Article |
Address correspondence to Ronald A. Milligan, Department of Cell Biology, CB-227, Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. Tel.: (858) 784-9827. Fax: (858) 784-2749. E-mail: milligan{at}scripps.edu
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: MAP2; tau; structure; microtubule; cryo-EM
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
MAP2/tau proteins have dissimilar NH2-terminal "projection" domains and homologous COOH-terminal microtubule binding domains. Studies investigating the cytoskeleton of neuronal processes showed that microtubules with MAP2 or tau bound are organized in parallel arrays in which the spacing between microtubules correlates with the length of the projection domains of the MAP (Hirokawa, 1982; Chen et al., 1992). Rotary shadowing experiments and circular dichroism studies on isolated MAP2/tau proteins indicate that they are highly extended polypeptides with little or no detectable secondary structure (Voter and Erickson 1982; Schweers et al., 1994).
The MAP2/tau microtubule binding domain contains three or four 18-residue microtubule binding repeats (MTBRs) separated by 1314-residue inter-repeats (IRs) (Lewis et al., 1988; Himmler et al., 1989). Neighboring MTBRs within a given MAP share moderate homology; however, sequence alignment shows that repeats at identical positions in different MAP2s and taus are highly conserved (Fig. 1 A). There is evidence that IRs as well as MTBRs contribute to microtubule binding (Butner and Kirschner, 1991; Goode and Feinstein, 1994; Ludin et al., 1996). The affinity of the repeat domain for microtubules and its polymer stabilizing activity both increase with the number of MTBR-IR modules (Ludin et al., 1996; Goode et al., 2000). Binding to microtubules is mediated, in part, by the acidic tubulin COOH termini (Paschal et al., 1989), because their removal by subtilisin reduces MAP binding (Serrano et al., 1984, 1985).
|
Here we have used cryo-EM and helical image analysis to determine the geometry of MAP2c and tau binding to microtubules. We show that MAP2c- or tau-decorated microtubules have additional ordered density along protofilament ridges compared with undecorated microtubules. We used undecagold labeling to show that the IRs lie along the ridges and not between protofilaments. The gold labeling data suggest that the MTBR-IR modules may be uniquely targeted to or ß tubulin. Taken together, our results suggest that MAP2 and tau proteins reduce microtubule depolymerization by bridging and stabilizing the tubulintubulin interfaces along protofilaments.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We used cosedimentation assays to determine conditions for full decoration of microtubules by MAP2c and tau. Under saturating conditions, MAP2c bound microtubules at a ratio of one molecule for every 2.4 tubulin monomers (Fig. 1 B, I), and tau at one molecule for every 3.8 tubulin monomers (Fig. 1 B, II). These stoichiometry values are very similar to those determined by others (Gustke et al., 1994; Coffey and Purich, 1995). We used the conditions found for maximal binding to prepare decorated microtubules for cryo-EM.
Images of microtubules decorated with either MAP2c or tau were visually indistinguishable from those of undecorated microtubules (Fig. 2 A). Both the diameter and moiré (super-twist) repeat length of decorated 15-protofilament helical microtubules were similar to those of undecorated microtubules (Fig. 2 B), indicating that binding of MAP2c or tau does not induce large changes in the microtubule structure. Although individual images of decorated and undecorated microtubules look similar, differences were evident after averaging the layer line data from a number of images. In particular, layer line 1 amplitudes were stronger for decorated microtubules (Fig. S1, available at http://www.jcb.org/cgi/content/full/jcb.200201048/DC1) with minor changes in other layer lines, consistent with an increase in protofilament density. There were no additional layer lines in the decorated microtubules, as would be expected if the MAP projection domains were contributing to off-equatorial diffraction (Amos, 1977).
|
|
The COOH termini of and ß tubulin are disordered in undecorated microtubules (Nogales et al., 1998), but are directly involved in MAP2 and tau binding. Therefore, we interpret the elongated difference maps to represent the MAP2 and tau repeat domains together with the tubulin COOH termini. Even though we did not observe any difference density in the valleys between protofilaments (Fig. 3, D and F, arrows), these difference maps still allow for the possibility that the MAP2c and tau proteins bind laterally across protofilaments; the 1314-residue IR could stretch between adjacent protofilaments but would not be visualized at the resolution of this study.
