Department of Genetics, University of Washington, Seattle 98195
Proteasome-mediated protein degradation is a key regulatory mechanism in a diversity of complex processes, including the control of cell cycle progression. The selection of substrates for degradation clearly depends on the specificity of ubiquitination mechanisms, but further regulation may occur within the proteasomal 19S cap complexes, which attach to the ends of the 20S proteolytic core and are thought to control entry of substrates into the core. We have characterized a gene from Saccharomyces cerevisiae that displays extensive sequence similarity to members of a family of ATPases that are components of the 19S complex, including human subunit p42 and S. cerevisiae SUG1/ CIM3 and CIM5 products. This gene, termed PCS1 (for proteasomal cap subunit), is identical to the recently described SUG2 gene (Russell, S.J., U.G. Sathyanarayana, and S.A. Johnston. 1996. J. Biol. Chem. 271:32810- 32817). We have shown that PCS1 function is essential for viability. A temperature-sensitive pcs1 strain arrests principally in the second cycle after transfer to the restrictive temperature, blocking as large-budded cells with a G2 content of unsegregated DNA. EM reveals that each arrested pcs1 cell has failed to duplicate its spindle pole body (SPB), which becomes enlarged as in other monopolar mutants. Additionally, we have shown localization of a functional Pcs1-green fluorescent protein fusion to the nucleus throughout the cell cycle. We hypothesize that Pcs1p plays a role in the degradation of certain potentially nuclear component(s) in a manner that specifically is required for SPB duplication.
Selective proteolysis is a fundamental mechanism in
the regulation of numerous biological processes (13,
42). Since protein degradation is both rapid and irreversible, it provides an effective mechanism for switching between alternative states of cellular behavior: when
regulatory molecules that are required for maintenance of
one state are selectively degraded, the cell switches to the second state. Such regulation has been implicated in the
adaptation of plants to photosynthetic light (87), developmental decisions in Drosophila (46, 71), transcriptional
control in yeast (22, 43, 44) and vertebrate cells (73, 94),
signal transduction in yeast (54, 64), and antigen presentation in mammals (24, 79). Similarly, selective proteolysis is
an essential aspect of cell cycle regulation (67), where
timely progression from one stage to the next must be
tightly controlled. Clearly, it is of broad importance to understand the mechanisms that mediate and regulate selective protein degradation.
In eukaryotic cells, specific proteolysis is mediated by
the ubiquitin pathway (13, 34, 50), in which the covalent
attachment of ubiquitin to substrate proteins targets them
for degradation. Ubiquitin is activated by an E1 enzyme
and then transferred by an E2 enzyme to the ubiquitinprotein ligase, E3, which catalyzes the formation of a covalent bond between ubiquitin and the protein substrate.
The ubiquitin moeity then acts as a substrate for further rounds of this process, resulting in the synthesis of a polyubiquitin chain. The presence within cells of families of E2
and E3 enzymes that differ in their properties suggests differences in their substrate specificity. E3 enzymes are
known, in fact, to play key roles in substrate selection (see
below). Additionally, members of a large family of deubiquitination enzymes that have been identified are presumed
to confer further regulation on the population of ubiquitinated substrates (42).
Poly-ubiquitinated proteins are degraded by proteasomes (33, 41, 75; for exceptions see 40), which are distributed throughout both the cytoplasm and the nucleus of eukaryotic cells (76). Each 26S proteasome is assembled in
an ATP-dependent manner (28, 63) from a cylindrical 20S
core and two 19S complexes that cap the ends of the cylinder (75) (Fig. 1). The x-ray crystal structure of the 20S complex from the archaebacterium Thermoplasma acidophilum was recently determined (60). This complex, which
EM reveals to be structurally similar to the eukaryotic 20S
particle (78), was shown to consist of four stacked ring
structures. In T. acidophilum, each of the two outer rings
consists of seven identical
Unlike the 20S proteolytic core, the structure and function of the 19S cap complex is less well understood. The
19S cap is believed to confer both specificity toward ubiquitinated substrates and an ATP dependence on proteolysis (42). Isolated mammalian 19S complexes appear to
contain ~20 distinct subunits (17, 18). One subunit has
been shown to bind ubiquitin polymers (19), while at least
six others are members of a recently described family of
ATPases (17). The 20S complex can hydrolyze proteins in
the absence of ATP if the proteins are first denatured (20), suggesting that the ATPase activities of the 19S cap serve
to unfold these proteins. Isopeptidase activities, which remove ubiquitin from conjugated substrates, are also associated with the 26S proteasome (13). Taken together, these
observations suggest a pathway for 26S proteasome function: briefly, the 19S complex first binds a poly-ubiquitinated substrate, which then experiences ATP-dependent unfolding and translocation into the interior of the 20S cylinder, where it is hydrolyzed into small peptides. During
this process, the ubiquitin chains are removed intact and
recycled (50).
Ubiquitin-mediated proteolysis plays a major role in the
control of cell cycle progression. The cell cycle is largely
driven by the action of cyclin-dependent kinases (CDKs),1
which are successively activated by association with cyclins (70). It has been shown, for example, that entry into mitosis requires the activity of a CDK-cyclin B complex and
that completion of mitosis then requires cyclin destruction
(68). Mitotic cyclins made indestructible by mutation cause
arrest in mitosis, preventing the subsequent processes of
chromosome decondensation, spindle disassembly, and cytokinesis (27, 30, 32, 61, 68). The temporal specificity of
mitotic cyclin degradation appears to be controlled by the
activity of a large ubiquitin ligase (E3) complex that is
activated during mitosis (39, 90). This structure, termed
the anaphase promoting complex (APC), contains CDC16,
CDC23, and CDC27 gene products in S. cerevisiae and
their homologs in other eukaryotes (48, 52, 59, 96), as well
as a homolog of the Aspergillus nidulans BIME product
(77, 105).
