|
Article |
Address correspondence to M.N.J. Seaman, Cambridge Institute for Medical Research, University of Cambridge, Wellcome Trust/MRC Building, Addenbrookes Hospital, Hills Road, Cambridge CB2 2XY, England, UK. Tel.: (44) 1223-762627. Fax: (44) 1223-762640. email: mnjs100{at}cam.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: retromer; vesicle; retrieval; endosome; Golgi
Abbreviations used in this paper: CD-MPR, cation-dependent mannose 6-phosphate receptor; CI-MPR, cation-independent mannose 6-phosphate receptor; CPY, carboxypeptidase Y; MPR, mannose 6-phosphate receptor; siRNA, small interfering RNA; Snx, sorting nexin; TfnR, transferrin receptor.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Two types of MPR exist in mammalian cells, the cation-independent MPR (CI-MPR) and the cation-dependent MPR (CD-MPR). Both are type 1 transmembrane proteins that share some sequence similarity in their luminal domains (Kornfeld, 1992). Although there is no sequence homology between Vps10p and the MPRs, fundamentally they perform an identical task, namely that of sorting newly synthesized hydrolases into a pathway that will ultimately deliver the enzymes to the lysosome/vacuole. Recent evidence now supports a role for the conserved Golgi-associated, earcontaining ARF-binding proteins (GGAs) in the sorting of both MPRs and Vps10p at the TGN/late Golgi (Robinson and Bonifacino, 2001). The VHS domains of GGA proteins recognize acidic clusterdileucine signals in the cytoplasmic tails of MPRs and Vps10p, and can also bind clathrin via their hinge regions (Mullins and Bonifacino, 2001; Misra et al., 2002; Shiba et al., 2002). These interactions form the basis of the sorting of MPRs and Vps10p and their cargo of hydrolases into vesicles for eventual delivery to lysosomes/vacuoles.
To maintain efficient sorting and transport of lysosomal/vacuolar hydrolases, the receptors have to be retrieved from the endosome. In contrast to the exit of receptor ligands from the TGN, the process of retrieval is currently poorly understood at the molecular level. Analyses in yeast have identified a complex of five proteins that is necessary for the endosome-to-Golgi retrieval of Vps10p. This complex was dubbed "retromer" and comprises the Vps35p, 29p, 26p, 17p, and 5p proteins (Seaman et al., 1997, 1998). Phenotypic analysis of the respective mutants along with biochemical analyses led to the hypothesis that retromer was a candidate vesiclecoat protein complex that mediates endosome-to-Golgi retrieval in yeast.
Characterization of yeast retromer has provided many insights into the assembly of the complex and the respective roles of the individual components. Several lines of evidence, both genetic and biochemical, favor a role in cargo selection for Vps35p (Nothwehr et al., 1999, 2000). Vps29p is essential for the assembly of the retromer complex. Vps5p and Vps17p are members of the sorting nexin (Snx) family of proteins, and due to the intrinsic self-assembly activity of Vps5p, it was suggested that theVps5pVps17p complex may promote vesicle budding (Seaman et al., 1998). Vps26p plays a crucial role in directing the interactions of Vps35p and helps stabilize the retromer complex (Reddy and Seaman, 2001).
Significantly, retromer is highly conserved and an analogous complex has been identified in mammalian cells (Renfrew-Haft et al., 2000). SNX1, the mammalian homologue of Vps5p, associates with the cytoplasmic tails of several proteins that traffic in the endocytic system, including the EGF receptor and the transferrin receptor (TfnR; Kurten et al., 1996; Renfrew-Haft et al., 1998). Does this mean that mammalian retromer mediates endosome-to-Golgi retrieval? This question has yet to be addressed directly, but it has been proposed that mammalian retromer is likely to function in an endosome-to-Golgi retrieval pathway with cargoes yet unknown (Pfeffer, 2001). Aside from retromer, other candidate molecules that could mediate the retrieval of the MPRs are TIP47 (Diaz and Pfeffer, 1998) with rab9 (Riederer et al., 1994) and the clathrin adaptor, AP-1 (Meyer et al., 2000).
Here, we have addressed the specific question of the role of retromer in endosome-to-Golgi retrieval. Using cells derived from transgenic mice that are deleted for mammalian VPS26 (mVPS26) and through the application of small interfering RNA (siRNA) to knock down expression of mVPS26, we show that absence of mVPS26 (and therefore functional retromer) results in a range of phenotypes consistent with a defect in endosome-to-Golgi retrieval.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In Fig. 1 A, HeLaM cells stably transfected with these constructs were fixed and double labeled with antibodies against CD8 (left panels) and mVPS26 (right panels). The three different CD8 reporters all have slightly different steady-state localizations. For example, the CD8-furin construct localizes to a perinuclear structure that colocalizes with TGN46 (unpublished data). The CD8CD-MPR chimera has a more punctate localization consistent with an endosomal localization. The CD8CI-MPR reporter has both endosomal and TGN localization. Extensive colocalization between mVPS26 and the CD8CD-MPR construct was observed and some colocalization between mVPS26 and the CD8CI-MPR construct was also apparent, but there was no significant colocalization between mVPS26 and CD8-furin. Additionally, we find that antibodies against Snx1 label very similar structures to those labeled with anti-mVPS26 antibodies, and there is a similar degree of colocalization between Snx1 and the three CD8 reporters as was observed for mVPS26 (unpublished data).
