Medical Research Council Laboratory for Molecular Cell Biology and Department of Biochemistry, University College London, London WC1E 6BT, United Kingdom
In T lymphocytes, the Src-family protein tyrosine kinase p56lck (Lck) is mostly associated with the cytoplasmic face of the plasma membrane. To determine how this distribution is achieved, we analyzed the location of Lck in lymphoid and in transfected nonlymphoid cells by immunofluorescence. We found that in T cells Lck was targeted correctly, independently of the cell surface proteins CD4 and CD8 with which it interacts. Similarly, in transfected NIH-3T3 fibroblasts, Lck was localized at the plasma membrane, indicating that T cell-specific proteins are not required for targeting. Some variation in subcellular distribution was observed when Lck was expressed in HeLa and MDCK cells. In these cells, Lck associated with both the plasma membrane and the Golgi apparatus, while subsequent expression of CD4 resulted in the loss of Golgi-associated staining. Together, these data indicate that Lck contains intrinsic signals for targeting to the plasma membrane. Furthermore, delivery to this site may be achieved via association with exocytic transport vesicles.
A mutant Lck molecule in which the palmitoylation site at cysteine 5 was changed to lysine (LC2) localized to the plasma membrane and the Golgi region in NIH3T3 cells. However, the localization of a mutant in which the palmitoylation site at cysteine 3 was changed to serine (LC1) was indistinguishable from wild-type Lck. Chimeras composed of only the unique domain of Lck linked to either c-Src or the green fluorescent protein similarly localized to the plasma membrane of NIH-3T3 cells. Thus, the targeting of Lck appears to be determined primarily by its unique domain and may be influenced by the use of different palmitoylation sites.
Alarge number of cytosolic proteins associate with
membranes through long chain fatty acids covalently
attached to their amino or carboxyl termini. Examples include members of the Src-family, the alpha subunits of heterotrimeric G proteins, small GTP-binding proteins, and retroviral matrix proteins. In a number of cases these proteins have been found to associate with a specific
membrane compartment, e.g., c-Src associates with endosomal membranes (Kaplan et al., 1992 The Src-family of nonreceptor protein tyrosine kinases
currently consists of nine proteins (Src, Fyn, Lyn, Yes, Fgr,
Hck, Blk, Lck, and Yrk [for review see Rudd et al., 1993
Lck is expressed in thymocytes and mature T lymphocytes and is crucial for the development (Molina et al.,
1992 Here, we have sought to determine factors that are important for the plasma membrane distribution of Lck. The
Lck domains confer a potential for numerous protein-protein and protein-lipid interactions, any of which might
contribute to the subcellular localization of this protein.
Palmitoylation and myristoylation at the SH4 domain play
a key role in the association of Lck with membranes. The
unique domain interacts with CD4 and CD8 (Rudd et al.,
1988 In addition to CD4 and CD8, Lck has been reported to
interact with a variety of other cell surface proteins, both
transmembrane and GPI-linked proteins, as well as with
plasma membrane-associated caveolae (Shenoy-Scaria et
al., 1994 We analyzed the distribution of Lck by immunofluorescence and found that neither CD4, CD8, nor other T cell-
specific proteins are required for the plasma membrane
localization of Lck in T cells and transfected NIH-3T3 fibroblasts. The use of chimeras demonstrated that the unique
domain of Lck plays an important role in establishing the
plasma membrane localization in NIH-3T3 cells. Palmitoylation of either Cys 3 or Cys 5 resulted in membrane association, confirming the result of others (Kwong et al., 1995; Yurchak et al., 1995). However, an Lck mutant that contains only the palmitoylation site at Cys 3 localized both to
the Golgi region and the plasma membrane, suggesting
that the position of the palmitic acid influences the subcellular distribution of Lck. We observed cell type-specific
variation in the distribution of Lck: in HeLa cells, Lck was
partially found at the Golgi complex. This may suggest
that unidentified cellular components are involved in the
correct sorting of Lck, and furthermore, that Lck may be
transported to the plasma membrane via the exocytic pathway.
Reagents
Tissue culture reagents were from Gibco Ltd. (Paisley, UK), tissue culture
plastic was from Falcon Plastics, and chemicals were from Sigma Chemical
Co., (Poole, UK), unless indicated otherwise.
Cells
The human T cell lines, SupT1, BC7, A3.01, and A2.01, were cultured in
RPMI 1640 supplemented with 10% FCS. BC7 cells (provided by J. Hoxie, University of Philadelphia, Philadelphia, PA) are CD4-negative
derivatives of SupT1 cells (Endres et al., 1996 NIH-3T3 fibroblasts and transfectants of these cells were grown in
DME containing 10% FCS, 100 U/ml penicillin, 0.1 mg/ml streptomycin
(Pen/Strep), and supplemented where appropriate with 1 mg/ml G418
and/or 0.2 mg/ml hygromycin (Boehringer Mannheim GmbH, Mannheim,
Germany). NIH-3T3 cells transfected with human CD4 and either murine
Lck, c-Src, Lck/Src, or Src/Lck have been described before (Pelchen-Matthews et al., 1992 Transfections and DNA Constructs
Transfections of NIH-3T3 cells were carried out by electroporation in
HEBS buffer (20 mM Hepes, pH 7.05, 137 mM NaCl, 5 mM KCl, 0.7 mM
Na2HPO4, 6 mM d-glucose) using a Gene Pulser at 350 V, 250 µF, infinite
The GFP cDNA (Prasher et al., 1992 Antibodies
The anti-CD4 mouse mAb Q4120 was provided by Q. Sattentau through
the Medical Research Council AIDS Directed Reagents Programme (South Mimms, Potters Bar, UK). This antibody recognizes an epitope that is identical to, or overlaps with, the Leu3a epitope. Two rabbit polyclonal antisera against Lck were used, both raised against a synthetic peptide comprising residues 478-509. One (Lck I) was kindly provided by S. Ley (National Institute for Medical Research, Mill Hill, UK), (Ley et al.,
1994 Immunofluorescence
T cells were immobilized on 13-mm-diam glass coverslips coated with 1 mg/ml poly-l-lysine in PBS. Adherent NIH-3T3 and HeLa cells were
plated on coverslips 2 d before analysis. Cells were fixed at room temperature with 3% paraformaldehyde for 15 min, quenched with 50 mM NH4Cl,
and permeablilized in 0.1% Triton TX-100 for 10 min at room temperature. All solutions were made in PBS. After preincubation for 10 min in
0.2% gelatin, cells were incubated for 1 h with primary antibodies diluted
in 0.2% gelatin: mAb Q4120 for CD4 (at 1.6 µg/ml), Lck I serum at 1:1,000
for Lck, and mAb 327 for Src at 0.1 µg/ml. Fluorescent second layer antibodies were used at 1:2,000 dilution in 0.2% gelatin, and incubations were
again for 1 h. Coverslips were mounted in Moviol (Calbiochem-Novachem, [UK] Ltd, Beeston, UK) and observed either with a fluorescence microscope (Axioskop; Carl Zeiss, Inc., Thornwood, NY) or by confocal microscopy using an Optiphot-2 microscope (Nikon Inc., Melville, NY)
equipped with an MRC 1024 laser scanning attachment (Bio-Rad Laboratories).
