§
* Department of Medicine, Department of Microbiology and Immunology, § Howard Hughes Medical Institute, University of
California, San Francisco, San Francisco, California 94143
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Abstract. Binding of a T cell to an appropriate antigen-presenting cell (APC) induces the rapid reorientation
of the T cell cytoskeleton and secretory apparatus towards the cell-cell contact site in a T cell antigen receptor (TCR) and peptide/major histocompatibility complex-dependent process. Such T cell polarization
directs the delivery of cytokines and cytotoxic mediators towards the APC and contributes to the highly selective and specific action of effector T cells. To study
the signaling pathways that regulate cytoskeletal rearrangements in T lymphocytes, we set up a conjugate formation assay using Jurkat T cells as effectors and
cell-sized latex beads coated with various antibodies as
artificial APCs. Here, we report that beads coated with
antibodies specific for the TCR-CD3 complex were sufficient to induce T cell polarization towards the bead
attachment site, as judged by reorientation of the microtubule-organizing center (MTOC) and localized actin polymerization. Thus, these cytoskeletal changes
did not depend on activation of additional coreceptors.
Moreover, single subunits of the TCR complex, namely
TCR- and CD3
, were equally effective in inducing cytoskeletal polarization. However, mutagenesis of the
immunoreceptor tyrosine-based activation motifs
(ITAMs), present three times in TCR-
and once in
CD3
, revealed that the induction of cytoskeletal rearrangements required the presence of at least one intact
ITAM. In agreement with this result, lack of functional
Lck, the protein tyrosine kinase responsible for ITAM
phosphorylation, abolished both MTOC reorientation
and polarized actin polymerization. Both inhibitor and
transient overexpression studies demonstrated that MTOC reorientation could occur in the absence of Ras
activation. Our results suggest that APC-induced T cell
polarization is a TCR-mediated event that is coupled to
the TCR by the same signaling motif as TCR-induced
gene activation, but diverges in its distal signaling requirements.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
POLARIZATION of a T cell response towards a triggering antigen-presenting cell (APC)1 is thought to contribute to the specificity of the immune response. Upon encountering an APC, T cells rapidly undergo cytoskeletal polarization, which includes the formation of a
tight collar of polymerized actin at the T cell-APC interface and the reorientation of the microtubule-organizing
center (MTOC) towards the bound APC (Geiger et al.,
1982; Ryser et al., 1982
). Whereas F-actin accumulation at
the cell-cell interface was suggested to stabilize and favor
continuous T cell antigen receptor (TCR)-antigen interactions (Valitutti et al., 1995b
), MTOC reorientation is
thought to position the T cell secretory apparatus into
close proximity with the APC. Indeed, several studies
showed that repositioning of the MTOC was accompanied
by the polarized concentration of cytokines and cytotoxic
mediators at the T cell-APC/target interface (Kupfer and
Dennert, 1984
; Kupfer et al., 1991
, 1994). Moreover, Poo
et al. (1988)
have demonstrated that limited TCR cross-linking in a cloned helper T cell line triggered the release
of cytokines preferentially over the area of receptor cross-linking. Thus, the engagement of only a fraction of TCRs
on a helper T cell results in the polarized delivery of cytokines towards the site of the stimulus.
Cytoskeletal polarization of a T cell is dependent on the
presence of specific antigen (Kupfer and Singer, 1989),
suggesting the involvement of a TCR-mediated signaling
pathway. A variety of cellular responses, including gene
activation, proliferation, and secretion of cytokines and
cytotoxic mediators, have been reported to be initiated by
TCR engagement. Interestingly, activation of Jurkat T
cells with immobilized TCR-specific antibodies could induce
actin polymerization and formation of F-actin-rich pseudopods, suggesting that TCR-mediated signaling pathways may
indeed regulate cytoskeletal organization (Melamed et al.,
1991
). Furthermore, a recent report implies a role for the
small GTPase CDC42 in APC-mediated T cell polarization (Stowers et al., 1995
). Members of the Rho subfamily
of small GTPases (Rho, Rac, CDC42) are evolutionary conserved regulators of the actin cytoskeleton in a variety
of different cell systems (Hall, 1994
). Consequently, TCR-mediated signals might activate small GTPases by an as
yet unidentified mechanism. However, T cell-APC conjugate formation involves the clustering and engagement of
various other T cell surface receptors besides TCR-antigen interactions, including the CD8/CD4 coreceptors and
integrins (Kupfer and Singer, 1989
; Kupfer et al., 1987
). It
is conceivable that triggering of these additional receptors is required for or at least contributes to APC-induced T
cell polarization.
The TCR is coupled to intracellular signaling pathways
by two noncovalently associated signal-transducing complexes, namely the CD3 (,
, and
) and the TCR-
chains. Signaling through these complexes requires a conserved sequence motif (YxxLx(6-8)YxxL), termed the immunoreceptor tyrosine-based activation motif (ITAM) (Irving and Weiss, 1991
; Romeo and Seed, 1991
). The
CD3 and TCR-
chains each contain one and three
ITAMs, respectively. Upon TCR engagement, the tyrosine residues in the ITAMs are rapidly phosphorylated by
the Src-family protein tyrosine kinase (PTK) Lck (van
Oers et al., 1996
) and serve as docking sites for src-homology-domain 2 (SH2) containing signaling molecules such as
the PTKs of the Syk/zeta-associated protein 70 (ZAP-70)
family. After recruitment, Syk/ZAP-70 is activated by
phosphorylation and contributes to the initiation of downstream signaling events such as calcium mobilization and
activation of the Ras pathway. Single CD3 and TCR-
chains can independently activate a variety of qualitatively similar proximal and distal signaling events (Irving and
Weiss, 1991
; Letourneur and Klausner, 1991
; Romeo and
Seed, 1991
; Shinkai et al., 1995
), suggesting that the presence of multiple ITAMs in the TCR mainly serves the purpose of signal amplification. However, amino acids surrounding the ITAMs differ in the CD3/TCR chains and
have been shown to bind to distinct SH2-containing signaling molecules (Osman et al., 1995
, 1996
; Songyang et al., 1993
). This suggests that, in addition to signal amplification, distinct ITAMs might couple the receptor to qualitatively different signaling pathways. For example, chimeric
proteins containing the cytoplasmic tail of CD3
or TCR-
differ in their ability to induce apoptosis in a murine T cell
line (Combadiere et al., 1996
). Furthermore, the third
TCR-
ITAM and the CD3
ITAM have been implicated
in coupling the TCR to the actin cytoskeleton in an activation-dependent manner (Rozdzial et al., 1995
). Thus, individual subunits might couple the TCR to effector molecules involved in the regulation of cytoskeletal changes.