MAP2/tau proteins bind longitudinally along protofilaments
To distinguish between lateral and longitudinal binding geometries, we used undecagold labeling to locate IR-3/4 of MAP2c. The single natural cysteine (Cys 348) present in MAP2c was first replaced by a serine, thereby generating a cysteine-free MAP2c (cf-MAP2c). This mutant protein bound microtubules with the same stoichiometry as MAP2c (Fig. 4 A). We then introduced a cysteine in place of lysine 364 (Fig. 1 A, asterisk) in IR-3/4 of cf-MAP2c generating a cysteine-IR-MAP2c mutant (cIR-MAP2c), which we conjugated to undecagold (Au11) (Milligan et al., 1990; Safer, 1999; Rice et al., 1999). We confirmed that neither the mutation nor Au11 attachment interferes with cIR-MAP2c binding to microtubules (Fig. 4 B). The 3D map calculated from Au11cIR-MAP2cdecorated microtubules showed an additional knob-like density on the microtubule surface. Difference mapping and statistical analysis showed that this density was statistically significant at the P = 0.001 level (Fig. 5 and Fig. S3, E and F).
|
|
The repeat domain recognizes and ß tubulins uniquely
Unexpectedly, we observed an additional degree of specificity in the Au11IR-3/4 localization. As and ß tubulins are indistinguishable at the resolution of this study, either tubulin monomer (40-Å repeat) or dimer symmetry (80-Å repeat) may be imposed during averaging. With longitudinal binding and nonspecific MTBR-IR module attachment to
or ß tubulins, image analysis and averaging would yield an undecagold difference peak at every tubulin monomer irrespective of whether monomer or dimer symmetry is applied (Fig. 5 B, II). On the other hand, if MTBR-IR modules uniquely target
or ß tubulin, the undecagold difference peak will only be visualized when dimer symmetry is imposed (Fig. 5 B, I). We analyzed our data imposing either monomer or dimer symmetry and were only able to visualize the undecagold when we used dimer symmetry (Fig. 5 B, III). These data strongly argue in favor of specific binding of IR-3/4 to either
or ß tubulin, but not to both (Fig. 5 B, III).
The repeat domains bind helix 11 (H11), helix 12 (H12), and the COOH termini of tubulin
Although there is considerable evidence showing that MAP2 and tau are unstructured in solution (Voter and Erickson, 1982; Schweers et al., 1994), the data presented here show that they form ordered densities along the protofilament ridges when they bind microtubules. Thus, it seems likely that specific residues on the protofilament surface are required to fold the MTBR-IR modules and induce the bound density that we observe. To investigate which structural elements on the tubulin surface are likely to induce the IRs and MTBRs to fold, we manually docked the atomic coordinates of the ß tubulin dimer into the microtubule map and displayed the result with the MAP2c and undecagold difference maps. As the tubulin COOH termini (18 and 10 residues for
and ß tubulins, respectively) are disordered and not resolved in the structure (Nogales et al., 1998), we modeled these parts of the molecule to show where they exit the protofilament surface (Fig. 6 A). MAP2c difference densities are closely apposed to helices 11 (H11) and 12 (H12), which are the prominent structural elements of tubulin exposed on the outer surface of microtubules. The last resolved residues of the tubulin COOH terminus are positioned directly below the MAP2c difference map (Fig. 6 A).
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
MAP2 and tau may stabilize protofilaments by bridging tubulin interfaces
Our data support a previously proposed model that longitudinal binding of the MAP2/tau proteins to protofilaments leads to microtubule stabilization by bridging the tubulin interfaces (Dye et al., 1993). It is likely that the longitudinal MAP2/tau binding stabilizes a specific conformation of the tubulin interdimer interface. The conformation of this interface depends on the state of guanosine nucleotide in ß tubulin. The GTP-bound state mediates straight interdimer interfaces and maintains straight protofilaments (Muller-Reichert et al., 1998). In the absence of the GTP cap, the GDP-bound state leads to curved protofilaments (Gigant et al., 2000), which promote microtubule catastrophe. By bridging tubulintubulin interfaces axially, we suggest that MAP2/tau binding along protofilaments may stabilize a straight GDP conformation and produce a cumulative effect along their length. Furthermore, longitudinal binding is consistent with evidence showing that the binding of MAP2c and tau decreases flexibility of microtubules (Dye et al., 1993; Felgner et al., 1997). In contrast, taxol-induced stabilization slightly increases microtubule flexibility (Mickey and Howard, 1995; Felgner et al., 1997). This distinction may underlie the observed differences between the action of taxol and MAP2/tau proteins in vivo (Spero and Roisen, 1985; Leclerc et al., 1996).
