* The Murdoch Institute for Research into Birth Defects, Royal Children's Hospital, Parkville 3052, Australia; and Institute of
Reproduction and Development, Monash University, Clayton 3168, Australia
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier cytological and indirect experimental studies have provided conflicting evidence concerning the role of this protein in mitosis. The requirement of this protein in meiosis has also not previously been described. To resolve these uncertainties, we used targeted disruption of the Cenpb gene in mouse to study the functional significance of this protein in mitosis and meiosis. Male and female Cenpb null mice have normal body weights at birth and at weaning, but these subsequently lag behind those of the heterozygous and wild-type animals. The weight and sperm content of the testes of Cenpb null mice are also significantly decreased. Otherwise, the animals appear developmentally and reproductively normal. Cytogenetic fluorescence-activated cell sorting and histological analyses of somatic and germline tissues revealed no abnormality. These results indicate that Cenpb is not essential for mitosis or meiosis, although the observed weight reduction raises the possibility that Cenpb deficiency may subtly affect some aspects of centromere assembly and function, and result in reduced rate of cell cycle progression, efficiency of microtubule capture, and/or chromosome movement. A model for a functional redundancy of this protein is presented.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
THE protein components of the mammalian centromere can be broadly classified into two groups.
Proteins from the first group are constitutively
present on the centromere throughout the cell cycle, and
include CENP-A, CENP-B, and CENP-C. The second
group of proteins has been referred to as passenger proteins, since these proteins undergo complex relocations to
other cellular organelles during the cell cycle, appearing
on the centromere only during specific stages of the cycle
(Brinkley et al., 1992; Earnshaw and Mackay, 1994). Examples of passenger proteins are INCENPs, MCAK,
CENP-E, CENP-F, 3F3/2 antigens, and cytoplasmic dynein (reviewed by Earnshaw and Mackay, 1994; Pluta et al.,
1995
; Choo, 1997a
). The proposed biological roles for
these passenger proteins have included centromere formation and maturation, motor movement of chromosomes,
sister chromatid cohesion and release, modulation of spindle dynamics, nuclear organization, intercellular bridge structure and function, and cytokinesis (reviewed by
Choo, 1997a).
Amongst the constitutive centromere proteins, CENP-A
has been localized to the outer kinetochore domain, and is
a member of a growing class of proteins referred to as histone H3-like proteins whose members also include the S. cerevisiae homologue of CENP-A, CSE4p (Sullivan et al.,
1994; Wilson et al., 1994
; Stoler et al., 1995
). Since CENP-A
is found in association with histone H4 and the other core
histones in particles that copurify with nucleosome core
particles (Palmer and Margolis, 1985
; Palmer et al., 1987
), the protein is thought to act as a histone H3 homologue,
replacing one or both copies of histone H3 in a certain set
of centromeric nucleosomes, and is thought to serve to differentiate the centromere from the rest of the chromosome at the most fundamental level of chromatin structure: the nucleosome (Sullivan et al., 1994
). CENP-C is
located at the inner kinetochore plate, and has been shown
to have an essential although yet undetermined centromere function as seen from its association with the active, but not the inactive centromeres of human dicentric
chromosomes (Earnshaw et al., 1989
; Page et al., 1995
;
Sullivan and Schwartz, 1995
), arrest of mitotic progression
after microinjection of anti-CENP-C antibodies into cultured mammalian cells (Bernat et al., 1990
; Tomkiel et al.,
1994
) or gene knockout (Fukagawa and Brown, 1997
; Kalitsis et al., 1998
), and the significant sequence homology it
shares with Mif2, a protein involved in budding yeast chromosome segregation and believed to have a role in kinetochore function (Brown et al., 1993
; Brown, 1995
; Meluh
and Koshland, 1995
).
Human CENP-B is an 80-kD polypeptide that has been
localized throughout the heterochromatin or central domain of the centromere (Earnshaw and Rothfield, 1985;
Earnshaw et al., 1987
; Cooke et al., 1990
; Sullivan and
Glass, 1991
; Saitoh et al., 1992
). The protein is encoded by
an intronless gene present in a single copy within the genome (Sugimoto et al., 1993
; Seki et al., 1994
). The number of CENP-B protein molecules has been estimated to
be ~20,000 per diploid genome in HeLa cells (Cooke et
al., 1990
; Muro et al., 1992
). On different human chromosomes, variable but generally detectable levels of the protein have been observed (Earnshaw et al., 1987
). A notable exception is the Y chromosome, which has been shown
to consistently lack this protein (Earnshaw et al., 1987
).
Through the recognition of a 17-bp PyTTCGTTGGAAPuCGGGA sequence known as the CENP-B box motif,
CENP-B protein has been demonstrated to bind human
centromeric
-satellite DNA directly (Masumoto et al.,
1989
; Muro et al., 1992
; Pluta et al., 1992
; Yoda et al.,
1992
).
Comparison of cloned human and mouse CENP-B gene
sequences (Earnshaw et al., 1987; Sullivan and Glass,
1991
) reveals a high degree of homology between the two
species, with the coding regions showing an overall 96%
sequence similarity and substantial stretches demonstrating 100% nucleotide identity between the two species (Sullivan and Glass, 1991
). Of particular importance, both
the NH2-terminal DNA-binding and COOH-terminal dimerization domains are totally conserved. Surprisingly, even
the 5' and 3' untranslated sequences demonstrate an unusually high level (95% and 83%, respectively) of homology that is suggestive of possible posttranscriptional regulatory mechanisms (Mullner and Kühn, 1988
; Caput et al., 1986
). Like its human counterpart, the mouse gene is single-copy and intronless. Although the mouse genome does
not contain recognizable
-satellite DNA, CENP-B binding occurs through the 17-bp consensus CENP-B box motif that is found in the mouse centromeric minor satellite
DNA (Pietras et al., 1983
; Rattner, 1991
). In addition to
mouse and humans, the CENP-B gene is conserved in
hamster, African green monkey, great ape, tupaias, calf,
Indian muntjac, and sheep (Sullivan and Glass, 1991
; Haaf
and Ward, 1995
; Yoda et al., 1996
; Bejarano and Valdivia,
1996
; EMBL accession no. U35655). Significant homology
is also found between CENP-B and two S. pombe centromere DNA-binding proteins Cbh+ and Abp1p, where
cbh+ has been shown to be an essential gene (Lee et al., 1997
), while abp1-deleted strains exhibit slower growth
and a pronounced meiotic defect (Halverson et al., 1997
).
The CENP-B box motif has been found in the centromeric
satellite DNA of species as diverse as primates, Mus musculus, Mus caroli, tree shrews, giant panda, gerbils, and
ferrets (Pietras et al., 1983
; Masumoto et al., 1989
; Rattner,
1991
; Muro et al., 1992
; Pluta et al., 1992
; Yoda et al., 1992
;
Haaf and Ward, 1995
; Kipling et al., 1995
; Kipling et al.,
1994
; Wu et al., 1990
; Volobouev et al., 1995
; Choo et al.,
1991
; Laursen et al., 1992
; Haaf et al., 1995
). Based on this
observed conservation of CENP-B and its DNA-binding motif, it may be speculated that CENP-B is a functionally
important component of the mammalian centromere.