To investigate the role of TCR-mediated signaling pathways in APC-induced T cell polarization, we set up a conjugation assay using Jurkat T cells or mutants derived from it as effector cells, with antibody-coated, cell-sized latex beads as APCs. We show here that TCR cross-linking alone is sufficient to induce MTOC polarization and actin polymerization at the T cell-bead interface. Cytoskeletal reorientation required the presence of at least one intact ITAM. In support of this result, no cytoskeletal changes could be observed in the Lck-deficient Jurkat mutant JCaM1.6. Furthermore, our studies demonstrate that MTOC reorientation occurs in the absence of Ras activation. Our results imply that APC-induced T cell polarization is a TCR-mediated event that is coupled to the receptor by the same signaling motif as TCR-mediated gene activation, but diverges in its distal signaling requirements, since Ras is not required. The assay described in this study might be a useful tool to characterize signaling molecules involved in T cell polarization.
![]() |
Materials and Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cells and Reagents
The Jurkat T cell subclone E6, JCaM1.6 (Goldsmith et al., 1988) and large
T antigen (TAg) Jurkat cells (kindly provided by Dr. G. Crabtree, Stanford University, Palo Alto, CA; Clipstone and Crabtree, 1992
) were maintained in RPMI 1640 medium supplemented with 5% fetal calf serum (Intergen Co., Purchase, NY), 2 mM glutamine, 50 U/ml penicillin, and 50 µg/ml streptomycin. Jurkat-derived stable clones were cultured in complete medium containing 10% FCS and 2 mg/ml G418 (GIBCO BRL,
Gaithersburg, MD). JCaM1.6/Lck cells (Straus and Weiss, 1992
) were
maintained in complete medium containing 10% FCS and 250 µg/ml hygromycin (GIBCO BRL). Poly-L-lysine was obtained from Sigma Chemical Co. (St. Louis, MO). The MAPKK inhibitor PD 098059 and Wortmannin were purchased from Calbiochem-Novabiochem Corp. (San Diego,
CA). Polystyrene latex microspheres (diameter 6 µm) were purchased
from Polysciences Inc. (Warrington, PA). Antibodies were absorbed to
the beads as previously described (Mescher, 1992
). Briefly, 5-10 µg of purified antibody were mixed with 107 polystyrene beads in a final volume of
1 ml PBS, and incubated for 90 min at room temperature with constant
tumbling. Beads were then blocked in 1.5 ml of PBS/1% BSA for 30 min.
After three washes in PBS, latex beads were resuspended in PBS and
stored at 4°C. Efficient antibody absorption was verified by flow cytometry.
Antibodies
Antibodies used for stimulation and immunofluorescence microscopy are
as follows: the mAb C305 (IgM) specifically recognizes the Jurkat Ti chain (Weiss and Stobo, 1984
). Leu 4 (IgG1) is directed against the human
CD3
chain. RBC4 (IgM) recognizes the transferrin receptor. The mAb
9.1 (IgG3) is specific for human CD2 (Yang et al., 1986
). Mouse mAb
OKT8 recognizes an extracellular epitope of human CD8 and was acquired from American Type Culture Collection (Rockville, MD). The
mAb 7G7B6 is directed against murine CD25 (Tac) and was obtained
from American Type Culture Collection. A mouse mAb to human CD11a
(IgG1, SPV-L7) was purchased from Zymed Laboratories, Inc. (S. San
Francisco, CA). A rat mAb to
-tubulin (YOL1/34) was obtained from
Harlan Sera-Laboratories (Crawley, UK) and was detected with an FITC-conjugated, affinity-purified donkey anti-rat (Fab
)2 antibody (Jackson
ImmunoResearch Laboratories, Inc., West Grove, PA). F-actin was detected with rhodamin-phalloidin (Molecular Probes, Inc., Menlo Park,
CA). Antiphosphotyrosine mAb 4G10 was purchased from Upstate Biotechnology Inc. (Lake Placid, NY). An mAb against human Ha-Ras was
purchased from Transduction Laboratories (Lexington, KY).
Plasmids
The dominant-negative ZAP-70 constructs SH2 (N+C) and SH2 (N+*C)
are described elsewhere (Qian et al., 1996). The N17Ras plasmid was a
kind gift from D. Cantrell (ICRF, London, UK).
Chimera Construction and Clones
Stable clones expressing the TT- chimeras were kindly provided by Dr.
Nicolai S.C. van Oers. Plasmids encoding for chimeric proteins containing
the external and transmembrane portions of CD25 fused to the cytoplasmic tails of either CD3
(TT-
) or TCR-
(TT-
) were a gift from Dr. R.D.
Klausner (National Cancer Institute, Bethesda, MD; Letourneur and
Klausner, 1991
). A truncated version of TT-
was generated by PCR mutagenesis of the original TT-
To construct (kindly provided by Dr. R.D.
Klausner) using the following primers: 5
primer (within Tac): 5
ACAGATCTCCAGGTAGCAGTG 3
; 3
primer (within CD3
): 5
TCGATATCACCTATTCTTGAGCCCACT 3
. Wild-type TT-
in pCDL
SR
was replaced by the BglII/EcoRV-digested PCR fragment. The new
truncated TT-
encompasses the three first amino acids of the CD3
cytoplasmic tail. All constructs were subcloned into pcDNA3 (Invitrogen
Corp., San Diego, CA) and transfected into Jurkat T cells by electroporation. Briefly, 107 cells were transfected with 20 µg of plasmid in a Gene
Pulser (Bio-Rad Laboratories, Hercules, CA) at 250 V and a capacitance of 960 µF. After transfection, cells were grown for 2 d in complete RPMI
before plating out in medium containing 2 mg/ml of G418 (GIBCO BRL).
Clones were obtained by limiting dilution. Generation of the CD8-
clone
has been described elsewhere (Irving and Weiss, 1991
). Stable cell lines
expressing the wild-type CD8-
T76 truncation or the CD8-
4F mutant
were generated as described elsewhere (Irving and Weiss, 1991
). Construction of CD8-
T76 and CD8-
4F vectors was based on modifications
of the original CD8-
plasmid. The CD8-
T76 truncation mutant was
created by PCR mutagenesis from the CD8-
wild type using the following
oligonucleotides: 5
primer (within CD8): 5
CACCATCGCGTCGCAGC3
; T76 truncation: 5
GATCTCGAGAGGATCCTATTACATCCCAATCTCACTG 3
.
After PCR amplification, the CD8-T76 truncated fragment was digested with EcoRV and BamHI, and substituted for the wild-type CD8-
in the ptf neo CD8-
expression vector (Irving and Weiss, 1991
). The mutation was confirmed by sequencing. The CD8-
T76 mutant truncated the
chain two amino acids after the second ITAM. The CD8-
4F mutant was
created from the CD8-
T76 truncation by sequential PCR mutagenesis.
The outside primers and fragment substitution were the same as for the
creation of the CD8-
T76 truncation. After PCR mutagenesis, the construct was sequenced to verify that only the intended mutations existed.
To mutate the first tyrosine to phenylalanine of the first ITAM of CD8-,
the following primers were used: 5
CAGCTCTTTAACGAGCTCAA 3
,
and 3
TCTTGGTCGAGAAATTGCTC 5
.
To mutate the second tyrosine to phenylalanine of the first ITAM of
CD8-, the following primers were used: 5
GAGGAGTTCGATGTTTTGGA 3
, and 3
CTTCTCTCCTCAAGCTACAA 5
.
