Correspondence to Maarten Fornerod: m.fornerod{at}nki.nl
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Nuclear activity of ß-catenin is regulated by several mechanisms. In the absence of a Wnt signal, TCF proteins occupy and repress promoters of their target genes by recruiting repressor proteins like Groucho, CtBP (COOH-terminal binding protein), and histone deacetylases (Cavallo et al., 1998; Levanon et al., 1998; Roose et al., 1998; Waltzer and Bienz, 1998; Brannon et al., 1999; Chen et al., 1999). Interaction of ß-catenin with TCF/LEF transcription factors results in activation of these genes. BCL-9/Legless and Pygopus have been shown to be essential components of the ß-cateninTCF transcription complexes (Kramps et al., 2002; Parker et al., 2002; Thompson et al., 2002). ß-Catenin also interacts with chromatin remodeling and histone modification proteins such as Brg1 (Brahma-related gene 1) and CBP (CREB binding protein)/p300 to promote target gene activation (Hecht and Kemler, 2000; Takemaru and Moon, 2000; Barker et al., 2001). Furthermore, ICAT (inhibitor of ß-catenin and TCF4) and Chibby are identified as nuclear proteins that repress Wnt signaling by competing with TCF for binding to ß-catenin (Tago et al., 2000; Takemaru et al., 2003).
In this study, we aimed to identify new modulators of ß-catenin in the nucleus. We used the nuclear marker RanGTP to select for nuclear factors that directly bind ß-catenin and identified Ran binding protein 3 (RanBP3). We show that RanBP3 inhibits ß-cateninTCF4mediated transactivation in human cell lines by relocalization of active ß-catenin from the nucleus to the cytoplasm. In addition, we show that RanBP3 causes ventralization and inhibits ß-catenininduced double axis formation in Xenopus laevis embryos. Loss of Drosophila melanogaster RanBP3 results in cuticle defects and expands the Engrailed protein expression domain. We conclude that RanBP3 functions as a novel type of inhibitor of ß-catenin and identify its gene as a candidate human tumor suppressor in the commonly deleted chromosomal region 19p13.3.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
RanBP3 inhibits transcription of a TCF-responsive reporter
Wnt signaling ultimately results in the stabilization of ß-catenin, which forms active transcriptional regulation complexes with transcription factors of the TCF/LEF family. A well-established functional readout of Wnt signaling makes use of TCF-responsive luciferase reporter constructs (Korinek et al., 1997). To test the functional relevance of the interaction between ß-catenin and RanBP3, we transfected human embryonic kidney (HEK) 293 cells with reporter constructs that contain either three optimal TCF binding sites (TCF optimal promoter [TOP]) or three mutated binding sites (fake optimal promoter [FOP]). Transfection of a Wnt1 plasmid resulted in a strong activation of the TOP reporter but not of the FOP control (Fig. 2 B). Cotransfection of increasing amounts of RanBP3 repressed Wnt1/ß-catenin transactivation dose dependently (Fig. 2 B). A mutant of RanBP3 that cannot interact with RanGTP and binds ß-catenin with less affinity (Fig. 1 C) was less active than wild-type (wt) RanBP3 (Fig. 2 B). To investigate whether RanBP3 inhibits Wnt signaling downstream or upstream of ß-catenin, we mimicked Wnt signaling in HEK293 cells by expressing ß-catenin. RanBP3 could still specifically inhibit activation of the TOP reporter (Fig. 2 C), whereas the RanBP3 wv mutant was less effective. These experiments show that RanBP3 inhibits TCF-dependent transcription by acting on either ß-catenin itself or regulators downstream of ß-catenin. We confirmed that the expression levels of our wt and wv mutant RanBP3 constructs were equal by analyzing cell lysates from transfected HEK293 cells on Western blot (Fig. 2 A).
|
To address whether RanBP3 could also affect expression of endogenous target genes of ß-cateninTCF, we expressed RanBP3 in human colon carcinoma cell line HCT116. This cell line harbors an activating mutation in ß-catenin (45 catenin) and therefore expresses increased levels of the target gene c-myc (He et al., 1998). Expression of wt RanBP3 decreased c-Myc protein levels compared with control cells (Fig. 2 E, lanes 2 and 3). Although expressed in higher levels, the wv mutant RanBP3 was less capable of decreasing c-Myc levels.
Reduction of RanBP3 results in increased transactivation of a TCF-responsive reporter
In addition to studying the effects of RanBP3 overexpression, we studied the effects of RanBP3 depletion. We expressed short hairpin RNAs (shRNAs) directed against unique parts of RanBP3 that are present in all isoforms of RanBP3. We obtained several shRNA RanBP3 constructs that down-regulate RanBP3 protein levels in HEK293 cells (Fig. 3 A).
|
RanBP3 down-regulates ß-cateninmediated transactivation independently of APC
To further address the question of whether RanBP3 represses ß-catenin transcriptional activation by stimulating export of ß-catenin via the APCCRM1 pathway, we expressed RanBP3 in human colorectal cancer cell lines that express COOH-terminal truncations of APC. First, we tested DLD1 cells, which express APC11417, which retains some ß-catenin binding sites but lacks all COOH-terminal nuclear export signals (NESs), the most highly conserved APC NESs in evolution. As shown in Fig. 4 A, ß-catenin/TCF activity is already high in these cells. Expression of a RanBP3 wt or wv mutant could still dose-dependently down-regulate transcriptional activity, with the mutant again being a less potent inhibitor (Fig. 4 A). Because APC in DLD1 cells can still bind to ß-catenin and NESs have also been reported in the NH2 terminus of APC, we repeated the experiment in COLO320 cells. These cells express a very short APC truncation (1811) that lacks all ß-catenin binding sites. ß-catenin/TCF activity was much higher in these cells than in DLD1 cells, a finding that correlates with the severity of the APC mutation (Fig. 4 B; Rosin-Arbesfeld et al., 2003). Nevertheless, transfection of the RanBP3 expression constructs caused a significant down-regulation of transcription (Fig. 4 B). Therefore, the mechanism by which RanBP3 inhibits ß-catenin is independent of a nuclear export function of APC.