Through its CENP-B box-binding and dimerization properties, the protein has the hallmark of a cross-linking protein that is involved in assembly of the large arrays of centromeric -satellite or minor satellite DNA (Yoda et al.,
1992
; Muro et al., 1992
). However, the absence of this protein on the Y chromosome in humans and mouse (Earnshaw et al., 1987
), and on the centromeres of African green
monkeys, which are known to be composed largely of
-satellite DNA containing little or no binding sites for
CENP-B (Goldberg et al., 1996
), suggests that this role
may not be universal. In other studies, the protein has
been shown to be present on both the active and inactive
centromeres of mitotically stable pseudodicentric human
chromosomes (Earnshaw et al., 1989
; Page et al., 1995
;
Sullivan and Schwartz, 1995
), suggesting that CENP-B
binding does not immediately translate into centromere
activity. Furthermore, an increasing number of stable human neocentromeric marker chromosomes (Voullaire et al.,
1993
; Ohashi et al., 1994
; Choo, 1997b
; Depinet et al., 1997
; du Sart et al., 1997
) have now been described that
are capable of normal mitotic division in the absence of
CENP-B binding, indicating that CENP-B is nonessential
for mitotic chromosome segregation, at least for these
marker chromosomes. Earlier attempts at defining the
role of CENP-B in mammals have yielded conflicting results. Microinjection of polyclonal anti-CENP-B antibodies into human and mouse cells resulted in disruption of
centromere assembly during interphase, and led to inhibition of kinetochore morphogenesis and function in mitosis
(Bernat et al., 1990
; Simerly et al., 1990
; Bernat et al.,
1991
). However, a different study has indicated that expression of truncated versions of CENP-B in HeLa cells does not lead to a mitotic or cell cycle arrest phenotype
(Pluta et al., 1992
). To date, the role of CENP-B in meiosis
has not been investigated.
To better understand the role of CENP-B in centromere function, we used gene targeting in mouse embryonic stem cells to derive animals with a null mutation in the CENP-B gene. A major advantage of such mouse mutants is that it enables us to study CENP-B functions not only in mitosis, but also in meiosis. We report that CENP-B-deficient mice appear to be mitotically and meiotically normal, but develop lower body and testis weights. We discuss the implications of these results and propose a model in favor of a redundancy of CENP-B in centromere function.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Construction of Targeting Vectors
A hybridization probe spanning the coding region of Cenpb was prepared
from genomic DNA of mouse embryonic stem (ES)1 cell line E14 by PCR
using primers Bprot-1 (5'-GCGCAGATCTATGGGCCCCAAGCGGCGGCAGC-3') and Bprot-3 (5'-TCAGAATTCAGCTTTGATGTCCAAGACCC-3'). Screening of mouse genomic phage libraries with this
probe resulted in the identification of a positive clone (designated E1)
from a 129/OLA library (gift of M. Kennedy) of E14 cells, and a second
clone (designated D1) from a 129/SV library (Stratagene) of R1 mouse ES
cells. An E1-derived fragment spanning nucleotides 920-2676 of mouse
Cenpb gene (Sullivan and Glass, 1991, EMBL accession no. X55038) was
ligated with a D1-derived fragment spanning 2676-5800 and cloned into a
modified pSP72 vector (Promega Corp., Madison, WI). An oligonucleotide linker sequence designated D/TAA (5'-GTACCTAGGTATACTTTTAAACTGAC-3') was inserted at position 1207, which is 72 amino
acids downstream of the ATG start site of the 1.8 kb-coding sequence of
Cenpb (Fig. 1b). This linker introduced a DraI site, a frameshift mutation,
and three stop codons in all three reading frames, of which TAA was in
frame with Cenpb translation, disrupting not only the critical NH2-terminal 125-amino acid centromere DNA-binding domain (Yoda et al., 1992
;
Kitagawa at al., 1995), but also removing all remaining COOH-terminal
regions including the dimerization domain (Yoda et al., 1992
; Kitagawa et
al., 1995
). The IRES-neomycin (Mountford et al., 1994
) and IRES-hygromycin (A. Smith, personal communication) markers were separately
cloned into an AvrII site at position 3202 in the 3' untranslated region before the polyadenylation signal to produce the targeting constructs IRES(neo) and IRES(hygro), respectively.
|
Southern Blot and PCR Analyses of Targeting Events
Correct gene targeting in ES cells and mouse tail genomic DNA was determined by Southern analysis using a 5' genomic probe generated from the E1 phage clone with NheI (position 564) and SacII (position 920) situated outside the targeting construct sequence (see Fig. 1 d). For PCR genotyping, the following primers flanking the D/TAA linker were used: Fd-1 (5'-ACCATCCTGAAGAGAACAACGG-3') and Rev-2 (TGGAACCAAGCATGAGAGAAG), which gave 128-bp and 154-bp products for wild-type and targeted alleles, respectively; or Fd-1 and Rev-3 (3'-TGGAACCAAGCATGAGAAG-5'), which gave a 173-bp and 199-bp product for wild-type and targeted alleles, respectively (see Fig. 1, d and g). PCR conditions were as follows: 95°C for 30 s, 55°C for 1 min, and 72°C for 1.5 min for a total of 35 cycles using a 50-µl vol containing 50-200 ng genomic tail DNA, 1 U Taq polymerase, 200 µM dNTPs, and 300 ng of each primer in 1 X Taq PCR buffer (Perkin-Elmer Corp., Norwalk, CT).
Generation of Targeted ES Cells and Mouse Chimeras
For transfection, 50 µg of the IRES(neo) construct was linearized at the 3'
end with AatII or SspI, or at the 5' end with SacII, and electroporated into
approximately 108 ES cells in 800 µl vol using a single pulse from a Bio-Rad Gene Pulser at 800 V, 3 µFD,
. The ES cell lines used in this study were R1 (Nagy et al., 1993
), W9.5, and W9.8 (Buzin et al., 1994
). Transfected cells were plated onto mitomycin C-treated, neomycin-resistant, STO-neoR (Robertson, 1987
) plus 103U/ml LIF (Amrad-Pharamacia) and
selected in G418 (Gibco-BRL) active at 300 µg/ml. One R1-derived G418-resistant colony, designated R1-26, demonstrated correct targeted disruption at the Cenpb allele, and was used for blastocyst injection to produce
germline chimeric mice and for a second round of gene targeting to produce double-targeted, Cenpb-null cell lines in culture.
For chimeric mouse production, R1-26 cells were microinjected into host (C57 bla/6) blastocysts, followed by breeding of the resulting germ-line transmitting chimeras to generate heterozygous and homozygous Cenpb-null mice. For the second targeting event, the R1-26 cells were electroporated with 50 µg of the IRES(hygro) construct that has been linearized at the 3' end with SspI. Transfected cells were grown in the absence of STO fibroblast feeder layer, and were selected in 300 µg/ml G418 and 110-140 µg/ml hygromycin. This resulted in a Cenpb-null cell line, designated R1-189N/H, in which both the Cenpb alleles were disrupted. This cell line was injected into C57 bla/6 blastocysts, and the resulting germline chimeras were used in a back-cross with C57 black mice to allow segregation of the two targeted alleles and the derivation of heterozygous and homozygous mouse strains carrying only the IRES(hygro)-targeted allele. In this way, mice with two independently targeted Cenpb alleles were generated.
