From the
Institute of Basic Medical Sciences, National Cheng-Kung University Medical College, Tainan 701, Taiwan, Republic of China,
Department of Internal Medicine, National Cheng-Kung University Medical College, Tainan 701, Taiwan, Republic of China,
¶ Department of Physiology, National Cheng-Kung University Medical College, Tainan 701, Taiwan, Republic of China
Received for publication, January 6, 2003
, and in revised form, March 10, 2003.
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Three-dimensional collagen gel has been used as a cell culture vehicle for the study of morphogenesis by us and many laboratories (1820). Collagen fibrils can transduce signals through integrins and the receptor tyrosine kinase discoidin domain receptor 1 (DDR1) (21). Interaction of ECM with its transmembrane receptor integrins causes subsequent cascades of protein-protein interaction and modification at the focal adhesion complex site and the recruitment of several cytoskeletal proteins to form the focal adhesion complex (22). Engagement of collagen with its receptor tyrosine kinase, DDR1, resulted in the tyrosine phosphorylation of DDR1 (23, 24). However, the signaling pathways triggered by activation of DDR1 have not been well understood.
Although collagen gel may exert both biochemical and biophysical impact on cells, its biophysical impact on cell biology has been largely unknown. Collagen gel is a flexible substrate with the rigidity of 30100 pascals as measured by a dynamic mechanical analyzer. In contrast, a normal cell culture dish is non-flexible with a rigidity of more than 1 gigapascals.2 Therefore, the biophysical effects of collagen gel on cells could be due to its physical property, i.e. very low rigidity. To differentiate the biophysical effects of collagen gel from its biochemical impacts, we employed cells cultured on collagen gel and a collagen gel-coated dish for comparison. Our previous report showed that collagen gel overlay induced selective proteolysis of focal adhesion complex proteins in MDCK cells (25). In this study, we employed various cell lines to examine whether collagen gel affected the expression of focal adhesion complex proteins via its physical nature. We found that collagen gel, but not collagen gel coating, induced selective down-regulation of focal adhesion proteins in all lines of cells examined. Our data demonstrated that lowered substratum rigidity regulated the expression of focal adhesion proteins. The signaling mechanism whereby the collagen gel regulated expression of focal adhesion was explored further.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cells and Cell CultureMDCK, LLCPK1, NRK52E, Chang Liver, HeLa, TCCSUP, U373MG, NIH 3T3, and 293 cells were maintained in DMEM (high glucose or low glucose; Invitrogen) supplemented with 10% fetal bovine serum under 5% CO2 at 37 °C. The cells were seeded on different substrata at a density of 3 x 105 cells/60-mm dish.
Preparation of Collagen Gel, Matrigel, and Agarose GelType I collagen was prepared from rat tail tendons according to the established procedure described previously (19, 20). The collagen stock solution was 1%, containing 10 mg of (dry weight) rat tail tendon dissolved in 1 ml of 0.025 N acetic acid. For the preparation of 0.3% collagen gel, 3 volumes of collagen stock were mixed with 5.7x DMEM (1 volume), 2.5% NaHCO3 (0.5 volume), 0.1 M HEPES (1 volume), 0.17 M CaCl2 (0.1 volume), 1N NaOH (0.1 volume), and 4.3 volumes of 1x culture medium (DMEM plus 10% fetal calf serum) under chilled conditions. The mixtures were dispensed in the culture dish (2 ml/60-mm dish) and placed in an incubator (5% CO2 in air, 37 °C) to allow for gelation. After gelation, each culture was supplemented with 1.5 ml of culture medium containing DMEM and 10% fetal calf serum. To prepare the collagen gel-coated dish, chilled 0.3% collagen solution was added into culture dishes to cover the surface. The culture dish was then tilted, and the excess amount of collagen gel was aspirated. The collagen gel-coated dishes were air dried and washed twice by normal culture medium prior to the use. For the preparation of matrigel, a stock of 11.7 mg/ml matrigel (BD Biosciences) was diluted by culture medium to the concentration of 3.9 mg/ml, and the matrigel solution was placed in an incubator to allow for gelation. The preparation of matrigel-coated dishes was generally the same as the preparation of collagen gel-coated dishes. To prepare collagen-coated agarose gel, the agarose dissolved in normal culture medium was heated by microwave and allowed for gelation at room temperature. The agarose gel was coated by 0.3% collagen gel according to the method of preparation of a collagen gel-coated dish.
