Article |
Address correspondence to Hiroshi Masumoto, Graduate School of Science, Nagoya University, Chikusa-ku, Nagoya 464-8602, Japan. Tel.: 81-52-789-2985. Fax: 81-52-789-5732. E-mail: g44478a{at}nucc.cc.nagoya-u.ac.jp
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: CENP-B; CENP-B box; alphoid DNA; MAC; CENP-A
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Many protein components of the centromere have been identified, including centromere proteins (CENPs)* A, B, C, E, H, and F (Earnshaw and Rothfield, 1985; for review see Warburton, 2001), and some of these protein components are conserved among yeast species and humans (for review see Kitagawa and Hieter, 2001). In particular, CENP-A, a centromere-specific histone H3 variant (Sullivan et al., 1994; Shelby et al., 1997), is highly conserved among most eukaryotes (for review see Choo, 2001). This protein is required for assembly of other centromere components (Howman et al., 2000), and is considered a fundamental component of the centromere-specific chromatin structure. CENP-B, a highly conserved protein in humans and mice, is specifically localized at the centromere (Earnshaw and Rothfield, 1985). This protein binds to the 17-bp motif of the CENP-B box sequence in alphoid DNA at its amino-terminal region and forms homodimers at its carboxy-terminal region (Masumoto et al., 1989; Yoda et al., 1992). CENP-C, a constitutive centromere protein, localizes at the inner kinetochore laminar on mitotic chromosomes and is required for centromere function (Saitoh et al., 1992; Kalitsis et al., 1998). CENP-E transiently assembles on the outer surface of the kinetochore on mitotic chromosomes and is required for mitotic check point and interactions between the kinetochore and spindle microtubules (Yen et al., 1991; Abrieu et al., 2000). On the other hand, centromeric DNA organization is very divergent among species (for reviews see Murphy and Karpen, 1998; Choo, 2001; Henikoff et al., 2001). Thus, there is no single general theory of how these centromere chromatin components assemble at specific genetic loci in eukaryotes, although the roles of centromeric DNA in some species have been clarified.
In humans, the relationship between centromeric DNA organization and function is complicated. Human alphoid DNA contains a huge repetitive sequence, exists only at the centromeric region, and is found in all human chromosomes (Alexandrov et al., 2001). Alphoid sequences consist of tandem repeats of an AT-rich 171-bp alphoid monomer unit, and some alphoid monomers form chromosome-specific higher-order repeated units (Willard, 1985; for review see Willard and Waye, 1987). The repetitive structure of alphoid DNA can be classified into two types of repeats (Ikeno et al., 1994): units composed of several monomers (type-I alphoid repeat; Fig. 1 a, 21-I) and monomeric organization consisting of diverged alphoid monomer units (type-II alphoid repeat; Fig. 1 a,
21-II). Centromere components are mainly assembled on type-I alphoid sequences (Ikeno et al., 1994; Ando et al., 2002, Politi et al., 2002). Human artificial chromosome formation is associated only with type-I alphoid sequences (Harrington et al., 1997; Ikeno et al., 1998; Masumoto et al., 1998; Schueler et al., 2001). The CENP-B box appears only in type-I alphoid sequences (Masumoto et al., 1989; Muro et al., 1992; Haaf and Ward, 1994) of autosomes and X chromosomes. However, it has been reported that neocentromeres (a rare phenomenon in which centromeres form on fragmented chromosomes) have no significant centromeric DNA sequences, not even alphoid DNA (du Sart et al., 1997; Lo et al., 2001). Like the Y chromosome, neocentromere-containing chromosomes are stably maintained in cells that undergo mitosis (Tyler-Smith et al., 1999).