Microinjection
HeLa-Lck cells were seeded on 13-mm-diam coverslips 2 d before microinjection. Plasmid DNA containing cDNA for CD4 or CD4 Membrane Preparation
Cells (7.5 × 106) were washed once with ice-cold PBS, once with ice-cold
TEA buffer (10 mM triethanolamine, 10 mM acetic acid, 250 mM sucrose,
1 mM EDTA, pH 7.45), and subsequently resuspended in 0.5 ml TEA
buffer containing 1 mM PMSF. Cells were broken with a ball-bearing homogenizer (diameter: 0.1564 inch; ball: 0.1553 inch; H & Y Enterprise,
Redwood City, CA) until 75% of nuclei were free (~80 passes for T cells).
Unbroken cells and nuclei were removed by centrifugation for 5 min at
2,000 rpm at 4°C. Postnuclear supernatants were subsequently centrifuged
at 100,000 g for 40 min at 4°C in an ultracentrifuge (OptimaTM TLX; Beckman Instruments, Fullerton, CA). Membrane pellets were dissolved in NP-40 lysis buffer. Proteins were precipitated by the addition of 4 vol
Immunoblotting
After electrophoresis, proteins were transferred to nitrocellulose membranes (Schleicher and Schuell, Keene, NH). The membranes were incubated in blocking buffer (10% skimmed milk powder [Marvel, Premier
Beverages, Adbaston, UK], 0.1% Tween-20 in PBS) overnight at 4°C. Incubation with primary antibody was for 1 h at room temperature. Lck was
detected using affinity-purified Lck II at 0.15 µg/ml in blocking buffer,
and CD4 using the mouse mAb Q4120 (1.6 µg/ml). HRP-conjugated goat
anti-rabbit and goat anti-mouse antibodies, diluted 1:2,000 in blocking
buffer, were used as secondary antibodies. Blots were developed using enhanced chemiluminescence (Amersham International plc, Little Chalfont,
UK) and visualized using autoradiography film (Fuji Photo Film Co. Ltd.,
Tokyo, Japan).
Electron Microscopy
For immunolabeling of cryosections, HeLa cells (untransfected or transfected with Lck) were fixed in 4% paraformaldehyde in PBS containing
5% sucrose, for 1 h at room temperature. The cells were scraped from the
culture dish, pelleted, and processed for cryo-EM. Small blocks of gelatine
(10% wt/wt) embedded cells were infused with 2.3 M sucrose for 4 h at
4°C and then placed on specimen holders and frozen in liquid nitrogen.
Ultrathin cryosections were cut using an ultracut E/FC4E low temperature sectioning system (Reichert Jung, Vienna, Austria) and the sections
were collected with a mixture of methylcellulose and 2.3 M sucrose (Liou
and Slot, 1994 Distribution of Lck in T Cells
In T lymphocytes, the TcR coreceptors CD4 and CD8 are
the principal binding determinants for Lck. This interaction involves two cysteines in the unique domain of Lck
(at positions 20 and 23) and two cysteines in the cytoplasmic tail of CD4 (at positions 420 and 422 in human CD4)
or the CD8 We compared the cellular distribution of Lck in a CD4positive human leukemia-derived T cell line, SupT1, and a
CD4-negative derivative of this cell line, BC7. In addition,
a second human CD4-positive (CD8-negative) CEMderived T cell line, A3.01, was compared with a derivative
of this line, A2.01-CD4stop399, which expresses a CD4
molecule lacking 34 of the 38 amino acids from its cytoplasmic domain. This truncation, which removes C420 and C422, abolishes the ability of CD4 to interact with Lck
(Turner et al., 1990 For immunofluorescence, T cells were immobilized on
poly-l-lysine-coated coverslips, fixed, permeabilized, and
stained with antibodies against the COOH-terminal domain of Lck and the NH2-terminal ecto-domain of CD4. In
the CD4-positive cells SupT1 and A3.01, staining for Lck
was only found in permeabilized cells and overlapped extensively with that of CD4 (Fig. 2), indicating that the majority of Lck was associated with the cytosolic side of the
plasma membrane. The distribution of Lck in the absence
of interacting CD4 was determined in BC7 and A2.01CD4stop399 cells. In both cell types Lck staining was again
seen at the periphery of the cell. The clearest indication
that this represents plasma membrane staining can be seen
in A2.01-CD4stop399 cells, where Lck colocalizes with tailless CD4 (Fig. 2). The plasma membrane staining of
Lck was evenly distributed in all cases and showed no apparent clustering. In addition to plasma membrane staining, some perinuclear staining was observed for Lck, both
in the presence and absence of interactive CD4 (Fig. 2; the
visibility of this staining depends on the plane of focus and
is therefore not apparent in all the cell profiles in these
fields). A similar perinuclear staining was previously described for Lck in Jurkat T cells and ascribed to late endosomes (Ley et al., 1994
Distribution of Lck in NIH-3T3 Cells
In addition to CD4 and CD8, a number of other plasma
membrane proteins, including CD2 (Bell et al., 1992 The amount of Lck associated with CD4 in the dual
transfectants was found to be equivalent to that seen in T
cells (not shown). Immunofluorescence staining of NIH3T3 cells that express CD4 and Lck showed colocalization
of the two proteins at the plasma membrane (Fig. 3). As
with the T cells, the plasma membrane staining of Lck in
these flat fibroblastic cells was seen as a homogeneous, diffuse staining that was visible to the extremities of the cell. This staining was distinct from the cytosolic pattern seen
with Lck mutants that are unable to bind to membranes
(see Fig. 10). CD4 was also observed in a perinuclear pattern resembling that of Golgi-associated antigens and might
represent CD4 in the exocytic pathway en route to the cell
surface. When Lck was expressed in the absence of CD4, a
homogeneous plasma membrane staining was again observed. This staining was indistinguishable from that seen
in the presence of CD4 (Fig. 3). No clustering of Lck, indicative of association with plasma membrane microdomains, was apparent.