|
|
Nuclear/cytoplasmic fractionation data does not always reflect the subcellular localization in living cells because pools of proteins that are not tightly bound to nuclear or cytoplasmic structures and are relatively small may leak through nuclear pore complexes of permeabilized cells. We therefore assayed the effect of RanBP3 overexpression on active ß-catenin in situ using the antiactive ß-catenin antibody. In our hands, this antibody did not visualize endogenous dephosphorylated ß-catenin in Wnt1-transfected HEK293 cells (unpublished data). We therefore tested two colon carcinoma cell lines (SW480 and DLD1) that have a constitutively activated ß-catenin because of a mutation in APC (Rosin-Arbesfeld et al., 2003). In SW480, but not in DLD1, the antidephosphorylated ß-catenin antibody recognizes a clear nuclear signal above background (Fig. 6, A and C). The presence of this signal correlates with the exceptionally high ß-catenin activity as measured in luciferase assays (Fig. 6 D), i.e., 30-fold higher than in DLD1. Importantly, RanBP3 overexpression leads to a clear reduction of active ß-catenin signal from the SW480 nuclei (Fig. 6 A) but has no influence on total ß-catenin localization (Fig. 6 B). This indicates that, even in the extremely active SW480 cell line, only a very small proportion of total ß-catenin is properly dephosphorylated and active, and that this is the pool RanBP3 acts on.
|
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
RanBP3 was originally identified as a nuclear protein that contains FG repeats and a RanGTP-binding domain (Mueller et al., 1998). RanBP3 can directly bind the nuclear export receptor CRM1, stimulating the formation of nuclear export complexes and increasing the export rate of certain CRM1 substrates (Englmeier et al., 2001; Lindsay et al., 2001). One mechanism by which RanBP3 could influence ß-catenin activity would therefore be increased nuclear export via the CRM1 pathway. Although the nuclear export mechanisms of ß-catenin are not fully understood, two pathways have been proposed (Henderson and Fagotto, 2002). In the first, ß-catenin exits the nucleus independently of nuclear export receptors by interacting directly with proteins of the nuclear pore complex (Eleftheriou et al., 2001; Wiechens and Fagotto, 2001). In the second pathway, ß-catenin exits the nucleus via the CRM1 pathway, but because ß-catenin does not contain NESs of its own, it uses binding to APC to exit the nucleus. The APC tumor suppressor does contain functional NESs and has been shown to be exported by CRM1 (Henderson, 2000; Neufeld et al., 2000; Rosin-Arbesfeld et al., 2000). Therefore, RanBP3 could inhibit ß-catenin by stimulating its export via APC and CRM1. However, four lines of evidence argue against this. First, in a CRM1 export complex, RanBP3 would bind to the complex via CRM1. Instead, we find that RanBP3 interacts directly with ß-catenin. Second, ß-catenin activity is RanBP3 sensitive in the colon carcinoma cell line COLO320 (Quinn et al., 1979) that expresses a short type I APC truncation lacking all ß-catenin interaction sites (Rosin-Arbesfeld et al., 2003). We cannot formally exclude the possibility that the neuronal APC-like protein APC2 (van Es et al., 1999), which is expressed in certain colon carcinoma cell lines, compensates for the loss of APC. However, in luciferase reporter assays, CRM1 overexpression does not reverse stimulation of ß-catenin activity caused by depletion of RanBP3. Finally, RanBP3-mediated relocalization of active ß-catenin is insensitive to LMB, a potent CRM1 inhibitor (Wolff et al., 1997). Therefore, we conclude that the mechanism by which RanBP3 inhibits ß-catenin is independent of CRM1 and APC.
It was recently suggested that nuclear ß-catenin signaling is performed mainly by ß-catenin dephosphorylated at serine 37 and threonine 41, which are main target sites of GSK3ß (Staal et al., 2002; van Noort et al., 2002). Depletion of RanBP3 by RNAi specifically increases the amount of dephosphorylated ß-catenin in nuclear fractions, whereas RanBP3 overexpression has the opposite effect. No concomitant increase, but rather a small decrease, of cytoplasmic endogenous active ß-catenin was observed by overexpression of RanBP3. We attribute this to cytoplasmic phosphorylation and subsequent degradation of wt ß-catenin.
Endogenous active ß-catenin was visualized in situ, using the antiactive ß-catenin antibody recognizing dephosphorylated ß-catenin. This was only possible in SW480 colon carcinoma cells that contain a high level of active ß-catenin because of severely defective APC function (Korinek et al., 1997). RanBP3 overexpression reduced active ß-catenin levels in the nucleus but had no effect on total ß-catenin. This suggests that only a small proportion of total ß-catenin is active in SW480 cells and confirms the specificity of RanBP3 for active ß-catenin. Apparently, absence of proper ß-catenin phosphorylation and degradation is not sufficient for ß-catenin to be in an active, dephosphorylated state. Also, we infer that the modulation by RanBP3 of ß-catenin activity as measured in our luciferase reporter assays acts on a small dephosphorylated pool, explaining why RanBP3 modulates wt and GSK3ß-catenin to a similar extent (Figs. 2 and 4).