Collection of Cell Lysates and Western BlotThe cells were cultured on a dish, a collagen gel-coated dish, and a collagen gel. Cell lysates were harvested in modified radioimmune precipitation assay buffer (RIPA) buffer (150 mM NaCl, 1 mM EGTA, 50 mM Tris, pH 7.4, 10% glycersol, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, and CompleteTM) at distinct times, and the lysates were analyzed by Western blot using antibodies against FAK, PYK2, paxillin, calnexin (BD Transduction Laboratories), P130cas, c-Src, DDR 1 (Santa Cruz Biotechnology), vinculin, talin (Biogenesis), and phosphotyrosine (4G10; from Upstate Biotechnology), and by use of an enhanced chemiluminescence (ECL) system (Amersham Biosciences).
RT-PCRTotal RNA of the cells was extracted by a Trizol commercial kit (Invitrogen). For RT-PCR, first-strand cDNA was synthesized from 0.21 µg of total RNA with an oligo-dT primer and the Moloney murine leukemia virus (MMLV) reverse transcriptase (Promega). The following primers from conserved regions of different species for FAK are FAK F (5'-GTAGTGAGCCAACCACCTGG-3') and FAK R (5'-GCCCTTGTCTGTCAGGTAAC-3'). The resulting PCR product was 370 bp. Talin primers are TAL F (5'-GAAATTGAGGCCAAGGTCCG-3') and TAL R (5'GCCTTCAGTCGTCTGTACTG3'). c-Src primers are SRC F (5'-AGCTGGTGGAGCACTACACC-3') and SRC R (5'-CCCCTTGGCCATGTACTCTG-3'). GAPDH primers are GAPDH F (5'-ACGGCACAGTCAAGGCTGAG-3') and GAPDH R (5'-GGAGGCCATGTAGACCATGAGG-3'). The PCR protocol was performed with the FAK, talin, or c-Src primers at 94 °C for 2 min, 53 °C for 30 s, and 72 °C for 1 min (35 cycles), followed by 72 °C for 10 min. The PCR protocol was performed with the GAPDH primer at 94 °C for 2 min, 58° for 1 min, and 72° for 1 min (25 cycles), followed by 72° for 10 min.
Measurement of Protein Synthesis RatesMDCK cells were cultured on dish, collagen gel-coated dish, or collagen gel for 3, 7, 17, or 23 h. Cells were serum starved for 1 h and treated with medium containing [35S]methionine (1 µCi/ml) for another 1 h. Cellular proteins were then precipitated by chilled 10% trichloroacetic acid, and the precipitates were solved in 0.5 N NaOH. The radioactivities were measured by -counter.
Cloning and Selection of Stable Clone of DDR1 in MDCK CellThe DDR1 construct was produced by PCR amplification of the full-length DDR1b cDNA generated by the RT-PCR method using total RNA of the A431 cell as template. The 2.8-kb EcoRI-XbaI fragment of the PCR product was ligated to the plasmid pcDNA3.1 that contained a 3'-Myc epitope. To generate the carboxyl-terminal truncated DDR1 construct, the DDR 1 construct was digested by XhoI and XbaI, followed by treatment with the Klenow enzyme and ligase to generate the carboxyl-terminal truncated clone that encoded 524 amino acids. The truncated DDR1b clone was cloned into a pcDNA 3.1 plasmid. The plasmid containing DDR1b or truncated DDR1 was transfected into MDCK clone II 3B5 and selected by G418.
Immunofluorescence and Confocal StudyMDCK cells cultured on dish, collagen gel coated dish, or collagen gel for 4 h were washed three times with phosphate-buffered saline (PBS) and fixed using 4% paraformaldehyde prepared in PBS for 20 min at room temperature. Cells were then washed three times in PBS and permeabilized with 0.5% Triton X-100 in PBS for 10 min at room temperature and then incubated with anti-FAK monoclonal Ab for 1 h. Cells were then washed and incubated with Alexa Fluor 488-conjugated goat anti-mouse Ab (Molecular Probes) and phalloidin-TRITC (from Sigma) for 1 h. The immunofluorescent images were taken by confocal microscopy (Leica, TCS-SP2).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
To clarify whether collagen gel-induced selective decrease of focal adhesion complex proteins is a general phenomenon, we employed nine different cell lines representing normal epithelial cells (MDCK, LLCPK1, NRK52E), transformed/cancer cells (Change Liver, HeLa, TCCSUP, and U373MG), and fibroblasts (3T3 and 293). These cells were on a dish, collagen gel-coated dish, or collagen gel for 24 h, and their proteins in focal adhesion complex were analyzed by Western blot. We found that collagen gel induced a selective decrease in FAK, talin, PYK2, p130cas, and paxillin in all of the cell lines examined (Fig. 2). These focal adhesion complex proteins remained unchanged when the cells were cultured on dish or collagen gel-coated dish, consistent with our notion that the collagen gel-induced decrease of focal adhesion complex proteins is regulated by the physical property of collagen gel.