To quantitate the association of Lck with membranes in
the presence and absence of CD4, CD4-positive and CD4negative T cell lines (Fig. 4 A) and NIH-3T3 cells (Fig. 4 B)
were homogenized and fractionated into a 100,000-g membrane pellet and supernatant. Western blotting revealed
that in all cell lines, Lck was exclusively present in the
membrane fraction, independently of the presence of
CD4. Association with CD4 therefore does not influence
recruitment of Lck to membranes. Nonpalmitoylated Lck
that does not associate with membranes (see Figs. 1 and
10) was found entirely in the supernatant fraction (Fig. 4 B).
We previously determined that the plasma membrane in
BHK cells constitutes ~18% of the total cellular membrane area (excluding inner mitochondria membranes
[Griffiths et al., 1989 Distribution of Lck in HeLa Cells
We stably expressed murine Lck in a second nonlymphoid
cell line, HeLa. In these cells, Lck showed a distribution
distinct from that seen in NIH-3T3 cells. The protein was
not only located at the plasma membrane, but was also
seen in the perinuclear region of the cells, in a pattern similar to that described for Golgi-associated proteins (Fig. 5
A). Costaining with an antibody against
We investigated whether coexpression with CD4 would
modulate the distribution of Lck. Hela-Lck cells were
transfected with cDNA for human CD4 and analyzed 2 d
later. We found that in the CD4-positive cells, Lck was exclusively located at the plasma membrane, while in adjacent CD4-negative cells, Lck was still observed in the
Golgi region (Fig. 5 B). Similar results were observed for
cells expressing either murine Lck or human Lck. Thus,
association with CD4 either prevented deposition of Lck on Golgi membranes or induced redistribution of Lck that
was already associated with the Golgi complex. To distinguish between these two possibilities, we expressed CD4
in HeLa-Lck cells by microinjection and analyzed the distribution of Lck soon after onset of CD4 synthesis. We observed that as early as 3 h after injection of cDNA for
CD4, Golgi staining of Lck had disappeared and Lck was
located only at the plasma membrane (Fig. 6, left). In contrast, injection of cDNA encoding a tailless form of CD4
did not change the distribution of Lck (Fig. 6, right). Previous experiments have estimated the half-life of Lck to be
20-30 h (Hurley and Sefton, 1989
The Role of the Unique Domain of Lck
To determine the role of the unique domain of Lck in targeting to the plasma membrane, we studied the cellular
distribution of chimeras between Lck and c-Src. These chimeras contain either the unique domain of murine Lck
and the remainder of c-Src (Lck/Src) or the unique domain of c-Src and the remainder of Lck (Src/Lck) (Fig. 1)
(Turner et al., 1990 In cells expressing c-Src we observed the protein at the
plasma membrane and in the perinuclear region (Fig. 7), a
distribution clearly different from that of Lck (Fig. 7). A
similar perinuclear distribution of c-Src was previously described (Kaplan et al., 1992
A similar result was obtained with a second chimera,
composed of the unique domain of Lck linked to the NH2
terminus of the GFP of Aequoria victoria. cDNA's for this
chimera (designated UD-GFP) and GFP were transfected
separately into NIH-3T3 cells. The cells were fixed 2 d
later and observed by fluorescence microscopy. We found
that GFP localized to the cytoplasm and nucleus as described previously (Fig. 8) (Ogawa et al., 1995
We conclude that despite the potential of the other domains for extensive protein-protein interaction, the cellular distribution of Lck is determined primarily by its NH2terminal unique domain.
The Role of Palmitoylation
A short motif (SH4) at the NH2 terminus of Src-family kinases contains signals for myristoylation and palmitoylation (Fig. 1). Myristic acid is attached to an NH2-terminal
glycine after removal of the methionine at position 1 (Fig.
10). In agreement with previous reports (Turner et al.,
1990 Palmitoylation occurs on cysteines in the general motif
Met-Gly-Cys, where Gly 2 is myristoylated (Resh, 1994 The tyrosine kinase Lck primarily associates with the cytosolic side of the plasma membrane in T cells. Here, we
have studied the subcellular distribution of wild-type and
mutant Lck in lymphoid and nonlymphoid cells to identify
determinants that influence the localization of this protein.
In particular, we have studied the contribution of CD4, the
unique domain of Lck and palmitoylation (see Table I for
summary).
Table I.
The Subcellular Distribution of Lck and Lck Constructs in T Cells and Transfected Cells
), G
i-3 with the
Golgi complex (Ercolani et al., 1990
), and the Gag protein
of Moloney murine leukemia virus with the plasma membrane (Wills and Craven, 1991
). However, little is known
about the mechanisms that underlie the targeting of acylated proteins to their sites of function in the cell. To gain
more insight into this, we have analyzed the cellular distribution of the myristoylated and palmitoylated Src-family
member Lck.
