Report |
Address correspondence to Christopher C.J. Miller, Department of Neuroscience, P.O. Box PO37, The Institute of Psychiatry, Denmark Hill, London SE5 8AF, UK. Tel.: 44-207-848-0393. Fax: 44-207-708-0017. E-mail: chris.miller{at}iop.kcl.ac.uk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key Words: neurofilament proteins; axonal transport; amyotrophic lateral sclerosis; Alzheimer's disease; Cdk5/p35
* Abbreviations used in this paper: NFH, neurofilament heavy chain; NFL, neurofilament light chain; NFM, neurofilament middle chain; scg, superior cervical ganglion.
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
The molecular mechanisms that regulate neurofilament transport are not properly understood, but a body of evidence associates increased phosphorylation of neurofilament side arms with slower transport rates (Ackerley et al., 2000; Sanchez et al., 2000; Yabe et al., 2001). In most mature neurons, neurofilaments comprise three subunit proteins, neurofilament light, middle, and heavy chains (NFL, NFM, and NFH),* and the carboxy-terminal domains of NFM and NFH form side arms that extend from the filament. These NFM/NFH side arms are phosphorylated in axons, with that of NFH being particularly heavily phosphorylated (Pant et al., 2000). Much of this phosphate is located in a domain that contains repeats of the motif lys-ser-pro (KSP). Kinases that phosphorylate the serines in these KSPs include Cdk5/p35, GSK-3/ß, and members of the MAPK/SAPK family (Pant et al., 2000). Here, we have investigated the role of side arm phosphorylation in neurofilament transport by analyzing movement of EGFP-tagged phosphorylation mutants of NFH in neurons. Our results provide direct experimental evidence to support a role for NFH side arm phosphorylation as a regulator of neurofilament transport.
![]() |
Results and discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Transfection of GFPNFHwt, GFPNFHala, or GFPNFHasp did not alter this RT97/8D8 labeling pattern over the time periods in which GFPNFH transport was investigated (140260 min and 48 h after transfection, see below); cell bodies remained negative and axons positive for RT97/8D8. Furthermore, regions of axons that contained GFPNFHwt showed increased RT97/8D8 staining, which shows that phosphorylation of the GFPNFH species on these epitopes is mimicking that of endogenous NFH (unpublished data; Fig. 1, OR).
At least some serines within KSP repeats 4448, 50, and 51 of NFH are targeted by Cdk5/p35
Most phosphorylation sites in NFH side arm are within a domain that contains repeats of the motif KSP (Fig. 2 A), but only 12 of these have been formally identified as in vivo phosphorylation sites in the rat (Elhanany et al., 1994). KSPs with the motif KSPXK are believed to be targeted by Cdk5/p35, and several lines of evidence indicate that these are functionally significant (Shetty et al., 1993; Guidato et al., 1996; Sun et al., 1996; Bajaj and Miller, 1997). We therefore chose to analyze the effect of Cdk5/p35 phosphorylation on NFH transport. The known in vivo phosphoserines within the consensus Cdk5/p35 motif are those in repeats 4448, 50, and 51 (Elhanany et al., 1994), and these were mutated to alanine to preclude phosphorylation or aspartate to mimic permanent phosphorylation (Fig. 2 A). There are many examples where the substitution of such a charged residue accurately mimics the functional effect of phosphorylation (Eidenmuller et al., 2000).
|
Mutant NFH in which the Cdk5/p35 sites were mutated to alanine (NFHala) comigrated with NFHwt when transfected alone into COS cells, but mutation of the sites to aspartate (NFHasp) induced a minor upward shift in a proportion of the transfected protein. This may be due to the aspartate residues mimicking phosphorylation that primes phosphorylation on other residues to induce a shift. NFHala and NFHasp did not react or reacted only weakly with antibodies 8D8 and RT97. However, after cotransfection of the mutants with Cdk5/p35, increased labeling with antibodies 8D8 and RT97 was observed; although this was significantly weaker than NFHwt in Cdk5/p35-cotransfected cells (Fig. 2 B). Cotransfection of NFHala or NFHasp with Cdk5/p35 also induced upward mobility shifts in a proportion of the transfected protein. However, the shift for NFHala was minor, whereas that for NFHasp was more pronounced so that it migrated close to NFH from brain. These results are consistent with the notion that some, if not all, of the sites mutated in NFHala are phosphorylated by Cdk5/p35 but that Cdk5/p35 targets other, as yet unidentified, sites.
