PEN-2 and APH-1 Coordinately Regulate Proteolytic Processing of Presenilin 1*

Wen-jie LuoDagger §, Hong WangDagger §, Hongqiao Li, Benny S. KimDagger , Sanjiv Shah, Hahn-Jun Lee||, Gopal Thinakaran**, Tae-Wan Kim||, Gang Yu, and Huaxi XuDagger DaggerDagger

From the Dagger  Fisher Center for Research on Alzheimer's Disease and Laboratory of Molecular and Cellular Neuroscience, The Rockefeller University, New York, New York 10021, the  Center for Basic Neuroscience, University of Texas Southwestern Medical Center, Dallas, Texas 75390, the || Department of Pathology, College of Physicians and Surgeons, Columbia University, New York, New York 10032, and the ** Department of Neurobiology, Pharmacology, and Physiology, The University of Chicago, Chicago, Illinois 60637

Received for publication, November 20, 2002, and in revised form, January 2, 2003

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Presenilin (PS, PS1/PS2) complexes are known to be responsible for the intramembranous gamma -secretase cleavage of the beta -amyloid precursor protein and signaling receptor Notch. PS holoprotein undergoes endoproteolysis by an unknown enzymatic activity to generate NH2- and COOH-terminal fragments, a process that is required for the formation of the active and stable PS/-gamma -secretase complex. Biochemical and genetic studies have recently identified nicastrin, APH-1, and PEN-2 as essential cofactors that physically interact with PS1 and are necessary for the gamma -secretase activity. However, their precise function in regulating the PS complex and gamma -secretase activity remains unknown. Here, we demonstrate that endogenous PEN-2 preferentially interacts with PS1 holoprotein. Down-regulation of PEN-2 expression by small interfering RNA (siRNA) abolishes the endoproteolysis of PS1, whereas overexpression of PEN-2 promotes the production of PS1 fragments, indicating a critical role for PEN-2 in PS1 endoproteolysis. Interestingly, accumulation of full-length PS1 resulting from down-regulation of PEN-2 is alleviated by additional siRNA down-regulation of APH-1. Furthermore, overexpression of APH-1 facilitates PEN-2-mediated PS1 proteolysis, resulting in a significant increase in PS1 fragments. Our data reveal a direct role of PEN-2 in proteolytic cleavage of PS1 and a regulatory function of APH-1, in coordination with PEN-2, in the biogenesis of the PS1 complex.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Alzheimer's disease is a progressive neurodegenerative disorder that is pathologically characterized by the cerebral deposition of 39-42 amino acid peptides, termed beta -amyloid (Abeta )1 (1). Abeta peptides are proteolytically derived from amyloid precursor protein (APP), a type 1 transmembrane glycoprotein that predominantly resides in the trans-Golgi network (TGN), by two distinct enzymatic activities known as beta -secretase (or BACE) and gamma -secretase (2). Mutations of presenilins (presenilin 1 (PS1) and presenilin 2 (PS2)) are responsible for the majority of early-onset familial Alzheimer's disease. Several lines of evidence suggest that PSs play a crucial role in intramembranous gamma -secretase cleavage of select type I membrane proteins including APP and the signaling receptor, Notch-1 (3-9).

PS1 encodes a hydrophobic protein with 467 amino acids spanning the membrane six to eight times (10, 11). Shortly after being synthesized, PS1 undergoes endoproteolytic cleavage by unknown proteases (named presenilinases) between transmembrane domains 6 and 7 to generate a 27-kDa NH2-terminal fragment (NTF) and a 17-kDa COOH-terminal fragment (CTF) (12). Cell biological studies indicated that full-length PS1 resides almost exclusively in the endoplasmic reticulum (ER), while the NTF and CTF localize predominantly in the Golgi and, to a lesser extent, in the plasma membrane and endocytic compartments (13-15). Endoproteolytic cleavage of PS1 is suggested to take place in the ER and the cleaved fragments are subsequently transported to the Golgi compartments (16). The subcellular location of the gamma -secretase activity has been proposed to include multiple organelles such as the ER (17-20), late-Golgi/TGN (19, 21), endosomes (17, 20), and plasma membrane (15).