To mutate the first tyrosine to phenylalanine of the second ITAM of
CD8-, the following primers were used: 5
GGCCTGTTCAATGAACTGCA 3
, and 3
TCCTTCCGGACAAGTTACTT 5
.
To mutate the second tyrosine to phenylalanine of the second ITAM of
CD8-, the following primers were used: 5
AGGCCTTCAGTGAGATTGG 3
, and 3
ACCGCCTCCGGAAGTCAC 5
.
Conjugate Formation and Immunofluorescence Microscopy
Jurkat T cells or derived clones and mutants were mixed with antibody-coated latex beads at a 2:1 ratio. After centrifugation for 5 min at 100 g, the cell-bead mixture was incubated for an additional 5-25 min at 37°C. Conjugates were then resuspended, plated onto poly-L-lysine-treated slides, and fixed for 30 min in 3.4% paraformaldehyde at room temperature. Fixed cells were permeabilized for 4 min in PBS/0.1% Triton X-100 and blocked for 10 min in PBS/0.2% BSA. Cells were labeled for 30 min with antibody diluted in PBS/0.2% BSA, followed by two washes of 10 min each. After secondary antibody labeling, cells were incubated for 10 min in 33 nM rhodamin-phalloidin. After three final washes, slides were mounted. Samples were either viewed under a laser scanning microscope (LSM 410; Carl Zeiss, Inc., Thornwood, NY) (1st experiment) or a conventional Microphot-FXA microscope (all other experiments). The MTOC was scored as reoriented if it was located in close proximity to the T cell plasma membrane between the T cell nucleus and the bead contact area. At least 100 conjugates were scored in each experiment.
Transient Transfection Conjugate Formation Assay
Cell (107) were transiently cotransfected by electroporation, as described above, with 30 µg of the indicated TT chimera and 40 µg of a vector containing no insert or expressing dominant-negative mutants of ZAP-70 and Ras. After 36 h, dead cells were eliminated by centrifugation over a Ficoll gradient (Sigma Chemical Co.). After two washes, conjugates were formed and analyzed as described above.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Anti-TCR-coated Latex Beads Induce MTOC Reorientation and Polarized Actin Polymerization in Jurkat T Cells
Previous T cell polarization studies performed in a B cell-T
cell system demonstrated the dependence of cytoskeletal
rearrangements during conjugate formation on the presence of antigen, implying the participation of the TCR in
these events (Kupfer and Dennert, 1984). The involvement of accessory molecules including integrins and coreceptors such as CD4/CD8 made it difficult to evaluate to
what extent TCR-linked pathways were involved and sufficient for T cell cytoskeletal polarization. To address this
question, we set up an in vitro assay using Jurkat T cells as
effectors, and antibody-coated, cell-sized latex microspheres
as APCs. Previous studies have demonstrated that such artificial APCs, either coated with TCR-specific antibodies
or antigen-major histocompatibility complexes (MHC),
could induce early and late signaling events, such as tyrosine phosphorylation and exocytosis, in T cells (Anel et
al., 1994
; Mescher, 1992
). In contrast to soluble or plate-bound TCR-specific antibodies, the use of latex beads allowed us to study signaling events in response to a focal
stimulus. In a first set of experiments, we investigated
whether triggering of the TCR alone was sufficient to induce reorientation of the microtubule cytoskeleton and
polarized actin polymerization. Latex beads coated with
the CD3
-specific antibody Leu4 were mixed with Jurkat
T cells at a 1:2 ratio and incubated for 30 min at 37°C.
Formed conjugates were fixed and stained for tubulin and
F-actin. The position of the MTOC within the T cells was
analyzed microscopically. Only MTOCs directly underlying the bound latex bead were scored positive. In the majority of all conjugates (73 ± 2%), the T cell MTOC was
facing the latex bead contact area (Fig. 1 a). Polymerized actin was concentrated in a dense collar at the bead attachment site. F-actin-rich pseudopods protruded from the T
cell surface, and in many cases surrounded the bead (Fig.
1 b). Similar results were obtained at shorter incubation
times (10-20 min) and with latex beads coated with the Jurkat Ti
-specific antibody C305 (data not shown). In contrast, the position of the MTOC was random when conjugates between Jurkat T cells and poly-L-lysine-treated beads
were analyzed (Fig. 1 a). Furthermore, no F-actin accumulation at the bead contact site could be observed (Fig. 1 b).
|
To determine whether cytoskeletal polarization was specifically associated with TCR cross-linking, antibodies directed against a variety of T cell surface molecules (CD11a/ LFA-1, transferrin receptor [TfR] and CD2) and poly-L-lysine were bound to latex beads and used in the conjugate formation assay. All surface molecules analyzed were expressed at comparable levels in Jurkat T cells and similar numbers of bead-cell conjugates were formed (data not shown). As summarized in Fig. 2, TCR/CD3-specific beads displayed MTOC polarization in ~80% of all scored conjugates, whereas beads coated with either anti-CD11a, anti-TfR, anti-CD2, or poly-L-lysine were randomly positioned (31 ± 5, 26 ± 2, 39 ± 4, and 26 ± 6% of scored conjugates, respectively), demonstrating that cytoskeletal polarization is specifically associated with TCR/CD3 cross-linking.
|
Clustering of Chimeras Containing the
Cytoplasmic Domain of CD3 or TCR-
Can Induce
MTOC Reorientation and Actin Polymerization
Several studies support the view that the presence of multiple ITAMs in the TCR might serve the purpose of signal
amplification (Irving et al., 1993; Shinkai et al., 1995
).
However, single TCR subunits can associate with distinct
SH2-containing signaling molecules and show qualitative
differences in the induction of certain cellular responses
(Combadiere et al., 1996
; Osman et al., 1996
). This suggests that distinct TCR subunits could couple the receptor
to qualitatively different signaling pathways. To evaluate the
ability of single TCR chains to induce cytoskeletal changes,
we analyzed Jurkat T cells stably expressing a chimera between the extracellular and transmembrane domain of
CD25 (Tac) with either the cytoplasmic tail of TCR-
(TT-
),
CD3
(TT-
), or a truncated form of CD3
(TT-
T) containing only the first three amino acids of the cytoplasmic
tail. An ITAM motif is present once in the CD3
chain
and three times in the TCR-
chain. The ITAMs in both
chains differ in their nonconsensus sequences and were
shown to bind signaling molecules with different affinities (Osman et al., 1996
). As demonstrated previously (Letourneur and Klausner, 1991
; Shinkai et al., 1995
), TT chimeras are expressed as monomeric molecules and do not
associate with endogenous CD3 subunits. Clones with similar surface expression of the chimeric proteins (Fig. 3)
were chosen and mixed with anti-Tac-coated latex beads
for 10 min. The percentage of conjugate formation was
comparable (data not shown). As shown in Fig. 4 A, clustering of the cytoplasmic tail of either TCR-
or CD3
was
sufficient to induce MTOC reorientation. The extent of
MTOC reorientation triggered by either chimera was comparable and was similar to levels induced by cross-linking of the complete TCR-CD3 complex. Furthermore,
both chimeras could induce actin polymerization (Fig. 4, B
and C). In contrast, no cytoskeletal polarization was detected towards beads bound to the truncated TT-
T chimera. These results suggest that both the
and
chains
can trigger qualitatively similar signals, which are normally
generated by the TCR and induce T cell polarization. Furthermore, the presence of one ITAM motif was sufficient
to induce cytoskeletal rearrangements, and the number of
ITAMS had no obvious quantitative effect on the induction of cytoskeletal polarization. However, in transient expression experiments where chimera surface expression
was lower, the TT-
chimera induced MTOC reorientation
less efficiently than TT-
(see below and data not shown).