The failure of NFHasp to react strongly with 8D8 and RT97 is as expected. Substituting charged residues in tau mimics the functional effects of phosphorylation but does not generate the epitopes for phosphorylation-dependent antibodies (Eidenmuller et al., 2000).
Mutation of NFH phosphorylation sites and inhibition of Cdk5/p35 alters NFH transport rates in a bulk transport assay
We calculated the transport rate of NFHwt, NFHala, and NFHasp in axons using a previously described assay (Ackerley et al., 2000). GFPNFHwt was transported at a rate of 80 µm/h, and this was not significantly different from that of GFPNFM (Fig. 3 A). These rates were linear over the course of the experiment, which suggests that very early movement of nonphosphorylated neurofilaments close to cell bodies (Sanchez et al., 2000) is not being studied. Indeed, dual labeling of GFPNFHwt-transfected cells with RT97 revealed that phosphorylation on NFH to generate this epitope commences
20 µm from the cell body (PFig. 1, O and P). This is less than the distance travelled by GFPNFHwt/ala/asp at the first time point analyzed (Ackerley et al., 2000; Fig. 3, legend).
|
We also calculated the average distance moved by GFPNFHwt and GFPNFHasp 240 min after transfection in the presence of the Cdk5/p35 inhibitor roscovitine. Cdk5/p35 is active in cortical neurons (Nikolic et al., 1996). 20 µM roscovitine or vehicle was applied to the cells 130 min after transfection and maintained throughout the course of the experiment. Roscovitine did not induce any noticeable changes in the cells, including alterations to nuclear morphology. However, roscovitine significantly increased the distance travelled by GFPNFHwt at this time point but had little effect on GFPNFHasp (Fig. 3 C). Thus, mutation of Cdk5/p35 sites in NFH to preclude or mimic permanent phosphorylation modulates NFH transport, and inhibition of Cdk5/p35 activity with roscovitine significantly accelerates NFH transport. For all of the above assays, three independent experiments were performed using different preparations of plasmid DNAs.
Mutation of NFH phosphorylation sites alters NFH transport properties in transfected living cortical neurons
Although neurofilaments move at an overall slow rate of transport, this is now known to be due to rapid movement that is interrupted by prolonged pauses. This has been revealed by analyses of GFPNFM and GFPNFH movement in transfected living superior cervical ganglion (scg) neurons (Roy et al., 2000; Wang et al., 2000). Scg neurons possess gaps in their axonal neurofilament network through which moving GFPNFM/H can be visualized several days after transfection. We found that similar gaps in GFPNFH fluorescence also appeared in the transfected cortical neurons 48 h after transfection (Fig. 4, A and B). These weaker areas of fluorescence enabled us to monitor neurofilament movement in a manner similar to that described for scg neurons.
|
NFH side arm phosphorylation is dynamic, but the phosphorylation states of GFPNFHala and GFPNFHasp on the seven sites investigated are defined irrespective of their subcellular location. We therefore compared the movement characteristics of these two mutants.
The lengths of GFPNFHala and GFPNFHasp moving fluorescent structures were not noticeably different from those of GFPNFHwt, and their velocities, excluding pauses, were similar to GFPNFHwt. The two mutants also exhibited bidirectional movement, but analyses of this revealed no significant differences. Because images of moving GFPNFH and GFPNFM reveal minipauses (Roy et al., 2000; Wang et al., 2000), we next considered whether GFPNFHala and GFPNFHasp displayed differences in pausing. Moving GFPNFHala and GFPNFHasp spent an average of 16 and 37% pausing, respectively, and statistical analyses revealed a significant difference. In a separate experiment, we also measured the total distances moved by GFPNFHala and GFPNFHasp per minute of microscope observation time. As the majority of neurofilaments are stationary at any one time, many movies do not show any movement. In this assay, GFPNFHala moved significantly more than GFPNFHasp. These results are summarized in Table I. Examples of GFPNFHala and GFPNFHasp movement and pausing are shown in Fig. 4 C.