|
We have also determined the localization of mVPS26 and Snx1 by EM. Attempts to use conventional cryo-EM to localize mVPS26 were unsuccessful. Therefore, we developed a method to allow the pre-embedding labeling of mVPS26. In Fig. 2, a montage of images is shown. Antibodies against both mVPS26 (ac) and Snx1 (d and e) labeled structures that had morphology typical of endosomes. Arrows indicate where tubularvesicular elements are labeled with the anti-Snx1 antibody.
|
|
Increased cell surface localization of the CI-MPR after mVPS26 knock down would also be expected to result in increased colocalization of the CI-MPR with early endosomal markers such as EEA1. This was investigated by double labeling control and mVPS26 knock-down cells with antibodies against the CI-MPR and EEA1. In Fig. 4 D, the control cells display extensive overlap in the labeling patterns of EEA1 and mVPS26 (indicated by arrows), but relatively little coincidence between the CI-MPR and EEA1. After siRNA knock down of mVPS26, the EEA1 distribution is largely unchanged, but the CI-MPR appears to be redistributed to EEA1-positive structures (indicated by arrows). These data are consistent with increased cycling of the CI-MPR between the cell surface and early endosomes after mVPS26 knock down.
|
Increased expression of the CI-MPR in the mVPS26 knock-down cells could account for the apparent increased steady-state levels of CI-MPR, but could also have been masking an increased turnover of the CI-MPR in the knock-down cells. The apparent loss of the CI-MPR in mVPS26/ cells indicates that there is a defect in endosome-to-Golgi retrieval, resulting in the degradation of the CI-MPR in lysosomes. Therefore, we investigated the stability of the CI-MPR in both the mVPS26/ cells and in the mVPS26 knock-down cells by a pulsechase experiment. Cells were labeled with [35S]methionine and then chased over a 3-h period. The CI-MPR was recovered from lysates prepared at various time points by immunoprecipitation. After analysis of CI-MPR levels by SDS-PAGE and fluorography, the data were converted to graph form (Fig. 5 A). The CI-MPR was rapidly degraded in mVPS26/ cells with a half-life of 3 h; however, to our surprise, we have found that there was no increased turnover of the CI-MPR in the mVPS26 knock-down cells (Fig. 5 B).
|
|
|
|
Loss of mVPS26 results in a defect in the retrieval of endogenous CI-MPR and also the CD8CI-MPR reporter. Are there other proteins that cycle between the endosome and TGN in a retromer-dependent manner? To answer this question, we made another CD8 reporter, this time with the tail of sortilin. Sortilin is a homologue of the Vps10 protein (Petersen et al., 1997) and is believed to have a similar trafficking itinerary to the CI-MPR. In Fig. 8 E, the anti-CD8 uptake assay was performed on cells stably transfected with CD8-sortilin. In control cells (top panels), the antibody is endocytosed and (after 24 min of chase) delivered to the TGN. After mVPS26 knock down, the endocytosed antibody accumulates in peripheral structures that have a similar morphology to those observed in CD8CI-MPR cells (compare Fig. 8 E with Fig. 8 B).
Therefore, loss of mVPS26 expression results in a significant effect upon the endosome-to-Golgi retrieval of the CD8CI-MPR chimera. The effect on the trafficking of the CD8CD-MPR and CD8-furin chimeras was also examined using the anti-CD8 antibody uptake assay, although this time by continuous incubation with antibody over 3 h. Over the 3-h period, the CD8 reporter construct with bound antibody will reach a steady-state localization. In Fig. 9 A, control cells were incubated with anti-CD8 for 3 h at 37°C. After washes, the cells were fixed and mVPS26 was labeled along with the anti-CD8 antibody. The distribution of the anti-CD8 antibody in the cells expressing the three CD8 reporter constructs is virtually the same as shown for the steady-state distribution of the three chimeras in Fig. 1 A. There is some significant colocalization between the CD8CI-MPR and mVPS26 and very extensive colocalization between the CD8CD-MPR and mVPS26, but very little colocalization between CD8-furin and mVPS26. After mVPS26 knock down (Fig. 9 B), endocytosed anti-CD8 antibody is found in peripheral and some perinuclear structures in CD8CI-MPR expressing cells. The CD8CD-MPR expressing cells appear to endocytose more anti-CD8 antibody after knock down of mVPS26. This is apparent when some unaffected cells are compared with cells in which the mVPS26 knock down has occurred. The overall localization of the endocytosed anti-CD8 antibody in CD8CD-MPR expressing cells is not any different after mVPS26 knock down. In cells expressing the CD8-furin chimera, endocytosed anti-CD8 reaches a perinuclear compartment that, although fragmented, does correspond to the TGN and colocalizes with anti-TGN46 (unpublished data).