The effect of MAP2/tau on stabilizing straight protofilaments by longitudinal binding is consistent with their observed effects on microtubule dynamics. At low concentrations, MAP2/tau proteins decrease the frequency of catastrophes and dramatically increase the frequency of rescues (Joly et al., 1989; Kowalski and Williams, 1993; Gamblin et al., 1996). Furthermore, rescues tend to occur at regions in microtubules where MAP2 and tau proteins are bound, suggesting that the protofilaments are less likely to curl at such regions (Ichihara et al., 2001). Below the critical concentrations of tubulin, MAP2/tau proteins inhibit microtubule catastrophes and lead to "stalled" microtubule ends, which do not shrink or grow (Panda et al., 1995).
At high concentrations, MAP2/tau proteins moderately increase the rate of tubulin polymerization and slightly lower its critical concentration (Drechsel et al., 1992), effects that resemble the consequences of subtilisin cleavage of the tubulin COOH termini or increasing the divalent cation concentration. These "charge-shielding" effects enhance polymerization presumably by altering the conformation or charge of the tubulin COOH termini at the growing ends (Wolff et al., 1996). We suggest that the latter effects are distinct from those observed on microtubule dynamics, because they are observed at a different concentration range (Drechsel et al., 1992). The effects on microtubule dynamics were observed with low MAP2 or tau concentrations, whereas effects on the polymerization rate at such concentrations were negligible (Gamblin et al., 1996). Microtubule flexibility also decreased when MAP2c and tau bound to microtubules at low concentrations (Felgner et al., 1997). The convergence of the effects on microtubule dynamics and flexibility at similar concentrations of bound MAPs suggests that both are a result of the MAPs acting on the protofilament conformation.
MTBRs bind tubulin COOH termini and H12, whereas IRs bind H11
We observed the MTBR peaks in the MAP2c difference map to lie along H12. These MTBR peaks contain higher density compared with neighboring regions in the MAP2c difference map and colocalize with the tubulin COOH termini exit sites. Thus, they are likely to be composed of MTBRs and the tubulin COOH termini, both of which presumably become ordered upon binding. This evidence is consistent with NMR data suggesting that MTBR peptides fold when they bind microtubules, interacting with tyrosines within H12 and the tubulin COOH terminus (Kotani et al., 1990). The Au11 localization indicates that IRs are bound to the end of H11, suggesting that the sequences of the IRs, not just their lengths (as suggested by Butner and Kirschner, 1991), are crucial for repeat domain function. A combination of recent mutagenesis, peptide, and cross-linking studies has suggested that IR sequences contribute to the microtubule affinity and stabilizing activity of the repeat domain (Goode and Feinstein, 1994; Chau et al., 1998; Goode et al., 2000). Our data are consistent with the idea that IRs and MTBRs bind at adjacent sites and that both are required for stabilizing protofilaments (Fig. 7).
We hypothesize that both IR and MTBR binding to H11 and H12 would influence the conformation of longitudinal tubulin interfaces via the H11-H12 loop. The H11-H12 loop participates in the outer region of the longitudinal tubulin interfaces (Nogales et al., 1999). There are two possible explanations for how the MTBR-IR binding arrangement on tubulins might lead to increased stability at the interfaces. First, MTBR-IR binding to H12 and H11 may possibly influence the flexibility of the intervening loop, in turn affecting the longitudinal interface. Second, the MTBRCOOH terminus complex could act as a physical wedge that stabilizes tubulin interfaces by preventing the straight to curved protofilament conformation. Validation of either possibility must await a high-resolution structure of the MAP2/taumicrotubule complex.
MTBR-IR modules specifically target or ß tubulins
The specific targeting of MAP2c to ß tubulin dimers is suggested by the localization of Au11IR-3/4 near only one of the two possible tubulintubulin interfaces. As we cannot distinguish
and ß tubulin in our 3D maps, we are unable to say whether the IR-3/4 is at the interdimer interface or at the intradimer interface. However, our results suggest that IRs bind to either ß
(interdimer) or
ß (intradimer) regions. Such specific targeting is consistent with the evolutionarily maintained divergence between neighboring IRs and MTBRs (Fig. 1 A). It is notable that many charged residues that lie on the surfaces of H11 and H12 are different in
and ß tubulin and this distribution is highly conserved across species (Villasante et al., 1986; Wang et al., 1986; Nogales et al., 1998, 1999). Specificity in targeting requires such differences in the residue distribution on
and ß tubulins and in different MTBRs and IRs within the repeat domains.