|
Very recently, Rao et al. (2002) created mice in which the side arm domain of NFH had been deleted by gene replacement. These animals show no alteration in neurofilament transport, which suggests that the side arm is not involved in this process. However, other transgenic studies have supported a role for NFH in neurofilament transport; ablation of the NFH gene accelerates neurofilament transport, and increased NFH expression inhibits transport (Collard et al., 1995; Marszalek et al., 1996; Zhu et al., 1998). Also, NFM and NFH phosphorylation states are intimately related; NFM phosphorylation is increased (including the RT97 epitope) in both NFH knockout and NFH side armdeleted mice (Tu et al., 1995; Zhu et al., 1998; Sanchez et al., 2000; Rao et al., 2002). Thus, there are compensatory changes in NFM after modulation of NFH expression in mice, and these changes may well effect neurofilament transport.
The precise mechanisms by which phosphorylation inhibits neurofilament transport are not clear. One possibility is that phosphorylation leads to a detachment of neurofilaments from their motors. Alternatively, phosphorylation may influence neurofilament interactions with other axoplasmic components that somehow alter movement. The identification of neurofilament motors will enable a better understanding of this process.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Serines within KSP repeats 4448, 50, and 51 of NFH side arm were mutated to either alanine or aspartate using a Chameleon mutagenesis kit (Stratagene) in three consecutive rounds. Serines in repeats 44 and 45 were mutated using oligonucleotides ATCTCTTCCTTCACAGGGGCCTTGGCCTTCTCAGGGGCCTTGGCCTCAGCTAGGGATTTTGCAC (ala) or ATCTCTTCCTTCACAGGGTCCTTGGCCTTCTCAGGGTCCTTGGCCTCAGCTAGGGATTTTGCAC (asp). Serines in repeats 50 and 51 were mutated using oligonucleotides CTGGTCTCTTCCTTCTCGGGGGCCTTGGCCTCCTCCTTGGCAGGAGCTTTGACCTGCTCAGGGGATCTGATGT (ala) and CTGGTCTCTTCCTTCTCGGGGTCCTTGGCCTCCTCCTTGGCAGGATCTTTGACCTGCTCAGGGGATCTGATGT (asp). Serines in repeats 46, 47, and 48 were mutated using oligonucleotides ATCCAGAGTCTTGGCCTTCTCAGGAGCCTTGGCCTCCTCCTTCATGGGGGCCTTGGCCT-TCTCGGGGGCTTTCACCTCAGCTGGAGGCTTGAT (ala) and ATCCAGAGTCTTGGCCTTCTCAGGGTCCTTGGCCTCCTCCTTCATGGGGTCC-TTGGCCTTCTCGGGGTCTTTCACCTCAGCTGGAGGCTTGAT (asp).
Cell culture and transfection
SW13- cells, COS cells, and cortical neurons were grown and transfected as previously described (Guidato et al., 1996; Ackerley et al., 2000). Roscovitine was obtained from Calbiochem and prepared as a 20 mM solution in DMSO.
Immunoblot and immunofluorescence analyses
COS cells were processed for SDS-PAGE and immunoblotting, and SW13- cells and neurons were fixed and immunostained as previously described (Ackerley et al., 2000). The primary antibodies used were NA1211 (Affiniti), NR4 (Sigma-Aldrich), 8D8, and RT97.
Axonal transport of GFPNFH/NFM
Bulk axonal transport of GFPNFM and GFPNFH was analyzed in cortical neurons using a previously published method (Ackerley et al., 2000; Brownlees et al., 2002; Utton et al., 2002). Statistical analyses were performed using One-way ANOVA tests, and the rates of transport were calculated using linear regression analyses.
To study GFPNFH movement in living neurons, cortical neurons were transfected as for the bulk transport assays and observed 48 h later using a Carl Zeiss MicroImaging, Inc. Axiovert S100 microscope and a 100x Fluar lens. Cells grown on coverslips were viewed in normal medium using an Open Perfusion Micro-Incubator equipped with bipolar temperature controller (models PDM12 and TC-202; Medical Systems Corp.) that was attached to the microscope stage. Cells were gassed with 5% CO2. Images were captured from 1-s exposures taken every 5 s using a CCD camera (model RTE/CCD-1300-Y/HS; Princeton Instruments). The shutter was controlled using a motorized shutter controller (Lambda 10-2; Sutter Instruments). Filter sets for EGFP were from Chroma Technology Corp. Images were analyzed using Metamorph Software, and Quicktime movies were prepared using Adobe Premiere.
