From the Dipartimento di Biologia Animale,
Università di Modena e Reggio, Via Campi 213/d, 41100 Modena, Italy and § Medizinische Klinik II,
Max-Bürger-Forschungszentrum, Universität Leipzig,
Johannisallee 30, D-04103 Leipzig, Germany
Received for publication, October 1, 2002, and in revised form, December 10, 2002
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The CCAAT box is one of the most common elements
in eukaryotic promoters and is activated by NF-Y, a conserved trimeric
transcription factor with histone-like subunits. Usually one CCAAT
element is present in promoters at positions between The CCAAT box is a widespread promoter element that is present in
many, if not most eukaryotic promoters (1); in the vast majority of
promoters, it is located in either orientation between Coactivators are a large and heterogeneous family of non-DNA-binding
proteins that make use of the platforms represented by DNA binding
factors to access promoters. In general, coactivators are thought to
serve as a bridge for transcription factors and holoenzyme
interactions, having been recruited to promoters through activation
domains. Many coactivators, such as CBP/p300, PCAF, GCN5,
possess an enzymatic activity, histone acetyltransferase, that adds an
acetyl group to lysines of the N-terminal ends of the core histones
(7). The enzymatic activity is apparently essential for activation
function in many, but not in all systems tested (8-10). In addition to
histones, coactivators also target transcription factors, influencing
different aspects of their functions, such as DNA binding affinity,
nuclear localization, or retention (for review, see Ref. 11). The role
of p300/CBP in control of cell growth and differentiation has been
studied in many systems (12). p300/CBP exerts a profound effect on cell cycle control, as exemplified by the finding that E1A mutants that
cannot bind to p300 exhibit defective cellular transformation (13). The
p300/CBP·PCAF protein complex might regulate target genes that
are involved in controlling the G1/S transition, such as
p21WAF1 (14). The overexpression of E1A, whose binding to
p300/CBP antagonizes PCAF association, drives cells into S phase (15). p300 Because NF-Y is important for the activation of many promoters, it was
natural that connections between this factor and coactivators emerged.
Affinity columns identified interactions of the histone-fold motif
subunits with human GCN5 (17); NF-Y-PCAF interactions mediate the
potent activation of the multi-drug resistance-1 promoter upon
treatment of human cells with trichostatin A, and binding to
p300 activates the HSP70 promoter in Xenopus oocytes in the absence of heat shock or the addition of heat shock factor-1 (18, 19).
Among the many genes activated by NF-Y, an emerging class is
represented by those regulated differently during the cell cycle,
particularly in the G2/M phase. Key regulators such as CDC25A/B/C, cyclin B1/B2, Cdc2, and topoisomerase II Cyclin B is a central regulator for progression from G2 to
mitosis. It associates with the Cdc2 cyclin-dependent
kinase 1 and thereby regulates phosphorylation of target proteins (27). Complex formation between cyclin B and Cdc2 is essential for
G2/M transition. In mammalian cells cyclin B exists in two
isoforms, cyclin B1 and cyclin B2 (28). We have previously analyzed
expression from the cyclin B2 promoter and found NF-Y to be the major
activator (21). Cell cycle-dependent transcription is
mediated by a CDE-CHR repressor element (29). Three NF-Y binding
CCAAT boxes in the proximal promoter spaced 33-bp apart are responsible
for more than two-thirds of the total activity of the cyclin B2
promoter. A large difference in affinity to NF-Y was detected among
these three CCAAT elements, with the proximal Y3 binding NF-Y with very low affinity, yet they all equally contributed to the full
transcriptional activity of the promoter (21). This raised the
possibility that NF-Y binding is cooperative, either directly, through
interactions with intermediate factors such as coactivators, or else
that another factor, for which there is no evidence at the moment,
might bind and activate Y3. To solve this matter, we present data that
dissect the interplay between NF-Y and p300.
Analysis of Mutants with Changed Spacing between CCAAT
Boxes--
Plasmids derived from the firefly luciferase-expressing
wild type cyclin B2 promoter construct B2-Luc (21, 29) were created by
PCR-based targeted mutagenesis yielding constructs with insertions or
deletions between different CCAAT boxes: Y1-2Plus,
CCAATCAACGTGCAGAAAGGCTCGAGCTTCCAGTCTAGCCAATGGGTTGCGCGCGCCCTGCGTGCGTCTACCCAAT; Y1-2Del,
CCAATCAACGTGC
Transfections and luciferase activity assays to compare wild type with
the above mutant reporters were done by lipofection with FuGENE 6 (Roche Molecular Biochemicals) as previously described (21). NIH3T3
cells (AC 59; Deutsche Sammlung von Mikroorganismen und Zellkultur,
Braunschweig, Braunschweig, Germany) were transfected with 1 µg of B2-Luci wt or mutant plasmids and with 0.02 µg of pRL-null
vector (Promega). Transfection efficiencies were normalized by the
pRL-null cotransfection and by using Renilla luciferase expression assayed with the dual luciferase system (Promega). The
activities of promoter mutants represent averages of nine assays, which
were standardized as described (21). SaOS-2 cells (ACC 243, from DSMZ)
were cultured as previously described (30). The CMV-p300 expression
plasmid was generously provided by Antonio Giordano. Cells were
transfected using 0.8 µg of B2-Luci wt or mutant reporter with 0.016 µg of pRL-null and 2.4 µg of CMV-p300 or pcDNA3.1 His C
(Invitrogen) plasmids to keep the total DNA amount constant.
Transfections and Renilla luciferase standardization were
done as described above.
