Department of Neurobiology, University of Heidelberg, 69120 Heidelberg, Germany
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Sorting of regulated secretory proteins in the
TGN to immature secretory granules (ISG) is thought
to involve at least two steps: their selective aggregation
and their interaction with membrane components destined to ISG. Here, we have investigated the sorting of
chromogranin B (CgB), a member of the granin family present in the secretory granules of many endocrine
cells and neurons. Specifically, we have studied the role
of a candidate structural motif implicated in the sorting
of CgB, the highly conserved NH2-terminal disulfide-
bonded loop. Sorting to ISG of full-length human CgB
and a deletion mutant of human CgB (cys-hCgB) lacking the 22-amino acid residues comprising the disulfide-bonded loop was compared in the rat neuroendocrine cell line PC12. Upon transfection, i.e., with ongoing synthesis of endogenous granins, the sorting of
the deletion mutant was only slightly impaired compared to full-length CgB. To investigate whether this
sorting was due to coaggregation of the deletion mutant
with endogenous granins, we expressed human CgB using recombinant vaccinia viruses, under conditions in
which the synthesis of endogenous granins in the infected PC12 cells was shut off. In these conditions,
cys-hCgB, in contrast to full-length hCgB, was no
longer sorted to ISG, but exited from the TGN in constitutive secretory vesicles. Coexpression of full-length
hCgB together with
cys-hCgB by double infection, using the respective recombinant vaccinia viruses, rescued the sorting of the deletion mutant to ISG. In conclusion, our data show that (a) the disulfide-bonded
loop is essential for sorting of CgB to ISG and (b) the
lack of this structural motif can be compensated by coexpression of loop-bearing CgB. Furthermore, comparison of the two expression systems, transfection and
vaccinia virus-mediated expression, reveals that analyses under conditions in which host cell secretory protein synthesis is blocked greatly facilitate the identification of sequence motifs required for sorting of
regulated secretory proteins to secretory granules.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
SPECIALIZED eukaryotic cells, such as endocrine cells
and peptidergic neurons, contain a regulated secretory pathway in addition to the constitutive pathway
present in all cells (Burgess and Kelly, 1987). Proteins specific for either of the two pathways are segregated from
each other at the level of the TGN. Morphological and
biochemical data indicate that a key feature in this sorting is the formation of aggregates of regulated secretory proteins in the TGN from which constitutively secreted proteins are excluded (Tooze et al., 1993
). A paradigm for the
aggregation-mediated sorting are chromogranin A (CgA),1
chromogranin B (CgB, secretogranin I), and secretogranin
II (SgII), the three classical members of the granin family
with widespread occurrence in secretory granules of neuroendocrine cells (Huttner et al., 1991
; Rosa and Gerdes,
1994
). It was shown that their selective aggregation is triggered by an acidic pH and millimolar concentration of calcium in vitro (Gerdes et al., 1989
; Gorr et al., 1989
; Yoo
and Albanesi, 1990
) and in the TGN (Chanat and Huttner,
1991
). This low pH/calcium-induced aggregation is thought to be mediated by structural features common to all
granins, in particular, an abundance of acidic residues distributed along the polypeptide chain (Gerdes et al., 1989
).
Aggregates of regulated secretory proteins exit the TGN
in immature secretory granules (ISG), a short lived intermediate in the biogenesis of mature secretory granules
(Tooze and Huttner, 1990
; Tooze et al., 1991
). During
maturation of ISG, which includes further condensation of
the soluble content and removal of excess membrane, budding of ISG-derived vesicles has been proposed (Tooze et
al., 1991
). Such vesicles are thought to mediate the constitutive-like secretion of proteinaceous material that remained soluble in the ISG (Arvan and Castle, 1992
; Kuliawat and Arvan, 1992
).
During exit from the TGN into ISG, regulated secretory
proteins are thought to interact with specific components
in the membrane of the TGN. Recently it has been proposed that carboxypeptidase E is a membrane-associated
binding site, recognizing regulated secretory proteins in
the TGN (Cool et al., 1997). The structural features of regulated secretory proteins involved in membrane recognition,
often referred to as sorting signals, are poorly understood.
To date, no such sorting signals have been unequivocally identified. One dilemma could lie in the fact that it is not
single molecules, but rather aggregates, which are sorted
to ISG. Therefore, mutated regulated secretory proteins
lacking the sorting signal when analyzed by transfection
might not be missorted if the mutant protein can coaggregate with endogenous regulated secretory proteins carrying a sorting signal. Coaggregative sorting could explain why mutated regulated secretory proteins were not seen to
be affected in their sorting to secretory granules (Burgess
et al., 1987
; Powell et al., 1988
; Chu et al., 1990
; Roy et al.,
1991
; Castle et al., 1992
; Chevrier et al., 1993
). In the few
cases in which effects of mutations have been detected, the
analysis was not performed at the level of the TGN, but
rather at the level of mature secretory granules (Sevarino
et al., 1989
; Stoller and Shields, 1989
; Cool and Peng Loh,
1994; Cool et al., 1995
), and thus it remained open whether
sorting to, or storage in, secretory granules was effected.
To overcome these two limitations of previous studies we
pursued the following strategy. First, we surmised that the
identification of sorting signals by a mutagenesis approach would necessitate expression of the mutants under conditions in which there is no synthesis of endogenous regulated secretory proteins, thus precluding coaggregative
sorting. Second, to analyze sorting at the level of the TGN,
we monitored the exit of proteins from the TGN into ISG
by pulse-chase labeling in combination with subcellular
fractionation.
Here we study the sorting of human CgB (hCgB), which
contains near the NH2 terminus a stretch of 22-amino acid
residues that is highly conserved between CgA and CgB in
many species. These amino acids form a loop stabilized by
a disulfide bond, and are encoded in both proteins by a
separate exon, exon 3 (Benedum et al., 1987; Pohl et al.,
1990
; Iacangelo et al., 1991
; Wu et al., 1991
; Mouland et al.,
1994
). It has been shown previously that reductive cleavage of the disulfide bond with DTT in vivo, results in the
constitutive secretion of CgB (Chanat et al., 1993
), without affecting its aggregative properties (Chanat et al., 1994
),
suggesting a role of the disulfide bond in the sorting of
CgB to the regulated pathway of secretion. Although
DTT-induced missorting was specific for CgB and not observed for SgII, which lacks cysteins, it cannot be entirely
excluded that the effect of DTT was not due to its reduction of the disulfide bond of CgB, but reflected an effect on a component necessary for the sorting of CgB and not
for SgII. In this report, we analyze the sorting of hCgB and
of a deletion mutant of hCgB lacking the highly conserved
disulfide-bonded loop at the level of the TGN as well as at
the level of the mature secretory granule. Recombinant
proteins were expressed in the neuroendocrine cell line
PC12, either by transfection, i.e., in the presence of endogenous granin synthesis, or by recombinant vaccinia viruses, i.e., in the absence of endogenous granin synthesis.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Materials
Hydroxyurea was purchased from Boehringer Ingelheim Bioproducts (Heidelberg, Germany), sodium butyrate from Merck (Darmstadt, Germany), radiochemicals from Amersham Intl. (Buckinghamshire, UK), and cell culture reagents from GIBCO BRL (Gaithersburg, MD).
Cells and Viruses
RK13 (rabbit kidney cells ATCC CCL 37) and Hu143 Tk (ATCC CRL
8303) were cultured in Eagle's minimal essential medium supplemented with 10% fetal calf serum at 37°C in 5% CO2. PC12 cells (rat pheochromocytoma cells, clone 251; Heumann et al., 1983
) were grown in DME
supplemented with 10% horse serum and 5% fetal calf serum as previously described (Tooze and Huttner, 1990
). Vaccinia virus, wild type
(strain vv-WR), and a temperature-sensitive mutant, Ts7 (strain Copenhagen), were kindly provided by H. Stunnenberg (University of
Nijmegen, The Netherlands).
Antibodies
The hybridoma supernatant monoclonal antibody 67-C7-2 was used for
hCgB detection (Rosa et al., 1992). A polyclonal antibody was used for
detection of rat CgB (rCgB; Rosa et al., 1992
). For rat SgII (rSgII) detection, a rabbit antiserum against the NH2-terminal peptide (-QRNQLLQKEPDL RLENV-) of rSgII was raised. Anti-myc ascites was a gift
from E. Karsenti (European Molecular Biology Laboratory [EMBL],
Heidelberg, Germany). A polyclonal anti-human
1-antitrypsin antibody
was kindly provided by J.L. Brown (Denver, CO) and bought as IgG fraction from Sigma Chemical Co. (St. Louis, MO).
Expression Vector Cloning
wt-hCgB.
The cDNA of hCgB was released from vector pDS6/SgI (Benedum et al., 1987) by EcoRI/BamHI digestion, blunt-ended, and subcloned into the SmaI site of pGEM4 (Promega, Heidelberg, Germany). hCgB was subcloned into p160/10 (gift from U. Ruether, Medizinische Hochschule, Hannover, Germany) using HindIII and EcoRI as restriction sites.
It was exized from p160/10 with HindIII and NotI and subcloned into
pCDM8 (Invitrogen, Carlsbad, CA).
cys-hCgB.