Only cells that exhibited a healthy appearance were monitored, and we did not acquire data from cells expressing high levels of GFPNFH (as judged by brightness of fluorescence) because this can induce pathological changes (Roy et al., 2000). Statistical analyses of GFPNFH movement in living transfected neurons were performed using chi-square, One-way ANOVA, and Mann-Whitney tests as indicated in the text.
Online supplemental material
The supplemental material (Video 1) is available at http://www.jcb.org/cgi/content/full/jcb.200303138/DC1. Video 1 is a Quicktime movie of GFPNFHwt anterograde movement in a transfected cortical neuron. 1-s exposures were taken every 5 s.
![]() |
Acknowledgments |
---|
This work was supported by grants from the Medical Research Council, Wellcome Trust, UK Motor Neurone Disease Association, and Kings Healthcare Trust.
Submitted: 20 March 2003
Revised: 27 March 2003
Accepted: 27 March 2003
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ackerley, S., A.J. Grierson, J. Brownlees, P. Thornhill, B.H. Anderton, P.N. Leigh, C.E. Shaw, and C.C.J. Miller. 2000. Glutamate slows axonal transport of neurofilaments in transfected neurons. J. Cell Biol. 150:165175.
Bajaj, N.P., and C.C.J. Miller. 1997. Phosphorylation of neurofilament heavy-chain side-arm fragments by cyclin-dependent kinase-5 and glycogen synthase kinase-3a in transfected cells. J. Neurochem. 69:737743.[Medline]
Brownlees, J., A. Yates, N.P. Bajaj, D. Davis, B.H. Anderton, P.N. Leigh, C.E. Shaw, and C.C.J. Miller. 2000. Phosphorylation of neurofilament heavy chain side-arms by stress activated protein kinase-1b/Jun N-terminal kinase-3. J. Cell Sci. 113:401407.
Brownlees, J., S. Ackerley, A.J. Grierson, N.J. Jacobsen, K. Shea, B.H. Anderton, P.N. Leigh, C.E. Shaw, and C.C. Miller. 2002. Charcot-Marie-Tooth disease neurofilament mutations disrupt neurofilament assembly and axonal transport. Hum. Mol. Genet. 11:28372844.
Collard, J.-F., F. Cote, and J.-P. Julien. 1995. Defective axonal transport in a transgenic mouse model of amyotrophic lateral sclerosis. Nature. 375:6164.[CrossRef][Medline]
de Waegh, S.M., V.M.-Y. Lee, and S.T. Brady. 1992. Local modulation of neurofilament phosphorylation, axonal caliber and slow axonal transport by myelinating Schwann cells. Cell. 68:451463.[Medline]
Eidenmuller, J., T. Fath, A. Hellwig, J. Reed, E. Sontag, and R. Brandt. 2000. Structural and functional implications of tau hyperphosphorylation: information from phosphorylation-mimicking mutated tau proteins. Biochemistry. 39:1316613175.[CrossRef][Medline]
Elhanany, E., H. Jaffe, W.T. Link, D.M. Sheeley, H. Gainer, and H.C. Pant. 1994. Identification of endogenously phosphorylated KSP sites in the high-molecular-weight rat neurofilament protein. J. Neurochem. 63:23242335.[Medline]
Guidato, S., L.-H. Tsai, J. Woodgett, and C.C.J. Miller. 1996. Differential cellular phosphorylation of neurofilament heavy side-arms by glycogen synthase kinase-3 and cyclin-dependent kinase-5. J. Neurochem. 66:16981706.[Medline]
Marszalek, J.R., T.L. Williamson, M.K. Lee, Z.S. Xu, P.N. Hoffman, M.W. Becher, T.O. Crawford, and D.W. Cleveland. 1996. Neurofilament subunit NF-H modulates axonal diameter by selectively slowing neurofilament transport. J. Cell Biol. 135:711724.[Abstract]
Nikolic, M., H. Dudek, Y.T. Kwon, Y.F.M. Ramos, and L.H. Tsai. 1996. The cdk5/p35 kinase is essential for neurite outgrowth during neuronal differentiation. Genes Dev. 10:816825.[Abstract]
Pant, H.C., Veeranna, and P. Grant. 2000. Regulation of axonal neurofilament phosphorylation. Curr. Top. Cell. Regul. 36:133150.[Medline]
Prahlad, V., B.T. Helfand, G.M. Langford, R.D. Vale, and R.D. Goldman. 2000. Fast transport of neurofilament proteins along microtubules in squid axoplasm. J. Cell Sci. 113:39393946.