])
that play important roles in cell growth regulation and differentiation. These proteins have overlapping but distinct
activities and tissue distributions. At the cellular level, Srcfamily members have discrete subcellular localizations
that may in part determine the specific function of these
proteins. V-Src has been found in focal adhesions (Rohrschneider, 1980
), c-Src on endosomes (Kaplan et al., 1992
), Fyn in the microtubule organizing center (Ley et al., 1994
),
Hck on secretory granules (Mohn et al., 1995
), and Lck at
the plasma membrane (Ley et al., 1994
). Each Src-family
protein contains a nonhomologous domain of ~70 amino
acids at the NH2 terminus (the unique domain), followed
by a single Src homology 3 (SH3) domain, an SH2 domain,
and the tyrosine kinase or SH1 domain (see Rudd et al.,
1993
) (Fig. 1). In addition, a short tyrosine-containing (Y505 in Lck) motif at the COOH terminus regulates the
enzymatic activity of the protein (Cooper and Howell,
1993
), and a conserved region (SH4 domain) at the extreme NH2 terminus contains the signal(s) for acylation
(Fig. 1) (Resh, 1993
). All family members are myristoylated and, with the exception of Src and Blk, contain one
or two sites for palmitoylation (Koegl et al., 1994
; Resh,
1994
). Thus far palmitoylation has been demonstrated for
Lck, Fyn, Hck, Yes, and Fgr (Paige et al., 1993
; Alland et
al., 1994
; Koegl et al., 1994
; Shenoy-Scaria et al., 1994
).
Fig. 1.
Domain organization of the Src-family proteins and of
the Lck constructs used in this study. Lck is shown schematically
as a representative of Src-family proteins. Indicated are the
unique domain (UD), the Src Homology 3 (SH3), SH2, the tyrosine kinase (SH1) domains, and the short conserved COOHterminal region that contains the "regulatory" tyrosine (Y). The
amino acid sequence of the conserved NH2-terminal region, also
designated the SH4 domain, which contains the signals for acylation is shown for Lck. The attachment of myristic acid to glycine
(boxed) requires the removal of the NH2-terminal methionine
and the consensus sequence GXXXS/C. Palmitic acid is attached
to cysteines (encircled) and requires a myristoylated NH2-terminal glycine and cysteine on position 3. Cysteine 5 in Lck is also a
palmitate acceptor site.In this study we used Lck mutants with disruptions to the first
(LC1), the second (LC2), or both (LC1/2) palmitoylation sites
(Turner et al., 1990). Also depicted are the chimeras used in this
study: Lck/Src contains the unique domain of Lck and the remainder of Src, Src/Lck contains the unique domain of Src and
the remainder of Lck (Turner et al., 1990
). The chimera UD-GFP
is composed of the unique domain of Lck fused to the NH2 terminus of green fluorescent protein.
[View Larger Version of this Image (24K GIF file)]
; Levin et al., 1993
) and function (Straus and Weiss,
1992
) of these cells. The localization of Lck at the cytosolic
side of the plasma membrane is consistent with its role in
facilitating signaling through the T cell antigen receptor
(TcR)1. It is well established that Lck interacts with CD4
and CD8 (Rudd et al., 1988
; Veillette et al., 1988
), the TcR
coreceptors on helper and cytotoxic T cells, respectively,
and that these interactions are important for T cell activation (Zamoyska et al., 1989
; Glaichenhaus et al., 1991
).
Lck also plays a role in regulating the endocytic properties
of CD4, thereby controlling the cellular distribution of this
coreceptor (Pelchen-Matthews et al., 1992
). The interaction of Lck with CD4 or CD8 is dependent on the presence of cysteine motifs in the cytoplasmic tails of the coreceptor molecules and in the unique domain of Lck (Shaw
et al., 1990
; Turner et al., 1990
).
; Veillette et al., 1988
), the SH2 domain with phospho-tyrosine-containing sequences (Pawson, 1995
) and
phosphatidylinositol (Rameh et al., 1995
), the SH3 domain
with proline-rich sequences (Pawson, 1995
), and the kinase domain with its tyrosine-containing substrates. Furthermore, the regulatory COOH-terminal tyrosine is a
substrate for c-Src kinase (Csk) (Nada et al., 1991
), the
CD45 phosphatases (Ostergaard et al., 1989
) and, when
phosphorylated, interacts with the SH2 domain (Sieh et
al., 1993
).
). Furthermore, an association of Lck with elements of the cytoskeleton has been suggested (Louie et al.,
1988
; Kinch et al., 1994
). The role of these interactions in
establishing and maintaining the subcellular distribution
of Lck is also unclear.
Materials and Methods
). A3.01 cells were selected
for HAT-sensitivity after mutagenesis of CEM T cells with 8-azaguanine
(Folks et al., 1985
). A2.01 cells are CD4-negative derivatives of A3.01 cells.
A2.01 expressing CD4 without a cytoplasmic tail (A.201-CD4stop399)
and A3.01 were kindly provided by D. Littman (Skirball Institute, New
York).
). HeLa cells and HeLa transfectants were cultured in
DME containing 4% FCS, Pen/Strep (as above), and 1 mg/ml G418 where
appropriate. The HeLa cells expressing human CD4 used in this study
were made in our laboratory by Dr. C. Pitcher.
(Bio-Rad Laboratories, Richmond, CA). HeLa cells were transfected
using 450 V. Murine Lck (Marth et al., 1985
) and the constructs LC1, LC2,
LC1/2, and Lck/Src (Turner et al., 1990
) were all generously provided by
D. Littman. These constructs were subcloned behind the SV-40 promotor
of the pBabe/Hygro vector (Morgenstern and Land, 1990
) and 10 µg
DNA was used per transfection. Resistant colonies were selected on 0.2 mg/ml hygromycin. A cDNA encoding human CD4 was cloned into pSG5
(Stratagene Ltd., Cambridge, UK). A cDNA encoding CD4 with a stopcodon at position 399 (CD4
cyt) was prepared by site-directed mutagenesis using the Kunkel method.