Protein Purification, EMSAs, and Footprinting--
NF-Y
subunits, wt and mutants, were produced in Escherichia coli
and purified on nickel nitrilotriacetic acid columns (Sigma) as in
Liberati et al. (30). His-tagged p300 was produced in Sf9 cells and purified through nickel nitrilotriacetic
acid-agarose affinity columns. 32P-Labeled fragments
containing the core cyclin B2 promoter ( Chromatin Immunoprecipitations--
Formaldehyde cross-linking
and chromatin immunoprecipitation were performed as described in Wells
et al. (31), with the following modifications. NIH3T3 cells,
serum-starved for 48 h and restimulated for 6, 12, 18, and 24 h, were fixed for 10 min with 1% formaldehyde; after quenching the
reaction with 0.1 M glycine, the cross-linked material was
sonicated to 500/800-bp fragments. Immunoprecipitations were performed
with protein G-Sepharose (Kirkegaard & Perry Laboratories,
Inc.) and 3 µg of the YB-purified rabbit polyclonals,
anti-p300 (Santa Cruz SC-585X) and anti-LBP1 control. The
chromatin solution was precleared by adding protein G-Sepharose for
2 h at 4 °C, separated into aliquots, and incubated with the
antibodies overnight at 4 °C with mild shaking. Before use, protein
G-Sepharose was blocked twice with 1 µg/µl salmon sperm DNA sheared
at 500-bp lengths and 1 µg/µl bovine serum albumin, first for
2 h at 4 °C and then overnight. PCR amplifications were performed with the following primers: cyclin B2 coding,
5'-TGTAGACAAGGAAACAACAAAGCCTGGTGGCC, and noncoding, 5' CAGCCACTCCGGTCTGCGACA.
p300 Is Bound to the Cyclin B2 Promoter in Vivo--
The chromatin
immunoprecipitation (ChIP) technique is a valuable system to detect the
binding of transcription factors and coactivators to promoter
sequences. We immunoprecipitated chromatin derived from exponentially
growing NIH3T3 cells with anti-NF-YB, anti-NF-YC, and anti-p300, and
PCR amplifications with cyclin B2-specific oligonucleotides detected
the target promoter in the NF-Y immunoprecipitations (not shown); this
is expected from the previously detected in vitro binding of
NF-Y to the CCAAT boxes and activity of the NF-YA dominant negative
vector (21). Next we wished to determine the association of NF-Y and
p300 to the cyclin B2 promoter during the cell cycle. NIH3T3 cells were
serum-starved and restimulated. Chromatin was prepared at different
time points from these cells, and ChIPs were performed. Fig.
1 shows that G0 cells have no
NF-Y or p300 on the promoter. The two proteins do not associate with
the cyclin B2 promoter until after 18 h of restimulation, when
most cells are completing S phase and cyclin B2 expression starts. At
24 h, where most cells are in G2/M, NF-Y and p300 are
still largely bound. As a control for earlier time points, we checked a
promoter, JunB, which is rapidly induced by serum, and found NF-Y and
p300 bound in G0 cells (Data not shown). We conclude that
NF-Y and p300 association to the cyclin B2 promoter is regulated during
the cell cycle, positively correlating with transcriptional activation
of the gene.
Transcriptional Activation of the Cyclin B2 Promoter by
p300--
Because of the p300 interactions with the cyclin B2 promoter
observed in ChIP assays in vivo, we decided to investigate
their role in the transcriptional regulation of this gene. We
cotransfected a p300 expression vector and the cyclin B2-luciferase
reporter (21) in NIH3T3 cells. In reporter assays we observed a
reproducible, although not spectacular, activation of transcription
(Fig. 2A) that is well in line
with numerous reports of similar experiments performed in other
promoter systems (8-10). To verify the CCAAT dependence of the p300
activation, we used several mutant constructs with alterations in the
Y1, Y2, and/or Y3 pentanucleotides described previously (21): Fig.
2A shows that compared with the wt cyclin B2, all
mutant constructs are variously crippled in transcription and, most
importantly, in p300 activation. In particular, mutation of the Y1/Y2
high affinity NF-Y sites and change of the all three Y1-3 boxes are
essentially refractory to the activity of p300 overexpression.
Additionally, mutation of Y3, which is a poor NF-Y binding site, is
also severely down in p300-stimulated transcription.
It is well known that correct spacing between different transcription
factors is a crucial aspect in promoter proficiency. The three CCAAT
boxes of the cyclin B2 promoter are aligned, with a conserved spacing
of 33 base pairs between them. Because the presence of all three CCAAT
boxes is important for optimal transcription and for p300 activation,
we figured that cyclin B2 transcriptional regulation represents a good
system to study the role of activator alignment for p300 function. The
distance between the three CCAAT sites is 33 base pairs, which
represents an almost perfect alignment of the three binding elements on
the same side of the double helix. We derived a set of mutants in which
the spacing between Y1/Y2 and Y2/Y3 was altered, either by eliminating
10 base pairs, 1 turn of the double helix, or adding 5 base pairs. In
the first case one expects to be at the limit of simultaneous
NF-Y/CCAAT binding, based on experiments performed on the double CCAAT
boxes of the human Association of p300 to Multiple NF-Y/CCAAT Complexes--
The
results obtained with in vivo assays prompted us to set up
an in vitro system with recombinant proteins to dissect the interplay between p300 and the NF-Y binding to the three CCAAT boxes in
the cyclin B2 promoter. Recombinant NF-Y proteins were purified from
E. coli, and p300 was purified from baculovirus. These
reagents were employed in EMSAs. It should be noted that NF-Y-p300
direct interactions in solution were described in Xenopus (18), but we found no evidence of such interactions under our immunoprecipitation
conditions.3
Initially, we wished to test the possibility that p300 directly binds
to DNA-bound NF-Y. A cyclin B2 fragment of 200 base pairs containing
the three Y boxes was labeled and used with increasing amounts of NF-Y
in the absence or presence of 20 ng of p300 (Fig. 3A, lanes 1-4 and
5-8, respectively). As expected, multiple bands are
generated with NF-Y, corresponding to the formation of complexes with
one, two, or three trimers bound to the Y boxes (see
below). Two types of information were manifest from this
experiment. (i) At high NF-Y concentrations a slow migrating complex is
observed only in the presence of p300 (compare lanes 4 and
8); (ii) at low NF-Y concentrations the addition of p300
induces an increase of double CCAAT binding (compare lanes 2 and 3 with lanes 6 and 7). In
parallel, the same amount of proteins was incubated with probes of
identical lengths containing mutations in either Y1 and Y2 (Fig.
3A, lanes 9-17) or all three CCAAT boxes (Fig.