Reverse Transcription (RT)-PCR Analysis and Sequencing
Total genomic RNA was extracted from wild-type R1 cells (+/+), the
IRES(neo)-targeted cell line R1-26 (+/), and the double-targeted cell
line R1-189N/H (
/
). 0.5-1.0 µg total RNA was reverse-transcribed using a first-strand RT kit (Boehringer Mannheim Corp., Indianapolis, IN)
and oligo-d(T) as primer. Annealing was carried out at room temperature
for 10 min, followed by transcription at 42°C for 60 min and cooling at 4°C
for 5 min. PCR was then performed on +/+, +/
, and
/
cell lines using
conditions described for primers Fd-1 and Rev-2/Rev-3. For sequencing,
the 199-bp Fd-1/Rev-3 PCR product from the
/
cell line was gel-isolated and cloned into the pGEM-T vector (Promega Corp., Madison, WI).
Sequencing was performed on both strands in two separate clones using
M13 Rev and T7 primers. Reactions were carried out using fluorescent
dye terminator cycle sequencing (ABI PRISMTM; Perkin-Elmer Corp.,
Norwalk, CT).
Immunohistochemistry
Autoimmune serum CREST no. 6 (gift of S. Wittingham and T. Kaye)
was from a patient with calcinosis, Raynaud's phenomenon, esophageal
dysmotility, sclerodactyly, and telangiectasia (Fritzler et al., 1980; Moroi
et al., 1981; Brenner et al., 1981
) and detects CENP-A and CENP-B (du
Sart et al., 1997
). Anti-CENP-B monoclonal antibody 2D-7 (Earnshaw et al.,
1987
) was purchased as hybridoma cells from American Type Culture
Collection (Rockville, MD) and prepared as ascites fluid in pristane
primed mice. Anti-Cenpc polyclonal antibody, Am-C1, was produced in a
rabbit against a mouse Cenpc/GST-fusion product expressed in Escherichia coli (du Sart et al., 1997
). Antihuman CENP-E antibody, HX1, was a
gift from T. Yen (Yen et al., 1991
; Yen et al., 1992
). Cultured cells were arrested in mitosis with 10 µg/ml colcemid for 2 h. Immunofluorescence staining was performed as previously described (Jeppeson et al.,1992; du
Sart et al., 1997
). After the antibody binding, the cells were postfixed in
10% formalin, washed, and counterstained with DAPI and DABCO
mountant. Images were analyzed using an Axioskop fluorescence microscope equipped with a 100× objective (Carl Zeiss, Inc., Thornwood, NY)
and a cooled CCD camera (Photometrics Image Point) linked to a PowerMac computer.
Histology, Advanced Sperm Count (ASC), and Stereology
The organs analyzed for histology were dissected from 10-wk-old and 6 mo-old mice using standard techniques. Testicular determination of homogenization-resistant ASC was performed as previously described (Robb et al., 1978) on 10-wk-old animals. Stereological analysis was performed on testicular materials from 10-wk-old mice using the optical dissector (sic) technique (Wreford et al., 1995) to investigate the efficiency of
meiosis by determining the ratio of pachytene spermatocytes to round
spermatids associated with stages I-VIII of spermatogenesis. This ratio
has an expected value of 4:1 if the efficiency of division through meiosis I
and II is 100% and there is no loss of round spermatids after meiosis.
Cytogenetics and Flow Sorting
For karyotyping, /
R1-189 N/H cell line as well as spleen and bone
marrow cell cultures (with and without phytohaemagglutinin) were isolated from
/
mice and compared with the +/+ cell line and +/+ animal. Cells were treated with colcemid and GTL-stained using standard cytogenetic techniques. For flow sorting, 50,000 cells from spleen, bone
marrow, or testis were isolated from 30-wk-old mice. These were analyzed
by two-parameter analysis of DNA content vs. cell diameter using a FACScanTM (Becton Dickinson & Co., Sparks, MD) cell sorter equipped with
an argon laser at 488 nm. Signals were collected by a FL2 detector with a
585-nm band pass filter. Testis cells were profiled into five main regions
corresponding to the different steps in maturation from elongated and
round haploid spermatids to diploid, S-phase, and tetraploid cells.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Generation of Cenpb-null ES Cells and Mice
For disruption of the mouse Cenpb gene in ES cells, a promoterless targeting vector was constructed that incorporated a translation frame-shift linker, designated D/TAA,
containing stop codons in all three reading frames, and the
IRES-neomycin or IRES-hygromycin marker (Fig. 1 b and
Methods). The D/TAA linker inserted 72 amino acids
downstream of the translation start site not only disrupted the critical NH2-terminal 125-amino acid centromere DNA-binding domain (Kitagawa et al., 1995; Yoda et al., 1992
),
but also removed all remaining COOH-terminal regions
including the dimerization domain (Kitagawa et al., 1995
;
Yoda et al., 1992
). The IRES-neo and IRES-hygro selectable markers were placed in the 3' untranslated region before the polyadenylation signal. For correct targeting and
gene disruption, two homologous recombination events
external to the linker and IRES(neo/hygro) regions were
required (Fig. 1 b, solid-cross regions). When the IRES(neo)
construct was linearized at the 3' end with AatII or SspI
and transfected into R1 and W9.5 cells, 2% (or 2 out of
103 neomycin resistant colonies) of R1 cells, 1.3% (1 out
of 72 colonies) of W9.8, and 3.5% (12 out of 344 colonies)
of W9.5 cells gave the desired targeted gene disruption (Fig. 1 e, lane 5). Interestingly, a significantly higher frequency (90% for R1, 67% for W9.8, and 92% for W9.5) of
an undesired targeting event was detected (Fig. 1 e, lanes 2,
4, 6, and 7) where incorporation of the IRES-neo element
at the Cenpb locus had not been accompanied by the
D/TAA linker. This result was due to recombinations occurring within the region between the IRES-neo cassette
and the D/TAA linker (Fig. 1 b, broken-cross region) instead of in the region 5' of the linker. The observation of a
higher recombination frequency in this region was perhaps
not surprising in view of the fact that 1995 bp of homologous DNA was present in this region compared with only
287 bp of homologous DNA between the D/TAA linker
and the 5' end of the construct. In subsequent experiments, it was further demonstrated that use of construct
DNA linearized at the 5' end using KspI to expose the
Cenpb DNA end, as distinct from the plasmid vector DNA
end using 3' AatII or SspI, gave a 2.5-fold increase in the
frequency of the desired targeting in R1 cells and a 3.8-fold increase in W9.5 cells (data not shown).
From the above screening, 21 heterozygous ES cell colonies with a disrupted Cenpb allele were obtained from the R1, W9.5, and W9.8 cell lines. Two of these colonies, R1-26 from the R1 line and W-190 from the W9.8 cell line, were retransfected with the IRES(hygro) construct to obtain a Cenpb null cell line. Selection of the transfected cells in neomycin and hygromycin gave rise to one double-targeted colony (out of five resistant colonies screened) designated R1-189N/H from R1-26, and two double-targeted colonies (out of 76 colonies screened) from W-190. All three colonies showed normal cell morphology and apparently normal growth rates. No desired double-targeted event (0 out of 81 colonies) were seen for both W9.8 and R1 when the transfected cells were selected in hygromycin alone, due presumably to a direct replacement of the IRES(neo)-targeted allele with the IRES(hygro) cassette. Furthermore, as with the IRES(neo) construct, a much higher frequency (three out of five colonies for R1-26, and 57 out of 76 colonies for W-190) of the undesired targeting event involving the loss of the D/TAA linker was observed.