|
In this paper, to determine whether information carried by the type-I alphoid DNA sequence is involved in assembly of human centromeres, we created four kinds of homogeneous synthetic repeated sequences: a type-I alphoid DNA sequence and a nonalphoid sequence, with and without CENP-B boxes. Using the mammalian artificial chromosome (MAC) formation assay (Harrington et al., 1997; Ikeno et al., 1998; Masumoto et al., 1998; Ebersole et al., 2000) and a newly developed competitive chromatin immunoprecipitation (CHIP) assay, we obtained the first known molecular evidence of a functional relationship between de novo centromeric chromatin assembly and centromeric satellite DNA.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We divided the 21-I 11mer unit into 4mer, 2mer, and 5mer fragments by treating it with the restriction endonuclease EcoRI. Using PCR, we introduced a two-nucleotide substitution into all five active CENP-B box sequences, making them all identical to an inactive sequence at the CENP-B box position of the number 10 alphoid monomer unit (Fig. 1, a and b; see Materials and methods). Loss of interaction between CENP-B protein and the fragments with modified CENP-B boxes was confirmed using a gel mobility shift competition assay. The 2mer, 4mer, and 5mer fragments with modified CENP-B boxes did not compete with labeled DNA containing the CENP-B box for complex formation with CENP-B, even with a 100-fold excess of these fragments (Fig. 2). Then, the fragments were reintegrated to form a modified
21-I 11mer repeating unit (mutant
21-I 11mer).
|
|
|
|
|
Comparing the results obtained for pWTR11.32 and pMTR11.32, it is clear that binding of CENP-B to the CENP-B boxes in alphoid DNA is important for MAC formation. Although it has been suggested that input DNA multimerization, coupled with MAC formation, is caused by binding of CENP-B to CENP-B boxes (Ebersole et al., 2000), the pMTR11.32 plasmid was multimerized at a level similar to that of the pWTR11.32 plasmid and a control BAC plasmid containing only the neomycin resistance gene without alphoid DNA insert (unpublished data). We did not detect any significant relationships between CENP-B binding activity and input DNA amplification.
Centromere protein assembly on the MAC and MAC stability in cell divisions
We assessed whether CENP-B and the essential centromere components CENP-A, -C, and -E were assembled on introduced DNA, by simultaneous detection of indirect immunofluorescent staining and FISH on metaphase chromosomes using specific antibodies and a digoxygenin-labeled BAC DNA probe. In all analyzed cell lines, assembly of all four of these centromere-specific proteins was detected on all the MACs in metaphase spreads (Fig. 4 b; Table II).
Next, using FISH analysis, we analyzed mitotic stability of these MACs after 60 d of culture without the selective drug G418. The MACs were very stable for an extended period, with a loss rate per cell division of <0.18% of a copy in most cases (Table II). Thus, we conclude that these MACs obtained a functional centromere. MAC formation and centromere protein assembly were dependent on the existence of CENP-B box sequences in alphoid DNA.
Variegated assembly of centromere proteins on ectopically integrated synthetic 21-I 11mer repeats
To confirm that MAC formation and centromere protein assembly are dependent on CENP-B binding activity, we analyzed the distribution of centromere proteins on the ectopic pWTR11.32 and pMTR11.32 integration sites. Two cell lines in which pWTR11.32 integrated into a host chromosomal arm (2/27 pWTR11.32 cell lines) were used for the wild-type sequence. We recloned these cell lines in order to obtain cell lines with homogeneous ectopic integration of pWTR11.32. In these subcloned cell lines, 838% of cells exhibited partial assembly of CENP-A, -B, -C, and -E at the ectopic integration sites of pWTR11.32, and the CENP-A, -C, and -E signals at the ectopic sites always colocalized with CENP-B in all analyzed chromosome spreads (Fig. 4 d; Table II).
Our subcloned cell lines containing ectopically integrated pWTR11.32 exhibited a variegated assembly pattern similar to that observed for pseudo-dicentric and dicentric chromosomes (Earnshaw et al., 1989; Wandall, 1994). Although the molecular mechanisms are still unclear, a phenomena called centromere inactivation, which is known to be one of the epigenetic mechanisms of centromere regulation, may involve this variegated assembly (Fisher et al., 1997; unpublished data).
In contrast, in cell lines with ectopic integration of alphoid repeats with mutant CENP-B boxes (pMTR11.32) into host chromosomal arms, no CENP-B signal was observed at the integration sites. Furthermore, there was no assembly of functional centromere components CENP-A, -C, or -E at the ectopic sites (six cell lines were analyzed) (Fig. 4 f; Table II).
