Article |
Address correspondence to Andreas Mayer, Friedrich-Miescher-Laboratorium der Max-Planck-Gesellschaft, Spemannstr. 37-39, 72076 Tübingen, Germany. Tel.: 49-7071-601850. Fax: 49-7071-601455. E-mail: Andreas.Mayer{at}Tuebingen.mpg.de
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: membrane fusion; vacuoles; SNAREs; V-ATPase; calcium
* Abbreviations used in this paper: BCECF, 2'7'-bis-(2-carboxyethyl)-5-(and 6)-carboxyfluorescein; FCCP, carbonylcyanide-4-trifluormethoxyphenylhydrazon; pmf, proton motive force.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The fusion of vacuoles from the yeast Saccharomyces cerevisiae shares many key features with other fusion reactions (Mayer, 2001). Thus, it can serve to test hypotheses about the fusion mechanism and about the role of specific conserved components. Vacuole fusion depends on the activation of t- and v-SNAREs by the ATPase Sec18p/NSF and its cofactor Sec17p/-SNAP and on a Rab-GTPase, Ypt7p (Haas et al., 1995; Haas and Wickner, 1996; Mayer et al., 1996; Ungermann et al., 1999a). Ypt7p cooperates with the HOPS complex, an oligomeric assembly of tethering factors containing the class C Vps proteins (Price et al., 2000ab; Sato et al., 2000; Seals et al., 2000; Wurmser et al., 2000). During priming, ATP hydrolysis by Sec18p/NSF disrupts cis-SNARE complexes (Nichols et al., 1997; Ungermann et al., 1998a) and yields SNAREs in a labile, activated state which is stabilized by the LMA1 complex (Xu and Wickner, 1996; Slusarewicz et al., 1997; Xu et al., 1997, 1998). Priming also releases the armadillo repeat protein Vac8p from SNAREs and triggers its palmitoylation (Veit et al., 2001; Rohde et al., 2003), a modification that might be relevant to the function of Vac8p in later stages of fusion (Wang et al., 2000). Priming facilitates tethering, the initial and less stable attachment of the fusion partners that depends on Ypt7p and the HOPS complex (Mayer and Wickner, 1997; Ungermann et al., 1998b; Price et al., 2000a). Specific interactions between HOPS and SNAREs involve the NH2-terminal domain of the SNARE Vam3p (Laage and Ungermann, 2001; Wang et al., 2001a). Tethering is a prerequisite for subsequent docking, a tighter binding of vacuoles that requires SNAREs and might involve the formation of trans-SNARE complexes, i.e., complexes of cognate t- and v-SNAREs on the opposing membranes (Ungermann et al., 1998b; Laage and Ungermann, 2001). Tethering and docking are accompanied by a concentration of many fusion-relevant components around the contact zones between vacuoles (Wang et al., 2002). Trans-SNARE complexes accumulate to low abundance during the fusion reaction (Ungermann et al., 1998b; Rohde et al., 2003). An enormous advantage of the vacuole fusion system is that trans-SNARE pairing can be directly assayed as an intermediate which is well integrated into the reaction pathway, a property that distinguishes it from the other major systems used to study membrane fusion. Notably, trans-SNARE pairs between vacuoles can be disassembled after docking without blocking further progression of fusion (Ungermann et al., 1998b). This indicates that SNAREs are required at least up to the docking stage but that trans-SNARE pairing may be dispensable for completion of the reaction.
Priming and docking also show specific lipid requirements, in particular for phosphatidylinositol 4,5-bisphosphate (Mayer et al., 2000), ergosterol (Kato and Wickner, 2001), and phosphatidylinositol 3-phosphate (Cheever et al., 2001; Boeddinghaus et al., 2002). Like exocytosis (Adamo et al., 1999, 2001; Guo et al., 2001; Zhang et al., 2001), vacuole fusion requires more than one small GTPase. In addition to the Rab-GTPase Ypt7p, the Rho-GTPases Cdc42p and Rho1p are involved (Eitzen et al., 2001; Muller et al., 2001), probably by regulating the remodeling of vacuolar actin. Dynamic changes of vacuolar actin occur during fusion (Eitzen et al., 2002; Seeley et al., 2002).
Vacuole docking triggers an efflux of calcium from the lumen of the organelle which fosters the binding of calmodulin to the membranes (Peters and Mayer, 1998). Calmodulin binds to a high molecular weight complex which contains the protein phosphatase 1 Glc7p (Peters et al., 1999) and V0 sectors, the membrane integral part of the vacuolar H+-ATPase (V-ATPase). Calmodulin was also found in association with the membrane integral VTC complex (Peters et al., 2001). The VTC complex binds to the V-ATPase, is required for the priming activity of Sec18p/NSF, and influences the binding of LMA1 to the membrane (Muller et al., 2002). VTC proteins may, therefore, couple Sec18p/NSF to V0, perhaps to activate it for a potential role in fusion. This speculation appears particularly attractive because a subset of V0 sectors, which is enriched in calmodulin and in the vacuolar t-SNARE Vam3p, form transcomplexes. V0 sectors from the opposing membranes bind to each other before fusion has been completed (Peters et al., 2001). A multimeric (probably hexameric) cylinder of proteolipids is a central part of the V0 sector (Hirata et al., 1997; Powell et al., 2000). Thus, V0 transcomplexes resemble the situation postulated in some pore models of fusion (Lindau and Almers, 1995; Mayer, 2001; Zimmerberg, 2001) which suggest that continuous proteinaceous pores composed of multiple subunits could mediate membrane fusion. This could occur, for example, by radial expansion of the cylinder and partial lateral separation of their subunits (Lindau and Almers, 1995) or by conformational changes of the pore subunits, resulting in rotation or the transient shifting of hydrophobic and hydrophilic surfaces (Zimmerberg, 2001). If vacuole fusion followed this or a similar pathway, proteolipids or entire V0 sectors should act in the postdocking phase of this reaction. We have begun to test this hypothesis by manipulating different V-ATPase subunits and assaying the effects on vacuolar membrane fusion.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We pursued in vivo and in vitro approaches to address this question. V-ATPasedeficient mutants die on neutral media and survive with slow growth on acidic media (Stevens and Forgac, 1997; Kane, 1999). Due to altered physiological properties of the cells, this complicates an in vivo analysis of vacuole structure. All deletions of core V-ATPase subunits result in this "vma phenotype," with one important exception: The a-subunit of the V-ATPase exists in two isoforms, the vacuolar isoform Vph1p and the Golgi or endosomal isoform Stv1p (Manolson et al., 1994). Both isoforms can substitute for one another in proton translocation, although they differ with respect to regulated V1/V0 dissociation that occurs upon glucose depletion (Parra and Kane, 1998; Kawasaki-Nishi et al., 2001a, b). A single deletion of either Vph1 or Stv1 does not result in the vma phenotype and permits healthy growth of the cells, also on neutral media (Manolson et al., 1994).