Rao, M.V., M.L. Garcia, Y. Miyazaki, T. Gotow, A. Yuan, S. Mattina, C.M. Ward, N.A. Calcutt, Y. Uchiyama, R.A. Nixon, and D.W. Cleveland. 2002. Gene replacement in mice reveals that the heavily phosphorylated tail of neurofilament heavy subunit does not affect axonal caliber or the transit of cargoes in slow axonal transport. J. Cell Biol. 158:681693.
Roy, S., P. Coffee, G. Smith, R.K.H. Liem, S.T. Brady, and M.M. Black. 2000. Neurofilaments are transported rapidly but intermittently in axons: implications for slow axonal transport. J. Neurosci. 20:68496861.
Sanchez, I., L. Hassinger, R.K. Sihag, D.W. Cleveland, P. Mohan, and R.A. Nixon. 2000. Local control of neurofilament accumulation during radial growth of myelinating axons in vivo. Selective role of site-specific phosphorylation. J. Cell Biol. 151:10131024.
Shah, J.V., L.A. Flanagan, P.A. Janmey, and J.-F. Leterrier. 2000. Bidirectional translocation of neurofilaments along microtubules mediated in part by dynein/dynactin. Mol. Biol. Cell. 11:34953508.
Shetty, K.T., W.T. Link, and H.C. Pant. 1993. Cdc2-like kinase from rat spinal cord specifically phosphorylates KSPXK motifs in neurofilament proteins: isolation and characterization. Proc. Natl. Acad. Sci. USA. 90:68446848.[Abstract]
Sun, D., C.L. Leung, and R.K.H. Liem. 1996. Phosphorylation of the high molecular weight neurofilament protein (NF-H) by cdk-5 and p35. J. Biol. Chem. 271:1424514251.
Tu, P.-H., G. Elder, R.A. Lazzarini, D. Nelson, J.Q. Trojanowski, and V.M.-Y. Lee. 1995. Overexpression of the human NFM subunit in transgenic mice modifies the level of endogenous NFL and the phosphorylation state of NFH subunits. J. Cell Biol. 129:16291640.[Abstract]
Utton, M.A., J. Connell, A.A. Asuni, M. van Slegtenhorst, M. Hutton, R. de Silva, A.J. Lees, C.C. Miller, and B.H. Anderton. 2002. The slow axonal transport of the microtubule-associated protein tau and the transport rates of different isoforms and mutants in cultured neurons. J. Neurosci. 22:63946400.
Wang, L., and A. Brown. 2001. Rapid intermittent movement of axonal neurofilaments observed by fluorescence photobleaching. Mol. Biol. Cell. 12:32573267.
Wang, L., C.L. Ho, D. Sun, R.K. Liem, and A. Brown. 2000. Rapid movement of axonal neurofilaments interrupted by prolonged pauses. Nat. Cell Biol. 2:137141.[CrossRef][Medline]
Yabe, J.S., T. Chylinski, F.-S. Wang, A. Pimenta, S.D. Kattar, M.-D. Linsley, W.K.-H. Chan, and T.B. Shea. 2001. Neurofilaments consist of distinct populations that can be distinguished by C-terminal phosporylation, bundling and axonal transport rates in axonal neurites. J. Neurosci. 21:21952205.
Yabe, J.T., A. Pimenta, and T.B. Shea. 1999. Kinesin-mediated transport of neurofilament protein oligomers in growing axons. J. Cell Sci. 112:37993814.
Zhu, Q.Z., M. Lindenbaum, F. Levavasseur, H. Jacomy, and J.P. Julien. 1998. Disruption of the NF-H gene increases axonal microtubule content and velocity of neurofilament transport: relief of axonopathy resulting from the toxin b,b'-iminodipropionitrile. J. Cell Biol. 143:183193.