Direct assembly of CENP-A and CENP-B on synthetic alphoid sequences
In this study and previous studies, using cytological observation, we demonstrated that centromere protein assembly and MAC formation occur on the introduced alphoid DNA via a de novo mechanism without acquiring host centromeres. However, it was not easy to detect direct assembly of centromere components on the introduced alphoid DNA at the molecular level because of the difficulty in distinguishing the introduced alphoid DNA from endogenous alphoid DNA sequences.
In the present study, we used synthetic alphoid DNA to generate artificial chromosomes. We designed a specific primer set that discriminates our synthetic DNA (pWTR11.32 and pMTR11.32) from endogenous alphoid sequences. We then tested whether the centromeric chromatin components CENP-A and CENP-B assembled on WTR DNA directly, using the CHIP assay and competitive PCR detection (Becker-Andre and Hahlbrock, 1989). In our CHIP and competitive PCR assays, in order to standardize individual preparations and PCR for each sample, we used as an internal reference pMTR11.32-transformed cells (M1319) that did not exhibit centromere protein assembly at the synthetic alphoid integration site. We mixed the internal reference cells with sample cells, pWTR11.32-transformed cells (W0203) containing MACs.
Before starting the CHIP analyses, to examine the linearity of our competitive PCR assay as a control experiment, W0203 and M1319 cells were mixed at different ratios of cell number (from 16:1 to 1:16), and genomic DNAs were prepared from these mixtures. Using the competitive PCR assay with a specific primer set, we confirmed that synthetic alphoid DNA fragments from WTR11.32 and MTR11.32 were amplified parallel to each other and competitively even after the DNA preparation, maintaining the initial ratio of WTR and MTR fragments (Fig. 5, a and b). Then, a WTR11.32 and MTR11.32 cell mixture (1:1) was fixed, sonicated, and immunoprecipitated in a single tube and used as competitive PCR start material. The WTR11.32 DNA fragment was immunoprecipitated 37 times and eight times more efficiently than the reference MTR11.32 DNA fragment with antiCENP-A and antiCENP-B antibodies, respectively; whereas these two synthetic alphoid fragments were nonspecifically immunoprecipitated at the same ratio to the input DNA with normal IgG (Fig. 5 c). However, when antihistone H3 antibody was used, the ratio of immunoprecipitated WTR11.32 fragment to MTR11.32 decreased to
60%. These results indicate that considerable numbers of nucleosomes on WTR11.32 DNA on the MAC were replaced with nucleosomes containing CENP-A.
|
No MAC formation and no centromere chromatin assembly on nonalphoid repeated sequences containing CENP boxes
Using two kinds of synthetic 21-I 11mer alphoid repeats (
60% AT rich), we demonstrated that the CENP-B box sequence is required for high-efficiency de novo centromeric chromatin assembly. However, this raises the question of whether the CENP-B box is sufficient for de novo assembly without depending on the AT-rich alphoid sequence. The AT-rich trend is common in many eukaryotic centromere DNAs (Lo et al., 2001; for reviews see Choo, 1997b; Koch, 2000; Henikoff, 2002), therefore, suggested to be one of possible properties for efficient centromeric chromatin assembly. However, our results clearly showed that the synthetic AT-rich
21-I 11mer alphoid repeats with inactive CENP-B boxes alone could not induce any assembly of centromere chromatin (Fig. 4 f; Fig. 5 c; Table II). If the CENP-B box is sufficient, de novo centromere formation may occur even on GC-rich spacer sequences. We thus tested whether the CENP-B binding site induces de novo centromeric chromatin assembly on an exogenous nonalphoid GC-rich (
60%) sequence, the 340-bp NheI-SphI restriction fragment (corresponding to the length of alphoid dimer) from plasmid pBR322 (RF322). CENP-B boxes appear on every other monomer unit (
170 bp x 2) in the
21-I 11mer alphoid unit, and we joined the RF322 fragment to a CENP-B box or a spacer sequence at the SphI site. These DNA constructs, with CENP-B boxes (RF322B) or without CENP-B boxes (RF322L), were cloned into the pBACNX vector between the NheI and SpeI sites, and were concatemerized tandemly to a length of 69 kb (pRF322B.192 and pRF322L.192, respectively), as described above (Fig. 3 a; Fig. 6 a).
