Expression of the Pro-apoptotic Gene
gadd153/chop Is Elevated in Liver with Aging and Sensitizes
Cells to Oxidant Injury*
Shizuo
Ikeyama
,
Xian-Tao
Wang
,
Ji
Li§,
Andrej
Podlutsky
§,
Jennifer L.
Martindale
,
Gertrude
Kokkonen
,
Rika
van
Huizen
,
Myriam
Gorospe
, and
Nikki J.
Holbrook
§¶
From the
Laboratory of Cellular and Molecular
Biology, National Institute on Aging-IRP, Baltimore, Maryland 21224 and § Yale University School of Medicine, Section of
Geriatrics, New Haven, Connecticut 06520
Received for publication, January 21, 2003
 |
ABSTRACT |
Aging is generally accompanied by reduced
tolerance to oxidative stress and altered responsiveness to
proliferative signals. We have shown that hepatocytes derived from aged
rats (24-26 months) exhibit greater sensitivity to
H2O2 treatment and reduced proliferation following epidermal growth factor (EGF) treatment than cells of young
adult rats (5-6 months). Here we examined the effects of aging and
calorie restriction (CR) on expression of the oxidative stress-inducible and pro-apoptotic gene gadd153
(chop) in these hepatocytes, and we investigated its
influence on sensitivity to oxidants. We show that aging was associated
with elevated expression of gadd153, both basally and in
response to H2O2 treatment. CR, which
attenuates age-associated declines in stress tolerance, prevented the
age-related increase in gadd153 expression. EGF treatment also resulted in gadd153 induction in old cells.
This effect was absent in young cells and in old cells of CR rats. gadd153 induction by EGF was reactive oxygen
species-dependent and correlated with heightened
sensitivity to subsequent H2O2 treatment,
suggesting that elevated Gadd153 contributes to the greater sensitivity
of EGF-pretreated old cells to oxidative stress. Additional support for
this hypothesis was provided by experiments with Rat1 fibroblasts in
which conditional expression of Gadd153 conferred increased sensitivity
to H2O2. We propose a model whereby the
diminished ability of old hepatocytes to overcome an EGF-triggered reactive oxygen species load leads to induction of the proapoptotic gene gadd153, which, in turn, sensitizes the cells to
oxidant injury. Our findings point to gadd153 expression
levels as an important factor in liver aging.
 |
INTRODUCTION |
Reactive oxygen species
(ROS)1 constitute a
double-edged sword for mammalian cells. Many proteins involved in
growth control are subject to redox regulation, and transient
generation of ROS by growth factor treatments is essential for
proliferation (1-8). However, high or sustained levels of ROS can
result in the oxidation of biomolecules, resulting in cell damage
leading to growth arrest, senescence, or death (9, 10). Oxidative
damage contributes to a wide variety of age-related diseases, including
cancer, diabetes, and neurodegenerative disorders, and several lines of
evidence implicate oxidative stress as an important factor in normal
mammalian aging (11-14). First, oxidative damage accumulates with age
in rodents; and calorie restriction (CR), the only non-genetic
intervention capable of extending life span in mammals, reduces such
accumulation (15-17). Second, in mammals as well as lower organisms,
gene mutations or manipulations that modify oxidative stress tolerance
correspondingly influence longevity (18-24). Among these is the
mutation of the signaling molecule Shc66, which enhances oxidative
stress tolerance and increases life span in mice (25). Finally,
chronological aging in rats is accompanied by reduced tolerance to
oxidative injury, reflecting a decreased ability to activate certain
pro-survival signaling pathways in response to the insult (26-28).
Reduced proliferative capacity constitutes another important feature of
mammalian aging (16, 29). That altered proliferative ability is linked
to a reduction in oxidative stress tolerance is suggested by the
significant overlap between signaling pathways involved in regulating
proliferation and those involved in supporting cell survival in
response to oxidative stress (10, 26, 28, 30). Indeed, there is strong
evidence indicating that oxidants usurp growth factor signaling
pathways, such as those mediated by the epidermal growth factor (EGF)
receptor, to activate downstream signaling pathways important to both
responses (5, 31-34). Rat hepatocytes exhibit reductions in both
proliferative capacity and oxidative stress tolerance as a function of
aging and provide a useful model to understand associated mechanisms.
We have demonstrated that hepatocytes derived from aged rats (hereafter
referred to as "old" or "aged" hepatocytes) show a reduced
ability to activate extracellular signal-regulated kinase in response
to both EGF and a wide range of hydrogen peroxide
(H2O2) concentrations (35). In the case of
either EGF treatment or low (mitogenic) concentrations of
H2O2, this is associated with reduced DNA
synthesis. In the case of high (toxic) concentrations of the oxidant,
it is associated with lower survival. Hepatocytes from rats maintained
on CR display less of a decline in extracellular signal-regulated
kinase activation with aging and, accordingly, greater oxidative stress
tolerance than those derived from their ad libitum (AL) fed
counterparts (28).
