Department of Cell Biology, Harvard Medical School, Boston, Massachusetts 02115
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
A feedback control mechanism, or cell cycle checkpoint, delays the onset of anaphase until all the chromosomes are correctly aligned on the mitotic spindle. Previously, we showed that the murine homologue of Bub1 is not only required for checkpoint response to spindle damage, but also restrains progression through a normal mitosis (Taylor, S.S., and F. McKeon. 1997. Cell. 89:727-735). Here, we describe the identification of a human homologue of Bub3, a 37-kD protein with four WD repeats. Like Bub1, Bub3 localizes to kinetochores before chromosome alignment. In addition, Bub3 and Bub1 interact in mammalian cells. Deletion mapping was used to identify the domain of Bub1 required for binding Bub3. Significantly, this same domain is required for kinetochore localization of Bub1, suggesting that the role of Bub3 is to localize Bub1 to the kinetochore, thereby activating the checkpoint in response to unattached kinetochores. The identification of a human Mad3/Bub1-related protein kinase, hBubR1, which can also bind Bub3 in mammalian cells, is described. Ectopically expressed hBubR1 also localizes to kinetochores during prometaphase, but only when hBub3 is overexpressed. We discuss the implications of the common interaction between Bub1 and hBubR1 with hBub3 for checkpoint control.
Key words: hBub3; mitosis; cell cycle; checkpoint; anaphase ![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
BEFORE cell division, the replicated genome must be
accurately segregated to ensure the continued
growth and development of the daughter cells. To
maintain the fidelity of chromosome segregation, eukaryotes have evolved a feedback control mechanism, often referred to as a cell cycle checkpoint (Hartwell and Weinert,
1989), which delays the onset of anaphase until all the
chromosomes are correctly aligned on the microtubule
spindle apparatus.
Evidence that the mitotic checkpoint monitors chromosome alignment has been mounting for many years. It has
long been appreciated that insect spermatocytes remain
blocked at the first meiotic metaphase if one or more chromosomes are not correctly attached to the meiotic spindle
(Callan and Jacobs, 1957). In addition, analyses of mitotic
newt heart cells suggested that the arrival of the last kinetochore at the metaphase plate may play a critical role
in regulating anaphase onset (Zirkle, 1970a
,b).
More recently, it has been shown that anaphase is inhibited until all the chromosomes achieve bipolar attachments
(Rieder et al., 1994) and that unattached kinetochores generate the inhibitory signal (Rieder et al., 1995
). Micromanipulation experiments with insect spermatocytes suggest
that this inhibitory signal is generated by tension-sensitive
kinases and/or phosphatases located at the kinetochore
(Nicklas, 1997
). When a chromosome is not attached to the
spindle, or only mono-oriented, the kinetochores are not under tension. In the absence of tension, kinetochores express the 3F3/2 phosphoepitope, suggesting that a kinase is
active, and anaphase is delayed (Gorbsky and Ricketts,
1993
; Li and Nicklas, 1995
, 1997
; Nicklas et al., 1995
).
Upon achieving a bipolar attachment, kinetochores experience tension due to opposing spindle forces. When under
tension, kinetochores lack the 3F3/2 phosphoepitope, suggesting a loss of kinase activity, and anaphase ensues. Significantly, microinjection of the 3F3/2 antibody into living
cells prevents kinetochore dephosphorylation and delays
the onset of anaphase (Campbell and Gorbsky, 1995
).
Although the evidence implicating tension as the regulator of anaphase onset in insect spermatocytes is compelling (Nicklas, 1997), it is not known whether tension is the
key factor in other cell types. Furthermore, it is not known
whether the effect of tension is direct. Tension at the kinetochore is known to stabilize microtubule attachment
(Nicklas and Koch, 1969
) and hence microtubule attachment may be the event that directly regulates anaphase. Indeed, in mitotic PtK1 cells, laser ablation of the distal,
unattached kinetochore of a mono-oriented chromosome
resulted in a timely anaphase, suggesting that microtubule
attachment, not tension, regulates anaphase (Rieder et al.,
1995
). However, it has been suggested that, in these irradiated cells, the remaining attached kinetochore is still under tension due to polar ejection forces (Rieder et al.,
1995
).
Formal demonstration that the onset of anaphase is regulated by a cell cycle checkpoint, as defined by Hartwell
and Weinert (1989), came with the identification of several
Saccharomyces cerevisiae mutants that failed to undergo
mitotic arrest in response to spindle damage (Hoyt et al.,
1991
; Li and Murray, 1991
). Genetic screens identified
BUB 1, 2, and 3 (Hoyt et al., 1991
) and MAD 1, 2, and 3 (Li and Murray, 1991
) as necessary for the preanaphase delay in response to spindle damage. Mad1, a phosphoprotein that can bind Mad2, is hyperphosphorylated in response to spindle damage (Hardwick and Murray, 1995
).
This phosphorylation appears to be carried out by Mps1
(Hardwick et al., 1996
), a protein kinase required for spindle pole body duplication and checkpoint response to
spindle damage (Weiss and Winey, 1996
). Bub1 is a protein kinase that can bind and phosphorylate Bub3 (Roberts et al., 1994
; Farr and Hoyt, 1998
), and appears to act
upstream of Mad1 (Hardwick and Murray, 1995
). Both
Mad3, which shares homology with the NH2-terminal, noncatalytic domain of Bub1, and Bub2 appear to act
downstream of Mad1 phosphorylation (Hardwick and
Murray, 1995
).
One of the downstream targets of the mitotic checkpoint is likely to be the anaphase-promoting complex
(APC)1 or cyclosome (Irniger et al., 1995; King et al., 1995
;
Sudakin et al., 1995
; Tugendreich et al., 1995
). Activation
of APC is required to initiate both the onset of anaphase,
by degrading inhibitors of sister chromatid separation such
as Pds1 and Cut2 (Cohen-Fix et al., 1996
; Funabiki et al.,
1996
), and the exit from mitosis, by degrading mitotic cyclins and the spindle component, Ase1 (Juang et al., 1997
).
Recently, Mad2 has been shown to interact with APC (Li
et al., 1997
; He et al., 1997
; Hwang et al., 1998
; Kim et al.,
1998
) and repress its activity by inhibiting cdc20, an APC
activator (Visintin et al., 1997
; Hwang et al., 1998
; Kim et al.,
1998
). Although these observations link the checkpoint pathway to the cell cycle machinery that initiates anaphase, the mechanism by which Mad2 inhibits APC remains unclear. In addition, how spindle events regulate
Mad2 activity remains uncertain.