|
Using FISH analysis and simultaneous detection of indirect immunofluorescent staining on metaphase chromosomes, we detected no assembly of the essential centromere component proteins CENP-A, -C, or -E at the integration sites of synthetic RF322B. Only CENP-B protein was detected at the RF322B sites (Fig. 4, g and h; Table II). At the RF322L integration sites, no signals were detected for any of these four centromere proteins (Table II). In competitive CHIP analysis, significant relative concentration of the RF322B fragment versus RF322L was only detected with antiCENP-B antibody; no significant relative concentration was observed with antiCENP-A or antihistone H3 antibodies (Fig. 6 b). Thus, we concluded that interaction between CENP-B and the CENP-B box is not sufficient for de novo centromere chromatin assembly on the nonalphoid GC-rich sequence, although it is required for centromere chromatin assembly on alphoid DNA.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In the present study, using the MAC formation assay, we analyzed the relationship between de novo centromere chromatin assembly and the sequences of centromeric DNA, alphoid DNA, and CENP-B boxes. Using synthetic repetitive DNAs, we demonstrated that only alphoid DNA and CENP-B boxes, but no other sequences from the human chromosomes, are required for de novo centromere assembly and MAC formation. These results not only provide important information for constructing human artificial chromosomes but also provide evidence supporting the theory that CENP-BCENP-B box interaction is involved in the centromere assembly mechanism. Also, these results indicate that there is an element or a character in 21-I 11mer alphoid DNA, other than the CENP-B box, that is important for de novo centromere formation. Further analysis using reverse genetic methods (mutational analyses) such as the MAC formation assay may be needed to identify this important element. MAC technology has gradually been advancing through clarification of relationships between DNA sequence elements and chromosome functions. In the near future, an ideal human artificial chromosome with full chromosomal functions (like YACs) may be created.
Selective assembly of CENP-A chromatin on introduced synthetic alphoid DNA with CENP-B binding capacity
In this study, using cytological analyses, we demonstrated that the functional centromere components CENP-A, -C, and -E assemble on synthetic alphoid DNA fragments, and that CENP-B binding capacity of alphoid DNA sequences has a major effect on this assembly. Moreover, using a CHIP-based competitive PCR assay, we demonstrated direct assembly of CENP-A on synthetic alphoid DNA that contained functional CENP-B boxes. In contrast, at integration sites of an artificial repeated sequence based on RF322 (derived from pBR322), no CENP-A chromatin assembly was detected, although CENP-B assembly was detected on sequences that contained CENP-B boxes. Therefore, we hypothesize that there are important elements or characters in the 21-I 11mer alphoid DNA sequence that aid in stabilizing or assembling centromere chromatin, including CENP-A chromatin.
As described in the Results, AT-rich regions of alphoid DNA may contain such important elements or characters. Although CENP-A folded DNA sequences are not conserved among centromeres of eukaryotes, these sequences tend to be AT rich (AT content is usually at least 60%) in many eukaryotes, including yeast and humans (for reviews see Choo, 1997b; Koch, 2000; Henikoff, 2002). No sequence conservation is observed between human alphoid DNA and mouse centromeric minor satellite DNA (120-bp repeats), except CENP-B boxes and AT-rich nucleotide composition. We speculate that this AT-rich nucleotide composition may facilitate CENP-A nucleosome folding. Another possibility, that the relationship between regular higher-order structure and nucleosomal phasing pattern is affected by type-I alphoid DNA sequence and CENP-B/CENP-B box function, has previously been suggested (Muro et al., 1992; Romanova et al., 1996; Yoda et al., 1998). It is possible that compartmentalization of alphoid DNA by CENP-BCENP-B box interaction restricts contact between, for example, the CENP-Ahistone H4 heterotetramer (or histone H3/H4) and alphoid DNA (Sullivan et al., 1994; Shelby et al., 1997; Ando et al., 2002), and that this restriction of alphoid DNA is the basis of selectivity for CENP-Ahistone H4 tetramer incorporation. A third possibility is that alphoid DNA contains binding sites for other centromere component proteins. We have detected proteinprotein interactions between CENP-B and CENP-C using yeast two-hybrid analysis and an immunoprecipitation assay with HeLa chromatin (unpublished data). It has been reported that CENP-C exhibits nonspecific DNA binding activity (Yang et al., 1996), and that CENP-C associates with type-I alphoid DNA in vivo (Politi et al., 2002). This suggests that CENP-B and CENP-C play a cooperative functional role in de novo centromere formation, and that there is specific interaction between the kinetochore and type-I alphoid DNA containing CENP-B boxes.