The heterozygous R1-26 cell line was injected into C57
bla/6 blastocysts to produce germline chimeras, from which
heterozygous (+/ neo) and homozygous (
/
neo) mice
carrying the IRES(neo)-targeted allele were produced
(Fig. 1 f). The double-targeted R1-189N/H cell line was
similarly injected into C57 bla/6 blastocysts and, through
selective breeding, heterozygous (+/
hygro) and homozygous (
/
hygro) mice carrying the IRES (hygro) allele were generated (data not shown). These mice, together with the various cell lines created above, were
subjected to further detailed studies.
Abolition of Cenpb Gene Expression in the Targeted Cell Lines
Cenpb gene disruption was determined by RNA analysis
using PCR performed with primers designed across the
D/TAA linker region. The results (Fig. 1 g) indicated the
presence of normal Cenpb transcripts in the wild-type
(Fig. 1 g; lanes 1 and 4) and heterozygous cell lines (lanes 2 and 5), but not in the double-targeted R1-189N/H cell line
(lanes 3 and 6). This result suggested that transcription of
both copies of the wild-type Cenpb alleles in the /
cell line had been abolished and replaced by that of the targeted alleles. In addition, we wished to determine whether
the D/TAA linker had incorporated correctly into the
NH2-terminal centromere DNA-binding domain of the
targeted Cenpb gene, and that no unforeseen sequence rearrangement undetected by the Southern or RT-PCR
analyses had occurred. This was done by purifying and
cloning the 199-bp fragment corresponding to the targeted
allele (Fig. 1 g, lane 6) and direct sequencing analysis. The
results (not shown) confirmed the correct insertion of the
D/TAA linker and therefore the stop codons.
Absence of Cenpb Binding on Centromeres by Direct Immunofluorescence Staining
Immunofluorescence staining of metaphase chromosomes
was used to detect specific centromere-binding proteins.
Fig. 2 shows results obtained with the +/+ R1 and /
R1-189N/H cell lines; the results for the +/
R1-26 cell
line were similar to those of the +/+ R1 cell line, and are
not shown. The anti-Cenpb monoclonal antibody clearly
demonstrated the presence of Cenpb on the centromeres of the +/+ cell line, but not on those of the
/
cell line.
The intensity of the Cenpb signals in the +/+ cells varied
considerably on different chromosomes, reflecting the intrinsic quantitative variation in the amount of Cenpb
boxes and Cenpb binding on different centromeres (Earnshaw et al., 1987
). When these cell lines were tested with a
CREST antibody and antibodies for Cenpc and CENP-E, uniform staining of the centromere was observed (Fig. 2).
Similar results (not shown) were obtained with cells established from the +/+, +/
, and
/
IRES(neo) and
IRES(hygro) mice. These data therefore provided direct
evidence that the Cenpb gene has been disrupted in the
/
neo and
/
hygro knockout mice. They also demonstrated that Cenpb is not essential for centromeric binding of Cenpc and Cenpe and for CREST antibody binding on
active centromeres.
|
Cenpb Null Mice Have Lower Body Weight and Testis Size, but Are Otherwise Developmentally Normal
Cenpb null mice appeared phenotypically normal, and
routinely gave normal litter size and the expected Mendelian ratios of offspring, suggesting that Cenpb deficiency
did not drastically affect cell division, development, and
reproduction of the mice. This phenotype is in stark contrast to that of another mouse model we have recently created with a disruption of Cenpc, where null mutants display
severe mitotic disarray and die during early embryogenesis (Kalitsis et al., 1998). To determine if Cenpb gene disruption has a more subtle effect on growth, we measured
the body weight of the IRES(neo) animals over an 8-mo
period (Fig. 3). The
/
mice as a group appeared uniform in size at birth, and presented with normal weights at
weaning (3 wk), but subsequent weight gain in this group
lagged behind those of sex-matched +/+ and +/
animals, with the difference reaching a level of significance (P < 0.05) after 22 wk in males and 12 wk in females (see Table
I for representative weight data for 26-wk-old animals).
When the weight data were collected from the IRES(hygro) animals, similar trends as those obtained for the
IRES(neo) mice were seen for the different genotypes in
the two sexes (data not shown).
|
|
Histological Analysis Reveals No Gross Abnormality
To investigate the reasons for the observed weight difference, various organs from the IRES(neo)-targeted animals
were subjected to histological examination. The organs analyzed were stomach, duodenum, descending colon, liver,
hairy skin, ear flap, salivary gland, spleen, pancreas, kidney,
thymus, brain, lung, adrenal, seminal vesicle, ovary, uterus,
and pituitary. When organs from 10-wk- and 6-mo-old
male and female /
mice were directly compared with
those derived from age- and sex-matched +/+ and +/
animals, the results indicated no obvious abnormality in any
of these organs. During this analysis, the testes of
/
mice were found to be markedly smaller (29%; P < 0.01)
than those of the wild-type mice (Table I). Follicle-stimulating hormone (FSH) and luteinizing hormone (LH) levels were measured and found to be normal. When the testes of 10-wk-old animals were assessed for sperm content (ASC), a 39.5% reduction (P = 0.0007) was seen in the
/
animals (N = 9) compared with the +/+ animals (N = 12).
When the efficiency of meiosis was determined using the
more comprehensive stereological analysis on sectioned
testicular materials from +/+ (N = 5), +/
(N = 6), and
/
(N = 4) mice, values of 3.9 ± 0.2 (mean ± SEM), 3.8 ± 0.1, and 3.6 ± 0.2, respectively, were obtained, which were not
significantly different from the expected 4:1 ratio. Thus, although it appears that reduction in germ cell content is
correlated with testicular weight reduction, results of the
stereological analysis have revealed no substantial difference in the efficiency of either mitotic or meiotic division.
Karyotyping and Flow Sorting of Cenpb/
Cells
Indicate Normal Meiosis and Mitosis
The chromosomes of the Cenpb-disrupted cells were investigated by cytogenetic analysis and flow sorting. For cytogenetic analysis, ES-derived R1-189 N/H /
cells in
culture and spleen and bone marrow cells from 30-wk-old
/
mice (N = 4) were analyzed and compared with the
wild-type ES cells and animal. The results indicated a normal karyotype in each case. For flow sorting, 50,000 cells from the spleen, bone marrow, or mitotically and meiotically dividing testis cells were isolated from +/+ (N = 8),
+/
(N = 13), and
/
(N = 7) 10-wk-old mice, and +/+
(N = 3), +/
(N = 1), and
/
(N = 8) 30-wk-old mice.
Again, no detectable aberration was observed. These results, together with those obtained using the stereological
techniques, provide further evidence that Cenpb is not essential for mitosis or meiosis.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The question of whether CENP-B is essential for chromosome segregation has been intensely debated in recent
years. Conservation of the protein in different mammalian
species and in lower eukaryotes and its demonstrated centromere DNA-binding property attest to a significant functional role. However, various cytological observations have
hinted at CENP-B not being critical for mitosis, although such evidence are often indirect and open to interpretation. For example, detection of CENP-B on both the active
and inactive centromeres of mitotically stable pseudodicentric human chromosomes (Earnshaw et al., 1989; Page
et al., 1995
; Sullivan and Schwartz, 1995
), rather than indicating a lack of functional importance for CENP-B, can be
interpreted to mean that additional centromere proteins are necessary to make the inactive centromere fully active.