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key to understanding the role that retromer plays in mammalian cells is the localization of retromer itself. We find that mVPS26 is localized to endosomal membranes that are positive for rab5 and EEA1. These data are consistent with the published colocalization between Snx1 and EEA1 (Chin et al., 2001). The EM analysis of mVPS26 and Snx1 localization confirms that mVPS26 is present on multivesicular bodies.
CD8 has been extensively and successfully used in previous works as a reporter protein for type I transmembrane proteins such as furin, TGN38, and endolyn (Chapman and Munro, 1994; Ponnambalam et al., 1994; Ihrke et al., 2000). The CD8 reporter constructs used here have proven to be invaluable for these experiments, as they each have a slightly different steady-state localization. The CD8CI-MPR appears to reside in both TGN and endosomal compartments, whereas the CD8CD-MPR and CD8-furin constructs are restricted to endosomal or TGN localization, respectively. This difference in steady-state localization of the three chimeras can only be due to the intrinsic signals present in the three different cytoplasmic tails of the CD8 reporter constructs, as the transmembrane and luminal domains are identical in each case. As the cytoplasmic tails of the three chimeras are responsible for the trafficking/localization of the protein, it is logical to assert that interactions with cytoplasmic machinery such as vesicle coat proteins are critical to determine the trafficking of the chimeras. So although we do not claim that the trafficking of the CD8CI-MPR is exactly identical to the endogenous CI-MPR, the chimeras do, nevertheless, provide a means of examining the trafficking of various type I transmembrane proteins present in the TGN/endocytic system.
The EM localization and colocalization of mVPS26 with rab5 and EEA1 establishes that mVPS26 is in the "right place" to mediate endosome-to-TGN retrieval (see also Fig. S2, available at http://www.jcb.org/cgi/content/full/jcb.200312034/DC1). To investigate whether retromer has a role in endosome-to-TGN retrieval, we have used a cell line derived from mVPS26/ transgenic mice (Lee et al., 1992), and we have succeeded in knocking down mVPS26 expression by RNA interference. The siRNA knock down of mVPS26 in the HeLaM cells can achieve an almost complete loss of mVPS26 expression such that by Western blotting and metabolic labeling, levels of mVPS26 protein are undetectable and therefore no different to levels of mVPS26 protein in the mVPS26/ cells. Only occasionally are mVPS26-positive cells observed by immunofluorescence. Loss of mVPS26 expression has a profound effect upon the trafficking of the CI-MPR, resulting in a significant increase in the amount of CI-MPR present at the cell surface and extensive overlap in the immunofluorescence labeling patterns of the CI-MPR and EEA1.
If retromer is required for the endosome-to-Golgi retrieval of the CI-MPR, then redistribution to the cell surface and increased cycling between the plasma membrane and an early endosome is one of two possible fates of the CI-MPR in retromer-deficient cells. The other possible destination is the lysosome, which would result in increased turnover of the CI-MPR. This does appear to be the case for the mVPS26/ cells, which have significantly reduced steady-state levels of CI-MPR and degrade their CI-MPR with a half-life of 3 h. In the mVPS26 knock-down cells there doesn't appear to be any increased turnover of the CI-MPR. A possible reason why there is a lack of turnover of the CI-MPR in the mVPS26 knock-down cells is that there may be more trafficking of the CI-MPR between endosomes and the plasma membrane and less delivery of the CI-MPR to lysosomes relative to the mVPS26/ cells. Recent reports by Maxfield and colleagues have indicated that a significant proportion of the CI-MPR cycles between the plasma membrane and early endosomes after being endocytosed (Lin et al., 2004). Additionally, experiments performed over many years have shown that the CI-MPR localization can differ considerably between cell types being either predominantly TGN localized or endosomally/prelysosomally localized (Brown et al., 1986; Brown and Farquhar, 1987; Griffiths et al., 1988; Griffiths, 1989).
Even though there is no apparent instability of the CI-MPR after mVPS26 knock down, there is in fact a significant endosome-to-TGN retrieval defect resulting in rerouting of the CI-MPR into other pathways (e.g., endosome to plasma membrane). This assertion is supported by the fact that maturation of cathepsin D is completely abolished after mVPS26 knock down. Again, this is consistent with the yeast retromer deletion mutants, which all display strong CPY sorting defects.
When the steady-state localization of the CD8 reporter constructs was examined after mVPS26 knock down, we found that the CD8CI-MPR construct was partially redistributed to peripheral structures, but retained some perinuclear labeling in a compartment that was fragmented. The distribution of the CD8CD-MPR chimera was not significantly affected, but the CD8-furin construct was now also in a fragmented perinuclear compartment. This fragmented perinuclear compartment is likely to be the Golgi/TGN, as labeling with antibodies against GM130 and TGN46 showed that the Golgi complex fragments as a consequence of the loss of mVPS26 (see also Fig. S1, available at http://www.jcb.org/cgi/content/full/jcb.200312034/DC1). It is worth noting that although fragmented, the TGN/Golgi remains very much restricted to the perinuclear region of the cell. The cause of this fragmentation is not clear, but may be due to a defect in endosome-to-TGN retrieval of SNARE proteins that are required for homotypic Golgi membrane fusion. This is currently being investigated. Golgi fragmentation appeared less severe in the mVPS26/ cells possibly due to some form of adaptation that has occurred after prolonged culture.