To determine whether RanBP3 enhances ß-catenin NH2-terminal phosphorylation or nuclear export, we have visualized both nuclear and cytoplasmic distribution of active ß-catenin. For this, we used a fluorescently tagged ß-cateninGSK3 that is resistant to NH2-terminal phosphorylation and degradation. As shown in Fig. 7, RanBP3 causes a clear and significant shift of ß-catenin
GSK3 from the nucleus to the cytoplasm. We therefore conclude that RanBP3 directly enhances nuclear export of active ß-catenin. How does RanBP3 perform this task? Recent studies have indicated that the interactions of nuclear factors with chromatin or with each other are dynamic (Dundr et al., 2002; Phair et al., 2004). This suggests that RanBP3 does not need to actively remove ß-catenin from the TCF/LEFchromatin complexes. We therefore favor the possibility that association with RanBP3 prevents association of active ß-catenin with chromatin and keeps it in a more soluble state. In itself, this would be sufficient to allow CRM1-independent nuclear exit. We do not know whether RanBP3 accompanies ß-catenin to the cytoplasm and acts as a true nuclear export factor. The stimulatory effect of RanGTP on the ß-cateninRanBP3 interaction and the consistently weaker inhibitory effects on ß-catenin of a RanBP3 mutant unable to bind RanGTP would argue in favor of this possibility. Hydrolysis of RanGTP in the cytoplasm would increase the efficiency of release of ß-catenin for subsequent interactions with the cytoplasmic interacting proteins, such as E-cadherin or the APCAxinGSK3ß complex.
We studied the effect of RanBP3 in X. laevis and D. melanogaster embryogenesis. Overexpression of the X. laevis homologue of RanBP3 during early embryogenesis inhibits ß-catenindependent dorsoventral axis formation. RNAi of the D. melanogaster homologue of RanBP3 causes naked cuticle phenotypes and a broader Engrailed expression domain because of overactivation of the Wnt signaling pathway. Therefore, the results obtained in these two model organisms support the results obtained in cultured human cell lines and indicate that the inhibitory function of RanBP3 is highly conserved in metazoan evolution.
Wnt signaling plays an important role in tumor initiation and progression in a variety of human solid tumors, including colon carcinomas, hepatocellular carcinomas, and melanomas (Bienz and Clevers, 2000; Polakis, 2000). As a negative modulator of Wnt signaling, RanBP3 is a novel candidate tumor suppressor protein. Interestingly, the RanBP3 gene is located in 19p13.3, a region that is commonly deleted in several types of cancer and in which multiple tumor suppressor genes are likely to be present (Lee et al., 1998; Oesterreich et al., 2001; Tucci et al., 2001; Yanaihara et al., 2003; Kato et al., 2004; Miyai et al., 2004; Yang et al., 2004). Further work is required to determine whether the loss of the RanBP3 gene contributes to these or other types of cancer.
In conclusion, we have identified an unexpected role for RanBP3 as a novel inhibitor of Wnt signaling that enhances nuclear export of active ß-catenin. This function is separate from its role in CRM1-mediated nuclear export. The structural similarities between CRM1 and ß-catenin suggest that RanBP3 may be a more general cofactor for nuclear export of ARM repeat proteins.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Reagents
Antibodies used were ß-catenin (Transduction Laboratory and Santa Cruz Biotechnology, Inc.), RanBP3 (Transduction Laboratory and Affinity BioReagents, Inc.), active ß-catenin, TCF4 (Upstate Biotechnology), 414 (Eurogentec/Babco), -tubulin (European Collection of Cell Cultures), actin (Oncogene Research Products), and c-Myc (Santa Cruz Biotechnology, Inc.). The 4D9 anti-Engrailed/invected mAb was a gift from C. Goodman (University of California, Berkeley, Berkeley, CA; Patel et al., 1989).
Plasmids
The following plasmids were used: GSTß-catenin and GST-ARM (Wiechens and Fagotto, 2001), pET14b-h-RanBP3-b (Mueller et al., 1998), pET14b-hRanBP3-b wv mutant (Englmeier et al., 2001), and pRev(1.4)-RevNES-GFP (Henderson and Eleftheriou, 2000). pQE32-Ran and pQE32-RanQ69L were gifts from D. Görlich (Center for Molecular Biology Heidelberg, Heidelberg, Germany). TOP/FOP-Tk, Wnt1, GFPß-catenin, and pSUPER plasmid were gifts from H. Clevers (Hubrecht Laboratory, Utrecht, Netherlands), R. Kypta (University of California, San Francisco, San Francisco, CA), and R. Agami (Netherlands Cancer Institute, Amsterdam, Netherlands). pcDNA3-RanBP3-b wt and pcDNA3-RanBP3-b wv mutants were constructed by generating a blunt NdeIEcoRV fragment from pET14b-hRanBP3-b wt and wv mutants and by inserting these fragments into the EcoRV site of pcDNA3 (Invitrogen). shRNAs were expressed from the pSUPER vector (Brummelkamp et al., 2002). The successful 19-nt target sequences were as follows: RanBP3 2 (AAGGCGGAGAAGATTCTGACA), 3 (AAAGAGCCCCAGAAAAATGAG), 4 (AAGAGCCCCAGAAAAATGAGT), 8 (AAGCCGACATGGAGAATG-CTG), 9 (AACCGCAACGAACTATTTCCT), and 12 (AAGGACACAGGTCAGTTGTAT). pSUPER-GFP was a gift from S. Nijman (Netherlands Cancer Institute), and pBS(SK-)-Daxin-Myc was a gift from R. Nusse (Stanford University, Stanford, CA). For X. laevis injection studies, we used HAß-catenin (Funayama et al., 1995) and ß-galactosidase in pCS2+ (gift from R. Rupp, Adolph Butenardt Institute, Munich, Germany). pCS2 + MTRanBP3 wt and wv mutants were constructed by inserting PCR fragments into the EcoRI and XbaI sites of pCS + Myc. mRFPGSK3ß-catenin was constructed by inserting a BamHISacIIdigested PCR fragment spanning the ORF derived from pRK5-SK-catenin-GSK (a gift from R. Nusse) into the BglII and SacII sites of mRFP (Campbell et al., 2002).