In preliminary studies aimed at identifying potential genes responsible
for the reduced survival of old cells following oxidative stress, we
observed that the expression of gadd153 appeared higher in
old hepatocytes relative to young cells. Gadd153 belongs to the
CCAAT/enhancer-binding protein family of transcription factors (36-42). Expressed at low levels in proliferating cells, it undergoes marked induction in response to stresses that result in growth arrest
or cell death, including oxidant injury, certain DNA-damaging agents,
nutrient depletion/amino acid starvation, and stress to the endoplasmic
reticulum (ER). Gadd153 expression promotes apoptosis under conditions
of ER stress (40-42), but its role in regulating cell death under
other stress conditions is less well established.
In this paper, we explore the role of Gadd153 in mediating responses to
EGF and H2O2 in young versus aged
hepatocytes. We demonstrate that basal expression of gadd153
increases with aging, as does its magnitude of induction in response to
H2O2 treatment. In addition, we show that
gadd153 is preferentially induced in old cells in response
to EGF treatment through a ROS-dependent mechanism, and we
provide evidence that this sensitizes the old cells to a subsequent
oxidant injury. CR, which increases proliferative capacity and enhances
survival of old cells following oxidative stress, attenuates
gadd153 expression basally and in response to stress. Our
findings suggest that dysregulated gadd153 expression contributes to the reduced stress tolerance of aged hepatocytes and
point to Gadd153 expression as an important factor in liver aging.
 |
MATERIALS AND METHODS |
Animals--
Male Fischer 344 rats 4-26 months old (NIA
Contract Colonies at Harlan Sprague-Dawley) were maintained on a 12-h
light/dark cycle in a controlled environment with water supplied at all
times. AL fed rats were offered unlimited quantities of regular NIH-31 pelleted diet, whereas calorie-restricted (CR) rats received a vendor-provided pellet-enriched NIH-31 diet equal to 60% of the average daily caloric intake of the AL fed rats (GRC ACUC protocol NJH-058-Ra/Mi).
Cell Culture and Treatment--
Hepatocytes were isolated from
young (4-6-month-old) and old (24-26-month-old) rats by the method of
Seglen (43). Rat1 cells were obtained from Dr. C. C. Ling (44).
Gadd153i cells were derived from Rat1 fibroblasts and express ectopic
gadd153 under the control of an
isopropyl-
-D-thiogalactopyranoside (IPTG)-inducible promoter, as described previously (41). Rat1 and Rat1-Myc-Gadd153 (A94)
cells lines were grown in Dulbecco's modified essential medium
supplemented with 10% fetal bovine serum and antibiotics. A94 and
Gadd153i cells were maintained as described above in medium containing
300 µg of hygromycin B (Sigma) per ml. H2O2
was from Sigma; EGF was from Invitrogen; and AG1478, compound 56, ebselen, and N-acetylcysteine were from Calbiochem. Cell
viability was determined using trypan blue dye.
Northern and Western Blot Analyses and Real Time
RT-PCR--
Northern blot analysis was carried out using total RNA as
described previously (35). Hybridizations were carried out using radiolabeled cDNA probes specific for rat gadd153,
gadd45, and grp78. A radiolabeled
oligonucleotide complementary to 18 S rRNA was used to verify RNA
integrity and loading differences (35).
Real-time PCR determinations were performed using the iCycler
iQTM Real Time Detection System (Bio-Rad) using a SYBR®
Green PCR Master Mix (PE Biosystems, Foster City, CA). Assays were
carried out in triplicate, and PCR products were examined by agarose
gel electrophoresis. Primers for amplification of histone H1 sequence were AGATCGCGAGTCAGGTTCTG and GTGGAGTTCTCGGTCATGGT;
primers for amplification of the GADD153 sequence were
CCTGAAAGCAGAAACCGGTC and CCTCATACCAGGCTTCCAGC. Reactions were
performed as follows: 1 cycle at 95 °C for 7 min and 40 cycles at
95 °C for 30 s, 65 °C for 30 s, and 72 °C for
30 s. Standard curve and slope values were derived from 10-fold
cDNA dilutions (1:10, 1:100, 1:1000, and 1:10000). Input amounts of
RNA (IA) were calculated using Equation 1 provided by ABI
Prism 7700,
|
(Eq. 1)
|
where Ct = value from RT-PCR data file;
b = y intercept of standard curve line;
m = slope of standard curve line (from equation y = mx + b for standard curve
line). Histone H1 was used as reference gene, because its expression
was not changed with age.