This result supports the view that multiple ITAMs can act
as signal amplifiers under suboptimal activation conditions.
|
|
MTOC Reorientation and Actin Polymerization Require the Presence of an Intact ITAM
ITAM phosphorylation is essential for signaling through
the TCR in many cellular responses. Phosphorylated
ITAMs serve as docking sites for downstream signaling
molecules such as ZAP-70 (Osman et al., 1996). Furthermore, phosphorylated ITAMs can mediate the activation-induced association of TCR components with the actin cytoskeleton. In particular, the third ITAM of the TCR-
chain has been reported to be crucial for F-actin interaction (Rozdzial et al., 1995
). To investigate the role of
ITAM phosphorylation and F-actin binding in coupling
the TCR to T cell polarization, we analyzed stable clones
expressing a chimera between the extracellular/transmembrane domain of human CD8 and either the entire cytoplasmic tail of TCR-
(CD8-
), the cytoplasmic tail of
TCR-
truncated after the second ITAM (CD8-
T76), or
the CD8-
T76 chimera in which all four ITAM tyrosines
were mutated to phenylalanine (CD8-
4F) (Fig. 5 A).
Clones with comparable surface expression were used
(Fig. 6). As shown before for the TT-
expressing clone,
cross-linking of the CD8-
chimera efficiently induced
MTOC reorientation and actin polymerization at the bead
attachment site (Fig. 5, B and C). No obvious qualitative
difference was observed for the CD8-
T76 chimera, which
lacks the third ITAM, suggested to mediate F-actin binding. Focal actin polymerization was as frequently detected with CD8-
T76 as in the CD8-
chimera (Fig. 5 C). As
judged by immunofluorescence microscopy, no significant
difference in the extent of F-actin accumulation was observed (Fig. 5 D). Our data suggest that the observed clustering of F-actin at the site of TCR engagement occurs in
the absence of the third
chain ITAM. In contrast, analysis of CD8-
4F demonstrated the strict dependence of
both MTOC reorientation and actin polymerization on the
tyrosine phosphorylation of the ITAM motif. Mixing of
clone CD8-
4F with anti-CD8-coated latex beads still
yielded conjugates, but MTOC positioning was random
(38 ± 7%) (Fig. 5 B). The frequency and extent of actin
polymerization was also dramatically reduced (Fig. 5, C
and D). These results indicate that ITAM phosphorylation is required for TCR-induced cytoskeletal polarization.
|
|
To corroborate this finding, we analyzed cytoskeletal rearrangements in the mutant Jurkat cell line JCaM1.6,
which lacks functional Lck. Src family kinases and in particular Lck have been shown to be responsible for ITAM
phosphorylation in T cells (Iwashima et al., 1994; van Oers
et al., 1996
). Consistent with the failure to phosphorylate
and CD3 chains, TCR-ligation of JCaM1.6 fails to induce
tyrosine phosphorylation, calcium influx, or CD69 expression (Straus and Weiss, 1992
). Analyzed in our conjugate
formation assay, JCaM1.6 failed to polarize towards
CD3-specific latex beads. MTOC positioning was random
(30 ± 4% of scored conjugates) and no actin polymerization was detected (Fig. 7, A and B). Reconstitution of
JCaM1.6 with wild-type murine Lck (JCaM1.6/Lck) restored TCR-induced cytoskeletal changes comparable
with that observed in the parental Jurkat cell line (Fig. 7,
A and B). Similar results were obtained with the mutant
Jurkat cell line J45.01, which lacks functional CD45 (data
not shown). CD45 is a transmembrane tyrosine phosphatase required for the activation of Src family kinases
(Weiss and Littman, 1994
). Taken together, these results
support the view that ITAM phosphorylation and subsequent recruitment of downstream signaling molecules to
the TCR are a prerequisite for cytoskeletal alterations.
|
Overexpression of a Dominant-Negative ZAP-70 Mutant Impairs MTOC Reorientation
A crucial step in TCR-mediated signaling is the recruitment of ZAP-70 to phosphorylated ITAMs after TCR engagement. Recruitment leads to tyrosine phosphorylation
and activation of ZAP-70, which, in turn, contributes to
the activation of both early and late signaling cascades.
Several studies suggest that ZAP-70 plays in important
role in TCR-mediated signaling. For example, lack of
functional ZAP-70 in humans and mice results in severe
developmental and functional defects in the T cell compartment (Arpaia et al., 1994; Chan et al., 1994
; Elder et al.,
1994
). Furthermore, introduction of a dominant-negative
mutant form of ZAP-70 into T cells suppresses TCR-mediated tyrosine phosphorylation of several signaling
molecules and activation of NF-AT, a nuclear factor essential for inducible interleukin 2 gene expression (Qian et
al., 1996
). To assess the role of the ZAP-70-ITAM interaction in TCR-mediated MTOC reorientation, we transiently
cotransfected Jurkat cells with the activating chimera TT
and the dominant-negative ZAP-70 mutant SH2 (N+C) (Qian et al., 1996
). SH2 (N+C) is thought to inhibit TCR
signaling by blocking phosphorylated ITAMs (Qian et al.,
1996
). Transfected cells were mixed with anti-Tac latex
beads 36 h later, and conjugates were formed for 10 min at
37°C. Similar to our studies in stable clones, engagement
of TT-
induced MTOC reorientation, although to a lesser
extent (67 ± 1% of the conjugates). As expected, engagement of transiently expressed TT-
T failed to induce
MTOC reorientation (20 ± 6%) and served as a negative
control. Coexpression of dominant-negative ZAP-70 markedly reduced MTOC reorientation by ~50-60%, whereas expression of a mutant SH2 (N+C) form (SH2 (N +*C),
(Qian et al., 1996
), unable to bind to ITAMs, had only
minimal effects (Fig. 8). Expression of both mutants did
not affect TT-
surface expression (data not shown).
Moreover, comparable results were obtained in Jurkat
TAg cells (data not shown). These results demonstrate
that engagement of transiently expressed activating chimeras can induce MTOC reorientation. Moreover, a dominant-negative mutant of ZAP-70 encompassing the two
SH2 domains impairs both TCR-mediated MTOC reorientation (shown here) and NF-AT gene activation (Qian
et al., 1996
). This suggests that both responses are mediated by the same proximal signaling events requiring molecules that interact with phosphorylated ITAMs.
|
MTOC Reorientation Occurs in the Absence of Ras Activation
Two major signaling pathways, namely the Ras and the
PLC-1 pathway, are activated after TCR engagement. Activation of the small GTPase Ras by the TCR induces the
extracellular signal-regulated kinase (ERK 1,2) cascade
involving several cytoplasmic serine/threonine kinases.