Cell culture, transfection, and reporter assays
Cells were cultured in DME or in RPMI (NCI-H28) supplemented with 10% fetal calf serum and penicillin/streptomycin (GIBCO BRL) and were transfected using Fugene 6 (Roche) as instructed by the manufacturer. For reporter assays, cells were cultured in 12-well plates and transfected with 100 ng TOP/FOP-Tk-luc, 0.5 ng pRL-CMV, 10 ng Wnt1, 30 ng GFPß-catenin, 20 (HEK293) or 100 (NCI-H28) ng GSK3ß-catenin, 100 ng GFP-CRM1, and 100 ng RanBP3 wt/mutant or as indicated. Luciferase activity was measured 48 h after transfection using the Dual-luciferase reporter assay system (Promega). Reporter assays using shRNAs were performed as the aforementioned reporter assays using 200 ng shRNA constructs, and luciferase activity was measured 72 h after transfection. HCT116 cells were grown to 50% confluency in 10-cm dishes and transfected with 5 µg of ß-galactosidase or RanBP3 wt or wv mutant expression constructs and 0.5 µg EGFP-N3 plasmid to select for transfected cells. 40 h after transfection, GFP-positive cells were collected using flow cytometry. Cells were lysed in sample buffer, and 200,000 cells were resolved on a 10% SDS-PAGE gel and analyzed by Western blotting.
Protein expression and purification
GST, GST-ARM (amino acids 144665), and GSTß-catenin (Wiechens and Fagotto, 2001) were expressed in Escherichia coli strain BL21-pLysS and lysed by sonification in 500 mM NaCl, 20 mM Hepes-KOH, pH 7.9, 8.7% glycerol, and 2.5 mM 2-mercaptoethanol supplemented with Complete protease inhibitor cocktail tablets (Roche). GSTß-catenin fusion proteins were purified from postribosomal supernatants using protein GSepharose (GE Healthcare). His-tagged Ran RanQ69L, RanBP1, and RanGAP were expressed as previously described (Izaurralde et al., 1997; Englmeier et al., 2001). 6x His-tagged RanBP3a/b wt and wv mutant proteins were gifts from L. Englmeier and I. Mattaj (European Molecular Biology Laboratory, Heidelberg, Germany).
Western blotting
Proteins were analyzed by SDS-PAGE (25 µg per lane) and Western blotting using Immobilon-P transfer membrane (Millipore). Aspecific sites were blocked with 5% nonfat milk at RT for 1 h. Primary antibodies were incubated in 1% nonfat milk overnight at 4°C or 13 h at RT in the following dilutions: ß-catenin, 1:5,000; ABC, 1:500; RanBP3, 1:5,000; TCF4, 1:500; 414, 1:1,000; tubulin, 1:20; actin, 1:5,000; and c-Myc, 1:1,000. Blots were washed with PBS/0.05% Tween 20. Enhanced chemiluminescence (GE Healthcare) was used for detection of proteins.
Immunofluorescence and confocal microscopy
SW480 and DLD1 cells were transfected with 600 ng RanBP3 per six wells using Fugene 6. 45 h after transfection, cells were fixed for 10 min in 3.7% formaldehyde in PBS, permeabilized for 5 min in 0.2% Triton/PBS, and incubated for 1 h at RT with primary antibodies diluted in 0.05% BSA/PBS. Cells were washed in PBS, incubated in fluorescently conjugated secondary antibody (Invitrogen), and mounted in Vectashield (Vector Laboratories). Images were recorded using a confocal microscope (NT; Leica). HEK293 cells were transfected with 40 ng mRFPGSK3ß-catenin, 200 ng RanBP3, and/or 200 ng GFP-Rev-NES per six wells using Fugene 6. After 40 h, cells were either treated or not treated with 50 nM LMB for 1 h. Cells were fixed for 10 min in 3.7% formaldehyde in PBS and mounted in Vectashield. In each condition, cells with equally low expression were recorded with a confocal microscope (TCS SP2 AOBS; Leica). Nuclear and cytoplasmic regions of confocal images were quantified and background subtracted, and nuclear/cytoplasmic ratios were calculated using Image J software.
In vitro binding studies
In pull-down assays, 750 pmol GST, GSTß-catenin, or GST-ARM were incubated for 1 h at 4°C with X. laevis extracts (Hetzer et al., 2000) and 1:1 diluted in 200 mM NaCl, 20 mM Hepes-KOH, pH 7.9, 8.7% glycerol, and 2.5 mM 2-mercaptoethanol (buffer A). RanQ69L was added at 2 µM. In binding assays using HeLa nuclear extracts (4C Biotech), RanQ69L was used at 1 µM. Proteins were eluted with buffer A supplemented with 300 mM NaCl. After TCA precipitation, proteins were analyzed by Western blot. Pull-down assays using all recombinant proteins were performed by incubating for 1 h at 4°C; 1.5 µM GSTß-catenin beads with 0.2, 0.5, or 2 µM wt or wv mutant RanBP3 and 2 µM RanGTP in PBS, 8.7% glycerol, and 2 mM MgCl2. Proteins were eluted with 500 mM NaCl, 8.7% glycerol, 2 mM MgCl2, and 2.5 mM 2-mercaptoethanol in the presence or absence of RanBP1 or RanGAP in PBS and prepared for analysis on SDS-PAGE.
Cell fractionation
For cell fractionation, we used the protocol of Andrews and Faller (1991) with the following adaptations. Cells and nuclei were spun down at 4°C for 3 min at 500 and 300 g, respectively. 10 mM NaF, 2 mM NaVO3, and protease inhibitors (Complete protease inhibitor cocktail tablets minus EDTA) were added to the lysis buffers. After incubation in hypotonic buffer, NP-40 was added at a concentration of 10% and samples were vortexed shortly and passed through a 25G needle. Whole cell extracts were reconstituted by mixing nuclear and cytosolic extracts.