The BUB and MAD genes are also required for the mitotic delay induced by mutations in centromeric DNA sequences and kinetochore proteins (Wang and Burke, 1995;
Pangilinan and Spencer, 1996
; Wells and Murray, 1996
).
These observations suggested that the Mad and Bub proteins may play a role in the kinetochore attachment checkpoint described in larger eukaryotes. Additional support for this hypothesis came with the identification of vertebrate homologues of Mad2 (Chen et al., 1996
; Li and Benezra, 1996
), which localize to kinetochores of chromosomes before alignment on the metaphase spindle. Indeed,
XMad2 is required to maintain MPF activity in a Xenopus
egg extract system that reconstitutes the mitotic checkpoint (Chen et al., 1996
), and electroporation of anti-HsMad2 antibodies into HeLa cells inhibited mitotic arrest in response to spindle disruption (Li and Benezra,
1996
).
The murine homologue of Bub1 also localizes to the kinetochores of unaligned chromosomes (Taylor and McKeon,
1997). Expression of a dominant-negative mBub1 mutant in
HeLa cells compromised their ability to maintain mitotic
arrest in response to spindle damage. In addition, disrupting Bub1 function accelerated passage through a normal
mitosis, suggesting that Bub1 monitors the interactions between microtubules and kinetochores during every cell cycle (Taylor and McKeon, 1997
). To further characterize
how Bub1 activity regulates mitotic progression, we set
out to analyze proteins that interact with Bub1. In S. cerevisiae, Bub3 binds to and is a substrate of Bub1 (Roberts
et al., 1994
). Here we describe the identification of a human homologue of Bub3, which appears to be required for
kinetochore localization of Bub1. In addition, we describe
a human protein that shares significant homology with the NH2-terminal domain of Mad3 from budding yeast
(ScMad3). However, unlike ScMad3, this human protein
has a COOH-terminal extension that contains a protein
kinase domain, suggesting that it is a Bub1-related protein. This human Mad3/Bub1-related protein, hBubR1, also binds to hBub3 and can localize to kinetochores during prometaphase. The implications of the common interaction between Bub1 and BubR1 with Bub3 are discussed.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
cDNA Cloning and Manipulation
Human expressed sequence tags (ESTs) with homology to ScBub3
(EMBL/GenBank/DDBJ accession number H83201; WashU-Merck EST Project, St. Louis, MO), ScMad3 (accession number AA314793; Adams et
al., 1995), and mBub1 (accession number R94348; WashU-Merck EST
Project) were identified by searching the National Center for Biotechnology Information dEST databases using the BLAST algorithm (Altschul et
al., 1990
). Based on the EST sequences, the following oligonucleotides
were designed and used to screen pools of cDNAs by PCR: hBub3 Fwd
5' GTAACAGCTGCTGGGATTACACATGGC 3'(This is a vector-
derived sequence and was used in a vector-insert PCR screen); hBub3 Rvs
5' CTCCCTGCGCTGCTGCACGTAACC 3'; hBubR1 Fwd 5' TAGCTC- CGAGGGCAGGTTGC 3'; hBubR1 Rvs 5' CATAAACGCCCTAAT-
TTAAGCCAGAG 3'; hBub1 Fwd 5'ACGTATGGGGCCAAGTGT-
AGG 3'; hBub1 Rvs 5' GTCTGTTACTGTCTGGGCTTTCAA 3'. Positive subpools were screened by hybridization using either the ESTs
(hBub3 and hBub1) or the PCR product (hBubR1) as probes. cDNAs
were constructed using the SuperScript plasmid system for cDNA synthesis and plasmid cloning kit (GIBCO BRL, Gaithersburg, MD). mRNA
was purified from the U2OS osteosarcoma cell line using the FastTrack
Kit (Invitrogen, Carlsbad, CA). PCR reactions and filter hybridizations
were done according to standard methods (Sambrook et al., 1989
). cDNA
inserts were sequenced on both strands using an ABI 373A sequencer
(BioPolymers Facility, Howard Hughes Medical Institute, Harvard Medical School, Boston, MA). Sequence alignments were performed using the
MegAlign software (DNAStar, Madison, WI). The expression vectors
were constructed by directly subcloning cDNA fragments and/or PCR
amplification using Pfu polymerase (Stratagene, La Jolla, CA). All the expression vectors are based on pcDNA-3 (Invitrogen), modified to include
the 5' untranslated sequence from the human lamin A cDNA and NH2-terminal Myc, green fluorescent protein, or GST tags. Mutagenesis of
hBub3 was performed using the GeneEditor kit (Promega Corp., Madison, WI) according to the manufacturer's instructions. The hBub3
VAVE
mutant was constructed using the following oligonucleotide: 5' TCT ATT
GAA GGC CGA AGA TCT TAT TTG GAC CCA AGC 3', which results in a substitution of four amino acids (217 VAVE 220) with two
amino acids (217 RS 218), thus introducing a novel BglII restriction site.
Cell Culture and Transfections
BHK cells were cultured in a humidified incubator at 37°C plus 5% CO2 in
Dulbecco's modified Eagle's media supplemented with 10% fetal calf serum (HyClone, Logan, UT), 100 U/ml penicillin, 100 µg/ml streptomycin,
and 2 mM glutamine. All media reagents were from GIBCO BRL unless
stated otherwise. Transient transfections for immunofluorescence analysis
were performed on 18-mm coverslips using the calcium phosphate method
as described (Heald et al., 1993). Transient transfections for purification
of GST-hBub3 complexes were performed using Lipofectamine (GIBCO
BRL). Briefly, 1.6 × 105 BHK cells were plated in 60-mm dishes, cultured
for 24 h, and then washed three times with serum-free media. 1 µg of
DNA, purified by two rounds of cesium chloride/ethidium bromide density centrifugation, was complexed with 16 µg of Lipofectamine in serum-free media at room temperature for 20 min and then added to the cells in a
final volume of 1 ml of serum-free media for 16 h. The cells were then fed
with media plus serum and cultured for a further 24 h.