Whole-cell lysates (50-150 µg, prepared as reported previously (35))
were size-fractionated by electrophoresis through Tris-glycine gels
(Invitrogen) and transferred to polyvinylidene difluoride membranes.
For protein detection, a polyclonal anti-Gadd153 antibody was used
(Santa Cruz Biotechnology Inc., Santa Cruz, CA). After secondary
antibody incubation, signals were visualized by enhanced chemiluminescence (Amersham Biosciences).
Gadd153 Promoter-Luciferase Reporter Assays--
The
gadd153-LUC construct containing the
778 to +21 promoter
region of the hamster gadd153 gene was obtained from Dr. S. Howell (45). Cells were transiently transfected for 12 h using 100 µl of LipofectAMINE 2000 (Invitrogen) with 1.6 µg of DNA per dish.
After transfection, cells were incubated in serum-free medium for
6 h before treatment with 100 ng/ml of EGF for 12 h.
Cells were then incubated in fresh serum-free medium for 6 h,
washed twice with phosphate-buffered saline, and lysed for assessment of luciferase activity using the Luciferase Assay System kit (Promega, Madison, WI). Relative light units were normalized to protein concentrations that were determined in parallel.
Statistical Analysis--
Statistical analysis was
performed using a one-way analysis of variance. Differences between
individual age or treatment groups were evaluated using the unpaired
two-tailed Student's t test.
 |
RESULTS |
Basal and H2O2- and EGF-induced Gadd153
Expression in Young and Old Hepatocytes--
Preliminary experiments
using Northern analysis suggested that gadd153 mRNA
expression might be elevated with aging. However, basal expression of
gadd153 is very low and often undetectable by Northern
analysis, precluding accurate quantitative measurement with this
method. Therefore, real time RT-PCR was used to examine expression of the gene in young versus old cells
obtained from rats either AL fed or maintained on a CR diet. As shown
in Fig. 1A, gadd153
mRNA expression was higher in old hepatocytes from AL rats relative
to young cells from AL rats. However, old CR hepatocytes showed
significantly lower gadd153 expression relative to their AL
counterparts. Elevations in Gadd153 protein expression with aging were
also observed in whole liver tissue as shown in Fig. 1B, but
as shown for mRNA expression in hepatocytes, CR reduced them.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
Effects of aging and CR on gadd153
expression in hepatocytes and whole liver of rats.
A, RNA from hepatocytes derived from young and old rats
maintained on either AL or CR diets were used to assess
gadd153 mRNA levels using real time RT-PCR (see under
"Materials and Methods"). B, top,
basal level of Gadd153 expression in liver specimens (80 µg of
protein per lane) were monitored by Western blot analysis with a
polyclonal antibody that recognizes Gadd153 ("Materials and
Methods"). Bottom, summary of results obtained for three
animals, each group. Shown are the means ± S.E. *,
p < 0.05 comparing Gadd153 protein levels relative to
those in young AL hepatocytes. YAL, young AL;
YCR, young CR; OAL, old AL; OCR, old
CR.
|
|
As oxidative damage increases gadd153 expression in many
cell types, we next examined gadd153 mRNA levels in
young and old cells following their exposure to 300 or 600 µM H2O2. We have shown previously
(28) that H2O2 induces apoptosis in a
dose-dependent manner in both young and old hepatocytes,
but with old cells exhibiting greater sensitivity. Consistent with the
old cells being more sensitive to H2O2, these
cells showed higher induction of gadd153 mRNA relative
to young cells (Fig. 2).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 2.
Induction of gadd153
mRNA in H2O2-treated hepatocytes
isolated from young and old rats. Hepatocytes derived from young
and old AL-fed rats were treated with either 300 or 600 µM H2O2 for the indicated times.
Top, total cellular RNA was isolated, and Northern
blot analysis was performed to assess gadd153 expression.
Bottom, quantification of results comparing amounts of
gadd153 mRNA expression in cells from young
versus aged hosts relative to levels in untreated cells.
Shown are the means ± S.E. of three independent experiments. *,
p < 0.05 comparing signals between
H2O2-treated and untreated control cells; **,
p < 0.05 comparing signals between young and old
cells.
|
|
We next investigated gadd153 expression following treatment
with EGF. As shown in Fig. 3A,
the absence of gadd153 mRNA induction by EGF in young
cells is consistent with the general view that gadd153, as
implied by its name, is regulated by conditions of growth arrest and is
not responsive to proliferative signals. Much to our surprise, however,
we observed significant induction of gadd153 mRNA by EGF
in old cells (Fig. 3A). The abundance of mRNAs encoding
gadd45 and grp78, two other stress-related genes whose expression often coincides with that of gadd153 during
conditions of stress, was not affected by EGF treatment (Fig.
