found that
nap1,
clb1,3,4 cells proceed through the cell cycle normally until
they enter mitosis, at which point they undergo a prolonged delay at the short spindle stage with high Clb2 protein levels (Kellogg and Murray, 1995
). To determine
whether
gin4,
clb1,3,4 cells undergo a similar mitotic delay, we attempted to use
-factor to synchronize cells in
G1. However, we found that even after 5 h in the presence
of
-factor, many
gin4,
clb1,3,4 cells still have mitotic
spindles and the Clb2 protein is still present, suggesting
that cells are arrested in mitosis. This was true even in
strains carrying a deletion of the BAR1 gene to prevent cells from breaking through the
-factor arrest. To study
this mitotic arrest more carefully, we added
-factor to log
phase cultures of
gin4,
clb1,3,4,
bar1 cells, and to
clb1,3,4,
bar1 control cells, and then carried out assays
every 30 min to measure Clb2 protein levels and the fraction of cells with a mitotic spindle (Figs. 3, A and B). After
90 min of exposure to
-factor, the control cells become
synchronously arrested in G1 with no spindles and no Clb2
protein, as expected. In contrast, the Clb2 protein levels in
gin4,
clb1,3,4,
bar1 cells do not start to fall until 30-60
min after the control strain, and then remain nearly constant for the remainder of the 5-h time course. Similarly,
the fraction of cells with mitotic spindles does not start to
fall until 30-60 min after the control strain, and a significant number of cells still have spindles after 3 h. These results suggest that some of the cells are able to exit mitosis
after a delay of 30-60 min, while other cells are unable to
exit mitosis even after 5 h. The majority of the cells appear
to be arrested at the short spindle stage, which is the same
stage at which
nap1,
clb1,3,4 cells arrest (Fig. 3 C; and
Kellogg and Murray, 1995
). Many of the cells in the
gin4,
clb1,3,4 strain have a dark and condensed appearance,
suggesting that they are dead, which may be a consequence of the prolonged mitotic arrest. These observations are likely to explain the extremely slow growth rate
of the
gin4,
clb1,3,4 cells.
Gin4 Is Not Required for the Activation of Cyclin-dependent Kinase Activity by Clb2
The previous experiments demonstrate that Gin4 is required for the ability of Clb2 to promote normal mitotic
progression. A possible explanation for these results is
that Gin4 is required for the formation of active Clb2/
p34CDC28 kinase complexes. In the case of Nap1, we were
able to rule out this possibility by assaying the kinase activity of Clb2/p34CDC28 kinase complexes during the cell
cycle in nap1 cells (Kellogg and Murray, 1995
). To determine whether the same is true for Gin4, we assayed the activity of Clb2/p34CDC28 kinase complexes during the cell
cycle in
gin4 cells. We found that Clb2-associated kinase
activity rises to normal levels during mitosis in
gin4 cells,
and that the kinase activity peaks 10 min later than in the
control cells (Fig. 4). These results are similar to those obtained for
nap1 cells (Kellogg and Murray, 1995
). We
were unable to obtain clean results when we carried out
the same experiment in
gin4,
clb1,3,4 cells, due to the fact
that this strain cannot be completely synchronized with
-factor (Fig. 3). However, the results that we were able to
obtain using partially synchronized cultures agreed with
the results obtained using the
gin4 cells (not shown).
Therefore, neither Nap1 nor Gin4 are required for activation of cyclin-dependent kinase activity by Clb2. The delay
in the activation of kinase activity may be due to a defect
in the pathway used by the cyclin-dependent kinase complex to stimulate its own activation (King et al., 1994
).