), containing a Ser to Thr mutation
at position 65 (Heim et al., 1995
), was kindly provided by G. Gorrie (Medical Research Council Laboratory for Molecular Cell Biology, London). A
murine Lck unique domain (UD)-green fluorescent protein (GFP) chimera was made by three-step PCR using Taq polymerase. The first PCR
(PCR1) was performed using the Reverse Cycle primer (U.S. Biochemical
Corp., Cleveland, OH) and the oligonucleotide (5
)TCCTTTACTCATCAGCGGGGATGC(3)
(designated 413) with murine Lck cDNA cloned
into Bluescript KS. One half of the latter primer overlaps with the last 12 nucleotides of the unique domain of Lck and the other half with the first
12 nucleotides of GFP. The second PCR (PCR2) was performed with
GFP cDNA in pGW1, using oligonucleotide (5
)ATAAACAAGTTGGGCCAT(3
) (designated N2643) that anneals to the vector sequence
and as 5
primer (5
)GCATCCCCGCTGATGAGTAAAGGA(3
) (designated 412), which is complementary to 413. In the third PCR, the combined reaction products of PCR1 and PCR2 were used as templates for
the Reverse Cycle primer (5
) and N2643 (3
). The resulting product was
digested with EcoRI and cloned into pGW1 and sequenced using T7 sequenase (U.S. Biochemical Corp.).
) and used for immunofluorescence and electron microscopy. The
other (Lck II) was raised in our laboratory (Pelchen-Matthews et al.,
1992
), affinity purified using the Lck-peptide immobilized on Reactigel
(Pierce and Warriner, Chester, UK), and used for immunoblotting. Both
antisera against Lck do not recognize other members of the Src-family.
This was assessed by immunofluorescence and immunoblotting of T cells
that do not express normal Lck (JCam.1 [Straus et al., 1992]) and untransfected NIH-3T3 cells. The mAb 327 against v-Src was purchased from Oncogene Science, Inc. (Manhassett, NY). The rat mAb 23C identifies
-COP of the coatomer complex, under the conditions used (Willison et al., 1989
;
Harrison-Lavoie et al., 1993
). Peroxidase-conjugated goat anti-rabbit and
goat anti-mouse antibodies, as well as anti-mouse rhodamine, anti-rat
rhodamine, and anti-rabbit FITC reagents, were from Pierce and Warriner.
cyt was diluted in sterile PBS to a final concentration of 100 µg/ml and injected into
the nuclei. During microinjection, the cells were maintained at 37°C, in
5% CO2. Typically, 50 cells were injected over a 15-min period and the
cells were returned to the incubator for 3 h before fixation and staining.
70°C acetone for 30 min, recovered by centrifugation at 13,000 g for 15 min at 4°C, and resuspended in SDS-PAGE sample buffer. Samples from
membrane and supernatant preparations, representing equivalent numbers
of cells, were separated on 10% nonreducing SDS-polyacrylamide gels.
). Immunolabeling was performed as described (Slot et al.,
1991
) except that Lck I was used as primary antibody followed by goat
anti-rabbit IgG conjugated to 10-nm gold. Sections were viewed using a
transmission electron microscope (EM 400; Philips Electron Optic, Cambridge, UK).
Results
chain (at positions 194 and 196 in human
CD8a) (Shaw et al., 1990
; Turner et al., 1990
). As both
CD4 and CD8 are expressed at the cell surface, association with these proteins could promote plasma membrane localization of Lck. When expressed in the absence of CD4
or CD8 in transfected nonlymphoid cells, Lck has been
found to associate with the plasma membrane to some extent (Kwong et al., 1995; Yurchak et al., 1995). Whether
the distribution of Lck is influenced by coexpression of
CD4 or CD8 has not been examined.
). The relative amount of Lck that is associated with CD4 varies between T cell lines (Rudd et al.,
1993
). We determined this proportion to be at least 60 and
67% for SupT1 and A3.01 cells, respectively (not shown).
This was established by immunoblotting cell lysates for
Lck before and after depletion of CD4 by immunoprecipitation. The relative amount of CD4 that is associated with
Lck in SupT1 cells was found to be at least 85% (not
shown). Thus, the majority of Lck molecules are normally
complexed with CD4 in these cells and vice versa.
). By subcellular fractionation we
found that this pool of Lck constitutes only a very minor
fraction (<5%) of the total amount of Lck (not shown).
CD4 staining was also found in the perinuclear area, partially overlapping the Lck staining (see Fig. 2, SupT1
cells). This localization may reflect the presence of CD4 in
the exocytic pathway. We conclude that in T cells, Lck preferentially localizes to the plasma membrane independently of CD4 and, since CD8 is not expressed in A2.01CD4 stop399 cells, CD8.
Fig. 2.
Distribution of Lck in T cells. Double indirect immunofluorescence staining of Lck and CD4 in the CD4-expressing T cell line SupT1 and its CD4-negative derivative, BC7, as well as for the CD4-positive T cell line A3.01 and its derivative A2.01-CD4stop399, that
expresses CD4 without a cytoplasmic tail. Rabbit anti-Lck (Lck I) was detected with FITC-conjugated goat anti-rabbit antibodies, murine anti-CD4 (Q4120) with rhodamine-conjugated goat anti-mouse antibodies. Observation was by confocal microscopy of 3-µm-thick optical sections. Bar, 12.5 µm.
[View Larger Version of this Image (61K GIF file)]
; Carmo
et al., 1993
), CD5 (Raab et al., 1994
), the IL-2 receptor
(Hatakeyama et al., 1991
), 4-1BB (Kim et al., 1993
), and
various glycosyl-phosphatidylinositol (GPI)-(Thy-1, CD48,
CD55, and CD59) (Stefanova et al., 1991
), have been
shown to interact with Lck, albeit with low stoichiometry. To investigate whether any T cell-specific membrane protein is required for the cellular distribution of Lck, we stably transfected murine Lck cDNA into murine NIH-3T3
fibroblasts either with or without CD4. Neither CD4 nor
Lck are normally expressed in these cells.
Fig. 3.
Distribution of Lck
in NIH-3T3 fibroblasts. Double indirect immunofluorescence staining of Lck and CD4
in fibroblasts either stably
transfected with both CD4 and
murine Lck (left) or with murine Lck alone (right). Primary and secondary antibodies
were as described in the legend
to Fig. 1. Optical sections (3 µm) were observed by confocal microscopy. Bar, 20 µm.
[View Larger Version of this Image (92K GIF file)]
Fig. 10.