ERKs phosphorylate transcription factors of the AP-1 family and are necessary for TCR-mediated NF-AT gene
activation and T cell development (Alberola-Ila et al.,
1995
; Izquierdo-Pastor et al., 1995
; Swan et al., 1995
). In
certain cell types, ERKs are associated with microtubules
(Morishima-Kawashima and Kosik, 1996
; Reszka et al.,
1995
) and phosphorylate microtubule-associated proteins
(MAPs). MAPs stimulate the polymerization of new and preexisting microtubules. Interestingly, these microtubule-promoting properties are lost after in vitro phosphorylation by ERKs (Hoshi et al., 1992
). Thus, TCR-induced
ERK activation could influence microtubule dynamics. To
address this question, we took advantage of the recently
described compound PD 098059, a selective inhibitor of
the ERK-activating enzyme MAPK/ERK kinase (Dudley
et al., 1995
). To characterize the effect of PD 098059 on
TCR-induced ERK activation, Jurkat T cells were preincubated for 30 min with increasing concentrations of PD
098059 and were stimulated for 10 min by the addition of C305-coated latex beads. Cells were then lysed and analyzed for tyrosine phosphorylation by immunoblotting. As
shown in Fig. 9 A, incubation with PD 098059 resulted in a
dose-dependent inhibition of ERK phosphorylation in response to TCR engagement, whereas the phosphorylation
status of various other proteins remained unchanged. The
identity and quantity of ERK detected was confirmed by
stripping and reblotting the same membrane with a phospho-ERK-specific antibody (data not shown). This experiment demonstrates that PD 098059 indeed specifically inhibits ERK phosphorylation. However, the inhibitor had
no significant effect on MTOC reorientation (Fig. 9 B),
even at concentrations that substantially reduced ERK
phosphorylation. This suggests that ERKs are not involved in the regulation of cytoskeletal events associated
with MTOC reorientation.
|
Besides ERKs, the small GTPase Rac-1 and phosphatidylinositol 3 kinase (PI-3 kinase) have been recently identified as Ras effector molecules (Genot et al., 1996; Rodriguez-Viciana et al., 1994
). Interestingly, both PI-3 kinase
and CDC42, a close family member of Rac-1, have been
shown to be involved in B cell-induced MTOC reorientation of a murine T cell hybridoma (Stowers et al., 1995
).
Thus, TCR-mediated Ras activation might induce MTOC
reorientation via ERK-independent pathways. To investigate this possibility, we transiently coexpressed the activating TT-
chimera with the dominant-negative Ras mutant Ha-N17Ras in TAg Jurkat cells. Earlier studies have
demonstrated that overexpression of this Ras mutant efficiently inhibits TCR-mediated events such as NF-AT/IL-2
gene activation or T cell development (Alberola-Ila et al.,
1995
; Rayter et al., 1992
). However, when analyzed in the
polarization assay, the mutant did not significantly affect
MTOC reorientation (Fig. 9 C), although high expression
levels could be detected by Western blotting (Fig. 9 D).
Furthermore, MTOC reorientation in Jurkat T cells pretreated with the specific PI-3 kinase inhibitor Wortmannin was comparable to cells pretreated with the vehicle alone
(Fig. 10). These results further substantiate our inhibitor
experiment and suggest that Ras-mediated effector pathways are not involved in TCR-mediated microtubule reorganization. In contrast to earlier studies (Stowers et al.,
1995
), inhibition of PI-3 kinase did not affect MTOC reorientation in our assay system. This discrepancy might reflect differences in the assay systems used.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Upon binding to an APC, T cells undergo rapid and dramatic cytoskeletal changes that ensure the polarized delivery of an effector response. To date, T cell polarization has been mainly studied in a B cell-T cell system, where complex receptor-ligand interactions complicate the identification of the participating signaling pathways. In this report, we describe a simple bead-based conjugate formation assay to study this response. Jurkat T cells were chosen as model effector cells. Although this leukemic cell line may differ in many aspects from primary T cells, it has been a powerful tool in dissecting signaling pathways involved in T cell activation. Jurkat T cells can be easily manipulated by transient transfection approaches, and several TCR-signaling mutants have been generated and characterized. APCs have been replaced by antibody-coated latex beads. Since antibody-induced TCR cross-linking may induce stronger signals than TCR engagement by peptide-MHC complexes, our assay system may underscore the need for accessory molecules such as adhesion receptors or coreceptors. Furthermore, T cell activation with immobilized antibodies may not exactly reflect the role of receptor membrane motility and recycling in the generation of an intracellular signal. Nevertheless, the assay system should be useful to characterize the minimal requirements for polarized cytoskeletal rearrangements and to identify key-regulators of this mechanism. Our analysis provides evidence that TCR engagement alone is sufficient to induce MTOC reorientation and focal F-actin accumulation, suggesting that TCR-dependent signaling pathways can regulate cytoskeletal dynamics.
The induction of actin polymerization through antigen
receptor activation has been previously observed in a variety of cell types including T cells, B cells, and macrophages
(Greenberg et al., 1991; Melamed et al., 1991
; Parsey and
Lewis, 1993
), but so far the underlying signaling pathways
have been elusive. In contrast to cell activation by soluble
factors, antigen-induced T cell activation is triggered by
spatially constrained ligands; thus, TCR-induced cytoskeletal changes could influence the cellular response in several ways. First, cytoskeleton-dependent changes in cell
shape and motility could increase the frequency of APC contacts, eventually resulting in the formation of stable
conjugates (Negulescu et al., 1996
). Second, actin polymerization could be required for the rapid reorganization
and concentration of accessory molecules and receptors at
the T cell-APC contact site, which would further increase
conjugate stability and result in the formation of signaling
complexes (Monks et al., 1997
; Shaw and Dustin, 1997
). Focally clustered F-actin could also serve as a spatial cue,
recruiting proteins involved in MTOC reorientation. Such
a role for F-actin has been postulated in the mechanism of
spindle rotation during the embryogenesis of Caenorhabditus elegans (Waddle et al., 1994
). Third, reorientation of
the MTOC and organellar reorganization could ensure the
delivery of a polarized immune response by effector T
cells to a specific target cell in crowded environments such as lymphoid organs.