3A). Increased gadd153 mRNA expression was
associated with increased Gadd153 protein (Fig. 3B).
Importantly, the EGF-induced Gadd153 expression was greatly attenuated
in cells of old CR rats relative to cells of old AL rats. To determine
whether EGF induced gadd153 expression through increases in
transcription, cells were transiently transfected with a construct
carrying the gadd153 promoter linked to a luciferase reporter gene. As shown in Fig. 3C, no significant
activation of the promoter occurred in young cells. By contrast, a
marked increase in gadd153 promoter activity was seen
following EGF treatment of old hepatocytes (Fig. 3C).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of gadd153
mRNA in EGF-treated hepatocytes isolated from young and old
rats. A, hepatocytes derived from young and old AL-fed
rats were treated with 100 ng/ml of EGF for the times indicated.
Top, after isolation of total cellular RNA, Northern blot
analysis was performed with the indicated probes. Bottom,
quantification of gadd153 mRNA signals in hepatocytes
from young AL and old AL rats, relative to levels in untreated young
hepatocytes. Shown are the means ± S.E. of three independent
experiments. *, p <0.05 comparing signals between
H2O2-treated and untreated cells; **,
p <0.05 comparing signals between young and old cells.
B, kinetics of Gadd153 up-regulation by EGF and effect of CR
on EGF responsiveness. Hepatocytes derived from young and old AL-fed
and CR rats were treated with various concentrations of EGF
(top) or 100 ng/ml EGF (bottom) for 6 h.
Samples were harvested after stimulation, and Gadd153 expression was
monitored by Western blot analysis. The results are representative of
three independent experiments. C, activity of the
gadd153 promoter after treatment with EGF. Hepatocytes
isolated from young and old AL-fed rats were transiently transfected
with a luciferase reporter plasmid under the control of the
gadd153 promoter and then treated with 100 ng/ml of EGF for
12 h. Luciferase activities were measured by luciferase reporter
assays ("Materials and Methods"). Shown are the means ± S.E.
of three independent experiments. Cont., control. *,
p < 0.05 compared with untreated control cells; **,
p < 0.05 comparing values for young and old
cells.
|
|
ROS Contribute to Increasing Gadd153 Levels by EGF
Treatment--
EGF stimulation leads to the transient generation of
ROS downstream of EGF receptor activation (1). To investigate the importance of ROS in mediating Gadd153 induction by EGF, cells were
treated with EGF in the presence of either N-acetylcysteine, a glutathione precursor, or ebselen, a glutathione peroxidase mimetic,
both of which reduce the ROS load (46, 47). Both antioxidants prevented
Gadd153 induction in old cells in response to EGF (Fig.
4A), and they inhibited
Gadd153 induction in old and young cells in response to
H2O2 treatment (Fig. 4C). Gadd153 induction in response to both H2O2 and EGF was
likewise dependent on EGF receptor activation as co-treatment of cells
with either AG1478 or compound 56, inhibitors of EGF receptor
phosphorylation, markedly reduced Gadd153 induction (Fig. 4,
A and C).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of antioxidants and inhibitors of EGF
receptor on Gadd153 induction and cell death after treatment with
either EGF or H2O2. Hepatocytes derived
from young and old AL-fed rats were pretreated with either
N-acetylcysteine (NAC) (500 µM),
ebselen (10 µM), AG1478 (AG) (5 µM), or compound 56 (1 µM) for 30 min as
indicated and then treated with 100 ng/ml of EGF (A) or 600 µM of H2O2 (C), and
Gadd153 levels were examined 8 h later by Western blot analysis.
Cont., control. B and D, cells were
treated same as described above, and 24 h later cell viability
assay was assessed (see "Materials and Methods"). Shown are the
means ± S.E. of three independent experiments. *,
p < 0.05 compared with cells treated with either EGF
or H2O2. **, p < 0.05 comparing values for young and old AL cells.
|
|
Influence of Gadd153 on Survival--
Induction of Gadd153 is
frequently correlated with stresses that result in cell death. Evidence
that Gadd153 expression in fact correlated with relative survival in
H2O2-treated cells is shown in Fig.