Absence of CENP-B boxes from the Y centromere and neocentromere
CENP-B or CENP-B box has not been detected in the alphoid DNA on the Y chromosome or the neocentromere-specific DNA sequence. In CENP-B knockout mouse cells, functional structures of kinetochores are maintained without CENP-B (Hudson et al., 1998). How do these centromeres maintain their activity without de novo assembly? It might be explicable with a functional redundancy. On the other hand, the epigenetic character of centromeres has been well described. The other possibility is that once established, the centromere activity is maintained by the chromatin assembly mechanism (Williams et al., 1998; for reviews see Murphy and Karpen, 1998; Wiens and Sorger, 1998). However, in all normal human chromosomes, functional centromere structures are formed and maintained on the alphoid DNA arrays. This study, indeed, provides evidence of a molecular link between a centromere-specific DNA and centromeric chromatin assembly in humans. The mechanisms that specify the centromere location in each species are not straightforward; thus, further investigations on centromere DNA structures and functions and its molecular evolution correlating both with the epigenetic chromatin assembly and the de novo assembly are needed (Laurent et al., 1999; Alexandrov et al., 2001; Schueler et al., 2001; for review see Henikoff, 2002).
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Tandem concatenation of synthetic alphoid repeat units
We subcloned wild-type and modified 21-I 11mer repeat units into a BAC vector (pBACNX), which includes a neomycin resistance gene, between NheI and SpeI endonuclease sites. Plasmid DNA with the inserted
21-I 11mer unit was digested using two different endonuclease sets: NheI-HindIII and SpeI-HindIII. When the two resulting fragment types were ligated, the inserted fragments were concatenated tandemly, with no change in the physical relationships between the inserts and the endonuclease sites. Repeating this cycle of cutting and ligation resulted in tandem multiple repeat arrays of the inserted fragments (Fig. 3 a).
Construction of nonalphoid repeats
A 340-bp NheI-SphI restriction fragment from the pBR322 plasmid (RF322) was ligated at the SphI site to the CENP-B box sequence, GCATGCGATATCTTTCGTTGGAAACGGGACTAGT (RF322B), or a spacer oligonucleotide sequence, GCATGCGAATTCCTGTATATAAAACCAGACTAGT (RF322L). The two resulting DNA constructs were cloned into the pBACNX vector between the NheI and SpeI sites, and were concatemerized to form 69-kb tandem repeats (pRF322B.192 and pRF322L.192, respectively), as shown in Fig. 3 a and Fig. 6 a.
Gel mobility shift competition assay
Gel mobility shift competition assays were performed using the radiolabeled CB59 probe, which includes a single CENP-B box sequence in a 59-bp oligonucleotide (Muro et al., 1992). Fragments of wild-type and modified 21-I 11mer subunits were generated for the competition assay by PCR, using plasmids containing cloned wild-type or mutant 2-, 4-, and 5mer fragments with M13 forward and reverse primers (TAKARA). More details are provided in a previous report (Masumoto et al., 1989; Yoda et al., 1992).
Cell culture and transformation
HT1080 human fibroblast cells were cultured in DME supplemented with 10% (vol/vol) FCS, penicillin, streptomycin, and L-glutamine at 37°C in a 5% CO2 incubator. Introduced BAC DNAs were purified using a QIAGEN large construction kit. Using 4.5 µl of Lipofectamine reagent (GIBCO BRL), 0.4 µg of purified DNA was transfected into 80% confluent HT1080 cells in 3.5-cm dishes.
Cytological detection
Templates of in situ hybridization probes were prepared by PCR. Primers for p11-4, pan-alphoid, and intra-/inter-Alu sequences are described in our previous reports (Ikeno et al., 1998, Masumoto et al., 1998). The BAC vector template was generated by PCR using a pBAC108L template and the following primers: BACX, 5'-CCCTCGAGTGAGCGAGGAAGCACCAGGG-3', and BACS, 5'-GCTCGTCGACAGCGACACACTTGCATCGG-3'. PCR products were labeled using a nick translation kit with digoxygenin-11dUTP or biotin-16dUTP (Roche Diagnostics). For simultaneous indirect immunofluorescence and FISH staining, we used antiCENP-A (monoclonal antibody A1; Ando et al., 2002), antiCENP-B (monoclonal antibody 2D8D8), antiCENP-C (CGp2; Ikeno et al., 1998), and anti-CENP-E (monoclonal antibody 177; Yen et al., 1991).