Two complexes within the TCR, namely the TCR- and
CD3 chains, couple the receptor via ITAMs to the intracellular signaling pathways. Interestingly, individual phosphorylated ITAMs bind differentially to SH2-containing
signaling molecules in vitro (Osman et al., 1995
, 1996
) and
could therefore activate distinct signaling pathways (Combadiere et al., 1996
; Letourneur and Klausner, 1992
). In
our experiments, TCR-
and CD3
were equally able to trigger MTOC reorientation and actin polymerization in
stable clones. However, when transiently expressed at
lower levels, CD3
induced MTOC reorientation less efficiently compared with
, supporting the concept that multiple ITAMs can serve as signal amplifiers. ITAM-mediated signal amplification may be crucial when MTOC
reorientation is induced by a physiological stimulus; i.e., a
peptide-MHC complex. Earlier studies have demonstrated that MTOC reorientation in antigen-specific T
cell-B cell conjugates was highly antigen-dose dependent
and occurred inefficiently at low antigen levels (Kupfer et al.,
1987
). Antibody-induced TCR cross-linking, as used in
our study, may induce a more potent signal than TCR engagement by peptide-MHC complexes. Thus, the requirements for multiple ITAM-containing TCR/CD3-chains
may differ between the in vitro system and the in vivo situation.
A signaling molecule that binds preferentially to ITAMs, but not to the
ITAM in vitro, is the p85 regulatory subunit of PI-3 kinase (Osman et al., 1996
). Interestingly, inhibition of PI-3 kinase with the specific inhibitor
Wortmannin completely abolished MTOC reorientation
and actin polymerization in a B cell-T cell hybridoma conjugate assay (Stowers et al., 1995
). This result suggests that
PI-3 kinase is a regulator of T cell polarization. Tested in
our system, a TT-
chimera readily induces cytoskeletal polarization. This indicates that PI-3 kinase is either activated independently of its recruitment to the CD3
ITAM
or is not involved in the cytoskeletal responses in our assay. Since the PI-3 kinase inhibitor Wortmannin had no effect on T cell polarization in our hands, we favor the second interpretation. The discrepancy observed between the
two systems could reflect either cell line-specific differences or the different modes used to induce polarization. To generate a strong enough signal, B cell-T cell conjugates may need the contribution of adhesion molecules
that may signal via a PI-3 kinase-dependent mechanism.
Furthermore, efficient signaling by peptide-MHC complexes requires the serial engagement of TCRs (Valitutti
et al., 1995a
). PI-3 kinase could be involved in the recruitment and concentration of TCR molecules at the B cell-T cell contact area.
ITAM phosphorylation is a key event in T cell activation. Our analysis of -chain chimeras and Jurkat mutants
demonstrates that MTOC reorientation and actin polymerization require the presence of at least one intact
ITAM and a functional ITAM-phosphorylating Src-family
kinase. Similarly, Cox et al. (1996)
showed recently that
clustering of the ITAM-containing Fc receptor
subunit
can trigger submembranous actin assembly in the chicken
B cell line DT40. Actin polymerization required ITAM
phosphorylation and the presence of the PTK Syk. In T
cells, the Syk/ZAP-70 family member ZAP-70 can bind to
phosphorylated ITAMs of all TCR signaling subunits with
very high affinity (Osman et al., 1996
). Recruitment of
ZAP-70 to the receptor results in ZAP-70 phosphorylation and activation. Overexpression of a dominant-negative mutant of ZAP-70, which blocks phosphorylated
ITAMs, markedly reduced MTOC reorientation in our
studies. This result suggests that ZAP-70 or another phospho-ITAM-binding molecule may be involved in the regulation of microtubule dynamics. In fact, both Zap-70 and
Syk can associate and efficiently phosphorylate
-tubulin
in vitro (Huby et al., 1995
; Peters et al., 1996
). Furthermore, two recent reports provide evidence that T cell activation leads to the rapid tyrosine phosphorylation of
-tubulin (Cardine et al., 1995
; Ley et al., 1994
). Importantly, phosphorylated
-tubulin was not incorporated
into microtubules, but remained in the soluble, unpolymerized tubulin pool. Syk was found to phosphorylate a
site in the COOH terminus of
-tubulin, which coincides
with a region involved in MAP binding (Peters et al.,
1996
). Since MAPs are involved in regulating the polymerization status of tubulin, it is possible that TCR-induced
activation of ZAP-70 leads to the phosphorylation of
-tubulin and the subsequent dissociation of MAPs. This
in turn could destabilize existing microtubules and lower
the pool of tubulin monomers available for polymerization. Such changes in microtubule dynamics would occur
locally at the site of TCR engagement and might result in
the repositioning of the MTOC. Although the model described is very attractive, the possibility remains that dominant-negative ZAP-70 impairs MTOC reorientation by
inhibiting the binding of other SH2-containing effector
molecules to ITAMs. Taking advantage of membrane-targeted ZAP-70/Syk chimeras, future experiments will assess whether independent activation of this PTK family is
sufficient to induce T cell polarization.
Proteins involved in the regulation of microtubule dynamics are often good substrates for ERKs and protein kinase C (PKC) (Gelfand, 1991). Members of both kinase
families are known to be activated upon T cell activation.
Thus, apart from the aforementioned ZAP-70-mediated
mechanism, changes in the microtubule cytoskeleton could
be regulated by one of these pathways. Our experiments
show that MTOC reorientation can occur in the absence
of Ras activation. Neither overexpression of dominant-negative Ras, nor inhibition of MAPK/ERK significantly
affected MTOC reorientation. These results suggest that
Ras-independent pathways regulate microtubule rearrangements in response to TCR engagement. In earlier
studies, MTOC reorientation was shown to be dependent
on extracellular calcium (Kupfer et al., 1987
). Incubation
of B cell-T cell couples in the presence of EGTA reduced
MTOC reorientation from >90% to 55 ± 5%. Chelation of extracellular calcium showed similar effects in our conjugate formation assay (data not shown). MTOC reorientation was significantly reduced, but not abolished (from
78% to 50 ± 8%). This suggests that MTOC reorientation
may in part be regulated by a calcium-dependent pathway.
Indeed, repositioning of the MTOC could be a complex event involving the shortening of microtubules and the
subsequent anchoring of the MTOC at the site of TCR engagement. Thus, impairment of one of these events could
result in partial MTOC reorientation. A more simple explanation relates to the fact that intracellular calcium
stores are not depleted under our assay conditions. Thus, release of intracellular calcium may be sufficient to partially activate calcium-dependent effector molecules. Interestingly, Ca2+/calmodulin-dependent kinase family
members phosphorylate MAPs (Gelfand, 1991
). Thus,
several kinase families might participate in the regulation
of MTOC reorientation.
The assay system described here should prove useful to further characterize the effector molecules involved in T cell cytoskeleton dynamics. Once identified, it will be interesting to assess the physiological role of these effectors in maintaining a polarized intercellular immune response.
![]() |
Footnotes |
---|
Received for publication Received for publication 16 December 1997 and in revised form 29 December 1997..
The authors thank members of the Weiss laboratory for helpful discussions, and in particular Drs. D. Yablonski and N.S.C. van Oers for critical reading of the manuscript. We gratefully acknowledge the technical assistance of T. Laroche and the laser scanning microscope. ![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Alberola-Ila, J., K.A. Forbush, R. Seger, E.G. Krebs, and R.M. Perlmutter. 1995. Selective requirement for MAP kinase activation in thymocyte differentiation. Nature. 373: 620-623 |
2. |
Anel, A.,
G.V. Richieri, and
A.M. Kleinfeld.
