Article |
2 Head and Neck Service, Department of Surgery, Sloan-Kettering Institute for Cancer Research, Memorial Sloan-Kettering Cancer Center, New York, NY 10021
3 Department of Pediatrics, New York University School of Medicine, New York, New York 10016
Address correspondence to Filippo G. Giancotti Cellular Biochemistry and Biophysics Program, Memorial Sloan-Kettering Cancer Center, Box 216, 1275 York Ave., New York, NY 10021. Tel.: (212) 639-6998. Fax: (212) 794-6236. E-mail: f-giancotti{at}ski.mskcc.org
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: 6ß4; fyn; EGF-R; hemidesmosomes; carcinoma invasion
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The 6ß4 integrin is a laminin 5 receptor expressed in epithelial, Schwann, endothelial, and double-negative T cells (Giancotti, 1996; Borradori and Sonnenberg, 1999). In the basal cells of stratified and transitional epithelia,
6ß4 is concentrated at hemidesmosomes, adhesive junctions connected to the keratin cytoskeleton (Carter et al., 1990; Sonnenberg et al., 1991). In addition to
6ß4, hemidesmosomes contain the transmembrane element bullous pemphigoid antigen (BPAG)*-2, which is thought to interact with an unknown basement membrane component. Inside the cell,
6ß4 and BPAG-2 interact as a functional unit with two plakins, plectin/HD-1 and BPAG-1, that form the inner plaque of hemidesmosomes and link to the keratin cytoskeleton (Rezniczek et al., 1998; Schaapveld et al., 1998; Geerts et al., 1999; Hopkinson and Jones, 2000). Although genetic analyses suggest that these proteins are essential to build the core structure of hemidesmosomes (Guo et al., 1995; McGrath et al., 1995; Dowling et al., 1996; Smith et al., 1996; van der Neut et al., 1996; Andra et al., 1997; Ryan et al., 1999), they are not sufficient to account for the dynamic regulation of these junctions. In particular, it is known that the hemidesmosomes are disassembled during keratinocyte migration, presumably in response to activation of the EGF receptor (EGF-R) (Gipson et al., 1993; Mainiero et al., 1996). In addition, squamous carcinoma cells often lack hemidesmosomes in vivo (Schenk, 1979). Because hemidesmosomes mediate stable adhesion, their disruption may be a prerequisite for both normal migration and cancer invasion. The mechanisms and regulatory components mediating the disassembly of hemidesmosomes are poorly understood.
The 6ß4 integrin is characterized by the uniquely large cytoplasmic domain of its ß4 subunit, which appears to interact directly with both BPAG-2 and plectin/HD-1, and which is necessary for the assembly of hemidesmosomes (Murgia et al., 1998; Schaapveld et al., 1998). Recent studies have revealed that
6ß4 has also a signaling function. The integrin is associated with a tyrosine kinase and becomes phosphorylated on several tyrosine residues upon binding to laminin 5 or activation of the EGF-R (Mainiero et al., 1995; Mainiero et al., 1996). Tyrosine phosphorylation of ß4 promotes recruitment of the signaling adaptor protein Shc. Upon tyrosine phosphorylation, Shc binds to the Grb2/mSOS complex and activates Ras and, hence, both the Rafextracellular signal-regulated kinase (ERK) and phosphatidyl inositol-3 kinase (PI-3K)-Rac-JNK signaling cascades (Mainiero et al., 1997). Analysis of mice carrying a targeted deletion of the ß4 cytoplasmic domain has indicated that this portion of the integrin is essential for both assembly of hemidesmosomes and activation of growth promoting signaling pathways (Murgia et al., 1998). Although signaling and assembly of hemidesmosomes by
6ß4 are temporally distinguishable events, the relationship between the structural and signaling function of
6ß4 is currently unclear.
We have shown previously that treatment of normal keratinocytes with EGF induces tyrosine phosphorylation of the cytoplasmic domain of ß4 and disruption of hemidesmosomes (Mainiero et al., 1996). Others have suggested that protein kinase C may play a role in this process (Rabinovitz et al., 1999). Because the EGF-R and the 6ß4 integrin are often overexpressed in highly invasive squamous carcinomas (Kimmel and Carey, 1986; Yamamoto et al., 1986; Tennenbaum et al., 1996), we have examined the effect of EGF-R activation on
6ß4 function in squamous carcinoma cells. The results reported here indicate that a fraction of EGF-R combines with
6ß4 and, through the tyrosine kinase Fyn, induces phosphorylation of the ß4 tail and disruption of hemidesmosomes. Inhibition of Fyn increases the assembly or stability of hemidesmosomes and suppresses migration and invasion by squamous carcinoma cells. These findings suggest that the disassembly of hemidesmosomes mediated by Fyn is a prerequisite for normal cell migration and tumor invasion.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
As shown in Fig. 1, treatment with EGF caused tyrosine phosphorylation of ß4 in HaCaT and MSK-QLL-1 cells, and it increased the extent to which ß4 was already phosphorylated in A431 cells. The basal phosphorylation of ß4 observed in A431 cells may be a consequence of the constitutive activation of the EGF-R in these cells (Van de Vijver et al., 1991). We noticed that a tyrosine phosphorylated protein with an apparent molecular mass similar to that of EGF-R coimmunoprecipitated with 6ß4 from both MSKQLL-1 and A431 cells (Fig. 1). Prolonged exposure of the blot revealed a similar band also in ß4 immunoprecipitates from HaCaT keratinocytes. Immunoblotting with specific antibodies identified this protein as the EGF-R and provided evidence that a small but significant fraction of this receptor is associated with
6ß4 in all three cell lines (Fig. 1). Densitometric analysis indicated that
1% of total EGF-R was coimmunoprecipitated with
6ß4 from HaCaT keratinocytes and
2% from the squamous carcinoma cell lines. Control experiments indicated that neither normal mouse IgGs nor the anti-MHC monoclonal antibody W6.32 coprecipitated the EGF-R. Although
6ß4 combines with the EGF-R family member ErbB-2 in breast carcinoma cells which overexpress both molecules (Falcioni et al., 1997), and to a much smaller extent in HaCaT cells (Hintermann et al., 2001), we were unable to detect such an association under our experimental conditions (see Materials and methods) (Fig. 1). These results suggest that a fraction of EGF-R associates specifically with
6ß4 and induces phosphorylation of the ß4 cytoplasmic domain.