4D. This observation suggested that EGF treatment may indeed
constitute a stress for these cells. However, examination of
EGF-treated old cells revealed no evidence of apoptosis (Fig. 4B). In previous studies using several different cell lines,
we found that elevated Gadd153 expression alone did not lead to cell death but did enhance cell sensitivity to ER stress (41). Therefore, we
sought to determine whether up-regulation of Gadd153 in old hepatocytes
in response to EGF treatment would increase their sensitivity to an
oxidative insult. To this end, cells were treated with either EGF,
H2O2, or both, and Gadd153 expression and cell survival were assessed 8 or 24 h later, respectively. As shown in
Fig. 5A, EGF and
H2O2 treatments resulted in similar levels of
Gadd153 induction in old cells, although only
H2O2 resulted in apoptosis. Importantly,
however, simultaneous exposure of old cells to EGF and
H2O2 potentiated Gadd153 expression, and this was associated with greater apoptosis than that seen with
H2O2 alone. No such potentiation of Gadd153
expression was seen with combined treatment of young cells, nor was the
sensitivity to H2O2 altered by combined
exposure with EGF (Fig. 5A).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of combined treatment with
EGF and H2O2 on gadd153
induction and cell death. A, hepatocytes derived
from young AL and old AL rats were treated with either 100 ng/ml EGF,
600 µM H2O2, or both.
Top, Gadd153 levels were examined 8 h later by Western
blot analysis as described under "Materials and Methods."
Bottom, cells were treated as described in A, and
cell viability was assessed 24 h later. Cont., control.
Shown are the means ± S.E. of three independent experiments. *,
p < 0.05 comparing with untreated control cells; **,
p < 0.05 comparing values for young and old cells;
***, p < 0.05 comparing values from either EGF- or
H2O2-treated cells with values in cells treated
with both agents. B, cells were treated with
H2O2 at the concentrations indicated, and
24 h later cell viability was assessed as described under
"Materials and Methods." Basal Gadd153 protein expression in
untreated cells is shown by Western blot analysis. *, p < 0.05 comparing values for Rat1+myc and A94 cells. C, Rat1
Gadd153i cells were either left untreated or treated with IPTG (5 mM) for 8 h to induce gadd153
expression, and both Gadd153 expression (Western blot) and
cell viability (graph) were assessed as described under
"Materials and Methods." Shown are the means ± S.E. of three
independent experiments. *, p < 0.05 comparing values
for Gadd153i cells with and without IPTG.
|
|
The above studies suggest that EGF-stimulated increases in Gadd153
expression lead to heightened sensitivity of old hepatocytes to oxidant
exposure. If so, then ectopic expression of high levels of Gadd153
should likewise increase cell sensitivity to oxidants. Unfortunately,
such experiments cannot be performed in primary hepatocytes, as we are
unable to achieve a high enough efficiency of transfection. However,
support for this notion was obtained with Myc-transformed Rat1
fibroblasts (Rat1-Myc) in which Gadd153 expression is constitutively
elevated (A94 cells). Parental Rat1-Myc and A94 cells were treated with
various concentrations of H2O2 and 24 h
later evaluated for cell viability. Constitutive expression of Gadd153
led to a marked increase in cell death compared with that seen in
Rat1-Myc cells (Fig. 5B). Similar findings were obtained using another model in which ectopic (FLAG-tagged) Gadd153 expression was driven via an IPTG-inducible promoter in untransformed Rat1 cells
(Fig. 5C). In the absence of IPTG, Gadd153 protein is
undetectable in these cells. IPTG treatment (resulting in the
accumulation of Gadd153) alone did not significantly induce cell death.
However, it markedly enhanced the sensitivity of cells to
H2O2. These findings support the view that
elevated Gadd153 expression in aged hepatocytes contributes to their
enhanced sensitivity to oxidative stress.
 |
DISCUSSION |
We have reported previously (28) that aging in rats is
associated with reduced tolerance of hepatocytes to oxidative
injury, an effect that can be attenuated by maintaining the animals on CR. Having preliminarily identified the stress-inducible gene gadd153 as up-regulated in the aged hepatocytes, we sought
here to investigate further the relationship between gadd153
expression and oxidative stress tolerance in this model. The major
findings presented are as follows: 1) gadd153 expression is
elevated both basally and in response to oxidative injury as a function
of aging, but CR reduces these elevated levels; 2) aberrant induction
of gadd153 occurs in response to EGF stimulation selectively
in old hepatocytes; and 3) elevated Gadd153 sensitizes cells to
oxidative insults. Coupled with our previous observations, these new
findings argue strongly that elevated Gadd153 is an important factor in liver aging and specifically that it contributes to the enhanced susceptibility of aged cells to oxidative insults.