Immunofluorescence
24 h after transfection, BHK cells were fixed for 5 min in 1% formaldehyde, freshly diluted from a 37% stock (J.T. Baker, Phillipsburg, NJ) in PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4). After fixation, cells were washed three times in PBST (PBS plus 0.1% Triton X-100) and then blocked in PBST plus 5% nonfat dried milk (NFDM) for 30 min. To detect Myc-tagged proteins, the cells were incubated with the 9E10 monoclonal antibody diluted 1:500 in PBST plus 5% NFDM for 30 min. After three washes in PBST, the cells were incubated with a Cy3-conjugated donkey anti-mouse secondary antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) diluted 1:500 in PBST plus 5% NFDM for 30 min. After three washes in PBST the chromatin was stained for 1 min with Hoechst 33258 at 1 µg/ml in PBST. The coverslips were then inverted on microscope slides using 90% glycerol plus 10% 0.2M Tris-HCl, pH 7.5, as mounting media. Kinetochores were labeled using a CREST autoimmune serum diluted 1:1,000 and a Cy3-conjugated donkey anti-human secondary antibody (Jackson ImmunoResearch Laboratories, Inc.). Cells were examined on an Axioplan 2 microscope (Carl Zeiss, Inc., Thornwood, NY) equipped with fluorescence using an oil immersion 63× objective lens. Images were captured using a Sony color video camera (Park Ridge, NJ) driven by the Northern Exposure software (Empix Imaging, Inc., Mississauga, ON), and processed for printing using Adobe Photoshop (Adobe Systems, Inc., San Jose, CA).
Purification and Analysis of GST-hBub3 Complexes
Soluble protein lysates were prepared by scraping transfected cells in 500 µl
of lysis buffer (100 mM NaCl, 50 mM Hepes, pH 7.4, 20 mM -glycerophosphate, 1 mM sodium vanadate, 10 mM EDTA, 10 mM EGTA, 1 mM
DTT, 1 mM PMSF, 1 µg/ml antipain, 1 µg/ml aprotinin, 5 µg/ml bestatin,
5 µg/ml chymostatin, 2 µg/ml leupeptin, and 1 µg/ml pepstatin), followed
by centrifugation at 14,000 g for 10 min at 4°C. To purify GST-hBub3
complexes, 20 µl of glutathione Sepharose beads (Pharmacia Biotech,
Inc., Piscataway, NJ), equilibrated in lysis buffer and resuspended as a
50% slurry, were added to the lysates and incubated at 4°C for 30 min. After five washes in lysis buffer, proteins were eluted off the beads by boiling in SDS sample buffer, resolved by SDS-PAGE, and electroblotted onto
Immobilon-P membranes (Millipore Corp., Waters Chromatography, Milford, MA). GST-hBub3 and Myc-tagged proteins were then labeled using
a rabbit polyclonal antiserum containing both anti-GST and anti-Myc antibodies diluted at 1:1,000 in TBST (50 mM Tris, pH 7.6, 150 mM NaCl,
0.1% Tween-20) plus 5% NFDM for 1 h at room temperature. After
washing in TBST, bound primary antibodies were labeled with a horseradish peroxidase-conjugated goat anti-rabbit antibody (Zymed Labs,
Inc., South San Francisco, CA) diluted 1:500 in TBST plus 5% NFDM.
After washing in TBST, bound secondary antibodies were detected using
the SuperSignal chemiluminescence system (Pierce Chemical Co., Rockford, IL). To perform in vitro kinase assays, GST-mBub1 and GST-
hBubR1 were expressed and purified as described above for GST-hBub3.
After washing in lysis buffer, the beads were equilibrated in kinase buffer
(50 mM NaCl, 50 mM Hepes, pH 7.4, 20 mM
-glycerophosphate, 10 mM
MgCl2, 10 mM MnCl2, 1 mM sodium vanadate, 1 mM DTT, and 1 mM
PMSF) and then incubated with 10 µCi 32P
-ATP (ICN Biomedicals,
Inc., Irvine, CA) at 30°C for 30 min. The beads were then washed three
times in lysis buffer and bound proteins were eluted by boiling in SDS
sample buffer. Eluted proteins were resolved by SDS-PAGE, exposed to
a PhosphorImager screen, and analyzed using ImageQuant software (both
from Molecular Dynamics, Inc., Sunnyvale, CA).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Structural Comparison of Bub3 Homologues
A screen of EST databases identified a partial human
cDNA with homology to the S. cerevisiae protein Bub3
(ScBub3) (Hoyt et al., 1991). We isolated a corresponding full-length human cDNA (hBub3, EMBL/GenBank/
DDBJ accession number AF053304) with a 984-bp open
reading frame encoding a 328-amino acid protein with a
predicted molecular mass of ~37 kD. hBub3 shares ~34%
identity and 69% similarity with ScBub3 throughout the
entire protein. Both ScBub3 and hBub3 contain four WD
repeats, three in the NH2-terminal region and one towards
the COOH terminus (Fig. 1). hBub3 also shares significant
homology with the Rae1 proteins from human (Bharathi
et al., 1997
), S. cerevisiae (Murphy et al., 1996
) and Schizosaccharomyces pombe (Brown et al., 1995
), which
have been implicated in nucleocytoplasmic transport. An
alignment of the Bub3 and Rae1 homologues (Fig. 1) indicates that the Bub3 and Rae1 proteins represent two separate families.
|
hBub3 Localizes to Kinetochores before Chromosome Alignment
To determine the subcellular localization of hBub3, the
DNA corresponding to the open reading frame was cloned
into a GFP-tagged expression vector and transiently transfected into BHK cells. After fixation, chromatin was
stained with Hoechst dye and kinetochores labeled with
CREST autoantibodies. During interphase, the GFP fluorescence was diffusely localized in the nucleus (Fig. 2 A). During prophase and prometaphase, GFP fluorescence
was concentrated in pairs of foci that colocalized with the
CREST antigens (Fig. 2, B and C). During metaphase and
anaphase, the GFP fluorescence was distributed throughout the cell, whereas the CREST antigens remained associated with the chromatin (Fig. 2, D and E). Based on
these observations, we conclude that hBub3 localizes to kinetochores during prophase and prometaphase, but not
during and after metaphase. This kinetochore localization
pattern is very similar to that of murine Bub1 (Taylor and
McKeon, 1997).
|
A Domain in the NH2 Terminus of mBub1 Binds hBub3
In interphase cells, ectopically expressed mBub1 is predominately cytoplasmic (Taylor and McKeon, 1997)
whereas hBub3 is nuclear (Fig. 2 A). These different localization patterns provided an opportunity to test whether
Bub3 and Bub1 associate in mammalian cells. We reasoned that if these two proteins interacted, the localization
pattern of one or the other may be altered when coexpressed. The top row in Fig. 3 A shows two cells expressing
hBub3, only one of which is expressing mBub1. In the cell
not expressing mBub1, hBub3 is exclusively nuclear. However, in the cell expressing mBub1, hBub3 localizes to
both the cytoplasm and nucleus. This cytoplasmic sequestration of hBub3 was dependent on the amount of mBub1
cotransfected, but was not observed when a control plasmid was cotransfected (Fig. 3 B).
|
To determine which domain of mBub1 was responsible
for the cytoplasmic sequestration of hBub3, a series of
mBub1 deletion mutants were cotransfected with hBub3.