3A, lanes 17-24). With the Y1/Y2m probe a single
band was generated only at high NF-Y concentrations, representing a
single NF-Y bound to the low affinity Y3. This complex is not affected
by the addition of p300. With the Y1/Y2/Y3m probe, no interaction was
observed in the presence or absence of p300 even at high NF-Y
concentrations. To verify the effect of p300 addition, we performed
supershift EMSAs; as shown in Fig. 3B, formation of the
upper, slow migrating complex was partially inhibited by the addition
of anti-p300 antibodies, with the appearance of the non-p300 complexed
NF-Y single and double complexes (compare lane 4 with
lane 2). A the same time, the addition of anti-p300 had no
effect on the NF-Y complexes, much like an irrelevant anti-Gata
antibody on the NF-Y·p300 complexes (Fig. 3B, lanes
3 and 5). Having detected a complex of discrete mobility between NF-Y and p300 on the wt cyclin B2 probe, we used a
recombinant NF-Y trimer deleted of domains outside of the homology domains of NF-YA/B/C: Fig. 3C shows that unlike wt NF-Y,
which can be bound by p300, the YA9-YB4-YC5 mutant (33, 34) is
incapable of doing so.
Taken together these results indicate that a complex can be formed
in vitro between NF-Y and p300 provided that (i) multiple CCAAT boxes are present and bind the bridging NF-Y, and (ii) domains outside the histone-fold motifs of NF-YB-NF-YC and the conserved part
of NF-YA are present. Binding of p300 apparently favors NF-Y-DNA interactions.
Lack of Cooperativity of the NF-Y·p300 Complex--
Our analysis
on the double CCAAT box of the
One possibility to explain the transfection data of Fig. 2
could be that cooperativity is mediated by p300. We therefore performed the same type of off-rate EMSAs in the presence of p300 using as a
competitor a long oligonucleotide comprising the Y1-Y2 boxes (Fig.
4C, lanes 1-8) or a Y1 oligonucleotide (Fig.
4C, lanes 9-16). Results indicate that the
addition of the coactivator had no effect on the stability of the
NF-Y·p300 or NF-Y triple, double, or single complexes using
the Y1-Y2 competitor (compare lanes 1-4 with
5-8). Using the short Y1 oligonucleotide as competitor, no
effect was observed on the triple complexes, whereas a modest effect is
observed on the double complex (compare lanes 13-16 with
9-12). Most likely this is due to the less efficient
competition of the single CCAAT oligonucleotide compared with the
double CCAAT boxes. Collectively, these results argue against the
idea that multiple NF-Ys with or without p300 are capable of forming
higher order complexes that bind DNA cooperatively in
vitro.
EMSA and Footprinting Analysis of Distance Mutants between Y
Boxes--
The functional data on the distance mutants shown in Fig. 2
lead us to analyze the role of spacing on NF-Y interactions with and
without p300. Initially, we verified the NF-Y binding capacity in EMSA
experiments with probes containing the alterations described in Fig. 2.
Results in Fig 5 show that, with the
exception of Y1-Y2Del, all other mutants showed normal interactions
with NF-Y. The apparent difficulty in forming double CCAAT box-NF-Y
complexes observed with the latter mutant (Fig. 5, compare lane
3 with 1) was not unexpected, because the distance
between Y1 and Y2 becomes 23 base pairs, which is the lower limit for
simultaneous NF-Y binding (30).
Next we switched to footprinting analysis of these five
probes after incubation with NF-Y and p300 (Fig.
6). Panel A shows that
increasing concentrations of NF-Y progressively protects Y1 and Y2, but
hardly Y3 (Fig. 6A, lanes 1-4). However, in the presence of p300, protections over Y2 and Y3 are observed already at
lower NF-Y concentrations (Fig. 6A, compare lanes
2-4 with lanes 5-7). Furthermore, protection of Y3 is
only observed with p300 (Fig. 6A, compare lanes 4 and 7). In addition to CCAAT protections, NF-Y and
NF-Y·p300 also generated hypersensitive sites at the 5' of Y1,
between Y1 and Y2 and between Y2 and Y3. Note that p300 alone was
incapable of DNA binding (Fig. 6A, compare lanes
1 and 8 with lane 7). The same set of
experiments was performed on the four mutant promoters; Fig.
6B shows the Y1-Y2Del probe, with weaker protections over
Y2, no protection on Y3, and absence of hypersensitive sites between
Y1-Y2 and Y2-Y3. On the other hand, the binding on Y1 is apparently
normal (Fig. 6B, compare lanes 1-3 and
4-6 with lane 8). Fig. 6C shows the
1-2Plus probe, which has essentially wt-like patterns of
NF-Y protections and hypersensitive sites, with a decrease of the
hypersensitive site between Y2-Y3 (compare lanes 1-4 in
Fig. 6A with lanes 1-4 in Fig. 6C);
the addition of p300 has negligible effects on Y1 or Y2 binding but clearly decreases Y3 interactions (Fig. 6C, lanes
5-7 and 9). With the Y2-3Del probe, binding of Y3 and
to a lesser extent Y2, but not Y1, is decreased; the Y2-3
hypersensitive site is also abolished (Fig. 6D). Finally,
with the Y2-3Plus, binding of Y1 and Y2 is normal as well as the Y1-2
hypersensitive site, but Y3 binding is negligible; the addition of p300
has essentially no effect on NF-Y binding on Y3 but has a modest effect
on Y2 (Fig. 6E, compare lanes 2-4 with
5-7). Altogether, these results indicate p300 acts
on NF-Y bound to Y1 and Y2 to increase the otherwise very low affinity
for the Y3 CCAAT; alterations of the correct spacing between the Y1-Y2
or Y2-Y3 CCAAT boxes abolish the p300-facilitation effect.