Quantification of multiplicity of introduced DNA
Multiplicity of introduced DNA was determined using a quantitative competitive PCR assay (Wang et al., 1989). Competitor DNAs for the host genomic sequence, the neomycin resistance gene sequence, junctions of synthetic 21-I 11mer sequences, and synthetic RF322 sequences were prepared using a competitive DNA construction kit (TAKARA). Genomic DNA samples were isolated by agarase treatment and sonication from agarose plugs, which were prepared as described elsewhere (Ikeno et al., 1994). The primers were as follows: G1 (host genome), 5'-CTCCATTTGGAGTGAGCCCGG-3'; G2 (host genome), 5'-ACGGTTCAAATTCTGCACCC-3'; N1 (neomycin resistance gene), 5'-TGATTAGGGTGATGGTTCACGTAG-3'; N2 (neomycin resistance gene), 5'-CTGCATTCTAG-TTGTGGTTTGTCC-3'; SA1 (junctions of synthetic alphoid sequences), 5'-TCTGAGAATCCTTCTGTCTC-3'; SA2 (junctions of synthetic alphoid sequences), 5'-GGGAATTCGCTAGTGAATTC-3'; RF1 (RF322 synthetic repeat), 5'-TGGGTATGGTGGCAGGCCC-3'; and RF2 (RF322 synthetic repeat), 5'-CGCCATGATCGCGTAGTCG-3'. The amount of synthetic alphoid DNA was designated as equivalent to multiplicity of the inserted alphoid fragment (60 kb) on the BAC. DNA content of the MAC was estimated by quantification of the fluorescence intensity of the propidium iodide (5 µg/ml)stained metaphase spread image (Ikeno et al., 1998). Multiplicity was designated as equivalent to the copy number of 67-kb BAC DNA.
Competitive CHIP assay
A sample cell line produced by pWTR11.32 transformation and a reference cell line produced by pMTR11.32 transformation were harvested. These cell lines contained similar levels of BAC DNA. They were mixed together and then fixed with 0.25% formalin in the same tube at 22°C for 5 min. After fixation, the cells were centrifuged and recovered in buffer S (100 mM Hepes, pH 8.0, aprotinin, leupeptin, 1% BSA). Recovered cells were sonicated for 7 min with Biorupter (Cosmobio). After sonication, samples were supplemented with an equal volume of 2x buffer W (aprotinin, leupeptin, 1% BSA, 0.4% NP-40, 0.4% SDS, 20 mM MgCl2, 10 mM ATP, 0.02 mg/ml RNase A) and sonicated again for 2 min. This sample was centrifuged, and the supernatant was used as input material.
Input material prepared from 5 x 105 cells was immunoprecipitated by using 5 µg of antibody with 25 µg protein GSepharose (Amersham Biosciences). Immunoprecipitated DNA was washed three times with buffer W (10 mM Hepes, aprotinin, leupeptin, 1% BSA, 0.2% NP-40, 0.2%, SDS, 10 mM MgCl2, 5 mM ATP, 0.01 mg/ml RNase A) and then eluted by buffer E (2.5% SDS, 10 mM Tris, 0.1 mM EDTA). The antibodies used were anti-H3 (Upstate Biotechnology), antiCENP-A, and antiCENP-B.
The recovered DNA sample was used as a template in PCR with the amplification primers for the synthetic wild-type sequence and the 21-I 11mer with modified CENP-B boxes (SA3, TTTTTGATGTGTGTACCCAGCC, and SA4, ACCTTTTATTTGAATTCCC) and the amplification primers for the synthetic RF322 repeats (RF1 and RF2). After PCR, amplified DNA was digested by the endonuclease EcoRV (for the synthetic
21-I 11mer repeats) or EcoRI (for the synthetic RF322 repeats). Digested samples were analyzed by agarose gel electrophoresis. Gel images were quantified using Advanced Quantifier (Bio Image).