While full-length PS1 has a rapid turnover rate, the NTF and CTF stably accumulate at 1:1 stoichiometry as heterodimers that associate with nicastrin and other proteins to form high molecular weight complexes (22). The absolute levels of PS1 fragments are maintained in a highly regulated and saturable manner (22, 23). Overexpression of human PS1 in mouse cells results in limited conversion of human PS1 to fragments and rapid degradation of excess full-length PS1 and leads to the diminution of mouse PS fragments (12, 23, 24). Therefore, only a subset of molecules is selected for the "cleavage" pathway and the remainder is targeted for "rapid degradation," indicating that PS1 endoproteolytic cleavage is regulated by association with limiting cellular components (23).

Biochemical evidence demonstrates that PS1-dependent gamma -secretase activity resides in a high molecular weight multiprotein complex containing presenilin (25-28). The first identified functional component of the PS1 complex, termed nicastrin, was immunopurified using PS1 antibodies (26, 28, 29). Two additional components of the complex, termed APH-1 and PEN-2, were recently identified through genetic screening in Caenorhabditis elegans (30, 31). Mutations in either aph-1 or pen-2 impair the Notch signaling pathway in Caenorhabditis elegans and abolish gamma -secretase activities in Drosophila. PEN-2 has one homologue in mammals (30, 32), while two mammalian APH-1 homologues have been identified, termed APH-1a and APH-1b. APH-1a has at least two splice variants: APH-1aL and APH-1aS (30, 33, 34). Recent studies demonstrate that PEN-2 and APH-1 copurify with NTF and CTF of PS1 in mammalian cells. Furthermore, down-regulation of either PEN-2 or APH-1 (by RNAi) results in reduction of PS1 fragments and impaired gamma -secretase activity, indicating that PEN-2 and APH-1 are crucial for gamma -secretase activity (30-33). However, the cellular mechanism by which PEN-2 and APH-1 regulate the PS1 complex and gamma -secretase activity remains unknown. In the present study, we characterize endogenous PEN-2 in mammalian cells and demonstrate for the first time the function of PEN-2, with coordination of APH-1, in mediating the proteolytic processing/biogenesis of PS1 fragments.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Cell Cultures-- Mouse neuroblastoma (N2a) cells were maintained in 1:1 Dulbecco's modified Eagle's medium and Opti-MEM supplemented with 5% fetal bovine serum (Invitrogen). Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum was used for CHO and HeLa cell cultures.

cDNA Constructs and Transfections-- Full-length human pen-2 was amplified by PCR from I.M.A.G.E. clone 3901082. Expression construct was generated by inserting full-length cDNA in frame with HA in pRK5 (Genetech) at the amino terminus of PEN-2. Since inactivation of APH-1b only subtly reduces PS fragments in HeLa cells (33), we mainly focused on APH-1a in current study. mAPH-1aL-Myc/His was described previously (33). Nicastrin and presenilin expression constructs were described previously (26). Transient transfections were performed using FuGENE-6 transfection reagent (Roche Diagnostics). Coexpression of multiple cDNA constructs was achieved by cotransfection of equal amount of DNA, resulting in comparable levels of protein expression.

RNA Interference, RNA Extraction, and RT-PCR-- Small RNA duplexes were generated by Dharmacon Research, Inc. against mouse PEN-2 (5'-AAGGCTATGTTTGGCGCTCAG), mouse APH-1a (5'-AAGGCAGATGAGGGCTTAGCA), and human PEN-2 (5'-AAAGGCTATGTCTGGCGCTCA). Control siRNA (5'AAATGTGTGTACGTCTCCTCC) was designed by random nucleotides selection without targeting any sequence in the genome (by Blast search). siRNAs were transfected into N2a cells or HeLa cells using oligofectamine reagent (Invitrogen) on the first and forth days. On the 6th day, RNA was extracted by Qiagen Rneasy miniprep kit combined with QIAshredder (Qiagen). Down-regulation of PEN-2 and APH-1a expression was determined by RT-PCR using SuperScript one-step RT-PCR with Platium Taq (Invitrogen). Primers 5'-CAGCGCAACTATGAACTTGGAG and 5'-CATCCTGGGAGAAAGAACAGATC were used to amplify PEN-2 mRNA. Primers 5'-AGTATGGCCTCCTGATTTTTGGTG and 5'-CCTCCGGCTGTGATGAACG were used to amplify APH-1a mRNA.