The steady-state distributions of the CD8 reporters after mVPS26 knock down suggested that loss of mVPS26 could have a major impact on endosome-to-Golgi retrieval. However, the dynamic nature of the TGN/endocytic system requires that the kinetics of transport also be investigated. Using an antibody uptake assay, we followed the trafficking of the CD8CI-MPR from the cell surface to the TGN. In control cells, the process is rapid and occurs with kinetics consistent with previously published reports on CI-MPR retrieval (Hirst et al., 1998). CD8CI-MPR at the cell surface is efficiently endocytosed, and after an 8-min chase is present in a compartment positive for mVPS26. After 24 min, the CD8CI-MPR has reached the TGN and colocalizes with TGN46. In mVPS26 knock-down cells, the CD8CI-MPR appears to be efficiently endocytosed, but it is not rapidly returned to the TGN. Instead, the CD8CI-MPR appears to accumulate in structures close to the plasma membrane. After 24 min, a small minority of CD8CI-MPR does appear to be delivered to the fragmented perinuclear structures that are positive for TGN46, but the vast majority of internalized CD8CI-MPR remains in peripheral structures that are positive for Snx1. A CD8-sortilin reporter behaved in a similar fashion after mVPS26 knock down. As sortilin is a mammalian homologue of the yeast Vps10 protein (Petersen et al., 1997), it would perhaps be expected to traffic in a similar fashion to Vps10p (i.e., retromer dependent). Additionally, it has been observed that the tail of Vps10p can functionally substitute for the tail of the CI-MPR (Dennes et al., 2002). As yeast retromer mediates retrieval of Vps10p, mammalian retromer performs the same task for the CI-MPR.
Although the kinetics of the CD8CI-MPR retrieval in control cells appeared to be rapid, the CD8-furin chimera took much longer to reach the TGN, requiring a chase of 60 min (unpublished data). It was also difficult to examine retrieval of the CD8-furin chimera, as very little of the chimera is present at the cell surface at any one time. Therefore, prolonged incubation with the anti-CD8 antibody was used to determine the extent of uptake and to allow the antibody to reach its steady-state distribution. Loss of mVPS26 results in an accumulation of the CD8 antibody in peripheral endosomal structures in the CD8CI-MPR chimera-expressing cells. However, the CD8-furin chimera is endocytosed and delivered to the fragmented compartment positive for TGN46 (unpublished data).
Therefore, these data suggest that mVPS26 knock down can affect the trafficking of some proteins far more than others. The retrieval of the CD8CI-MPR (and CD8-sortilin) reporter is greatly affected, whereas the CD8-furin protein is only marginally affected, if at all. This hypothesis was confirmed by following the uptake of the CD8CI-MPR reporter in cells expressing a GFP-furin chimera. These data are in line with the current hypothesis that there are two distinct endosome-to-Golgi retrieval pathways in mammalian cells (Mallet and Maxfield, 1999). This can also explain why there is in fact some retrieval of the CD8CI-MPR to the TGN after mVPS26 knock down. A parallel pathway, possibly using AP-1 (Meyer et al., 2000), could provide for partial (perhaps kinetically slower) retrieval of the CI-MPR (and CD8CI-MPR).
In summary, loss of mVPS26 results in a severe defect in endosome-to-TGN retrieval of the CI-MPR. mVPS26 could mediate retrieval of the CI-MPR from both early and late endosomes. This would account for the partial overlap in the labeling patterns of mVPS26 and GFP-rab7, and may suggest that retromer-mediated retrieval is part of the process of endosome maturation. In this scenario, retromer could initiate endosome-to-TGN retrieval of the CI-MPR at an early endosome, but retrieval would continue as the endosome matures. The apparent lack of colocalization between mVPS26 and GFP-rab9 may indicate that an additional trafficking step is required for the retrieval of the CI-MPR from endosomes. This additional step would require TIP47 (Diaz and Pfeffer, 1998) and rab9 (Riederer et al., 1994). Alternatively, retromer and TIP47/rab9 could function sequentially in endosome-to-TGN retrieval.
The CD8 reporter constructs have been used to investigate which proteins may be retrieved in a retromer-dependent fashion. The retrieval of the CD8CI-MPR chimera depends upon retromer, whereas the trafficking of the CD8-furin construct does not, probably because of the existence of a parallel endosome-to-TGN retrieval pathway. An obvious candidate to mediate this pathway is AP-1 in concert with the furin-interacting "adaptor" PACS-1 (Crump et al., 2001; Folsch et al., 2001).
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Antibodies
The monoclonal anti-CD8 was obtained from Qbiogene. Anti-GM130 and anti-EEA1 were purchased from Becton Dickinson, and the anti-TfnR antibody was obtained from Zymed Laboratories. Polyclonal anti-actin was purchased from Sigma-Aldrich, and the polyclonal anti-CI-MPR (Reaves et al., 1996) was a gift from J. Paul Luzio (University of Cambridge, Cambridge, UK). Anti-cathepsin D antiserum was obtained from DakoCytomation, and anti-TGN46 was supplied by Serotec. Polyclonal anti-mVPS26, anti-Snx1, and anti-mVPS35 were produced in house using GST fusion proteins as antigens. The antisera were subsequently affinity purified using the respective antigens coupled to CNBr-Sepharose.