In this study we investigated the relationship between NF-Y and
p300 on the cyclin B2 promoter that is active in the G2/M phase of the cell cycle. We found that p300 activates in a manner that
requires a precise spacing between the three CCAAT boxes. Indeed, NF-Y
and the coactivator are bound to the promoter in vivo in a
cell cycle-dependent way. In vitro the order of
binding of three NF-Y protein complexes is Y1 > Y2 NF-Y Binding to Multiple CCAAT Boxes--
A recent analysis
of 1031 human promoters indicated that the CCAAT box is
present in 65% of them (1). We have catalogued >500 CCAAT promoters
regulated by NF-Y and found that the majority contain only one CCAAT
box, either in the forward or reverse orientation. In general, NF-Y
cooperates with neighboring factors to regulate gene expression. In
inducible systems, such as those of the heat shock, endoplasmic
reticulum stress response, and genes involved in cholesterol
metabolism, NF-Y teams up with heat shock factor, ATF6, and sterol
regulatory element binding protein. In the major histocompatibility complex class II genes setting, NF-Y cooperates with
the regulatory factor X box trimer (Ref. 3 and references therein; Refs. 18 and 34). The mechanism of the cooperative effect has
been studied and, baring the NF-Y-C/EBP connections on the albumin
promoter, in all other cases NF-Y mediates a profound increase in
DNA-binding affinity of the neighboring factor.
Alterations in the spacing between the CCAAT boxes and nearby sites
provoke a decrease and sometimes abolition of the activation potential.
In cell cycle-regulated promoters, NF-Y is essential for the timing of
activation (35, 36) and repression (37, 38). In the case of
G1/S promoters, NF-Y cooperates with E2Fs; in
G2/M promoters NF-Y binding CCAAT boxes are found near the CDE-CHR element (29, 37-39).
Biochemically, it is unclear at what level the cooperation is
exerted. Many cell cycle promoters are peculiar in that they contain at
least two and sometimes more NF-Y binding sites, in particular in
promoters of key G2/M cell cycle regulators Cdc2,
topoisomerase II
Bending and phasing assays revealed that NF-Y distorts and rotates DNA
in a way that is reminiscent of histones bound to DNA in the
nucleosomal structure (30, 39, 40). The stunningly slow off-rates
observed in this study are a premiere for sequence-specific transcription factors and can only be compared with the highly stable
nucleosomal structures. Indeed, two of the NF-Y subunits, NF-YB and
NF-YC, have histone-like features, as predicted from amino acid
alignments, o-phenanthroline footprinting, and
structure-function analyses and, most importantly, as detailed by
recent crystallographic studies (41). A spacing of 32/33 nucleotides,
thereby an alignment on the same side of the double helix, is in
keeping with three CCAAT boxes forming a heminucleosomal structure, as
indicated by Fig. 7. The minimal platform
recognized by coactivators is likely to be NF-Y binding to Y1 and Y2,
with additional contacts made on Y3 once p300 has been recruited onto
the promoter.
Activity of p300 on Cell Cycle Promoters--
p300/CBP proteins
are coactivators involved in the activation of a large number, if not
all, the polymerase II-transcribed genes. In particular, p300 and CBP
are targets of the adenovirus E1A oncoprotein; their role in cell cycle
control has been shown by the finding that E1A mutants that cannot bind
to p300 exhibit defective cellular transformation (13). The
overexpression of E1A, which antagonizes PCAF binding to p300/CBP,
drives cells into S phase (14). E1A is also known to affect the binding
of pocket proteins to the E2F transcription factors that are associated with genes modulated in the cell cycle. Recent experiments on an
E2F-regulated promoter show that p300 is important for the cell
cycle-regulated expression of dihydrofolate reductase (42). The
p300/CBP·PCAF protein complex is believed to regulate target genes
that are involved in controlling the G1/S transition, such as p21WAF1 (15). Activity of p300/CBP has been studied in a
number of systems, with particular focus on their acetyltransferase
enzymatic activity. We find that the positive role of p300 on NF-Y
function is exerted through an increase in DNA affinity, mostly
observed on the weak Y3 binding site. To the best of our knowledge,
this is the first such demonstration for p300 binding on multiple sites for the same factor. Essentially three types of action are supposed to
be exerted by p300/CBP; (i) the protein serves as a platform, a bridge,
through which the direct interactions with multiple DNA binding
activators are supported; recruitment of p300/CBP stabilizes the
otherwise weak binding of these factors or even makes them possible. In
keeping with this, interactions of p300/CBP with many transcription
factors have been mapped in one and sometimes multiple subdomains of
the coactivators. Evidence for this mechanism is still largely
circumstantial, and the biochemical dissection of this mechanism on DNA
was obtained only on the
One important result that stems from the ChIP analysis is that the
cyclin B2 promoter is devoid of NF-Y and p300 in cells arrested in
G0, and the two activators become bound only in S-phase, when the gene starts to be activated. This was not obvious, considering the presence of NF-Y on the cyclin B1 promoter during mitosis, recently
described in HeLa cells (47). Moreover, other promoters are indeed
bound by NF-Y in G0 cells, suggesting
regulation of promoter selectivity in this phase. These data rule out
alternative scenarios that could have been envisaged; (i) p300 would be
absent from the promoter in G1 and early S, when the
promoter is silent, and be recruited in late S through interactions
with a pre-bound NF-Y, constitutively associated through the cycle;
(ii) it would be co-resident with the Y1-Y2 NF-Y throughout the cell
cycle and only become active in late S, to promote Y3 binding. Open
questions remain as to the regulation of NF-Y promoter association
through the cell cycle. It is possible that additional signals, most
likely post-translational modifications such as phosphorylations and acetylations, regulate this process.
A corollary to the model in Fig. 7 is represented by the
possibility that NF-Y binding to Y3 is transitorily regulated by p300
during the G2/M phase of the cell cycle; in vivo
footprinting analysis show a much stronger protection of these two
boxes in cycling cells as compared with Y3 (21). Unfortunately, the
ChIP technique does not allow us to discriminate the presence of two or
three molecules of NF-Y bound to cyclin B2 in vivo. With the present limitations of our assays it is not possible to tell whether one or more p300 molecules become associated with the promoter. Y3 is
positioned just downstream of the two major start sites of this
TATA-less promoter and in proximity of the CDE-CHR element recently
described (29), which is also protected in vivo. Therefore, it is likely that it represents a key point for regulation of interactions with the proteins binding to the CDE-CHR, whose elusive biochemical nature precludes further studies at the moment. At the same
time these elements may be an entry site for the general transcriptional machinery. It is also possible that the low affinity for NF-Y at Y3 has evolved by fluctuation of the sequences flanking CCAAT to create the possibility of an on-off system, less likely to
happen on high affinity sites such as Y1. This type of mechanisms might
not be restricted to the cyclin B2 promoter but rather a constant for
cell cycle and, in general, growth-regulated promoters.
