|
Report |
Address correspondence to Junjie Chen, 1306 Guggenheim, Mayo Clinic, 200 First St., SW, Rochester, MN 55905. Tel.: (507) 538-1545. Fax: (507) 284-3906. email: Chen.junjie{at}mayo.edu
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: NHEJ; ATM; H2AX; V(D)J recombination; DNA repair
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Improper processing of DSBs gives rise to chromosomal instability that can result in carcinogenesis. To maintain genomic integrity, eukaryotic cells have evolved different pathways for the repair of DNA DSBs. In the yeast Saccharomyces cerevisiae, DSBs seem to be repaired almost exclusively through high fidelity homologous recombination (HR), a process that uses the undamaged sister chromatid or homologous chromosome as a DNA template (Lin et al., 1999; Khanna and Jackson, 2001). In mammalian cells, nonhomologous end joining (NHEJ), which is the error-prone joining of DNA ends without the requirement for sequence homology, plays an important role in DSB repair, especially during the G1 phase of the cell cycle when no sister chromatid is available (Hendrickson, 1997; Khanna and Jackson, 2001).
53BP1 participates early in the DNA damage response. It rapidly localizes to sites of DNA strand breaks in response to IR and interacts with phosphorylated histone H2AX (-H2AX; Schultz et al., 2000; Xia et al., 2000; Anderson et al., 2001; Rappold et al., 2001; Abraham, 2002). Studies using siRNA directed against 53BP1 implicate a role of 53BP1 in checkpoint control (DiTullio et al., 2002; Fernandez-Capetillo et al., 2002; Wang et al., 2002). Notably, 53BP1-deficient mice are hypersensitive to IR and exhibit an increased predisposition for T cell lymphomas. Moreover, lack of 53BP1 protein is accompanied by immunodeficiency and increased chromosomal instability (Morales et al., 2003; Ward et al., 2003b). This phenotype is reminiscent of the phenotype observed in mice with a defect in the NHEJ pathway.
Therefore, we examined if 53BP1 plays a role in DNA DSB repair. Our results indicate that HR by gene conversion does not require 53BP1. Moreover, NHEJ-dependent V(D)J recombination is not affected in the absence of 53BP1, but CSR is severely impaired in 53BP1/ mice. These results suggest that 53BP1 facilitates DNA end joining in a way that is not essential for V(D)J recombination.
![]() |
Results and discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
53BP1 is not required for HR
To test if 53BP1 is involved in HR, we used the recombination repair substrate DR-GFP designed to model HR-directed repair by using a tandem GFP repeat. The first GFP gene is inactivated by the introduction of an I-SceI recognition site, while the adjacent GFP gene is differentially mutated. After the introduction of a DSB at the I-SceI site, the GFP gene can be reconstituted by HR using the downstream inactivated GFP gene as a template.
We transfected 53BP1+/+ or 53BP1/ cells with DR-GFP and an I-SceI expression plasmid (pCBASce) and analyzed GFP expression 48 h later by flow cytometry. As a control, cells were transfected with DR-GFP alone or with a plasmid expressing an intact GFP gene. Although GFP-positive cells were very rare in both the wild-type (0.030.06%) and 53BP1-deficient cells (0.020.08%) transfected with DR-GFP alone (Fig. 2), an average of 4.80 ± 0.22% of 53BP1+/+ cells and 4.21 ± 1.42% of 53BP1/ cells expressed GFP 48 h after cotransfection with the I-SceI expression vector (Fig. 2). Similar numbers of GFP-positive cells were also observed after transfection of 53BP1+/+ and 53BP1/ cells with an intact control GFP expression vector, indicating that the transfection efficiency did not differ between 53BP1+/+ and 53BP1/ cells (Fig. 2). Thus, our results suggest that DSB repair by gene conversion is not impaired in 53BP1-deficient cells.