Microscopy
Immunofluorescence microscopy was performed using an epifluorescence microscope (Axioplan; Carl Zeiss MicroImaging, Inc.) with a Plan-Apochromat 63x oil immersion lens (Carl Zeiss MicroImaging, Inc.) at RT. The secondary antibodies were obtained from Molecular Probes, Inc. and were conjugated to Alexa Fluor® 488 or 594. The image was obtained using a CCD camera (Princeton Instruments) that was controlled via IP Lab software. Images were cropped using Adobe Photoshop® software.
Cell culture, wild-type, and mVPS26/ mouse cells
HeLaM cells (Tiwari et al., 1987) were provided by M.S. Robinson (University of Cambridge, Cambridge, UK). Embryonic stem cells derived from either homozygous wild-type or homozygous mVPS26/ mouse embryos (Robertson et al., 1992) were provided by F. Constantini (Columbia University, New York, NY). The embryonic stem cells were produced as part of an experiment to identify genes important for early embryogenesis (Radice et al., 1991). Upon receipt, the cells were cultured in DME supplemented with 10% FCS, 2 mM glutamine, and 1 mM pyruvate, and containing 0.1 mM ß-mercaptoethanol and penicillin/streptomycin. Wild-type and mVPS26/ cells were treated identically and were grown over a period of several months, passaging as necessary.
SDS-PAGE and Western blotting
SDS-PAGE and Western blotting were performed as described in Reddy and Seaman (2001).
GFP-rabs and CD8 reporter constructs
EST cDNA encoding rab5c, rab7, and rab9 were obtained from the IMAGE Consortium. The rab cDNAs were amplified by PCR using primers to add a BglII and an SalI site to the 5' and 3' ends, respectively. The PCR products were then cloned into the pEGFP-C1 vector (CLONTECH Laboratories, Inc.) for expression as a GFP fusion in mammalian cells. The CD8CD-MPR, CD8-furin, and CD8-sortilin constructs were made in a similar fashion. ESTs for the human cDNAs of the CD-MPR, furin, and sortilin were obtained from the IMAGE Consortium. Primers were designed to PCR through the region encoding the cytoplasmic tails of the respective proteins. The 5' primers incorporated an AflII site; the 3' primers were designed to anneal 3' to the stop codon. The PCR products were first cloned using the pCR blunt vector (Invitrogen). After digestion with AflII and either SpeI or NotI (depending on orientation), the insert was cloned into CD8 in pBlueScript® that had been digested with AflII and either XbaI or NotI to excise the endogenous CD8 cytoplasmic tail. Constructs were sequenced and then subcloned from pBlueScript® into the mammalian expression vector pIRESneo2 (CLONTECH Laboratories, Inc.). To generate the GFP-furin chimera, the luminal domain of CD8 (downstream of the signal sequence) was replaced with GFP. To facilitate production of this construct, a BamHI site was engineered into the CD8 cDNA 3' to the signal sequence. The luminal region of CD8 was excised by digestion with BamHI and EcoRV and replaced with GFP, which had a BamHI site introduced at the 5' end by PCR.
The CD8CI-MPR reporter was constructed by subcloning the cDNA encoding the cytoplasmic tail of the bovine CI-MPR into CD8-pIRESneo2. The bovine CI-MPR cDNA (provided by H. Davidson, University of Colorado, Denver, CO) was digested with BsrGI, which cuts precisely at the junction between the transmembrane domain and the cytoplasmic tail. After BsrGI digestion, the overhang was filled by T4 polymerase and then the CI-MPR cDNA was cut with NotI. The fragment corresponding to the tail was gel isolated and cloned into CD8-pIRESneo2, which had been digested with AflII, blunted, and then digested with NotI. This construct was also sequenced to confirm the success of the cloning. The constructs in pIRESneo2 or pEGFP-C1 were transfected into HeLaM cells using FuGENETM 6 (Roche). Stably transfected cells were selected using 500 µg/ml G418 (Life Technologies) and were screened for expression of the CD8 reporter constructs by immunofluorescence.
Pre-embedding labeling EM
Cells grown in 6-cm dishes were washed once with cold PBS and then once with cold glutamate lysis buffer (25 mM Hepes-KOH, pH 7.4, 25 mM KCl, 2.5 mM magnesium acetate, 5 mM EGTA, and 150 mM potassium glutamate) before draining on ice for 5 min. The cells were then snap frozen by immersion in liquid nitrogen and quick thawed by placing the dish on the bench for 60 s. The dish was then returned to ice and the cells were washed once with 2 ml glutamate lysis buffer. Excess buffer was removed and replaced with 2 ml of 4% PFA in PBS. The cells were then fixed at RT for 30 min with one change of fixative after 10 min. The cells were then washed for 5 min each time with 2 ml of the following: PBS containing 1 mg/ml sodium borohydride, PBS containing 5 mg/ml BSA, and then PBS containing 1 mg/ml BSA. After these washes, the cells were incubated (60 min) with 2 ml PBS containing 30 mg/ml BSA and either anti-mVPS26 or anti-Snx1 diluted 1:200. After washes with PBS/BSA, the cells were incubated (60 min) with 10-nm colloidal gold antirabbit diluted 1:50. After washes, the cells were fixed again with 2% PFA and 2.5% glutaraldehyde in 0.1 M cacodylate, pH 7.4, containing 30 mM CaCl2. The cells were then scraped up, serially dehydrated, and embedded in Epon before sectioning.