60 and
100,
but an emerging class of promoters harbor multiple NF-Y sites. In the triple CCAAT-containing cyclin B2 cell-cycle promoter, all CCAAT boxes,
independently from their NF-Y affinities, are important for function.
We investigated the relationships between NF-Y and p300. Chromatin
immunoprecipitation analysis found that NF-Y and p300 are bound
to the cyclin B2 promoter in vivo and that their binding is
regulated during the cell cycle, positively correlating with promoter
function. Cotransfection experiments determined that the coactivator
acts on all CCAAT boxes and requires a precise spacing between the
three elements. We established the order of in vitro
binding of the three NF-Y complexes and find decreasing affinities from
the most distal Y1 to the proximal Y3 site. Binding of two or three
NF-Y trimers with or without p300 is not cooperative, but association
with the Y1 and Y2 sites is extremely stable. p300 favors the binding
of NF-Y to the weak Y3 proximal site, provided that a correct distance
between the three CCAAT is respected. Our data indicate that the
precise spacing of multiple CCAAT boxes is crucial for coactivator
function. Transient association to a weak site might be a point of
regulation during the cell cycle and a general theme of multiple CCAAT
box promoters.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
60 and
100
from the transcription start site (2). The importance of this element
has been outlined in innumerable functional assays, and indeed,
mutations affecting it have a profound negative effect on the function
of neighboring cis-acting elements. Electrophoretic mobility shift
assays (EMSAs)1 and
transfections with highly diagnostic dominant negative vectors for
NF-YA implicated NF-Y as the CCAAT activator in >500 mammalian promoters (2).2 NF-Y is
composed of three subunits, NF-YA, NF-YB and NF-YC, all necessary for
DNA binding (3). NF-YA and NF-YC possess large Q-rich domains that are
required for transcriptional activation. NF-YB and NF-YC are tightly
bound through histone-fold motifs, whose formation is required for
NF-YA association and sequence-specific DNA binding. Circular
permutation assays have clearly shown that NF-Y bends DNA and organizes
the three-dimensional architecture of promoters; it is understood that
NF-Y promotes the binding of neighboring trans-activators and makes
connections with TFIID, contacting several of the TAFIIs
(4). Moreover, NF-Y is able to interface with a well positioned
nucleosome on the major histocompatibility complex class II Ea promoter
and with a chromatin-reconstituted topoisomerase II
promoter (5,
6).
/
and cbp
/
knockout mice have
provided evidence that p300/CBP proteins are important for cell cycle
regulation and differentiation (16).
contain multiple CCAAT boxes in their promoters, invariably shown to be crucial
for the proper regulation of these genes (Ref. 2 and references
therein; Refs. 20-26).
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-TCCAGTCTAGCCAATGGGTTGCGCGCGCCCTGCGTGCGTCTACCCAAT; Y2-3Plus,
CCAATCAACGTGCAGAAAGGCCTTCCAGTCTAGCCAATGGGTTGCGCGCGCCCTGCTCGAGGTGCGTCTACCCAAT; Y2-3Del,
CCAATCAACGTGCAGAAAGGCCTTCCAGTCTAGCCAATGGGTTGCGCGCGC
TCTACCCAAT (insertions are shown in italics, deletions were indicated by a
).
All plasmids were purified with anion exchange columns (Qiagen). Mutants were confirmed by DNA sequencing of both strands.
129 to +47) obtained by PCR
were incubated under conditions described in Bolognese et
al. (21). In the EMSA shown in Fig. 3B, we used a
monoclonal anti-p300 antibody (purified mouse anti-p300 14991A was from
Pharmingen). For footprinting assays, the wt and distance mutant cyclin
B2 triple CCAAT fragments were incubated with NF-Y alone or in
combination with p300 (200-400 ng) under the same conditions as in the
EMSAs. After the addition of 5 mM CaCl2, samples were treated with DNase I, extracted with phenol/ether, precipitated, and analyzed.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (92K):
[in a new window]
Fig. 1.
Binding of p300 and NF-Y to the cyclin B2
promoter in vivo. Chromatin immunoprecipitations were
performed with NIH3T3 mouse fibroblasts using the indicated antibodies.
NIH3T3 serum-starved cells (G0) were used as well as cells
at 6, 12, 18, and 24 h post-restimulation by the addition of 10%
fetal calf serum. Ctl, control.
View larger version (30K):
[in a new window]
Fig. 2.
Activation of cyclin B2 by p300.
A, the schemes of the single, double, and triple CCAAT
mutants are represented on the left, which are the results
from reporter assays after transfection in NIH3T3 cells. B,
equivalent to the upper panel with distance mutants between
the three CCAAT boxes. Standard deviations were lower than 20%.
-globin promoter (32). In the second, the two NF-Y sites would be positioned on opposite sides of the DNA helix (see
the scheme in Fig. 2B). These mutants were
tested in the cotransfection assays used above with and
without p300 overexpression. Fig. 2B shows that all distance
mutants exhibited decreased activity, about 3/4-fold lower than wt,
even without p300 cotransfection. More importantly,
p300-dependent activation was reduced by about 2/3-fold but
not completely abolished. Interestingly, the most affected mutant was
Y2/Y3Plus, which is expected to affect the interactions between the two
lowest affinity NF-Y sites. Overall, these data indicate that p300
activates cyclin B2 transcription by acting on intact and correctly
spaced CCAAT boxes. Despite their differences in relative NF-Y
affinities, all three CCAAT elements are important for
p300-dependent activation.
View larger version (42K):
[in a new window]
Fig. 3.