|
Matrigel Also Induced Down-regulation of Focal Adhesion Complex ProteinsTo understand whether the components of a basement membrane might exert similar effects, we employed matrigel. We cultured MDCK cells on a matrigel-coated dish or on matrigel for 4 h and analyzed the changes of focal adhesion complex proteins. MDCK cells cultured on a matrigel-coated dish showed relatively retracted cell shape, and on matrigel they exhibited completely round-up morphology (Fig. 3A). The Western blot results showed that focal adhesion complex proteins were selectively decreased when MDCK cells were cultured on matrigel but remained unaltered when they were cultured on a matrigel-coated dish (Fig. 3B). These data indicate that down-regulation of focal adhesion complex proteins induced by collagen gel and matrigel is controlled by the physical property of gel, i.e. substratum rigidity.
|
In addition, we tested the effects of agarose gel (0.54%) on the expression of focal adhesion proteins. In our experience, the rigidity of agarose gel at a concentration as low as 0.5% is still higher than that of collagen gel of any concentration. For experiments of this purpose, agarose gel was coated with 0.3% collagen gel to ensure cell attachment. We found that cells cultured on agarose gel displayed spreading morphology regardless of the concentration of agarose gel (Fig. 3C). Meanwhile, focal adhesion complex proteins remained unchanged in cells cultured on agarose gel of any concentration (Fig. 3D). These data indicate that a threshold might be required for the substratum rigidity-regulated expression of focal adhesion complex proteins. However, the threshold of rigidity that causes down-regulation of focal adhesion complex proteins remains to be defined.
Collagen Gel-induced Down-regulation of Focal Adhesion Complex Proteins Is Mediated by Post-transcriptional MechanismTo delineate whether the collagen gel-induced decrease in focal adhesion complex proteins is mediated by transcriptional regulation, we cultured MDCK cells on a dish, a collagen gel-coated dish, and collagen gel and analyzed the mRNA levels of FAK, talin, and c-Src by RT-PCR. We found that mRNA levels of FAK, talin, and c-Src were not changed by collagen gel (Fig. 4A), suggesting that the collagen gel-induced decrease of focal adhesion complex proteins is regulated through a post-transcriptional mechanism. We then measured protein synthesis rates by assessing the ratio of [35S]methionine incorporation into protein. As shown in Fig. 4B, collagen gel resulted in a significant decrease of total protein synthesis rates within 4 h. To examine whether the collagen gel-induced decrease in focal adhesion complex proteins is mediated by activation of proteases, we pretreated MDCK cells with different protease inhibitors for 1 h, then cultured the cells on collagen gel for 4 h in the presence of protease inhibitors, and analyzed their focal adhesion complex proteins. The results showed that the calpain inhibitors, ALLN and calpeptin, partially prevented the collagen gel-induced decrease in FAK, talin, and p130cas (Fig. 4C). Taken together, these data indicate that the collagen gel-induced lower expression of focal adhesion complex proteins is mediated by the reduction of protein synthesis rates and the activation of proteases.
|
To visualize whether focal adhesion complex proteins were actually diminished by collagen gel, we employed immunofluorescence studies. MDCK cells were cultured on a dish, a collagen gel-coated dish, and collagen gel for 4 h, fixed by paraformaldehyde, and stained with phalloidin-TRITC and anti-FAK antibody. Their stress fibers, cortical actin, and focal adhesions were observed under a confocal microscope. MDCK cells exhibited normal stress fibers and cortical actin as well as a regular pattern of focal adhesions when cultured on dish and collagen gel-coated dish. However, collagen gel resulted in a marked decrease in both focal adhesions and stress fiber (Fig. 5).