Gin4 Binds to Nap1
The experiments described above demonstrate that the
GIN4 deletion and the NAP1 deletion have nearly identical phenotypes. These results provide strong support for
the idea that Gin4 and Nap1 are involved in similar functions within the cell. Nap1 affinity chromatography experiments provide additional support for a close functional interaction between Gin4 and Nap1. For these experiments, we obtain purified Nap1 using an E. coli expression system, and then couple the Nap1 to a column matrix. Crude
extracts from log phase yeast cells are loaded onto the affinity column, which is then washed with buffer and eluted
with a gradient of 0.35-1 M KCl. We find that a number of
different proteins bind to Nap1 (Fig. 5 A). These results
are striking because the crude cell extract is made in a buffer that contains 0.275 M salt, and the column is washed
with 15 column volumes of buffer containing the same salt
concentration. The fact that many proteins remain bound to the column under these stringent wash conditions suggests that they bind to Nap1 with relatively high affinity,
and are likely to represent specific interactions. For the
present, however, we have focused our attention on the
proteins that elute from Nap1 with 0.8-1.0 M KCl, since
these are the most tightly bound and are therefore the
most likely to be directly involved in Nap1 function. We
noticed that one of these proteins is approximately the size
that would be predicted for Gin4 (Fig. 5 A, arrow). The sequence of a tryptic peptide obtained from this protein
identified it as Gin4, and Western blotting with anti-Gin4
antibodies provided further confirmation that it is the
Gin4 protein (Fig. 5 B). Note that the Gin4 protein is
quantitatively depleted from the extract as it passes over
the Nap1 affinity column, suggesting a tight and specific
interaction between Nap1 and Gin4. We also carried out
immunoprecipitation experiments using anti-Gin4 antibodies to demonstrate that the endogenous Nap1 protein
coprecipitates with the endogenous Gin4 protein in crude
extracts (Fig. 6). We found that the interaction between
Gin4 and Nap1 in crude extracts is stable to repeated
washes with 0.4 M NaCl, and is disrupted by 1.0 M NaCl,
as expected from the affinity column results. These results
demonstrate that Gin4 binds to Nap1 with high affinity, and that these two proteins are likely to function together
within the cell as a protein complex.
In Western blotting experiments, we are unable to detect Clb2 in the fractions that elute from the Nap1 affinity
column. This is not surprising, however, since in previous
experiments we found that Nap1 can be quantitatively
eluted from a Clb2 affinity column with 0.35 M salt (Kellogg et al., 1995a). In these experiments, the Nap1 affinity
column is washed with 15 column volumes of buffer containing 0.275 M salt before elution, which would be likely to wash off the Clb2 protein.
Nap1-dependent Activation of Gin4
The phenotype of gin4 cells and the fact that Gin4 binds
tightly to Nap1 both suggest that Gin4 functions during
mitosis, and that Nap1 and Gin4 are involved in similar
functions. To learn more about when Gin4 functions, we
developed an assay that would allow us to follow the kinase activity of Gin4 during the cell cycle. We immunoprecipitated Gin4 from cells arrested in interphase or mitosis,
and then assayed the precipitated Gin4 for kinase activity
using histone H1, myelin basic protein, or casein as test
substrates (Fig. 7 A). We found that Gin4 from mitotic
cells is able to phosphorylate histone H1, while Gin4 from
interphase cells has little detectable kinase activity. Gin4 is
also able to phosphorylate myelin basic protein (not shown).
As controls, we carried out identical assays using mitotic
extracts from cells that carry either a deletion of the GIN4
gene, or a point mutation in the Gin4 kinase domain
(lysine 48 changed to alanine). Neither of these controls
show any histone H1 kinase activity (Fig. 7 A). In addition
to phosphorylation of histone H1 in these assays, we also
detect phosphorylation of a protein that is the same size as
Gin4. Phosphorylation of this protein is not detected in
gin4 or in gin4K48A cells, suggesting that it is the Gin4
protein and that Gin4 is capable of undergoing autophosphorylation.