Although cyclin B destruction is required for exit from
mitosis, the initiation of anaphase can occur independently
of cyclin B degradation (45, 91). Nevertheless, the onset of
anaphase A, which is marked by sister chromatid separation, is slowed by inhibitors of the degradation machinery
(45). This observation suggests that proteins other than cyclins must be degraded and that these may include those
that hold sister chromatids together. Furthermore, the
APC is required for progression past metaphase, as well as
for exit from mitosis (48, 52, 96), indicating that this complex is also used to ubiquitinate regulatory molecule(s) whose destruction is required for the initiation of anaphase. Recent work also implicates the S. cerevisiae PDS1
gene product as an inhibitor of sister chromatid separation
that is inactivated by APC-mediated degradation (14, 103,
104). Similarly, the APC-dependent proteolysis of the
Schizosaccharomyces pombe Cut2 protein at anaphase is
essential for sister chromatid separation (26), and the pimples product of Drosophila is required for sister centromere cohesion and is rapidly degraded in mitosis (89). Besides sister chromatid separation, other aspects of spindle
mechanics may also be regulated by proteolysis. For example, the S. cerevisiae ASE1 product localizes to the spindle
midzone, functions in the process of spindle elongation,
and is degraded as cells exit mitosis (74), as is human
CENP-E, a spindle-associated kinesin-like protein (6). Thus,
proteolysis plays a fundamental regulatory role in numerous aspects of mitosis.
The effectiveness of proteolysis as a regulatory mechanism obviously depends upon the accurate and specific selection of targets for degradation. While one level of control clearly resides in specificity of substrate targeting by
the APC and other ubiquitination complexes (for review
see 53), further specificity might well be conferred by the
proteasome itself. For example, different substrates targeted for degradation might be recognized by different subunits in the 19S cap. In this paper we report the characterization of a gene, PCS1, from S. cerevisiae that encodes
a protein with extensive similarity to other subunits of the
19S cap structure. A conditional pcs1 mutant displays a
phenotype (reported here) that is distinct from those
caused by mutations reported for other 19S cap subunits
(31). Whereas cim3-1 and cim5-1 mutants arrest the cell
cycle at a stage with a complete spindle, EM of the present pcs1 allele reveals a defect in duplication of the spindle
pole body (SPB), which serves as the centrosome equivalent that organizes microtubule arrays in yeast (7). Before
mitosis, the single SPB that is present at the beginning of
the cell cycle must duplicate once (and only once) to generate the two poles of the mitotic spindle. By EM, the SPB
appears as a darkly staining trilaminar disk embedded in
the nuclear envelope, such that microtubules emanating
from the outer and inner surfaces extend into the cytoplasmic and nuclear compartments, respectively (7). The first
visible sign of SPB duplication occurs early in G1, when a
small aggregate of material, termed the satellite, appears
on the cytoplasmic face of the half-bridge, a darkly staining region of the envelope adjacent to the SPB. Later in
G1, the satellite is transformed into a second, mature SPB
that is fully embedded in the nuclear envelope. We show
here that SPB duplication fails in pcs1 cells, while other
landmarks of cell cycle initiation, including bud formation
and DNA replication, proceed successfully. Accordingly, we posit that PCS1-dependent proteolysis of specific substrate(s) is required for SPB duplication to occur.
Strains and Culture Techniques
Standard yeast genetic methods were used (66) and yeast media were
made as described (37). For temperature shift experiments requiring cell
synchronization, cells were arrested with 10 µM Table I.
Saccharomyces cerevisiae Strains
subunits, while each of the inner
rings consists of seven identical
subunits. Each
subunit
has a proteolytic site facing the interior of the 20S cylinder,
effectively sequestering its activity away from proteins that
lie outside the cylinder. In eukaryotes, the rings are formed
of nonidentical but related subunits. Seven related
subunit- and seven related
subunit-encoding genes have
been identified in S. cerevisiae (41), suggesting that each
ring might contain seven different subunits. It is likely that
all 20S proteasomal cores in S. cerevisiae are identical, each
one containing all 14 distinct
and
subunits (11).
Fig. 1.
Schematic representation of a 26S proteasome. The 20S
proteolytic barrel structure is indicated in pale grey and the 19S
cap structures at either end are in dark grey. The caps are believed to recognize ubiquitinated proteins, unfold them, and feed
them into the proteolytic core in an ATP-dependent manner, resulting in the release of peptides and free ubiquitin.
[View Larger Version of this Image (47K GIF file)]
Materials and Methods
-factor (Sigma Chemical
Co., St. Louis, MO) and released as described (101). Yeast strains are
listed in Table I. Bacterial strain DH5
was used for plasmid construction
and bacterial media were made as described (84).
Identification and Sequence Analysis of PCS1
PCS1 was fortuitously identified during studies of CDC31 (4). A plasmid (pHM27) encoding a lexA DNA-binding domain-Cdc31 protein fusion was used as "bait" in a two-hybrid screen (12). The L40 reporter strain (98) was cotransformed with pHM27 and the pGAD libraries (12). Library plasmids were recovered from transformants giving positive signals in the screen. A fragment of PCS1 was found immediately downstream from the GAL4 activation domain sequence in one plasmid, YL2-29, but subcloning showed that a gene elsewhere in the genomic DNA insert (CDC31) was responsible for the signal. Independent library plasmids containing CDC31 were identified, mapped, and shown to contain PCS1 in the same relative position. One plasmid, YL1-19, contained the complete PCS1 sequence.
The PCS1 gene was sequenced on both strands using YL2-29, YL1-19, and constructs derived from these plasmids as templates. Sequencing reactions were done using the Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) and were analyzed by the University of Washington Molecular Pharmacology Facility using an Applied Biosystems 373A automated sequencer. Oligonucleotides designed to prime the sequencing reactions at appropriate positions in PCS1 were synthesized by GIBCO BRL (Gaithersburg, MD). Sequence assembly and analysis were performed using the Genetics Computer Group package (36), and comparisons with sequence databases were performed using the BLAST program (2).
Genomic Disruption of PCS1
As a first step toward disrupting PCS1, the yeast integrating plasmids
pHM35 and pHM47 were constructed. Standard recombinant DNA techniques were used (84), and restriction enzymes, DNA polymerases, and T4
DNA ligase were purchased from New England Biolabs (Beverly, MA).