When the three major subdomains of mBub1 were assayed (Fig. 4 A), only the NH2-terminal domain (amino
acids 1-331) was capable of sequestering hBub3 in the cytoplasm in a dose-dependent manner (Fig. 3 B). Further
deletion mapping of the NH2-terminal domain of mBub1
identified a region within amino acids 201-300 as being required for localizing hBub3 in the cytoplasm (Fig. 4 A).
Closer inspection of the amino acid sequence in this region
identified a domain that shows significant homology between the Bub1 proteins from mouse, human, and S. cerevisiae. (Fig. 4 B). This 37-amino acid region of mBub1
shares ~36% identity with the corresponding domain in
ScBub1. To test whether this domain is required for the
Bub1/Bub3 interaction, we constructed a mutant lacking
this region (NH2-mBub1[40038]). This deletion abolished the ability of the NH2 terminus of mBub1 to sequester hBub3 in the cytoplasm (Fig. 3 A).
|
|
To test whether the cytoplasmic sequestration of hBub3
reflects a physical interaction between the two proteins,
hBub3 was expressed as a GST fusion protein in BHK
cells along with the NH2-terminal 400 amino acids of
mBub1 (NH2-mBub1[400]). GST-hBub3 was then purified
from cell lysates by affinity chromatography using glutathione-Sepharose beads and the affinity complexes were analyzed by Western blotting. NH2-mBub1(400) clearly
purifies with the glutathione beads in a GST-hBub3-dependent manner (Fig. 3 C, lane 4). In contrast, NH2-mBub1(40038), which does not sequester hBub3 in the
cytoplasm, does not copurify with GST-hBub3 (Fig. 3 C,
lane 5). Based on these observations, we conclude that
Bub1 and Bub3 can bind in mammalian cells, and that a
38-amino acid domain in the NH2 terminus, which is conserved among the Bub1 and Mad3-related proteins, is required for this interaction.
The Bub3-binding Domain of Bub1 Is Also Required for Kinetochore Localization
We previously showed that the kinetochore localization
domain of mBub1 resides within the NH2-terminal 331 amino acids (Taylor and McKeon, 1997). To further define
the kinetochore localization domain, we assayed the deletion mutants shown in Fig. 4 A for kinetochore localization
during mitosis by transient transfection into BHK cells.
This analysis defined a region within amino acids 201-300
as being required for kinetochore localization, suggesting that the hBub3-binding domain and the kinetochore localization domain of mBub1 may overlap (Fig. 4 A). Significantly, the 38-amino acid deletion that abolished the ability of mBub1 to interact with hBub3 also abolished its
ability to localize to the kinetochore. These observations
suggest that the Bub1/Bub3 interaction is required for localizing Bub1 to the kinetochore in mitosis.
The Bub3-binding Domain Is Conserved in hBubR1
The NH2 terminus of Mad3 from S. cerevisiae (ScMad3, EMBL/GenBank/DDBJ accession number Z49288) shares significant homology with the NH2-terminal domain of Bub1 (Hardwick, K.G., and A.W. Murray, personal communication) (refer to Fig. 4 C and see Fig. 5 A). Interestingly, ScMad3 also shares homology with Bub1 within the Bub3-binding domain (Fig. 4 B). This observation tempted us to speculate that perhaps Mad3 may also bind Bub3. To test this possibility, we set out to clone a mammalian homologue of ScMad3. A screen of EST databases identified a partial human cDNA with homology to the ScMad3. Using this EST, we isolated a corresponding full-length cDNA (EMBL/GenBank/DDBJ accession number AF053306) with an open reading frame of 3,153 bp, encoding a 1,050-amino acid protein with a predicted molecular weight of ~119 kD.
|
The NH2-terminal domain of this human Mad3-like protein (Fig. 4 C, lightly shaded box) shares ~26% identity
with ScBub1 and 35% identity with ScMad3 (Fig. 5 A).
However, unlike ScMad3, this human protein has a
COOH-terminal kinase domain (Fig. 4 C). Although this
kinase domain shares homology with the Bub1 kinase domains, it is clearly distinct (Fig. 5 B). For example,
whereas ScBub1 and mBub1 share 33% identity in the kinase domain, ScBub1 and the human Mad3/Bub1-related
protein share only 20% identity. Furthermore, mBub1 is
more closely related to ScBub1 (33% identity) than it is to
the human Mad3/Bub1-related protein (26% identity) in
the kinase domain. These observations suggest that this
human protein is perhaps not an additional member of the
Bub1 family, but more likely a Mad3-related protein. This
human Mad3/Bub1-related kinase is identical to a Bub1-related protein recently described by Cahill et al. (1998).
Therefore, in an effort to maintain a consistent nomenclature, we will refer to this Mad3/Bub1-related protein as
hBubR1.
Exogenous hBubR1 Localizes to the Kinetochore Only When Bub3 Is Overexpressed
To test whether hBubR1 localizes to kinetochores, the
open reading frame of its cDNA was cloned into an Myc-tagged mammalian expression vector and transiently transfected into BHK cells. During interphase, hBubR1 was
predominantly cytoplasmic (Fig. 6 A). During mitosis,
hBubR1 was diffusely distributed throughout the cell (Fig.
6 C), although occasionally, very faint kinetochore staining was observed during prometaphase (data not shown).
Note that mBub1 is also cytoplasmic when ectopically expressed in interphase BHK cells, but exhibits clear kinetochore staining in transfected prometaphase cells (Taylor
and McKeon, 1997).
|
The different localizations of ectopically expressed hBubR1 and hBub3 during interphase allowed us to test whether these two proteins interact by performing cotransfections as described above to test the Bub1-Bub3 interaction. Fig. 6 A shows several cells that have been cotransfected with hBubR1 and hBub3. In the cells not expressing hBubR1, hBub3 is predominantly nuclear. In the cell coexpressing hBubR1, hBub3 is clearly localized to the cytoplasm, suggesting that hBubR1 and hBub3 can interact in mammalian cells. Significantly, in prometaphase cells coexpressing hBub3 and hBubR1, localization of hBubR1 at kinetochores was observed (Fig. 6 D).