Cellular distribution of Lck palmitoylation mutants in
NIH-3T3 cells. (A) NIH-3T3 cells were stably transfected with either wild-type Lck, LC1, LC2, or LC1/2 (see Fig. 1). Cells were
stained by indirect immunofluorescence with an antibody against
Lck (Lck I). (B) CD4-expressing NIH-3T3 cells were transfected
with LC1/2 and stained for Lck with Lck I. Cells were observed
by fluorescence microscopy. Bar, 25 µm.
[View Larger Version of this Image (61K GIF file)]
Fig. 4.
Membrane association of Lck in the presence and absence of CD4. Cells were broken by passage through a ball-bearing homogenizer. After removal of unbroken cells and nuclei,
cellular membranes were recovered by centrifugation at 100,000 g
(P, pellet) and separated from the soluble fraction (S, supernatant). For each cell line, samples representing equivalent amounts
of cells were analyzed by SDS-PAGE and subsequent immunoblotting with the affinity-purified anti-Lck antibodies (Lck II).
(A) T cell lines expressing CD4 (SupT1 and A3.01), tailless CD4
(A2.01) or no CD4 (BC7). (B) NIH-3T3 cells transfected with
Lck alone, with both Lck and CD4, or with the palmitoylation
mutant LC1/2.
[View Larger Version of this Image (18K GIF file)]
]). As the surface areas of the membrane compartments in NIH-3T3 cells are likely to be similar to those in BHK cells, the exclusive presence of Lck at
the plasma membrane suggests that Lck is specifically sorted to this compartment. This sorting appears to occur
independently of the expression of T cell-specific proteins.
-COP indicated
that this perinuclear staining of Lck overlapped with the
Golgi complex (Fig. 5 A). This was confirmed by immunogold-electron microscopy. Frozen thin sections of HeLaLck cells, stained with anti-Lck antibodies and protein A
gold showed label associated with elements of the Golgi
apparatus (Fig. 5 C). The Golgi association was not a consequence of the heterologous expression of murine Lck in
human cells, as it was also observed for human Lck in
HeLa cells (Fig. 5 B). Nor was it due to overexpression of
Lck, since high level expression driven by the cytomegalovirus immediate early promotor (Fig. 5) and moderate
expression from the SV-40 early promotor showed similar
distributions (not shown). The Golgi association was not
unique to HeLa cells but was also observed when the protein was expressed in MDCK cells (not shown). It is possible that the cell type-specific variation in the cellular distribution of Lck reflects the involvement of cellular
components that are present in T cells and NIH-3T3 cells
but absent from HeLa and MDCK cells in establishing the
distribution of Lck.
Fig. 5.
Distribution of Lck in HeLa cells. (A) HeLa cells stably expressing murine Lck were double-stained with antibodies against Lck (Lck I) and -COP. Lck staining was detected with FITC-conjugated goat anti-rabbit antibodies,
-COP staining with rhodamineconjugated goat anti-rat antibodies. (B) HeLa cells stably expressing human Lck were transfected with a cDNA encoding CD4. 2 d
later, the cells were double-stained for Lck and CD4 (as in Fig. 1). Note the difference in distribution of Lck between cells that express CD4 (the four cells at the top) and cells that do not. Confocal images of a 3-µm optical section are shown. Bar, 20 µm. (C) Frozen thin
sections of untransfected HeLa cells (left) or HeLa cells transfected with human Lck (right) were labeled with an antibody against Lck
(Lck I) and as a second layer goat anti-rabbit IgG-conjugated gold (10 nm). Nu, nucleus; GC, Golgi complex; PM, plasma membrane. Bar, 0.1 µm.
[View Larger Versions of these Images (72 + 97 + 78K GIF file)]
). The disappearance of
the Golgi-associated Lck 3 h after microinjection of CD4
cDNA implies that newly synthesized CD4 can interact
with previously synthesized Lck located on the Golgi
membranes and facilitate the redistribution of this pool of
Lck. Thus in HeLa cells, the interaction between Lck and
CD4 can occur during transport of CD4 through the exocytic pathway.
Fig. 6.
Microinjection of
wild-type CD4 and tailless
CD4 into Hela-Lck cells.
HeLa cells stably expressing
human Lck were microinjected with cDNA for wildtype CD4 (left) or tailless
CD4 (right). Cells were fixed
3 h after injection and
stained with antibodies
against Lck and CD4 (as in
Fig. 1). Note the difference in
distribution of Lck between
cells that were injected with
wild-type CD4 cDNA (left,
the three cells on the left)
and cells that were not injected. Also note that injection with tailless CD4 cDNA
has no effect on the distribution of Lck (right, the cell in
the middle). Confocal images
of 3-µm optical sections are
shown. Bar, 15 µm.
[View Larger Version of this Image (96K GIF file)]
). The unique domains of Lck and c-Src
are not homologous apart from the signal for myristoylation at the extreme NH2 terminus (Resh, 1993
and 1994).
c-Src is modified by myristoylation only but contains an
additional polybasic region that enhances membrane association (Silverman and Resh, 1992
). In contrast, Lck is
modified with both myristic and palmitic acid (Paige et al.,
1993
).
) and attributed to association
with late endosomes. The distribution of the Src/Lck chimera was different from that of Lck despite containing
88% of the Lck protein sequence (Fig. 7). The staining pattern for Src/Lck was more punctate than that of Lck
and concentrated on one side of the nucleus. This distribution also differs from that of Src, but the specific location
of this chimera remains to be identified. Nevertheless, it is
clear that the presence of SH2, SH3, and kinase domains
of Lck do not target this chimera exclusively to the plasma
membrane. In contrast, the Lck/Src chimera was mainly
found at the plasma membrane (Fig. 7) identical to Lck.
Thus, the unique domain of Lck seems sufficient to target heterologous Src homology domains to the plasma membrane in NIH-3T3 cells.
Fig. 7.
Cellular distribution of chimeras
between Lck and Src. NIH-3T3 fibroblasts
were stably transfected either with Lck, c-Src, Lck/Src, or Src/Lck as indicated. Src/Lck contains the unique domain of c-Src and the remainder of Lck, while Lck/Src contains the
unique domain of Lck and the remainder of
c-Src (see Fig. 1). Lck- and Src/Lck-expressing cells were stained with Lck I, and Src- and
Lck/Src-expressing cells were stained with the
anti-Src mAb 327. Cells were observed by fluorescence microscope. Bar, 20 µm.