siRNA knock downs
siRNA oligos to knock down mVPS26 expression (AAUGAUGGGGAAACCAGGAAA) were obtained from Dharmacon and were resuspended into water according to the manufacturer's instructions. HeLaM cells were grown in 6-well dishes to a confluency of 6070%. Transfections with siRNA were performed as in Motley et al. (2003) using one-fifth the amounts of Opti-MEM®, OligofectamineTM, and siRNA per well as described.
Metabolic labeling experiments
Cells grown in tissue culture dishes were incubated with methionine-free DME for 1 h before labeling. After washes, the cells were pulse labeled with [35S]methionine in methionine-free DME and then chased with normal DME plus additions that had been supplemented with 5 mM methionine/1 mM cysteine. The duration of the labeling and chase varied depending on what type of experiment was being performed. After the chase (in most cases), the cells were washed with ice-cold PBS and then lysed using the following buffer: 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, and 0.2% sodium azide. The lysate was cleared by centrifugation at 13,000 g for 5 min and then was transferred to a fresh tube. Appropriate antibodies were added and allowed to incubate overnight at 4°C on a rotating wheel. The antibody was then captured using protein ASepharose or protein GSepharose (Amersham Biosciences), washed, dried down, and then resuspended into SDS-PAGE buffer for electrophoresis. The determination of the amount of cell surface CI-MPR required a slight modification as follows: cells labeled overnight with [35S]methionine in 9-cm dishes were gently removed using a nonenzymatic cell dissociation solution. The cells were recovered by centrifugation, resuspended into 2 ml of serum-free DME, equally divided between two tubes, and then placed in a shaking water bath at 30°C. 10 µl proteinase K (20 mg/ml) was added to one of each pair and allowed to incubate for 15 min. The cells were then transferred to a tube on ice containing 100 µl of 100% TCA. After precipitation, the pellet was washed with acetone, dried, solubilized in 100 µl of 50 mM Tris-HCl, pH 7.4, 6 M urea, and 1% SDS buffer, and was diluted with the lysis buffer above before clearing by centrifugation. Antibodies were added to the resulting supernatant to immunoprecipitate the CI-MPR, TfnR, or Snx1. Immunoprecipitates were washed with 1-ml aliquots of four different buffers as described in Reddy and Seaman (2001) before desiccation. After resuspension in SDS-PAGE loading buffer, the samples were subjected to SDS-PAGE and fluorography.
Anti-CD8 uptake assay
HeLaM cells expressing the CD8 reporter constructs were grown to 70% confluency on 22-mm coverslips. After washing the cells with ice-cold PBS, the coverslips were placed in the well of a 6-well dish containing 3 ml chilled media and allowed to incubate for 15 min at 4°C. This ensured that all trafficking had stopped at the time of the antibody incubations. The coverslips were then washed again in ice-cold PBS, blotted dry, and then placed over a 100-µl drop of DME containing 1 µg anti-CD8 antibody. The coverslip was incubated with the antibody for 30 min at 4°C before being washed again with cold PBS and then transferred to well of a 6-well dish containing 3 ml prewarmed media at 37°C. After incubation for either 8, 16, or 24 min, the coverslips were washed and fixed with ice-cold methanol/acetone. The continuous uptake assay was performed in a similar manner, except that the cells were incubated for 3 h continuously with the anti-CD8 antibody and there were no preincubations at 4°C.
Online supplemental material
Fig. S1 A shows lysates from control and knock-down cells subjected to SDS-PAGE and then Western blotted with antibodies against mVPS26. The mVPS26b knock down was less effective at eliminating mVPS26 expression. After knock down of mVPS35, mVPS26 becomes unstable. Fig. S1 B shows control and knock-down cells labeled with antibodies against mVPS26 and GM130. Golgi fragmentation was observed after mVPS26b knock down and mVPS35 knock down, but with less frequency. Fig. S2 shows control and mVPS26 knock-down cells incubated with serum-free media for 30 min before incubation with fluorescent transferrin for 10 min. The cells were then fixed and labeled with antibodies against mVPS26. After mVPS26 knock down, transferrin uptake appears normal. Fig. S3 (A and B) shows control, mVPS26 knock-down, and mVPS35 knock-down cells expressing either CD8CI-MPR (A) or CD8-furin (B) fixed and labeled with antibodies against CD8 and TGN46. Knock-down of mVPS26 or mVPS35 results in a defect in the retrieval of the CD8CI-MPR but not the CD8-furin reporter. Online supplemental material available at http://www.jcb.org/cgi/content/full/jcb.200312034/DC1.
![]() |
Acknowledgments |
---|
This work was supported by a Medical Research Council senior research fellowship awarded to M.N.J. Seaman.