A Domain Conserved between the Bub1 and Mad3-related Proteins Is Required for the hBubR1-hBub3 Interaction
To test whether the homology domain defined in Fig. 4 B
is required for the hBubR1/hBub3 interaction, this region
was deleted to generate hBubR142. GST-hBub3 was
cotransfected with either hBubR1 or hBubR1
42 into
BHK cells, followed by affinity purification from cell lysates using glutathione Sepharose beads. The affinity complexes were then analyzed by Western blotting. hBubR1
clearly purifies with the glutathione beads in a GST-
hBub3-dependent manner (Fig. 7, lane 4). In contrast,
hBubR1
42 does not copurify with GST-hBub3 (Fig. 7,
lane 5). In addition, hBubR1
42 did not sequester coexpressed hBub3 in the cytoplasm (Fig. 6 B). Furthermore, hBubR1
42 did not localize to kinetochores when coexpressed with hBub3 (Fig. 6 E). These observations show
that hBubR1 can physically interact with hBub3 in mammalian cells, and that a domain conserved between the Bub1
and Mad3-related proteins is required for this binding.
hBub3VAVE Does Not Interact with mBub1
or hBubR1
To define the domain of Bub3 required for binding to
Bub1 and BubR1, several hBub3 mutants were generated
and scored for their ability to be sequestered in the cytoplasm when coexpressed with either mBub1 or hBubR1.
One mutant, hBub3VAVE, which contains a four-amino
acid deletion (amino acids 217-220) from within the central domain (refer to Fig. 1), was not sequestered in the cytoplasm when coexpressed with either mBub1 or hBubR1,
but rather remained exclusively nuclear (Fig. 8). These observations suggest that Bub3 binds to both Bub1 and
BubR1 in a similar manner. Kinetochore localization of
hBub3
VAVE was not observed in transfected prometaphase cells (data not shown), suggesting that the ability to bind Bub1 or BubR1 is required for kinetochore localization of Bub3.
|
In Vitro Phosphorylation of mBub1 and hBubR1
The sequence alignment shown in Fig. 5 B indicates that
the kinase domain of hBubR1 differs significantly from
the mBub1 kinase domain. In addition, hBubR1 lacks several of the residues that are usually highly conserved
among most protein kinases (Hanks and Hunter, 1995).
To test whether hBubR1 is indeed a protein kinase, GST-
hBubR1 was expressed in BHK cells, affinity purified from cell lysates using glutathione Sepharose beads, and
then assayed for in vitro protein kinase activity. Bound
proteins were first analyzed by Western blotting to normalize the amount of GST protein used in the subsequent
kinase assays (Fig. 9). The kinase assay reveals several
phosphorylated proteins associated with the glutathione
beads incubated in lysates from cells expressing either
GST-mBub1 (Fig. 9, lane 5) and GST-hBubR1 (Fig. 9,
lane 6). These phosphorylated proteins were not detected
when either equivalent amounts of GST alone (Fig. 9, lane
7) or equivalent amounts of glutathione beads incubated
with lysates from mock transfected cells (Fig. 9, lane 8)
were compared. The major phosphorylated proteins detected in Fig. 9, lanes 5 and 6 are of the molecular weights
expected of GST-mBub1 and GST-hBubR1 respectively,
(as judged by Western blotting, see Fig. 9, lanes 1 and 2).
This indicates that the phosphorylated bands are GST-
mBub1 and GST-hBubR1, suggesting that the observed
kinase activity is probably autophosphorylation. Although
we cannot rule out the possibility that the observed activities are due to another copurifying protein kinase, these data are consistent with the notion that, like ScBub1 (Roberts et al., 1994
), mBub1 and hBubR1 exhibit autophosphorylation activity in vitro.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We describe the cloning of a human homologue of Bub3,
which, like murine Bub1, localizes to kinetochores during
prometaphase (Taylor and McKeon, 1997). In addition,
we show that mBub1 and hBub3 can interact in mammalian cells. We have also identified the Bub3-binding site in
Bub1. This same domain is required for kinetochore localization of Bub1, which we have previously shown is required for checkpoint function (Taylor and McKeon,
1997
). Therefore, these observations suggest that the role
of Bub3 is to facilitate kinetochore localization of Bub1,
thereby activating the checkpoint in response to unattached kinetochores. ScBub3 was identified as a high copy
suppressor of the bub1-1 allele, suggesting that ScBub1
and ScBub3 interact in yeast (Hoyt et al., 1991
). Further
support for this interaction came from genetic experiments, which showed that bub3
strains have a similar
phenotype to bub1
strains (Roberts et al., 1994
). In addition, bub1
/bub3
double mutants are phenotypically
similar to strains with deletions of either gene, and Bub1p
and Bub3p have been shown to coimmunoprecipitate when overexpressed in S. cerevisiae (Roberts et al., 1994
).
Our observations with Bub1 and Bub3 in mammalian cells
are consistent with those in S. cerevisiae and suggest the
following model: in the absence of Bub3, Bub1 cannot localize to the kinetochore and hence the checkpoint is not
activated in response to unattached kinetochores.
hBub3 also appears to be required for kinetochore localization of hBubR1. Whether Bub3 plays any roles in addition to kinetochore localization of Bub1 and BubR1 remains to be seen. Interestingly, hBub3 contains four WD
repeats, a 40-amino acid motif found in many proteins involved in a diverse array of cellular processes, including G
protein-linked receptor signaling, RNA processing and
export, and cell cycle control (Neer et al., 1994). The exact function of WD repeats is not clear, but it seems likely that they play a role in mediating protein-protein interactions.
Indeed, WD repeat proteins are often part of multiprotein
complexes (Neer et al., 1994
). Whether Bub3 is part of a
large multiprotein complex remains to be seen. Thus far,
Bub3 has been shown to interact with Bub1 and the human Mad3/Bub1-related protein, hBubR1 (Roberts et al.,
1994
; this work). In addition, Bub3 and Mad3 have been shown to interact in S. cerevisiae (Hardwick, K.G., and
A.W. Murray, personal communication). Recently, Mad1,
Mad2, and Mad3 have been shown to interact with cdc20
(Hwang et al., 1998
; Kim et al., 1998
), which in turn has
been shown to interact with the APC (Visintin et al.,
1997
). Significantly, the vertebrate homologues of Mad2, Bub1, Bub3 and the Mad3-related kinase, BubR1, have
been shown to localize to kinetochores before chromosome alignment (Chen et al., 1996
; Li and Benezra, 1996
;
Taylor and McKeon, 1997
; this work). It is therefore
tempting to speculate that the checkpoint components, including Bub1, BubR1, Bub3, Mad1, Mad2, and Mad3, may
be part of a large protein complex that is recruited to unattached kinetochores. This kinetochore-bound form of the
checkpoint complex may bind and inhibit cdc20, thereby
preventing activation of APC, and hence delaying the onset of anaphase. Based on the observations that Mad2,
Bub1, Bub3, and BubR1 are not present at the kinetochores of metaphase chromosomes (Chen et al., 1996
; Li
and Benezra, 1996
; Taylor and McKeon, 1997
; this work),
it appears likely that the checkpoint complex dissociates
from kinetochores upon achieving correct bipolar attachments. Upon dissociation, perhaps the composition or activity of the checkpoint complex is altered, rendering
cdc20 active and hence allowing the onset of anaphase.