To introduce a unique EcoRI site in the region of the gene encoding the
ATPase domain, oligonucleotide primers hm15-BamHI (5GAAGATCTCGGATCCACTGGTG3
) and hm16-EcoRI (5
GGAATTCTATAACCTCCCTTAA3
) (underlined nucleotides represent restriction sites)
were used together with VentTM DNA polymerase (New England Biolabs) to amplify YL2-29 template DNA between nucleotides 583 and 689 (see Fig. 2 B) in a PCR. The product was digested with BamHI and EcoRI
and ligated into BamHI/EcoRI-digested pRS306 (88) to create plasmid
pHM34. Primers hm17-EcoRI (5
CGAATTCCCATTGAAGAACCCAG3
) and hm18-KpnI (5
CCGGTACCAGGGGGAC3
) were used to
amplify the YL2-29 template between nucleotides 685 and 775. This product was digested with EcoRI and KpnI and ligated into EcoRI/KpnI- digested pHM34 to create pHM35. The insert in pHM35 was excised with
BamHI and KpnI and ligated into BamHI/KpnI-digested pRS304 (88) to
create pHM47.
To disrupt one genomic copy of PCS1, plasmid pHM47, which carries the TRP1 gene, was digested with EcoRI and used to transform the diploid yeast strain D8bx5cA (which is congenic with S288C) to Trp+. Southern blot analysis (not shown) confirmed that integration of pHM47 into one copy of PCS1 had occurred as expected in the transformant used in further experiments (YHM9.1).
Construction of a Temperature-sensitive PCS1 Allele
To create a temperature-sensitive PCS1 mutant, we constructed plasmid pHM55, which encodes a degron-Pcs1p fusion. The EcoRI-HindIII fragment encoding the degron unit (Ub-DHFRts-ha) (21) was previously cloned into the EcoRI-HindIII sites in the pRS316 polylinker by Dr. Frank Russo (University of Washington, Seattle, WA). This fragment was excised with EcoRI and ClaI and treated with Klenow. pHM53 (see below) was digested with NcoI and treated with Klenow, and the degron- encoding fragment was ligated into this site. These manipulations resulted in the degron fragment being inserted at the start codon of PCS1, in frame with the open reading frame. We refer to this allele as pcs1td (temperature-inducible degron allele). Next, the yeast integrating plasmid pHM56 was constructed. The insert from pHM55 was excised with PvuII and inserted into PvuII-digested pRS306 (88) to create pHM56.
To replace the wild-type PCS1 gene with the pcs1td allele in the chromosome, the two-step "pop-in/pop-out" gene replacement method was used (81, 85). pHM56 was digested with EcoRI and used to transform the haploid strain Wx257-5c (which is congenic with S288C) to Ura+. PCR analysis confirmed that integration had occurred at the PCS1 locus as predicted (data not shown), resulting in both PCS1 and pcs1td flanking the plasmid sequences. Excision of the plasmid and either of the PCS1 alleles via homologous recombination was then selected for using 5-fluoroorotic acid (5-FOA; PCR Inc., Gainesville, FL), which kills Ura3+ cells (5). Two 5-FOA-resistant colonies were identified that had a temperature-sensitive phenotype, suggesting that they contained the pcs1td allele. PCR analysis confirmed that this was true in the pcs1td strain used in further experiments, YHM11.2 (data not shown).
To delete UBR1 from both YHM11.2 and Wx257-5c, plasmid pJDubr4-B
(a gift from Drs. Jürgen Dohmen and Alexander Varshavsky, California
Institute of Technology, Pasadena) was digested with EcoRI and used to
transform these yeast strains to His+. This manipulation resulted in the replacement of UBR1 with the ubr1
::HIS3 allele, creating strains YHM12.1
(pcs1td) and YHM13.1 (PCS1).
Plasmid Constructions
Plasmids pHM48 and pHM49 were constructed to supply PCS1 function
in a haploid yeast strain containing a disrupted genomic copy of PCS1.
Primers hm27-XhoI (5CCGCTCGAGAAGCTTGAAATACCATAGTG3
) and hm28-SmaI (5
TCCCCCGGGAGTTCAATAGCCATTTCGAGC3
) were used together with VentTM DNA polymerase to amplify the
YL1-19 template between nucleotides 1 and 1,506 (Fig. 2 B). The product
was digested with XhoI and SmaI and ligated into the yeast centromere
(CEN) plasmids pRS315 and pRS316 (88), also digested with XhoI and
SmaI, to create plasmids pHM48 and pHM49.
To facilitate later constructions, a unique NcoI site was engineered to
overlap the PCS1 start codon in pHM48. Primer hm32-NcoI (5CCTGTTCTTCACCCATGGTTAGTTATTAATATCTTTG3
) was used in a
PCR-based site-directed mutagenesis technique (10). Primers hm32-NcoI and T3 (whose site is outside the polylinker upstream from the PCS1 gene
in pHM48) were used to amplify a fragment of DNA from pHM48. This
fragment was then used as a primer, together with the T7 primer (whose
site is outside the polylinker downstream from the PCS1 gene in pHM48)
in a second PCR. The second PCR product was digested with XhoI and
SstI and ligated into XhoI/SstI-digested pRS315 (88) to create plasmid
pHM53. As a result of the site-directed mutagenesis, the second codon in
PCS1 was changed from AGT (Ser) to GGT (Gly).
Plasmid pHM54 was constructed to encode a green fluorescent protein (GFP)-Pcs1 protein fusion. Plasmid pZA66 was previously constructed by Dr. Michael Moser (University of Washington). It encodes S65T GFP (38) engineered to contain a COOH-terminal 10-amino acid spacer consisting of repeating Gly-Ala residues. The DNA fragment encoding this unit was excised from pZA66 with BspHI and ligated into NcoI-digested pHM53 to create pHM54. This manipulation resulted in the S65T GFP encoding DNA being inserted in frame with the PCS1 gene, at the PCS1 start codon.