Antibodies, Coimmunoprecipitations, and Western Blots-- Rabbit polyclonal antibody PNT2 was generated (in Dr. Thinakaran's laboratory at the University of Chicago) against the NH2-terminal 26 amino acids of PEN-2 and polyclonal antibody CR8 was generated (in Dr. Kim's laboratory at Columbia University) against the COOH-terminal 25 amino acids of PEN-2. Polyclonal antibodies Ab14 (35) and alpha PS1Loop (12) specifically recognize epitopes at the NH2 terminus and within the hydrophilic loop domain of PS1. HA-tagged PEN-2 was detected using a monoclonal anti-HA antibody (Sigma). Monoclonal gamma -adaptin antibody (Transduction Laboratories) was used in Western blot at 1:1000. For protein extract preparation and immunoprecipitation experiments, cells were solubilized with 1% CHAPSO in 150 mM NaCl, 50 mM HEPES (pH 7.4), and 2 mM EDTA supplemented with protease inhibitor mixture (Roche Diagnostics).

Subcellular Fractionation-- For subcellular fractionation, cells were homogenized using a ball-bearing cell cracker, and cell lysates were fractionated using sucrose density gradient as described (19, 36).

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

To investigate biological functions of endogenous mammalian PEN-2, polyclonal antibodies against the NH2 terminus (PNT2) or COOH terminus (CR8) of mammalian PEN-2 were generated. Western blot analysis of N2a cell lysates revealed that the PEN-2 antibody CR8 detected a polypeptide of ~12 kDa, which is the predicted molecular weight of PEN-2. The antibody also recognized exogenous HA-PEN-2 that has a higher molecular weight due to the presence of the HA tag. The specificity of the antibody was further tested by immunoprecipitation. Significant amounts of endogenous PEN-2 were precipitated by CR8 but not by the preimmune serum (Fig. 1A). Consistent with the previous report (32), the level of endogenous PEN-2 is largely decreased in PS1/PS2 double knock-out embryonic stem cells (Fig. 1B), further confirming that the 12-kDa band detected by CR8 antibody is indeed endogenous PEN-2.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 1.   Endogenous PEN-2 is a membrane protein located in Golgi/ER compartments. A, lysates from N2a cells with or without overexpression of HA-PEN-2 were subjected to direct Western blot or immunoprecipitation followed by Western blot analysis. Left, Western blot result using monoclonal HA antibody conjugated with horseradish peroxidase. Right, Western blot analysis using polyclonal antibody against COOH terminus of mammalian PEN-2 (CR8). HA-PEN-2 migrates slower compared with endogenous PEN-2 due to the presence of HA tag. B, Western blot analysis of mouse embryonic stem cell lysates (PS1+/+/PS2+/+ and PS1-/-/PS2-/-) using PEN-2 antibody (CR8). C, PEN-2 is enriched in membrane fraction. N2a cells were homogenized, and membrane fractions were sedimented at 10,000 and 100,000 × g followed by Western blot analysis using anti-PEN-2 antibody (CR8). D, subcellular localization of PEN-2 by sucrose density gradient fractionation. N2a cells were fractionated by velocity sedimentation, and the distribution of PEN-2 and different organelle markers were analyzed by Western blotting. The enrichment of protein markers for various organelles across the gradients is indicated. PEN-2 was detected by CR8 antibody; ER marker, GRP78; Golgi marker, gamma -adaptin.

As predicted from the primary amino acid sequence, PEN-2 is an integral membrane protein as detected only in the membrane-enriched fractions resulting from 10,000 × g and 100,000 × g sedimentation (Fig. 1C). As expected, subcellular fractionation studies using a well established sucrose gradient revealed that endogenous PEN-2 is localized in the ER and Golgi apparatus (Fig. 1D). The subcellular localization of endogenous APH-1 has been recently demonstrated to be mainly in the ER and cis-Golgi (34).