Binding of NF-Y and p300 to the triple CCAAT
cyclin B2-promoter. A, EMSA analysis of the wt cyclin
B2 region (lanes 1-8), the Y1-Y2m (lanes 9-17),
and triple CCAAT mutant (lanes 18-25) with increasing doses
of NF-Y (0.3 ng: lanes 1, 5, 10,
14, 18, 22; 1 ng: lanes 2,
6, 11, 15, 19,
23; 3 ng: lanes 3, 7, 12,
16, 20, 24; 10 ng: lanes 4,
8, 13, 17, 21,
25) in the absence (lanes 1-4,
10-13, 18-21) or presence (lanes
5-8, 14-17, 22-25) of 100 ng of p300. In
lane 9 p300 alone was incubated with DNA. B, EMSA
supershift. Same as A in lanes 4 and
8, except that we added anti-p300 (500 ng in lanes
3 and 4) or anti Gata1 (same amount in lanes
5) for 30 min before the addition of p300. Ctl,
control. C, EMSA of wt NF-Y trimer (lanes 3-4)
or mutants YA9/YB4/YC5 (30) were incubated with wt cyclin B2 DNA in the
absence (lanes 1 and 3) or presence of p300
(lanes 2-4).
-globin promoter suggested that if a
certain spacing is respected (32 bp), then cooperative binding of NF-Y
molecules is possible, mainly thanks to the presence of Q-rich regions
of NF-YA and NF-YC. In other systems, NF-Y is capable of improving the
DNA binding affinity of neighboring factors, forming extremely stable
DNA-protein complexes (3). Because of the presence of a 33-bp spacing
between all three Y boxes, we considered the possibility that three
NF-Ys could bind DNA cooperatively; alternatively, cooperativity could be mediated by the association of the coactivator. To investigate this
point, we performed off-rate EMSA experiments with the cyclin B2 probe
used above. We incubated two different quantities of NF-Y
in two sets of assays for 30 min, until the binding equilibrium was
reached, then added a large
200-fold excess of an unlabeled oligonucleotide containing the high affinity CCAAT box of the major
histocompatibility complex class II Ea promoter. After the indicated
periods of time, an aliquot of the sample was loaded on a running
polyacrylamide gel. At low doses (Fig.
4A, lanes 1-5),
under conditions where only single and double CCAAT binding is
observed, the upper band, corresponding to Y1-Y2 occupation (see
below), was rapidly competed (compare lanes 1-3),
whereas the single interaction only slowly decreased. This behavior is not indicative of a cooperative effect, because in the latter case, we
would have observed a slower decrease of the upper complex compared
with the lower, single CCAAT binding activity. At higher NF-Y amounts
(Fig. 4A, lanes 6-10), the triple interaction
appeared. In this case, double and single CCAAT binding was still
observed at late time points (lanes 9 and 10),
but triple binding was rapidly competed, being minimal after 15 min
(compare lanes 6-8). Because of the persistence of NF-Y
binding at relatively late points (90 min in lanes 5 and
10), we extended the off-rates to 4, 8, 16, and 24 h,
starting with NF-Y concentrations that generate triple binding. Fig.
4B shows that double and single, but not triple NF-Y
binding, persisted after 24 h of incubation with the competing oligonucleotide. By comparison, we performed a parallel experiment in
the absence of unlabeled competitor, which showed a slower off-rate for
the triple complex (Fig. 4B, compare lanes 1-3
with 6-8). These latter experiments reinforce the notion
that CCAAT binding by NF-Y to high, that medium affinity sites are
stunningly stable, and that no cooperativity is observed in
vitro with either Y1-Y2 or the low affinity Y3.
View larger version (71K):
[in a new window]
Fig. 4.
Lack of DNA binding cooperativity with
NF-Y·p300 complexes. A, off-rates EMSA analysis of
NF-Y and NF-Y·p300 complexes on the cyclin B2 promoter. 2 ng
(lanes 1-5) or 10 ng (lanes 6-10) of NF-Y were
incubated with the cyclin B2 probe until equilibrium was reached and
then challenged for the indicated times with 100-fold molar excess of
Y1 CCAAT-oligonucleotide (21). B, as in A, except
that samples with 10 ng of NF-Y were incubated for the indicated hours
in the presence (lanes 1-5) or absence (lanes
6-10) of the unlabeled competitor (comp.).
C, same as A, except that NF-Y (2 ng) was
incubated in the absence (lanes 1-4 and 9-12)
or presence (lanes 5-8 and 13-16) of 100 ng of
p300. In lanes 1-8 a long oligonucleotide containing both
Y1 and Y2 (21) was used as a cold competitor; lanes 9-16
used the Y1 oligonucleotide.
View larger version (70K):
[in a new window]
Fig. 5.
Binding of NF-Y to the CCAAT distance
mutants. EMSA analysis of NF-Y binding (2 ng) to cyclin B2
promoter mutants derived from plasmids described in Fig. 2.
View larger version (79K):
[in a new window]
Fig. 6.
Footprinting analysis of NF-Y·p300 binding
to the cyclin B2 CCAAT box distance mutants. Increasing
concentrations of NF-Y (5, 15, 50 ng) in the absence (lanes
2-4) or in the presence of 500 ng of p300 (lanes 5-7)
were used with the indicated probes in A-E. In lanes
1 and 9 no protein was added; lanes 8 contained only p300.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
Y3, with
decreasing affinities from the most distal to the proximal site. The
binding of two or three NF-Y molecules with or without p300 is not
cooperative. However, p300 favors the association of NF-Y to the
proximal site, and the distance between the three CCAAT boxes is
crucial for this activity. We conclude that the precise alignment of
multiple CCAAT boxes is crucial for coactivator function.