The deletion mutant of hCgB was constructed using a oligonucleotide-directed mutagenesis system (Amersham Intl., version 2.1). In short, the hCgB cDNA was subcloned from pGEM4 into M13mp19 using HindIII and EcoRI restriction sites. The single-stranded antisense
clone was used as a template for mutagenesis. The mutagenic primer,
TTCAGGACTTGGCGGCGAGTCACCATTC, was used to obtain the
desired deletion. After mutagenesis, double-stranded phage DNA was
isolated and screened by digestion with HaeI. Three out of five analyzed phage plaque DNAs showed the expected restriction fragment pattern. The DNA sequence of the deletion mutation from one phage plaque was
confirmed by sequencing. DNA from this phage was digested with SalI
and XhoI and the restriction fragment containing the deleted region was
used to replace the corresponding wild-type restriction fragment in
pCDM8/wt-hCgB.
AT.
By HindIII/XbaI digestion of pECE/A1PiTS (Leitinger et al.,
1994) the
1-antitrypsin cDNA containing the tyrosine sulfation site (AT) of
rat cholecystokinin precursor was released and subcloned into pRC/CMV.
Preparation of Recombinant Viruses
vv:wt-hCgB.
A plasmid transfer vector with a 7.5K vaccinia promoter
flanked by viral thymidine kinase sequences (Chocran et al., 1985), modified by Bujard and co-workers (von Brunn et al., 1988
) was linearized with
BamHI and ClaI and blunt-ended. The cDNA of hCgB (2.5 kb) was released from vector pDS6/SgI (Benedum et al., 1987
) by EcoRI/BamHI digestion, blunt-ended, and subcloned into the plasmid transfer vector under control of the 7.5-K promoter.
vv:cys-hCgB, vv:AT, vv:wt-hCgB-EGFP.
A dominant selection system
for recombinant viruses based on the xanthine-guanine phosphoribosyltransferase (gpt) gene of Escherichia coli was used (Falkner and Moss,
1988
). Therefore, a gpt gene was introduced into the PstI site of the plasmid transfer vector (constructed by von Brunn et al., 1988
). The transfer
vector was linearized with PstI and blunt-ended. A DNA fragment encoding the gpt gene was obtained from the pEMBL-I3-gpt plasmid (kindly provided by H. Stunnenberg) after ClaI/EcoRI digestion. The fragment was blunt-ended and ligated into the prepared transfer vector, such that
the 7.5-K promoter and the gpt promoter were oriented in opposite directions. In addition, a SalI site in the NH2-terminal region of the gpt gene
was removed by partial digestion, treatment of the recessive ends by Klenow-polymerase, and religation. The resulting plasmid transfer vector,
termed pAB, was used to generate three recombinant viruses. The vector
was linearized with XhoI and SalI and blunt-ended.
cys-hCgB was released from pCDM8/
cys-hCgB by SalI/EcoRI digestion,
1-antitrypsin
containing the tyrosine sulfation site of rat cholecystokinin precursor was
released from pECE/A1PiTS (Leitinger et al., 1994
) by HindIII/XbaI digestion and hCgB-EGFP (Kaether et al., 1997
) was released from pSP73
by restriction with HindIII/EcoRI. Each fragment was blunt-ended and
subcloned into pAB. Generation of recombinant virus and gpt+ selection
was carried out as described (Falkner and Moss, 1988
) except that recombinant viruses were generated in HuTK
cells and gpt+ selection was carried out with RK13 cells.
Viral Amplifications and Titrations
Vaccinia virus-infected RK13 cells were scraped into the medium 2.5 d
post infection (PI), pelleted for 1 h at 31,000 g, resuspended in 10 mM
Tris, pH 9.0, and lysed by Dounce homogenization. After low-speed centrifugation to remove nuclei, the virus was sedimented through a 36% sucrose cushion (10 mM Tris, pH 9.0) in an SW28 rotor (Beckman Instruments, Inc., Fullerton, CA) at 15,000 rpm for 1 h. The virus pellet was
resuspended in PBS, briefly sonicated, and stored in aliquots at 20°C. Titer estimations of viral stocks were performed on RK13 cells by infecting
confluent dishes with dilution series in complete culture medium.
Infections
PC12 cells were plated onto laminin-coated dishes (for metabolic labeling) or on poly(L)lysine-coated coverslips (for immunofluorescence) 5 d
before infection. Single infections were done at 100 plaque-forming units
per cell (pfu/cell) in complete growth medium containing 5 mM hydroxyurea. For double infections, vv:hCgB-EGFP was used at 400 pfu/cell to
adjust the expression level to that of cys-hCgB, which was used at 100 pfu/cell. Hydroxyurea was present in the inoculum and in all subsequent
culture media. After 1 h at 37°C and 10% CO2 with intermittent agitation,
the inoculum was aspirated, the cells were washed with growth medium,
and then propagated in complete growth medium. Standard infection
times before analysis were 3 h. Deviations from these standard conditions
are indicated in the figure legends.
Transfections
Standard protocol: PC12 cells were trypsinized, washed with PBS, and resuspended in PBS at a density of 1.5-2.5 × 107 cells/ml. Electroporation was done with 50 µg DNA in a total volume of 0.8 ml cell suspension using a BioRad Gene Pulser at 960 µF and 250 V (Hercules, CA). Transfected cells were diluted in 15 ml growth medium and plated onto cell culture dishes. Growth medium was changed the next day and, except for the stimulated release experiments, replaced by growth medium containing 10 mM sodium butyrate 17.5 h before pulse labeling.
Metabolic Labeling
To label PC12 cells (3.5-cm dishes) with [35S]methionine, cells were depleted of endogenous methionine by incubation for 30 min at 37°C in methionine-free medium (DME lacking methionine) with 1% dialyzed horse
serum and 0.5% dialyzed fetal calf serum, and, thereafter, pulse labeled
for 5 min with [35S]methionine. At the end of the pulse, dishes were transferred to 4°C, the medium was aspirated, and the cells were washed twice with 1 ml ice-cold PBS supplemented with 5 mM methionine and 5 mM
cysteine. Thereafter, cells were scraped off in 0.5 ml of isotonic buffer (20 mM Tris/HCl, pH 7.4 , 0.3 M sucrose, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 0.25 mM PMSF), and divided into two aliquots. One aliquot was analyzed directly on SDS-PAGE (referred to as total homogenate) to estimate the amount of isolated cells by scanning Coomassie-stained cellular
protein bands. From the other aliquot, a heat stable fraction highly enriched for the granins was prepared, as described previously, (Benedum et
al., 1987) followed by quantitation of labeled rSgII from the fluorogram.
To label the granins present in the TGN, PC12 cells were preincubated
for 30 min with sulfate-free DME, supplemented with 10% of the normal
concentration of methionine and cysteine. Thereafter, they were pulse labeled for 5 min with sulfate-free DME containing 3-4 mCi/ml carrier-free
[35S]sulfate. To chase the sulfate label, the normal growth medium was
supplemented with twice the normal concentration of sulfate. The total
amount of [35S]sulfate-labeled proteins always increased slightly over time due to a lag time of chase with [35S]sulfate, as observed previously (Baeuerle and Huttner, 1987).
Depolarization-induced Release
3 d or 3 h after transfection, PC12 cells were labeled with [35S]sulfate for 10 or 5 min, respectively. After 90 min of chase, cells were washed twice with either 5K/Ca medium (127 mM NaCl, 5 mM KCl, 2.2 mM CaCl, 0.33 mM Na2HPO4, 0.44 mM KH2PO4, 4.2 mM NaHCO3, 5.6 mM glucose, and 10 mM Hepes-NaOH; pH 7.4; for 5 mM KCl control and 55 mM KCl release) or 5K/Mg medium (5K/Ca medium in which 2.2 mM CaCl2 was replaced by 10 mM MgCl2; for 55 mM KCl plus 10 mM MgCl2 control). Thereafter, cells were incubated for 10 min in 5K/Ca medium (for 5 mM KCl control), 55K/Mg medium (5K/Mg medium in which 127 mM NaCl and 5 mM KCl were replaced by 77 mM NaCl and 55 mM KCl; for 55 mM KCl plus 10 mM MgCl2 control) or 55K/Ca medium (5K/Ca medium in which 127 mM NaCl and 5 mM KCl were replaced by 77 mM NaCl and 55 mM KCl; for 55 mM KCl release). At the end of the incubation, dishes were placed on ice, medium was removed, and cells and media were analyzed, either after immunoprecipitation or directly by SDS-PAGE and phosphoimaging.
Subcellular Fractionation
The exit of the granins from the TGN into constitutive secretory vesicles
(CV) and immature secretory granules was followed by sequential velocity and equilibrium sucrose gradients according to standard procedures
(Tooze and Huttner, 1990; Tooze and Huttner, 1992
), except for the following changes: velocity and equilibrium gradients were fractionated into
1-ml aliquots, fractions 2-5 from the top of the velocity gradients were
pooled and analyzed by equilibrium gradient centrifugation on linear 0.6-
1.6 M sucrose gradients.
Immunoprecipitation
Myc-tagged proteins.
After the indicated chase times, the medium was collected and cells were washed twice with ice-cold PBS. Cells were lysed for
10 min in 0.8 ml (6-cm dishes), or 1.2 ml (10-cm dishes) myc lysis buffer
(10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% Triton X-100,
10 µg/ml leupeptin, 0.25 mM PMSF). The lysate was cleared by sequential
centrifugation for 10 min at 800 g and 30 min at 100,000 g diluted with 1 vol cell dilution buffer (10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM
EDTA, 10 µg/ml leupeptin, 0.25 mM PMSF). Chase or release media were
cleared as done for cell lysates and diluted with 1 vol medium dilution
buffer (10 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM EDTA, 1% Triton
X-100, 10 µg/ml leupeptin, 0.25 mM PMSF). Samples were incubated for 4 h after which 40 µl of a 50% (wt/vol) suspension of protein A-Sepharose CL-4B (Pharmacia Diagnostics AB, Uppsala, Sweden), swollen and washed
three times in PBS and a 1:1 mixture of cell lysis and cell dilution buffer,
was added. After a 2-h incubation, the immunocomplexes were washed
four times with myc wash buffer (10 mM Tris-HCl, pH 8.0, 100 mM NaCl,
1 mM EDTA, 0.2% Triton X-100). The final pellet was resuspended in
Laemmli sample buffer (Laemmli, 1970), boiled, and subjected to SDS-PAGE. In some experiments, an aliquot of the supernatants before dilution with cell or medium dilution buffer was mixed with Laemmli sample
buffer, and directly subjected to SDS-PAGE.