Since Nap1 is able to interact with Gin4 and Clb2, it is
important to demonstrate that the kinase activity we observe in this assay is not due to Clb2/p34CDC28 kinase complexes that might coprecipitate with the Gin4 protein. The
fact that no kinase activity is observed for the gin4K48A
mutant argues strongly against this possibility. Control experiments demonstrate that the gin4K48A mutant protein is
expressed at normal levels (Fig. 10, bottom) and is immunoprecipitated by the anti-Gin4 antibody (not shown). In
addition, the immunoprecipitates used for these kinase assays are washed repeatedly with buffer containing detergent and 1M NaCl, which should wash off proteins that associate with Gin4. Indeed, neither Clb2 nor Nap1 can be
detected in the Gin4 immunoprecipitates by Western blotting. (Note that the immunoprecipitation protocol used to
detect an interaction between Nap1 and Gin4 shown in
Fig. 6 uses a lower concentration of salt in the wash
buffer.) Even when Gin4 immunoprecipitations are carried out at physiological salt concentrations we are unable
to detect Clb2, and we suspect that Clb2 and Gin4 do not
associate with Nap1 at the same time within the cell. In our
previous work with Clb2 affinity columns, we found that
Clb2 binds Nap1 but not Gin4 (Kellogg et al., 1995a). This
result supports the idea that Clb2 and Gin4 are not found in the same complex, and it suggests that Clb2 can only
bind to Nap1 that is not complexed with Gin4. As an additional precaution, we immunoprecipitated Gin4 from a
strain that carries the cdc28-4 temperature-sensitive allele
of CDC28. Previous experiments have demonstrated that
this allele produces a Cdc28 protein that is temperature
sensitive in vitro (Ghiara et al., 1991
). When we assayed
the kinase activity of Gin4 immunoprecipitates at the restrictive temperature for cdc28-4, we observed no difference in kinase activity relative to a control strain, demonstrating that the kinase activity we observe is not due to
Cdc28 (Fig. 7 B). Finally, in recent experiments we have
found that fusion proteins purified from bacteria that contain the Gin4 kinase domain are able to phosphorylate histone H1 in vitro, demonstrating that Gin4 has the capacity
to phosphorylate histone H1 (not shown).
We next used the phosphorylation of histone H1 as an
assay to follow Gin4-associated kinase activity during the
cell cycle. We arrested cells in G1 with -factor, and then
removed the
-factor and took samples every 10 min as
the cells proceeded synchronously through the cell cycle.
At each time point, we assayed Gin4-associated kinase activity, Clb2 protein levels, and Clb2-associated kinase activity
(Fig. 8 A). We found that Gin4-associated kinase activity peaks during mitosis, and in multiple independent experiments we always observe that the peak of Gin4 kinase activity occurs slightly later than the peak of Clb2-associated
kinase activity (Fig. 8 B). We also found that the putative
autophosphorylation of Gin4 peaks at the same time as
the kinase activity of Gin4.
Since Gin4 binds tightly to Nap1, and these two proteins
appear to be involved in the same activities, we next sought
to determine whether Nap1 is required for activation of the
Gin4 kinase. To do this, we assayed Gin4-associated kinase activity during the cell cycle in nap1,
clb1,3,4 cells.
We found that there is a low level of Gin4-associated kinase activity in these cells that undergoes relatively little change during the cell cycle, demonstrating that Nap1 is
required for the proper regulation of Gin4-associated kinase activity (Fig. 8 A). Interestingly, it appears that there
is a low but significant level of Gin4 kinase activity during
interphase in the
nap1,
clb1,3,4 cells (compare the kinase
activity at the zero time points for the two different strains
in Fig. 8 A). This observation suggests that Nap1 might be
required both for the activation of Gin4 during mitosis,
and for the efficient inactivation of Gin4 during interphase.
Nap1-dependent Phosphorylation of Gin4
We next addressed the mechanism by which Gin4 is activated during mitosis. Western blotting experiments reveal that the Gin4 protein in cells arrested in mitosis has a slower electrophoretic mobility than Gin4 from interphase cells, suggesting that Gin4 undergoes posttranslational modification during mitosis. Treatment of Gin4 immunoprecipitated from mitotic cells with phosphatase causes it to shift to the same electrophoretic mobility as Gin4 from interphase cells, demonstrating that Gin4 in mitotic cells is phosphorylated (Fig. 9 A). To determine the timing of Gin4 phosphorylation, we used Western blotting to follow the phosphorylation of Gin4 during the cell cycle in the same samples we used to follow the activation of Gin4 kinase activity in Fig. 8. We found that Gin4 phosphorylation occurs in parallel with the appearance of Gin4-associated kinase activity, and that phosphorylation of Gin4 is completely dependent upon the presence of Nap1 (Fig. 8 D).