|
Because the EGF-R does not phosphorylate efficiently fusion proteins derived from the cytoplasmic domain of ß4 in vitro (Mainiero et al., 1997), we asked if the EGF-R promotes phosphorylation of ß4 by activating an intermediary kinase. It is known that the EGF-R can interact with and activate Src family kinases (Biscardi et al., 1999). In addition, our previous results had suggested that 6ß4 is associated with a Src family kinase (Mainiero et al., 1995). Thus, we examined the role of Src kinases in EGF-Rinduced phosphorylation of ß4. As shown in Fig. 2 A, the two Src kinase inhibitors, PP1 and PP2, which display a higher affinity for Fyn than Src in vitro (Hanke et al., 1996), suppressed tyrosine phosphorylation of ß4 in HaCaT keratinocytes treated with EGF. The effect of the two compounds was dose-dependent and specific, as both did not interfere with the activation and autophosphorylation of EGF-R. These results suggest that EGF-Rinduced phosphorylation of ß4 is mediated by a Src family kinase.
|
To identify the Src kinase(s) associated with 6ß4, we performed immunoprecipitation and immunoblotting experiments in several epithelial cell lines. We varied extraction conditions and used antibodies reacting specifically with Src, Fyn, or Yes, either in the immunoprecipitation or the immunoblotting step of the coprecipitation assay. Despite several attempts, we were unable to detect a specific association of Src, Fyn, or Yes with
6ß4 in cells expressing endogenous levels of Src kinases. We suspect that this negative result is due to the low stoichiometry or relative instability of the association of
6ß4 with Src kinases and the low affinity of currently available antibodies reacting specifically with each Src kinase.
To overcome these problems, we decided to use an overexpression approach. 293-T HEK cells were transfected with vectors directing the expression of 6ß4 and each one of several cytoplasmic tyrosine kinases. Preliminary experiments of immunoprecipitation followed by kinase assay and V8 peptide mapping indicated that
6ß4 coprecipitated with Fyn, but to a much lesser or no extent with Src, Abl, focal adhesion kinase (FAK), or JAK1. No association of
6ß1 with Fyn was detected by using the same assay (unpublished data), suggesting that
6ß4 interacts with Fyn through the ß4 subunit.
To further examine the association of 6ß4 with Src kinases, 293-T cells were transfected with vectors directing the expression of
6ß4 and wild-type or mutant versions of the Src family kinases known to be expressed in keratinocytes, namely Fyn, Src, and Yes (Fig. 3 A). To verify that each kinase was expressed at an equivalent level, we probed total lysates by immunoblotting with anti-Fyn and anti-panSrc (Fig. 3 B). Prior experiments had shown that this antibody displays similarly high affinity for recombinant Src and Fyn and reacts less efficiently with recombinant Yes (Fig. S1). The transfectants were subjected to immunoprecipitation and immunoblotting analysis. The results indicated that Fyn and, to a somewhat more limited extent Yes, associate with
6ß4. By contrast, Src combined with
6ß4 much less efficiently (Fig. 3 B).
|
To examine the sequences of ß4 required for the association with Fyn, 293 T cells were transfected with various deletion mutants of ß4 (Fig. 3 A) in combination with wild-type Fyn. Immunoprecipitation and immunoblotting analysis indicated that a recombinant ß4 subunit lacking almost the entire COOH-terminal domain, which includes all Fn-III repeats (mutant C), associated with Fyn as efficiently as wild-type ß4 (molecule A). By contrast, recombinant forms of ß4 lacking the entire (mutant L), or almost the entire, cytoplasmic domain of ß4 (mutant B) did not combine with Fyn (Fig. 3 C). These observations indicate that the membrane proximal portion of the cytoplasmic domain of ß4, comprising amino acid residues 8541183, is required for association with Fyn.
Taken together, these results indicate that Fyn interacts specifically with 6ß4, and that this interaction requires the membrane-proximal NH2-terminal segment of Fyn and the corresponding portion of the cytoplasmic domain of ß4.
Fyn mediates EGF-Rinduced phosphorylation of ß4 and disruption of hemidesmosomes
To examine the role of Fyn in regulation of hemidesmosomes, we used the rat bladder carcinoma 804G cells, which form relatively well structured hemidesmosome-like adhesions in vitro (Riddelle et al., 1991). 804G clones stably expressing a dominant negative (kinase dead) form of Fyn or a corresponding mutant version of Src were generated. Immunoblotting with anti-Fyn indicated that the clones F1, 2, and 3 express levels of kinase-dead Fyn significantly higher than those of endogenous wild-type Fyn in control clone C1 (Fig. 4 A). Similar results were obtained with the clones S1 and 2, which express dominant negative Src (Fig. 4 A). Endogenous Fynand Src in clone C1 were detected only upon overexposure of the blot. Densitometric analysis of films exposed for different times indicated that kinase-dead Src and Fyn were similarly overexpressed as compared to the levels of corresponding wild-type endogenous proteins (unpublished data). In addition, immunoblotting with anti-panSrc, which reacts with Src slightly better than wth Fyn (Fig. S1), indicated that kinase-dead Src was expressed at levels somewhat higher than kinase-dead Fyn (Fig. 4 A).