Similarly, the finding that the protein is absent on the Y
chromosome in both humans and mouse (Earnshaw et al.,
1987
) is intriguing but needs to be interpreted in light of
the unresolved peculiarity that this observed absence is associated with the only centromere in these genomes that
does not undergo sister centromere pairing in meiosis. The
absence of CENP-B on various analphoid neocentromeres (Choo, 1997b
) also does not per se exclude functions for
CENP-B (or
-satellite DNA) on normal centromeres
since these neocentromeres may have gained centromere
function through some epigenetic modifications (Karpen
and Allshire, 1997
). Finally, the observation that the
-satellite DNA-containing centromeres of African green monkey lacks binding sites for CENP-B (Goldberg et al., 1996
)
could be because monkeys have evolved a different and
functionally equally important way to compensate for their
CENP-B deficiency.
In addition to the uncertainty on mitotic functions, the
requirement of CENP-B in meiosis has also not previously
been investigated. Such an investigation is especially important in light of recent evidence indicating a specific role
of centromeric heterochromatin in meiotic chromosome
segregation in Drosophila (Dernburg et al., 1996; Karpen
et al., 1996
), and in view of the fact that CENP-B binds directly to centromeric heterochromatic DNA and is thought to be involved in the higher order organization of this
DNA (Yoda et al., 1992
; Muro et al., 1992
). The production and characterization of Cenpb null mice allows several conclusions regarding the functional significance of
this protein in mitosis and meiosis to be drawn. The apparently normal growth and reproductive characteristics of
these mice indicate that Cenpb is not essential for either of
these cell division processes. This result is confirmed by direct cytogenetic and FACS analyses of chromosomes,
which have not detected any karyotypic abnormality in the
/
mice. A closer look at the different stages of male
meiosis in these animals has similarly not revealed any obvious defect. The protein also appears not to be required
for the structural integrity of the centromere-kinetochore
complex since the centromeres of Cenpb-deficient cells
continue to show clear association with at least two of the
functionally important centromere proteins: Cenpc and
Cenpe. The observation that Cenpb is not essential for mitosis or meiosis therefore drastically contrasts the severe
phenotypes previously reported for the cbh+ and abp1
null yeast strains (Halverson et al., 1997
; Lee et al., 1997
),
suggesting that the functions of these homologues have diverged significantly.
Despite the lack of any detectable mitotic and meiotic
phenotype, adult Cenpb null mice are significantly smaller
in body weight compared with age- and sex-matched wild-type or heterozygous mice. In addition, the /
male testes show a pronounced reduction both in weight (by 30%)
and in total sperm count (by 39.5%) compared with wild-type animals. Extensive histological analysis of many different organs and direct measurement of FSH and LH
hormones have not revealed any abnormality. It is possible that the absence of CENP-B may have a subtle effect
on centromere assembly and function, and result in a slight
reduction in the rate of progression through one or more
phases of the cell cycle, in the efficiency of chromosome
capture by microtubules, and/or chromosome movement. Alternatively, a small number of cells beyond our detection ability may not enter mitosis at all, or carry severe
chromosomal abnormality, resulting in loss of valuable
cells from the cycling cell population sufficiently to cause a
significant weight reduction over time. The possibility that
the weight phenotype is caused by some as yet unidentified hormonal or metabolic factors cannot be discounted at present.
In formulating any model on the role of CENP-B, the
following observations need to be taken into consideration: (a) the protein is highly conserved in divergent
mammals; (b) the protein binds centromeric repetitive
DNA via the CENP-B-box motif and possesses dimerization properties that allow the protein to cross-link centromeric repeats (Yoda et al., 1992; Muro et al., 1992
); (c)
CENP-B box and CENP-B protein are not detected on
human and mouse Y chromosomes, and are poorly represented on centromeric subdomains of certain human chromosomes (e.g.
13-II,
14-II, and
21-II domains of chromosomes 13, 14, and 21; Trowell et al., 1993
; Ikeno et al., 1994
; Choo, 1997a); (d) the centromeres of African green
monkey are composed largely of
-satellite DNA containing few if any binding sites for CENP-B (Goldberg et al.,
1996
); (e) the protein is found on both active and inactive
centromeres of dicentric chromosomes (Earnshaw et al.,
1989
); (f) despite the lack of CENP-B binding, human
neocentromeres derived from noncentromeric chromosomal regions display full mitotic functions (Voullaire et al.,
1993
; Depinet et al., 1997
; du Sart et al., 1997
; Choo,
1997b
); and (g) the protein is neither essential for mitosis
nor meiosis in Cenpb knockout mice.
Based on the sequence similarity between CENP-B and
certain transposases, Kipling and Warburton (1997) suggested that CENP-B may share the DNA strand cleavage
function of transposases and promote nicks adjacent to
CENP-B boxes to facilitate the evolution and maintenance
of satellite DNA. This model does not, however, take into
consideration the dimerization property of CENP-B, offers no direct evidence for the proposed strand cleavage
function, and cannot explain the absence of CENP-B on
human and mouse Y chromosomes or the paucity of this
protein on the
-satellite-containing centromeres of African green monkey and centromeric subdomains of at least
some human chromosomes. Here we present a different model that satisfies all the reported observations. Simply
stated, we propose that the role of CENP-B is to organize
structurally the great abundance of repetitive DNA found
in the centromere, with this role neither being exclusive to
CENP-B nor directly essential or sufficient for centromere
function. Our model further implicates the existence of a
functionally related but perhaps lower-affinity protein, arbitrarily designated CENP-Z, that can perform a similar
function to CENP-B in its absence (Fig. 4). The proposal
of a role for CENP-B in organizing centromeric repeats is
based on the biochemical (observation b above), cytogenetic (observation e above), and, indirectly, evolutionary
(observation a above) properties of the protein. The suggestion that this role is not exclusive to CENP-B is based
on the fact that centromeric repetitive DNAs with little or
no CENP-B binding (observations c, d and g above) are
nonetheless organized in a way that is compatible with
centromere function. The suggestion that CENP-B is neither essential nor sufficient for centromere function is evident from the fact that the protein can be totally absent on
centromeres without detrimental effects on chromosome
segregation (observations c, d, f, and g above), and that its
mere presence on some centromeres does not immediately
lead to centromere activity (observation e above).
|
A nuclear protein, pJ (Gaff et al., 1994
), has previously
been described that binds a 9-bp sequence motif, GTG(G/
A)AAAAG, that is present as an alternative nucleotide
configuration to the CENP-B-box motif on a significant
proportion (~14%) of
-satellite monomers, including
those that constitute the centromere of the human Y chromosome and the various CENP-B box-poor human centromeric subdomains (Tyler-Smith and Brown, 1987
; Alexandrov et al., 1993
; Vissel and Choo, 1992
; Romanova
et al., 1996
). A recent study has further demonstrated that
pJ
box-containing
-satellite monomers are the primordial DNA from which the CENP-B box-containing monomers arose (Romanova et al., 1996
). In preliminary studies, we have detected pJ
proteins in the nuclear extracts
of the +/+, +/
, and
/
Cenpb knockout mice, and in
that of the African green monkey (D.F. Hudson and
K.H.A. Choo, unpublished data). In addition, the consensus sequence for the CENP-B box-poor
-satellite DNA of African green monkey has been shown to contain a perfectly conserved pJ
-box motif GTGAAAAAG (Yoda et
al., 1996
). These analyses therefore suggest that pJ
may be
a suitable candidate for the proposed CENP-Z protein. The
availability of the Cenpb null mice should provide an amenable system to allow the further study of the role of Cenpb,
as well as investigation of the proposed CENP-Z protein.