X. laevis injection studies
mRNAs were synthesized in vitro using SP6 polymerase (Promega). mRNAs were injected in the subequatorial region of a dorsal or ventral blastomere at the four-cell stage as described previously (Fagotto et al., 1996, 1997). Embryos were raised in 0.1x MBSH (88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3, 0.82 mM MgSO4, 0.33 mM Ca[NO3]2, 0.41 mM CaCl2, 10 mM Hepes, pH 7.4, 10 mg/ml benzylpenicillin, and 10 mg/ml streptomycin) until tail bud stage and scored. RNA was prepared from late stage 9 embryos as previously described (Schohl and Fagotto, 2003).
dsRNA synthesis D. melanogaster
ß-galactosidase, Daxin, and RanBP3 dsRNAs were synthesized according to Kennerdell and Carthew (1998) and purified using S400 Spin Columns (GE Healthcare). PCR products were verified by DNA sequencing. For D. melanogaster RanBP3 dsRNA, two 750-bps fragments that span exon-2 of the D. melanogaster RanBP3 gene (GC10225) were amplified from genomic DNA. Fragment 1 spans the RanBP3 ORF from position 3411104, and fragment 2 from position 683 to 3'UTR position 1423. The following primers were used: BP3 sense primer 1 (AGAACAACATGCCAAATGTTCAG), BP3 antisense primer 1 (GACGCCGTTTTTCGCTTCCTCT), BP3 sense primer 2 (AGAAACGCAAATACGAGGAGGT), and BP3 antisense primer 2 (GGCGCGCTTTATTAATTAGTGT). pBS(SK-)-Daxin-Myc (Willert et al., 1999) was used as a template to generate a 750-bp dsRNA Daxin fragment spanning nucleotides 14622210. The following primers were used: Daxin sense primer (GAGAAGTTTGCACTGGACGAAGA) and Daxin antisense primer (GGCTTGACAAGACCCATCGCTT). For ß-galactosidase dsRNA, nucleotides spanning from 1296 to 1921 of the lac operon (available from GenBank/EMBL/DDBJ under accession no. J01636) were subcloned into pGEMT-easy and T7 RNA polymerase promoters were added by PCR of the linearized plasmid.
Cuticle analysis and immunohistochemistry
Embryos were prepared for injections as previously described (Kennerdell and Carthew, 1998) with minor modifications. Embryos were injected with 3 µM dsRNA, and for RanBP3 RNAi, a 1:1 mixture of two dsRNA fragments was used. After injection, the embryos were covered with oil and incubated for 48 h at 18°C in a humidified chamber. After incubation, the embryos were manually dissected from their viteline membranes and incubated overnight at 65°C in glycerol/acetic acid (1:3). The next day, embryos were mounted in Hoyers mounting medium and incubated for 12 d at 55°C and visualized by dark field microscopy. For antiEngrailed antibody staining, embryos were incubated for 15 h, fixed, manually devitalinized, and processed for antibody staining according to standard procedures (Patel, 1994).
D. melanogaster RT-PCR
Dechorionated wt embryos were injected with buffer or RanBP3 dsRNA and then aged at 16°C for 15 h. RNA was prepared and treated with DNase (RNA-Easy kit; QIAGEN), and randomly primed first-strand cDNA was prepared using SuperScript kit (Invitrogen), both according to the manufacturer's protocol. Samples for the RP49-specific control PCRs were initially diluted 80-fold to compensate for higher expression levels. Subsequently, a series of twofold dilutions was performed for each sample; 1 µl of each dilution was used in a PCR reaction. Primers were chosen to span an intron to allow discrimination of PCR products originating from contaminating genomic DNA from those originating from first-strand cDNA. Primers used were as follows: RanBP3 forward (AGTGACAGCGATAACACAGCGATAA) and reverse (GCAGAAACGGATTATTCAGCAGG) and RP49 forward (ATGACCATCCGCCCAGCA) and reverse (TTGGGGTTGGTGAGGCGGAC). 30-cycle PCRs were performed using SuperTaq Plus polymerase (SpheroQ), and equal volumes of the reaction products were electrophoresed on 1.5% agarose gels and visualized by ethidium bromide staining.
![]() |
Acknowledgments |
---|
J. Hendriksen is supported by grants from the Netherlands Science Foundation Medical Sciences (901-020250) and the Dutch Cancer Foundation (NKB/KWF; 2004-3080). F. Fagotto is supported by the Canadian Cancer Research Society, and J. Noordermeer is supported by a Netherlands Science Foundation Pioneer grant.
Submitted: 23 February 2005
Accepted: 31 October 2005
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Andrews, N.C., and D.V. Faller. 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19:2499.[Medline]
Barker, N., A. Hurlstone, H. Musisi, A. Miles, M. Bienz, and H. Clevers. 2001. The chromatin remodelling factor Brg-1 interacts with ß-catenin to promote target gene activation. EMBO J. 20:49354943.
Barth, A.I.M., D.B. Stewart, and J.W. Nelson. 1999. T cell factor-activated transcription is not sufficient to induce anchorage-independent growth of epithelial cells expressing mutant ß-catenin. Proc. Natl. Acad. Sci. USA. 96: 49474952.
Behrens, J., J.P. von Kries, M. Kuhl, L. Bruhn, D. Wedlich, R. Grosschedl, and W. Birchmeier. 1996. Functional interaction of beta-catenin with the transcription factor LEF-1. Nature. 382:638642.[CrossRef][Medline]
Behrens, J., B.A. Jerchow, M. Wurtele, J. Grimm, C. Asbrand, R. Wirtz, M. Kuhl, D. Wedlich, and W. Birchmeier. 1998. Functional interaction of an axin homolog, conductin, with ß-catenin, APC, and GSK3ß. Science. 280:596599.
Bienz, M., and H. Clevers. 2000. Linking colorectal cancer to Wnt signaling. Cell. 103:311320.[CrossRef][Medline]
Boutros, M., and M. Mlodzik. 1999. Dishevelled: at the crossroads of divergent intracellular signaling pathways. Mech. Dev. 83:2737.[CrossRef][Medline]
Brannon, M., M. Gomperts, L. Sumoy, R.T. Moon, and D. Kimelman. 1997. A ß-catenin/XTcf-3 complex binds to the siamois promoter to regulate dorsal axis specification in Xenopus. Genes Dev. 11:23592370.