In multiple experiments, we always observed that the time point that shows maximal phosphorylation of Gin4 occurs concurrently with the peak of Gin4 kinase activity (120-min time point in Fig. 8). This observation suggested that the kinase activity of Gin4 is activated during mitosis by phosphorylation. To confirm this, we immunoprecipitated Gin4 from cells arrested in mitosis, treated the Gin4 with phosphatase, and then assayed its kinase activity. We found that dephosphorylation of Gin4 from mitotic cells causes nearly a complete loss of Gin4 kinase activity (Fig. 9 B). The dephosphorylated Gin4 appears to be capable of undergoing autophosphorylation, but this result should be treated with caution. If a small fraction of the Gin4 protein is not completely dephosphorylated or inactivated by the phosphatase treatment, it would be likely to undergo autophosphorylation. This would give a deceptively strong signal relative to the phosphorylation of histone H1 because intramolecular phosphorylation will be more efficient than the intermolecular phosphorylation.
Gin4 Autophosphorylation
The Gin4 kinase assays shown in Figs. 7 and 8 suggest that
Gin4 is capable of undergoing autophosphorylation. To
test whether this is the case, we synchronized the gin4K48A
strain with -factor and then assayed phosphorylation of
the mutant Gin4 protein during the cell cycle by Western
blotting. We found that Gin4 with an inactive kinase domain completely fails to undergo mitotic phosphorylation,
supporting the idea that autophosphorylation is occurring
(Fig. 10). We obtain the same result in both a wild-type background and in the Clb2-dependent background.
Phosphorylation of Gin4 Is Induced by Clb2
Since Nap1 interacts with Clb2 and Gin4, and both Nap1
and Gin4 are required for the proper control of mitotic
events by Clb2, one would predict that the phosphorylation and activation of Gin4 are also mediated by Clb2. To
directly test whether this is true, we expressed the Clb2
protein in cells arrested in interphase and then used Western blotting to determine whether Gin4 is phosphorylated. For these experiments, we used a version of Clb2 that has
a deletion of the first 176 amino acids (called Clb2176),
which removes the cyclin destruction box that normally
prevents accumulation of mitotic cyclins during interphase. A bar1 strain carrying clb2
176 under the control of
the gal1 promotor (gift of Adam Rudner, University of
California, San Francisco, CA) was arrested in interphase by treatment with
-factor. The arrested cells were then
divided into two equal cultures and galactose was added to
one to induce expression of clb2
176 in the continued presence of
-factor. We found that expression of clb2
176 in
cells arrested in interphase rapidly led to hyperphosphorylation of Gin4 (Fig. 11). Expression of clb2
176 during interphase did not, however, induce bud emergence, as reported previously (Amon et al., 1994
).
It has been known for a number of years that entry into
mitosis is induced by the activation of a cyclin-dependent
kinase by B-type cyclins. Yet we still know almost nothing
about how B-type cyclins and cyclin-dependent kinases
induce the actual events of mitosis. It remains unclear,
for example, whether cyclin-dependent kinases initiate signaling pathways that lead to the activation of many other
kinases during mitosis, or whether they function more directly to phosphorylate the proteins involved in the execution of mitotic events (Nigg, 1993). It is also unclear how
the specificity of cyclin-dependent kinases is controlled,
since simple organisms like budding yeast are somehow
able to use the same cyclin-dependent kinase to induce
completely different events during mitosis and interphase.
The pathway used by Clb2 to control bud growth during
mitosis provides an excellent model system for understanding how cyclins and cyclin-dependent kinases control
mitotic events. The function of this pathway is not required for viability, and mutations that disrupt the pathway can be easily identified because they give rise to both
an unusual cell morphology and an unusual colony morphology. We have now identified two proteins that function in this pathwayNap1 and Gin4. Nap1 was identified
in a previous study in which we used affinity chromatography to identify proteins that bind specifically to Clb2 (Kellogg et al., 1995
a), while Gin4 was identified in the present
study using a genetic screen for mutations that disrupt the
control of bud growth during mitosis. We have also identified Gin4 biochemically as a protein that binds tightly to
Nap1 in affinity chromatography experiments.