![]() |
Footnotes |
---|
Received for publication 12 January 1998 and in revised form 25 February 1998.
Address all correspondence to Dr. Andy Choo, The Murdoch Institute for Research into Birth Defects, Royal Children's Hospital, Flemington Road, Parkville 3052, Australia. Phone: 61-3-9345-5045; FAX: 61-3-9348-1391; E-mail: choo{at}cryptic.rch.unimelb.edu.auWe thank L. Robertson, J. Mann, and S. Delaney for STO-NeoR, W9.5, W9.8, and R1 cell lines, T. Yen, S. Wittingham, and T. Kaye for antibodies, P. Mountford and A. Smith for IRES-neo and IRES-hygro markers, S. Gazeas and R. Breslin for mouse breeding, R. O'Dowd for technical assistance, C.W. Chow for histology, S. Bol and A. Fryga for flow sorting, A. O'Connor for DSP assay, L. Wilton and S. Pompolo for tissue dissection, and Qing Song for stereology. This work was supported by the National Health and Medical Research Council of Australia. KHA Choo is a Senior Associate of the Univeristy of Melbourne and a Principal Research Fellow of the National Health and Medical Research Council of Australia.
![]() |
Abbreviations used in this paper |
---|
ASC, advanced sperm count; ES, embryonic stem; RT, reverse transcription.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Alexandrov, I.A., L.I. Medvedev, T.D. Mashkova, L.L. Kisselev, L.Y. Romanova, and Y.B. Yurov. 1993. Definition of a new alpha satellite suprachromosomal family characterized by monomeric organization. Nucl. Acids Res. 21: 2209-2215 [Abstract]. |
2. | Bejarano, L.A., and M.M. Valdivia. 1996. Molecular cloning of an intronless gene for the hamster centromere antigen CENP-B. Biochim. Biophys. Acta 1307: 21-25 |
3. | Bernat, R.L., G.G. Borisy, N.F. Rothfield, and W.C. Earnshaw. 1990. Injection of anticentromere antibodies in interphase disrupts events required for chromosome movement in mitosis. J. Cell Biol 111: 1519-1533 [Abstract]. |
4. | Bernat, R.L., M.R. Delannoy, N.F. Rothfield, and W.C. Earnshaw. 1991. Disruption of centromere assembly during interphase inhibits kinetochore morphogenesis and function in mitosis. Cell. 66: 1229-1238 |
5. | Brenner, S., D. Pepper, M.W. Berns, E. Tan, and B.R. Brinkley. 1981. Kinetochore structure, duplication and distribution in mammalian cells: analysis by human autoantibodies from scleroderma patients. J. Cell Biol 91: 95-102 [Abstract]. |
6. | Brinkley, B.R., I. Ouspenski, and R.P. Zinkowski. 1992. Structure and molecular organization of the centromere-kinetochore complex. Trends Cell. Biol. 2: 14-21 . |
7. | Brown, M.. 1995. Sequence similarities between the yeast chromosome segregation protein Mif2 and the mammalian centromere protein CENP-C. Gene. 160: 111-116 |
8. | Brown, M.T., L. Goetsch, and L.H. Hartwell. 1993. MIF2 is required for mitotic spindle integrity during anaphase spindle elongation in Saccharomyces cerevisiae. J. Cell Biol. 123: 387-403 [Abstract]. |
9. |
Buzin, C.H.,
J.R. Mann, and
J. Singer-Sam.
1994.
Quantitative RT-PCR assays
show Xist RNA levels are low in mouse female adult tissue, embryos and
embryoid bodies.
Development.
120:
3529-3536
|
10. | Caput, D., B. Beutler, K. Hartog, R. Thayer, S. Brown-Shimer, and A. Cerami. 1986. Identification of a common nucleotide sequence in the 3'-untranslated region of mRNA molecules specifying inflammatory mediators. Proc. Natl. Acad. Sci. USA. 83: 1670-1674 [Abstract]. |
11. | Choo, K.H.A. 1997a. The Centromere. Oxford University Press, Oxford, United Kingdom. 304 pp. |
12. | Choo, K.H.A.. 1997b. Centromere DNA dynamics: latent centromeres and neocentromere formation. Am. J. Hum. Genet 61: 1225-1233 |
13. | Choo, K.H.A., B. Vissel, A. Nagy, E. Earle, and P. Kalitsis. 1991. A survey of the genomic distribution of alpha satellite DNA on all human chromosomes and derivation of a new consensus sequence. Nucl. Acids Res. 19: 1179-1182 |
14. | Cooke, C.A., R.L. Bernat, and W.C. Earnshaw. 1990. CENP-B: a major human centromere protein located beneath the kinetochore. J. Cell Biol. 110: 1475-1488 [Abstract]. |
15. |
Depinet, T.W.,
J.L. Zackowski,
W.C. Earnshaw,
S. Kaffe,
G.S. Sekhon,
R. Stallard,
B.A. Sullivan,
G.H. Vance,
D.L. VanDyke,
H.F. Willard, et al
.
1997.
Characterization of neo-centromeres in marker chromosomes lacking detectable alpha-satellite DNA.
Hum. Mol. Genet
6:
1195-1204
|
16. | Dernburg, A.F., J.W. Sedat, and R.S. Hawley. 1996. Direct evidence of a role of heterochromatin in meiotic chromosome segregation. Cell. 86: 135-146 |
17. | du Sart, D., M.R. Cancilla, E. Earle, J. Mao, R. Saffery, K.M. Tainton, P. Kalitsis, J. Martyn, A.E. Barry, and K.H.A. Choo. 1997. A functional neo-centromere formed through activation of a latent human centromere and consisting of non-alpha-satellite DNA. Nat. Genet. 16: 144-153 |
18. |
Earnshaw, W.C., and
A.M. MacKay.
1994.
Role of nonhistone proteins in the
chromosomal events of mitosis.
FASEB J.
8:
947-956
|
19. | Earnshaw, W.C., H. Ratrie, and G. Stetten. 1989. Visualization of centromere proteins CENP-B and CENP-C on a stable dicentric chromosome in cytological spreads. Chromosoma. 98: 1-12 |
20. | Earnshaw, W.C., and N. Rothfield. 1985. Identification of a family of human centromere proteins using autoimmune sera from patients with scleroderma. Chromosoma. 91: 313-321 |
21. | Earnshaw, W.C., K.F. Sullivan, P.S. Machlin, C.A. Cooke, D.A. Kaiser, T.D. Pollard, N.F. Rothfield, and D.W. Cleveland. 1987. Molecular cloning of cDNA for CENP-B, the major human centromere autoantigen. J. Cell Biol. 104: 817-829 [Abstract]. |
22. | Fritzler, M.J., and T.D. Kinsella. 1980. The CREST syndrome: a distinct serologic entity with anticentromere antibodies. Am. J. Med. 69: 520-526 |
23. |
Fukagawa, T., and
W.R.A. Brown.