1994.
A tyrosine phosphorylation
requirement for cytotoxic T lymphocyte degranulation.
J. Biol. Chem.
269:
9506-9513
|
3. | Arpaia, E., M. Shahar, H. Dadi, A. Cohen, and C.M. Roifman. 1994. Defective T cell receptor signaling and CD8+ thymic selection in humans lacking ZAP-70 kinase. Cell. 76: 947-958 |
4. |
Cardine, A.M.,
H. Kirchgessner,
C. Eckerskorn,
S.C. Meuer, and
B. Schraven.
1995.
Human T lymphocyte activation induces tyrosine phosphorylation of
![]() |
5. | Chan, A.C., T.A. Kadlecek, M.E. Elder, A.H. Filipovich, W.-L. Kuo, M. Iwashima, T.G. Parslow, and A. Weiss. 1994. ZAP-70 deficiency in an autosomal recessive form of severe combined immunodeficiency. Science. 264: 1599-1601 |
6. | Clipstone, N.A., and G.R. Crabtree. 1992. Identification of calcineurin as a key signalling enzyme in T-lymphocyte activation. Nature. 357: 695-697 |
7. |
Combadiere, B.,
M. Freedman,
L. Chen,
E.W. Shores,
P. Love, and
M.J. Lenardo.
1996.
Qualitative and quantitative contributions of the T cell receptor ![]() |
8. |
Cox, D.,
P. Chang,
T. Kuosaki, and
S. Greenberg.
1996.
Syk tyrosine kinase is
required for immunoreceptor tyrosine activation motif-dependent actin assembly.
J. Biol. Chem.
271:
16597-16602
|
9. | Dudley, D.T., L. Pang, S.J. Decker, A.J. Bridges, and A.R. Saltiel. 1995. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc. Natl. Acad. Sci. USA. 92: 7686-7689 [Abstract]. |
10. | Elder, M.E., D. Lin, J. Clever, A.C. Chan, T.J. Hope, A. Weiss, and T. Parslow. 1994. Human severe combined immunodeficiency due to a defect in ZAP-70, a T cell tyrosine kinase. Science. 264: 1596-1599 |
11. | Geiger, B., D. Rosen, and G. Berke. 1982. Spatial relationships of microtubule-organizing centers and the contact area of cytotoxic T lymphocytes and target cells. J. Cell Biol. 95: 137-143 [Abstract]. |
12. | Gelfand, V.I.. 1991. Microtubule dynamics: mechanism, regulation, and function. Annu. Rev. Cell Biol. 7: 93-116 . |
13. | Genot, E., S. Cleverley, S. Henning, and D. Cantrell. 1996. Multiple p21ras effector pathways regulate nuclear factor of activated T cells. EMBO (Eur. Mol. Biol. Organ.) J. 15: 3923-3933 [Abstract]. |
14. | Goldsmith, M.A., P.E. Dazin, and A. Weiss. 1988. At least two non-antigen-binding molecules are required for signal transduction by the T cell antigen receptor. Proc. Natl. Acad. Sci. USA. 85: 8613-8617 [Abstract]. |
15. | Greenberg, S., J. El, Khoury, F. Di Virgilio, E.M. Kaplan, and S.C. Silverstein. 1991. Ca2+-independent F-actin assembley and disassembley during Fc receptor-mediated phagocytosis in mouse macrophages. J. Cell Biol. 113: 757-767 [Abstract]. |
16. | Hall, A.. 1994. Small GTP-binding proteins and the regulation of the actin cytoskelton. Annu. Rev. Cell Biol. 10: 31-54 . |
17. | Hoshi, M., K. Otha, Y. Gotoh, A. Mori, H. Murofushi, H. Sakai, and E. Nishida. 1992. Mitogen-activated-protein-kinase-catalyzed phosphorylation of microtubule-associated proteins, microtubule-associated protein 2 and microtubule-associated protein 4, induces alteration in their function. Eur. J. Biochem. 203: 43-52 [Abstract]. |
18. |
Huby, R.D.J.,
G.W. Carlile, and
S.C. Ley.
1995.
Interaction between the protein-tyrosine kinase ZAP-70, the proto-oncoprotein Vav, and tubulin in Jurkat T cells
J. Biol. Chem
270:
30241-30244
|
19. |
Irving, B.A.,
A.C. Chan, and
A. Weiss.
1993.
Functional characterization of a
signal transducing motif present in the T cell antigen receptor ![]() |
20. |
Irving, B.A., and
A. Weiss.
1991.
The cytoplasmic domain of the T cell receptor
![]() |
21. | Iwashima, M., B.A. Irving, N.S. van Oers, A.C. Chan, and A. Weiss. 1994. Sequential interactions of the TCR with two distinct cytoplasmic tyrosine kinases. Science. 263: 1136-1139 |
22. | Izquierdo-Pastor, M., K. Reif, and D. Cantrell. 1995. The regulation and function of p21ras during T cell activation and growth. Immunol. Today. 16: 159-164 |
23. |
Kupfer, A., and
G. Dennert.
1984.
Reorientation of the microtubule-organizing
center and the Golgi apparatus in cloned cytotoxic lymphocytes triggered by
binding to lysable target cells.
J. Immunol.
133:
2762-2766
|
24. | Kupfer, A., T.R. Mosmann, and H. Kupfer. 1991. Polarized expression of cytokines in cell conjugates of helper T cells and splenic B cells. Proc. Natl. Acad. Sci. USA. 88: 775-779 [Abstract]. |
25. | Kupfer, A., and S.J. Singer. 1989. The specific interaction of helper T cells and antigen-presenting B cells: IV. Membrane and cytoskeletal reorganizations in the bound T cell as a function of antigen dose. J. Exp. Med. 170: 1697-1713 [Abstract]. |
26. | Kupfer, A., S.L. Swain, and S.J. Singer. 1987. The specific interaction of helper T cells and antigen-presenting B cells. II. Reorientation of the microtubule organizing center and reorganization of the membrane-associated cytoskeleton inside the bound helper T cells. J. Exp. Med. 165: 1565-1580 [Abstract]. |
27. | Kupfer, H., C.R.F. Monks, and A. Kupfer. 1994. Small splenic B cells that bind to antigen-specific T helper (Th) cells and face the site of cytokine production in the Th cells selectively proliferate: immunofluorescence microscopic studies of Th-B antigen-presenting cell interactions. J. Exp. Med. 179: 1507-1515 [Abstract]. |
28. |
Letourneur, F., and
R.D. Klausner.
1991.
T-cell and basophil activation through
the cytoplasmic tail of T-cell-receptor ![]() |
29. |
Letourneur, F., and
R.D. Klausner.
1992.
Activation of T cells by a tyrosine kinase activation domain in the cytoplasmic tail of CD3![]() |
30. |
Ley, S.C.,
W. Verbi,
D.J.C. Pappin,
B. Druker,
A.A. Davies, and
M.J. Crumpton.
1994.
Tyrosine phosphorylation of ![]() |
31. |
Melamed, I.,
G.P. Downey,
K. Aktories, and
C.M. Roifman.