Gin4, Nap1, and Clb2 Function Together in the Control of Mitotic Events
A number of different experimental approaches demonstrate that Gin4, Nap1, and Clb2 work together in the control of mitotic events. First, the phenotypes caused by
deletion of the GIN4 gene or the NAP1 gene are nearly indistinguishable, consistent with these two proteins being
involved in carrying out similar functions. Second, loss of
Gin4 or Nap1 function in cells that are dependent upon
Clb2 causes a prolonged mitotic delay, consistent with these three proteins being required for the proper execution of
mitotic events. Third, loss of Gin4, Nap1, or Clb2 function
in cells that are dependent upon Clb2 causes the formation
of highly elongated buds, demonstrating that all three of
these proteins function in the switch from polar to isotropic bud growth that normally occurs during mitosis (Kellogg et al., 1995a; Kellogg and Murray, 1995
; Lew and Reed,
1995
; Lew and Reed, 1993
). Fourth, biochemical experiments demonstrate that Gin4 and Clb2 interact directly with Nap1, indicating that the functions of these three proteins
must be closely tied (Kellogg et al., 1995
a). Fifth, the Gin4
kinase is phosphorylated and activated during mitosis, consistent with a mitotic role for Gin4. Sixth, Nap1 is required
in vivo for the phosphorylation and activation of Gin4 during mitosis, demonstrating functional interaction between
these two proteins in vivo. Finally, expression of Clb2 in
cells arrested in interphase leads to the phosphorylation of
Gin4, indicating that Gin4 phosphorylation occurs in response to Clb2 activity.
Loss of Gin4 Function in Clb2-dependent Cells Causes a Prolonged Mitotic Delay
In cells that are dependent upon CLB2 for survival, deletion of either the GIN4 gene or the NAP1 gene causes a
prolonged mitotic delay at the short spindle stage. The mitotic delay observed for the GIN4 deletion is more severe,
since many of the cells appear to be permanently arrested
in mitosis and eventually die. The primary cause of this mitotic arrest is unknown. One possible explanation is that
the cells fail to execute specific mitotic events, leading to
the activation of checkpoint controls that delay the cells in
mitosis until the completion of these events. Previous studies have demonstrated the existence of checkpoint controls that delay the cell cycle in response to spindle defects (Li and Nicklas, 1995; Murray, 1995
; Rieder et al., 1994
), and the fact that the mutant cells arrest with a short spindle
suggests that they are defective in some aspect of spindle
assembly or function. We have found that
nap1 and
gin4
cells are both resistant to conditions that destabilize microtubules, suggesting that Nap1 and Gin4 may play a role
in regulating microtubule stability (Kellogg and Murray,
1995
; and data not shown). A failure to properly control microtubule stability could cause a mitotic spindle defect
and lead to activation of a spindle assembly checkpoint. A
number of genes have been identified that are required for
a spindle assembly checkpoint in yeast (Hoyt et al., 1991
;
Li and Murray, 1991
), but we have not yet been able to
test whether these genes are required for the mitotic delay
seen in
gin4,
clb1,3,4 cells or in
nap1,
clb1,3,4 cells, since
at least some of these checkpoint genes are synthetically lethal with a
clb3,
clb4 double deletion (Kellogg, D.,
unpublished data). Interestingly, we observe that cells arrested by benomyl at the mitotic spindle assembly checkpoint have fully phosphorylated and activated Gin4 (Figs. 7
and 9). This suggests that the spindle assembly checkpoint
must be arresting mitotic events at a point after the activation
of Gin4. Further analysis of this kind on other components of
mitotic control pathways may help define where checkpoint
controls are acting to arrest the cell cycle in mitosis.