|
Collagen Gel-induced Down-regulation Is Mediated by 2
1 Integrin but Not DDR1Collagen fibrils may exert their effects via two separate receptor systems, integrin and DDR1 (21, 23, 24). To delineate how the physical property of collagen gel transduces signals into cells, we performed stable transfection of DDR1 and its dominant negative mutant in MDCK clone 3B5 cells. We established several stable transfectants that overexpressed the control plasmid, wild type DDR1, or the C-terminal truncated mutant of DDR1. As shown in Fig. 6A, both 3B5 cells and the control transfectant (PC11) exhibited endogenous DDR 1. D-1 and D-9 overexpressed DDR1, whereas N-36 and N-38 overexpressed truncated DDR1 as detected by the anti-Myc antibody. There was a basal level of DDR1 phosphorylation in both PC-11 and D-9 cells even in the absence of collagen. Upon stimulation of soluble type I collagen (200 µg/ml) for 2 h, the PC-11 cell did not show further activation of DDR1 phosphorylation, but D-9 cells exhibited marked activation of DDR1. Both N-36 and N-38 clones exhibited little phosphorylation of DDR1 regardless of the presence of soluble collagen, indicating that the truncated DDR1 can be used as a dominant negative mutant (Fig. 6B). To determine whether the
2
1 integrin or DDR1 is involved in collagen gel-induced down-regulation of focal adhesion complex proteins, we cultured these DDR1 transfectants on collagen gel with or without the anti-
2
1 integrin antibody (5E8) (26) for 4 h. As shown in Fig. 6C, D-9 cells showed a more round-up morphology when cultured on a collagen gel-coated dish or a collagen gel than the PC-11 control cells. In contrast, N-38 cells were more flattened when cultured on a collagen gel-coated dish or a collagen gel than PC-12 and D-9 cells. On the other hand, 5E8 markedly reduced the extension of either PC-11 or N-38 cells cultured on a collagen gel. These morphological data suggest that the functions of
2
1 integrin and DDR1 are opposite, with the former causing cell extension and the later triggering retraction. As shown in Fig. 6D, overexpression of wild type or dominant negative DDR1 did not alter collagen gel-induced down-regulation of FAK, PYK2, and p130cas. However, 5E8 could alleviate a collagen gel-induced decrease in levels of FAK, PYK2, and p130cas in all of these transfectants. These data indicate that collagen gel-induced down-regulation of focal adhesion complex proteins is mediated by
2
1 integrin, but not DDR1.
|
Integrins play important roles in transducing mechano-signals in various cell types (27). The mechano-stress applied through integrin-specific adhesion sites may trigger tyrosine phosphorylation of integrin downstream signaling proteins and result in cytoskeletal stiffening (28, 29). In addition, Wang et al. (30) found that focal adhesion kinase is involved in mechanosensing during fibroblast migration. To understand whether FAK is involved in the collagen gel-induced decrease of focal adhesion complex proteins, we employed 3B5 cells transfected wild type FAK and the endogenous FAK inhibitor, FAK-related non-kinase (FRNK) (31). These cells were cultured on a dish, a collagen gel-coated dish, and a collagen gel for 4 h, and the focal adhesion proteins were assessed by Western blot. We found that overexpression of either FAK nor FRNK could alter the collagen gel-induced decrease of focal adhesion complex proteins, suggesting that FAK is not involved in this process (Fig. 7). Taken together, these results indicate that the collagen gel-induced decrease expression of focal adhesion complex proteins is mediated by 2
1 integrin without the involvement of FAK.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We showed that cells cultured on collagen gels did not spread well and displayed reduced stress fibers as well as down-regulation of focal adhesion proteins. It should be of interest to ask whether the observed changes could be due to a lack of spreading rather than the gel per se. In this study, collagen gel induced down-regulation of focal adhesion proteins in all of the cell lines examined. However, collagen gel-induced reduction on cell spreading was not observed in all lines. For example, collagen gel did not block cell spreading in 293 or TCCSUP cells. On the other hand, cells cultured on a matrigel-coated dish and cells overexpressing DDR1 both showed limited cell extension, but their focal adhesion proteins remained intact, and the levels of these proteins were unaltered (Fig. 3, AD). In Fig. 6, C and D, D-9 cells show reduced spreading on a normal culture dish as well as a collagen gel-coated dish, but they display intact focal adhesion complex proteins. In addition, we also examined whether reduced cell extension by deprivation of cell-matrix interactions affected expression of the focal adhesion complex. The result showed that cells cultured on albumin- or poly(2-hydroxyethyl methacrylate)-coated dishes exhibited intact FAK, despite the fact that they could not adhere, and they spread and gradually underwent apoptosis (data not shown). Taken together, collagen gel-induced down-regulation of focal adhesion proteins may not be mediated through the inhibition of cell spreading.