|
We next evaluated the effect of dominant negative Fyn and Src on hemidesmosomes. At the immunofluorescent microscope, hemidesmosomes appear as punctuate structures, which tend to coalesce around circular areas of unknown composition. The resulting staining is commonly referred to as "swiss cheese"like. As shown in Fig. 5, staining with antibodies to BPAG-2 revealed that 804G clones expressing dominant negative Fyn display a significantly higher number of hemidesmosomes than control cells. The clones expressing dominant negative Src did not have an increased number of hemidesmosomes; however, these junctions tended to be somewhat more clustered than in control cells. Similar results were obtained after staining with antibodies to ß4 (unpublished data). Treatment with EGF caused an almost complete disruption of hemidesmosomes in control cells and clones expressing dominant negative Src. By contrast, the hemidesmosomes of clones expressing dominant negative Fyn were resistant to the effect of EGF to a significant extent (Fig. 5). Parental 804G cells and HaCaT keratinocytes treated with PP2 displayed a similar stabilization of hemidesmosomes (unpublished data). These results imply that Fyn prevents the assembly and/or causes disassembly of hemidesmosomes and this effect requires the catalytic activity of the kinase.
|
|
|
Next, we sought to verify that dominant negative Fyn prevented tyrosine phosphorylation of ß4 and stabilized hemidesmosomes also in A431 cells. As shown in Fig. 8 A, EGF treatment caused significant tyrosine phosphorylation of ß4 in the control clone, but not in those expressing dominant negative Fyn. In addition, whereas A431 clones expressing dominant negative Fyn were able to form numerous hemidesmosome-like adhesions upon plating on a laminin 5 matrix, control cells were much less able to do so (Fig. 8 B). Finally, clones expressing dominant negative Fyn migrated into an artificial wound and invaded through Matrigel less efficiently than control clones (Fig. 8 C). These results indicate that dominant negative Fyn stabilizes hemidesmosomes and suppresses migration and Matrigel invasion by A431 squamous carcinoma cells.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Previous studies have indicated that cell migration and invasion require assembly of focal adhesions and stress fibers at the leading edge of the cell and their disassembly at the trailing edge (Horwitz and Parsons, 1999). These processes are jointly regulated by ß1 and v integrins and by growth factor receptors through the focal adhesion kinase FAK (Sieg et al., 2000) and the adaptor protein Shc (Collins et al., 1999; Gu et al., 1999). Upon activation, FAK combines with Src, which phosphorylates a number of focal adhesion components, including p130CAS and paxillin (Giancotti and Ruoslahti, 1999). Genetic evidence implies that Src signaling stimulates cell migration by promoting spreading of the leading edge and turnover of focal adhesions at the trailing edge (Kaplan et al., 1995; Fincham and Frame, 1998; Klinghoffer et al., 1999). Shc is activated by Fyn and possibly other palmitoylated Src family kinases (Wary et al., 1998) and plays a role in cell migration through activation of ERK and disassembly of focal adhesions (Collins et al., 1999; Gu et al., 1999). In addition to, or instead of, focal adhesions, many epithelial cells form hemidesmosomes. Our results argue that their disassembly in response to activation of the EGF-R and phosphorylation of the ß4 tail is required for epithelial cell migration and invasion.
What is the mechanism by which EGF causes phosphorylation of the ß4 cytoplasmic domain? Our results indicate that a fraction of EGF-R associates with 6ß4 and induces phosphorylation of the ß4 cytoplasmic domain through the Src family kinase Fyn (Fig. 9). Dominant negative studies suggest that Src can not replace Fyn in this pathway. This is most likely because Fyn combines with
6ß4, but Src does so much less efficiently. By contrast, Yes combines relatively efficiently with
6ß4. The NH2-terminal domains of both Fyn and Yes are known to be palmitoylated and we have observed that the association of Fyn with
6ß4 requires this lipid modification. It is likely that the association of Yes with
6ß4 similarly requires palmitoylation of the kinase.
|
Our mutagenesis results indicate that the association of 6ß4 with Fyn requires the membrane proximal segment of the cytoplasmic domain of ß4, but not the SH2 domain, the SH3 domain, or the enzymatic function of Fyn, suggesting that palmitoylation of
6ß4 and Fyn may be required but not sufficient to mediate the interaction between the two molecules. It is likely that the membrane proximal portion of the cytoplasmic domain of ß4 and the NH2-terminus of Fyn establish a proteinprotein interaction. However, future studies will be required to identify more precisely the protein sequences involved in this interaction. In addition, although our data are most consistent with the hypothesis that Fyn interacts with and phosphorylates ß4 directly, this remains to be established formally.
The cytoplasmic domain of ß4 has both a signaling and a cytoskeletal function. What is the relationship between these two functions? Ligation of 6ß4 causes a rapid phosphorylation of the ß4 tail, followed by recruitment of Shc and activation of ERK (Mainiero et al., 1995, 1997). In addition, there is evidence that
6ß4 activates PI-3K, either through Ras or IRS-1 and 2, rapidly (Mainiero et al., 1997; Shaw et al., 1997; Shaw, 2001). Finally, our results suggest that the EGF-R can activate
6ß4 signaling, by acting on Fyn, with a similarly rapid kinetics. By contrast, assembly of hemidesmosomes is a much slower process, at least in cultured cells (Riddelle et al., 1991). In addition, because exposure to EGF induces both phosphorylation of ß4 and disruption of hemidesmosomes, it is likely that
6ß4-dependent signaling and nucleation of hemidesmosomes are mutually exclusive processes. It is possible that phosphorylation of ß4 by Fyn prevents incorporation of
6ß4 in hemidesmosomes (Fig. 9).