A previous study (48), employing microarray screening to identify genes
altered by aging in mouse brain, reported that gadd153 expression was increased 1.8-fold with aging in the neocortex but not
the cerebellum. In that study, CR did not alter the effect of aging on
gadd153 expression. By using a similar approach to examine
age-related changes in gene expression in mouse heart, it was recently
reported that gadd153 expression is not affected by aging
but is reduced >3-fold by CR (49). Such disparate findings point to
important organ/cell type-specific differences in the aging process of
mammals. However, it is worth noting that in neither of the two
previous studies were the findings for gadd153 obtained with
the arrays verified by other methods. Here we have demonstrated the
up-regulation of gadd153 with aging in rat hepatocytes and
its attenuation by CR by using several different approaches including
real time RT-PCR and Northern and Western blot analyses. The fact that
CR alters gadd153 expression in old cells, but not young
cells, supports the notion that, in liver, CR does not directly influence gadd153 expression but rather acts to prevent
age-related alterations leading to elevated expression of the gene.
The mechanisms contributing to age-related alterations in
gadd153 expression remain to be determined. As an oxidative
stress-inducible gene, basal increases in gadd153 expression
are consistent with the idea that aging is associated with elevated
levels of ROS and chronic oxidative stress (4, 50). However, it is also possible that changes in gadd153 contribute to elevations in
ROS, as we have shown that ectopic expression of Gadd153 in rat
fibroblasts leads to increased levels of ROS (41). Elevations in basal
ROS levels with aging could be an important factor contributing to EGF-induced gadd153 expression as well. Whereas transient
generation of ROS is an important and necessary consequence of growth
factor stimulation for proliferation, if imposed on cells already
containing elevations in ROS, it could shift the cell into a
pro-oxidant state, resulting in oxidative stress. The ability of CR
(which is known to reduce the levels of oxidative damage with aging) to
prevent EGF-induced gadd153 expression is consistent with
this hypothesis.
Whereas a role for gadd153 in mediating apoptosis in
response to ER stress is well established (40, 42), its contribution to
cell death in other stress paradigms is less clear. Such an effect
cannot be taken for granted, as we found that elevated gadd153 expression did not affect the cellular response to
ionizing radiation in Myc-transformed rat fibroblasts (41). Our
findings here using two different model systems of gadd153
overexpression, as well as experiments in rat hepatocytes, support its
pro-apoptotic function during conditions of oxidative stress and point
to elevated gadd153 expression as an important factor in the
increased susceptibility of aged hepatocytes to oxidant injury.
Strategies aimed at reducing gadd153 expression in aged
cells and tissues could have anti-aging benefits.
 |
FOOTNOTES |
*
This work was supported in part by a grant from the Claude
D. Pepper Older Americans Independence Center at Yale (T30AG21342) and
NIADDK, National Institutes of Health Grant T30-3489 awarded to the
Yale Liver Center.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Section of
Geriatrics, Dept. of Internal Medicine, Yale University School of
Medicine, P. O. Box 208025, New Haven, CT 06511. Tel.: 203-737-5847;
Fax: 203-737-1801; E-mail: nikki-holbrook@yale.edu.
Published, JBC Papers in Press, February 27, 2003, DOI 10.1074/jbc.M300677200
 |
ABBREVIATIONS |
The abbreviations used are:
ROS, reactive oxygen
species;
AL, ad libitum;
CR, calorie-restricted;
EGF, epidermal growth factor;
gadd, growth arrest and
DNA-damage-inducible;
RT, reverse transcriptase;
IPTG, isopropyl-
-D-thiogalactopyranoside;
ER, endoplasmic
reticulum.
 |
REFERENCES |
1.
|
Bae, Y. S.,
Kang, S. W.,
Seo, M. S.,
Baines, I. C.,
Tekle, E.,
Chock, P. B.,
and Rhee, S. G.
(1997)
J. Biol. Chem.
272,
217-221[Abstract/Free Full Text]
|
2.
|
Burdon, R. H.
(1995)
Free Radic. Biol. Med.
18,
775-794[CrossRef][Medline]
[Order article via Infotrieve]
|
3.
|
Droge, W.
(2002)
Physiol. Rev.
82,
47-95[Abstract/Free Full Text]
|
4.
|
Finkel, T.
(1998)
Curr. Opin. Cell Biol.
10,
248-253[CrossRef][Medline]
[Order article via Infotrieve]
|
5.
|
Guyton, K. Z.,
Liu, Y.,
Gorospe, M.,
Xu, Q.,
and Holbrook, N. J.
(1996)
J. Biol. Chem.
271,
4138-4142[Abstract/Free Full Text]
|
6.
|
Krieger-Brauer, H. I.,
and Kather, H.
(1995)
Biochem. J.