Another possible explanation for the mitotic arrest is
that Gin4 and Nap1 play a role in the pathway that triggers
the destruction of Clb2 and the exit from mitosis. When
cyclins induce entry into mitosis they initiate a series of
events that culminates in the activation of the cyclin destruction machinery and the exit from mitosis (King et al.,
1994, 1995
). A number of experiments suggest that, in
addition to destroying the cyclins, the cyclin destruction machinery may also function to induce chromosome separation by destroying proteins involved in holding sister
chromosomes together (Holloway et al., 1993
; Irniger et al.,
1995
). Interestingly, defects in the cyclin destruction machinery cause yeast cells to arrest with short spindles and
unseparated chromosomes (Heichman and Roberts, 1996
;
Irniger et al., 1995
). We know virtually nothing about the
pathway that leads to activation of the cyclin destruction machinery, and it is possible that Gin4 and Nap1 function
in this pathway. However, a role for Nap1 and Gin4 in the
activation of cyclin destruction cannot explain the loss of
bud growth control caused by deletion of these genes, indicating that Gin4 and Nap1 would have to be involved in
several mitotic control pathways.
Mitosis-specific Phosphorylation and Activation of the Gin4 Kinase
Our results demonstrate that the Gin4 kinase is activated and phosphorylated during mitosis in a manner that is dependent upon Clb2 and Nap1. In addition, we found that a mutant version of Gin4 with an inactive kinase domain is not phosphorylated during mitosis, suggesting that the phosphorylation of Gin4 is due to autophosphorylation.
How is the Gin4 kinase phosphorylated and activated
during mitosis? The results that we have obtained thus far
suggest that Clb2 and Nap1 somehow work to activate Gin4
autophosphorylation. There are several models that might
explain the requirement for Nap1 in the phosphorylation
of Gin4. In previous studies, we found that purified Xenopus Nap1 can be phosphorylated by cyclin-dependent kinase
complexes that contain cyclin B, but not by complexes that contain cyclin A (Kellogg et al., 1995a). This result suggests that Nap1 is only phosphorylated during mitosis
when B-type cyclins are present. Once phosphorylated,
Nap1 could then stimulate Gin4 autophosphorylation. In
this model, the specific induction of certain mitotic events
by Clb2 would be due entirely to the ability of Clb2 to
form a cyclin-dependent kinase complex that can phosphorylate Nap1. A problem with this model is that we
have not yet been able to reconstitute phosphorylation of
yeast Nap1 in vitro to recapitulate the results that we obtained using Xenopus proteins, but this may be due to
technical differences between the two systems.
Another possible model for activation of Gin4 is that Nap1 functions as part of a mechanism that targets Gin4 for phosphorylation by the Clb2 cyclin-dependent kinase complex. The initial phosphorylation of Gin4 might then stimulate Gin4 autophosphorylation and lead to full phosphorylation and activation of the Gin4 kinase. A third model postulates that Gin4 autophosphorylation is activated simply by binding to both Nap1 and the Clb2 cyclin-dependent kinase complex, in a manner analogous to the activation of cyclin-dependent kinases by binding of cyclins. A problem with this kind of model is that we have thus far been unable to detect Clb2 in Gin4 immunoprecipitates, suggesting that these two proteins may not exist in the same complex within the cell.
The Induction of Cell Cycle Events and the Kinase Specificity Problem
Gin4 is able to phosphorylate both histone H1 and myelin
basic protein in vitro, which means that its substrate specificity overlaps with the specificity of cyclin-dependent kinases and MAP kinases (Nigg, 1993; Peter et al., 1992
).
Since all of these kinases are known to be activated during
mitosis (Gotoh et al., 1991
; Heider et al., 1994
; Minshull et al.,
1994
), this result emphasizes the importance of exercising
caution when interpreting the results of kinase assays carried out in vitro. Many proteins have been identified that
can be phosphorylated by cyclin-dependent kinases in
vitro, but the increasing number of kinases with substrate specificities that overlap with cyclin-dependent kinases
makes it difficult to conclude whether these proteins are
genuinely phosphorylated by cyclin-dependent kinases in
vivo. It is therefore difficult to use in vitro phosphorylation
assays to study the pathways used by cyclin-dependent kinases to induce cell cycle events unless one has independent means of verifying that proteins are phosphorylated
by cyclin-dependent kinases in vivo.