Deletion of the V0 subunit Vph1p results in vacuolar fusion defects
Absence of the vma phenotype makes vph1 mutants suitable for probing a role of V0 in vacuolar fusion in vivo. Mutation of fusion-relevant components frequently results in a fragmentation of vacuoles into multiple small vesicles in vivo (Raymond et al., 1992; Wada et al., 1992b). In some mutants, fragmentation does not occur, for example, after mutation of the v-SNARE Nyv1, Vtc1, or Vtc4 (Nichols et al., 1997; Muller et al., 2002). We assayed the in vivo effects of V-ATPase mutations by light microscopy after staining the vacuolar membranes with the red fluorescent vital dye FM464. Mutants lacking the vacuolar V0 subunit Vph1p showed numerous small vacuolar fragments which formed clusters (Fig. 1). This phenotype was observed with high frequency and resembles that of mutants in other genes with a function in the postdocking phase of vacuole fusion, such as Vtc3, Glc7 (protein phosphatase 1), calmodulin, or Vac8 (Peters and Mayer, 1998; Peters et al., 1999, 2001; Wang et al., 2001b; Muller et al., 2002). In contrast, mutation of Stv1, the Golgi/endosomal isoform of Vph1, did not result in vacuolar fragmentation (Fig. 1), nor did deletion of the V1 subunit Vma1p (unpublished data; with the strong caveat that this last mutant has the severe vma phenotype). Our results differ from those published in another study (Perzov et al., 2002) that reported vacuolar fragmentation for stv1 cells but not for
vph1 cells. Due to this discrepancy, we generated
vph1 mutants in three independent strain backgrounds and consistently observed vacuolar fragmentation. Currently, we have no explanation for this difference. However, our results are strongly corroborated by an unbiased microscopic screen for deletion mutants showing vacuolar fragmentation (Seeley et al., 2002). This genome wide screen identified mutants in four out of five Vo subunits as defective in vacuolar morphology, reporting a particularly strong phenotype for
vph1 but none for
stv1 or
vma1.
|
|
|
|
|
|
|
|
Coupling of Vph1p to the Ca2+-releasing channel
Docking triggers a Ca2+ release from the vacuolar lumen that strengthens the binding of calmodulin to the vacuolar membrane and triggers fusion (Peters and Mayer, 1998). We tested whether Vph1p function would even be required after the Ca2+/calmodulin-dependent step by accumulating reaction intermediates in the presence of the Ca2+ chelator BAPTA. This reversible block can be relieved by removing BAPTA and replenishing Ca2+ (Ungermann et al., 1999b). Completion of the reaction from this stage still showed significant sensitivity to anti-Vph1p (Fig. 8 C), although the effect was not as pronounced as for the low molecular weight inhibitor GTPS. This suggests that the antibody-sensitive stage might be tightly coupled to the Ca2+-requiring step and/or be overcome rapidly after removal of BAPTA. The requirement for Vph1p can obviously not be completely satisfied before completion of the Ca2+/calmodulin-dependent step. Together, the results from the kinetic analysis (Fig. 8 A), the direct assay of trans-SNARE pairing (Fig. 8 B), and the staging experiments (Fig. 8 C) all suggest that Vph1p functions after the completion of docking and trans-SNARE pairing, concomitant with or after the release of lumenal Ca2+ and close to the completion of fusion.
The relationship of Ca2+ release and Vph1p function in fusion was further characterized by monitoring Ca2+ release in the course of fusion. Fusion reactions were run in the presence of aequorin and coelenterazine (Muller et al., 2001). Aequorin is a protein that oxidizes its substrate coelenterazine in a Ca2+-dependent fashion, emitting light (Shimomura et al., 1993). This permits continuous recording of Ca2+ levels in the buffer of ongoing fusion reactions. In agreement with previous results obtained with a different approach (Peters and Mayer, 1998), treatments preventing priming, such as antibodies to Sec18p/NSF or Sec17p/-SNAP, suppressed the release of Ca2+ from the vacuolar lumen (Fig. 9 A). Docking inhibitors, such as antibodies to the t-SNAREs Vam3p and Vam7p had the same effect (not depicted). Surprisingly, antibodies to Vph1p also inhibited Ca2+ release, suggesting that either Vph1p or V0 itself might be involved in Ca2+ release or that Vph1p might be coupled to the Ca2+ channel. In both cases, adding an antibody to Vph1p might block a conformational change required for activation of the channel. Only in the first case, however, should deletion of Vph1p, which eliminates the vacuolar V0 sector as a whole (Stevens and Forgac, 1997; Kane and Parra, 2000), abolish Ca2+ release. This was not the case.
vph1 vacuoles showed Ca2+efflux just as their wild-type counterparts (Fig. 9 B). Efflux was sensitive to the Rab-GTPase inhibitor Gdi1p, demonstrating that it depended on docking and was triggered by the authentic fusion pathway. This permits several conclusions. First, it suggests that the fusion defect of
vph1 vacuoles is not due to the inability to release calcium. Second, Vph1p itself is not part of the Ca2+-releasing channel. Third, Vph1p may be coupled to the Ca2+ channel, leaving calcium release intact if Vph1p is absent but blocking it if Vph1p is inactivated by an antibody.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
First, we demonstrate that V0 does not only form transcomplexes but is critically involved in vacuole fusion in vitro and in vivo. The V0 requirement kinetically mapped to the reaction phase that follows completion of docking and trans-SNARE pairing (Ungermann et al., 1998b) and is independent of a proton gradient (Mayer et al., 1996; Mayer and Wickner, 1997; Ungermann et al., 1999b). However, this terminal reaction phase depends on Ca2+ release from the vacuolar lumen which triggers bilayer fusion (Peters and Mayer, 1998). This is consistent with the observation that V0 transcomplexes form after docking and depend on Ca2+ release (Peters et al., 2001). It establishes a correlation between the timing of V0 function in fusion and V0 transcomplex formation, strengthening the hypothesis that V0 transcomplex formation is tied to V0 function in vacuole fusion. Second, we demonstrate that Vph1p is required on both fusion partners. This symmetric requirement for Vph1p is consistent with a feature of some published pore models, namely that two membrane integral multisubunit cylinders connect the two membranes before fusion (Lindau and Almers, 1995; Zimmerberg, 2001).