PEN-2 has been shown to be a functional component of gamma -secretase complex, and coimmunoprecipitation of endogenous PEN-2 and PS1 fragments using PS1 antibodies has been reported (32). However, it is not clear whether the interaction is also mediated through full-length PS1, as both PS1 full-length and fragments coexist in the precipitates. To further decipher the relationship between PEN-2 and PS1, we carried out coimmunoprecipitation experiments in N2a cell extracts using PEN-2 antibody CR8 to precipitate endogenous PEN-2. Surprisingly, we only detected insignificant levels, if any (see darker exposure in Fig. 2A), of PS1 fragments from the precipitated products. To confirm this observation and to rule out the possibility that binding of the COOH-terminal PEN-2 antibody could have interfered with the association of PS1 fragments with PEN-2, another PEN-2 antibody raised against the NH2 terminus, PNT2, was also used in coimmuniprecipitation studies of N2a cells (data not shown) and mouse brain homogenates. As shown in Fig. 2B, both PEN-2 antibodies failed to coimmunoprecipitate appreciable levels of PS1 CTF from mouse brain homogenates. In contrast, significant amounts of PS1 CTF were clearly immunoprecipitated by APH-1aL antibody H2D2 (33) from N2a cells (Fig. 2A) and mouse brain (Fig. 2B).


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   PEN-2 preferentially interacts with full-length PS1. N2a cells (A), mouse brain (B), or N2a cells stably expressing wild type human PS1 (C) were extracted and immunoprecipited in 1% CHAPSO and analyzed by Western blots. Antibodies used in coimmunoprecipitation are PEN-2 antibodies (CR8 and PNT2) or APH-1aL antibody (H2D2). The precipitates were immunoblotted with alpha PS1Loop antibody, PEN-2 antibody (CR8), or APH-1aL antibody (H2D2). 1% of total protein lysates was loaded as input.

The absence of readily detectable association between PS1 fragments and PEN-2 in coimmunoprecipitation studies led us to hypothesize that the interaction between PEN-2 and PS1 complex may be mediated via full-length PS1. Since the levels of endogenous full-length PS1 are extremely low in N2a cells, stably transfected cells overexpressing human PS1 were used for coimmunoprecipitation analyses. Similar to what was observed in naïve N2a cells, anti-PEN-2 antibody failed to precipitate the fragments of PS1. However, a substantial amount of full-length PS1 was coimmunoprecipitated by PEN-2 antibody but not the preimmune serum (Fig. 2C). These findings demonstrate that PEN-2 binds preferentially to full-length PS1, supporting our hypothesis that the interaction of PEN-2 with PS1 complex is likely through its association with full-length PS1.

Previous studies have proposed that endoproteolysis of full-length PS1, required for the formation of the active and stable PS/gamma -secretase complex, is facilitated by cellular factors available at limiting levels (23, 24). Our observation of robust interaction between PEN-2 and full-length PS1 prompted us to examine whether PEN-2 is a potential factor mediating PS1 proteolytic processing. To this end, we inhibited endogenous PEN-2 and APH-1a expression in N2a cells by siRNA (see "Experimental Procedures"). The diminution of endogenous PEN-2 and APH-1a mRNA by siRNA was confirmed by RT-PCR (Fig. 3, A and B) and Northern blot analyses (data not shown). Consistent with earlier studies using Drosophila S2, HEK293, and HeLa cells (30-33), down-regulation of APH-1a expression caused a reduction in the levels of PS1 fragments (CTF) in N2a cells (Fig. 3A). On the other hand, down-regulation of PEN-2 expression led to a significant accumulation of full-length PS1 and concomitant decrease in the levels of processed PS1 derivatives. A similar effect of PEN-2 siRNA was observed in HeLa cells (Fig. 3A).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3.   Down-regulation of PEN-2 and APH-1 affects PS1 endoproteolysis. N2a or HeLa cells were transfected with different siRNA as indicated for 5 days. A, PS1 levels in lysates of N2a and HeLa cells were analyzed by Western blots using alpha PS1Loop antibody. Down-regulation of PEN-2 or APH-1a mRNA expression was assessed by RT-PCR. MmPEN-2 and MmAPH-1a indicate mouse PEN-2 and APH-1a siRNA, respectively. HsPEN-2 indicates human PEN-2 siRNA. B, down-regulation of PEN-2 increases stability of full-length PS1. N2a cells transfected with control siRNA or PEN-2 siRNA were treated with cycloheximide (30 µg/ml) for 0, 2, 4, 6, or 8 h. PS1 protein levels were detected by Western blot. C, accumulation of full-length PS1 after down-regulation of PEN-2 is alleviated by additional down-regulation of APH-1a. N2a cells were transfected with control siRNA, PEN-2 siRNA, APH-1 siRNA, or both PEN-2 and APH-1a siRNA at equal amount. Down-regulation of PEN-2 and APH-1 by RNAi was confirmed by RT-PCR.