Electrophoresis and Immunoblotting
SDS-PAGE was performed and gels were processed as described (Lee
and Huttner, 1983). For the analysis of gradient fractions, equal aliquots
were acetone precipitated before analysis. Western blots were probed
with a monoclonal anti-hCgB (67-C7-2) followed by a goat anti-mouse
antibody (Dianova, Hamburg, Germany) and 125I-protein A.
Immunofluorescence
Single and double immunofluorescence was performed following standard
procedures (Rosa et al., 1989). The coverslips were mounted on glass
slides with 90% glycerol containing 1 mg/ml p-phenylenediamine. Fluorescence was viewed using a conventional Zeiss Axiophot microscope (objective 63 × and 40 ×; Oberkochen, Germany) or a confocal microscope (Leica TCS 4D, Heerbrugg, Switzerland) with ~800 nm depth for the analyzed sections.
Quantitations
Unless indicated, quantitation was done using a FUJI X-BAS 1000 phosophoimager (Tokyo, Japan). Fluorograms were quantitated by densitometric scanning using the Pharmacia-LKB ultroscan XL.
For determination of the infection rate, cells were fixed after different time periods of infection followed by immunofluorescence with anti-hCgB. For each time point, the percentage of immunopositive cells was calculated by analyzing ~2,000 cells (Zeiss microscope, objective 40 ×).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Transfected Wild Type and cys-hCgB Are Stored in
Secretory Granules
To test whether the disulfide-bonded loop of CgB is an essential structure for its sorting to secretory granules, a deletion mutant of hCgB (cys-hCgB) was constructed (Fig.
1). This mutant lacks amino acids 16-37 comprising the
disulfide-bonded loop of hCgB. Transfection experiments
were carried out with wild-type hCgB (wt-hCgB) and
cys-hCgB containing a myc tag at their COOH termini.
|
Trafficking of the recombinant proteins was analyzed by biochemical and morphological methods. We (a) determined secretion kinetics and intracellular storage of recombinant proteins by pulse-chase analysis, (b) characterized the type of vesicle to which recombinant proteins were sorted upon exit from the TGN by sucrose gradient centrifugation, (c) tested the storage of recombinant proteins in secretory granules by depolarization-induced release, and (d) analyzed their subcellular distribution by immunofluorescence analysis.
First, we analyzed whether wt-hCgB and cys-hCgB
were sorted to the regulated pathway of secretion during
ongoing synthesis of endogenous regulated secretory proteins. Both proteins were transiently expressed in the
neuroendocrine cell line PC12. Expression of transfected
proteins was monitored by [35S]sulfate-labeling, a posttranslational modification of the TGN (Baeuerle and
Huttner, 1987
), followed by immunoprecipitation with an
antibody against the myc tag. At the end of the 5-min pulse, wt-hCgB and
cys-hCgB were detected as single
bands in cell lysates indicating the full-length products
(Fig. 2 A, bracket). In addition, after a 90-min chase, two
fragments of hCgB of ~68 kD were observed in cell lysates and media (Fig. 2 A, diamond), which could also be
immunoprecipitated with an antibody against hCgB (data
not shown). As a marker for constitutive secretion, recombinant human
1-antitrypsin containing a tyrosine sulfation site at the COOH terminus (AT; Leitinger et al.,
1994
) was expressed in PC12 cells. AT was chosen because
its isoelectric point is similar to that of hCgB (Owen and
Carrell, 1992
; Gerdes and Huttner, 1995
), but, in contrast
to the latter protein, does not undergo calcium- and low
pH-induced aggregation in vitro (Krömer, A., and H.-H.
Gerdes, unpublished observation). By immunoprecipitation of [35S]sulfate-labeled AT from cell lysates and media
a major band of ~62 kD (Fig. 2 A, asterisk) was detected.
A minor band of lower molecular weight observed in cell
lysates at the end of the 5-min pulse (Fig. 2 A, arrowhead)
probably reflected sulfation of incompletely sialyted AT,
because this form disappeared already after short chase
times (data not shown).
|
Secretion kinetics of transfected wt-hCgB, cys-hCgB,
and of AT were determined after 5-min sulfate pulse-
labeling followed by chase times for up to 3 h (Fig. 2 B).
At all time points, the total amount of [35S]sulfate-labeled
proteins had increased slightly (see Materials and Methods) indicating that degradation of [35S]sulfate-labeled
proteins did not take place during the chase periods.
Rapid secretion of all three proteins occurred during the
first 60 min and approached a plateau after 90 min of
chase. The relative amounts that were released into the
medium differed for each protein. We determined the
storage efficiency (Seff) for each protein by quantitation of
the relative amount stored in the cell after 90 min of chase
(Fig. 2 C). Wt-hCgB was stored with a Seff of 70.9% ± 6.0 SD. This value was lower than that determined for endogenous rSgII in transfected cells (Seff: 93.4% ± 2.7 SD), suggesting that granins of species other than rat are stored
less efficiently in PC12 cells.
cys-hCgB lacking the disulfide-bonded loop was stored to 40.8% ± 6.8 SD and the
constitutive marker AT to 9.3% ± 1.2 SD. Although the
reduction in storage efficiency of
cys-hCgB as compared
to wt-hCgB points to a role of the disulfide-bonded loop in
sorting of hCgB, this structure is apparently not essential for its sorting after transfection.
The subcellular compartment to which wt-hCgB and
cys-hCgB were sorted was characterized by three different approaches. First, we determined the type of vesicle
into which wt-hCgB and
cys-hCgB were sorted upon exit
from the TGN. PC12 cells were transfected, pulse labeled
for 5 min with [35S]sulfate, and chased for 12 min, after
which the transfected protein had completely left the TGN
(data not shown). Thereafter, postnuclear supernatants
were prepared and subjected to an established subcellular
fractionation protocol, which consists of a sequential velocity and equilibrium sucrose gradient centrifugation
(Tooze and Huttner, 1990
). The distribution across the
equilibrium gradients of the heparansulfate proteoglycan
(hsPG), a marker for CV, SgII, a marker for ISG and
transfected proteins is shown in Fig. 3. Both wt-hCgB (Fig.
3, left) and
cys-hCgB (Fig. 3, right) were found in fractions also containing rSgII indicating sorting to ISG. A minor amount of
cys-hCgB (~30%) comigrated with hsPG
(Fig. 3, right), suggesting that it exited from the TGN in
CV. The observation that nearly 100% of transfected wt-hCgB and ~70% of
cys-hCgB exited into ISG within 12 min but remained in the cell to only ~70% and ~40% after 90 min of chase (see Fig. 2 C), respectively, suggests
basal release of mature secretory granules or constitutive-like secretion from ISG of the transfected proteins (see
Discussion). In contrast to the gradient profiles obtained
after 12 min of chase, complete codistribution of wt-hCgB
and
cys-hCgB with rSgII was observed for equilibrium
gradients prepared after 90 min of chase at a density characteristic of mature secretory granules (data not shown).
|
Second, we tested whether secretion of wt-hCgB and
cys-hCgB could be induced by depolarization of transfected PC12 cells. After transfection with either wt-hCgB
or
cys-hCgB, PC12 cells were pulse labeled for 10 min
with [35S]sulfate and chased for 90 min. Depolarization of
cells by incubation in medium containing 55 mM KCl released 18.2% ± 1.9 SD and 16.1% ± 5.1 SD of wt-hCgB
and
cys-hCgB, respectively (Fig. 4). In contrast, incubation in control medium containing 5 mM KCl or 55 mM
KCl plus 10 mM MgCl2 in the absence of calcium resulted
in release of 1.6-2.5% of recombinant proteins (Fig. 4). As
also shown previously (Bauerfeind et al., 1995
), the transfected protein rSgII was released to a similar extent (55 mM KCl: 21.5 ± 2.1 SD, 5 mM KCl: 2.7 ± 2.6 SD, 55 mM
KCl/10 mM MgCl2: 4.2 ± 1.0 SD). Consistent with its efficient secretion (Fig. 2), no stimulated release of transfected, sulfate-labeled AT was detectable. The sevenfold
increase in secretion of wt-hCgB and
cys-hCgB after
stimulation provides strong evidence that both proteins
were stored in secretory granules.
|
Third, the subcellular distribution of transfected proteins
was analyzed by confocal double immunofluorescence.
After incubation of transfected PC12 cells with cycloheximide for 90 min, both wt-hCgB (Fig. 5 B) and cys-hCgB
(Fig. 5 D) were detected as a punctate pattern at the periphery of the cell. Punctate structures immunoreactive for
wt-hCgB and
cys-hCgB were also immunoreactive for
endogenous rCgB (compare arrowheads in Fig. 5, A vs. B
and C vs. D), suggesting the presence of wt-hCgB and
cys-hCgB in secretory granules. On the other hand, the
marker protein for the constitutive pathway, AT, which
could be detected as a perinuclear staining without cycloheximide treatment (Fig. 5 E), was barely detectable in
cells after 90 min of cycloheximide chase (Fig. 5 F), consistent with its efficient secretion during pulse-chase labeling
(Fig. 2 B and C). In summary, we conclude that both wt-hCgB and
cys-hCgB expressed by transfection are sorted
to ISG after exit from the TGN, and are stored in secretory granules.
|
Vaccinia Virus Infection of PC12 Cells Blocks Endogenous Protein Synthesis
We next analyzed sorting of the same recombinant proteins
expressed in the absence of endogenous granins. Because
all known cell lines bearing the regulated pathway of protein secretion express granins, we set up the vaccinia expression system for PC12 cells. Infection with vaccinia virus
has been shown to inhibit host cell protein synthesis and to
induce the synthesis of virus-encoded proteins (Moss, 1968).