Previous studies have indicated that mutation of the four tyrosine residues in ß4 necessary for binding to Shc prevents disassembly of hemidesmosomes in cells exposed to the tyrosine phosphatase inhibitor pervanadate (Dans et al., 2001). However, this mutation does not interfere with hemidesmosome disruption in response to EGF in both 804G cells (Dans et al., 2001), and in keratinocytes (unpublished data). It is possible that EGF prevents assembly of hemidesmosomes by promoting phosphorylation of additional tyrosine residues, as suggested by the fact that mutation of the four tyrosines necessary for binding to Shc reduces but does not suppress tyrosine phosphorylation of ß4 in response to EGF (unpublished data). In addition, it is known that the EGF-R activates PKC through PLC- (Chen et al., 1996), and there is evidence suggesting that inhibition of PKC prevents EGF-mediated disruption of hemidesmosomes (Rabinovitz et al., 1999). Thus, it is also possible that PKC contributes to disruption of hemidesmosomes by phosphorylating the ß4 tail on serine residues (Rabinovitz et al., 1999) or by contributing to the activation of Fyn (Shanmugam et al., 1998). Finally, although we did not detect tyrosine phosphorylation of BPAG-1 or -2, or plectin/HD-1 in cells treated with EGF (unpublished data), activation of the EGF-R could affect the function of other hemidesmosomal components or the stability of other interactions within hemidesmosomes.
Introduction of 6ß4 in breast carcinoma cells that have lost its expression promotes activation of the PI-3KRac pathway and invasion through Matrigel (Shaw et al., 1997). Because it is well established that PI-3KRac signaling is important for tumor invasion (Keely et al., 1997), it is possible that, in addition to promoting disruption of hemidesmosomes and thus releasing the cell's brakes,
6ß4-associated Fyn promotes migration and invasion by activating the PI-3KRac pathway or signaling to ERK (Fig. 9).
In squamous carcinoma cells, the fraction of EGF-R associated with 6ß4 appears to be activated even in the absence of exogenous EGF. Hence, these cells display enhanced tyrosine phosphorylation of ß4 and reduced ability to assemble hemidesmosomes. These observations imply that the signaling pathway that prevents assembly of hemidesmosomes is constitutively activated in squamous carcinoma cells. Dominant negative Fyn suppresses the ability of these cells to migrate and invade both in vitro and in vivo suggesting that disruption of hemidesmosomes is required for carcinoma invasion. Because in our experimental metastasis assay the cells were injected directly into the blood stream, Fyn is probably required in one or more steps of the extravasation process, perhaps traversal of the endothelial basement membrane and/or underlying interstitial matrix. To our knowledge, our study provides the first evidence that inhibition of a Src family kinase suppresses a complex phenomenon such as metastasis. It is plausible that strategies aimed at inhibiting the kinase activity of Fyn may be useful to control squamous carcinoma progression.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
All eucaryotic expression vectors were based on the cytomegalovirus promoter. Vectors encoding human 6, ß4, ß4 deletion mutants (B, C, L), Src, Fyn, Fyn
SH3, kinase-dead Fyn or Src, and the palmitoylation-defective Fyn mutant (FynC3,6S) have been described previously (Spinardi et al., 1993; Alland et al., 1994; Mainiero et al., 1997; Wary et al., 1998). The vector encoding Yes was provided by M. Sudol (Mount Sinai Medical School, New York, NY). The Fyn-SH2 point mutant (FynR176E) was generated by two-step PCR using the oligonucleotides 5'-ACCTTGCGTACGAGAGGA, 5'-TCACTCTCTTCGATAAGAAAG, 5'-TTTCTT-ATCGAAGAGAGTGAA, and 5'GATTCTCGAGGGATTTCCCAG; the PCR product was cloned into the SplI/XhoI sites of pRK5-c-Fyn. The chimera FynSrc (Fyn1-13/Src14-533) was generated by PCR with the oligonucleotides 5'-ATCGGATCC-GGAAATTTTGGAATTTAG and 5'-ATGCCGGCGTTTTGTTGCTTCTTTAT; the PCR product was cloned into the HindIII/NaeI site of pRK5-c-Src.
Antibodies and chemical compounds
The monoclonal antibody 3E1, reacting with the extracellular portion of human ß4, and the rabbit polyclonal antiserum to the COOH-terminal peptide of ß4, have been described previously (Giancotti et al., 1992). The rabbit polyclonal antiserum to the COOH-terminal of the EGF receptor was obtained from J. Schlessinger (New York University School of Medicine, New York, NY). The affinity- purified rabbit polyclonal antibodies to Fyn (FYN3), Src (N-16), Src kinases (anti-pan Src SRC2), and ErbB-2 (C-18), and the mouse monoclonal antibody to the EGF-R (528) were from Santa Cruz Biotechnology, Inc. The anti-phosphotyrosine monoclonal antibody RC20 was from BD Transduction Laboratories. The rabbit antiserum ß4-exo, reacting with the extracellular portion of ß4, and affinity-purified rabbit antibodies to BPAG2 have been described previously (Murgia et al., 1998). The Src kinase inhibitors PP1, PP2 (Calbiochem), and Herbimycin A (GIBCO BRL), the PI-3K inhibitor LY 294002 (Biomol), and the p38 kinase inhibitor SB203580 (Stratagene) were dissolved in DMSO and further diluted in culture medium.