The reduction of PS1 fragments may be attributed to either instability of the existing PS1 complex or a failure in de novo generation of the fragments or a combination of both. In the case of PEN-2 siRNA-transfected cells, judging from the inverse relationship between the levels of PS1 holoprotein and processed fragments, the most likely explanation is that the reduced level of PS1 fragments resulted from a failure in their de novo generation by endoproteolysis of nascent PS1 holoprotein. Thus our findings from studies of RNA interference together with interaction between full-length PS1 and PEN-2 strongly suggest a role for PEN-2 in mediating the endoproteolysis of PS1.

It has been found that newly synthesized full-length PS1 peptides are rapidly endoproteolytically cleaved into fragments, and excess full-length PS1 in transfected cells that fail to be converted to fragments is rapidly degraded (23). To explore whether the accumulation of full-length PS1 in PEN-2 siRNA transfected cells is due to its stabilization, we followed the decay of full-length PS1 in the presence of the protein synthesis inhibitor, cycloheximide, because pulse-chase analysis is ineffective when applied to studying presenilin processing or half-life (see Ref. 22 for detailed discussion). In agreement with previous reports (23, 24), in control cells the levels of full-length PS1 are quite low and decline rapidly (within 2 h of cycloheximide treatment), while PS1 fragments (CTF) were more abundant and long-lived (Fig. 3B), supporting the notion that full-length PS1 readily enters the cleavage pathway. In cells where the endogenous PEN-2 was eliminated by siRNA, the levels of accumulated full-length PS1 remained fairly unchanged for up to 8 h, indicating that endoproteolysis and/or degradation of full-length PS1 are prevented in the absence of PEN-2. Given the fact that markedly lower levels of PS1 CTF are detected in PEN-2 siRNA transfected cells as compared with controls, and the remaining PS fragments were quite stable during the length of cycloheximide treatment (8 h) (Fig. 3B), we conclude that accumulation of stabilized PS1 holoprotein and the concomitant diminution in the levels of PS1 fragment is a direct consequence of deficiency in endoproteolytic processing of PS1, further supporting our model that PEN-2 plays an indispensable role in the proteolytic cleavage of PS1. Furthermore, these results also indicate that accumulated full-length PS1 resulting from endoproteolysis defect stays as a stable pool, which is resistant to the degradation machinery, providing further evidence for the notion that full-length PS1 is stabilized by limiting cellular factors before endoproteolytic cleavage (23, 24).

A recent study demonstrated that endogenous APH-1a associates with full-length PS1, suggesting a potential role of APH-1 in the maturation of PS1 complex (34). Since APH-1 RNA interference does not result in the accumulation of full-length PS1 (Fig. 3A), it is unlikely that APH-1 is directly involved in the cleavage step. Thus, we explored the possibility that APH-1 might serve a role in the stabilization of full-length PS1. As described above, rapid conversion of endogenous full-length PS1 to fragments makes it inaccessible to examine the stability of endogenous full-length PS1. Therefore, we eliminated APH-1a expression in N2a cells in which full-length PS1 accumulated due to PEN-2 siRNA. Interestingly, accumulation of full-length PS1 resulting from down-regulation of PEN-2 was alleviated by additional siRNA down-regulation of APH-1a (Fig. 3C). These results suggest that APH-1 is a cofactor essential for stabilizing nascent full-length PS1, and in the absence of APH-1, PS1 holoprotein is diverted to a rapid protein degradation pathway (24) rather than the endoprocessing pathway, which generates PS1 NTF and CTF. Nevertheless, these results do not formally rule out the possibility that APH-1 may also be involved in stabilizing PS1 fragments.