The viral system was established by infection of PC12
cells with a recombinant virus vv:wt-hCgB which contains
wt-hCgB cDNA under the control of the viral 7.5-K promoter. This promoter is active at early and late stages of
viral infection. Most importantly, viral infections were performed in the presence of hydroxyurea, a drug known to
inhibit the expression of late viral genes (Pogo and Dales,
1971). Thereby viral assembly, in particular, two steps of
viral membrane recruitment, at the intermediate compartment (Sodeik et al., 1993
) and at the TGN (Schmelz et al.,
1994
), are blocked, thus preventing disturbance of the
secretory pathway.
Infection of PC12 cells with a recombinant virus led to a striking decrease in newly synthesized host cell proteins as determined by pulse labeling of PC12 cells with [35S]methionine. This effect was visible by comparison of total homogenates prepared from either mock-infected or infected PC12 cells (Fig. 6 A, compare total, lanes m and vv). In particular, the cessation of protein synthesis of the two major secretory proteins of PC12 cells, rSgII and rCgB, could be demonstrated after preparation of heat stable fractions (Fig. 6 A, HS). Whereas in heat stable fractions of mock-infected cells rSgII (arrowhead) and rCgB (bracket) were the most prominent bands, in infected cells their expression was reduced to a low level. Residual expression of endogenous granins was due to noninfected cells (see below). At the same time hCgB was expressed under viral control to approximately the same level as either of the two endogenous granins, rSgII and rCgB, and was already visible in total homogenates (Fig. 6 A, total and HS, lanes vv, arrows). The expression level was unchanged from 3 to 8 h PI (data not shown). The identity of hCgB was confirmed by Western blotting of total homogenates with a species-specific antibody that recognizes human, but not rat, CgB. A signal of the expected molecular weight was detected only in infected cells (Fig. 6 B, lane vv, arrow).
|
We quantitatively correlated cessation of host cell protein synthesis with the onset of hCgB expression. Expression of hCgB at the cellular level was detected by indirect
immunofluorescence with the antibody specific for the human protein. As a marker protein for regulated secretory
protein synthesis of the host cell, we followed expression
of rSgII. Synthesis of rSgII was monitored by pulse labeling of PC12 cells with [35S]methionine after various times
of infection with 0, 20, and 100 pfu per cell. The time
courses of the synthesis of rSgII and of the percentage of
noninfected cells are shown in Fig. 6 C. For all conditions
applied, the block of synthesis of rSgII upon infection was
paralleled by the decrease of noninfected cells. By trypan
blue staining, after 8 h of infection with 100 pfu/cell, <1%
positive cells were detected, indicating that the decrease in
rSgII synthesis was not due to cell death (data not shown). The expression of hCgB and shut-off of host cell protein
synthesis, therefore, are concurrent events and the remaining expression of rSgII seen at 8 h PI is due to noninfected cells. This implies that the shut-off of host cell protein synthesis starts at the latest with the onset of early
viral expression. Furthermore, the decrease in methionine-labeled or sulfate-labeled endogenous rSgII was compared
after 3 h PI of either vv:wt-hCgB or vv:cys-hCgB at 100 pfu/cell (not shown). Because the same amount in decrease of labeled rSgII was detected for both recombinant viruses,
we conclude that the shut-off of endogenous granin synthesis of vv:
cys-hCgB was as complete as for vv:wt-hCgB.
To obtain direct evidence at the single cell level for a complete block of host cell protein synthesis in infected cells, we used confocal double immunofluorescence. Two constraints of our system have to be considered in this context. First, shut-off at the cellular level cannot be monitored by a lack of endogenous granins because PC12 cells store them in secretory granules located in the cell periphery. Second, immunoreactivity for the endogenous granins (in contrast to that for exogenous hCgB) was, for unknown reasons, not detectable at the level of the PC12 cell Golgi, not even after application of various transport blocks (data not shown). We, therefore, analyzed whether vaccinia virus-expressed hCgB colocalized with endogenous granins at the level of mature secretory granules, as has been shown to be the case for hCgB expressed by transfection (Fig. 5). Lack of colocalization would imply that virally expressed hCgB and endogenous granins were not packaged into the same secretory granule and, thus, were not present in the TGN at the same time. Infected PC12 cells were chased for 90 min with cycloheximide before fixation. In vv:wt-hCgB-infected cells (Fig. 7 A), as was the case in noninfected cells (not shown), endogenous rCgB and rSgII were largely colocalized, with most of the immunostaining being observed at the cell periphery. This result is consistent with both proteins being present in the TGN simultaneously and being copackaged into secretory granules. In contrast, vaccinia virus-expressed wt-hCgB chased to mature secretory granules (see also Figs. 9 and 10) did not colocalize with endogenous rCgB (Fig. 7 B) nor endogenous rSgII (Fig. 7 C), but was observed as distinct punctate structures distributed largely at the cell periphery and to some extent scattered in the cytoplasm. A quantitative analysis of >100 cells revealed that <5% of punctate signals were positive for both virally expressed hCgB and endogenous granins. Bearing in mind that wt-hCgB in transfected cells colocalized with endogenous granins (Fig. 5), we conclude that the synthesis of endogenous granins is shut off under vaccinia virus infection and that the secretory granules containing endogenous granins were made before shut-off, whereas secretory granules containing hCgB were made after shut-off.
|
|
|
ER to trans-Golgi Transport Rate Is Unaffected after Prolonged Shut-off
To analyze the transport of hCgB in the early secretory
pathway of infected cells, we monitored the conversion of
newly synthesized hCgB to the mature form, i.e., its arrival
in the trans-Golgi, by pulse-chase labeling. After a 3-min
pulse with [35S]methionine, the ER form of hCgB was detected as a doublet (Fig. 8 top, arrowhead). With increasing chase time, this form shifted to a higher molecular
mass form of ~125 kD (Fig. 8 top, arrow), which comigrated with [35S]sulfate-labeled hCgB (data not shown), a
marker for the mature form in the TGN (Baeuerle and
Huttner, 1987). The calculated t1/2 of transport from ER to
Golgi was ~7.5 min (Fig. 8, bottom). In uninfected PC12
cells, transport of rCgB to the trans-Golgi occurred with a
t1/2 of ~7 min (Chanat et al., 1993
). Our results indicate that host cell protein synthesis shut-off has virtually no effect on ER to Golgi transport of hCgB. Furthermore, the
short t1/2 suggests that endogenous granins synthesized before host cell protein synthesis shut-off are cleared out
from the secretory pathway rapidly, and, thus, do not contribute to the cargo of newly formed secretory granules
during shut-off.
|
hCgB Is Sorted to the Regulated Secretory Pathway When Protein Synthesis of the Host Cell Is Blocked
The data in Fig. 6 suggest that hCgB is the only regulated secretory protein in the TGN of PC12 cells when expressed by a recombinant vaccinia virus. Sorting of hCgB to secretory granules under these conditions was tested by examining depolarization-induced secretion (Fig. 9). 3 h PI, cells were pulse labeled for 5 min with [35S]sulfate followed by a 90-min chase. Subsequent depolarization of the cells by incubation in medium containing 55 mM KCl released 21.5% ± 2.1 SD of hCgB. Under control conditions (5 mM KCl or 55 mM KCl plus 10 mM MgCl2 in the absence of calcium) 5.0% ± 2.8 SD or 4.2% ± 1.0 SD was, respectively, released. rSgII from noninfected cells was released in comparable amounts, i.e., 19.7% ± 2.9 SD in the presence of 55 mM KCl and 2.7% ± 2.6 SD or 2.1% ± 1.7 SD in control media (5 mM KCl or 55 mM KCl plus 10 mM MgCl2 in the absence of calcium, respectively). These data show that hCgB is stored in a compartment which can undergo depolarization-induced, calcium-dependent exocytosis. This result demonstrates that sorting to the regulated pathway of secretion is not abolished under shut-off conditions.
Virally Expressed wt-hCgB but Not
cys-hCgB Is Sorted to Immature Secretory Granules
Which Undergo Maturation
Having established the vaccinia virus-mediated expression system, we investigated the role of the disulfide-bonded loop in sorting. For this purpose, a recombinant
virus expressing a deletion mutant lacking the disulfide-bonded loop (vv:cys-hCgB) was generated. To characterize the type of vesicle into which
cys-hCgB is sorted upon
exit from the TGN, sucrose gradient centrifugation analysis of a postnuclear supernatant of infected and pulse-chase labeled cells was performed as described for transfected cells (Fig. 3). wt-hCgB was analyzed in parallel.
Both recombinant proteins were detected as full-length
forms and in addition as two fragments of ~68 kD, which
have also been observed after transfection (compare with
Fig. 2 A). After a 12-min chase period, the majority of wt-hCgB comigrated on the equilibrium sucrose gradient with
the ISG marker protein, rSgII, synthesized in noninfected
cells of the same dish (Fig. 10, ISG; left). In addition a minor
portion codistributed with the constitutive marker protein
hsPG. (Fig. 10, CV, left). In contrast
cys-hCgB comigrated
exclusively with hsPG after a 12-min chase (Fig. 10, middle) indicating that it exits from the TGN exclusively into CV.