|
|
|
|
CSR is a deletional recombination reaction that results in the looping out and deletion of intervening DNA sequences as a circular episome (Iwasato et al., 1990; Matsuoka et al., 1990; von Schwedler et al., 1990). The looped-out circular DNA contains segments of Sµ and the target S region, including its I promoter. This promoter is still active in the looped-out circle and drives the synthesis of the circle transcript, a hybrid containing the I and Cµ exons (Kinoshita et al., 2001). The circle transcript appears only after productive CSR, and its level is proportional to the frequency of successful joining events (Kinoshita et al., 2001). To determine if 53BP1 deficiency has an impact on the frequency of joining during CSR, we used real-time RT-PCR to quantitate 1 circle transcripts in B cells stimulated with LPS and IL-4. The level of
1 circle transcript in 53BP1/ B cells was 6.6-fold reduced when compared with wild-type (Fig. 5 D) and is consistent with decreased CSR in the absence of 53BP1 (Fig. 5 B). Together, these data indicate that 53BP1 is required for CSR at the DNA level and that impaired CSR in 53BP1/ B cells is not due to abnormal B cell proliferation.
The impairment in CSR observed in 53BP1-deficient cells is less severe than the CSR defects in B cells deficient for components of the NHEJ pathway (Casellas et al., 1998; Manis et al., 1998, 2002). However, it appears to be more severe than the defect described in H2AX-deficient mice (Celeste et al., 2002; Reina-San-Martin et al., 2003). Moreover, the fact that 53BP1-null mice, like H2AX-deficient mice, support normal V(D)J recombination implies that the joining of class switch junctions differs from the rejoining of RAG-induced strand breaks. The repair pathways could be different for V(D)J recombination and CSR. Alternatively, 53BP1 and H2AX could be indirectly involved in the repair process by facilitating chromosomal accessibility or influencing chromatin organization and the loading of repair proteins. Because RAG proteins bind directly to DNA ends during V(D)J recombination, the involvement of RAG proteins may alleviate the requirement of a structural role of H2AX and 53BP1 in V(D)J recombination. Of course, it is also possible that the role of 53BP1 or H2AX in chromatin alterations is specific to CSR. Further analysis of H2AX and 53BP1 in the regulation of chromatin structure will be necessary to test these hypotheses.
Both 53BP1 and H2AX become rapidly phosphorylated by ATM (ataxia telangiectasia mutated) after IR and interact with each other at sites of DNA breaks (Burma et al., 2001; Rappold et al., 2001; Ward et al., 2003a). Similar to H2AX- or 53BP1-deficient cells, ATM-deficient cells also display a defect in CSR but support normal V(D)J recombination (Pan-Hammarstrom et al., 2003), suggesting that the functions of these proteins are closely linked. Although the exact role of 53BP1, ATM, and H2AX in DNA DSB repair remains to be determined, all three proteins appear to function in facilitating certain aspects of DNA end joining. Unraveling their mode of action in DNA repair will be a step further in our understanding of the process of carcinogenesis.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Apoptosis assay
To assess apoptosis in irradiated thymocytes, 6-wk-old 53BP1/ mice and wild-type littermates were exposed to 5 Gy of IR. 8 h later, the animals were killed and the thymocytes were isolated and stained with annexin-FITC (Molecular Probes) and PI before analysis on a FACScan.
PFGE assay
For determination of DSB rejoining, equal numbers of exponentially growing cells labeled with [14C]thymidine were exposed to IR at the indicated doses. After various recovery times, the cells were embedded in agarose plugs and lysed for 16 h in 1% sarcosyl, 0.5 M EDTA, and 1mg/ml proteinase K. For determination of break induction, cells were embedded in plugs before irradiation and lysed immediately. The plugs were washed in TE buffer and electrophoresis was performed in a CHEF DRII system (Bio-Rad Laboratories) for 65 h in 0.8% agarose in 0.5x TBE at 14°C with a field strength of 1.5 V/cm and pulse times increasing from 50 to 5,000 s. For quantification, single lanes were cut into 1-cm-thick slices, melted, and analyzed on a scintillation counter. The level of DNA breakage was estimated by the fraction of activity released from the plug into the gel.