Brannon, M., J.D. Brown, R. Bates, D. Kimelman, and R.T. Moon. 1999. XCtBP is a XTcf-3 co-repressor with roles throughout Xenopus development. Development. 126:31593170.
Brummelkamp, T.R., R. Bernards, and R. Agami. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science. 296:550553.
Calvo, R., J. West, W. Franklin, P. Erickson, P. Bemis, E. Li, B. Helfrich, P. Bunn, J. Roche, E. Brambilla, et al. 2000. Altered HOX and WNT7A expression in human lung cancer. Proc. Natl. Acad. Sci. USA. 97:1277612781.
Campbell, R.E., O. Tour, A.E. Palmer, P.A. Steinbach, G.S. Baird, D.A. Zacharias, and R.Y. Tsien. 2002. A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. USA. 99:78777882.
Cavallo, R.A., R.T. Cox, M.M. Moline, J. Roose, G.A. Polevoy, H. Clevers, M. Peifer, and A. Bejsovec. 1998. Drosophila Tcf and groucho interact to repress wingless signaling activity. Nature. 395:604608.[CrossRef][Medline]
Chen, G., J. Fernandez, S. Mische, and A.J. Courey. 1999. A functional interaction between the histone deacetylase Rpd3 and the corepressor groucho in Drosophila development. Genes Dev. 13:22182230.
Dundr, M., J.G. McNally, J. Cohen, and T. Misteli. 2002. Quantitation of GFP-fusion proteins in single living cells. J. Struct. Biol. 140:9299.[CrossRef][Medline]
Eleftheriou, A., M. Yoshida, and B.R. Henderson. 2001. Nuclear export of human ß-catenin can occur independent of CRM1 and the adenomatous polyposis coli tumor suppressor. J. Biol. Chem. 276:2588325888.
Englmeier, L., M. Fornerod, F.R. Bischoff, C. Petosa, I.W. Mattaj, and U. Kutay. 2001. RanBP3 influences interactions between CRM1 and its nuclear protein export substrates. EMBO Rep. 2:926932.
Fagotto, F., N. Funayama, U. Gluck, and B.M. Gumbiner. 1996. Binding to cadherins antagonizes the signaling activity of ß-catenin during axis formation in Xenopus. J. Cell Biol. 132:11051114.[Abstract]
Fagotto, F., K. Guger, and B.M. Gumbiner. 1997. Induction of the primary dorsalizing center in Xenopus by the Wnt/GSK/ß-catenin signaling pathway, but not by Vg1, activin or noggin. Development. 124:453460.
Funayama, N., F. Fagotto, P. McCrea, and B.M. Gumbiner. 1995. Embryonic axis induction by the armadillo repeat domain of ß-catenin: evidence for intracellular signaling. J. Cell Biol. 128:959968.[Abstract]
Groden, J., A. Thliveris, W. Samowitz, M. Carlson, L. Gelbert, H. Albertsen, G. Joslyn, J. Stevens, L. Spirio, M. Robertson, et al. 1991. Identification and characterization of the familial adenomatous polyposis coli gene. Cell. 66:589600.[CrossRef][Medline]
Hart, M.J., R. de los Santos, I.N. Albert, B. Rubinfeld, and P. Polakis. 1998. Downregulation of beta-catenin by human axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr. Biol. 8:573581.[CrossRef][Medline]
He, T.C., A.B. Sparks, C. Rago, H. Hermeking, L. Zawel, L.T. da Costa, P.J. Morin, B. Vogelstein, and K.W. Kinzler. 1998. Identification of c-MYC as a target of the APC pathway. Science. 281:15091512.
He, X., J.P. Saint-Jeannet, J.R. Woodgett, H.E. Varmus, and I.B. Dawid. 1995. Glycogen synthase kinase-3 and dorsoventral patterning in Xenopus embryos. Nature. 374:617622.[CrossRef][Medline]
Hecht, A., and R. Kemler. 2000. Curbing the nuclear activities of ß-catenin. Control over Wnt target gene expression. EMBO Rep. 1:2428.
Henderson, B.R. 2000. Nuclear-cytoplasmic shuttling of APC regulates ß-catenin subcellular localization and turnover. Nat. Cell Biol. 2:653660.[CrossRef][Medline]
Henderson, B.R., and A. Eleftheriou. 2000. A comparison of the activity, sequence specificity, and CRM1-dependence of different nuclear export signals. Exp. Cell Res. 256:213224.[CrossRef][Medline]
Henderson, B.R., and F. Fagotto. 2002. The ins and outs of APC and ß-catenin nuclear transport. EMBO Rep. 3:834839.
Hetzer, M., D. Bilbao-Cortes, T.C. Walther, O.J. Gruss, and I.W. Mattaj. 2000. GTP hydrolysis by Ran is required for nuclear envelope assembly. Mol. Cell. 5:10131024.[CrossRef][Medline]
Ikeda, S., S. Kishida, H. Yamamoto, H. Murai, S. Koyama, and A. Kikuchi. 1998. Axin, a negative regulator of the Wnt signaling pathway, forms a complex with GSK-3ß and ß-catenin and promotes GSK-3ß-dependent phosphorylation of ß-catenin. EMBO J. 17:13711384.
Itoh, K., V.E. Krupnik, and S.Y. Sokol. 1998. Axis determination in Xenopus involves biochemical interactions of axin, glycogen synthase kinase 3 and beta-catenin. Curr. Biol. 8:591594.[CrossRef][Medline]
Izaurralde, E., U. Kutay, C. von Kobbe, I.W. Mattaj, and D. Gorlich. 1997. The asymmetric distribution of the constituents of the Ran system is essential for transport into and out of the nucleus. EMBO J. 16:65356547.