The depolarization-induced, calcium-dependent release
of virally expressed wt-hCgB suggested its presence in
secretory granules (Fig. 9). To directly show that ISG in
infected cells undergo maturation as has been shown for
ISG in uninfected cells (Tooze et al., 1991), equilibrium
gradient analysis was performed after a 90-min chase period. As shown in Fig. 10, under these conditions, the peak
of wt-hCgB was shifted by one fraction towards higher density as compared to 12 min of chase (Fig. 10, compare
fractions 8 and 9, left, to fractions 9 and 10, right). Notably,
after 90 min of chase wt-hCgB was detected in the same
gradient fractions as rSgII synthesized in noninfected cells.
This suggests that maturation of ISG in infected cells occurred within a similar time window as in noninfected
cells. In contrast
cys-hCgB colocalizing with the peak of
hsPG after 12 min of chase was barely detectable on equilibrium gradients after a 90-min chase (not shown) suggesting its constitutive secretion into the medium (see below). We conclude from the gradient analyses that after
vaccinia virus expression (a) the majority of wt-hCgB is
sorted from the TGN into ISG, which undergo maturation
during a 90-min chase and (b)
cys-hCgB exits from the
TGN exclusively into CV.
Vaccinia-expressed wt-hCgB but Not cys-hCgB Is
Stored in Secretory Granules
The differential exit of wt-hCgB and cys-hCgB from the
TGN indicated sorting of wt-hCgB but not of the mutant
to the regulated pathway of secretion. To determine the
storage efficiencies of vaccinia-expressed proteins, PC12
cells were infected with either vv:wt-hCgB, vv:
cys-hCgB,
or vv:AT and analyzed by a 5-min pulse with [35S]sulfate
followed by a 90-min chase. The recovery of [35S]sulfate-labeled hCgB and AT in cells and media after 90 min of
chase was slightly higher than that obtained at the end of the pulse (see Materials and Methods) indicating that no
degradation of sulfated proteins occurred under infection
conditions. Virally expressed wt-hCgB was stored with an
efficiency of 32.2% ± 1.0 SD which is ~4.5 times higher
than that of
cys-hCgB (Seff: 7.0% ± 2.7 SD; Fig. 11). Notably, after vaccinia expression
cys-hCgB was secreted
like the constitutive marker protein AT (Seff: 8.3% ± 0.8 SD). This result was different from that obtained after transfection. Together with the data obtained by gradient
centrifugation it indicates secretion of virally expressed
cys-hCgB via CV during 90 min of chase.
|
The finding that on the one hand ~70% wt-hCgB exited the TGN in ISG (Fig. 10, left) and on the other hand the storage efficiency determined after 90 min was ~32% (Fig. 11) suggests that constitutive-like secretion from ISG or an increased basal release of secretory granules occurred. A similar observation was made in the transfection studies (see Discussion).
Immunofluorescence Analysis of Vaccinia-mediated
Expression of wt-hCgB and cys-hCgB
Storage of wt-hCgB but not cys-hCgB could also be demonstrated by immunofluorescence analysis of infected
cells. 3 h PI, cells were immediately fixed or chased for 90 min in the presence of cycloheximide and subsequently
fixed. Immunofluorescence analysis for hCgB is shown in
Fig. 12. Without cycloheximide treatment, both wt-hCgB
(Fig. 12 A, arrows) and
cys-hCgB (Fig. 12 C, arrows) were detected as a perinuclear staining, which colocalized
with TGN38 (data not shown), a marker protein of the
TGN. After cycloheximide treatment, the signal in vv:
cys-hCgB infected cells was almost completely lost (Fig.
12 D), reflecting its efficient secretion as observed by metabolic pulse-chase labeling (Fig. 11). In contrast, virally expressed wt-hCgB showed a peripheral distribution after a
90-min cycloheximide treatment (i.e., 4.5 h PI), characteristic of secretory granules (Fig. 12 B, arrowheads), that is
consistent with its storage observed by pulse-chase analysis. Peripheral staining was already visible, although less
pronounced, before incubation with cycloheximide (i.e., 3 h
PI) in vv:wt-hCgB (Fig. 12 A, arrowheads) but not in vv:
cys-hCgB (Fig. 12 C) infected cells. Incubation of vv:wt-hCgB infected cells with cycloheximide for up to 3 h did
not significantly decrease the hCgB signal when compared
to that obtained after 90 min, suggesting that wt-hCgB is
neither secreted nor degraded once it has reached the mature secretory granule (data not shown).
|
Sorting of Vaccinia Virus-expressed cys-hCgB
Is Rescued by Coinfection with a Virus Expressing
Full-Length hCgB
Comparison of the sorting behavior of cys-hCgB after
transfection or infection suggests that, in the case of transfection, the lack of the disulfide-bonded loop was compensated by coaggregation of
cys-hCgB with loop-containing
full-length CgB. If so, double infection of vv:
cys-hCgB
with a recombinant virus expressing full-length hCgB
should mimic the transfection conditions and rescue sorting of the mutant to secretory granules. We investigated this issue using [35S]sulfate pulse-chase in combination with
subcellular fractionation. This approach has the advantage
of providing a direct analysis of protein sorting from the
TGN to ISG. In contrast, the three other approaches used
to analyze protein sorting to the regulated pathway of secretion (determination of storage efficiency, stimulation of
secretion, immunofluorescence) are indirect in that conclusions about sorting at the level of the TGN can only be
made if the protein under study that is sorted to ISG is also
retained in secretory granules during their maturation.
To investigate whether loop-containing full-length CgB
would rescue the sorting of cys-hCgB upon double infection, a recombinant virus, vv:wt-hCgB-EGFP, expressing
wt-hCgB tagged with enhanced green fluorescent protein
(EGFP; Kaether et al., 1997
) was generated. The EGFP
tag, which does not interfere with the sorting of wt-hCgB to secretory granules (Kaether et al., 1997
), makes it possible to distinguish wt-hCgB from
cys-hCgB on SDS-PAGE due to a shift in molecular weight. PC12 cells were
double-infected with vv:
cys-hCgB and vv:wt-hCgB-EGFP and subjected to sucrose gradient analysis after sulfate pulse-chase as described (Fig. 10, left, middle) to analyze for coaggregative sorting during exit from the TGN. In parallel the same analysis was performed with PC12
cells infected with vv:
cys-hCgB only. Fig. 13 shows the
distribution of sulfated proteins across the equilibrium
gradient. Similar to wt-hCgB, the fusion protein wt-hCgB-EGFP is largely found in fractions 8 and 9, the position of
ISG, and to a minor extent in fraction 6, the position of
CV (Fig. 13 middle, bottom,
). In double-infected cells, at
least 50% of
cys-hCgB colocalized with wt-hCgB-EGFP at the position of ISG (Fig. 13 middle, bottom,
), whereas
in single infections with vv:
cys-hCgB, the deletion mutant was almost exclusively found at the position of CV
(Fig. 13, top, bottom,
; also Fig. 10, middle). In conclusion, coexpression of
cys-hCgB with wt-hCgB-EGFP rescues sorting of the mutant to ISG in the vaccinia system.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The Disulfide-bonded Loop Is Essential for Sorting of CgB during Vaccinia Expression
In our study we provide biochemical and morphological
evidence that the 22 amino acids of hCgB comprising the
disulfide-bonded loop are essential for sorting of CgB to
secretory granules and that they affect sorting at the level
of the TGN. This result was accomplished using a vaccinia
virus-based expression system which inhibits host cell protein synthesis. We have shown by different methods that
under these conditions wt-hCgB but not cys-hCgB is
sorted to secretory granules. First, sucrose gradient analysis showed a differential exit of wt-hCgB and
cys-hCgB
from the TGN. Whereas wt-hCgB was sorted mainly into
ISG, which were shown to undergo maturation,
cys-hCgB was found exclusively in CV (Fig. 10). The reduction in sorting efficiency of wt-hCgB in the vaccinia system
(~70% versus ~100% after transfection) is most likely
due to the shut-off of host cell protein synthesis, which
could make factors involved in sorting rate-limiting. Consistent with this explanation, we observed that the sorting
efficiency of virally expressed wt-hCgB decreased with increasing infection times (data not shown). Second, after
pulse-chase labeling,
cys-hCgB was secreted like the constitutive marker protein AT whereas wt-hCgB was stored
~4.5-fold more (Fig. 11). Third, immunofluorescence analysis after 90 min of cycloheximide treatment revealed a
pattern for wt-hCgB, which was reminiscent of granule
staining. For the deletion mutant, no signal was detected
after 90 min of cycloheximide treatment reflecting its efficient
secretion (Fig. 12). Furthermore, we have demonstrated
that sorting of
cys-hCgB to ISG can be rescued by coexpression with full-length CgB (Fig. 13), resembling the presence of endogenous granins, as in the case of transfection.
From the finding that the disulfide-bonded loop is necessary for the sorting of hCgB to secretory granules, we
conclude that the disulfide-bonded loop comprises either a
part or the entire sorting signal. This explanation is consistent with the data obtained by Chanat et al. (1993), who
showed that reductive cleavage of the disulfide bond of
CgB by DTT caused its missorting to the constitutive
secretory pathway. However, the previous DTT data did
not strictly exclude an effect of DTT on a component of
the secretory machinery for CgB, rather than CgB itself.
Our results obtained by expression of
cys-hCgB clearly
indicate that missorting is due to the mutation in CgB.