Cytological Techniques and Protein Analysis
Cells were prepared for immunofluorescence microscopy as described (49,
51). To detect microtubules, the rat monoclonal anti--tubulin antibody
YOL1/34 (Accurate Chemical and Scientific Corp., Westbury, NY) and
FITC-conjugated goat anti-rat antibodies (Amersham Corp., Arlington
Heights, IL) were used at dilutions of 1:100 and 1:50, respectively. For
hemagglutinin (HA) epitope tag localization, mAb 12CA5 (Boehringer
Mannheim Biochemicals, Indianapolis, IN) was used at a concentration of
0.8 µg/ml followed by FITC-conjugated goat anti-mouse antibodies (Amersham Corp.) diluted 1:100. DNA was visualized with 4
,6-diamidino-2phenylindole (DAPI) (1 µg/ml; Sigma Chemical Co.). Fixed and stained
cells were viewed using a Microphot FX fluorescent microscope (Nikon Inc., Garden City, NY) and photographed with TMAX 400 film (Eastman Kodak Co., Rochester, NY).
Cells containing the GFP-Pcs1p fusion were grown to a density of ~107 cells per ml and stained with DAPI by first resuspending the cells briefly in methanol, washing with PBS, and resuspending in a 1 µg/ml DAPI solution. These cells were viewed and photographed as described above.
Yeast cells were prepared for thin-section EM as described (9). Serial sections were viewed on an EM300 electron microscope (Philips Electronic Instruments, Inc., Mahwah, NJ).
Cells were prepared for flow cytometry as described (47). Propidium iodide (Sigma Chemical Co.) was used to stain the DNA. A Becton Dickinson FACS®can flow cytometer (San Jose, CA) was used together with the CELLFIT and LYSYS software packages.
For Western blot analysis, whole cell lysates were prepared from yeast spheroplasts as follows. Spheroplasts derived from 5-ml cultures at a density of 3 × 107 cells per ml were resuspended in 100 µl lysis buffer (50 mM Tris-Cl, pH 7.5, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5 µg/ml leupeptin, 2 µg/ml aprotinin) and lysed using 20 strokes in a Dounce homogenizer. This solution was centrifuged for 15 min at top speed in a microfuge at 4°C, and the supernatant was transferred to a fresh tube. Total protein concentration in the clarified lysates was determined using the Bio-Rad protein assay (Bio Rad Laboratories, Hercules, CA) and BSA as a standard. Equivalent amounts of total protein were subjected to SDS-PAGE (58). Proteins were transferred to nitrocellulose in a transphor electrophoresis unit (Hoefer Scientific Instruments, San Francisco, CA) for 1 h at 0.3 A. The nitrocellulose membrane was blocked with 5% nonfat dry milk in TBS/Tw (TBS, 0.05% Tween-20) for 1 h, and then incubated with antiGFP antiserum (Clontech, Palo Alto, CA) at a 1:4,000 dilution in TBS/Tw for 1 h. The membrane was washed in TBS/Tw and incubated with goat anti-rabbit IgG-HRP (Accurate Chemical and Scientific Corp.) at a 1:5,000 dilution for 1 h, followed by washing in TBS/Tw. All incubations were done at room temperature. The signal was developed using the enhanced chemiluminescence system (Amersham Corp.).
Identification and Sequence Analysis of PCS1
We identified PCS1 while sequencing near CDC31 (4), a gene located on the right arm of S. cerevisiae chromosome XV (see Materials and Methods for experimental details and rationale). Briefly, one end of a genomic fragment of DNA containing CDC31 internally was sequenced and found to encode a portion of a novel gene encoding a new member of a diverse family of ATPases (86). Since members of this family are known to play roles in the regulation of mitosis, we pursued its characterization further. We identified a plasmid (YL1-19) containing an 11-kb insert that includes the full-length version of the new gene. It is located ~1 kb from CDC31 and faces in the opposite orientation. A partial restriction map of the relevant portion of the YL1-19 insert is shown in Fig. 2 A; the relative positions of PCS1, CDC31, and a third open reading frame are indicated by arrows beneath the map. Sequence analysis revealed that a 1.3-kb open reading frame (Fig. 2 B), designated PCS1, represents the novel ATPase-encoding gene.
To examine the relationship between Pcs1p and other
protein sequences in the databases, we used the BLAST
alignment program (2). This analysis confirmed the identity of Pcs1p as a member of the "AAA" (ATPases Associated with diverse cellular Activities [56]) superfamily.
Members of this superfamily share a conserved region of
~200 amino acids that contains motifs A and B characteristic of ATP binding, underlined in Fig. 2 B (99). Pcs1p is
most similar to a subclass of this superfamily composed of
proteasomal 19S cap subunits. Fig. 3 shows an alignment
of Pcs1p with three of the highest scoring proteins in the
BLAST search. p42 (25) and S4 (23) are subunits of the
human 26S proteasome, and their sequences are respectively 67% and 38% identical to the Pcs1p sequence as determined by the pairwise alignment program BESTFIT (36). SUG1 (92)/CIM3 (31) (and CIM5 [31]) are S. cerevisiae genes; the sequences of their predicted products are
43% and 39% identical to the Pcs1p sequence. Homologs
of the SUG1/CIM3 and CIM5 gene products were identified in purified preparations of 26S proteasomes from
Drosophila (31), and the Sug1/Cim3 protein has been directly shown to be a subunit of the yeast 26S proteasome (82). Pcs1p is also closely related to the S. pombe mts2+
gene product, a 26S proteasome component necessary for
completion of mitosis (35). The very high degree of sequence similarity between these known proteasome cap
subunits and Pcs1p provides strong evidence that Pcs1p is
itself a 19S cap subunit. This identity has been confirmed
by the recent work of Russell et al. (83), who demonstrated that the protein encoded by SUG2 (which is identical to PCS1) is a component of the 26S proteasome, while
our work was in progress.
PCS1 is predicted to encode a protein 437 amino acids
in length, with an expected molecular mass of 49 kD and
isoelectric point of 5.5. A notable characteristic of Pcs1p is
the very hydrophilic region extending between amino acids 13 and 96, shown graphically in Fig. 2 C. This region
also corresponds to the most divergent part of Pcs1p compared with the sequences most closely related to it (Fig. 3).