Kao, K.R., and R.P. Elinson. 1988. The entire mesodermal mantle behaves as spemann's organizer in dorsoanterior enhanced Xenopus laevis embryos. Dev. Biol. 127:6477.[CrossRef][Medline]
Kato, N., M. Romero, L. Catasus, and J. Prat. 2004. The STK11/LKB1 Peutz-Jegher gene is not involved in the pathogenesis of sporadic sex cord-stromal tumors, although loss of heterozygosity at 19p13.3 indicates other gene alteration in these tumors. Hum. Pathol. 35:11011104.[CrossRef][Medline]
Kennerdell, J.R., and R.W. Carthew. 1998. Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell. 95:10171026.[CrossRef][Medline]
Kinzler, K.W., M.C. Nilbert, L.K. Su, B. Vogelstein, T.M. Bryan, D.B. Levy, K.J. Smith, A.C. Preisinger, P. Hedge, D. McKechnie, et al. 1991. Identification of FAP locus genes from chromosome 5q21. Science. 253:661665.[Medline]
Korinek, V., N. Barker, P.J. Morin, D. van Wichen, R. de Weger, K.W. Kinzler, B. Vogelstein, and H. Clevers. 1997. Constitutive transcriptional activation by a ß-catenin-Tcf complex in APC/ colon carcinoma. Science. 275:17841787.
Kramps, T., O. Peter, E. Brunner, D. Nellen, B. Froesch, S. Chatterjee, M. Murone, S. Zullig, and K. Basler. 2002. Wnt/wingless signaling requires BCL9/legless-mediated recruitment of pygopus to the nuclear ß-catenin-TCF complex. Cell. 109:4760.[CrossRef][Medline]
Lee, J.Y., S.M. Dong, H.S. Kim, S.Y. Kim, E.Y. Na, M.S. Shin, S.H. Lee, W.S. Park, K.M. Kim, Y.S. Lee, et al. 1998. A distinct region of chromosome 19p13.3 associated with the sporadic form of adenoma malignum of the uterine cervix. Cancer Res. 58:11401143.[Abstract]
Levanon, D., R.E. Goldstein, Y. Bernstein, H. Tang, D. Goldenberg, S. Stifani, Z. Paroush, and Y. Groner. 1998. Transcriptional repression by AML1 and LEF-1 is mediated by the TLE/groucho corepressors. Proc. Natl. Acad. Sci. USA. 95:1159011595.
Lindsay, M.E., J.M. Holaska, K. Welch, B.M. Paschal, and I.G. Macara. 2001. Ran-binding protein 3 is a cofactor for Crm1-mediated nuclear protein export. J. Cell Biol. 153:13911402.
Mao, J., J. Wang, B. Liu, W. Pan, G.H. Farr III, C. Flynn, H. Yuan, S. Takada, D. Kimelman, L. Li, and D. Wu. 2001. Low-density lipoprotein receptor-related protein-5 binds to axin and regulates the canonical Wnt signaling pathway. Mol. Cell. 7:801809.[CrossRef][Medline]
Miyai, K., Y. Furugen, T. Matsumoto, K. Iwabuchi, S. Hirose, K. Kinoshita, and H. Fujii. 2004. Loss of heterozygosity analysis in uterine cervical adenocarcinoma. Gynecol. Oncol. 94:115120.[CrossRef][Medline]
Molenaar, M., M. van de Wetering, M. Oosterwegel, J. Peterson-Maduro, S. Godsave, V. Korinek, J. Roose, O. Destree, and H. Clevers. 1996. XTcf-3 transcription factor mediates ß-catenin-induced axis formation in Xenopus embryos. Cell. 86:391399.[CrossRef][Medline]
Mueller, L., V.C. Cordes, F.R. Bischoff, and H. Ponstingl. 1998. Human RanBP3, a group of nuclear RanGTP binding proteins. FEBS Lett. 427:330336.[CrossRef][Medline]
Neufeld, K.L., F. Zhang, B.R. Cullen, and R.L. White. 2000. APC-mediated downregulation of ß-catenin activity involves nuclear sequestration and nuclear export. EMBO Rep. 1:519523.
Noguchi, E., Y. Saitoh, S. Sazer, and T. Nishimoto. 1999. Disruption of the YRB2 gene retards nuclear protein export, causing a profound mitotic delay, and can be rescued by overexpression of XPO1/CRM1. J. Biochem. (Tokyo). 125:574585.[Abstract]
Noordermeer, J., P. Johnston, F. Rijsewijk, R. Nusse, and P.A. Lawrence. 1992. The consequences of ubiquitous expression of the wingless gene in the Drosophila embryo. Development. 116:711719.
Nusse, R. 1999. WNT targets. Repression and activation. Trends Genet. 15:13.[CrossRef][Medline]
Nusslein-Volhard, C., and E. Wieschaus. 1980. Mutations affecting segment number and polarity in Drosophila. Nature. 287:795801.[CrossRef][Medline]
Oesterreich, S., D.C. Allredl, S.K. Mohsin, Q. Zhang, H. Wong, A.V. Lee, C.K. Osborne, and P. O'Connell. 2001. High rates of loss of heterozygosity on chromosome 19p13 in human breast cancer. Br. J. Cancer. 84:493498.[CrossRef][Medline]
Parker, D.S., J. Jemison, and K.M. Cadigan. 2002. Pygopus, a nuclear PHD-finger protein required for wingless signaling in Drosophila. Development. 129:25652576.
Patel, N.H. 1994. Imaging neuronal subsets and other cell types in whole-mount Drosophila embryos and larvae using antibody probes. Methods Cell Biol. 44:445487.[Medline]
Patel, N.H., E. Martin-Blanco, K.G. Coleman, S.J. Poole, M.C. Ellis, T.B. Kornberg, and C.S. Goodman. 1989. Expression of engrailed proteins in arthropods, annelids, and chordates. Cell. 58:955968.[CrossRef][Medline]
Phair, R.D., S.A. Gorski, and T. Misteli. 2004. Measurement of dynamic protein binding to chromatin in vivo, using photobleaching microscopy. Methods Enzymol. 375:393414.[Medline]
Polakis, P. 2000. Wnt signaling and cancer. Genes Dev. 14:18371851.