Submitted: 4 December 2003
Accepted: 19 February 2004
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Brown, W.J., and M.G. Farquhar. 1987. The distribution of the 215-kilodalton mannose 6-phosphate receptors within cis (heavy) and trans (light) Golgi subfractions varies in different cell types. Proc. Natl. Acad. Sci. USA. 84:90019005.[Abstract]
Brown, W.J., J. Goodhous, and M.G. Farquhar. 1986. Mannose-6-phosphate receptors for lysosomal enzymes cycle between the Golgi complex and endosomes. J. Cell Biol. 103:12351247.[Abstract]
Chapman, R.E., and S. Munro. 1994. Retrieval of TGN proteins from the cell surface requires endosomal acidification. EMBO J. 13:23052312.[Abstract]
Chin, L.-S., M.C. Raynor, X. Wei, H.-Q. Chen, and L. Li. 2001. Hrs interacts with sorting nexin 1 and regulates degradation of epidermal growth factor receptor. J. Biol. Chem. 276:70697078.
Cooper, A.A., and T.H. Stevens. 1996. Vps10p cycles between the late-Golgi and prevacuolar compartments in its function as the sorting receptor for multiple yeast vacuolar hydrolases. J. Cell Biol. 133:529542.[Abstract]
Crump, C.M., Y. Xiang, L. Thomas, F. Gu, C. Austin, S.A. Tooze, and G. Thomas. 2001. PACS-1 binding to adaptors is required for acidic cluster motif-mediated protein traffic. EMBO J. 20:21912201.
Dennes, A., P. Madsen, M.S. Nielsen, C.M. Petersen, and R. Pohlmann. 2002. The yeast Vps10p cytoplasmic tail mediates lysosomal sorting in mammalian cells and interacts with human GGAs. J. Biol. Chem. 277:1228812293.
Diaz, E., and S.R. Pfeffer. 1998. TIP47: a cargo selection device for mannose 6-phosphate receptor trafficking. Cell. 93:433443.[Medline]
Folsch, H., M. Pypaert, P. Schu, and I. Mellman. 2001. Distribution and function of AP-1 clathrin adaptor complexes in polarized epithelial cells. J. Cell Biol. 152:595606.
Griffiths, G. 1989. The structure and function of a mannose 6-phosphate receptor enriched, pre-lysosomal compartment in animal cells. J. Cell Sci. Suppl. 11:139147.[Medline]
Griffiths, G., B. Hoflack, K. Simons, I. Mellman, and S. Kornfeld. 1988. The mannose 6-phosphate receptor and the biogenesis of lysosomes. Cell. 52:329341.[Medline]
Hirst, J., C.E. Futter, and C.R. Hopkins. 1998. The kinetics of mannose 6-phosphate receptor trafficking in the endocytic pathway in HEp-2 cells: The receptor enters and rapidly leaves multivesicular endosomes without accumulating in a prelysosomal compartment. Mol. Biol. Cell. 9:809816.
Ihrke, G., S.R. Gray, and J.P. Luzio. 2000. Endolyn is a mucin-like type I membrane protein targeted to lysosomes by its cytoplasmic tail. Biochem. J. 345:287296.[CrossRef][Medline]
Kornfeld, S. 1992. Structure and function of the mannose 6-phosphate/insulin-like growth factor II receptors. Annu. Rev. Biochem. 61:307330.[CrossRef][Medline]
Kornfeld, S., and I. Mellman. 1989. The biogenesis of lysosomes. Annu. Rev. Cell Biol. 5:483525.[CrossRef][Medline]
Kurten, R.C., D.L. Cadena, and G.N. Gill. 1996. Enhanced degradation of EGF receptors by a sorting nexin, SNX1. Science. 272:10081010.[Abstract]
Lee, J.J., G. Radice, C. Perkins, and F. Costantini. 1992. Identification and characterization of a novel, evolutionary conserved gene disrupted by the murine Hß58 embryonic lethal transgene insertion. Development. 115:277288.[Abstract]
Lin, S.X., W.G. Mallet, A.Y. Huang, and F.R. Maxfield. 2004. Endocytosed cation-independent mannose 6-phosphate receptor traffics via the endocytic recycling compartment en route to the trans-Golgi network and a subpopulation of late endosomes. Mol. Biol. Cell. 15:721733.
Mallet, W.G., and F.R. Maxfield. 1999. Chimeric forms of furin and TGN38 are transported from the plasma membrane to the trans-Golgi network via distinct endosomal pathways. J. Cell Biol. 146:345359.
Marcusson, E.G., B.F. Horazdovsky, J.-L. Cereghino, E. Gharakhanian, and S.D. Emr. 1994. The sorting receptor for yeast vacuolar carboxypeptidase Y is encoded by the VPS10 gene. Cell. 77:579586.[Medline]
Meyer, C., D. Zizoli, S. Lausmann, E.-L. Eskelinen, J. Hamann, P. Saftig, K. Von Figura, and P. Schu. 2000. m1A-adaptin-deficient mice: Lethality, loss of AP-1 binding and rerouting of mannose 6-phosphate receptors. EMBO J. 19:21932203.