Biochemical methods
Prior to treatment with EGF (25 ng/ml, 4 min) (Intergen), HaCaT and MSK-QLL-1 cells were serum starved overnight; A431 cells were starved for 40 h. The cells were then lysed in TX-DOC lysis buffer (50 mM Hepes, 150 mM NaCl, 4 mM EDTA, 1 mM EGTA, 1% Triton X-100, and 0.5% sodium deoxycolate) containing 1 mM sodium orthovanadate, 20 mM sodium pyrophosphate, 100 mM NaF, 0.02% aprotinin, 20 µg/ml leupeptin, and 4 µg/ml pepstatin A (all from Sigma-Aldrich). 804G cells were stimulated with 50 ng/ml EGF for 4 min and lysed in modified RIPA buffer (50 mM Hepes, 150 mM NaCl, 4 mM EDTA, 1 mM EGTA, 10% glycerol, 1% Triton X-100, 1% sodium deoxycolate, and 0.1% sodium dodecylsulfate) containing protease and phosphatase inhibitors as above. 293-T cells were lysed in modified RIPA buffer. The Src family kinase inhibitors PP1 and PP2 were added to the culture medium at the indicated concentrations, and cells were incubated for 15 min at 37°C before the addition of EGF. Immunoprecipitation and immunoblotting were performed as described previously (Mainiero et al., 1995). To avoid aspecific binding of the EGF-R to the beads during immunoprecipitation experiments, cell lysates were precleared with protein A Agarose (Upstate Biotechnology) and normal Mouse IgGs (Sigma-Aldrich) covalently linked to CNBr-activated SepharoseTM 4B (Amersham Pharmacia Biotech) for 1.5 h at 4°C. After centrifugation, the supernatants were immunoprecipitated using the 3E1 monoclonal antibody covalently linked to CNBr-activated beads. The immobilized immunocomplexes were washed extensively in lysis buffer before SDS-PAGE. To cross-link the antibodies to the Sepharose beads, the antibodies were dialyzed in Spectra/Por MWCO:68,000 dialysis bags (Spectrum Medical Industries) against coupling buffer (carbonate-bicarbonate buffer, pH 9.2, 0.5 M NaCl) overnight at 4°C. CNBr-activated Sepharose beads (400 mg/5 mg of antibody) were incubated in 1 mM HCl for 15 min at room temperature. The beads were then washed with 1 mM HCl and then once in coupling buffer before incubation with the antibody. The suspension was incubated overnight at 4°C on a rotator, then spun down, and the pellet was washed two times in 0.1 M Tris HC, pH 8, containing 0.5 M NaCl, and stored in TBS at 4°C. The efficiency of cross-linking was checked by measuring the concentration of the dialyzed antibody before and after incubation with the activated beads. This method allows to minimize the amount of beads used (about 10 µl/sample) and to use high quantities of antibody (2530 µg/sample).
Immunofluorescence
804G clones were plated on glass coverslips for 24 h and then treated with EGF (50 ng/ml) in serum-free medium. The cells were permeabilized in 0.2% Triton X-100 in PBS for 4 min on ice and fixed with cold methanol for 10 min. A431 clones were plated on glass coverslips coated with the laminin 5 matrix deposited by RAC-11P/SD cells (Sonnenberg et al., 1993) for 48 h before permeabilization and fixation. The cells were incubated for 1 h with the primary antibody, washed with 0.1% Triton X-100 in PBS, and then stained with FITC-conjugated goat antimouse or goat antirabbit IgGs (Jackson ImmunoResearch Laboratories) for 45 min. After washing, the coverslips were mounted in Citifluor mounting medium (Ted Pella).
In vitro wound assay and invasion assay
After overnight starvation, wounds were made on confluent cell monolayers with a plastic tip. 804G cells were stimulated with EGF (50 ng/ml) for 5 or 10 h, and A431 cells were treated with EGF (25 ng/ml) for 24 h, before staining in 0.25% crystal violet. To quantify cell migration, three randomly chosen regions of a wound (1 mm long) were photographed at a magnification of 40X; a mean wound width was measured every 20 µm, and an average percent wound closure was calculated. Three independent wounds were examined per sample and a mean percent wound closure was calculated.
For in vitro invasion assays, 50 µl of Matrigel (Collaborative Biomedical Products) (1 mg/ml in serum-free DME) was allowed to gelify on the upper side of the filter (8 µm pore size) in a Transwell chamber (Corning Costar Corp.) at 37°C for 2 h. Cells were then plated on the Matrigel (80,000 cells per chamber in 100 µl of serum-free DME), let attach for 2 h, and the lower chamber was filled with serum-free medium containing EGF (25 ng/ml). After 24 h, the Matrigel and the cells that did not invade were removed from the upper side of the filter with a cotton swab, and the cells attached to the lower side of the filter were stained with crystal violet and counted. Each experiment was performed in triplicate. For invasion assays in presence of chemical inhibitors, cells were seeded on Matrigel and, when attached, the indicated compound was added to the medium. The inhibitor was present in the upper chamber for the entire duration of the assay; at the end of the assay, cell viability in the upper chamber was assessed by Trypan blue.
In vivo metastasis formation experiment
36-wk-old athymic nude mice (Nu/nu Harlan Sprague Dawley) were injected with 2 x 106 cells suspended in 200 µl of PBS. After 5 wk, the mice were sacrificed and their lungs removed, fixed in formalin, and paraffin-embedded. 8-µm sections were stained with Gill's hematoxylin and eosin, and examined for the presence of lung metastases.
Online supplemental material
Fig. S1 is available at http://www.jcb.org/cgi/content/full/jcb.200105017/DC1 and shows reactivity of the anti-pan Src antibodies with recombinant Fyn, Src, and Yes.
![]() |
Footnotes |
---|
P.A. Kedeshian's present address is UCLA Medical Center, Division of Head and Neck Surgery, Los Angeles, CA 90502.
L. Gagnoux-Palacios's present address is INSERM U385, Nice, France.
* Abbreviations used in this paper: BPAG, bullous pemphigoid antigen; ERK, extracellular signal-regulated kinase; FAK, focal adhesion kinase; ITAM, immunoreceptor tyrosine-based activation motif; PI-3K, phosphatidylinositol-3 kinase.
![]() |
Acknowledgments |
---|
This study was supported by National Institutes of Health grants R01 CA58976 (to F.G. Giancotti) and P30 CA08748 (to Memorial Sloan-Kettering Cancer Center). A. Mariotti was recipient of a fellowship from the American-Italian Cancer Foundation. F.G. Giancotti was an established investigator of the American Heart Association.
Submitted: 2 May 2001
Revised: 31 August 2001
Accepted: 21 September 2001
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alland, L., S.M. Peseckis, R.E. Atherton, L. Berthiaume, and M.D. Resh. 1994. Dual myristylation and palmitylation of Src family member p59fyn affects subcellular localization. J. Biol. Chem. 269:1670116705.