Understanding the Specificity of Cyclin-dependent Kinase Complexes
We found that expression of Clb2 in cells arrested in interphase can induce the phosphorylation of Gin4 at an inappropriate time during the cell cycle. Although expression
of Clb2 in interphase cells can induce the phosphorylation
of Gin4, it cannot induce bud emergence, which is normally induced by the G1 cyclins during interphase (Amon
et al., 1994; Lew and Reed, 1995
). Conversely, the fact that
Gin4 is normally phosphorylated only during mitosis demonstrates that the G1 cyclins do not induce phosphorylation of Gin4. These results make it clear that different cyclins are somehow able to induce different cell cycle
events. A further understanding of the molecular mechanism of Gin4 activation should provide an important step
towards understanding how cyclins are able to do this. The
finding that phosphorylation and activation of Gin4 are
dependent upon Nap1 in vivo provides an important criterion for reconstituting the activation of Gin4 in vitro.
Received for publication 24 October 1996 and in revised form 2 May 1997.
1. Abbreviation used in this paper: YPD, yeast/peptone/dextrose.This work was supported by National Institutes of Health grant GM53959-01.
1. | Amon, A., M. Tyers, B. Futcher, and K. Nasmyth. 1993. Mechanisms that help the yeast cell cycle clock tick: G2 cyclins transcriptionally activate G2 cyclins and repress G1 cyclins. Cell. 74: 993-1007 |
2. | Amon, A., S. Irniger, and K. Nasmyth. 1994. Closing the cell cycle circle in yeast: G2 cyclin proteolysis initiated at mitosis persists until the activation of G1 cyclins in the next cycle. Cell. 77: 1037-1050 |
3. | Anderson, C.W., P.R. Baum, and R.F. Gesteland. 1973. Processing of adenovirus 2-induced proteins. J. Virol. 12: 241-252 |
4. | Fitch, I., C. Dahmann, U. Surana, A. Amon, K. Nasmyth, L. Goetsch, B. Byers, and B. Futcher. 1992. Characterization of four B-type cyclin genes of the budding yeast Saccharomyces cerevisiae. Mol. Biol. Cell. 3: 805-818 [Abstract]. |
5. | Ghiara, J.B., H.E. Richardson, K. Sugimoto, M. Henze, D.J. Lew, C. Witenberg, and S.I. Reed. 1991. A cyclin B homolog in S. cerevisiae: chronic activation of the Cdc28 protein kinase by cyclin prevents exit from mitosis. Cell. 65: 163-174 |
6. | Gotoh, Y., K. Moriyama, S. Matsuda, E. Okumura, T. Kishimoto, H. Kawasaki, K. Suzuki, I. Yahara, H. Sakai, and E. Nishida. 1991. Xenopus M phase MAP kinase: isolation of its cDNA and activation by MPF. EMBO (Eur. Mol. Biol. Organ.) J. 10: 2661-2668 [Abstract]. |
7. | Hanks, S.K., and A.M. Quinn. 1991. Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Methods Enzymol. 200: 38-62 |
8. | Harlow, E., and D. Lane. 1988. Antibodies. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. |
9. | Heichman, K.A., and J.M. Roberts. 1996. The yeast CDC16 and CDC27 genes restrict DNA replication to once per cell cycle. Cell. 85: 39-48 |
10. | Heider, H., C. Hug, and J.M. Lucocq. 1994. A 40-kDa myelin basic protein kinase, distinct from erk1 and erk2, is activated in mitotic HeLa cells. Eur. J. Biochem. 219: 513-520 [Abstract]. |
11. | Holloway, S.L., M. Glotzer, R.W. King, and A.W. Murray. 1993. Anaphase is initiated by proteolysis rather than by the inactivation of MPF. Cell. 73: 1393-1402 |
12. | Hoyt, M.A., L. Trotis, and B.T. Roberts. 1991. S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function. Cell. 66: 507-517 |