Several lines of evidence suggest that trans-SNARE pairing is a necessary intermediate in vacuole fusion but that further events are required to drive the transition from docking to full fusion. First, quenching of the Ca2+ efflux by BAPTA reduces fusion activity to 10% of the control samples (Peters and Mayer, 1998), although BAPTA permits trans-SNARE pairing (Ungermann et al., 1999b). However, BAPTA blocks V0 transcomplex formation completely (Peters et al., 2001). Second, deletion of Vtc3 permits docking of the vacuoles, Ca2+ release, and V0 transcomplex formation but not fusion (Muller et al., 2002). Third, inactivation of V0 by deletion of Vph1p reduced fusion activity to 1015% of the control value, although trans-SNARE pairing was unaffected. This demonstrates that V0 is crucial for most of the observable fusion activity of vacuoles. Fourth, trans-SNARE complexes appear to be largely dispensable after the BAPTA-sensitive stage (Ungermann et al., 1998a, 1999b) but V0 is not. This correlates to the behavior of V0 transcomplexes because docking and trans-SNARE pairing are required to establish V0 transcomplexes. Once formed, however, V0 transcomplexes persist in the absence of SNARE complexes (Peters et al., 2001).
The 1015% of fusion activity observed after V0 inactivation is probably caused by trans-SNARE complexes, reflecting a basal level of fusion that may result from forcing the membranes into close proximity. It is possible that this basal activity is what could be reconstituted with purified SNAREs in liposomes. Although these liposomes contained high concentrations of SNAREs, they yielded significantly lower fusion rates than the equivalent complete fusion system can show in situ (Weber et al., 1998; Parlati et al., 1999). Lowering the v-SNARE concentration in liposomes to roughly physiological levels abolished this fusion activity (Mahal et al., 2002). It made the system completely dependent on an additional factor, the exocytic Ca2+ sensor synaptotagmin. Synaptotagmin strongly stimulated fusion, though in this case in a Ca2+-independent fashion.
It appears that both in triggered fusion events, such as regulated exocytosis, and in "constitutive" fusion events, such as vacuole fusion, the membranes require additional factors to efficiently progress from docking and trans-SNARE pairing to fusion. Such a function may be fulfilled by synaptotagmin in regulated exocytosis (Fernandez-Chacon et al., 2001; Chapman, 2002) or by V0 and Vtc3p in vacuole fusion. It is possible that proteins with related properties participate in other membrane fusion reactions. Candidates exist, as exemplified by Got1p and Sft2p, tetraspanning membrane proteins with a genetic interaction with the t-SNARE Sed5p and some similarities to the V0 proteolipids. Got1p is required in a postdocking stage of ER-Golgi trafficking and forms multimeric assemblies in the membrane (Conchon et al., 1999). SCAMP2 was identified as a factor required for endocytosis but also for a very late step in mast cell exocytosis. SCAMP2 is also a tetraspanning membrane protein that belongs to a protein family with members on various compartments, exists as a multimeric complex in the membrane, and binds to the t-SNARE subunit SNAP-23 (Singleton et al., 1997; Fernandez-Chacon et al., 2000; Fernandez-Chacon and Sudhof, 2000; Guo et al., 2002).
Ca2+ is released from the vacuolar lumen in a way that depends on priming and docking (Peters and Mayer, 1998). Now we have discovered that inactivation of the V0 subunit Vph1p by antibodies prevents this release, but deletion of Vph1p does not. Since inactivation of Vph1p by deletion or antibodies interferes neither with priming nor with docking (Fig. 8 B; unpublished data), we propose that the effect of Vph1p antibodies on Ca2+ release may reflect a coupling of Vph1p to the putative Ca2+ channel. Whether this coupling would be direct or indirect via shared binding partners cannot be judged at the moment. But it is striking that V0 is associated with the t-SNARE Vam3p (Peters et al., 2001) and that t-SNAREs in regulated exocytosis were shown to specifically bind to calcium channels (Leveque et al., 1994; Sheng et al., 1994). Our hypothesis is further supported by the differential effects of Ca2+ chelators on fusion (Peters and Mayer, 1998). Only BAPTA, a Ca2+ chelator with a rapid association rate, can block fusion. EGTA, which has a comparable Kd for Ca2+ but a much slower association rate, is not effective. This difference is best explained by assuming that the site of Ca2+ release and the Ca2+ effector proteins (in case of the vacuoles the effectors are most likely V0 and calmodulin [Peters et al., 2001]) are tightly associated. Then, chelators must act rapidly to be able to quench Ca2+ before it diffuses to and binds its receptor site (Neher, 1998). An analogous situation exists in regulated exocytosis. The triggering stage of this reaction is only sensitive to fast Ca2+ chelators (Adler et al., 1991), and the Ca2+ channels are associated with syntaxin (t-SNARE) in the plasma membrane (Leveque et al., 1994; Sheng et al., 1994). They should hence be close to the fusion site. This provides a physical correlate for the differential sensitivity of exocytosis to BAPTA and EGTA.