Additionally, the boxed region indicated in Fig. 2 B is predicted to be a potential nuclear localization signal by the
program PSORT (69). To gain further information about the conformation of Pcs1p, we used the method of Robson-Garnier (29) to predict the secondary structural features of the Pcs1p sequence. This analysis, also depicted
graphically in Fig. 2 C, suggests that the protein may be
largely globular, since the three conformational features of
helix, turn, and
sheet generally alternate. One region
largely predicted to be
-helical, between amino acid residues 74 and 101, displays a limited heptad repeat motif
suggestive of the ability to form a short
-helical coiledcoil. This motif consists of a repeating heptad with hydrophobic residues enriched at positions 1 and 4 (1) (residues
at position 1 are indicated with a triangle beneath them in
Fig. 2 B). The program COILS (62) gives this region a
probability near 1.0 of adopting a coiled-coil conformation. Other members of the 19S ATPase family also contain heptad motifs near their NH2 termini (78).
PCS1 Is Essential for Vegetative Growth
To determine whether PCS1 gene function is essential for cell viability, we constructed haploid strains disrupted for PCS1 (pcs1::TRP1). We reasoned that the highly conserved ATP-binding motif A (P-loop; underlined in Fig. 2 B) would almost certainly be essential for Pcs1p function. Therefore, we constructed a plasmid, pHM47, that when integrated into the genome results in the insertion of the S. cerevisiae TRP1 gene into the P-loop-encoding region (see Materials and Methods); the insertion site is indicated by the arrow in Fig. 2 B. The diploid strain D8bx5cA was transformed with this plasmid, which was cut at EcoRI to direct integration at the PCS1 locus. Southern blotting was used to confirm that the plasmid had integrated into one copy of PCS1 as expected in each of eight Trp+ transformants (data not shown). The transformant chosen for further experiments (designated YHM9.1) was sporulated, and the resulting tetrads were dissected. In all cases (20/20), the four spores segregated in a ratio of two viable to two inviable; this result held true at both 23° and 37°C. The viable spores were always auxotrophic for tryptophan, indicating that they did not carry the disruption marker. We examined the phenotype of the inviable spore microcolonies after 3 d at either 23° or 37°C and observed a small effect of temperature on the cell cycle at which division arrested. At 23°C, the spore germinated and divided twice, arresting as four large-budded cells. At 37°C, the spore germinated and divided once, arresting in the second division cycle as two large-budded cells. Often the bud was misshapen and could not be pulled away from the mother cell with a dissecting needle. These results indicate that PCS1 function is necessary for cell viability and are consistent with an essential role for this protein in mitosis.
To determine whether the sequenced length of DNA shown in Fig. 2 B is sufficient to supply PCS1 function, we constructed a plasmid (pHM49; see Materials and Methods) that contains the PCS1 sequence carried on a CENbased vector marked with URA3. pHM49 was transformed into strain YHM9.1, which is heterozygous for the pcs1:: TRP1 disruption. Sporulation and tetrad analysis revealed that more than two spores per tetrad formed colonies. All Trp+ colonies were also Ura+, indicating that a haploid strain disrupted for chromosomal PCS1 can be maintained by the sequence cloned in pHM49.
Construction of a Temperature-sensitive pcs1 Allele
To obtain a conditional allele that could be used for more
detailed phenotypic analysis, we constructed a haploid strain, designated YHM11.2, in which the chromosomal PCS1
gene was replaced with an allele (pcs1td) that encodes a degron-Pcs1p fusion (see Materials and Methods). The degron unit is a heat-inducible degradation signal (21) that at
high temperature (37°C) is degraded, together with sequences fused downstream of it, by the N-end rule pathway of protein degradation (3). Strain YHM11.2 was viable at 23° and 30°C (Fig. 4 A, patch b), but was inviable at
36° and 37°C. Strain Wx257-5c, the wild-type strain from
which YHM11.2 is derived, was viable at all temperatures tested (Fig. 4 A, patch a). Thus, pcs1td is a temperaturesensitive allele of PCS1. We also confirmed that the pcs1td
mutation is recessive, as expected for an allele designed to encode a protein that is degraded rapidly: pcs1td/PCS1 diploid cells grew normally at 37°C (data not shown), and the
mutant phenotype caused by pcs1td can be complemented
by pHM49 (see above).
To test whether this temperature sensitivity is a result of degradation via the N-end pathway as predicted, we deleted UBR1 from strains YHM11.2 and Wx257-5c to create strains YHM12.1 and YHM13.1, respectively. The UBR1 gene is required for the N-end rule pathway and for the temperature sensitivity of several alleles encoding degron fusions (21). We found that deleting UBR1 partially rescued the temperature sensitivity caused by pcs1td. Although deletion of UBR1 does not restore growth of the pcs1td strain at 37°C (Fig. 4 A, patch d), growth did occur at 36°C. These results confirm an important role for the N-end rule pathway in the loss of function for pcs1td.
pcs1td Strains Arrest as Large-budded Cells with a G2 Content of DNA
To determine whether depletion of PCS1 function causes
arrest at a specific stage in the cell cycle, we shifted asynchronous liquid cultures of strains Wx257-5c (PCS1) and
YHM11.2 (pcs1td) from 23° to 37°C and observed their behavior after various times. Fig. 4 B shows the relative proportions of unbudded, small-budded, and large-budded
cells after 9 h at the restrictive temperature. About 90% of
the pcs1td cells were found to be large budded at the restrictive temperature, compared with ~30% for the culture continuing to grow at the permissive temperature. To
investigate the kinetics of entry into this state of arrest, we
used synchronous cultures of PCS1 and pcs1td obtained by
arresting growth in G1 with -factor and then shifting them to 37°C in fresh media without
-factor. Fig. 4, C and
D, shows the proportions of cell types at time points after
this shift. From this experiment it is clear that pcs1td cells
underwent at least two cell divisions before becoming arrested as large-budded cells, since a second cycle of bud
formation was evident at ~5 h. We also noted a partial defect in cell separation, for pairs of budded cells remained
attached to each other as the second cell cycle progressed.
By 9 h after release from
-factor, ~25% of the cells were
detected as attached pairs of large-budded cells.