HR repair assay
The efficiency of HR was assessed using an I-SceI repair substrate (DR-GFP) composed of two differentially mutated GFP and an I-SceI expression plasmid (pCBASce; both gifts from M. Jasin, Memorial Sloan-Kettering Cancer Center and Cornell University Graduate School of Medical Sciences, New York, NY). 53BP1+/+ and 53BP1/ embryonic cells were transfected by electroporation with either 5 µg DR-GFP plus 5 µg pCBASce or 5 µg DR-GFP alone. In addition, an aliquot of the cells was transfected with a functional GFP expression plasmid (pIRES-GFP Puro) to monitor transfection efficiency. 46 h later, cells were harvested and GFP expression was assessed by flow cytometry.
NHEJ repair and V(D)J assays
The assay for microhomology-directed end joining was performed as described previously (Verkaik et al., 2002). 5 µg of blunt-ended linear pDVH94 plasmid (a gift from D.C. van Gent, Erasmus Medical Center, Rotterdam, Netherlands) was electroporated into 4 x 106 cells, and extrachromosomal DNA was isolated 48 h later. DNA end-joining regions were amplified by PCR, and microhomology-directed end joining was assessed by BstXI restriction digestion.
V(D)J recombination in vivo was tested by a semiquantitative PCR method as described previously (Livak et al., 1995, 1999; Livak and Schatz, 1996).
Primer sequences not published before are as follows: Vß4, 5' GAAGCCTCTAGAGTTCATGTTTTC 3'; Jß2.5, 5' GAGCCGAGTGCCTGGCCCAAAGTA 3'; V2, 5' GCCGGATCCAGGAGAAACGTGACCAGCAG 3'; V
10, 5' AGCGAATTCCCGCGTCCTTGGTTCTGCA 3'; V
2 signal joint, 5' CTCTGGATCCGAATTCATYTAAACTAGTTAA 3', where Y = C or T; V
10 signal joint, 5' CCTGGATCCAGAATTCTACCAATACARGAAAG 3', where R = A or G; and J
26/27, 5' CCTGGATCCTTACTGTCATATATCGAA 3'.
Lymphocyte cultures and flow cytometry
Resting B lymphocytes were isolated from the spleen using CD43 microbeads (Miltenyi Biotec), labeled with CFDA-SE for 10 min at 37°C (5 µM; Molecular Probes), and cultured (106 cells/ml) with LPS (25 ng/ml; Sigma-Aldrich) and IL-4 (5 ng/ml; Sigma-Aldrich) for 4 d. Percentage of switching to IgG1 was determined by flow cytometry by using Biotin-anti-IgG1 (BD Biosciences) and Streptavidin-PE-Cy7 (Caltag). Dead cells were excluded from the analysis by staining with Topro-3 (Molecular Probes).
Quantitative real-time RT-PCR
Total RNA was extracted with TRIzol (Invitrogen) and reverse transcribed with random hexamers and superscript II reverse transcriptase (Invitrogen). First strand cDNA was used for SYBR green fluorogenic dye real-time PCR (Applied Biosystems). Primers used and PCR conditions are described in Reina-San-Martin et al. (2003).
![]() |
Acknowledgments |
---|
This work was supported by a grant from the National Institutes of Health to J. Chen (CA100109). J. Chen is a recipient of a Department of Defense (DOD) breast cancer career development award (DAMD17-02-1-0472). I. Ward is supported by a postdoctoral fellowship from the DOD Breast Cancer Research Program (DAMD17-01-1-0317).
Submitted: 2 March 2004
Accepted: 2 April 2004
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Abraham, R.T. 2002. Checkpoint signalling: focusing on 53BP1. Nat. Cell Biol. 4:E277E279.[CrossRef][Medline]
Anderson, L., C. Henderson, and Y. Adachi. 2001. Phosphorylation and rapid relocalization of 53BP1 to nuclear foci upon DNA damage. Mol. Cell. Biol. 21:17191729.
Bassing, C.H., W. Swat, and F.W. Alt. 2002. The mechanism and regulation of chromosomal V(D)J recombination. Cell. 109:S45S55.[Medline]
Burma, S., B.P. Chen, M. Murphy, A. Kurimasa, and D.J. Chen. 2001. ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J. Biol. Chem. 276:4246242467.
Casellas, R., A. Nussenzweig, R. Wuerffel, R. Pelanda, A. Reichlin, H. Suh, X.F. Qin, E. Besmer, A. Kenter, K. Rajewsky, and M.C. Nussenzweig. 1998. Ku80 is required for immunoglobulin isotype switching. EMBO J. 17:24042411.