307,
549-556[Medline]
[Order article via Infotrieve]
|
7.
|
Lo, Y. Y.,
and Cruz, T. F.
(1995)
J. Biol. Chem.
270,
11727-11730[Abstract/Free Full Text]
|
8.
|
Sundaresan, M., Yu, Z. X.,
Ferrans, V. J.,
Irani, K.,
and Finkel, T.
(1995)
Science
270,
296-299[Abstract]
|
9.
|
Finkel, T.,
and Holbrook, N. J.
(2000)
Nature
408,
239-247[CrossRef][Medline]
[Order article via Infotrieve]
|
10.
|
Martindale, J. L.,
and Holbrook, N. J.
(2002)
J. Cell. Physiol.
192,
1-15[CrossRef][Medline]
[Order article via Infotrieve]
|
11.
|
Beckman, K. B.,
and Ames, B. N.
(1998)
Physiol. Rev.
78,
547-581[Abstract/Free Full Text]
|
12.
|
Harman, D.
(1956)
J. Gerontol.
11,
298-300[Medline]
[Order article via Infotrieve]
|
13.
|
Sohal, R. S.
(2002)
Free Radic. Biol. Med.
33,
37-44[CrossRef][Medline]
[Order article via Infotrieve]
|
14.
|
Stadtman, E. R.
(1992)
Science
257,
1220-1224[Medline]
[Order article via Infotrieve]
|
15.
|
Ames, B. N.,
Shigenaga, M. K.,
and Hagen, T. M.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
7915-7922[Abstract/Free Full Text]
|
16.
|
Good, R. A.,
and Lorenz, E.
(1992)
Int. J. Immunopharmacol.
14,
361-366[CrossRef][Medline]
[Order article via Infotrieve]
|
17.
|
Masoro, E. J.
(2001)
in
Handbook of the Biology of Aging
(Masoro, E. J.
, and Austad, S. N., eds)
, pp. 396-420, Academic Press, San Diego
|
18.
|
Ogg, S.,
Paradis, S.,
Gottlieb, S.,
Patterson, G. I.,
Lee, L.,
Tissenbaum, H. A.,
and Ruvkun, G.
(1997)
Nature
389,
994-999[CrossRef][Medline]
[Order article via Infotrieve]
|
19.
|
Murakami, S.,
and Johnson, T. E.
(1996)
Genetics
143,
1207-1218[Abstract/Free Full Text]
|
20.
|
Lithgow, G. J.,
White, T. M.,
Melov, S.,
and Johnson, T. E.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
7540-7544[Abstract]
|
21.
|
Lin, Y. J.,
Seroude, L.,
and Benzer, S.
(1998)
Science
282,
943-946[Abstract/Free Full Text]
|
22.
|
Larsen, P. L.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8905-8909[Abstract]
|
23.
|
Guarente, L.,
and Kenyon, C.
(2000)
Nature
408,
255-262[CrossRef][Medline]
[Order article via Infotrieve]
|
24.
|
Fabrizio, P.,
Pozza, F.,
Pletcher, S. D.,
Gendron, C. M.,
and Longo, V. D.
(2001)
Science
292,
288-290[Abstract/Free Full Text]
|
25.
|
Migliaccio, E.,
Giorgio, M.,
Mele, S.,
Pelicci, G.,
Reboldi, P.,
Pandolfi, P. P.,
Lanfrancone, L.,
and Pelicci, P. G.
(1999)
Nature
402,
309-313[CrossRef][Medline]
[Order article via Infotrieve]
|
26.
|
Holbrook, N. J.,
and Ikeyama, S.
(2002)
Biochem. Pharmacol.
64,
999-1005[CrossRef][Medline]
[Order article via Infotrieve]
|
27.
|
Hall, D. M.,
Oberley, T. D.,
Moseley, P. M.,
Buettner, G. R.,
Oberley, L. W.,
Weindruch, R.,
and Kregel, K. C.
(2000)
FASEB J.
14,
78-86[Abstract/Free Full Text]
|
28.
|
Ikeyama, S.,
Kokkonen, G.,
Shack, S.,
Wang, X. T.,
and Holbrook, N. J.
(2002)
FASEB J.
16,
114-116[Abstract/Free Full Text]
|
29.
|
Hornsby, P. J.
(2001)
in
Handbook of the Biology of Aging
(Masoro, E. J.
, and Austad, S. N., eds)
, pp. 207-235, Academic Press, San Diego
|
30.
|
Liu, Y.,
and Holbrook, N. J.
(2002)
in
Handbook of the Biology of Aging
(Masoro, E. J.