We also followed individual cells after shift to the restrictive temperature. Cells were arrested with -factor, transferred to a plate, and observed after 27 h at 37°C. About
half of the cells had arrested in the second cycle as two
large-budded cells, while the other half had completed this
cycle and undergone the same type of arrest in the third
cycle. It has been observed that the effectiveness of the degron system improves if cells are held in stationary phase
before the temperature shift (Dirick, L., personal communication). Accordingly, we permitted pcs1td cells to remain
at stationary phase for 3 d at 23°C, at which time ~90%
were unbudded, transferred them to a plate, and again observed them after incubation for 27 h at 37°C. 50% of the
cells reached the final stage of arrest as large-budded cells
within the first cycle, 30% in the second cycle, and 20% in
the third, suggesting that degron-Pcs1p was more effectively depleted in this experiment.
Flow cytometry experiments indicate that pcs1td cells arrest with a 2C (G2) content of DNA. Fig. 5 A shows the
cytometry profiles of asynchronous PCS1 and pcs1td cultures at 23°C, where it can be seen that about equal proportions of pcs1td cells had apparent 1C and 2C DNA contents. After 9 h at 37°C, however, 87% of the pcs1td cells
had accumulated in a state with a 2C content of DNA,
whereas a higher proportion of PCS1 cells had a 1C content of DNA at 37°C than at 23°C (Fig. 5 B). These findings demonstrate that cells lacking PCS1 function undergo
arrest in the division cycle after DNA synthesis, and that
this function therefore must be required for progression
from G2 into mitosis.
PCS1 Function Is Required for Spindle Pole Body Duplication
To gain a better understanding of how a lack of PCS1
function perturbs mitosis, we visualized DNA and microtubules using fluorescence microscopy in pcs1td cells that
had accumulated in the terminal arrest described by flow
cytometry (see above). After 9 h at 37°C, the DNA remained unsegregated and was localized in a region immediately adjacent to the bud neck in ~80% of these cells
(Fig. 6, B-E). Nuclei occupying this position in PCS1 cells
grown at 37°C were shown by tubulin antibody staining
to contain a short intranuclear spindle (Fig. 6 A), as is
characteristic of yeast cells in G2 or mitotic metaphase. However, the arrested pcs1td cells did not contain discrete
spindles and generally had fewer detectable intranuclear
microtubules. The most common phenotype is shown in
Fig. 6 B, in which a single bundle of cytoplasmic microtubules extended away from the nucleus and through the
bud neck. Additionally, some cells contained a relatively
bright focus of microtubule staining at the nuclear periphery, as well as cytoplasmic microtubules emanating away
from this focus (Fig. 6 C). Less frequently, we observed
cells in which microtubules appeared to lie along the surface of the nucleus (Fig. 6 D), and other cells in which two
bundles of cytoplasmic microtubules extended away from
the nucleus in an antennae-like array (Fig. 6 E). (Significant numbers of cells lacking spindle structures were not observed at earlier time points in this experiment, presumably because the first cycle proceeded normally, albeit
slowly.) These findings suggest that cells deprived of PCS1
function fail to form a mitotic spindle while retaining the
ability to assemble cytoplasmic microtubule arrays.
The attachment between pairs of large-budded cells
seen after transfer of a pcs1td culture to the restrictive temperature (as described earlier) provided us with a method
of identifying mother and daughter cells unambiguously.
Fig. 7 A shows cells in this configuration. Since the cells had
been arrested with -factor before the shift to high temperature, the original mother is identifiable as the schmooshaped cell 1. This cell presumably had budded once to
produce cell 2 and a second time to produce bud 3. Cell 2 had also budded to produce bud 4. In Fig. 7 B, it can be
seen that the unsegregated DNA lies largely within the
buds (3 and 4) that are the products of the second division.
Cytoplasmic microtubule staining is evident in bud 4 (Fig.
7 C); faint microtubule staining was also observed in bud 3 in a different focal plane. Although we could not distinguish the mother cell and bud unambiguously among all
cells examined in this manner, the DNA localized to the
mother ~50% of the time and bud 50% of the time when
both could be identified (data not shown). A mutant that
is specifically defective in spindle pole body duplication,
ndc1-1, has previously been shown to display random localization of the single functional spindle pole and the
bulk of the DNA between the mother cell and the bud (93, 97). Similarly, certain mutations that cause cells to arrest with a bipolar spindle also display such random localization of DNA (72).
Given our finding that the pcs1td cells arrest more
quickly if held in stationary phase before a shift to the restrictive temperature, we also examined the microtubule
arrays of cells treated in this manner at various times after
the temperature shift. Since mutations in the closely related SUG1/CIM3 and CIM5 genes have previously been
reported to cause cells to arrest with short spindles (31), we also wished to determine whether the phenotypes of
pcs1td, cim3-1, and cim5-1 mutants were indeed distinct when
the same conditions were used for the experiment. Accordingly, strains YHM11.2 (pcs1td), CMY763 (cim3-1), and
CMY765 (cim5-1) (each congenic with the S288C background) were held at stationary phase for 3 d at 23°C, and
then diluted into fresh media at 37°C. At the time of the temperature shift, no abnormal spindles were observed in
any of the strains. Fig. 8 shows the percentage of largebudded cells containing short spindles, long spindles, or no
spindles in each of the strains at different times after the
temperature shift. While most large-budded pcs1td cells
were observed to contain no spindles at 4 and 6 h after the
shift, most large-budded cim3-1 and cim5-1 cells contained short spindles at these time points. Incidentally, we also
observed cytoplasmic microtubule arrays in the cim3-1 cells
containing short spindles that were broader and more
elongated than those seen in wild-type or cim5-1 cells; this
characteristic of cim3-1 is also apparent in the figure from the
original paper describing these mutants (31). More strikingly, these data demonstrate that loss of PCS1 function
causes an arrest that differs distinctly from that caused by
loss of CIM3 or CIM5 function.
To learn more about how loss of PCS1 function perturbs
spindle formation, we used serial section EM to examine
cells from strain YHM11.2 (pcs1td) held at 37°C for 9 h.
We found that the majority of cells (21/25 examined) had
failed to duplicate their SPBs and therefore possessed only
a monopolar spindle. The remaining cells (4/25) had duplicated their SPBs and each contained a bipolar spindle. Fig.