[View Larger Version of this Image (130K GIF file)]
). However,
UD-GFP was located at the plasma membrane, although
some protein was observed in the perinuclear region as
well (Fig. 8). In HeLa cells, UD-GFP again behaved similarly to Lck. In the absence of CD4 the protein was found
at the plasma membrane and in the Golgi region (Fig. 9).
When transfected into CD4-expressing cells, UD-GFP was
located predominantly at the plasma membrane (Fig. 9).
However, the extent of redistribution in the presence of
CD4 was slightly less for UD-GFP than for Lck, as some
internal staining of UD-GFP remained in CD4-expressing
cells. Association of UD-GFP with CD4 could be demonstrated by coimmunoprecipitation with anti-CD4 antibodies (not shown).
Fig. 8.
Cellular distribution of GFP and UDGFP in NIH-3T3 cells. NIH-3T3 cells were transfected either with GFP or UD-GFP, a chimera composed of the unique domain of Lck linked to
GFP. Cells were fixed 2 d later and observed by
fluorescent confocal microscopy. Note the
plasma membrane distribution of UD-GFP as
opposed to the cytosolic distribution of GFP.
Confocal images of 3-µm optical sections are
shown. Bar, 15 µm.
[View Larger Version of this Image (44K GIF file)]
Fig. 9.
Cellular distribution of UD-GFP in HeLa cells. UD-GFP
was transfected into HeLa cells (left) or into HeLa cells that express CD4 (right). Cells were fixed 2 d later and 3-µm optical sections were observed by confocal microscopy. Bar, 10 µm.
[View Larger Version of this Image (49K GIF file)]
; Kwong and Lublin 1995
), we found that the absence
of both palmitoylation attachment sites in the Lck mutant
LC1/2 (Fig. 1) localized the protein to the cytosol in stably
transfected NIH-3T3 cells (Fig. 10 A), indicating that
myristoylation alone is not sufficient for membrane association. Membrane association was also not detected by cell
fractionation (Fig. 4 B). We further found that LC1/2 also
localized to the cytosol when expressed in the presence of
CD4 (Fig. 10 B). Thus, the interaction of Lck with CD4 requires initial membrane association of Lck.
;
Milligan et al., 1995
). In addition to Cys 3, Cys 5 in Lck
and Cys 6 in Fyn (Alland et al., 1994
) are also palmitate
acceptor sites. For Lck, conflicting results have been reported on the relative contribution of the two cysteines to
palmitoylation (Rodgers et al., 1994
; Shenoy-Scaria et al.,
1994
). The constructs LC1 and LC2, with either one or the
other palmitoylation site deleted (Fig. 1), both localized to
the plasma membrane (Fig. 10 A) in stably transfected NIH-3T3 cells as was shown before by others (Yurchak et
al., 1995). However, we observed a striking difference in
distribution between LC1 and LC2: while the localization
of LC1 was indistinguishable from that of wild-type Lck,
LC2 was found at the plasma membrane and in the perinuclear region. The perinuclear staining of LC2 overlapped
with that of
-COP (not shown), suggesting that this mutant was associated with the Golgi complex in NIH-3T3
cells. A difference in localization between palmitoylation
mutants was also observed by Yurchak et al. (1995). However, they found that in stably transfected rat 208F fibroblasts, a mutant without Cys 5 (=LC2) localized to a
higher extent at the plasma membrane than wild-type Lck
or a mutant that lacks Cys 3 (=LC1). Lck and the Cys 3 mutant localized partially to the perinuclear region in their
experiments (Yurchak et al., 1995), but this staining does not resemble the Golgi staining described here for LC2.
We do not know the cause for this discrepancy other than
that cell type-specific differences might influence localization of Lck. Nevertheless, both sets of data show that the
position of the palmitic acid can influence the association
of Lck with specific membrane compartments.
Discussion
The association of Lck with CD4 and CD8, coreceptors
of the TcR in helper and cytotoxic T cells, respectively, is
well established. In the cells used in this study, at least 60-
70% of Lck is associated with CD4. Cysteine motifs in Lck
and in CD4 (or CD8) are essential for the Lck-CD4 association; however, the precise nature of the interaction and
where in the cell it is established is not understood. It has
been shown that Lck can associate with CD4 at the ER,
when CD4 is held in this compartment through association
with an ER-retained HIV-gp120 (Crise and Rose, 1992).
Furthermore, under conditions where Lck is overexpressed together with a construct containing the cytoplasmic tail of CD4, Lck was found to associate with an endo
H-sensitive form of this construct (Shaw et al., 1989
).
These observations suggest that Lck and CD4 might interact early in the exocytic pathway and subsequently move
together through the constitutive exocytic route to the
plasma membrane. Consequently, CD4 could have an active role in establishing the cellular distribution of Lck.
However, we found that in T cells, neither CD4 nor CD8 are required for targeting Lck to the plasma membrane.
In addition to CD4 and CD8, other T cell-specific transmembrane proteins such as CD2 (Bell et al., 1992; Carmo
et al., 1993
), CD5 (Raab et al., 1994
), CD28 (August and
Dupont, 1994
), the IL-2 receptor (Hatakeyama et al.,
1991
), the IL-7 receptor (Page et al., 1995
), and 4-1BB
(Kim et al., 1993
) associate with Lck, albeit with a lower
stochiometry. The finding that Lck expressed in NIH-3T3 cells is also located primarily at the plasma membrane indicated that T cell-specific proteins are not required for its
targeting.
Lck has also been shown to associate with various GPIlinked proteins, including CD48, CD55, CD59, and Thy-1
(Stefanova et al., 1991). A role for these ubiquitously expressed proteins in Lck targeting cannot be excluded at
present. However, it should be noted that the association
with GPI-linked proteins is not specific for Lck, but also
occurs for other Src-family members that have different
subcellular distributions to Lck (Shenoy et al., 1993; Stefanova et al., 1991
; Ley et al., 1994
). Furthermore, the interaction of Src-family kinases with GPI-linked proteins is
not well understood and may reflect an ability of both
GPI-linked and myristoylated/palmitoylated proteins to
partition with specific membrane lipids under certain conditions rather than a direct interaction. For one of the GPI-
linked proteins, CD59, we used anti-CD59 antibodies to
induce cap formation on the CD4-negative T cells BC7.