Andra, K., H. Lassmann, R. Bittner, S. Shorny, R. Fassler, F. Propst, and G. Wiche. 1997. Targeted inactivation of plectin reveals essential function in maintaining the integrity of skin, muscle, and heart cytoarchitecture. Genes Dev. 11:31433156.
Baldari, C.T., J.L. Telford, and O. Acuto. 2000. Lymphocyte antigen receptor and coreceptor signaling. Embo J. 19:48574865.
Biscardi, J.S., D.A. Tice, and S.J. Parsons. 1999. c-Src, receptor tyrosine kinases, and human cancer. Adv. Cancer Res. 76:61119.[Medline]
Borradori, L., and A. Sonnenberg. 1999. Structure and function of hemidesmosomes: more than simple adhesion complexes. J. Invest. Dermatol. 112:411418.
Boudreau, N., and M.J. Bissell. 1998. Extracellular matrix signaling: integration of form and function in normal and malignant cells. Curr. Opin. Cell Biol. 10:640646.[Medline]
Boukamp, P., R.T. Petrussevska, D. Breitkreutz, J. Hornung, A. Markham, and N.E. Fusenig. 1988. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 106:761771.[Abstract]
Brown, D.A., and E. London. 1998. Functions of lipid rafts in biological membranes. Annu. Rev. Cell. Dev. Biol. 14:111136.[Medline]
Carico, E., D. French, B. Bucci, R. Falcioni, A. Vecchione, and R. Mariani-Costantini. 1993. Integrin beta 4 expression in the neoplastic progression of cervical epithelium. Gynecol. Oncol. 49:6166.[Medline]
Carter, W.G., P. Kaur, S.G. Gil, P.J. Gahr, and E.A. Wayner. 1990. Distinct functions for integrins 3 ß1 in focal adhesions and
6 ß4/bullous pemphigoid antigen in a new stable anchoring contact (SAC) of keratinocytes: relation to hemidesmosomes. J. Cell Biol. 111:31413154.[Abstract]
Chen, P., H. Xie, and A. Wells. 1996. Mitogenic signaling from the egf receptor is attenuated by a phospholipase C-gamma/protein kinase C feedback mechanism. Mol. Biol. Cell. 7:871881.[Abstract]
Collins, L.R., W.A. Ricketts, L. Yeh, and D. Cheresh. 1999. Bifurcation of cell migratory and proliferative signaling by the adaptor protein Shc. J. Cell Biol. 147:15611568.
Costantini, R.M., R. Falcioni, P. Battista, G. Zupi, S.J. Kennel, A. Colasante, I. Venturo, C.G. Curio, and A. Sacchi. 1990. Integrin (alpha 6/beta 4) expression in human lung cancer as monitored by specific monoclonal antibodies. Cancer Res. 50:61076112.[Abstract]
Dans, M., L. Gagnoux-Palacios, P. Blaikie, S. Klein, A. Mariotti, and F.G. Giancotti. 2001. Tyrosine phosphorylation of the beta 4 integrin cytoplasmic domain mediates Shc signaling to extracellular signal-regulated kinase and antagonizes formation of hemidesmosomes. J. Biol. Chem. 276:14941502.
Dowling, J., Q.C. Yu, and E. Fuchs. 1996. ß4 integrin is required for hemidesmosome formation, cell adhesion and cell survival. J. Cell Biol. 134:559572.[Abstract]
Falcioni, R., A. Antonini, P. Nistico, S. Di Stefano, M. Crescenzi, P.G. Natali, and A. Sacchi. 1997. Alpha6beta4 and alpha6beta1 integrins associate with ErbB2 in human carcinoma cell lines. Exp. Cell Res. 236:7685.[Medline]
Fincham, V.J., and M.C. Frame. 1998. The catalytic activity of Src is dispensable for translocation to focal adhesions but controls the turnover of these structures during cell motility. EMBO J. 17:8192.
Geerts, D., L. Fontao, M.G. Nievers, R.Q. Schaapveld, P.E. Purkis, G.N. Wheeler, E.B. Lane, I.M. Leigh, and A. Sonnenberg. 1999. Binding of integrin 6ß4 to plectin prevents plectin association with F-actin but does not interfere with intermediate filamet binding. J. Cell Biol. 147:417434.
Giancotti, F.G. 1996. Signal transduction by the alpha 6 beta 4 integrin: charting the path between laminin binding and nuclear events. J. Cell Sci. 109:11651172.
Giancotti, F.G., and F. Mainiero. 1994. Integrin-mediated adhesion and signaling in tumorigenesis. Biochim. Biophys. Acta. 1198:4764.[Medline]
Giancotti, F.G., and E. Ruoslahti. 1999. Integrin signaling. Science. 285:10281032.
Giancotti, F.G., M.A. Stepp, S. Suzuki, E. Engvall, and E. Ruoslahti. 1992. Proteolytic processing of endogenous and recombinant ß4 integrin subunit. J. Cell Biol. 118:951959.[Abstract]
Gipson, I.K., S. Spurr-Michaud, A. Tisdale, J. Elwell, and M.A. Stepp. 1993. Redistribution of the hemidesmosome components alpha 6 beta 4 integrin and bullous pemphigoid antigens during epithelial wound healing. Exp. Cell Res. 207:8698.[Medline]
Gu, J., M. Tamura, R. Pankov, E.H. Danen, T. Takino, K. Matsumoto, and K.M. Yamada. 1999. Shc and FAK differentially regulate cell motility and directionality modulated by PTEN. J. Cell Biol. 146:389403.
Guo, L., L. Degenstein, J. Dowling, Q.C. Yu, R. Wollmann, B. Perman, and E. Fuchs. 1995. Gene targeting of BPAG1: abnormalities in mechanical strength and cell migration in stratified epithelia and neurologic degeneration. Cell. 81:233243.[Medline]
Hanke, J.H., J.P. Gardner, R.L. Dow, P.S. Changelian, W.H. Brissette, E.J. Weringer, B.A. Pollok, and P.A. Connelly. 1996. Discovery of a novel, potent, and Src family-selective tyrosine kinase inhibitor. Study of Lck- and FynT-dependent T cell activation. J. Biol. Chem. 271:695701.