![]() |
Footnotes |
---|
![]() |
Acknowledgments |
---|
This research was supported by a grant-in-aid for Scientific Research on Priority Areas (B), Core Research for Evolutional Science and Technology, and Special Coordination Funds for Promoting Science and Technology from the Ministry of Education, Science, Sports, and Culture of Japan, as well as a grant-in-aid for Basic Research 21 for Breakthroughs in Info-Communications and a grant-in-aid from the Cell Science Research Foundation. J. Ohzeki is a research fellow of the Japan Society for the Promotion of Science.
Submitted: 22 July 2002
Revised: 25 October 2002
Accepted: 25 October 2002
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alexandrov, I., A. Kazakov, I. Tumeneva, V. Shepelev, and Y. Yurov. 2001. -Satellite DNA of primates: old and new families. Chromosoma. 110:253266.[Medline]
Ando, S., H. Yang, N. Nozaki, T. Okazaki, and K. Yoda. 2002. CENP-A, -B, and -C chromatin complex that contains the I-type -satellite array constitutes the prekinetochore in HeLa cells. Mol. Cell. Biol. 22:22292241.
Becker-Andre, M., and K. Hahlbrock. 1989. Absolute mRNA quantification using the polymerase chain reaction (PCR). A novel approach by a PCR aided transcript titration assay (PATTY). Nucleic Acids Res. 17:94379446.[Abstract]
Choo, K.H.A. 1997a. The Centromere. Oxford University Press, Oxford, UK. 320 pp.
Choo, K.H. 2001. Domain organization at the centromere and neocentromere. Dev. Cell. 1:165177.[Medline]
Earnshaw, W.C., and N. Rothfield. 1985. Identification of a family of human centromere proteins using autoimmune sera from patients with scleroderma. Chromosoma. 91:313321.[Medline]
Ebersole, T.A., A. Ross, E. Clark, N. McGill, D. Schindelhauer, H. Cooke, and B. Grimes. 2000. Mammalian artificial chromosome formation from circular alphoid input DNA does not require telomere repeats. Hum. Mol. Genet. 9:16231631.
Grimes, B.R., A.A. Rhoades, and H.F. Willard. 2002. -Satellite DNA and vector composition influence rates of human artificial chromosome formation. Mol. Ther. 5:798805.[CrossRef][Medline]
Haaf, T., and D.C. Ward. 1994. Structural analysis of -satellite DNA and centromere proteins using extended chromatin and chromosomes. Hum. Mol. Genet. 3:697709.[Abstract]
Henikoff, S. 2002. Near the edge of a chromosome's "black hole." Trends Genet. 18:165167.[CrossRef][Medline]
Henikoff, S., K. Ahmad, and H.S. Malik. 2001. The centromere paradox: stable inheritance with rapidly evolving DNA. Science. 293:10981102.
Howman, E.V., K.J. Fowler, A.J. Newson, S. Redward, A.C. MacDonald, P. Kalitsis, and K.H. Choo. 2000. Early disruption of centromeric chromatin organization in centromere protein A (Cenpa) null mice. Proc. Natl. Acad. Sci. USA. 97:11481153.
Hudson, D.F., K.J. Fowler, E. Earle, R. Saffery, P. Kalitsis, H. Trowell, J. Hill, N.G. Wreford, D.M. de Kretser, M.R. Cancilla, et al. 1998. Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights. J. Cell Biol. 141:309319.
Ikeno, M., H. Masumoto, and T. Okazaki. 1994. Distribution of CENP-B boxes reflected in CREST centromere antigenic sites on long-range -satellite DNA arrays of human chromosome 21. Hum. Mol. Genet. 3:12451257.[Abstract]
Kalitsis, P., K.J. Fowler, E. Earle, J. Hill, and K.H. Choo. 1998. Targeted disruption of mouse centromere protein C gene leads to mitotic disarray and early embryo death. Proc. Natl. Acad. Sci. USA. 95:11361141.
Koch, J. 2000. Neocentromeres and -satellite: a proposed structural code for functional human centromere DNA. Hum. Mol. Genet. 9:149154.