Comparison with kinesinmicrotubule interactions
As suggested here for MAPs, the kinesin motor domain effectively distinguishes between and ß tubulin, because only one motor binds per tubulin heterodimer (Sosa et al., 1997). Specific targeting of
or ß tubulin is attained by both kinesin and MAP2c using completely different microtubule binding domains. Furthermore, a class-specific lysine-rich insertion in KIF1A motor domain (termed the K-loop) binds the ß tubulin COOH terminus, forming an ordered complex that was observed at medium resolution (Kikkawa et al., 2000), suggesting that the COOH termini induce K-loop folding in the KIF1A. This phenomenon, ordering of the COOH termini and K-loop, is analogous to what we suggest is occurring with the MTBRs in MAP2c. Finally, the overlap between MAP and kinesin binding sites on the protofilament surface suggests that steric interference would occur between these two classes of molecules when both attempt to bind microtubules simultaneously. Such interference probably accounts for the observed effects of MAPs in inhibiting kinesin-based motility, observed in vivo (Ebneth et al., 1998; Trinczek et al., 1999). Thus, the ordered longitudinal binding of MAPs along the outside of the protofilament ridges not only stabilizes microtubules, but also may regulate kinesin-based motility along microtubules.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
To generate a cysteine-free mutant of MAP2c, cysteine 348 in MAP2c R3 (Fig. 1 A) was mutated to serine (cf-MAP2c) by site-directed mutagenesis using the primer extension method (Stratagene) with the primer 5'GTTCTTTAGAGAGCCAGATTTGGAAGTC3' and its complementary strand (Operon). The poorly conserved lysine 364 (Fig. 1 A, asterisk) of MAP2c IR-3/4 was mutated to cysteine in cf-MAP2c (cIR-MAP2c) with the primer 5'TACACTCTCAATGCACACGCGTCCACC3'and its complementary strand (Operon). All point mutagenesis steps were confirmed by DNA sequencing. The cf-MAP2c and cIR-MAP2c mutants were bacterially expressed and purified as described above.
Microtubule binding assays
Microtubules were polymerized by incubating phosphocellulose purified bovine tubulin (Cytoskeleton Co.) at 5 mg/ml in 80 mM Pipes, pH 6.8, 4 mM MgCl2, 1 mM EGTA, 6 mM GTP, 8% DMSO, and 50 µM Taxol for 20 min at 34°C. Polymerized microtubules were then diluted to 0.5 mg/ml into binding buffer (50 mM Pipes, pH 7.6, 1 mM MgCl2, 1 mM EGTA) containing various concentrations of freshly dialyzed MAP2/tau proteins. MAP2/tau proteins with and without microtubules were incubated at 30°C for 1 h to induce microtubule binding, and then spun at 100,000 g for 10 min. Supernatants and pellets were separated then analyzed on SDS-PAGE. Molar ratios of tubulin monomer to MAP2/tau proteins were determined by scanning gel bands using a personal densitometer (Molecular Dynamics) equipped with ImageQuant software.
Undecagold cluster labeling
Monomaleimide undecagold clusters were synthesized and attached to Cys 364 of cIR-MAP2c as previously described (Safer et al., 1986; Safer, 1999; Rice et al., 1999). We used a ratio of 10 mol of activated undecagold to 1 mol of cIR-MAP2c to ensure full labeling. The extent of labeling was confirmed by comparing protein concentration determined by SDS-PAGE to undecagold cluster concentration determined by its absorbance at 420 nm (undecagold extinction coefficient ° = 470 M-1cm-1).
Sample preparation for electron microscopy
Microtubule-saturating MAP2/tau protein concentrations were determined by microtubule binding assays as described above. The MAP2/tau saturated microtubule mixtures (45-µl aliquots) were then applied to glow discharged 400-mesh Quantifoil grids with uniform 2-µm hole carbon support films (Signal Probe Co.). After 2 min, the grids were washed with binding buffer containing MAP2/tau protein, which prevents the dissociation of bound MAP2/tau protein, blotted, and frozen by rapidly plunging them into liquid ethane slush (Dubochet et al., 1988). Frozen grids were stored under liquid nitrogen.