The reconstituted proteolipid cylinder of the V-ATPase can form large pores in response to binding of Ca2+ and calmodulin, demonstrating a potential for significant conformational changes in the membrane (Peters et al., 2001). On the other hand, a fraction of V0 in vacuolar membranes is associated with the VTC complex, a membrane integral complex that is required for the priming activity of Sec18p/NSF (Muller et al., 2002) and for membrane binding of LMA1, i.e., it is coupled to two components that are directly involved in generating (Sec18p; Mayer et al., 1996; Ungermann et al., 1998a) or maintaining (LMA1; Mayer and Wickner, 1997; Xu et al., 1997) an activated state of the fusion machinery. Therefore, we speculate that Vph1p, or the entire V0 sector, might undergo significant conformational changes during fusion, perhaps driven by Sec18p/NSF. Antibodies to Vph1p may prevent such conformational changes and thereby also block Ca2+ release through a channel associated with V0. Such coupling should be functionally relevant because Ca2+ release from the lumen of an organelle can only be transient. If the fusion system is not competent to respond to Ca2+ at the time of release, the reaction might be nonproductive. One might expect higher efficiency of the overall process if Ca2+ release and the Ca2+ controlled fusion system were activated in a coordinated fashion. This question can be answered with certainty only once the Ca2+-releasing channel will have been identified and assays for conformational changes of V0 during fusion will be available.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Deletion strains of VPH1 were made by replacing the gene with a loxP-kanMX-loxP cassette from plasmid pUG6 (Guldener et al., 1996) using the following primers: Vph1 forward K.O., GCCTCTCAATATATCTATACTTGCTTAGAGGGCTACCTGTGTCAGCTGAAGCTTCGTACGC and Vph1 reverse K.O., CTGGTGGATTGGATTGCAAGTCTAACGTTTTCATGAGATAAGGCATAGGCCACTAGTGGATCTG. Vma1 and Vma2 were deleted by replacement with the HIS3 cassette from plasmid pRS 303 using the following primers: VMA1 forward, ATGGCTGGTGCAATTGAAAAGCTCGTAAGGAAATAAAAAGAATCAGATTGTACTGAGAGTGCAC, VMA1 reverse, CAGACAAGGCCGATTTACAACTAATTGAACAACTTGTTCCTG-TGCGGTATTTCACACCG, VMA2 forward, GGTGTGAACGGTCCATT-AGTCATTTGGAAAAGGTCAAGTTCCCAGATTGTACTGAGAGTGCAC, and VMA2 reverse, GAATCTTTGGGGAGATTCTATTCAACATCTCCTTAGGGTAGCTGTGCGGTATTTCACACCG. All deletions were verified by diagnostic colony PCR and by Western blotting of purified vacuoles from the mutants.
General procedures
Vacuole isolation, cytosol preparation, fusion, purification of antibodies or Gdi1p, inhibitors, and FM464 staining were as described (Peters and Mayer, 1998; Peters et al., 1999). PS buffer is 10 mM Pipes/KOH, pH 6.8, and 200 mM sorbitol. 1x PIC is a protease inhibitor cocktail: 100 µM pefabloc SC, 100 ng/ml leupeptin, 50 µM o-phenanthroline, and 500 ng/ml pepstatin A. Vacuoles without V1 sector were prepared as described (Peters et al., 2001). In experiments with BAPTA, the alkaline phosphatase assay mixture contained 10 mM CaCl2. All samples were centrifuged (1 min, 14, 000 g) before spectrophotometry to remove precipitated Ca2+ salts.
Proton uptake activity of vacuoles
BCECF assay.
For the determination of pump activity, 100-µl fusion reactions were incubated at 25°C with 0.5 µM BCECF-dextran (70 K; Molecular Probes). The change of fluorescence was measured at an excitation of 490 nm and an emission of 520 nm in a Perkin Elmer LS50B fluorometer or in a plate reader fluorometer (Spectra Max Gemini; Molecular Devices). Initial pump activity was determined as described (Peters et al., 2001). In brief, the pH shift in the medium was followed via the pH-dependent shift in fluorescence of BCECF. This shift could be calibrated by buffering the solution to different pH values using PS buffer with 150 mM KCl.
Acridine orange assay.
Proton uptake of vacuoles was measured essentially as described. The absorbance changes of acridine orange at 491 and 540 nm were followed in a Beckman Coulter DU-600 spectrophotometer (Gluck et al., 1982). The difference between these values at any time point serves as a measure of the vacuolar pmf. The reaction mixture in a final volume of 100 µl contained 20 µg of vacuoles under standard fusion conditions with 15 µM acridine orange. The reaction was started by the addition of 5 µl of ATP regenerating system. At the end, 30 µM FCCP were added. Proton uptake activity was defined as the absorbance change in the first 20 s of the reaction.
Trans-SNARE assay
120-µl fusion reactions (containing 24-µg vacuoles) with cytosol (0.5 µg/µl) were incubated for 50 min. The reactions were stopped by chilling the samples on ice. 380 µl of precipitation buffer were added (150 mM KCl, 1.3% [wt/vol] Triton X-100, 1.3 mM PMSF, 1.2x PIC, 13 mM EDTA, 200 mM Sorbitol, 10 mM Pipes/KOH, pH 6.8). Samples were shaken (10 min, 4°C) and centrifuged (21,000 g, 10 min). 450 µl of the solubilisate were transferred to a new reaction tube. 3% of the volume was kept as load control. 14 µg of affinity-purified anti-Vam3p antibody and 100 µl of a 1:4 slurry of protein ASepharose CL-4B (Amersham Biosciences) preequilibrated in washing buffer (150 mM KCl, 1% [wt/vol] Triton X-100, 1 mM PMSF, 1x PIC, 10 mM EDTA, 200 mM Sorbitol, 10 mM Pipes/KOH, pH 6.8) were added to each sample. After 1 h of shaking at 4°C, the protein ASepharose was washed three times with washing buffer. Residual liquid was removed with a Hamilton pipette. 80 µl SDS sample buffer was added, and aliquots were analyzed by gel electrophoresis and Western blotting.
Generation of antibodies to Vph1p
Vph1 cytosolic domain (Vph1-Cyt) was cloned with an NH2-terminal His6 tag for expression in Escherichia coli. The coding region of this domain was amplified by PCR using primers cyt Vph1 forward, GCAGAGAAGGAGGAAGCGATTTTTC, cyt Vph1 reverse, TCACTGGACTTCAATTTGATCGGT, and genomic DNA as a template. The PCR product was cloned into pCR T7/NT-TOPO (Invitrogen). The resulting plasmid was transformed into E. coli BL21. Cells were grown in LB/Ampicillin medium (37°C, 225 rpm) to an OD600 of 0.6. Expression was induced with 1 mM IPTG at 37°C for 4 h. Cells were harvested by centrifugation (10,000 g, 7 min), washed with twofold-concentrated PBS, and lysed by two freezethaw cycles and sonication in twofold-concentrated PBS, 8 M urea. The lysate (50 ml out of 8 liters culture) was centrifuged (20,000 g, 15 min, 4°C) and batch incubated with Ni-NTA resin (1 ml bed volume, 2 h, 4°C). The resin was washed with 20 ml of twofold-concentrated PBS, 0.05% SDS and with 20 ml twofold-concentrated PBS, 0.05% SDS, and 10 mM imidazole. Urea was omitted during washing to avoid interference in the following coupling reaction. 0.05% SDS was added to avoid precipitation during elution from the column. The protein was eluted with 150 mM imidazole. The eluate (containing 3 mg of protein) was directly coupled (1 h, RT) to 1.5 ml CH-activated Sepharose 4 B (Amersham Biosciences).