, CDC25C, and cyclin B1/B2 (Table I). The distance
between these elements is (i) highly conserved among species and (ii)
relatively constant; in the case of CDC25C, three CCAAT boxes are
spaced 32 bp apart, in cyclin B2 the distances are 33 bp, in Cdc2 two
CCAAT elements are spaced by 32 bp. Promoters for which both human and
mouse sequences are available show that the sequences of NF-Y binding
sites as well as their distance is strictly conserved. Especially in
CDC25C and cyclin B2 mouse and human promoters nucleotides in between CCAAT boxes are not conserved, contrasting the sequence identity of and
distance between NF-Y binding elements
(32).4 In all the promoters
mentioned above, the affinities of NF-Y for the individual CCAAT sites
differ; in CDC25C one of the CCAAT boxes is not even a perfect
pentanucleotide. In cyclin B2 it is apparent that between Y1 and Y3
there is a 50-fold difference in binding affinity, yet the integrity of
Y3 is as important as the high affinity Y1 binding in terms of
function. The cyclin B2 systems is also conspicuous for another reason;
that is, the NF-Y sites are apparently sufficient on their own to
activate this promoter essentially without the need of additional
factors. This is unlike the other systems tested so far, in which NF-Y is unable to activate alone. In a previous study on the
-globin promoter, we found that NF-Y binding to double CCAAT boxes spaced by 27 nucleotides was not cooperative unless an extra 5 nucleotides were
added. In such a case, a complex formed by two NF-Y trimers bound to
the two sites was much more stable in off-rate experiments thanks to
the presence of the NF-YA and NF-YC glutamine-rich domains (30). The
distance of 32 nucleotides predicts that the two CCAAT boxes are on the
same side of the DNA double helix, which has an average periodicity of
10.5 and is somewhat dependent upon the sequence. Thus, we expected
that the binding of NF-Y to the triple CCAAT elements of cyclin B2
could be itself cooperative in our in vitro EMSAs. This is
not the case (Fig. 4). It is possible that the lack of cooperativity is
due to the extra nucleotide present between the cyclin B2 CCAAT boxes
or to the intervening sequences. Nevertheless, it is clear that the
stability of the Y1-Y2·NF-Y complexes is extremely high, with a
half-life of >24 h in vitro. Thus, one is tempted to
conclude that unlike the situation when NF-Y finds another
transcription factor nearby, cooperativity at the DNA binding level is
not required when two or more NF-Y sites are aligned on the promoter,
even in the presence of CCAAT boxes that do not conform to an optimal
binding consensus. Yet, the perfect alignment of the three sites is
clearly required for optimal promoter function (Fig. 2). Optimal
transcription then results from additional contacts.
List of cell cycle promoters with multiple CCAAT boxes spaced by 31/33
nucleotides
View larger version (77K):
[in a new window]
Fig. 7.
Scheme for NF-Y·p300 interactions on the
cyclin B2 promoter.
-interferon promoter (43). (ii) Once on a
promoter, p300/CBP proteins modify the chromatin structures nearby the
sites by virtue of their histone acetylation activity, rendering
nucleosomes more "accessible" to the general
transcription apparatus. (iii) The same histone acetyltransferase
activity would be used to increase the affinity of the DNA binding
factor for the targeted sequence. This latter property is less well
understood. In many cases, in fact, the opposite happens; acetylation
of high mobility group(I) inhibits formation of the enhanceosome
on the
-interferon promoter (43). In the case of p53, whose function
is positively affected by p300, acetylation apparently affects
recruitment of p300/CBP (44). Interestingly, in keeping with these
latter results, we find that p300 acetylates NF-YB and that this
modification increases NF-Y-p300 interactions.3 In many
promoters, the histone acetyltransferase activity of p300/CBP is
apparently dispensable (8-10); p300/CBP and PCAF cooperate with
members of the MyoD family of muscle transcription factors in
modulating the expression of downstream myogenic factors, including myogenin and MEF2, leading to terminal withdrawal from the cell cycle
of myotubes (45, 46). The p300 histone acetyltransferase domain is
dispensable for MyoD-dependent transcription, suggesting that the "bridging" mechanism is predominant in this case.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Lee Kraus for p300 baculovirus and Antonio Giordano for providing plasmids.
![]() |
FOOTNOTES |
---|
* This work was supported by grants from Associazione Italiana per la Ricerca sul Cancro and Ministero dell'Istruzione dell'Università e della Ricerca (to R. M.) and by grants from the Bundesministerium für Bildung und Forschung, Interdisziplinäres Zentrum für Klinische Forschung and the Deutsche Forschungsgemeinschaft (to K. E.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed. Tel.: 39-059-2055542; Fax: 39-059-2055548; E-mail: mantor@mail.unimo.it.
Published, JBC Papers in Press, December 12, 2002, DOI 10.1074/jbc.M210065200
2 F. Romani and R. Mantovani, unpublished information.
3 G. Caretti and R. Mantovani, manuscript in preparation.
4 M. Wasner and K. Engeland, unpublished information.
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: EMSA, electrophoretic mobility shift assay; CBP, cAMP-response element-binding protein (CREB)-binding protein; wt, wild type; CMV, cytomegalovirus; ChIP, chromatin immunoprecipitation.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. |
Suzuki, Y.,
Tsunoda, T.,
Sese, J.,
Taira, H.,
Mizushima-Sugano, J.,
Hata, H.,
Ota, T.,
Isogai, T.,
Tanaka, T.,
Nakamura, Y.,
Suyama, A.,
Sakaki, Y.,
Morishita, S.,
Okubo, K.,
and Sugano, S.
(2001)
Genome Res.
11,
677-684 |
2. |
Mantovani, R.
(1998)
Nucleic Acids Res.
26,
1135-1143 |
3. | Mantovani, R. (1999) Gene 239, 15-27[CrossRef][Medline] [Order article via Infotrieve] |
4. |
Frontini, M.,
Imbriano, C.,
diSilvio, A.,
Bell, B.,
Bogni, A.,
Romier, C.,
Moras, D.,
Tora, L.,
Davidson, I.,
and Mantovani, R.
(2002)
J. Biol. Chem.
277,
5841-5848 |
5. |
Caretti, G.,
Motta, M. C.,
and Mantovani, R.
(1999)
Mol. Cell. Biol.
19,
8591-8603 |
6. |
Coustry, F., Hu, Q.,
de Crombrugghe, B.,
and Maity, S. N.
(2001)
J. Biol. Chem.
276,
40621-40630 |
7. |
Sterner, D. E.,
and Berger, S. H.
(2000)
Microbiol. Mol. Biol. Rev.
64,
435-459 |
8. |
Zeng, X.,
Lee, H.,
Zhang, Q.,
and Lu, H.