To confirm the results obtained from RNA interference experiments, we overexpressed PEN-2 and/or APH-1a in CHO cells with or without coexpression of human PS1. As expected, endogenous PS1 NTF level was increased after overexpression of PEN-2 or coexpression with APH-1a (Fig. 4, lanes 1, 2, and 4). Notably, overexpression of APH-1a alone did not increase the fragment level (Fig. 4, lane 3). This could suggest that APH-1a is not a limiting factor mediating generation of PS1 fragments and that endogenous APH-1a alone is sufficient to stabilize PS1. The role of PEN-2 in endoproteolysis of exogenously expressed human PS1 was also revealed. Overexpression of PS1 resulted in robust accumulation of full-length PS1 without noticeable increase in the level of PS1 NTF (Fig. 4, lane 5 versus lane 1), likely due to the paucity of limiting cellular factors necessary for PS1 endoproteolysis (23). However, when PEN-2 was overexpressed, a fraction of full-length PS1 was converted to fragments (Fig. 4, lane 6). In contrast, consistent with the endogenous PS1 results, overexpressing APH-1a had little effect on the levels of both full-length PS1 and its fragments (Fig. 4, lane 7). When PEN-2 and APH-1a were coexpressed, full-length PS1 was efficiently cleaved into fragments (Fig. 4, lane 8). The further increase in PS1 NTF by APH-1 might be explained by the potential function of APH-1 in stabilizing PS1 fragments.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4.   Overexpression of PEN-2 and APH-1 facilitates PS1 cleavage. CHO cells were transiently transfected with various expression constructs at equal amounts, as indicated, and PS1 levels were examined by Western blot using anti PS1 NH2-terminal antibody (Ab14). Note, in lanes 5-8 nicastrin was coexpressed.

Based upon data presented in this study and those of other investigators, we propose that PEN-2 preferentially associates with full-length PS1 and plays a crucial role in PS1 endoproteolytic cleavage. We further demonstrate that APH-1 is crucial for stabilizing PS1 and coordinates with the function of PEN-2 in endoproteolysis and the formation of PS1 fragments (which are widely believed to be the central elements of the gamma -secretase complex). In summary, our data reveal a novel function of PEN-2 and APH-1 in mediating proteolytic cleavage of full-length PS1 and provide a cellular mechanism underlying the regulation by PEN-2 and APH-1 of gamma -secretase activity, which governs Notch signaling pathways and the production of the amyloidogenic Abeta peptides.

    ACKNOWLEDGEMENTS

We are grateful to Dr. Sangram S. Sisodia (The University of Chicago) for helpful discussion and reagents and Drs. Dongming Cai, Ping Han, and William J. Netzer (The Rockefeller University) for critical reading of the manuscript.

    FOOTNOTES

* This work was supported by the National Institutes of Health Grant AG09464, by the Ellison Medical Foundation, and by the Alzheimer's Association.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Both authors contributed equally to this work.

Dagger Dagger To whom correspondence should be addressed: Fisher Center for Research on Alzheimer's Disease and Laboratory of Molecular and Cellular Neuroscience, The Rockefeller University, 1230 York Ave., New York, NY 10021. Tel.: 212-327-7567; Fax: 212-327-7888; E-mail: xuh@mail.rockefeller.edu.

Published, JBC Papers in Press, January 8, 2003, DOI 10.1074/jbc.C200648200

    ABBREVIATIONS

The abbreviations used are: Abeta , beta -amyloid; APP, amyloid precursor protein; TGN, trans-Golgi network; PS, presenilin; NTF, NH2-terminal fragment; CTF, COOH-terminal fragment; ER, endoplasmic reticulum; CHO, Chinese hamster ovary; RT, reverse transcriptase; siRNA, small interfering RNA; HA, hemagglutinin; CHAPSO, 3-[(3-cholamidopropyl)dimethylammonio]-2-hydroxy-1-propanesulfonic acid.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