Celeste, A., S. Petersen, P.J. Romanienko, O. Fernandez-Capetillo, H.T. Chen, O.A. Sedelnikova, B. Reina-San-Martin, V. Coppola, E. Meffre, M.J. Difilippantonio, et al. 2002. Genomic instability in mice lacking histone H2AX. Science. 296:922927.
Chaudhuri, J., M. Tian, C. Khuong, K. Chua, E. Pinaud, and F.W. Alt. 2003. Transcription-targeted DNA deamination by the AID antibody diversification enzyme. Nature. 422:726730.[CrossRef][Medline]
Dickerson, S.K., E. Market, E. Besmer, and F.N. Papavasiliou. 2003. AID mediates hypermutation by deaminating single stranded DNA. J. Exp. Med. 197:12911296.
DiTullio, R.A., T.A. Mochan, M. Venere, J. Bartkova, M. Sehested, J. Bartek, and T.D. Halazonetis. 2002. 53BP1 functions in an ATM-dependent checkpoint pathway that is constitutively activated in human cancer. Nat. Cell Biol. 4:9981002.[CrossRef][Medline]
Dunnick, W., G.Z. Hertz, L. Scappino, and C. Gritzmacher. 1993. DNA sequences at immunoglobulin switch region recombination sites. Nucleic Acids Res. 21:365372.[Abstract]
Fernandez-Capetillo, O., H.T. Chen, A. Celeste, I. Ward, P.J. Romanienko, J.C. Morales, K. Naka, Z. Xia, R.D. Camerini-Otero, N. Motoyama, et al. 2002. DNA damage-induced G(2)-M checkpoint activation by histone H2AX and 53BP1. Nat. Cell Biol. 4:993997.[CrossRef][Medline]
Gellert, M. 2002. V(D)J recombination: RAG proteins, repair factors, and regulation. Annu. Rev. Biochem. 71:101132.[CrossRef][Medline]
Hendrickson, E.A. 1997. Cell-cycle regulation of mammalian DNA double-strand-break repair. Am. J. Hum. Genet. 61:795800.[Medline]
Honjo, T., K. Kinoshita, and M. Muramatsu. 2002. Molecular mechanism of class switch recombination: linkage with somatic hypermutation. Annu. Rev. Immunol. 20:165196.[CrossRef][Medline]
Iwasato, T., A. Shimizu, T. Honjo, and H. Yamagishi. 1990. Circular DNA is excised by immunoglobulin class switch recombination. Cell. 62:143149.[Medline]
Khanna, K.K., and S.P. Jackson. 2001. DNA double-strand breaks: signaling, repair and the cancer connection. Nat. Genet. 27:247254.[CrossRef][Medline]
Kinoshita, K., M. Harigai, S. Fagarasan, M. Muramatsu, and T. Honjo. 2001. A hallmark of active class switch recombination: transcripts directed by I promoters on looped-out circular DNAs. Proc. Natl. Acad. Sci. USA. 98:1262012623.
Lin, Y., T. Lukacsovich, and A.S. Waldman. 1999. Multiple pathways for repair of DNA double-strand breaks in mammalian chromosomes. Mol. Cell. Biol. 19:83538360.
Livak, F., and D.G. Schatz. 1996. T-cell receptor alpha locus V(D)J recombination by-products are abundant in thymocytes and mature T cells. Mol. Cell. Biol. 16:609618.[Abstract]
Livak, F., H.T. Petrie, I.N. Crispe, and D.G. Schatz. 1995. In-frame TCR delta gene rearrangements play a critical role in the alpha beta/gamma delta T cell lineage decision. Immunity. 2:617627.[Medline]
Livak, F., M. Tourigny, D.G. Schatz, and H.T. Petrie. 1999. Characterization of TCR gene rearrangements during adult murine T cell development. J. Immunol. 162:25752580.
Manis, J.P., Y. Gu, R. Lansford, E. Sonoda, R. Ferrini, L. Davidson, K. Rajewsky, and F.W. Alt. 1998. Ku70 is required for late B cell development and immunoglobulin heavy chain class switching. J. Exp. Med. 187:20812089.