9 A shows one pole of a bipolar spindle from one of these
latter cells. The SPB seen here is indistinguishable from
that of wild type: its half-bridge (arrow), the darkly staining segment of the nuclear envelope immediately adjacent
to the SPB, has the same appearance as that which is normally seen in wild-type cells (7). Fig. 9, B, B and C, C
,
show (in adjacent sections) the single SPBs from two cells
containing monopolar spindles. These SPBs are larger than
normal, as has been observed for other mutants that fail to
duplicate their SPBs (e.g., 8, 101). Normal half-bridge structures were not seen in any of the cells (n = 21) containing
unduplicated SPBs; instead, most cells examined contained an unusual type of structure in one of the adjacent
sections in the series. This structure, shown in Fig. 9, B
and C
, appears to represent an aberrant half-bridge that is
unusually curved in profile and is wrapped partly around
the SPB.
A GFP-Pcs1p Fusion Is Localized to the Nucleus
To gain more insight into Pcs1p function, we determined the localization of a GFP-Pcs1p fusion. Plasmid pHM54 was constructed to contain the sequence encoding this fusion in a CEN-based vector marked with LEU2 (see Materials and Methods). This plasmid was transformed into haploid yeast strain YHM10.1.49, which contains a disrupted chromosomal PCS1 gene and is rendered viable by the presence of PCS1 on a URA3-marked CEN plasmid. Leu+ transformants were transferred to growth on 5-FOA, which kills cells that are Ura3+ (5), effectively selecting for loss of the URA3-marked plasmid. The generation of 5-FOA-resistant colonies indicated that cells can use the GFP-Pcs1p fusion as their only functional source of Pcs1p. One of these isolates was retained for further analysis and designated YHM10.1.54. In this strain, GFP-Pcs1p is probably not being expressed to a significantly higher level than Pcs1p in a wild-type strain, both because its expression is controlled by the PCS1 promoter and because it is borne on a CEN vector, which should be present at only one or two copies per cell (95).
The GFP-Pcs1p fusion is predicted to have a molecular
mass of 76 kD. To confirm the presence of this product in
strain YHM10.1.54, equivalent amounts of whole-cell extracts from strains YHM10.1.54 and Wx257-5c (wild-type
control) were analyzed by Western blot (Fig. 10 A). AntiGFP antiserum recognized a band of approximately the
correct size in YHM10.1.54 extract (Fig. 10 A, lane 2) but not in the wild-type control (lane 1).
An asynchronous YHM10.1.54 culture was stained with DAPI to visualize DNA and examined by fluorescence microscopy. The GFP signal colocalized with the nuclear DNA, indicating that the GFP-Pcs1p fusion resides principally within the nucleus (Fig. 10, B and C). (A similar GFP signal was observed in cells that were not stained with DAPI, confirming that this signal was not due to bleedthrough of the DAPI signal.) This colocalization was consistently seen in all stages of the cell cycle, including the unbudded (1), small-budded (2), and large-budded (3 and 4) cells indicated in the figure. The GFP signal in cell 3 is observed to colocalize with a thin finger of DNA that extends through the bud neck, as well as with the bulk of the DNA. In ~5% of the cells examined, an additional patch of GFP signal was observed at a position separate from the site of DNA staining, as indicated (*) in Fig. 10 B. The cytological basis for this occasional patch of apparent cytoplasmic localization is unknown, and it remains possible that it represents an extension of the nucleus. Nevertheless, it is clear that the great majority of GFP-Pcs1p fusion colocalizes with the nuclear DNA and must therefore reside within the nucleus.
To gain a better understanding of how Pcs1p distribution compares with that of other proteasome subunits, we
examined the localization of a different 19S subunit. The
Sen3 protein from S. cerevisiae is a component of the proteasome cap, unrelated in sequence to the ATPase subunits (16). To study the localization of this protein, we
used MHY851 cells, which express a functional Sen3 protein tagged with three copies of the HA epitope (16). We
used anti-HA antibodies to visualize Sen3 protein distribution in these cells and found that it also colocalized with
the nuclear DNA throughout the cell cycle (Fig. 11, A and
B). No staining was observed in cells expressing untagged
Sen3 protein (strain MHY849; data not shown). Similarly,
the Sug1/Cim3 and Cim5 proteins have been localized primarily to the nucleus using affinity-purified antibodies, although more significant cytoplasmic staining was observed
for Cim5 than for Cim3 (Mann, C., personal communication). Thus, a number of different proteasome cap subunits appear to localize largely within the nucleus.
We have described the identification and characterization of PCS1, an essential yeast gene whose predicted product shows a high level of sequence identity with a family of ATPases that are components of the 19S proteasome cap. The 67% identity between Pcs1p and p42, a known human 26S proteasome regulatory subunit (25), provides strong evidence that Pcs1p is itself a proteasome subunit. This idea has recently been confirmed biochemically (83). The p42 subunit has been identified not only as a component of the proteasome cap (also known as PA700) but also of the proteasome "modulator," a second complex that enhances cap activation of proteolytic activity (18). Whether a modulator of this sort also exists in S. cerevisiae is unknown.
It has been suggested that different ATPases within the
19S cap might serve to recognize distinct degradation substrates; a structural model for how this recognition specificity might be mediated has been proposed by Rechsteiner et al. (78). These authors note that members of this
family are highly conserved in their COOH-terminal regions and more divergent in their NH2-terminal segments
(see Fig. 3), suggesting that the latter portion of the molecule might be involved in specific substrate selection. As is
also the case for Pcs1p, these NH2-terminal domains contain stretches of sequence that are predicted to form leucine zippers or -helical coiled-coils. Rechsteiner et al. propose a "helix shuffle" hypothesis, in which these regions of
the ATPase subunits interact with similar regions within
target proteins. ATP hydrolysis would then serve to reverse this binding and to permit transfer of the substrates
to the 20S proteasome core. In partial confirmation of this
model, it has been shown that the leucine zipper in the murine homolog of Sug1/Cim3 protein interacts with the leucine zipper in c-Fos; both were detected in a 26S proteasome preparation (100), suggesting that murine Sug1/Cim3
may be involved in the degradation of c-Fos.