Lo, A.W., D.J. Magliano, M.C. Sibson, P. Kalitsis, J.M. Craig, and K.H. Choo. 2001. A novel chromatin immunoprecipitation and array (CIA) analysis identifies a 460-kb CENP-A-binding neocentromere DNA. Genome Res. 11:448457.
Masumoto, H., H. Masukata, Y. Muro, N. Nozaki, and T. Okazaki. 1989. A human centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a human centromeric satellite. J. Cell Biol. 109:19631973.[Abstract]
Mejia, J.E., A. Willmott, E. Levy, W.C. Earnshaw, and Z. Larin. 2001. Functional complementation of a genetic deficiency with human artificial chromosomes. Am. J. Hum. Genet. 69:315326.[CrossRef][Medline]
Muro, Y., H. Masumoto, K. Yoda, N. Nozaki, M. Ohashi, and T. Okazaki. 1992. Centromere protein B assembles human centromeric -satellite DNA at the 17-bp sequence, CENP-B box. J. Cell Biol. 116:585596.[Abstract]
Murray, A.W., and J.W. Szostak. 1983. Construction of artificial chromosomes in yeast. Nature. 305:189193.[Medline]
Politi, V., G. Perini, S. Trazzi, A. Pliss, I. Raska, W.C. Earnshaw, and G.D. Valle. 2002. CENP-C binds the -satellite DNA in vivo at specific centromere domains. J. Cell Sci. 115:23172327.
Saffery, R., L.H. Wong, D.V. Irvine, M.A. Bateman, B. Griffiths, S.M. Cutts, M.R. Cancilla, A.C. Cendron, A.J. Stafford, and K.H. Choo. 2001. Construction of neocentromere-based human minichromosomes by telomere-associated chromosomal truncation. Proc. Natl. Acad. Sci. USA. 98:57055710.
Schueler, M.G., A.W. Higgins, M.K. Rudd, K. Gustashaw, and H.F. Willard. 2001. Genomic and genetic definition of a functional human centromere. Science. 294:109115.
Shelby, R.D., O. Vafa, and K.F. Sullivan. 1997. Assembly of CENP-A into centromeric chromatin requires a cooperative array of nucleosomal DNA contact sites. J. Cell Biol. 136:501513.
Sullivan, K.F., M. Hechenberger, and K. Masri. 1994. Human CENP-A contains a histone H3related histone fold domain that is required for targeting to the centromere. J. Cell Biol. 127:581592.[Abstract]
Wandall, A. 1994. A stable dicentric chromosome: both centromeres develop kinetochores and attach to the spindle in monocentric and dicentric configuration. Chromosoma. 103:5662.[Medline]
Wang, A.M., M.V. Doyle, and D.F. Mark. 1989. Quantitation of mRNA by the polymerase chain reaction. Proc. Natl. Acad. Sci. USA. 86:97179721.[Abstract]
Wiens, G.R., and P.K. Sorger. 1998. Centromeric chromatin and epigenetic effects in kinetochore assembly. Cell. 93:313316.[Medline]
Willard, H.F., and J.S. Waye. 1987. Hierarchical order in chromosome-specific human alpha satellite DNA. Trends Genet. 3:192198.[CrossRef]
Yang, C.H., J. Tomkiel, H. Saitoh, D.H. Johnson, and W.C. Earnshaw. 1996. Identification of overlapping DNA-binding and centromere-targeting domains in the human kinetochore protein CENP-C. Mol. Cell. Biol. 16:35763586.[Abstract]
Yen, T.J., D.A. Compton, D. Wise, R.P. Zinkowski, B.R. Brinkley, W.C. Earnshaw, and D.W. Cleveland. 1991. CENP-E, a novel human centromere-associated protein required for progression from metaphase to anaphase. EMBO J. 10:12451254.[Abstract]
Yoda, K., K. Kitagawa, H. Masumoto, Y. Muro, and T. Okazaki. 1992. A human centromere protein, CENP-B, has a DNA binding domain containing four potential helices at the NH2 terminus, which is separable from dimerizing activity. J. Cell Biol. 119:14131427.[Abstract]
Yoda, K., S. Ando, A. Okuda, A. Kikuchi, and T. Okazaki. 1998. In vitro assembly of the CENP-B/-satellite DNA/core histone complex: CENP-B causes nucleosome positioning. Genes Cells. 3:533548.
Related Article