13. | Irniger, S., S. Piatti, C. Michaelis, and K. Nasmyth. 1995. Genes involved in sister chromatid separation are needed for B-type cyclin proteolysis in budding yeast. Cell. 81: 269-277 |
14. | Kellogg, D.R., and B.M. Alberts. 1992. Purification of a multiprotein complex containing centrosomal proteins from the Drosophila embryo by chromatography with low-affinity polyclonal antibodies. Mol. Biol. Cell. 3: 1-11 [Abstract]. |
15. | Kellogg, D.R., and A.W. Murray. 1995. NAP1 acts with Clb2 to perform mitotic functions and suppress polar bud growth in budding yeast. J. Cell Biol. 130: 675-685 [Abstract]. |
16. | Kellogg, D.R., A. Kikuchi, T. Fujii-Nakata, C.W. Turck, and A. Murray. 1995. Members of the NAP/SET family of proteins interact specifically with B-type cyclins. J. Cell Biol. 130: 661-673 [Abstract]. |
17. | Kellogg, D.R., K. Oegema, J. Raff, K. Schneider, and B.M. Alberts. 1995. CP60: a microtubule-associated protein that is localized to the centrosome in a cell cycle-specific manner. Mol. Biol. Cell. 6: 1673-1684 [Abstract]. |
18. | King, R.W., P.K. Jackson, and M.W. Kirschner. 1994. Mitosis in transition. Cell. 79: 563-572 |
19. | King, R.W., J.-M. Peters, S. Tugendreich, M. Rolfe, P. Hieter, and M.W. Kirschner. 1995. A 20S complex containing CDC27 and CDC16 catalyzes the mitosis specific conjugation of ubiquitin to cyclin B. Cell. 81: 279-288 |
20. | Lawrence, C.W.. 1991. Classical mutagenesis techniques. Methods Enzymol. 194: 273-281 |
21. | Lew, D.J., and S.I. Reed. 1993. Morphogenesis in the yeast cell cycle: regulation by Cdc28 and cyclins. J. Cell Biol. 120: 1305-1320 [Abstract]. |
22. | Lew, D.J., and S.I. Reed. 1995. Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Gen. Dev. 5: 17-23 |
23. | Li, R., and A.W. Murray. 1991. Feedback control of mitosis in budding yeast. Cell. 66: 519-531 |
24. | Li, X., and R.B. Nicklas. 1995. Mitotic forces control a cell cycle checkpoint. Nature (Lond.). 373: 630-632 |
25. | Minshull, J., H. Sun, N.K. Tonks, and A.W. Murray. 1994. MAP-kinase dependent mitotic feedback arrest in Xenopus egg extracts. Cell. 79: 475-486 |
26. | Murray, A.. 1995. The genetics of cell cycle checkpoints. Curr. Opin. Gen. Dev. 5: 5-11 |
27. | Murray, A., and T. Hunt. 1993. The Cell Cycle: An Introduction. Oxford University Press, New York. 243 pp. |
28. | Nigg, E.A.. 1993. Cellular substrates of p34cdc2 and its companion cyclin-dependent kinases. Trends Cell Biol. 3: 296-301 . |
29. | Norbury, C., and P. Nurse. 1992. Animal cell cycles and their control. Annu. Rev. Biochem. 61: 441-470 |
30. | Peter, M., J.S. Sanghera, S.L. Pelech, and E.A. Nigg. 1992. Mitogen-activated protein kinases phosphorylate nuclear lamins and display sequence specificity overlapping that of mitotic protein kinase p34cdc2. Eur. J. Biochem. 205: 287-294 [Abstract]. |
31. | Pringle, J.R., A.E.M. Adams, D.G. Drubin, and B.K. Haarer. 1991. Immunofluorescence methods for yeast. Methods Enzymol. 194: 565-602 |
32. | Richardson, H., D.J. Lew, M. Henze, K. Sugimoto, and S. Reed. 1992. Cyclin B homologs in Saccharomyces cerevisiae function in S phase and in G2. Genes & Dev. 6: 2021-2034 [Abstract]. |
33. | Rieder, C.L., A. Schultz, R. Cole, and G. Sluder. 1994. Anaphase onset in vertebrate somatic cells is controlled by a checkpoint that monitors sister kinetochore attachment to the spindle. J. Cell Biol. 127: 1301-1310 [Abstract]. |