Antibodies to Vph1-Cyt were raised by injecting purified recombinant protein eluate (300500 µg per boost) into a goat. Serum (10 ml) was affinity purified using the recombinant protein immobilized on activated CHSepharose 4B. The serum was diluted with 1 vol PBS and passed over the column at RT. The column was washed with 2025 column volumes of PBS. Antibodies were eluted with 0.1 M glycine pH 2.75/150 mM NaCl, and the pH was immediately neutralized by adding 1 M Tris/HCl, pH 8.8. The antibodies were transferred into PS buffer with 150 mM KCl by repeated dilution and ultrafiltration in centricon-30 (Amicon) and stored at -20°C. Control antibodies were affinity purified with protein G from preimmune serum and treated as above.
Preparation of Fab fragments
Fab fragments were prepared from Vph1p antibodies essentially according to the manufacturer's instructions (ImmunoPure Fab Preparation kit; Pierce Chemical Co.). 20 mg of purified antibody were diluted with 1 vol of digestion buffer (as supplied). The solution (2 ml) was incubated overnight at 30°C with 0.5 ml immobilized papain. The sample was centrifuged, and the supernatant was passed over a protein G column to remove uncleaved antibodies and Fc Fragments. The flowthrough containing the Fab fragments was repeatedly diluted and concentrated to exchange the buffer for PS with 150 mM KCl.
Ca2+ assay
Ca2+ release from vacuoles in the course of the fusion reaction was assayed similarly as described (Peters and Mayer, 1998) with the following modifications. Ca2+ was directly measured with aequorin in ongoing fusion reactions running in parallel in a microtiter plate luminometer (EG&G Berthold). Reactions (30 µl) contained 10 µg of vacuoles from strain BJ3505 in PS buffer with 150 mM KCl and 0.5 µl cytosol (30 mg/ml). Respective inhibitors were included. After 2 min of preincubation on ice, 2 µl of ATP regenerating system (same composition as in the fusion assay) and 3 µl of a freshly prepared 2:2:1 mix of the following stock solutions were added: 2.5 µM aequorin (Aqualite; Molecular Probes), 1 mM EGTA/KOH, pH 7.5, and 500 µM native coelenterazine (Molecular Probes) in EtOH. Samples were pipetted into a microtiter plate, and light emission of aequorin was measured with the luminometer for 60 min at 27°C. The assay was calibrated with solutions of different calcium concentrations as described (Peters and Mayer, 1998).
FM464 staining
Cells were grown logarithmically in liquid YPD overnight (OD600 < 2) at 30°C. Cells were harvested (2 min, 3,000 g), resuspended in YPD with 10 µM FM464 at OD600 = 1, and shaken for 3 h at 30°C. Cells were harvested as above, resuspended in YPD at OD600 = 0.2, and shaken for 23 h at 30°C. For microscopy, individual samples were removed from the shaker. Cells were harvested (1 min, 3,000 g), resuspended in YPD at OD600 = 10, and immediately analyzed by fluorescence microscopy. For quantitation of vacuole morphology, photos of at least 20 random fields were taken. Vacuoles were counted in at least 200 cells per experiment and condition.
![]() |
Acknowledgments |
---|
This work was supported by grants from the Deutsche Forschungsgemeinschaft (SFB184) and from the Human Frontier Science Program.
Submitted: 2 December 2002
Revised: 27 May 2003
Accepted: 27 May 2003
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Adachi, I., K. Puopolo, N. Marquez-Sterling, H. Arai, and M. Forgac. 1990. Dissociation, cross-linking, and glycosylation of the coated vesicle proton pump. J. Biol. Chem. 265:967973.
Adamo, J.E., G. Rossi, and P. Brennwald. 1999. The Rho GTPase Rho3 has a direct role in exocytosis that is distinct from its role in actin polarity. Mol. Biol. Cell. 10:41214133.
Adamo, J.E., J.J. Moskow, A.S. Gladfelter, D. Viterbo, D.J. Lew, and P.J. Brennwald. 2001. Yeast Cdc42 functions at a late step in exocytosis, specifically during polarized growth of the emerging bud. J. Cell Biol. 155:581592.
Adler, E.M., G.J. Augustine, S.N. Duffy, and M.P. Charlton. 1991. Alien intracellular calcium chelators attenuate neurotransmitter release at the squid giant synapse. J. Neurosci. 11:14961507.[Abstract]
Arai, H., S. Pink, and M. Forgac. 1989. Interaction of anions and ATP with the coated vesicle proton pump. Biochemistry. 28:30753082.[Medline]
Boeddinghaus, C., A.J. Merz, R. Laage, and C. Ungermann. 2002. A cycle of Vam7p release from and PtdIns 3-Pdependent rebinding to the yeast vacuole is required for homotypic vacuole fusion. J. Cell Biol. 157:7990.
Chapman, E.R. 2002. Synaptotagmin: a Ca(2+) sensor that triggers exocytosis? Nat. Rev. Mol. Cell Biol. 3:498508.[CrossRef][Medline]
Cheever, M.L., T.K. Sato, T. de Beer, T.G. Kutateladze, S.D. Emr, and M. Overduin. 2001. Phox domain interaction with PtdIns(3)P targets the Vam7 t-SNARE to vacuole membranes. Nat. Cell Biol. 3:613618.[CrossRef][Medline]
Chen, Y.A., and R.H. Scheller. 2001. SNARE-mediated membrane fusion. Nat. Rev. Mol. Cell Biol. 2:98106.[CrossRef][Medline]
Conchon, S., X. Cao, C. Barlowe, and H.R. Pelham. 1999. Got1p and Sft2p: membrane proteins involved in traffic to the Golgi complex. EMBO J. 18:39343946.