Hintermann, E., M. Bilban, A. Sharabi, and V. Quaranta. 2001. Inhibitory role of 6ß4'''associated erbB-2 and phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on
3ß1 integrin. J. Cell Biol. 153:465478.
Hopkinson, S.B., and J.C. Jones. 2000. The N terminus of the transmembrane protein BP180 interacts with the N-terminal domain of BP230, thereby mediating keratin cytoskeleton anchorage to the cell surface at the site of the hemidesmosome. Mol. Biol. Cell. 11:277286.
Horwitz, A.R., and J.T. Parsons. 1999. Cell migrationmovin' on [comment]. Science. 286:11021103.
Izumi, K., Y. Hirao, L. Hopp, and R. Oyasu. 1981. In vitro induction of ornithine decarboxylase in urinary bladder carcinoma cells. Cancer Res. 41:405409.[Abstract]
Kaplan, K.B., J.R. Swedlow, D.O. Morgan, and H.E. Varmus. 1995. c-Src enhances the spreading of src-/- fibroblasts on fibronectin by a kinase-independent mechanism. Genes Dev. 9:15051517.[Abstract]
Keely, P.J., J.K. Westwick, I.P. Whitehead, C.J. Der, and L.V. Parise. 1997. Cdc42 and Rac1 induce integrin-mediated cell motility and invasiveness through PI(3)K. Nature. 390:632636.[Medline]
Kimmel, K.A., and T.E. Carey. 1986. Altered expression in squamous carcinoma cells of an orientation restricted epithelial antigen detected by monoclonal antibody A9. Cancer Res. 46:36143623.[Abstract]
Klinghoffer, R.A., C. Sachsenmaier, J.A. Cooper, and P. Soriano. 1999. Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 18:24592471.
Lin, C.R., W.S. Chen, W. Kruiger, L.S. Stolarsky, W. Weber, R.M. Evans, I.M. Verma, G.N. Gill, and M.G. Rosenfeld. 1984. Expression cloning of human EGF receptor complementary DNA: gene amplification and three related messenger RNA products in A431 cells. Science. 224:843848.[Medline]
Mainiero, F., C. Murgia, K.K. Wary, A.M. Curatola, A. Pepe, M. Blumemberg, J.K. Westwick, C.J. Der, and F.G. Giancotti. 1997. The coupling of alpha6beta4 integrin to Ras-MAP kinase pathways mediated by Shc controls keratinocyte proliferation. EMBO J. 16:23652375.
Mainiero, F., A. Pepe, K.K. Wary, L. Spinardi, M. Mohammadi, J. Schlessinger, and F.G. Giancotti. 1995. Signal transduction by the alpha 6 beta 4 integrin: distinct beta 4 subunit sites mediate recruitment of Shc/Grb2 and association with the cytoskeleton of hemidesmosomes. EMBO J. 14:44704481.[Abstract]
Mainiero, F., A. Pepe, M. Yeon, Y. Ren, and F.G. Giancotti. 1996. The intracellular functions of alpha6beta4 integrin are regulated by EGF. J. Cell Biol. 134:241253.[Abstract]
McGrath, J.A., B. Gatalica, A.M. Christiano, K. Li, K. Owaribe, J.R. McMillan, R.A. Eady, and J. Uitto. 1995. Mutations in the 180-kD bullous pemphigoid antigen (BPAG2), a hemidesmosomal transmembrane collagen (COL17A1), in generalized atrophic benign epidermolysis bullosa. Nat. Genet. 11:8386.[Medline]
Murgia, C., P. Blaikie, N. Kim, M. Dans, H.T. Petrie, and F.G. Giancotti. 1998. Cell cycle and adhesion defects in mice carrying a targeted deletion of the integrin beta4 cytoplasmic domain. EMBO J. 17:39403951.
Rabinovitz, I., A. Toker, and A.M. Mercurio. 1999. Protein kinase C-dependent mobilization of the alpha6beta4 integrin from hemidesmosomes and its association with actin-rich cell protrusions drive the chemotactic migration of carcinoma cells. J. Cell Biol. 146:11471160.
Reiss, M., E.B. Stash, V.F. Vellucci, and Z.L. Zhou. 1991. Activation of the autocrine transforming growth factor alpha pathway in human squamous carcinoma cells. Cancer Res. 51:62546262.[Abstract]
Rezniczek, G.A., J.A. de Pereda, S. Reipert, and G. Wiche. 1998. Linking integrin 6ß4-based cell adhesion to the intermediate filament cytoskeleton: direct interaction between the ß4 subunit and plectin at multiple sites. J. Cell Biol. 141:209225.
Riddelle, K.S., K.J. Green, and J.C. Jones. 1991. Formation of hemidesmosomes in vitro by a transformed rat bladder cell line. J. Cell Biol. 112:159168.[Abstract]
Ryan, M.C., K. Lee, Y. Miyashita, and W.G. Carter. 1999. Targeted disruption of the LAMA3 gene in mice reveals abnormalities in survival and late stage differentiation of epithelial cells. J. Cell Biol. 145:13091323.
Schaapveld, R.Q., L. Borradori, D. Geerts, M.R. van Leusden, I. Kuikman, M.G. Nievers, C.M. Niessen, R.D. Steenbergen, P.J. Snijders, and A. Sonnenberg. 1998. Hemidesmosome formation is initiated by the ß4 integrin subunit, requires complex formation of ß4 and HD1/plectin, and involves a direct interaction between ß4 and the bullous pemphigoid antigen 180. J. Cell Biol. 142:271284.
Schenk, P. 1979. The fate of hemidesmosomes in laryngeal carcinoma. Arch. Otorhinolaryngol. 222:187198.[Medline]
Serini, G., L. Trusolino, E. Saggiorato, O. Cremona, M. De Rossi, A. Angeli, F. Orlandi, and P.C. Marchisio. 1996. Changes in integrin and E-cadherin expression in neoplastic versus normal thyroid tissue. J. Natl. Cancer Inst. 88:442449.