However, although there is evidence that many of these
checkpoint components can interact with each other (see
above), the existence of such a complex has not yet been
demonstrated to exist in vivo. It is therefore possible that
some of these proteins interact only transiently as cells
progress through mitosis.
hBub3 shares significant homology with the Rae1 family
of proteins, both within the WD repeats and in the central,
non-WD repeat region (refer to Fig. 1). The S. pombe rae1
gene was identified as a poly(A)+ RNA export mutant
(Brown et al., 1995). SpRae1 has recently been shown to
interact with the S. pombe homologue of the Nic96 nucleoporin (Yoon et al., 1997
). In addition, the S. cerevisiae homologue of Rae1, gle2p, interacts with the Nup100p nucleoporin and other proteins involved in nucleocytoplasmic
transport (Murphy et al., 1996
). Furthermore, gle2 strains
also show defects in poly(A)+ RNA export and have
grossly perturbed nuclear pores. These observations suggest that Rae1 is required for nucleocytoplasmic transport and probably does not play a direct role in cell cycle control.
Despite the significant similarity between the Rae1 proteins and the human Bub3 homologue described here
(39% identity), several lines of evidence suggest that
hBub3 is not a member of the Rae1 family. First, a human
cDNA encoding a protein with 49% identity to SpRae1
has recently been identified (Bharathi et al., 1997). This
cDNA complements the temperature sensitivity of the
rae1-1 allele and is therefore likely to be the human Rae1
homologue. Second, an alignment of the Rae1 and Bub3
proteins identifies several amino acid sequences in the
central domain, including the VATAER sequence (amino
acids 174-179 in SpRae1), which are conserved in all the
Rae1 proteins, but not in the Bub3 homologues. Conversely, there are several sequences, including the SSI(E/ D)GRVAVE sequence (amino acids 211-220 in hBub3),
which are conserved in the Bub3 proteins, but are not conserved in the Rae1 homologues. Significantly, deletion of
the VAVE sequence abolishes the ability of hBub3 to interact with mBub1 and hBubR1. Note that the S. pombe rae1-1 loss of function allele results in a substitution of the glycine at position 219 with a glutamic acid (Brown et al.,
1995
). Significantly, this glycine is conserved in the Rae1
homologues, but is replaced by a serine in the Bub3 homologues.
In addition to the sequence analysis, two observations
indicate that hBub3 is indeed the homologue of ScBub3.
First, hBub3 interacts with mBub1, as do Bub3 and Bub1
in S. cerevisiae (Roberts et al., 1994). Second, hBub3 localizes to kinetochores during prometaphase, a property that
one might predict based on the localizations of mBub1
(Taylor and McKeon, 1997
) and the vertebrate homologues of Mad2 (Chen et al., 1996
; Li and Benezra, 1996
).
The significance, if any, of the similarity between the Bub3
and Rae1 proteins remains to be determined.
This work also describes the identification of a novel human Mad3/Bub1-related protein, hBubR1. hBubR1 shares homology with Mad3 from S. cerevisiae and yet it is significantly larger (1,050 amino acids) than ScMad3 (515 amino acids), due to a COOH-terminal extension which contains a kinase domain. This suggests that perhaps the human Mad3/Bub1-related kinase is a second Bub1 homologue. Indeed, within the NH2-terminal domains, hBubR1 is more similar to ScBub1 (26% identity) than mBub1 is to ScBub1 (23% identity). In addition, a BLAST search of the yeast genome shows that the kinase most closely related to hBubR1 is ScBub1. However, an alignment of the COOH-terminal kinase domains shows that hBubR1 is clearly distinct from the Bub1 family (refer to Fig. 5 B). Within the kinase domains, there are 85 amino acids conserved among the Bub1 homologues from S. cerevisiae, mouse and human. However, 54 of these are not conserved in hBubR1. Indeed, within the kinase domain, mBub1 is more closely related to ScBub1 (33% identity) than it is to hBubR1 (26% identity). Within the NH2-terminal domain, hBubR1 is significantly more similar to ScMad3 (35% identity) than it is to ScBub1 (26% identity). These observations suggest that perhaps hBubR1 is a Mad3-related protein kinase. Whether hBubR1 and ScMad3 have indeed evolved from a common ancestor will remain uncertain until Mad3-related proteins from other organisms have been identified, or until we have a better understanding of the functions of these two proteins.
The functional analysis presented here illustrates similarities between mBub1 and hBubR1, as well as a significant difference. Like mBub1, hBubR1 can bind hBub3 in
mammalian cells, and this binding requires a domain that
is conserved between the Bub1 and Mad3-related proteins. In addition, hBubR1 can localize to kinetochores during prometaphase and the ability to bind Bub3 is required for this localization. However, unlike mBub1, ectopically expressed hBubR1 only localizes to kinetochores
when hBub3 is overexpressed. In contrast, ectopically expressed mBub1 localizes to the kinetochore without coexpression of hBub3 (Taylor and McKeon, 1997). One possible explanation for this observation is that hBubR1 cannot
bind hamster Bub3, and hence kinetochore localization is
not observed in transfected BHK cells unless exogenous
human Bub3 is present. However, significant kinetochore
staining was also not observed when hBubR1 was transfected into human cells (data not shown). Until the localization of endogenous hBubR1 has been determined,
these observations have to be treated with caution. However, it does suggest that the amount of endogenous Bub3
is limiting with respect to ectopically expressed hBubR1. One possibility is that the endogenous Bub3 is complexed
with Bub1 and hence there is no Bub3 available for binding to, and hence kinetochore localization of, transfected
hBubR1. This suggests that perhaps the majority of
BubR1 may not play a role at the kinetochore. Alternatively, perhaps hBubR1 does play a role at the kinetochore, but that overexpression of hBubR1 somehow prevents the formation of complexes capable of kinetochore
localization. The generation of anti-hBubR1 antibodies
will hopefully resolve this issue.
The role of hBubR1 remains to be determined. It is possible that Bub1 and BubR1 have similar or partially overlapping roles. Although there is only a single Bub1 kinase
encoded in the S. cerevisiae genome, functional redundancy may be beneficial in mammalian cells. Recently,
mutant BUB1 alleles have been identified in colorectal tumors displaying a chromosome instability phenotype (Cahill et al., 1998), suggesting that mitotic checkpoint defects may contribute to tumorigenesis. Therefore, overlapping
or partially redundant roles for Bub1 and BubR1 may provide a selective advantage to multicellular organisms: increasing the fidelity of chromosome segregation may reduce the possibility of generating potentially tumorigenic
aneuploid cells.