Sorting of Transfected cys-hCgB by Coaggregation
In contrast to the data obtained with the vaccinia expression system, cys-hCgB was efficiently sorted to the regulated pathway after transfection. This was determined by
pulse-chase labeling (Fig. 2), sucrose gradient centrifugation (Fig. 3), depolarization-induced calcium-dependent
release (Fig. 4), and confocal double immunofluorescence analysis (Fig. 5). How can one reconcile the opposing results for
cys-hCgB obtained by the two different expression systems? The major difference between the two systems is the ongoing synthesis of endogenous proteins after
transfection, in contrast to a shut-off of host cell protein
synthesis during viral infection, resulting in the presence
or absence of endogenous granins in the TGN (Fig. 14).
Ongoing protein synthesis during transfection would allow the formation of aggregates between transfected and
endogenous regulated secretory proteins enabling the
former to enter the regulated secretory pathway by coaggregation. The fact that approximately one-third of
cys-hCgB was missorted to CV after transfection may be explained by the formation of homotypic aggregates of the mutant. Because, under transfection,
cys-hCgB is expressed approximately two to three times higher than
endogenous granins (not shown), the probability of homotypic
cys-hCgB aggregates is increased. Indeed the absence and presence of rescuing molecules (full-length CgB) as the principal difference between the two expression systems is clearly shown by coexpression in the vaccinia system of
cys-hCgB with full-length CgB, which rescues sorting of the mutant to secretory granules (Fig. 13).
This implies that sorting of the deletion mutant is accomplished by coaggregation with loop-bearing CgB, i.e., endogenous rCgB in the case of transfection and recombinant wt-hCgB in the vaccinia system (Fig. 14).
|
This explanation is supported by the demonstration of
heterophilic interactions between regulated secretory proteins in vitro (Gorr et al., 1989; Palmer and Christie, 1992
;
Colomer et al., 1996
). In particular, it was shown that CgB
interacts with CgA at low pH (Yoo, 1996
). Because the aggregative properties of CgB are maintained after reduction of the disulfide bond (Chanat et al., 1994
) and deletion of the disulfide-bonded loop (A. Krömer and H.-H.
Gerdes, unpublished observations),
cys-hCgB, like wt-hCgB, can be expected to interact with other regulated
secretory proteins. Taken together, our data suggest that
cys-hCgB lacking the disulfide-bonded loop, when expressed by transfection, is sorted to the regulated pathway
of secretion by coaggregation with endogenous regulated secretory protein, the latter bearing the sorting signal.
Constitutive-like Secretion in PC12 Cells
Gradient analysis of transfected PC12 cells showed that
wt-hCgB and cys-hCgB pulse labeled for 5 min with
[35S]sulfate exited completely within 12 min from the TGN
into post-TGN vesicles. At the end of a 12-min chase,
transfected wt-hCgB was detected exclusively in ISG,
whereas
cys-hCgB was found in ISG and to a minor extent in CV (Fig. 3), indicating that ~30% of the mutant
had entered the constitutive pathway of secretion upon exit from the TGN. These data are consistent with a role
of the disulfide-bonded loop in sorting to ISG. We assume
that the proportion of
cys-hCgB entering CV did not coaggregate with endogenous granins but formed homotypic
aggregates (Fig. 14). After 90 min of chase, a time point at
which ISG have largely been converted to mature secretory granules (t1/2 ~45 min; Tooze et al., 1991
), 70.9 and 40.8% of transfected wt-hCgB and
cys-hCgB, respectively, were stored in secretory granules (Fig. 2 C). Comparison of the storage efficiencies determined after 90 min
of chase with the proportion sorted to ISG after 12 min
suggests that a similar proportion of both proteins was secreted in an unstimulated manner after entering the ISG.
Two mechanisms, basal release of ISG (Matsuuchi and
Kelly, 1991
) and constitutive-like secretion (Kuliawat and Arvan, 1992
), have been described which could account
for this effect. For PC12 cells it has been shown, following
rSgII as a marker protein, that basal release occurred at a
very low level if at all (Gerdes et al., 1989
; Tooze and
Huttner, 1990
). Similar results were obtained in this study
for transfected PC12 cells (Seff of rSgII: 93.4% ± 2.7 SD).
Therefore, it is unlikely to be basal release but rather constitutive-like secretion that accounts for unstimulated secretion of wt-hCgB and
cys-hCgB between 12 and 90 min
of chase. This explanation is consistent with data obtained
from pancreatic islet cells, in which constitutive-like secretion was restricted to the maturation period of ISG (Kuliawat and Arvan, 1992
). During vaccinia expression, unstimulated secretion of wt-hCgB (sorting into ISG ~65% versus
Seff ~32%) from ISG was observed to a similar extent as in
the case of transfection (sorting into ISG ~100% versus
Seff ~71%). This suggests that in both systems, transfection and infection, the difference between sorting and storage of wt-hCgB is caused by constitutive-like secretion.
Sorting during Host Cell Synthesis Shut-off
The observation that virally expressed wt-hCgB is sorted and packaged into secretory granules under host cell protein synthesis shut-off allows the following conclusions: First, sorting of wt-hCgB to secretory granules is independent of other regulated secretory proteins, i.e., it carries all signals necessary for sorting to the regulated pathway of secretion. Second, involvement of chaperones with a short half-life in the secretory pathway assisting transport or aggregation of wt-hCgB is unlikely. Third, recruitment of other components necessary for granule formation, e.g., membrane proteins and cytosolic factors is, at least for the infection time analyzed, mostly independent of ongoing protein synthesis, and thus can be obtained from preexisting pools.
In the past, the vaccinia virus has been used frequently
as a mammalian expression system because of its ability to
infect a wide spectrum of cell types yielding high expression levels of the recombinant proteins (Hruby et al.,
1986). In particular, processing and sorting of prohormones and proneuropeptides have been studied by infecting fibroblast-like cells, which have only a constitutive
pathway of protein secretion, and AtT20 cells, with recombinant vaccinia viruses usually at very low viral multiplicity (Thomas et al., 1986
; Edwards et al., 1988
; Thomas et
al., 1988
; Seethaler et al., 1991
). However, inhibition of
host cell protein synthesis was not analyzed under the conditions used. Because the degree of inhibition varies significantly with viral multiplicity (Moss, 1968
) and with cell
type (Bablanian et al., 1978
), it remains unclear whether
processing and sorting was determined in the presence or
absence of host cell protein synthesis.
Secretory granule biogenesis under protein synthesis arrest
was subject of a study by Moore and co-workers (Brion et
al., 1992). Using cycloheximide to block protein synthesis
and analyze glycosaminoglycan chain trafficking, Brion et
al. found that formation of secretory vesicles was severely
impaired. In contrast to a total block of protein synthesis
after cycloheximide application, vaccinia infection inhibits only
host cell protein synthesis. Under the latter condition, we
have shown that expression of a single regulated secretory
protein is sufficient for the formation of secretory granules.
Analysis of Sorting Signals in Other Regulated Secretory Proteins
Prosomatostatin is a regulated secretory protein whose
sorting to secretory granules has been studied intensively.
Its sorting information was shown to reside in the first 82 (Stoller and Shields, 1989) or 78 amino acids (Sevarino et
al., 1989
) of prosomatostatin. A more detailed mutational
analysis of prosomatostatin did not reveal a unique amino
acid sequence sufficient for sorting (Sevarino and Stork,
1991
). Taking into account that the proregion of somatostatin encodes for more than half of the prohormone,
the defined region might exhibit aggregative properties
rather than functioning as a sorting signal. Furthermore,
by using stimulated secretion to monitor sorting to the regulated pathway of protein secretion, it is not clear to which
extent sorting in the TGN or sorting by retention in mature secretory granules had occurred.
Proopiomelanocorticotrophic hormone (POMC) is another model protein for studying sorting to the regulated
pathway. When mutants of this hormone with a 25- or 26-
amino acid deletion at the NH2 terminus of the proregion
were analyzed in Neuro 2A cells, opposing results for the
existence of an NH2-terminal-sorting motif were reported
(Roy et al., 1991; Chevrier et al., 1993
; Cool and Peng Loh,
1994; Cool et al., 1995
). Using a retroviral expression system (which does not shut off host cell protein synthesis)
Roy et al. showed that the NH2-terminal 26 amino acids
are not necessary for sorting. In addition, they provided
evidence that sorting information is present in multiple
domains of POMC and speculated that cooperation between these domains is needed for sorting of the precursor
to secretory granules (Chevrier et al., 1993
). In contrast,
Cool et al. reported that transfection of a deletion mutant
of POMC lacking amino acids 2-26 or 8-20 resulted in its constitutive secretion (Cool and Peng Loh, 1994; Cool et
al., 1995
). Furthermore, the authors present data that in
AtT20 cells the NH2-terminal 26 amino acids of POMC
are sufficient to sort the constitutive reporter protein
chloramphenicol acetyltransferase to secretory granules
(Tam et al., 1993
). However, it remains unclear to what
degree homo- or heterophilic interactions of the transfected proteins with endogenously regulated secretory
proteins were involved in the sorting process. It is possible
that such interactions vary considerably with the expression
level of the transfected proteins and might account for the
opposing results. In addition, as for prosomatostatin, sorting was studied at the level of mature secretory granules,
and not in the TGN. Nevertheless, it is interesting that the
proposed sorting motif of POMC like the loop of CgB is
stabilized by a disulfide bond. This raises the question of
whether an exposed loop of amino acids is a general feature of the signal for granular sorting. From theoretical
calculations based on the primary sequence analysis of regulated proteins it was suggested that the sorting signal may
contain a degenerated amphipathic helix (Kizer and Tropsha, 1991
). Consistent with the latter suggestion, the disulfide-bonded loop in hCgB forms an amphipathic helix, as
determined by secondary structure prediction.