Misra, S., R. Puertollano, Y. Kato, J.S. Bonifacino, and J.H. Hurley. 2002. Structural basis for acidic-cluster-dileucine sorting-signal recognition by VHS domains. Nature. 415:933937.[CrossRef][Medline]
Motley, A., N.A. Bright, M.N.J. Seaman, and M.S. Robinson. 2003. Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162:909918.
Mullins, C., and J.S. Bonifacino. 2001. Structural requirements for function of yeast GGAs in vacuolar protein sorting, -factor maturation, and interactions with clathrin. Mol. Cell Biol. 21:79817994.
Nothwehr, S.F., P. Bruinsma, and L.S. Strawn. 1999. Distinct domains within Vps35p mediate retrieval of two different cargo proteins from the yeast prevacuolar/endosomal compartment. Mol. Biol. Cell. 10:875890.
Nothwehr, S.F., S.-A. Ha, and P. Bruinsma. 2000. Sorting of yeast membrane proteins into an endosomal-to-Golgi pathway involves direct interaction of their cytosolic domains with Vps35p. J. Cell Biol. 151:297309.
Petersen, C.M., M.S. Nielsen, A. Nykjaer, L. Jacobsen, N. Tommerup, H.H. Rasmussen, H. Roigaard, J. Gliemann, P. Madsen, and S.K. Moestrup. 1997. Molecular identification of a novel candidate sorting receptor purified from human brain by receptor-associated protein affinity chromatography. J. Biol. Chem. 272:35993605.
Pfeffer, S.R. 2001. Membrane transport: retromer to the rescue. Curr. Biol. 11:R109R111.[CrossRef][Medline]
Pfeffer, S. 2003. Membrane domains in the secretory and endocytic pathways. Cell. 112:507517.[Medline]
Ponnambalam, S. C. Rabouille, J.P. Luzio, T. Nilsson, and G. Warren. 1994. The TGN38 glycoprotein contains two non-overlapping signals that mediate localization to the trans-Golgi network. J. Cell Biol. 125:253268.[Abstract]
Radice, G., J.J. Lee, and F. Costantini. 1991. Hß58, an insertional mutation affecting early postimplantation development of the mouse embryo. Development. 111:801811.[Abstract]
Reaves, B.J., N.A. Bright, B.M. Mullock, and J.P. Luzio. 1996. The effect of wortmannin on the localisation of lysosomal type I integral membrane glycoproteins suggests a role for phosphoinositide 3-kinase activity in regulating membrane traffic late in the endocytic pathway. J. Cell Sci. 109:749762.
Reddy, J.V., and M.N.J. Seaman. 2001. Vps26p, a component of retromer, directs the interactions of Vps35p in endosome-to-Golgi retrieval. Mol. Biol. Cell. 12:32423256.
Renfrew-Haft, C., M. Sierra, V.A. Barr, D.H. Haft, and S.I. Taylor. 1998. Identification of a family of sorting nexin molecules and characterisation of their association with receptors. Mol. Cell. Biol. 18:72787287.
Renfrew-Haft, C., M. Sierra, R. Bafford, M.A. Lesniak, V.A. Barr, and S.I. Taylor. 2000. Human orthologs of yeast vacuolar protein sorting proteins Vps26, 29 and 35: assembly into multimeric complexes. Mol. Biol. Cell. 11:41054116.
Riederer, M.A., T. Soldati, A.D. Shapiro, J. Lin, and S.R. Pfeffer. 1994. Lysosome biogenesis requires Rab9 function and receptor recycling from endosome to the trans-Golgi network. J. Cell Biol. 125:573582.[Abstract]
Robertson, E.J., F.L. Conlon, K.S. Barth, F. Constantini, and J.J. Lee. 1992. Use of embryonic stem cells to study mutations affecting postimplantation development in the mouse. Ciba Found. Symp. 165:237255.[Medline]
Robinson, M.S., and J.S. Bonifacino. 2001. Adaptor-related proteins. Curr. Opin. Cell Biol. 13:444453.[CrossRef][Medline]
Seaman, M.N.J., E.G. Marcusson, J.-L. Cereghino, and S.D. Emr. 1997. Endosome to Golgi retrieval of the vacuolar protein sorting receptor, Vps10p, requires the function of VPS29, VPS30 and VPS35 gene products. J. Cell Biol. 137:7992.
Seaman, M.N., J.M. McCaffery, and S.D. Emr. 1998. A membrane coat complex essential for endosome-to-Golgi retrograde transport in yeast. J. Cell Biol. 142:665681.
Shiba, T., H. Takatsu, T. Nogi, N. Matsugaki, M. Kawasaki, N. Igarashi, M. Suzuki, R. Kato, T. Earnest, K. Nakayama, and S. Wakatsuki. 2002. Structural basis for the recognition of acidic-cluster dileucine sequence by GGA1. Nature. 415:937941.[CrossRef][Medline]
Tiwari, R.K., J. Kusari, and G.C. Sen. 1987. Functional equivalents of interferon-mediated signals needed for induction of an mRNA can be generated by double-stranded RNA and growth factors. EMBO J. 6:33733378.[Abstract]
Related Article