We showed that collagen gel-induced down-regulation of focal adhesion proteins was in part mediated by reduction of protein synthesis. These data are consistent with the previous study that demonstrated that collagen gel caused decreased protein synthesis in cultured fibroblasts within 1 day (32). We also showed that cysteine protease calpain was involved in collagen gel-induced down-regulation of focal adhesion complex proteins. Carragher et al. (33) found that degraded collagen induced proteolysis of FAK, talin, and paxillin by activating a cysteine protease calpain. It is possible that collagen gel may induce activation of matrix metalloprotease (MMP), which cleaves collagen fibrils, and that the degraded collagen thereby triggers activation of calpain. However, this possibility could be ruled out because cells cultured on a collagen gel-coated dish did not display down-regulation of focal adhesion proteins. In addition, a collagen gel-induced decrease in focal adhesion complex proteins occurred within half an hour in culture. It is therefore less likely that collagen gel-induced decrease in focal adhesion complex proteins is caused by degradation of collagen in this case.
The biomechanical regulatory mechanism exerted by collagen gel in MDCK cells is mediated by 2
1 integrin but not DDR1. Previous studies showed the focal adhesion might be a potential mechano-sensor (34). In endothelial cells, shear stress-dependent signals are mediated by
v
3 and
5
1 integrins (27). In addition, stretching of the substratum promotes the assembly of focal adhesions (30, 35) and triggers integrin-dependent signaling (36). These data indicate that integrins play important roles in mediating biochemical as well as biomechanical stimuli. In this study, we demonstrate that FAK is not the downstream mediator of integrin for rigidity-regulated focal adhesion complex expression. Recent studies suggest that, besides FAK, integrin-linked kinase and caveolin-1 also play roles in integrin downstream signaling (37). In addition, mechanosensitive protein kinases have been proposed to reside in the caveolae located in the plasma membrane of the endothelium (38). These possibilities remain to be elucidated.
Because focal adhesion complex proteins play very important roles in cell migration and survival as well as proliferation, it is of interest to speculate why the mature kidney does not require the expression of intact focal adhesion complex proteins. Once the nephrogenesis is completed, there is little sign of cell proliferation or migration in kidney. Thus, the requirement of focal adhesion complex proteins in mature kidney is dampened. Besides, although focal adhesion complex proteins can provide anti-apoptosis functions (16, 39), mature kidney epithelial cells may have other survival machinery. Several lines of evidences showed that collagen fibril is associated with inhibition of cell proliferation. It was found that fibril collagen inhibited cell proliferation by increasing p27 expression as well as inhibition of the expression of cyclin D1 and cyclin E-associated kinase activity (4042). In addition, 2
1 integrin mediated fibril collagen-induced inhibition of cell growth (40, 41). In our study, we also observed that cells cultured on collagen gel exhibited markedly lower growth rates than cells on collagen-coated dishes (data not shown). Because FAK is involved in cell cycle progression (43, 44), it is therefore likely that collagen gel-induced cell growth inhibition may be mediated by the down-regulation of focal adhesion complex proteins.
This study should facilitate our understanding of how substratum rigidity controls cell behaviors through an important biomechanical regulatory mechanism. For example, Pelham and Wang (45) found that plating the cells on the flexible substrate could not form stable focal adhesions as reflected by the significant lower extent of tyrosine phosphorylation of FAK and paxillin. From our results, we can speculate that the flexible substrate may down-regulate the expression of focal adhesion proteins and thereby hinder the formation of focal adhesions as well as the phosphorylation of FAK and paxillin. On the other hand, down-regulation of focal adhesion complex proteins may contribute to a reduction of the binding of actin microfilament and thereby cause disruption of stress fibers, which may result in a marked decrease in the intracellular tension. Taken together, our data provide a novel biomechanical signal mechanism that links the substrate rigidity to the regulation of focal adhesions. The role of intracellular tension during this process remains to be examined.
![]() |
FOOTNOTES |
---|
|| To whom correspondence should be addressed. Tel.: 886-6-2353535 (ext. 5425); Fax: 886-6-2362780; E-mail: mjtang1{at}mail.ncku.edu.tw.
1 The abbreviations used are: ECM, extracellular matrix; FAK, focal adhesion kinase; DDR1, discoidin domain receptor 1; MDCK, Madin-Darby canine kidney; DMEM, Dulbecco's modified Eagle's medium; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered saline; Ab, antibody; TRITC, tetramethylrhodamine isothiocyanate; PYK2, proline-rich tyrosine kinase 2; FRNK, FAK-related non-kinase.
2 C.-C. Wu, Y.-H. Wang, M.-J. Tang, and H.-C. Chang, unpublished observations.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|