In summary, our data show that the vaccinia-based expression is a powerful tool for the identification of sorting
signals of regulated secretory proteins. Most importantly,
it allows us to distinguish sorting signals from aggregative
properties. Using this system it should be possible to identify two classes of regulated secretory proteins: (a) proteins containing all the structural information necessary
for sorting to secretory granules and which, therefore, are
properly sorted when they are present in the TGN as the
only cargo protein and (b) proteins lacking a specific sorting signal, but which are competent for aggregation, and
whose sorting therefore depends on the former class of
regulated secretory proteins. A paradigm for the former
class is CgB analyzed in this study. Recently, Natori and
Huttner (1996) provided in vivo evidence for a helper
function of CgB in sorting of proteins to secretory granules. In AtT20 cells, CgB was shown to promote sorting of the 23-K fragment of POMC, which was further processed
in ISG to ACTH. Other candidates that may rely on
helper proteins for sorting may be thyroid hormone and
luteinizing hormone whose aggregative properties have
been analyzed in vitro by Cohn and co-workers (Gorr et
al., 1989
), and Rindler and co-workers (Colomer et al., 1996
), respectively.
We have demonstrated here using the vaccinia expression system that the NH2-terminal disulfide-bonded loop of CgB is necessary for its sorting to secretory granules. Likewise, this system can be used in future studies to analyze sorting of regulated secretory proteins for which transfection studies failed in the identification of a sorting signal. In particular, it will be interesting to identify the nature of sorting signals in regulated secretory proteins that do not contain cysteins, e.g., SgII. It may turn out that exposed loops of amino acids stabilized by other means than disulfide-bonds serve as signal in these proteins.
![]() |
Footnotes |
---|
Received for publication 5 July 1996 and in revised form 23 December 1997.
W.B. Huttner and H.-H. Gerdes are recipients of grants from the Deutsche Forschungsgemeinschaft (SFB 317/C2 and C7) and the European Commission (Biotechnology ERBBIO4CT960058, TMR ERB-FMRX-CT96-0023).We thank Henk Stunnenberg for advice in vaccinia work, Andrea Betz
(MPI für experimetelle Medizin, Göttingen) for preparation of plasmid
transfer vector pAB and the recombinant virus vv:cys-hCgB, Martin
Spieß (Biozeutrum, Basel, Switzerland) for providing the COOH-terminally modified cDNA of
1-antitrypsin, Petra Samenfeld for excellent
technical assistance, and Denis Corbeil, Jeremy Garwood, Matthew Hannah, and Christoph Kaether for critical comments on the manuscript. The
antiserum against
1-antitrypsin was a gift from Jerry L. Brown.
![]() |
Abbreviations used in this paper |
---|
AT, 1-antitrypsin containing a tyrosine sulfation site;
CgA, chromogranin A;
CgB, chromogranin B;
CV, constitutive secretory vesicles;
EGFP, enhanced green fluorescent protein;
gpt, guanine phosphoribosyltransferase;
hCgB, human CgB;
hsPG, heparansulfate proteoglycan;
ISG, immature secretory granules;
pfu, plaque-forming unit;
PI, post infection;
POMC, proopiomelanocorticotrophic hormone;
rCgB, rat CgB;
rSgII, rat SgII;
SgII, secretogranin II;
Seff, storage efficiency;
vv, vaccinia virus.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Arvan, P., and D. Castle. 1992. Protein sorting and secretion granule formation in regulated secretory cells. Trends Cell Biol. 2: 327-331 . |
2. | Bablanian, R., M. Esteban, B. Baxt, and J.A. Sonnabend. 1978. Studies on the mechanisms of vaccinia virus cytopathic effects. I. Inhibition of protein synthesis in infected cells is associated with virus-induced RNA synthesis. J. Gen. Virol. 39: 391-402 [Abstract]. |
3. | Baeuerle, P.A., and W.B. Huttner. 1987. Tyrosine sulfation is a trans-Golgi- specific protein modification. J. Cell Biol. 105: 2655-2664 [Abstract]. |
4. | Bauerfeind, R., R. Jelinek, and W.B. Huttner. 1995. SynaptotagminI- and II- deficient PC12 cells exhibit calcium-independent, depolarization-induced neurotransmitter release from synaptic-like microvesicles. FEBS Lett. 364: 328-334 |
5. | Benedum, U.M., A. Lamouroux, D.S. Konecki, P. Rosa, A. Hille, P.A. Baeuerle, R. Frank, F. Lottspeich, J. Mallet, and W.B. Huttner. 1987. The primary structure of human secretogranin I (chromogranin B): comparison with chromogranin A reveals homologous terminal domains and a large intervening variable region. EMBO (Eur. Mol. Biol. Organ.) J. 6: 1203-1211 [Abstract]. |
6. |
Brion, C.,
S.G. Miller, and
H.-P.H. Moore.
1992.
Regulated and constitutive secretion. Differential effects of protein synthesis arrest on transport of glycosaminoglycan chains to the two secretory pathways.
J. Biol. Chem.
267:
1477-1483
|
7. | Burgess, T.L., and R.B. Kelly. 1987. Constitutive and regulated secretion of proteins. Ann. Rev. Cell Biol. 3: 243-293 . |
8. | Burgess, T.L., C.S. Craik, L. Matsuuchi, and R.B. Kelly. 1987. In vitro mutagenesis of trypsinogen: role of the amino terminus in intracellular protein targeting to secretory granules. J. Cell Biol. 105: 659-668 [Abstract]. |
9. |
Castle, A.M.,
L.E. Stahl, and
J.D. Castle.
1992.
A 13-amino acid N-terminal domain of a basic proline-rich protein is necessary for storage in secretory
granules and facilitates exit from the endoplasmic reticulum.
J. Biol. Chem.
267:
13093-13100
|
10. | Chanat, E., and W.B. Huttner. 1991. Milieu-induced, selective aggregation of regulated secretory proteins in the trans-Golgi network. J. Cell Biol. 115: 1505-1519 [Abstract]. |
11. |
Chanat, E.,
U. Wei![]() |
12. |
Chanat, E.,
U. Wei![]() |
13. | Chevrier, D., H. Fournier, C. Nault, M. Zollinger, P. Crine, and G. Boileau. 1993. Targeting of pro-opiomelanocortin to the regulated secretory pathway may involve cooperation between different protein domains. Mol. Cell. Endocrinol. 94: 213-221 |
14. | Chocran, M.A., C. Puckett, and B. Moss. 1985. In vitro mutagenesis of the promotor region for a vaccinia virus gene: evidence for tandem early and late regulatory signals. J. Virol. 54: 30-37 |
15. | Chu, W.N., J.D. Baxter, and T.L. Reudelhuber. 1990. A targeting sequence for dense secretory granules resides in the active renin protein moiety of human preprorenin. Mol. Endocrinol. 90: 1905-1913 . |
16. |
Colomer, V.,
G.A. Kieska, and
M.J. Rindler.
1996.
Secretory granule content
proteins and the luminal domains of granule membrane proteins aggregate
in vitro at mildly acidic pH.
J. Biol. Chem.
271:
48-55
|
17. | Cool, D.R., and Y. Peng Loh. 1994. Identification of a sorting signal for the regulated secretory pathway at the N-terminus of pro-opiomelanocortin. Biochimie (Paris). 76:265-270. |
18. |
Cool, D.R.,
M. Fenger,
C.R. Snell, and
Y.P. Loh.
1995.
Identification of the
sorting signal motif within pro-opiomelanocortin for the regulated secretory
pathway.
J. Biol. Chem.
270:
8723-8729
|
19. | Cool, D.R., E. Normant, F.-S. Shen, H.-C. Chen, L. Pannell, Y. Zhang, and Y.P. Loh. 1997. Carboxypeptidase E is a regulated secretory pathway sorting receptor: genetic obliteration leads to endocrine disorders in Cpefat mice. Cell. 88: 73-83 |
20. | Edwards, R.H., M.J. Selby, W.C. Mobley, S.L. Weinrich, D.E. Hruby, and W.J. Rutter. 1988. Processing and secretion of nerve growth factor: expression in mammalian cells with a vaccinia virus vector. Mol. Cell. Biol. 8: 2456-2464 |
21. | Falkner, F.G., and B. Moss. 1988. Escherichia coli gpt gene provides dominant selection for vaccinia virus open reading frame expression vectors. J. Virol. 62: 1849-1854 |
22. | Gerdes, H.-H., and W.B. Huttner. 1995. Chromogranin B. A. Haeberli, editor, VCH Verlagsges. mbH, Weinheim 3rd Installment. |
23. |
Gerdes, H.-H.,
P. Rosa,
E. Phillips,
P.A. Baeuerle,
R. Frank,
P. Argos, and
W.B. Huttner.
1989.
The primary structure of human secretogranin II, a
widespread tyrosine-sulfated secretory granule protein that exhibits low pH-
and calcium-induced aggregation.