1. Selkoe, D. J. (1996) J. Biol. Chem. 271, 18295-18298[Free Full Text]
2. Steiner, H., and Haass, C. (2000) Nat. Rev. Mol. Cell. Biol. 1, 217-224[CrossRef][Medline] [Order article via Infotrieve]
3. De Strooper, B., Saftig, P., Craessaerts, K., Vanderstichele, H., Guhde, G., Annaert, W., Von Figura, K., and Van Leuven, F. (1998) Nature 391, 387-390[CrossRef][Medline] [Order article via Infotrieve]
4. De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J., Goate, A., and Kopan, R. (1999) Nature 398, 518-522[CrossRef][Medline] [Order article via Infotrieve]
5. Herreman, A., Serneels, L., Annaert, W., Collen, D., Schoonjans, L., and De Strooper, B. (2000) Nat. Cell Biol. 2, 461-462[CrossRef][Medline] [Order article via Infotrieve]
6. Zhang, Z., Nadeau, P., Song, W., Donoviel, D., Yuan, M., Bernstein, A., and Yankner, B. A. (2000) Nat. Cell Biol. 2, 463-465[CrossRef][Medline] [Order article via Infotrieve]
7. Wolfe, M. S., Xia, W., Ostaszewski, B. L., Diehl, T. S., Kimberly, W. T., and Selkoe, D. J. (1999) Nature 398, 513-517[CrossRef][Medline] [Order article via Infotrieve]
8. Li, Y. M., Xu, M., Lai, M. T., Huang, Q., Castro, J. L., DiMuzio-Mower, J., Harrison, T., Lellis, C., Nadin, A., Neduvelil, J. G., Register, R. B., Sardana, M. K., Shearman, M. S., Smith, A. L., Shi, X. P., Yin, K. C., Shafer, J. A., and Gardell, S. J. (2000) Nature 405, 689-694[CrossRef][Medline] [Order article via Infotrieve]
9. Esler, W. P., Kimberly, W. T., Ostaszewski, B. L., Diehl, T. S., Moore, C. L., Tsai, J. Y., Rahmati, T., Xia, W., Selkoe, D. J., and Wolfe, M. S. (2000) Nat. Cell Biol. 2, 428-434[CrossRef][Medline] [Order article via Infotrieve]
10. Doan, A., Thinakaran, G., Borchelt, D. R., Slunt, H. H., Ratovitsky, T., Podlisny, M., Selkoe, D. J., Seeger, M., Gandy, S. E., Price, D. L., and Sisodia, S. S. (1996) Neuron 17, 1023-1030[Medline] [Order article via Infotrieve]
11. Lehmann, S., Chiesa, R., and Harris, D. A. (1997) J. Biol. Chem. 272, 12047-12051[Abstract/Free Full Text]
12. Thinakaran, G., Borchelt, D. R., Lee, M. K., Slunt, H. H., Spitzer, L., Kim, G., Ratovitsky, T., Davenport, F., Nordstedt, C., Seeger, M., Hardy, J., Levey, A. I., Gandy, S. E., Jenkins, N. A., Copeland, N. G., Price, D. L., and Sisodia, S. S. (1996) Neuron 17, 181-190[Medline] [Order article via Infotrieve]
13. Annaert, W. G., Levesque, L., Craessaerts, K., Dierinck, I., Snellings, G., Westaway, D., George-Hyslop, P. S., Cordell, B., Fraser, P., and De Strooper, B. (1999) J. Cell Biol. 147, 277-294[Abstract/Free Full Text]
14. Cupers, P., Bentahir, M., Craessaerts, K., Orlans, I., Vanderstichele, H., Saftig, P., De Strooper, B., and Annaert, W. (2001) J. Cell Biol. 154, 731-740[Abstract/Free Full Text]
15. Kaether, C., Lammich, S., Edbauer, D., Ertl, M., Rietdorf, J., Capell, A., Steiner, H., and Haass, C. (2002) J. Cell Biol. 158, 551-561[Abstract/Free Full Text]
16. Hartmann, T., Bieger, S. C., Bruhl, B., Tienari, P. J., Ida, N., Allsop, D., Roberts, G. W., Masters, C. L., Dotti, C. G., Unsicker, K., and Beyreuther, K. (1997) Nat. Med. 3, 1016-1020[Medline] [Order article via Infotrieve]
17. Soriano, S., Chyung, A. S., Chen, X., Stokin, G. B., Lee, V. M., and Koo, E. H. (1999) J. Biol. Chem. 274, 32295-32300[Abstract/Free Full Text]
18. Cook, D. G., Forman, M. S., Sung, J. C., Leight, S., Kolson, D. L., Iwatsubo, T., Lee, V. M., and Doms, R. W. (1997) Nat. Med. 3, 1021-1023[Medline] [Order article via Infotrieve]
19. Greenfield, J. P., Tsai, J., Gouras, G. K., Hai, B., Thinakaran, G., Checler, F., Sisodia, S. S., Greengard, P., and Xu, H. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 742-747[Abstract/Free Full Text]