Manis, J.P., D. Dudley, L. Kaylor, and F.W. Alt. 2002. IgH class switch recombination to IgG1 in DNA-PKcs-deficient B cells. Immunity. 16:607617.[Medline]
Matsuoka, M., K. Yoshida, T. Maeda, S. Usuda, and H. Sakano. 1990. Switch circular DNA formed in cytokine-treated mouse splenocytes: evidence for intramolecular DNA deletion in immunoglobulin class switching. Cell. 62:135142.[Medline]
Morales, J.C., Z. Xia, T. Lu, M.B. Aldrich, B. Wang, C. Rosales, R.E. Kellems, W.N. Hittelman, S.J. Elledge, and P.B. Carpenter. 2003. Role for the BRCA1 C-terminal repeats (BRCT) protein 53BP1 in maintaining genomic stability. J. Biol. Chem. 278:1497114977.
Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and T. Honjo. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell. 102:553563.[Medline]
Pan-Hammarstrom, Q., S. Dai, Y. Zhao, I.F. van Dijk-Hard, R.A. Gatti, A.L. Borresen-Dale, and L. Hammarstrom. 2003. ATM is not required in somatic hypermutation of VH, but is involved in the introduction of mutations in the switch mu region. J. Immunol. 170:37073716.
Petersen-Mahrt, S.K., R.S. Harris, and M.S. Neuberger. 2002. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature. 418:99103.[CrossRef][Medline]
Ramiro, A.R., P. Stavropoulos, M. Jankovic, and M.C. Nussenzweig. 2003. Transcription enhances AID-mediated cytidine deamination by exposing single-stranded DNA on the nontemplate strand. Nat. Immunol. 4:452456.[CrossRef][Medline]
Rappold, I., K. Iwabuchi, T. Date, and J. Chen. 2001. Tumor suppressor p53 binding protein 1 (53BP1) is involved in DNA damagesignaling pathways. J. Cell Biol. 153:613620.
Reina-San-Martin, B., S. Difilippantonio, L. Hanitsch, R.F. Masilamani, A. Nussenzweig, and M.C. Nussenzweig. 2003. H2AX is required for recombination between immunoglobulin switch regions but not for intra-switch region recombination or somatic hypermutation. J. Exp. Med. 197:17671778.
Schultz, L.B., N.H. Chehab, A. Malikzay, and T.D. Halazonetis. 2000. p53 binding protein 1 (53BP1) is an early participant in the cellular response to DNA double-strand breaks. J. Cell Biol. 151:13811390.
Verkaik, N.S., R.E. Esveldt-van Lange, D. van Heemst, H.T. Bruggenwirth, J.H. Hoeijmakers, M.Z. Zdzienicka, and D.C. van Gent. 2002. Different types of V(D)J recombination and end-joining defects in DNA double-strand break repair mutant mammalian cells. Eur. J. Immunol. 32:701709.[CrossRef][Medline]
von Schwedler, U., H.M. Jack, and M. Wabl. 1990. Circular DNA is a product of the immunoglobulin class switch rearrangement. Nature. 345:452456.[CrossRef][Medline]
Wang, B., S. Matsuoka, P.B. Carpenter, and S.J. Elledge. 2002. 53BP1, a mediator of the DNA damage checkpoint. Science. 298:14351438.
Ward, I.M., K. Minn, K.G. Jorda, and J. Chen. 2003a. Accumulation of checkpoint protein 53BP1 at DNA breaks involves its binding to phosphorylated histone H2AX. J. Biol. Chem. 278:1957919582.
Ward, I.M., K. Minn, J. Van Deursen, and J. Chen. 2003b. p53 Binding protein 53BP1 is required for DNA damage responses and tumor suppression in mice. Mol. Cell. Biol. 23:25562563.
Xia, Z., J.C. Morales, W.G. Dunphy, and P.B. Carpenter. 2000. Negative cell cycle regulation and DNA damage-inducible phosphorylation of the BRCT protein 53BP1. J. Biol. Chem. 276:27082718.[CrossRef][Medline]