1997.
Efficient conditional mutation of the
vertebrate CENP-C gene.
Hum. Mol. Genet
6:
2301-2308
|
24. | Gaff, C., D. du Sart, P. Kalitsis, R. Iannello, A. Nagy, and K.H.A. Choo. 1994. A novel nuclear protein binds centromeric alpha satellite DNA. Hum. Mol. Genet 3: 711-716 [Abstract]. |
25. | Goldberg, I.G., A.F. Sawhney, A.F. Pluta, P.E. Warburton, and W.C. Earnshaw. 1996. Surprising deficiency of CENP-B binding sites in African green monkey alpha satellite DNA: implications for CENP-B function at centromeres. Mol. Cell. Biol. 16:5156-5168. |
26. | Haaf, T., A.G. Mater, J. Wienberg, and D.C. Ward. 1995. Presence and abundance of CENP-B box sequences in great ape subsets of primate-specific alpha satellite DNA. J. Mol. Evol. 41: 487-491 |
27. | Haaf, T., and D.C. Ward. 1995. Rabl orientation of CENP-B box sequences in Tupaia belangeri fibroblasts. Cytogenet. Cell Genet. 70: 258-262 |
28. |
Halverson, D.,
M. Baum,
J. Stryker,
J. Carbon, and
L. Clarke.
1997.
A centromere DNA-binding protein from fission yeast affects chromosome segregation and has homology to human CENP-B.
J. Cell Biol.
136:
487-500
|
29. | Ikeno, M., H. Masumoto, and T. Okazaki. 1994. Distribution of CENP-B boxes reflected in CREST centromere antigenic sites on long-range alpha-satellite DNA arrays of human chromosome 21. Hum. Mol. Genet 3: 1245-1257 [Abstract]. |
30. | Jeppesen, P., A. Mitchell, B. Turner, and P. Perry. 1992. Antibodies to defined histone epitopes reveal variations in chromatin conformation and underacetylation of centric heterochromatin in human metaphase chromosomes. Chromosoma. 101: 322-332 |
31. |
Kalitsis, P.,
K.J. Fowler,
E. Earle,
J. Hill, and
K.H.A. Choo.
1998.
Targeted disruption of mouse centromere protein C gene leads to mitotic disarray and
early embryo death.
Proc. Natl. Acad. Sci. USA.
95:
1136-1141
|
32. | Karpen, G.H., and R.C. Allshire. 1997. The case for epigenetic effects on centromere identity and function. Trends Genet. 13: 489-496 |
33. | Karpen, G.H., M.-H. Le, and H. Le. 1996. Centric heterochromatin and the efficiency of achiasmate disjunction in Drosophila female meiosis. Science. 273: 118-273 [Abstract]. |
34. | Kipling, D., A.R. Mitchell, H. Matsumoto, H.E. Wilson, L. Nicol, and H.J. Cooke. 1995. CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli. Mol. Cell. Biol. 15: 4009-4020 [Abstract]. |
35. | Kipling, D., and P.E. Warburton. 1997. Centromeres, CENP-B and Tigger too. Trends Genet 13: 141-145 |
36. | Kipling, D., H.E. Wilson, A.R. Mitchell, B.A. Taylor, and H.J. Cooke. 1994. Mouse centromere mapping using oligonucleotide probes that detects variants of the minor satellite. Chromosoma. 103: 46-55 |
37. | Kitagawa, K., H. Masumoto, M. Ikeda, and T. Okazki. 1995. Analysis of protein-DNA and protein-protein interactions of centromere protein B (CENP-B) and properties of the DNA-CENP-B complex in the cell cycle. Mol. Cell. Biol 15: 1602-1612 [Abstract]. |
38. | Laursen, H.B., A.L. Jargensen, C. Jones, and A.L. Bak. 1992. Higher rate of evolution of X chromosome alpha-repeat DNA in human than in the great apes. EMBO J. 11:2367-2372. |
39. |
Lee, J.,
J.A. Huberman, and
J. Hurwitz.
1997.
Purification and characterization
of a CENP-B homologue protein that binds to the centromeric K-type repeat DNA of Schizosaccharomyces pombe.
Proc. Natl. Acad. Sci. USA.
94:
8427-8432
|
40. | Masumoto, H., K. Sugimoto, and T. Okazaki. 1989. Alphoid satellite DNA is tightly associated with centromere antigens in human chromosomes throughout the cell cycle. Exp. Cell Res. 181: 181-196 |
41. | Meluh, P., and D. Koshland. 1995. Evidence that the MIF2 gene of Saccharomyces cerevisiae encodes a centromere protein with homology to the mammalian centromere protein CENP-C. Mol. Cell. Biol. 6: 793-807 . |
42. | Moroi, Y., A.L. Hartman, P.K. Nakane, and E.M. Tan. 1981. Distribution of kinetochore (centromere) antigen in mammalian cell nuclei. J. Cell Biol. 90: 254-259 [Abstract]. |
43. | Mullner, E.W., and L.C. Kühn. 1988. A stem-loop in the 3' untranslated region mediates iron-dependent regulation of transferrin receptor mRNA stability in the cytoplasm. Cell. 53: 815-825 |
44. | Mountford, P., B. Zevnik, A. Duwel, J. Nichols, M. Li, C. Dani, M. Robertson, I. Chambers, and A. Smith. 1994. Dicistronic targeting constructs: Reporters and modifiers of mammalian gene expression. Proc. Natl. Acad. Sci. USA. 91: 4303-4307 [Abstract]. |
45. | Muro, Y., H. Masumoto, K. Yoda, N. Nozaki, M. Ohashi, and T. Okazaki. 1992. Centromere protein B assembles human centromeric alpha-satellite DNA at the 17-bp sequence, CENP-B box. J. Cell Biol. 116: 585-596 [Abstract]. |
46. |
Nagy, A.,
J. Rossant,
R. Nagy,
W. Abramow-Newerly, and
J.C. Roder.
1993.
Derivation of completely cell culture-derived mice from early-passage embryonic stem cells.
Proc. Natl. Acad. Sci. USA.