Cryo-EM and helical image analysis
A Gatan cryo-stage was used for transfer and observation of frozen grids in a Philips CM200T FEG electron microscope. Electron micrographs were recorded under low-dose conditions (<10 e/Å2 total dose) at an operating voltage of 120 kV and 40,000 nominal magnification.
Images of 15-protofilament, two-start helical microtubules (assuming tubulin dimer symmetry) were chosen for image analysis (Sosa et al., 1997). Selected micrographs were digitized on a flatbed microdensitometer (PDS 1010G; Perkin-Elmer Corp.) with spot and step sizes equivalent to 4.97 Å at the specimen. The digitized images were analyzed by standard helical reconstruction procedures (DeRosier and Moore, 1970) on Silicon Graphics workstations using the program software package PHOELIX (Whittaker et al., 1995; Carragher et al., 1996). An integral number of microtubule moiré repeats (three to eight) were masked off and Fourier transforms were calculated. Near- and far-side layer lines with Bessel orders up to ±30 and to an axial resolution of 1/18 Å-1 were extracted from the transform of each filament. For each of the final 3D maps, datasets were averaged after bringing them to a common phase origin. The moiré repeat and 80-Å and 40-Å layer lines were used for fitting and averaging of the data. An undecorated microtubule dataset was used as a reference for the first phase origin refinement. In the second and third cycles, the average from the previous cycle was used as the new reference. The axial positions of the layer lines were then refined by two cycles of "sniffing" (Morgan and DeRosier, 1992). Final sets of averaged and "sniffed" layer lines were truncated at 1/20 Å-1 (Fig. S1) and 3D maps were calculated by Fourier-Bessel inversion and synthesis. The following layer lines (n, l) were used to calculate the final 3D maps (Fig. S1), where n = bessel order and l = layer line number: (0, 0); (15, 1); (30, 2); (-17, 17); (-2, 18); (13, 19); (28, 20); (-19, 35); (-4, 36); (11, 37); (26, 38); (-21, 53); (-6, 54); (9, 55); (24, 56).
Difference mapping, statistical analysis, and atomic docking
Each difference map generated was confirmed using statistical difference mapping (Milligan and Flicker, 1987). Individual datasets were moved to a common phase origin and maps were calculated. A mean density and variance were calculated for each voxel in the maps of all datasets, after which a t test was used to compare the maps.
Tubulin ß dimer coordinates (Nogales et al., 1998; Protein Data Bank identification no. 1TUB) were manually docked into the undecorated microtubule 3D map using the program O (Jones et al., 1991) according to the previously published orientation (Nogales et al., 1999). The MAP2 and tau difference maps were displayed at a threshold level corresponding to the expected volume of an MTBR-IR module and the tubulin COOH terminus (31-residue repeat, plus 15-residue tubulin COOH terminus) bound to each tubulin monomer with a specific density of 0.833 D/Å3. 3D maps were rendered in Volvis (New York State University) and atomic coordinates docked into the 3D maps were rendered in AVS (AVS Corp.)
Online supplemental materials
Fig. S1 shows the layer line data from which MAP2c-decorated, tau-decorated, and undecorated microtubule 3D maps were calculated. Fig. S2 shows 3D maps of MAP2c-decorated, tau-decorated, and undecorated microtubules. Fig. S3 shows the MAP2c, tau, and undecagold statistical difference maps. Online supplemental materials are available at http://www.jcb.org/cgi/content/full/jcb.200201048/DC1.
![]() |
Footnotes |
---|
![]() |
Acknowledgments |
---|
J. Al-Bassam is a fellow of the American Heart Association (AHA-0010004Y). R.S. Ozer was supported by a National Institutes of Health fellowship (MH-12504). This work was supported by National Institutes of Health grants GM-52468 (to R.A. Milligan) and MH50861 and AG-05131 (to S. Halpain).