We failed to see cocapping of Lck, suggesting that the interaction between these two proteins in living cells is minimal (not shown). In contrast, cocapping of Lck with CD4
was observed (our unpublished data and Ley et al., 1994
).
As far as the individual domains of Lck are concerned,
we found that the unique domain of Lck is important for
the subcellular distribution of the protein. A chimera of
Lck and c-Src, in which the unique domain of c-Src was
substituted for that of Lck, localized exclusively to the
plasma membrane. In contrast, c-Src itself localizes to the
plasma membrane and perinuclear region (Fig. 7). In addition, a chimera composed of the unique domain of Lck and GFP (UD-GFP) also localized to the plasma membrane, while GFP was found in the cytosol and nucleus
(Fig. 8). Thus, the SH2 and SH3 domains do not appear to
contain targeting information that is relevant under the
conditions of these experiments. This is in contrast to v-Src,
where the SH2 domain was found to be important for its
localization to focal adhesion sites (Okamura and Resh,
1994), and the signaling molecules phospholipase C
and
GRB2 where the SH3 domain is crucial for localizing to
the actin cytoskeleton (Bar et al., 1993
).
In HeLa and MDCK cells we found Lck located in the
Golgi region and at the plasma membrane. Microinjection
of a cDNA encoding Lck-interactive forms of CD4 led to
the loss of Golgi-associated Lck within 3 h, indicating that
newly synthesized CD4 can interact with this pool of Lck
and presumably facilitate its transport to the cell surface.
The notion that CD4 can provide a dominant signal for
Lck localization may also explain why ER-retained CD4 can cause Lck to be located on the ER (Crise and Rose,
1992). Currently, we do not know why wild-type Lck associates with the Golgi in HeLa and MDCK cells but not in
T cells or NIH 3T3 cells. One hypothesis is that T cells and
NIH-3T3 cells express proteins that, in the absence of
CD4, allow efficient transport of Lck to the plasma membrane and that these proteins are missing or limited in
HeLa and MDCK cells. However, it is also possible that in
HeLa and MDCK cells, Lck is retained in the Golgi complex due to aberrant interactions with Golgi components.
Fusing NIH-3T3 cells with Lck-expressing HeLa cells might
allow us to discriminate between these possibilities. The
Golgi localization in HeLa cells might imply that newly
synthesised Lck is initially directed to an intracellular
membrane system and then transported to the plasma membrane on vesicular intermediates either with or without CD4/CD8.
In NIH-3T3 cells we also observed a Golgi distribution
for an Lck construct that has a mutation of the palmitoylation site at Cys 5. A mutant with a disruption of the first
palmitoylation site (Cys 3) showed a similar distribution to
that of wild-type Lck (Fig. 10 A). We assume that these
mutants were palmitoylated since they associated with
membranes and either Cys 3 or Cys 5 can be used for
palmitoylation (Kwong and Lublin, 1995; Rodgers et al.,
1994
; Yurchak and Sefton, 1995
). One explanation for the difference in localization between the two Lck mutants
could be that the use of different palmitoylation sites predisposes the protein to interact with the glycolipid domains that have been proposed to mediate sorting in the
trans-Golgi network (Yoshimori et al., 1996
). Some interaction of Lck with glycolipid domains has been reported
(Shenoy et al., 1993; Rodgers et al., 1994
), but the significance of this association remains to be determined. The
position of the palmitic acids on Lck may also influence
recognition by proteins that are involved in sorting Lck to
the plasma membrane. Whether parts of the unique domain other than the SH4 region influence the distribution
of Lck remains to be examined. The Golgi localization of
LC2 again implies that Lck could normally associate transiently with elements of the exocytic pathway before being
deposited at the plasma membrane, while inefficient transport results in retention of Lck on the Golgi complex.
Palmitoylation is crucial for stable association of Lck
with membranes. So far, all palmitoyl transferase activities
identified are membrane associated and, in some cases,
have been localized to parts of the exocytic pathway. A
palmitoyl transferase activity that acylates newly synthesized transmembrane proteins has been localized to the intermediate compartment (Bonatti et al., 1989). Furthermore, the cytosolic peripheral membrane protein glutamic acid decarboxylase (GAD65), requires targeting to the
Golgi region for palmitoylation (Solimena et al., 1994
).
Recently, a palmitoyl transferase that is specific for myristoylated proteins and palmitoylates Fyn in vitro was partially purified from bovine brain membranes (Berthiaume
and Resh, 1995
). Together, these data imply that Lck is
initially targeted to a membrane system, possibly belonging to the exocytic pathway, where palmitoylation occurs.
After membrane binding, Lck moves to the plasma membrane. How Lck is sorted to the plasma membrane rather
than other cellular membrane systems remains to be determined. However, the studies reported here provide a
basis on which these mechanisms can start to be unravelled.
.
Address all correspondence to Mark Marsh, MRC Laboratory for Molecular Cell Biology and Department of Biochemistry, University College London, Gower Street, London WC1E 6BT, United Kingdom. Tel.: (0044) 0171 380 7807. Fax: (0044) 0171 380 7805. E-mail: m.marsh{at}ucl.ac.ukWe thank colleagues in the Medical Research Council Laboratory for Molecular Cell Biology, for helpful discussions, Mark Shipman for assistance with confocal microscopy, Kate Nobes for instruction in microinjection, and Annegret Pelchen-Matthews for critically reading the manuscript. John Tite (GlaxoWellcome plc) provided constant support, and Dan Littman and Steve Ley provided crucial reagents.
This work was supported by Wellcome Foundation plc, the Leukaemia Research Campaign, the Medical Research Council, and by a long term European Molecular Biology Organization fellowship to M.-J.J.E. Bijlmakers.
GFP, green fluorescent protein; Lck, Src-family protein tyrosine kinase p56lck; TcR, T cell antigen receptor; UD, unique domain.