90:
8424-8428
|
47. | Ohashi, H., K. Wakui, K. Ogawa, T. Okano, N. Niikawa, and Y. Fukushima. 1994. A stable acentric marker chromosome: possible existence of an intercalary ancient centromere at distal 8p. Am. J. Hum. Genet. 55:1202-1208. |
48. | Page, S.L., W.C. Earnshaw, K.H.A. Choo, and L.G. Shaffer. 1995. Further evidence that CENP-C is a necessary component of active centromeres: studies of a dic(X;15) with simultaneous immunofluorescence and FISH. Hum. Mol. Genet. 4: 289-294 [Abstract]. |
49. | Palmer, D.K., and R.L. Margolis. 1985. Kinetochore components recognized by human autoantibodies are present on mononucleosomes. Mol. Cell. Biol. 5: 173-186 |
50. | Palmer, D.K., K. O'Day, M.H. Wener, B.S. Andrews, and R.L. Margolis. 1987. A 17-kD centromere protein (CENP-A) copurifies with nucleosome core particles and with histones. J. Cell Biol. 104: 805-815 [Abstract]. |
51. | Pietras, D.F., K.L. Bennett, L.D. Siracusa, M. Woodworth-Gutai, V.M. Chapman, K.W. Gross, C. Kane-Haas, and N.D. Hastie. 1983. Construction of a small Mus musculus repetitive DNA library: Identification of a new satellite sequence in Mus musculus. Nucl. Acids Res. 11: 6965-6983 [Abstract]. |
52. | Pluta, A.F., A.M. Mackay, A.M. Ainsztein, I.G. Goldberg, and W.C. Earnshaw. 1995. The centromere: hub of chromosomal activities. Science. 270: 1591-1594 [Abstract]. |
53. | Pluta, A.F., N. Saitoh, I. Goldberg, and W.C. Earnshaw. 1992. Identification of a subdomain of CENP-B that is necessary and sufficient for localization to the human centromere. J. Cell Biol 116: 1081-1093 [Abstract]. |
54. | Rattner, J.B.. 1991. The structure of the mammalian centromere. Bioessays. 13: 51-56 |
55. | Robb, G.W., R.P. Amann, and G.J. Killian. 1978. Daily sperm production and epididymal sperm reserves of pubertal and adult rats. J. Reprod. Fertil. 54: 103-107 [Abstract]. |
56. | Robertson, E.J. 1987. Embryo-derived stem cell lines. In Teratocarcinomas and Embryo Stem Cells: A Practical Approach, E.J. Robertson, editor. IRL Press, Oxford, United Kingdom. 71-112. |
57. |
Romanova, L.Y.,
G.V. Deriagin,
T.D. Mashkova,
I.G. Tumeneva,
A.R. Mushegian,
L.L. Kisselev, and
I.A. Alexandrov.
1996.
Evidence for selection in
evolution of alpha satellite DNA: the central role of CENP-B/pJ![]() |
58. | Saitoh, H., J. Tomkiel, C.A. Cooke, H. Ratrie III., M. Maurer, N.F. Rothfield, and W.C. Earnshaw. 1992. CENP-C, an autoantigen in scleroderma is a component of the human inner kinetochore plate. Cell. 70: 115-125 |
59. | Seki, N., T. Saito, K. Kitagawa, H. Masumoto, T. Okazaki, and T.A. Horit. 1994. Mapping of the human centromere protein B gene (CENP-B) to chromosome 20p13 by fluorescence in situ hybridization. Genomics. 24: 187-188 |
60. | Simerly, C., R. Balczon, B.R. Brinkley, and G. Schatten. 1990. Microinjected kinetochore antibodies interfere with chromosome movement in meiotic and mitotic mouse oocytes. J. Cell Biol. 111: 1491-1504 [Abstract]. |
61. | Stoler, S., K.C. Keith, K.E. Curnick, and M. Fitzgerald-Hayes. 1995. A mutation in CSE4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis. Genes Dev. 9: 573-586 [Abstract]. |
62. | Sullivan, B.A., and S. Schwartz. 1995. Identification of centromeric antigens in dicentric Robertsonian translocations: CENP-C and CENP-E are necessary components of functional centromeres. Hum. Mol. Genet. 4: 2189-2197 [Abstract]. |
63. | Sullivan, K.F., and C.A. Glass. 1991. CENP-B is a highly conserved mammalian centromere protein with homology to the helix-loop-helix family of proteins. Chromosoma. 100: 360-370 |
64. | Sullivan, K.F., M. Hechenberger, and K. Masri. 1994. Human CENP-A contains a histone H3 related histone fold domain that is required for targeting to the centromere. J. Cell Biol. 127: 581-592 [Abstract]. |
65. | Sugimoto, K., H. Yata, and M. Himemo. 1993. Mapping of the human CENP-B gene to chromosome 20 and the CENP-C gene to chromosome 12 by a rapid cycle DNA amplification procedure. Genomics. 17: 240-242 |
66. | Tomkiel, J., C.A. Cooke, H. Saitoh, R.L. Bernat, and W.C. Earnshaw. 1994. CENP-C is required for maintaining proper kinetochore size and for a timely transition to anaphase. J. Cell Biol. 125: 531-545 [Abstract]. |
67. | Trowell, H.E., A. Nagy, B. Vissel, and K.H.A. Choo. 1993. Long-range analyses of the centromeric regions of human chromosomes 13, 14 and 21: identification of a narrow domain containing two key centromeric DNA elements. Hum. Mol. Genet 2: 1639-1649 [Abstract]. |
68. | Tyler-Smith, C., and W.R. Brown. 1987. Structure of the major block of alphoid satellite DNA on the human Y chromosome. J. Mol. Biol 195: 457-470 |
69. | Vissel, B., and K.H. Choo. 1992. Evolutionary relationships of multiple alpha satellite subfamilies in the centromeres of human chromosomes 13, 14, and 21. J. Mol. Evol. 35: 137-146 |
70. | Volobouev, V., N. Voght, E. Viegas-Pequignot, B. Malfoy, and B. Dutrillaux. 1995. Characterization and chromosomal location of two repeated DNAs in three Gerbillus species. Chromosoma. 104:252-259. |
71. | Voullaire, L.E., H.R. Slater, V. Petrovic, and K.H.A. Choo. 1993. A functional marker centromere with no detectable alpha-satellite, satellite III, or CENP-B protein: activation of a latent centromere? Am. J. Hum. Genet 52: 1153-1163 |
72. | Wreford, N.G.. 1995. Theory and practice of stereological techniques applied to the estimation of cell number and nuclear volume in the testis. Microscopy Res. Tech. 32: 423-436 . |
73. | Wu, Z.A., W-X. Liu, C. Murphy, and J. Gall. 1990. Satellite 1 DNA sequence from genomic DNA of the giant panda Ailuropoda melanoleuca. Nucl. Acids Res 18: 1054 |
74. | Wilson, R.R., K. Anscough, C. Anderson, M. Baynes, J. Berks, J. Bonfield, M. Burton, T. Connell, J. Copsey, A. Cooper, et al . 1994. 2.2. Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature. 368: 32-38 |
75. | Yen, T.J., D.A. Compton, D. Wise, R.P. Zinkowski, B.R. Brinkley, W.C. Earnshaw, and D.W. Cleveland. 1991. CENP-E a novel human centromere-associated protein required for progression from metaphase to anaphase. EMBO J. 10: 1245-1254 [Abstract]. |
76. | Yen, T.J., G. Li, B.T. Schaar, I. Szilak, and D.W. Cleveland. 1992. CENP-E is a putative kinetochore motor that accumulates just before mitosis. Nature 359: 536-539 |
77. | Yoda, K., K. Kitagawa, H. Masumoto, Y. Muro, and T. Okazaki. 1992. A human centromere protein, CENP-B, has a DNA binding domain containing four potential alpha helices at the NH2 terminus, which is separable from dimerizing activity. J. Cell Biol. 119: 1413-1427 [Abstract]. |
78. | Yoda, K., T. Nakamura, H. Masumoto, N. Suzuki, K. Kitagawa, M. Nakano, A. Shinjo, and T. Okazaki. 1996. Centromere protein B of African green monkey cells: Gene structure, cellular expression, and centromeric localization. Mol. Cell. Biol. 16: 5169-5177 [Abstract]. |