Submitted: 10 January 2002
Revised: 26 April 2002
Accepted: 10 May 2002
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Amos, L.A. 1977. Arrangement of high molecular weightassociated proteins on purified mammalian brain microtubules. J. Cell Biol. 72:642654.[Abstract]
Butner, K.A., and M.W. Kirschner. 1991. Tau protein binds to microtubules through a flexible array of distributed weak sites. J. Cell Biol. 115:717730.[Abstract]
Chau, M.F., M.J. Radeke, C. de Ines, I. Barasoain, L.A. Kohlstaedt, and S.C. Feinstein. 1998. The microtubule-associated protein tau cross-links to two distinct sites on each alpha and beta tubulin monomer via separate domains. Biochemistry. 37:1769217703.[CrossRef][Medline]
Cleveland, D.W., S.Y. Hwo, and M.W. Kirschner. 1977. Physical and chemical properties of purified tau factor and the role of tau in microtubule assembly. J. Mol. Biol. 116:227247.[Medline]
Coffey, R.L., and D.L. Purich. 1995. Non-cooperative binding of the MAP-2 microtubule-binding region to microtubules. J. Biol. Chem. 270:10351040.
Crowther, R.A., and M. Goedert. 2000. Abnormal tau-containing filaments in neurodegenerative diseases. J. Struct. Biol. 130:271279.[CrossRef][Medline]
Drechsel, D.N., A.A. Hyman, M.H. Cobb, and M.W. Kirschner. 1992. Modulation of the dynamic instability of tubulin assembly by the microtubule-associated protein tau. Mol. Biol. Cell. 3:11411154.[Abstract]
Drewes, G., A. Ebneth, and E.M. Mandelkow. 1998. MAPs, MARKs and microtubule dynamics. Trends Biochem. Sci. 23:307311.[CrossRef][Medline]
Dye, R.B., S.P. Fink, and R.C. Williams, Jr. 1993. Taxol-induced flexibility of microtubules and its reversal by MAP2 and Tau. J. Biol. Chem. 268:68476850.
Ebneth, A., R. Godemann, K. Stamer, S. Illenberger, B. Trinczek, and E. Mandelkow. 1998. Overexpression of tau protein inhibits kinesin-dependent trafficking of vesicles, mitochondria, and endoplasmic reticulum: implications for Alzheimer's disease. J. Cell Biol. 143:777794.
Felgner, H., R. Frank, J. Biernat, E.M. Mandelkow, E. Mandelkow, B. Ludin, A. Matus, and M. Schliwa. 1997. Domains of neuronal microtubule-associated proteins and flexural rigidity of microtubules. J. Cell Biol. 138:10671075.
Garcia, M.L., and D.W. Cleveland. 2001. Going new places using an old MAP: tau, microtubules and human neurodegenerative disease. Curr. Opin. Cell Biol. 13:4148.[CrossRef][Medline]
Goldstein, L.S., and S. Gunawardena. 2000. Flying through the Drosophila cytoskeletal genome. J. Cell Biol. 150:F63F68.[Medline]
Goode, B.L., and S.C. Feinstein. 1994. Identification of a novel microtubule binding and assembly domain in the developmentally regulated inter-repeat region of tau. J. Cell Biol. 124:769782.[Abstract]
Goode, B.L., M. Chau, P.E. Denis, and S.C. Feinstein. 2000. Structural and functional differences between 3-repeat and 4-repeat tau isoforms. Implications for normal tau function and the onset of neurodegenetative disease. J. Biol. Chem. 275:3818238189.
Himmler, A., D. Drechsel, M.W. Kirschner, and D.W. Martin, Jr. 1989. Tau consists of a set of proteins with repeated C-terminal microtubule-binding domains and variable N-terminal domains. Mol. Cell. Biol. 9:13811388.[Medline]
Hirokawa, N. 1982. Cross-linker system between neurofilaments, microtubules, and membranous organelles in frog axons revealed by the quick-freeze, deep-etching method. J. Cell Biol. 94:129142.
Joly, J.C., G. Flyn, and D.L. Purich. 1989. The microtubule-binding fragment of microtubule-associated protein-2: location of the protease-accessible site and identification of an assembly-promoting peptide. J. Cell Biol. 109:22892294.[Abstract]
Kikkawa, M., Y. Okada, and N. Hirokawa. 2000. 15 A resolution model of the monomeric kinesin motor, KIF1A. Cell. 100:241252.[Medline]
Kowalski, R.J., and R.C. Williams, Jr. 1993. Microtubule-associated protein 2 alters the dynamic properties of microtubule assembly and disassembly. J. Biol. Chem. 268:98479855.