Conradt, B., J. Shaw, T. Vida, S. Emr, and W. Wickner. 1992. In vitro reactions of vacuole inheritance in Saccharomyces cerevisiae. J. Cell Biol. 119:14691479.[Abstract]
Conradt, B., A. Haas, and W. Wickner. 1994. Determination of four biochemically distinct, sequential stages during vacuole inheritance in vitro. J. Cell Biol. 126:99110.[Abstract]
Cunningham, K.W., and G.R. Fink. 1994. Calcineurin-dependent growth control in Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+ ATPases. J. Cell Biol. 124:351363.[Abstract]
Drose, S., and K. Altendorf. 1997. Bafilomycins and concanamycins as inhibitors of V-ATPases and P-ATPases. J. Exp. Biol. 200:18.
Eitzen, G., N. Thorngren, and W. Wickner. 2001. Rho1p and Cdc42p act after Ypt7p to regulate vacuole docking. EMBO J. 20:56505656.
Eitzen, G., L. Wang, N. Thorngren, and W. Wickner. 2002. Remodeling of organelle-bound actin is required for yeast vacuole fusion. J. Cell Biol. 158:669679.
Fernandez-Chacon, R., and T.C. Sudhof. 2000. Novel SCAMPs lacking NPF repeats: ubiquitous and synaptic vesicle-specific forms implicate SCAMPs in multiple membrane-trafficking functions. J. Neurosci. 20:79417950.
Fernandez-Chacon, R., M. Achiriloaie, R. Janz, J.P. Albanesi, and T.C. Sudhof. 2000. SCAMP1 function in endocytosis. J. Biol. Chem. 275:1275212756.
Fernandez-Chacon, R., A. Konigstorfer, S.H. Gerber, J. Garcia, M.F. Matos, C.F. Stevens, N. Brose, J. Rizo, C. Rosenmund, and T.C. Sudhof. 2001. Synaptotagmin I functions as a calcium regulator of release probability. Nature. 410:4149.[CrossRef][Medline]
Forster, C., and P.M. Kane. 2000. Cytosolic Ca2+ homeostasis is a constitutive function of the V-ATPase in Saccharomyces cerevisiae. J. Biol. Chem. 275:3824538253.
Gluck, S., S. Kelly, and Q. Al-Awqati. 1982. The proton translocating ATPase responsible for urinary acidification. J. Biol. Chem. 257:92309233.
Gotte, M., T. Lazar, J.S. Yoo, D. Scheglmann, and D. Gallwitz. 2000. The full complement of yeast Ypt/Rab-GTPases and their involvement in exo- and endocytic trafficking. Subcell. Biochem. 34:133173.[Medline]
Guldener, U., S. Heck, T. Fielder, J. Beinhauer, and J.H. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24:25192524.
Guo, W., F. Tamanoi, and P. Novick. 2001. Spatial regulation of the exocyst complex by Rho1 GTPase. Nat. Cell Biol. 3:353360.[CrossRef][Medline]
Guo, Z., L. Liu, D. Cafiso, and D. Castle. 2002. Perturbation of a very late step of regulated exocytosis by a secretory carrier membrane protein (SCAMP2)-derived peptide. J. Biol. Chem. 277:3535735363.
Haas, A., and W. Wickner. 1996. Homotypic vacuole fusion requires Sec17p (yeast alpha-SNAP) and Sec18p (yeast NSF). EMBO J. 15:32963305.[Abstract]
Haas, A., B. Conradt, and W. Wickner. 1994. G-protein ligands inhibit in vitro reactions of vacuole inheritance. J. Cell Biol. 126:8797.[Abstract]
Haas, A., D. Scheglmann, T. Lazar, D. Gallwitz, and W. Wickner. 1995. The GTPase Ypt7p of Saccharomyces cerevisiae is required on both partner vacuoles for the homotypic fusion step of vacuole inheritance. EMBO J. 14:52585270.[Abstract]
Hirata, R., L.A. Graham, A. Takatsuki, T.H. Stevens, and Y. Anraku. 1997. VMA11 and VMA16 encode second and third proteolipid subunits of the Saccharomyces cerevisiae vacuolar membrane H+-ATPase. J. Biol. Chem. 272:47954803.
Kane, P.M. 1999. Biosynthesis and regulation of the yeast vacuolar H+-ATPase. J. Bioenerg. Biomembr. 31:4956.[CrossRef][Medline]
Kane, P.M., and K.J. Parra. 2000. Assembly and regulation of the yeast vacuolar H(+)-ATPase. J. Exp. Biol. 203:8187.[Abstract]
Kane, P.M., C.T. Yamashiro, and T.H. Stevens. 1989. Biochemical characterization of the yeast vacuolar H(+)-ATPase. J. Biol. Chem. 264:1923619244.
Kato, M., and W. Wickner. 2001. Ergosterol is required for the Sec18/ATP-dependent priming step of homotypic vacuole fusion. EMBO J. 20:40354040.
Kawasaki-Nishi, S., K. Bowers, T. Nishi, M. Forgac, and T.H. Stevens. 2001a. The amino-terminal domain of the vacuolar proton-translocating ATPase a subunit controls targeting and in vivo dissociation, and the carboxyl-terminal domain affects coupling of proton transport and ATP hydrolysis. J. Biol. Chem. 276:4741147420.
Kawasaki-Nishi, S., T. Nishi, and M. Forgac. 2001b. Yeast V-ATPase complexes containing different isoforms of the 100-kDa a-subunit differ in coupling efficiency and in vivo dissociation. J. Biol. Chem. 276:1794117948.
Klionsky, D.J., P.K. Herman, and S.D. Emr. 1990. The fungal vacuole: composition, function, and biogenesis. Microbiol. Rev. 54:266292.[Medline]
Laage, R., and C. Ungermann. 2001. The N-terminal domain of the t-SNARE Vam3p coordinates priming and docking in yeast vacuole fusion. Mol. Biol. Cell. 12:33753385.
Leveque, C., O. el Far, N. Martin-Moutot, K. Sato, R. Kato, M. Takahashi, and M.J. Seagar. 1994. Purification of the N-type calcium channel associated with syntaxin and synaptotagmin. A complex implicated in synaptic vesicle exocytosis. J. Biol. Chem. 269:63066312.