Redundancy may allow multiple spindle events to be
monitored by the mitotic checkpoint. At present, there is
evidence implicating both tension and microtubule attachment as the events which regulate anaphase onset (Li and
Nicklas, 1995; Rieder et al., 1995
). Perhaps in the quest for
enhanced genome stability, both tension and attachment are monitored by the checkpoint. Perhaps, therefore,
Bub1 and BubR1 respond to different types of spindle
events. Tension and microtubule attachment may also be
differentially monitored in mitosis relative to meiosis
(Nicklas, 1997
). If Bub1 and BubR1 respond differentially
to tension and microtubule attachment, perhaps they play
differential roles in mitosis and meiosis.
The EMBL/GenBank/DDBJ accession numbers for the cDNA sequences reported here are AF053304 (hBub3); AF053305 (hBub1); and AF053306 (hBubR1).
![]() |
Footnotes |
---|
Received for publication 12 March 1998 and in revised form 1 June 1998.
Address all correspondence to Frank McKeon, Department of Cell Biology, Harvard University Medical School, 240 Longwood Avenue, Boston, MA 02115. Tel.: (617) 432-0327. Fax: (617) 432-6655. E-mail: mckeon{at}warren.med.harvard.eduWe would like to thank K. Hardwick (University of Edinburgh, Edinburgh, Scotland) and A. Murray (University of California, San Francisco, CA) for helpful discussion. We are grateful to J. Zhu for technical advice and reading the manuscript. We also thank P. Stein and M. Rolls (all three from Harvard Medical School, Boston, MA) for comments on the manuscript.
This work was supported by a National Institutes of Health grant (GM52027) to F. McKeon and a Traveling Research Fellowship from the Wellcome Trust to S.S. Taylor.
![]() |
Abbreviations used in this paper |
---|
APC, anaphase-promoting complex; EST, expressed sequence tag; NFDM, nonfat dry milk.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Adams, M.D., A.R. Kerlavage, R.D. Fleischmann, R.A. Fuldner, C.J. Bult, N.H. Lee, E.F. Kirkness, K.G. Weinstock, J.D. Gocayne, O. White, et al . 1995. Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence. Nature. 377(Suppl.): 3-174 |
2. | Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol 215: 403-410 |
3. | Bharathi, A., A. Ghosh, W.A. Whalen, J.H. Yoon, R. Pu, M. Dasso, and R. Dhar. 1997. The human RAE1 gene is a functional homologue of Schizosaccharomyces pombe rae1 gene involved in nuclear export of Poly(A)+ RNA. Gene 198: 251-258 |
4. |
Brown, J.A.,
A. Bharathi,
A. Ghosh,
W. Whalen,
E. Fitzgerald, and
R. Dhar.
1995.
A mutation in the Schizosaccharomyces pombe rae1 gene causes defects in poly(A)+ RNA export and in the cytoskeleton.
J. Biol. Chem
270:
7411-7419
|
5. | Cahill, D.P., C. Lengauer, J. Yu, G.J. Riggins, J.K. Willson, S.D. Markowitz, K.W. Kinzler, and B. Vogelstein. 1998. Mutations of mitotic checkpoint genes in human cancers. Nature. 392: 300-303 |
6. | Callan, H.G., and P.A. Jacobs. 1957. The meiotic process in Mantis Religiosa L. males. J. Genet. 55: 200-217 . |
7. | Campbell, M.S., and G.J. Gorbsky. 1995. Microinjection of mitotic cells with the 3F3/2 anti-phosphoepitope antibody delays the onset of anaphase. J. Cell Biol. 129: 1195-1204 [Abstract]. |
8. |
Chen, R.-H.,
J.C. Waters,
E.D. Salmon, and
A.W. Murray.
1996.
Association of
spindle assembly checkpoint component XMAD2 with unattached kinetochores.
Science
274:
242-246
|
9. | Cohen-Fix, O., J.M. Peters, M.W. Kirschner, and D. Koshland. 1996. Anaphase initiation in Saccharomyces cerevisiae is controlled by the APC-dependent degradation of the anaphase inhibitor Pds1p. Genes Dev 10: 3081-3093 [Abstract]. |
10. | Dalrymple, M.A., S. Petersen-Bjorn, J.D. Friesen, and J.D. Beggs. 1989. The product of the PRP4 gene of S. cerevisiae shows homology to beta subunits of G proteins. Cell 58: 811-812 |
11. |
Farr, K.A., and
M.A. Hoyt.
1998.
Bub1p kinase activates the Saccharomyces
cerevisiae spindle assembly checkpoint.
Mol. Cell. Biol
18:
2738-2747
|
12. | Funabiki, H., H. Yamano, K. Kumada, K. Nagao, T. Hunt, and M. Yanagida. 1996. Cut2 proteolysis required for sister-chromatid separation in fission yeast. Nature 381: 438-441 |
13. | Gorbsky, G.J., and W.A. Ricketts. 1993. Differential expression of a phosphoepitope at the kinetochores of moving chromosomes. J. Cell Biol 122: 1311-1321 [Abstract]. |
14. |
Hanks, S.K., and
T. Hunter.
1995.
The eukaryotic protein kinase superfamily:
kinase (catalytic) domain structure and classification.
FASEB (Fed. Am.
Soc. Exp. Biol.) J
9:
576-596
|
15. | Hardwick, K.G., and A.W. Murray. 1995. Mad1p, a phosphoprotein component of the spindle assembly checkpoint in budding yeast. J. Cell Biol 131: 709-720 [Abstract]. |
16. | Hardwick, K.G., E. Weiss, F.C. Luca, M. Winey, and A.W. Murray. 1996. Activation of the budding yeast spindle assembly checkpoint without mitotic spindle disruption. Science 273: 953-956 [Abstract]. |
17. | Hartwell, L.H., and T.A. Weinert. 1989. Checkpoints: controls that ensure the order of cell cycle events. Science 246: 629-634 |
18. |
He, X.,
T.E. Patterson, and
S. Sazer.
1997.
The Schizosaccharomyces pombe
spindle checkpoint protein mad2p blocks anaphase and genetically interacts
with the anaphase-promoting complex.
Proc. Natl. Acad. Sci. USA
94:
7965-7970
|
19. | Heald, R., M. McLoughlin, and F. McKeon. 1993. Human wee1 maintains mitotic timing by protecting the nucleus from cytoplasmically activated Cdc2 kinase. Cell 74: 463-474 |
20. | Hoyt, M.A., L. Totis, and B.T. Roberts. 1991. S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function. Cell 66: 507-517 |
21. |
Hwang, L.H.,
L.F. Lau,
D.L. Smith,
C.A. Mistrot,
K.G. Hardwick,
E.S. Hwang,
A. Amon, and
A.W. Murray.