J. Biol. Chem.
264:
12009-12015
|
24. | Gorr, S.-U., J. Shioi, and D.V. Cohn. 1989. Interaction of calcium with porcine adrenal chromogranin A (secretory protein-I) and chromogranin B (secretogranin I). Am. J. Physiol. 257: 247-254 . |
25. | Hänggi, M., W. Bannwarth, and H.G. Stunnenberg. 1986. Conserved TAAAT motif in vaccinia virus late promotors: overlapping TATA box and site of transcription initiation. EMBO (Eur. Mol. Biol. Organ.) J. 5: 1071-1076 [Abstract]. |
26. | Heumann, R., V. Kachel, and H. Thoenen. 1983. Relationship between NGF-mediated volume increase and "priming effect" in fast and slow reacting clones of PC12 pheochromocytoma cells. Exp. Cell Res. 145: 179-190 |
27. | Hruby, D.E., G. Thomas, E. Herbert, and C.A. Franke. 1986. Use of vaccinia virus as a neuropeptide expression vector. Methods Enzymol. 124: 295-309 |
28. | Huttner, W.B., H.-H. Gerdes, and P. Rosa. 1991. The granin (chromogranin/ secretogranin) family. Trends Biochem. Sci. 16: 27-30 |
29. | Iacangelo, A.L., M. Grimes, and L.E. Eiden. 1991. The bovine chromogranin A gene: structural basis for hormone regulation and generation of biologically active peptides. Mol. Endocrinol. 5: 1651-1660 [Abstract]. |
30. | Kaether, C., T. Salm, M. Glombik, W. Almers, and H.-H. Gerdes. 1997. Targeting of green fluorescent protein to neuroendocrine secretory granules: a new tool for real time studies of regulated protein secretion. Eur. J. Cell Biol. 74: 133-142 |
31. | Kizer, J.S., and A. Tropsha. 1991. A motif found in propeptides and prohormones that may target them to secretory vesicles. Biochem. Biophys. Res. Commun. 174: 586-592 |
32. | Kuliawat, R., and P. Arvan. 1992. Protein targeting via the "constitutive-like" secretory pathway in isolated pancreatic islets: passive sorting in the immature granule compartment. J. Cell Biol. 118: 521-529 [Abstract]. |
33. | Laemmli, U.K.. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227: 680-685 |
34. |
Lee, R.W., and
W.B. Huttner.
1983.
Tyrosine-O-sulfated proteins of PC12
pheochromocytoma cells and their sulfation by a tyrosylprotein sulfotransferase.
J. Biol. Chem.
258:
11326-11334
|
35. |
Leitinger, B.,
J.L. Brown, and
M. Spiess.
1994.
Tagging secretory and membrane proteins with a tyrosine sulfation site.
J. Biol. Chem.
269:
8115-8121
|
36. | Matsuuchi, L., and R.B. Kelly. 1991. Constitutive and basal secretion from the endocrine cell line, AtT-20. J. Cell Biol. 112: 843-852 [Abstract]. |
37. | Moss, B.. 1968. Inhibition of HeLa cell protein synthesis by the vaccinia virion. J. Virol. 2: 1028-1037 |
38. |
Mouland, A.J.,
S. Bevan,
J.H. White, and
G.N. Hendy.
1994.
Human chromogranin A Gene.
J. Biol. Chem.
269:
6918-6926
|
39. |
Natori, S., and
W.B. Huttner.
1996.
Chromogranin B (secretorgranin I) promotes sorting to the regulated secretory pathway of processing intermediates derived from a peptide hormone precursor.
Proc. Natl. Acad. Sci. USA.
93:
4431-4436
|
40. | Owen, M.C., and R.W. Carrell. 1992. Alpha-1-proteinase inhibitor. A. Haeberli, ed., VCH Verlagsges. mbH, Weinheim 1. Installment. |
41. |
Palmer, D.J., and
D.L. Christie.
1992.
Identification of molecular aggregates
containing glycoproteins III, J, K (carboxypeptidase H), and H (Kex2-
related proteases) in the soluble and membrane fractions of adrenal medullary chromaffin granules.
J. Biol. Chem.
267:
19806-19812
|
42. | Pogo, B.G.T., and S. Dales. 1971. Biogenesis of vaccinia: separation of early stages from maturation by means of hydroxyurea. Virology. 43: 144-151 |
43. | Pohl, T.M., E. Phillips, K. Song, H.-H. Gerdes, W.B. Huttner, and U. Rüther. 1990. The organisation of the mouse chromogranin B (secretogranin I) gene. FEBS Lett. 262: 219-224 |
44. | Powell, S.K., L. Orci, C.S. Craik, and H.-P.H. Moore. 1988. Efficient targeting to storage granules of human proinsulins with altered propeptide domain. J. Cell Biol. 106: 1843-1851 [Abstract]. |
45. | Rosa, P., and H.-H. Gerdes. 1994. The granin protein family: markers for neuroendocrine cells and tools for the diagnosis of neuroendocrine tumors. J. Endocrinol. Invest. 17: 207-225 |
46. | Rosa, P., U. Weiß, R. Pepperkok, W. Ansorge, C. Niehrs, E. H. K. Stelzer, and W. B. Huttner. 1989. An antibody against secretogranin I (chromogranin B) is packaged into secretory granules. J. Cell Biol. 109: 17-34 [Abstract]. |
47. |
Rosa, P.,
M. Bassetti,
U. Weiß, and
W.B. Huttner.
1992.
Widespread occurrence
of chromogranins/secretogranins in the matrix of secretory granules of endocrinologically silent pituitary adenomas.
J. Histochem. Cytochem.
40:
523-533
|
48. | Roy, P., D. Chevrier, H. Fournier, C. Racine, M. Zollinger, P. Crine, and G. Boileau. 1991. Investigation of a possible role of the amino-terminal pro- region of proopiomelanocortin in its processing and targeting to secretory granules. Mol. Cell. Endocrinol. 82: 237-250 |
49. | Schmelz, M., B. Sodeik, M. Ericcson, E.J. Wolffe, H. Shida, G. Hiller, and G. Griffiths. 1994. Assembly of vaccinia virus: the second wrapping cisterna is derived from the trans golgi network. J. Virol. 68: 130-147 [Abstract]. |
50. | Seethaler, G., M. Chaminade, R. Vlasak, M. Ericsson, G. Griffiths, O. Toffoletto, J. Rossier, H.G. Stunnenberg, and G. Kreil. 1991. Targeting of frog prodermorphin to the regulated secretory pathway by fusion to proenkephalin. J. Cell Biol. 114: 1125-1133 [Abstract]. |
51. |
Sevarino, K.A., and
P. Stork.
1991.
Multiple preprosomatostatin sorting signals
mediate secretion via discrete cAMP- and tetradecanoylphorbolacetate-
responsive pathways.
J. Biol. Chem.
266:
18507-18513
|
52. | Sevarino, K.A., P. Stork, R. Ventimiglia, G. Mandel, and R.H. Goodman. 1989. Amino-terminal sequences of prosomatostatin direct intracellular targeting but not processing specificity. Cell. 57: 11-19 |
53. | Sodeik, B., R.W. Doms, M. Ericsson, G. Hiller, C.E. Machamer, W. van't Hof, G. van Meer, B. Moss, and G. Griffiths. 1993. Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the golgi stacks. J. Cell Biol. 121: 521-541 [Abstract]. |
54. |
Stoller, T.J., and
D. Shields.
1989.
The propeptide of presomatostatin mediates
intracellular transport and secretion of ![]() |
55. | Tam, W.W.H., K.I. Andreasson, Y. Peng, and Loh. 1993. The amino-terminal sequence of pro-opiomelanocortin directs intracellular targeting to the regulated secretory pathway. Eur. J. Cell Biol. 62: 294-306 |
56. | Thomas, G., E. Herbert, and D.E. Hruby. 1986. Expression and cell type-specific processing of human preproenkephalin with a vaccinia recombinant. Science. 232: 1641-1643 |
57. | Thomas, G., B.A. Thorne, L. Thomas, R.G. Allen, D.E. Hruby, R. Fuller, and J. Thorner. 1988. Yeast KEX2 endopeptidase correctly cleaves a neuroendocrine prohormone in mammalian cells. Science. 241: 226-230 |
58. | Tooze, S.A., and W.B. Huttner. 1990. Cell-free protein sorting to the regulated and constitutive secretory pathways. Cell. 60: 837-847 |
59. | Tooze, S.A., and W.B. Huttner. 1992. Cell-free formation of immature secretory granules and constitutive secretory vesicles from the trans-Golgi network. Methods Enzymol. 219: 81-93 |
60. | Tooze, S.A., T. Flatmark, J. Tooze, and W.B. Huttner. 1991. Characterization of the immature secretory granule, an intermediate in granule biogenesis. J. Cell Biol. 115: 1491-1503 [Abstract]. |
61. | Tooze, S.A., E. Chanat, J. Tooze, and W.B. Huttner. 1993. Secretory granule formation. In Mechanisms of Intracellular Trafficking and Processing of Proproteins. Y. Peng Loh, editor. CRC Press, Boca Raton. 157-177. |
62. | von Brunn, A., K. Früh, H. Stunnenberg, and H. Bujard. 1988. 22 nm-like particles of the hepatitis B surface antigen containing epitopes of p190 of P. falciparum. In Technologicial Advances in Vaccine Development. Alan R. Liss, Inc. 167-173. |
63. |
Wu, H.-J.,
D.J. Rozansky,
R.J. Parmer,
B.M. Gill, and
D.T. O'Connor.
1991.
Structure and function of the chromogranin A gene.
J. Biol. Chem.
266:
13130-13134
|
64. |
Yoo, S.H..
1996.
pH- and Ca2+-dependent aggregation property of secretory
vesicle matrix proteins and the potential role of chromogranins A and B in
secretory vesicle biogenesis.
J. Biol. Chem.
271:
1558-1565
|
65. |
Yoo, S.H., and
J.P. Albanesi.
1990.
Ca2+-induced conformational change and
aggregation of chromogranin A.
J. Biol. Chem.
265:
14414-14421
|