Lindau, M., and W. Almers. 1995. Structure and function of fusion pores in exocytosis and ectoplasmic membrane fusion. Curr. Opin. Cell Biol. 7:509517.[CrossRef][Medline]
Mahal, L.K., S.M. Sequeira, J.M. Gureasko, and T.H. Sollner. 2002. Calcium-independent stimulation of membrane fusion and SNAREpin formation by synaptotagmin I. J. Cell Biol. 158:273282.
Manolson, M.F., B. Wu, D. Proteau, B.E. Taillon, B.T. Roberts, M.A. Hoyt, and E.W. Jones. 1994. STV1 gene encodes functional homologue of 95-kDa yeast vacuolar H(+)- ATPase subunit Vph1p. J. Biol. Chem. 269:1406414074.
Mayer, A. 2001. What drives membrane fusion in eukaryotes? Trends Biochem. Sci. 26:717723.[CrossRef][Medline]
Mayer, A., and W. Wickner. 1997. Docking of yeast vacuoles is catalyzed by the Ras-like GTPase Ypt7p after symmetric priming by Sec18p (NSF). J. Cell Biol. 136:307317.
Mayer, A., W. Wickner, and A. Haas. 1996. Sec18p (NSF)-driven release of Sec17p (alpha-SNAP) can precede docking and fusion of yeast vacuoles. Cell. 85:8394.[Medline]
Mayer, A., D. Scheglmann, S. Dove, A. Glatz, W. Wickner, and A. Haas. 2000. Phosphatidylinositol 4,5-bisphosphate regulates two steps of homotypic vacuole fusion. Mol. Biol. Cell. 11:807817.
Moriyama, Y., and N. Nelson. 1989. Cold inactivation of vacuolar proton-ATPases. J. Biol. Chem. 264:35773582.
Muller, O., D.I. Johnson, and A. Mayer. 2001. Cdc42p functions at the docking stage of yeast vacuole membrane fusion. EMBO J. 20:56575665.
Muller, O., M.J. Bayer, C. Peters, J.S. Andersen, M. Mann, and A. Mayer. 2002. The Vtc proteins in vacuole fusion: coupling NSF activity to V0 trans-complex formation. EMBO J. 21:259269.
Neher, E. 1998. Vesicle pools and Ca2+ microdomains: new tools for understanding their roles in neurotransmitter release. Neuron. 20:389399.[Medline]
Nichols, B.J., C. Ungermann, H.R. Pelham, W.T. Wickner, and A. Haas. 1997. Homotypic vacuolar fusion mediated by t- and v-SNAREs. Nature. 387:199202.[CrossRef][Medline]
Ohsumi, Y., and Y. Anraku. 1981. Active transport of basic amino acids driven by a proton motive force in vacuolar membrane vesicles of Saccharomyces cerevisiae. J. Biol. Chem. 256:20792082.
Ohsumi, Y., and Y. Anraku. 1983. Calcium transport driven by a proton motive force in vacuolar membrane vesicles of Saccharomyces cerevisiae. J. Biol. Chem. 258:56145617.
Parlati, F., T. Weber, J.A. McNew, B. Westermann, T.H. Sollner, and J.E. Rothman. 1999. Rapid and efficient fusion of phospholipid vesicles by the alpha-helical core of a SNARE complex in the absence of an N-terminal regulatory domain. Proc. Natl. Acad. Sci. USA. 96:1256512570.
Parra, K.J., and P.M. Kane. 1998. Reversible association between the V1 and V0 domains of yeast vacuolar H+-ATPase is an unconventional glucose-induced effect. Mol. Cell. Biol. 18:70647074.
Pelham, H.R. 2001. SNAREs and the specificity of membrane fusion. Trends Cell Biol. 11:99101.[CrossRef][Medline]
Perzov, N., V. Padler-Karavani, H. Nelson, and N. Nelson. 2002. Characterization of yeast V-ATPase mutants lacking Vph1p or Stv1p and the effect on endocytosis. J. Exp. Biol. 205:12091219.
Peters, C., and A. Mayer. 1998. Ca2+/calmodulin signals the completion of docking and triggers a late step of vacuole fusion. Nature. 396:575580.[CrossRef][Medline]
Peters, C., P.D. Andrews, M.J. Stark, S. Cesaro-Tadic, A. Glatz, A. Podtelejnikov, M. Mann, and A. Mayer. 1999. Control of the terminal step of intracellular membrane fusion by protein phosphatase 1. Science. 285:10841087.
Peters, C., M.J. Bayer, S. Buhler, J.S. Andersen, M. Mann, and A. Mayer. 2001. Trans-complex formation by proteolipid channels in the terminal phase of membrane fusion. Nature. 409:581588.[CrossRef][Medline]
Powell, B., L.A. Graham, and T.H. Stevens. 2000. Molecular characterization of the yeast vacuolar H+-ATPase proton pore. J. Biol. Chem. 275:2365423660.
Price, A., D. Seals, W. Wickner, and C. Ungermann. 2000a. The docking stage of yeast vacuole fusion requires the transfer of proteins from a cis-SNARE complex to a Rab/Ypt protein. J. Cell Biol. 148:12311238.
Price, A., W. Wickner, and C. Ungermann. 2000b. Proteins needed for vesicle budding from the Golgi complex are also required for the docking step of homotypic vacuole fusion. J. Cell Biol. 148:12231229.
Raymond, C.K., I. Howald-Stevenson, C.A. Vater, and T.H. Stevens. 1992. Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell. 3:13891402.[Abstract]
Rohde, J., L. Dietrich, D. Langosch, and C. Ungermann. 2003. The transmembrane domain of Vam3 affects the composition of cis- and trans-SNARE complexes to promote homotypic vacuole fusion. J. Biol. Chem. 278:16561662.
Rothman, J.E. 1994. Mechanisms of intracellular protein transport. Nature. 372:5563.[CrossRef][Medline]
Sato, T., Y. Ohsumi, and Y. Anraku. 1984. Substrate specificities of active transport systems for amino acids in vacuolar-membrane vesicles of Saccharomyces cerevisiae. Evidence of seven independent proton/amino acid antiport systems. J. Biol. Chem. 259:1150511508.