1998.
Budding yeast cdc20: a target of the spindle checkpoint.
Science
279:
1041-1044
|
22. | Irniger, S., S. Piatti, C. Michaelis, and K. Nasmyth. 1995. Genes involved in sister chromatid separation are needed for B-type cyclin proteolysis in budding yeast. Cell 81: 269-278 |
23. |
Juang, Y.L.,
J. Huang,
J.M. Peters,
M.E. McLaughlin,
C.Y. Tai, and
D. Pellman.
1997.
APC-mediated proteolysis of Ase1 and the morphogenesis of the
mitotic spindle.
Science
275:
1311-1314
|
24. |
Kim, S.H.,
D.P. Lin,
S. Matsumoto,
A. Kitazono, and
T. Matsumoto.
1998.
Fission yeast slp1: an effector of the Mad2-dependent spindle checkpoint.
Science
279:
1045-1047
|
25. | King, R.W., J.M. Peters, S. Tugendreich, M. Rolfe, P. Hieter, and M.W. Kirschner. 1995. A 20S complex containing CDC27 and CDC26 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B. Cell 81: 279-288 |
26. | Li, R., and A.W. Murray. 1991. Feedback control of mitosis in budding yeast. Cell 66: 519-531 |
27. | Li, X., and R.B. Nicklas. 1995. Mitotic forces control a cell-cycle checkpoint. Nature 373: 630-632 |
28. |
Li, X., and
R.B. Nicklas.
1997.
Tension-sensitive kinetochore phosphorylation
and the chromosome distribution checkpoint in praying mantid spermatocytes.
J. Cell Sci
110:
537-545
|
29. |
Li, Y., and
R. Benezra.
1996.
Identification of a human mitotic checkpoint
gene: hsMAD2.
Science
274:
246-248
|
30. |
Li, Y.,
C. Gorbea,
D. Mahaffey,
M. Rechsteiner, and
R. Benezra.
1997.
MAD2
associates with the cyclosome/anaphase-promoting complex and inhibits its
activity.
Proc. Natl. Acad. Sci. USA
94:
12431-12436
|
31. | Murphy, R., J.L. Watkins, and S.R. Wente. 1996. GLE2, a Saccharomyces cerevisiae homologue of the Schizosaccharomyces pombe export factor RAE1, is required for nuclear pore complex structure and function. Mol. Biol. Cell 7: 1921-1937 [Abstract]. |
32. | Neer, E.J., C.J. Schmidt, R. Nambudripad, and T.F. Smith. 1994. The ancient regulatory-protein family of WD-repeat proteins. Nature 371: 297-300 |
33. |
Nicklas, R.B..
1997.
How cells get the right chromosomes.
Science
275:
632-637
|
34. |
Nicklas, R.B., and
C.A. Koch.
1969.
Chromosome manipulation III: induced reorientation and the experimental control of segregation in meiosis.
J. Cell
Biol
43:
40-50
|
35. | Nicklas, R.B., S.C. Ward, and G.J. Gorbsky. 1995. Kinetochore chemistry is sensitive to tension and may link mitotic forces to a cell cycle checkpoint. J. Cell Biol 130: 929-939 [Abstract]. |
36. | Pangilinan, F., and F. Spencer. 1996. Abnormal kinetochore structure activates the spindle assembly checkpoint in budding yeast. Mol. Cell. Biol 7: 1195-1208 . |
37. | Rieder, C.L., A. Schultz, R. Cole, and G. Sluder. 1994. Anaphase onset in vertebrate somatic cells is controlled by a checkpoint that monitors sister kinetochore attachment to the spindle. J. Cell Biol. 127: 1301-1310 [Abstract]. |
38. | Rieder, C.L., R.W. Cole, A. Khodjakov, and G. Sluder. 1995. The checkpoint delaying anaphase in response to chromosome monoorientation is mediated by an inhibitory signal produced by unattached kinetochores. J. Cell Biol 130: 941-948 [Abstract]. |
39. | Roberts, B.T., K.A. Farr, and M.A. Hoyt. 1994. The Saccharomyces cerevisiae checkpoint gene BUB1 encodes a novel protein kinase. Mol. Cell. Biol 14: 8282-8291 [Abstract]. |
40. | Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 545 pp. |
41. | Sudakin, V., D. Ganoth, A. Dahan, H. Heller, J. Hersko, F. Luca, J.V. Ruderman, and A. Hershko. 1995. The cyclosome, a large complex containing cyclin-selective ubiquitination ligase activity, targets cyclins for destruction at the end of mitosis. Mol. Biol. Cell 6: 185-198 [Abstract]. |
42. | Taylor, S.S., and F. McKeon. 1997. Kinetochore localization of murine Bub1 is required for normal mitotic timing and checkpoint response to spindle damage. Cell 89: 727-735 |
43. | Tugendreich, S., J. Tomkiel, W. Earnshaw, and P. Hieter. 1995. CDC27Hs colocalizes with CDC16Hs to the centrosome and mitotic spindle and is essential for the metaphase to anaphase transition. Cell 81: 261-268 |
44. |
Visintin, R.,
S. Prinz, and
A. Amon.
1997.
CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis.
Science
278:
460-463
|
45. | Wang, Y., and D.J. Burke. 1995. Checkpoint genes required to delay cell division in response to nocodazole respond to impaired kinetochore function in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol 15: 6838-6844 [Abstract]. |
46. | Weiss, E., and M. Winey. 1996. The Saccharomyces cerevisiae spindle pole body duplication gene MPS1 is part of a mitotic checkpoint. J. Cell Biol. 132: 111-123 [Abstract]. |
47. | Wells, W.A.E., and A.W. Murray. 1996. Aberrantly segregating centromeres activate the spindle assembly checkpoint in budding yeast. J. Cell Biol 133: 75-84 [Abstract]. |
48. | Yoon, J.H., W.A. Whalen, A. Bharathi, R. Shen, and R. Dhar. 1997. Npp106p, a Schizosaccharomyces pombe nucleoporin similar to Saccharomyces cerevisiae Nic96p, functionally interacts with Rae1p in mRNA export. Mol. Cell. Biol 17: 7047-7060 [Abstract]. |
49. | Zirkle, R.E.. 1970a. Ultraviolet-microbeam irradiation of newt-cell cytoplasm: spindle destruction, false anaphase and delay of true anaphase. Radiat. Res. 41: 516-537 |
50. | Zirkle, R.E.. 1970b. Involvement of the prometaphase kinetochore in prevention of precocious anaphase. J. Cell Biol 47: 235a . |