Leclerc, N., P.W. Baas, C.C. Garner, and K.S. Kosik. 1996. Juvenile and mature MAP2 isoforms induce distinct patterns of process outgrowth. Mol. Biol. Cell. 7:443455.[Abstract]
Lewis, J., E. McGowan, J. Rockwood, H. Melrose, P. Nacharaju, M. Van Slegtenhorst, K. Gwinn-Hardy, M. Paul Murphy, M. Baker, X. Yu, et al. 2000. Neurofibrillary tangles, amyotrophy and progressive motor disturbance in mice expressing mutant (P301L) tau protein. Nat. Genet. 25:402405.[CrossRef][Medline]
Lim, R.W., and S. Halpain. 2000. Regulated association of microtubule-associated protein 2 (MAP2) with Src and Grb2: evidence for MAP2 as a scaffolding protein. J. Biol. Chem. 275:2057820587.
Ludin, B., K. Ashbridge, U. Funfschilling, and A. Matus. 1996. Functional analysis of the MAP2 repeat domain. J. Cell Sci. 109:9199.
Mandelkow, E.M., E. Mandelkow, and R.A. Milligan. 1991. Microtubule dynamics and microtubule caps: a time-resolved cryo-electron microscopy study. J. Cell Biol. 114:977991.[Abstract]
Mickey, B., and J. Howard. 1995. Rigidity of microtubules is increased by stabilizing agents. J. Cell Biol. 130:909917.[Abstract]
Milligan, R.A., and P.F. Flicker. 1987. Structural relationships of actin, myosin, and tropomyosin revealed by cryo-electron microscopy. J. Cell Biol. 105:2939.[Abstract]
Mitchison, T., and M.W. Kirschner. 1984. Dynamic instability of microtubule growth. Nature. 312:237242.[Medline]
Muller-Reichert, T., D. Chretien, F. Severin, and A.A. Hyman. 1998. Structural changes at microtubule ends accompanying GTP hydrolysis: information from a slowly hydrolyzable analogue of GTP, guanylyl (alpha,beta) methylenediphosphonate. Proc. Natl. Acad. Sci. USA. 95:36613666.
Nogales, E., M. Whittaker, R.A. Milligan, and K.H. Downing. 1999. High-resolution model of the microtubule. Cell. 96:7988.[Medline]
Ozer, R.S., and S. Halpain. 2000. Phosphorylation-dependent localization of microtubule-associated protein MAP2c to the actin cytoskeleton. Mol. Biol. Cell. 11:35733587.
Paschal, B.M., R.A. Obar, and R.B. Vallee. 1989. Interaction of brain cytoplasmic dynein and MAP2 with a common sequence at the C terminus of tubulin. Nature. 342:569572.[CrossRef][Medline]
Safer, D. 1999. Undecagold cluster labeling of proteins at reactive cysteine residues. J. Struct. Biol. 127:101105.[CrossRef][Medline]
Schweers, O., E. Schonbrunn-Hanebeck, A. Marx, and E. Mandelkow. 1994. Structural studies of tau protein and Alzheimer paired helical filaments show no evidence for beta-structure. J. Biol. Chem. 269:2429024297.
Serrano, L., E. Montejo de Garcini, M.A. Hernandez, and J. Avila. 1985. Localization of the tubulin binding site for tau protein. Eur. J. Biochem. 153:595600.[Abstract]
Spero, D.A., and F.J. Roisen. 1985. Neuro-2a neuroblastoma cells form neurites in the presence of taxol and cytochalasin. Brain. Res. 355:155159.[Medline]
Trinczek, B., A. Ebneth, E.M. Mandelkow, and E. Mandelkow. 1999. Tau regulates the attachment/detachment but not the speed of motors in microtubule-dependent transport of single vesicles and organelles. J. Cell Sci. 112:23552367.
Voter, W.A., and H.P. Erickson. 1982. Electron microscopy of MAP 2 (microtubule-associated protein 2). J. Ultrastruct. Res. 80:374382.[Medline]
Wang, D., A. Villasante, S.A. Lewis, and N.J. Cowan. 1986. The mammalian beta-tubulin repertoire: hematopoietic expression of a novel, heterologous beta-tubulin isotype. J. Cell Biol. 103:19031910.[Abstract]
Williamson, J.R. 2000. Induced fit in RNA-protein recognition. Nat. Struct. Biol. 7:834837.[CrossRef][Medline]
Related Article