, and Austad, S. N., eds)
, pp. 179-205, Academic Press, San Diego
|
31.
|
Sachsenmaier, C.,
Radler-Pohl, A.,
Zinck, R.,
Nordheim, A.,
Herrlich, P.,
and Rahmsdorf, H. J.
(1994)
Cell
78,
963-972[Medline]
[Order article via Infotrieve]
|
32.
|
Schieven, G. L.,
Mittler, R. S.,
Nadler, S. G.,
Kirihara, J. M.,
Bolen, J. B.,
Kanner, S. B.,
and Ledbetter, J. A.
(1994)
J. Biol. Chem.
269,
20718-20726[Abstract/Free Full Text]
|
33.
|
Knebel, A.,
Rahmsdorf, H. J.,
Ullrich, A.,
and Herrlich, P.
(1996)
EMBO J.
15,
5314-5325[Abstract]
|
34.
|
Zanella, C. L.,
Posada, J.,
Tritton, T. R.,
and Mossman, B. T.
(1996)
Cancer Res.
56,
5334-5338[Abstract]
|
35.
| Ikeyama, S., Kokkonen, G., Martindale, J. L., Wang, X. T.,
Gorospe, M., and Holbrook, N. J. (2003) Exp. Gerontol.,
in press
|
36.
|
Ron, D.,
and Habener, J. F.
(1992)
Genes Dev.
6,
439-453[Abstract]
|
37.
|
Carlson, S. G.,
Fawcett, T. W.,
Bartlett, J. D.,
Bernier, M.,
and Holbrook, N. J.
(1993)
Mol. Cell. Biol.
13,
4736-4744[Abstract]
|
38.
|
Luethy, J. D.,
Fargnoli, J.,
Park, J. S.,
Fornace, A. J., Jr.,
and Holbrook, N. J.
(1990)
J. Biol. Chem.
265,
16521-16526[Abstract/Free Full Text]
|
39.
|
Fornace, A. J., Jr.,
Nebert, D. W.,
Hollander, M. C.,
Luethy, J. D.,
Papathanasiou, M.,
Fargnoli, J.,
and Holbrook, N. J.
(1989)
Mol. Cell. Biol.
9,
4196-4203[Medline]
[Order article via Infotrieve]
|
40.
|
Zinszner, H.,
Kuroda, M.,
Wang, X.,
Batchvarova, N.,
Lightfoot, R. T.,
Remotti, H.,
Stevens, J. L.,
and Ron, D.
(1998)
Genes Dev.
12,
982-995[Abstract/Free Full Text]
|
41.
|
McCullough, K. D.,
Martindale, J. L.,
Klotz, L. O.,
Aw, T. Y.,
and Holbrook, N. J.
(2001)
Mol. Cell. Biol.
21,
1249-1259[Abstract/Free Full Text]
|
42.
|
Wang, X. Z.,
Lawson, B.,
Brewer, J. W.,
Zinszner, H.,
Sanjay, A.,
Mi, L. J.,
Boorstein, R.,
Kreibich, G.,
Hendershot, L. M.,
and Ron, D.
(1996)
Mol. Cell. Biol.
16,
4273-4280[Abstract]
|
43.
|
Seglen, P. O.
(1976)
Methods Cell Biol.
13,
29-83[Medline]
[Order article via Infotrieve]
|
44.
|
Chen, C.,
Nussenzweig, A.,
Guo, M.,
Kim, D.,
Li, G. C.,
and Ling, C. C.
(1996)
Oncogene
13,
1659-1665[Medline]
[Order article via Infotrieve]
|
45.
|
Gately, D. P.,
Sharma, A.,
Christen, R. D.,
and Howell, S. B.
(1996)
Br. J. Cancer
73,
18-23[Medline]
[Order article via Infotrieve]
|
46.
|
Parnham, M. J.,
and Kindt, S.
(1984)
Biochem. Pharmacol.
33,
3247-3250[CrossRef][Medline]
[Order article via Infotrieve]
|
47.
|
Wang, J. F.,
Komarov, P.,
Sies, H.,
and de Groot, H.
(1992)
Hepatology
15,
1112-1116[Medline]
[Order article via Infotrieve]
|
48.
|
Lee, C. K.,
Weindruch, R.,
and Prolla, T. A.
(2000)
Nat. Genet.
25,
294-297[CrossRef][Medline]
[Order article via Infotrieve]
|
49.
|
Lee, C. K.,
Allison, D. B.,
Brand, J.,
Weindruch, R.,
and Prolla, T. A.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
14988-14993[Abstract/Free Full Text]
|
50.
|
Anantharaju, A.,
Feller, A.,
and Chedid, A.
(2002)
Gerontology
48,
343-353[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.