Sato, T.K., P. Rehling, M.R. Peterson, and S.D. Emr. 2000. Class C Vps protein complex regulates vacuolar SNARE pairing and is required for vesicle docking/fusion. Mol. Cell. 6:661671.[Medline]
Seals, D.F., G. Eitzen, N. Margolis, W.T. Wickner, and A. Price. 2000. A Ypt/Rab effector complex containing the Sec1 homolog Vps33p is required for homotypic vacuole fusion. Proc. Natl. Acad. Sci. USA. 97:94029407.
Seeley, E.S., M. Kato, N. Margolis, W. Wickner, and G. Eitzen. 2002. Genomic analysis of homotypic vacuole fusion. Mol. Biol. Cell. 13:782794.
Sheng, Z.H., J. Rettig, M. Takahashi, and W.A. Catterall. 1994. Identification of a syntaxin-binding site on N-type calcium channels. Neuron. 13:13031313.[Medline]
Shimomura, O., B. Musicki, Y. Kishi, and S. Inouye. 1993. Light-emitting properties of recombinant semi-synthetic aequorins and recombinant fluorescein-conjugated aequorin for measuring cellular calcium. Cell Calcium. 14:373378.[Medline]
Singleton, D.R., T.T. Wu, and J.D. Castle. 1997. Three mammalian SCAMPs (secretory carrier membrane proteins) are highly related products of distinct genes having similar subcellular distributions. J. Cell Sci. 110:20992107.
Slusarewicz, P., Z. Xu, K. Seefeld, A. Haas, and W.T. Wickner. 1997. I2B is a small cytosolic protein that participates in vacuole fusion. Proc. Natl. Acad. Sci. USA. 94:55825587.
Sollner, T., S.W. Whiteheart, M. Brunner, H. Erdjument-Bromage, S. Geromanos, P. Tempst, and J.E. Rothman. 1993. SNAP receptors implicated in vesicle targeting and fusion. Nature. 362:318324.[CrossRef][Medline]
Stevens, T.H., and M. Forgac. 1997. Structure, function and regulation of the vacuolar (H+)-ATPase. Annu. Rev. Cell Dev. Biol. 13:779808.[CrossRef][Medline]
Ungermann, C., B.J. Nichols, H.R. Pelham, and W. Wickner. 1998a. A vacuolar v-t-SNARE complex, the predominant form in vivo and on isolated vacuoles, is disassembled and activated for docking and fusion. J. Cell Biol. 140:6169.
Ungermann, C., K. Sato, and W. Wickner. 1998b. Defining the functions of trans-SNARE pairs. Nature. 396:543548.[CrossRef][Medline]
Ungermann, C., G.F. von Mollard, O.N. Jensen, N. Margolis, T.H. Stevens, and W. Wickner. 1999a. Three v-SNAREs and two t-SNAREs, present in a pentameric cis-SNARE complex on isolated vacuoles, are essential for homotypic fusion. J. Cell Biol. 145:14351442.
Ungermann, C., W. Wickner, and Z. Xu. 1999b. Vacuole acidification is required for trans-SNARE pairing, LMA1 release, and homotypic fusion. Proc. Natl. Acad. Sci. USA. 96:1119411199.
Veit, M., R. Laage, L. Dietrich, L. Wang, and C. Ungermann. 2001. Vac8p release from the SNARE complex and its palmitoylation are coupled and essential for vacuole fusion. EMBO J. 20:31453155.
Wada, Y., and Y. Anraku. 1994. Chemiosmotic coupling of ion transport in the yeast vacuole: its role in acidification inside organelles. J. Bioenerg. Biomembr. 26:631637.[Medline]
Wada, Y., Y. Ohsumi, and Y. Anraku. 1992a. Chloride transport of yeast vacuolar membrane vesicles: a study of in vitro vacuolar acidification. Biochim. Biophys. Acta. 1101:296302.[Medline]
Wada, Y., Y. Ohsumi, and Y. Anraku. 1992b. Genes for directing vacuolar morphogenesis in Saccharomyces cerevisiae. I. Isolation and characterization of two classes of vam mutants. J. Biol. Chem. 267:1866518670.
Wang, L., C. Ungermann, and W. Wickner. 2000. The docking of primed vacuoles can be reversibly arrested by excess Sec17p (alpha-SNAP). J. Biol. Chem. 275:2286222867.
Wang, L., E.S. Seeley, W. Wickner, and A.J. Merz. 2002. Vacuole fusion at a ring of vertex docking sites leaves membrane fragments within the organelle. Cell. 108:357369.[Medline]
Wang, Y., I. Dulubova, J. Rizo, and T.C. Sudhof. 2001a. Functional analysis of conserved structural elements in yeast syntaxin Vam3p. J. Biol. Chem. 276:2859828605.
Wang, Y.X., E.J. Kauffman, J.E. Duex, and L.S. Weisman. 2001b. Fusion of docked membranes requires the armadillo repeat protein Vac8p. J. Biol. Chem. 276:3513335140.
Weber, T., B.V. Zemelman, J.A. McNew, B. Westermann, M. Gmachl, F. Parlati, T.H. Sollner, and J.E. Rothman. 1998. SNAREpins: minimal machinery for membrane fusion. Cell. 92:759772.[Medline]
Wurmser, A.E., T.K. Sato, and S.D. Emr. 2000. New component of the vacuolar class C-Vps complex couples nucleotide exchange on the Ypt7 GTPase to SNARE-dependent docking and fusion. J. Cell Biol. 151:551562.
Xu, Z., and W. Wickner. 1996. Thioredoxin is required for vacuole inheritance in Saccharomyces cerevisiae. J. Cell Biol. 132:787794.[Abstract]
Xu, Z., A. Mayer, E. Muller, and W. Wickner. 1997. A heterodimer of thioredoxin and I(B)2 cooperates with Sec18p (NSF) to promote yeast vacuole inheritance. J. Cell Biol. 136:299306.
Xu, Z., K. Sato, and W. Wickner. 1998. LMA1 binds to vacuoles at Sec18p (NSF), transfers upon ATP hydrolysis to a t-SNARE (Vam3p) complex, and is released during fusion. Cell. 93:11251134.[Medline]
Zhang, X., E. Bi, P. Novick, L. Du, K.G. Kozminski, J.H. Lipschutz, and W. Guo. 2001. Cdc42 interacts with the exocyst and regulates polarized secretion. J. Biol. Chem. 276:4674546750.
Zimmerberg, J. 2001. How can proteolipids be central players in membrane fusion? Trends Cell Biol. 11:233235.[CrossRef][Medline]