Genetic analysis supports the concept that different cap subunits might serve to recognize different substrates that have been targeted for degradation. At the restrictive temperature, pcs1td strains are arrested in the cell division cycle as large-budded cells with replicated, unsegregated DNA that is localized to the bud neck. Surprisingly, these cells do not form bipolar spindles, although cytoplasmic microtubule staining is clearly seen. The same phenotype has been seen for a temperature-sensitive allele of pcs1 generated by hydroxylamine mutagenesis (McDonald, H.B., and B. Byers, unpublished observations). Using EM, we determined that pcs1td cells fail to duplicate their SPBs. This phenotype differs strikingly both from any stage seen in normal cell cycle progression and from the arrests caused by cim3 and cim5. The SUG1/CIM3 and CIM5 gene products from S. cerevisiae are 19S cap subunits and are closely related to Pcs1p (Fig. 3). Conditional cim3 and cim5 mutations cause a cell to arrest in G2/M with a large bud and a short spindle (31), a state that is quite similar to that seen at the G2/M transition in a normal ongoing cell cycle. This phenotype suggests that the wild-type products of these genes play an active role in the degradation of APC-targeted substrates. Compatible with this view, the levels of B-type cyclins are increased in cim3 and cim5 mutants relative to wild type, even if the mutants are maintained in exponential growth at the permissive temperature (31). Since cyclin destruction is required for exit from mitosis, but not for initiation of anaphase (45, 91), the Sug1/Cim3 and Cim5 gene products are presumed to act in the degradation of other substrate(s) besides the cyclins. The distinctive pcs1td mutant phenotype suggests, on the other hand, that Pcs1p is required for the destruction of yet another class of substrate(s).
There is precedent for mutations in different proteasomal cap subunits differing in their effects on cell cycle regulation. The NIN1 gene of S. cerevisiae encodes a regulatory subunit of the 26S proteasome, but this protein is structurally unrelated to the family of ATPases that includes the SUG1/CIM3 and CIM5 products (55). Although the majority of nin1 cells arrest at the G2/M stage of the cell cycle, the nature of this arrest is distinct from that caused by cim3 or cim5. Arrested cim3 and cim5 mutants show activation of Cdc28p kinase, the S. cerevisiae CDK (31), consistent with the increased levels of mitotic cyclins observed in these mutants. In contrast, Cdc28p kinase is not activated in nin1 mutant cells after a shift to the restrictive temperature. The basis for this difference is unknown, but an intriguing suggestion offered is that NIN1 function is specifically required for the degradation of a CDK inhibitor (55).
The effectiveness of the pcs1td temperature-sensitive allele supports the idea that PCS1 function is dispensable for the degradation one particular substrate, the degron- Pcs1p fusion. Initially we were hesitant to attempt the construction of a temperature-sensitive PCS1 allele using the degron-based method, because degron fusions are targeted for proteolysis at high temperature by the N-end rule/ubiquitin/proteasome system. We therefore feared it might not be possible to deplete Pcs1p levels sufficiently by this technique, as Pcs1p might be required to play a role in its own destruction. However, we have identified conditions in which fully half the population of pcs1td cells will arrest during the first division cycle after shift to high temperature, suggesting that the degron-Pcs1p fusion probably is not a component of the proteolytic machinery that is needed for its destruction.
If different cap subunits are indeed responsible for the degradation of distinct substrates, several possible models could account for this phenomenon. For example, there might exist within the cell multiple subpopulations of 26S proteasomes, each containing different cap subunits responsible for the degradation of a specific set of substrates. Distinct subpopulations of proteasomes were suggested by recent experiments in Manduca sexta, where levels of 19S ATPases were found to vary differentially during development (15). An alternative model would be that all 26S proteasomes in yeast are identical, with different subunits within the proteasome cap being responsible for the recognition and import of different classes of substrates. Regardless of which model proves true, the largely nuclear localization of this and certain other 19S cap subunits supports the idea that a substantial fraction of fully assembled 26S proteasomes reside within the yeast nucleus. These findings suggest, in turn, that the majority of substrates targeted for degradation may also be localized to the yeast nucleus. More specifically, we propose that Pcs1p is required for the degradation of yet to be identified nuclear substrate(s), and that this activity is required for SPB duplication to occur.
Strikingly, this work has added a new member to the small collection of yeast genes for which conditional mutations specifically perturb the process of SPB duplication while permitting other early cell cycle functions to proceed unabated. Several distinct patterns of failure in SPB duplication are seen among these mutants. In the pattern displayed by mps2 (101) and ndc1 (102) mutants, a nascent SPB is assembled on the half-bridge, but it fails to be inserted into the nuclear envelope. In contrast, mutations in CDC31 (8), KAR1 (80), and MPS1 (101) prevent formation of the satellite, which serves as the precursor for the nascent SPB. The half-bridge in mps1 cells is dramatically enlarged relative to the more normal-appearing half-bridge found in cdc31-1 or kar1 cells at temperature-sensitive arrest. pcs1td cells likewise lack a normal half-bridge structure, but in this case the aberrant half-bridge is distinctively curvilinear in profile. Thus, mutations in these genes appear to alter the nature of half-bridge formation in different ways, each of which leads to failure of satellite formation and SPB duplication. In the case of pcs1td, we hypothesize that some nuclear factor(s) must be degraded for half-bridge formation to proceed correctly. Further experiments would be needed to identify the relevant substrate(s) and to test other possible roles for this cap component.
Received for publication 4 October 1996 and in revised form 24 February 1997.
1. Abbreviations used in this paper: APC, anaphase promoting complex; CDK, cyclin-dependent kinase; DAPI, 4We thank Drs. J. Dohmen, A. Varshavsky, M. Moser, R. Tsien, R. Heim, and F. Russo for gifts of plasmids, and Drs. M. Hochstrasser and C. Mann for yeast strains. We also thank Dr. C. Mann for communicating results prior to publication, L. Goetsch for her generous help with EM, Drs. L. Dirick and R. Coyne for useful discussions, and two anonymous reviewers for their useful comments.
This work was supported by a National Institutes of Health (NIH) postdoctoral fellowship (GM16027) to H.B. McDonald and an NIH research grant (GM18541) to B. Byers.