1991.
Microfilament assembly is required for antigen-receptor-mediated activation of human B lymphocytes.
J. Immunol.
147:
1139-1146
|
32. |
Mescher, M.F..
1992.
Surface contact requirements for activation of cytotoxic T
lymphocytes.
J. Immunol.
149:
2402-2405
|
33. |
Monks, C.R.F.,
H. Kupfer,
I. Tamir,
A. Barlow, and
A. Kupfer.
1997.
Selective modulation of protein kinase C-![]() |
34. | Morishima-Kawashima, M., and K. Kosik. 1996. The pool of MAP kinase associated with microtubules is small but constitutively active. Mol. Biol. Cell. 7: 893-905 [Abstract]. |
35. | Negulescu, P.A., T.B. Krasieva, A. Khan, H.H. Kerschbaum, and M.D. Cahalan. 1996. Polarity of T cell shape, motility and sensitivity to antigen. Immunity. 4: 421-430 |
36. |
Osman, N.,
S.C. Lucas,
H. Turner, and
D. Cantrell.
1995.
A comparison of the
interaction of Shc and the tyrosine kinase ZAP-70 with the T cell antigen receptor ![]() |
37. |
Osman, N.,
H. Turner,
S. Lucas,
K. Reif, and
D.A. Cantrell.
1996.
The protein
interactions of the immunoglobulin receptor family tyrosine-based activation motifs present in the T cell receptor ![]() ![]() ![]() ![]() |
38. |
Parsey, M.V., and
G.K. Lewis.
1993.
Actin polymerization and pseudopod reorganization accompany anti-CD3-induced growth arrest in Jurkat T cells.
J. Immunol.
151:
1881-1893
|
39. |
Peters, J.D.,
M.T. Furlong,
D.J. Asai,
M.L. Harrison, and
R.L. Geahlen.
1996.
Syk, activated by cross-linking the B-cell antigen receptor, localizes to the
cytosol where it interacts with and phosphorylates ![]() |
40. | Poo, W.-J., L. Conrad, and C.A. Janeway Jr.. 1988. Receptor-directed focusing of lymphokine release by helper T cells. Nature. 332: 378-380 |
41. | Qian, D., M.N. Mollenauer, and A. Weiss. 1996. Dominant-negative zeta-associated protein 70 inhibits T cell antigen receptor signaling. J. Exp. Med. 183: 611-620 [Abstract]. |
42. | Rayter, S.I., M. Woodrow, S.C. Lucas, D.A. Cantrell, and J. Downward. 1992. p21ras mediates control of IL-2 gene promoter function in T cell activation. EMBO (Eur. Mol. Biol. Organ.) J. 11: 4549-4556 [Abstract]. |
43. | Reszka, A.A., R. Seger, C.D. Diltz, E.G. Krebs, and E.H. Fischer. 1995. Association of mitogen-activated protein kinase with the microtubule cytoskeleton. Proc. Natl. Acad. Sci. USA. 92: 8881-8885 [Abstract]. |
44. | Rodriguez-Viciana, P., P.H. Warne, R. Dhand, B. Vanheaesbroeck, I. Gout, M.J. Fry, M.D. Waterfield, and J. Downward. 1994. Phosphatidylinositol-3-OH kinase as a direct target of Ras. Nature. 370: 527-532 |
45. | Romeo, C., and B. Seed. 1991. Cellular immunity to HIV activated by CD4 fused to T cell or Fc receptor polypeptides. Cell. 64: 1037-1046 |
46. |
Rozdzial, M.M.,
B. Malissen, and
T.H. Finkel.
1995.
Tyrosine-phosphorylated T
cell receptor ![]() |
47. |
Ryser, J.-E.,
E. Rungger-Brandle,
C. Chaponnier,
G. Gabbiani, and
P. Vassalli.
1982.
The area of attachment of cytotoxic T lymphocytes to their target cells
shows high motility and polarization of actin, but not myosin.
J. Immunol.
128:
1159-1162
|
48. | Shaw, A.S., and M.L. Dustin. 1997. Making the T cell receptor go the distance: a topological view of T cell activation. Immunity. 6: 361-369 |
49. |
Shinkai, Y.,
A. Ma,
H.-L. Cheng, and
F.W. Alt.
1995.
CD3![]() ![]() |
50. | Songyang, Z., S.E. Shoelson, M. Chaudhuri, G. Gish, T. Pawson, W.G. Haser, F. King, T. Roberts, S. Ratnofsky, and R.J. Lechleider. 1993. SH2 domains recognize specific phosphopeptide sequences. Cell. 72: 767-778 |
51. | Stowers, L., D. Yelon, L.J. Berg, and S. Chant. 1995. Regulation of the polarization of T cells toward antigen-presenting cells by Ras-related GTPase CDC42. Proc. Natl. Acad. Sci. USA. 92: 5027-5031 [Abstract]. |
52. | Straus, D., and A. Weiss. 1992. Genetic evidence for the involvement of the Lck tyrosine kinase in signal transduction through the T cell antigen receptor. Cell. 70: 585-593 |
53. | Swan, K.A., J. Alberola-Ila, J.A. Gross, M.W. Appleby, K.A. Forbush, J.F. Thomas, and R.M. Perlmutter. 1995. Involvement of p21ras distinguishes positive and negative selection in thymocytes. EMBO (Eur. Mol. Biol. Organ.) J. 14: 276-285 [Abstract]. |
54. | Valitutti, S., S. Muller, M. Cella, E. Padovan, and A. Lanzavecchia. 1995a. Serial triggering of many T-cell receptors by a few peptide-MHC complexes. Nature. 375: 148-151 |
55. | Valitutti, S., M. Dessing, K. Aktories, H. Gallati, and A. Lanzavecchia. 1995b. Sustained signaling leading to T cell activation results from prolonged T cell receptor occupancy. Role of T cell actin cytoskeleton. J. Exp. Med. 181: 577-584 [Abstract]. |
56. | van Oers, N.S., N. Killeen, and A. Weiss. 1996. Lck regulates the tyrosine phosphorylation of the T cell receptor subunits and ZAP-70 in murine thymocytes. J. Exp. Med. 183: 1053-1062 [Abstract]. |
57. |
Waddle, J.A.,
J.A. Cooper, and
R.H. Waterston.
1994.
Transient localized accumulation of actin in Caenorhabditis elegans blastomeres with oriented asymmetric divisions.
Development (Camb.).
120:
2317-2328
|
58. | Weiss, A., and D.R. Littman. 1994. Signal transduction by lymphocyte antigen receptors. Cell. 76: 263-274 |
59. | Weiss, A., and J.D. Stobo. 1984. Requirements for the coexpression of T3 and the T cell antigen receptor on a malignant human T cell line. J. Exp. Med. 160: 1284-1299 [Abstract]. |
60. |
Yang, S.Y.,
S. Chouaib, and
B. Dupont.
1986.
A common pathway for T lymphocyte activation involving both the CD3-Ti complex and CD2 erythrocyte
receptor determinants.
J. Immunol.
137:
1097-2003
|