Quinn, L.A., G.E. Moore, R.T. Morgan, and L.K. Woods. 1979. Cell lines from human colon carcinoma with unusual cell products, double minutes, and homogeneously staining regions. Cancer Res. 39:49144924.[Abstract]
R Development Core Team. 2005. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org (accessed April 17, 2005).
Roose, J., M. Molenaar, J. Peterson, J. Hurenkamp, H. Brantjes, P. Moerer, M. van de Wetering, O. Destree, and H. Clevers. 1998. The Xenopus Wnt effector XTcf-3 interacts with groucho-related transcriptional repressors. Nature. 395:608612.[CrossRef][Medline]
Rosin-Arbesfeld, R., F. Townsley, and M. Bienz. 2000. The APC tumour suppressor has a nuclear export function. Nature. 406:10091012.[CrossRef][Medline]
Rosin-Arbesfeld, R., A. Cliffe, T. Brabletz, and M. Bienz. 2003. Nuclear export of the APC tumour suppressor controls ß-catenin function in transcription. EMBO J. 22:11011113.
Sakanaka, C., J.B. Weiss, and L.T. Williams. 1998. Bridging of ß-catenin and glycogen synthase kinase-3ß by axin and inhibition of ß-catenin-mediated transcription. Proc. Natl. Acad. Sci. USA. 95:30203023.
Schohl, A., and F. Fagotto. 2003. A role for maternal ß-catenin in early mesoderm induction in Xenopus. EMBO J. 22:33033313.
Staal, F.J., M. Noort Mv, G.J. Strous, and H.C. Clevers. 2002. Wnt signals are transmitted through N-terminally dephosphorylated ß-catenin. EMBO Rep. 3:6368.
Tago, K., T. Nakamura, M. Nishita, J. Hyodo, S. Nagai, Y. Murata, S. Adachi, S. Ohwada, Y. Morishita, H. Shibuya, and T. Akiyama. 2000. Inhibition of Wnt signaling by ICAT, a novel ß-catenin-interacting protein. Genes Dev. 14:17411749.
Takemaru, K.I., and R.T. Moon. 2000. The transcriptional coactivator CBP interacts with ß-catenin to activate gene expression. J. Cell Biol. 149:249254.
Takemaru, K.I, S. Yamaguchi, Y.S. Lee, Y. Zhang, R.W. Carthew, and R.T. Moon. 2003. Chibby, a nuclear ß-catenin-associated antagonist of the Wnt/wingless pathway. Nature. 422:905909.[CrossRef][Medline]
Taura, T., H. Krebber, and P.A. Silver. 1998. A member of the Ran-binding protein family, Yrb2p, is involved in nuclear protein export. Proc. Natl. Acad. Sci. USA. 95:74277432.
Thompson, B., F. Townsley, R. Rosin-Arbesfeld, H. Musisi, and M. Bienz. 2002. A new nuclear component of the Wnt signaling pathway. Nat. Cell Biol. 4:367373.[CrossRef][Medline]
Tolwinski, N.S., M. Wehrli, A. Rives, N. Erdeniz, S. DiNardo, and E. Wieschaus. 2003. Wg/Wnt signal can be transmitted through arrow/LRP5,6 and axin independently of Zw3/Gsk3ß activity. Dev. Cell. 4:407418.[CrossRef][Medline]
Tucci, S., W. Futterweit, E.S. Concepcion, D.A. Greenberg, R. Villanueva, T.F. Davies, and Y. Tomer. 2001. Evidence for association of polycystic ovary syndrome in caucasian women with a marker at the insulin receptor gene locus. J. Clin. Endocrinol. Metab. 86:446449.
van Es, J.H., C. Kirkpatrick, M. van de Wetering, M. Molenaar, A. Miles, J. Kuipers, O. Destree, M. Peifer, and H. Clevers. 1999. Identification of APC2, a homologue of the adenomatous polyposis coli tumour suppressor. Curr. Biol. 9:105108.[CrossRef][Medline]
van Noort, M., J. Meeldijk, R. van der Zee, O. Destree, and H. Clevers. 2002. Wnt signaling controls the phosphorylation status of ß-catenin. J. Biol. Chem. 277:1790117905.
Waltzer, L., and M. Bienz. 1998. Drosophila CBP represses the transcription factor TCF to antagonize wingless signaling. Nature. 395:521525.[CrossRef][Medline]
Wharton, K.A., Jr. 2003. Runnin' with the Dvl: proteins that associate with Dsh/Dvl and their significance to Wnt signal transduction. Dev. Biol. 253:117.[CrossRef][Medline]
Wiechens, N., and F. Fagotto. 2001. CRM1- and Ran-independent nuclear export of beta-catenin. Curr. Biol. 11:1827.[CrossRef][Medline]
Willert, K., C.Y. Logan, A. Arora, M. Fish, and R. Nusse. 1999. A Drosophila axin homolog, Daxin, inhibits Wnt signaling. Development. 126:41654173.
Wolff, B., J.J. Sanglier, and Y. Wang. 1997. Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV-1) Rev protein and Rev-dependent mRNA. Chem. Biol. 4:139147.[CrossRef][Medline]
Yanaihara, N., A. Okamoto, and S. Matsufuji. 2003. A commonly deleted region in ovarian cancer on chromosome 19p13.3, not including the OAZ1 gene. Int. J. Oncol. 23:567575.[Medline]
Yang, T.L., Y.R. Su, C.S. Huang, J.C. Yu, Y.L. Lo, P.E. Wu, and C.Y. Shen. 2004. High-resolution 19p13.2-13.3 allelotyping of breast carcinomas demonstrates frequent loss of heterozygosity. Genes Chromosomes Cancer. 41:250256.[CrossRef][Medline]
Zeng, L., F. Fagotto, T. Zhang, W. Hsu, T.J. Vasicek, W.L. Perry III, J.J. Lee, S.M. Tilghman, B.M. Gumbiner, and F. Costantini. 1997. The mouse Fused locus encodes axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. Cell. 90:181192.[CrossRef][Medline]
Related Article