Shanmugam, M., N.L. Krett, C.A. Peters, E.T. Maizels, F.M. Murad, H. Kawakatsu, S.T. Rosen, and M. Hunzicker-Dunn. 1998. Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16:16491654.[Medline]
Shaw, L.M. 2001. Identification of insulin receptor substrate 1 (IRS -1) and IRS-2 as signaling intermediates in the 6ß4 integrin-dependent activation of phosphoinositide 3-OH kinase and promotion of invasion. Mol. Cell Biol. 21:50825093.
Shaw, L.M., I. Rabinovitz, H.H. Wang, A. Toker, and A.M. Mercurio. 1997. Activation of phosphoinositide 3-OH kinase by the alpha6beta4 integrin promotes carcinoma invasion. Cell. 91:949960.[Medline]
Sieg, D.J., C.R. Hauck, D. Ilic, C.K. Klingbeil, E. Schaefer, C.H. Damsky, and D.D. Schlaepfer. 2000. FAK integrates growth-factor and integrin signals to promote cell migration. Nat. Cell. Biol. 2:249256.[Medline]
Smith, F.J., R.A. Eady, I.M. Leigh, J.R. McMillan, E.L. Rugg, D.P. Kelsell, S.P. Bryant, N.K. Spurr, J.F. Geddes, G. Kirtschig, G. Milana, A.G. de Bono, K. Owaribe, G. Wiche, L. Pulkkinen, J. Uitto, W.H. McLean, and E.B. Lane. 1996. Plectin deficiency results in muscular dystrophy with epidermolysis bullosa. Nat. Genet. 13:450457.[Medline]
Sonnenberg, A., J. Calafat, H. Daams, L.M. van der Raaij-Helmer, R. Falcioni, S.J. Aplin, J. Baker, M. Loizidou, et al. 1991. Integrin 6/ß4 complex is located in hemidesmosomes, suggesting a major role in epidermal cell-basement membrane adhesion. J. Cell Biol. 113:907917.[Abstract]
Sonnenberg, A., A.A. de Melker, A.M. Martinez de Velasco, H. Janssen, J. Calafat, and C.M. Niessen. 1993. Formation of hemidesmosomes in cells of a transformed murine mammary tumor cell line and mechanisms involved in adherence of these cells to laminin and kalinin. J. Cell Sci. 106:10831102.
Spinardi, L., Y.L. Ren, R. Sanders, and F.G. Giancotti. 1993. The beta 4 subunit cytoplasmic domain mediates the interaction of alpha 6 beta 4 integrin with the cytoskeleton of hemidesmosomes. Mol. Biol. Cell. 4:871884.[Abstract]
Tani, T., T. Karttunen, T. Kiviluoto, E. Kivilaakso, R.E. Burgeson, P. Sipponen, and I. Virtanen. 1996. Alpha 6 beta 4 integrin and newly deposited laminin-1 and laminin-5 form the adhesion mechanism of gastric carcinoma. Continuous expression of laminins but not that of collagen VII is preserved in invasive parts of the carcinomas: implications for acquisition of the invading phenotype. Am. J. Pathol. 149:781793.[Abstract]
Tennenbaum, T., A.J. Belanger, V. Quaranta, and S.H. Yuspa. 1996. Differential regulation of integrins and extracellular matrix binding in epidermal differentiation and squamous tumor progression. J. Investig. Dermatol. Symp. Proc. 1:157161.[Medline]
Van de Vijver, M.J., R. Kumar, and J. Mendelsohn. 1991. Ligand-induced activation of A431 cell epidermal growth factor receptors occurs primarily by an autocrine pathway that acts upon receptors on the surface rather than intracellularly. J. Biol. Chem. 266:7503-7508.
van der Neut, R., P. Krimpenfort, J. Calafat, C.M. Niessen, and A. Sonnenberg. 1996. Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nat. Genet. 13:366369.[Medline]
van't Hof, W., and M.D. Resh. 1997. Rapid plasma membrane anchoring of newly synthesized p59fyn: selective requirement for NH2-terminal myristoylation and palmitoylation at cysteine-3. J. Cell Biol. 136:10231035.
van't Hof, W., and M.D. Resh. 1999. Dual fatty acylation of p59(Fyn) is required for association with the T cell receptor zeta chain through phosphotyrosine-Src homology domain-2 interactions. J. Cell Biol. 145:377389.
Varner, J.A., and D.A. Cheresh. 1996. Integrins and cancer. Curr. Opin. Cell Biol. 8:724730.[Medline]
Wary, K.K., A. Mariotti, C. Zurzolo, and F.G. Giancotti. 1998. A requirement for caveolin-1 and associated kinase Fyn in integrin signaling and anchorage-dependent cell growth. Cell. 94:625634.[Medline]
Wolf, G.T., T.E. Carey, S.P. Schmaltz, K.D. McClatchey, J. Poore, L. Glaser, D.J. Hayashida, and S. Hsu. 1990. Altered antigen expression predicts outcome in squamous cell carcinoma of the head and neck. J. Natl. Cancer Inst. 82:15661572.[Abstract]
Xu, L., B.J. Davidson, V.V. Murty, R.G. Li, P.G. Sacks, P. Garin-Chesa, S.P. Schantz, and R.S. Chaganti. 1994. TP53 gene mutations and CCND1 gene amplification in head and neck squamous cell carcinoma cell lines. Int. J. Cancer. 59:383387.[Medline]
Yamamoto, T., N. Kamata, H. Kawano, S. Shimizu, T. Kuroki, K. Toyoshima, K. Rikimaru, N. Nomura, R. Ishizaki, I. Pastan, et al. 1986. High incidence of amplification of the epidermal growth factor receptor gene in human squamous carcinoma cell lines. Cancer Res. 46:414416.[Abstract]