20. Takahashi, R. H., Milner, T. A., Li, F., Nam, E. E., Edgar, M. A., Yamaguchi, H., Beal, M. F., Xu, H., Greengard, P., and Gouras, G. K. (2002) Am. J. Pathol. 161, 1869-1879[Abstract/Free Full Text]
21. Xu, H., Sweeney, D., Wang, R., Thinakaran, G., Lo, A. C., Sisodia, S. S., Greengard, P., and Gandy, S. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 3748-3752[Abstract/Free Full Text]
22. Thinakaran, G. (2001) J. Mol. Neurosci. 17, 183-192[CrossRef][Medline] [Order article via Infotrieve]
23. Thinakaran, G., Harris, C. L., Ratovitski, T., Davenport, F., Slunt, H. H., Price, D. L., Borchelt, D. R., and Sisodia, S. S. (1997) J. Biol. Chem. 272, 28415-28422[Abstract/Free Full Text]
24. Ratovitski, T., Slunt, H. H., Thinakaran, G., Price, D. L., Sisodia, S. S., and Borchelt, D. R. (1997) J. Biol. Chem. 272, 24536-24541[Abstract/Free Full Text]
25. Capell, A., Grunberg, J., Pesold, B., Diehlmann, A., Citron, M., Nixon, R., Beyreuther, K., Selkoe, D. J., and Haass, C. (1998) J. Biol. Chem. 273, 3205-3211[Abstract/Free Full Text]
26. Yu, G., Nishimura, M., Arawaka, S., Levitan, D., Zhang, L., Tandon, A., Song, Y. Q., Rogaeva, E., Chen, F., Kawarai, T., Supala, A., Levesque, L., Yu, H., Yang, D. S., Holmes, E., Milman, P., Liang, Y., Zhang, D. M., Xu, D. H., Sato, C., Rogaev, E., Smith, M., Janus, C., Zhang, Y., Aebersold, R., Farrer, L. S., Sorbi, S., Bruni, A., Fraser, P., and St. George-Hyslop, P. (2000) Nature 407, 48-54[CrossRef][Medline] [Order article via Infotrieve]
27. Li, Y. M., Lai, M. T., Xu, M., Huang, Q., DiMuzio-Mower, J., Sardana, M. K., Shi, X. P., Yin, K. C., Shafer, J. A., and Gardell, S. J. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6138-6143[Abstract/Free Full Text]
28. Edbauer, D., Winkler, E., Haass, C., and Steiner, H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 8666-8671[Abstract/Free Full Text]
29. Esler, W. P., Kimberly, W. T., Ostaszewski, B. L., Ye, W., Diehl, T. S., Selkoe, D. J., and Wolfe, M. S. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 2720-2725[Abstract/Free Full Text]
30. Francis, R., McGrath, G., Zhang, J., Ruddy, D. A., Sym, M., Apfeld, J., Nicoll, M., Maxwell, M., Hai, B., Ellis, M. C., Parks, A. L., Xu, W., Li, J., Gurney, M., Myers, R. L., Himes, C. S., Hiebsch, R., Ruble, C., Nye, J. S., and Curtis, D. (2002) Dev. Cell 3, 85-97[Medline] [Order article via Infotrieve]
31. Goutte, C., Tsunozaki, M., Hale, V. A., and Priess, J. R. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 775-779[Abstract/Free Full Text]
32. Steiner, H., Winkler, E., Edbauer, D., Prokop, S., Basset, G., Yamasaki, A., Kostka, M., and Haass, C. (2002) J. Biol. Chem. 277, 39062-39065[Abstract/Free Full Text]
33. Lee, S. F., Shah, S., Li, H., Yu, C., Han, W., and Yu, G. (2002) J. Biol. Chem. 277, 45013-45019[Abstract/Free Full Text]
34. Gu, Y., Chen, F., Sanjo, N., Kawarai, T., Hasegawa, H., Duthie, M., Li, W., Ruan, X., Luthra, A., Mount, H. T., Tandon, A., Fraser, P. E., and St. George-Hyslop, P. (December 5, 2002) J. Biol. Chem. 10.1074/jbc.M209499200
35. Xu, H., Gouras, G. K., Greenfield, J. P., Vincent, B., Naslund, J., Mazzarelli, L., Fried, G., Jovanovic, J. N., Seeger, M., Relkin, N. R., Liao, F., Checler, F., Buxbaum, J. D., Chait, B. T., Thinakaran, G., Sisodia, S. S., Wang, R., Greengard, P., and Gandy, S. (1998) Nat. Med. 4, 447-451[Medline] [Order article via Infotrieve]
36. Leem, J. Y., Vijayan, S., Han, P., Cai, D., Machura, M., Lopes, K. O., Veselits, M. L., Xu, H., and Thinakaran, G. (2002) J. Biol. Chem. 277, 19236-19240[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.