(2001)
J. Biol. Chem.
276,
48-52 |
9. |
Harton, J. A.,
Zika, E.,
and Ting, J. P.
(2001)
J. Biol. Chem.
276,
38715-38720 |
10. |
Song, C-Z.,
Keller, K.,
Murata, K.,
Asano, H.,
and Stamatoyannopoulos, G.
(2002)
J. Biol. Chem.
277,
7029-7036 |
11. |
Kouzarides, T.
(2000)
EMBO J.
19,
1176-1179 |
12. |
Goodman, R. H.,
and Smolik, S.
(2000)
Genes Dev.
14,
1553-1577 |
13. | Wang, H.-G. H., Moran, E., and Yacuik, P. (1995) J. Virol. 69, 7917-7924[Abstract] |
14. | Yang, X. J., Ogryzko, V. V., Nishikawa, J., Howard, B. H., and Nakatani, Y. (1996) Nature 382, 319-324[CrossRef][Medline] [Order article via Infotrieve] |
15. | Missero, C., Calautti, E., Eckner, R., Chin, J., Tsai, L. H., Livingston, D. M., and Dotto, G. P. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 5451-5455[Abstract] |
16. | Yao, T., Oh, S. P., Fuchs, M., Zhou, N., Ch'ng, L., Newsome, D., Bronson, R. T., Li, E., Livingston, D. M., and Eckner, R. (1998) Cell 93, 361-372[Medline] [Order article via Infotrieve] |
17. |
Currie, R. A.
(1998)
J. Biol. Chem.
273,
1430-1434 |
18. |
Li, Q.,
Herrler, M.,
Landsberger, N.,
Kaludov, N.,
Ogryzko, V. V.,
Nakatani, Y.,
and Wolffe, A. P.
(1998)
EMBO J.
17,
6300-6315 |
19. |
Jin, S.,
and Scotto, K. W.
(1998)
Mol. Cell. Biol.
18,
4377-4384 |
20. | Adachi, N., Nomoto, M., Kohno, K., and Koyama, H. (2000) Gene 245, 49-57[CrossRef][Medline] [Order article via Infotrieve] |
21. | Bolognese, F., Wasner, M., Lange-zu Dohna, C., Gurtner, A., Ronchi, A., Muller, H., Manni, I., Mossner, J., Piaggio, G., Mantovani, R., and Engeland, K. (1999) Oncogene 18, 1845-1853[CrossRef][Medline] [Order article via Infotrieve] |
22. | Farina, A., Manni, I., Fontemaggi, G., Tiainen, M., Cenciarelli, C., Bellorini, M., Mantovani, R., Sacchi, A., and Piaggio, G. (1999) Oncogene 18, 2818-2827[CrossRef][Medline] [Order article via Infotrieve] |
23. |
Korner, K.,
and Muller, R.
(2000)
J. Biol. Chem.
275,
18676-18681 |
24. | Krause, K., Haugwitz, U., Wasner, M., Wiedmann, M., Mossner, J., and Engeland, K. (2001) Biochem. Biophys. Res. Commun. 284, 743-750[CrossRef][Medline] [Order article via Infotrieve] |
25. | Taylor, W. R., DePrimo, S. E., Agarwal, A., Agarwal, M. L., Schonthal, A. H., Katula, K. S., and Stark, G. R. (1999) Mol. Biol. Cell 19, 3607-3622 |
26. |
Yun, J.,
Chae, H. D.,
Choy, H. E.,
Chung, J.,
Yoo, H. S.,
Han, M. H.,
and Shin, D. Y.
(1999)
J. Biol. Chem.
274,
29677-29682 |
27. | Gautier, J., Minshull, J., Lohka, M., Glotzer, M., Hunt, T., and Maller, J. L. (1990) Cell 60, 487-494[Medline] [Order article via Infotrieve] |
28. | Lew, D. J., Dulic, V., and Reed, S. I. (1991) Cell 66, 1197-1206[Medline] [Order article via Infotrieve] |
29. | Lange-zu Dohna, C., Brandeis, M., Berr, F., Mossner, J., and Engeland, K. (2000) FEBS Lett. 484, 77-81[CrossRef][Medline] [Order article via Infotrieve] |
30. | Liberati, C., di Silvio, A., Ottolenghi, S., and Mantovani, R. (1999) J. Mol. Biol. 285, 1441-1455[CrossRef][Medline] [Order article via Infotrieve] |
31. |
Wells, J.,
Boyd, K. E.,
Fry, C. J.,
Bartley, S. M.,
and Farnham, P. J.
(2000)
Mol. Cell. Biol.
20,
5797-5807 |
32. |
Haugwitz, U.,
Wasner, M.,
Wiedmann, M.,
Spiesbach, K.,
Rother, K.,
Mossner, J.,
and Engeland, K.
(2002)
Nucleic Acids Res.
30,
1967-1976 |
33. | Bellorini, M., Zemzoumi, K., Farina, A., Berthelsen, J., Piaggio, G., and Mantovani, R. (1997) Gene 193, 119-125[CrossRef][Medline] [Order article via Infotrieve] |
34. | Zemzoumi, K., Frontini, M., Bellorini, M., and Mantovani, R. (1999) J. Mol. Biol. 286, 327-337[CrossRef][Medline] [Order article via Infotrieve] |
35. |
Yoshida, H.,
Okada, T.,
Haze, K.,
Yanagi, H.,
Yura, T.,
Negishi, M.,
and Mori, K.
(2001)
Mol. Cell. Biol.
21,
1239-1248 |
36. |
van Ginkel, P. R.,
Hsiao, K. M.,
Schjerven, H.,
and Farnham, P. J.
(1997)
J. Biol. Chem.
272,
18367-18374 |
37. | Luger, K., Mader, A. W., Richmond, R. K., Sargent, D. F., and Richmond, T. J. (1997) Nature 389, 251-262[CrossRef][Medline] [Order article via Infotrieve] |
38. | Zwicker, J., Gross, C., Lucibello, F. C., Truss, M., Ehlert, F., Engeland, K., and Muller, R. (1995) Nucleic Acids Res. 23, 3822-3830[Abstract] |
39. | Zwicker, J., Lucibello, F. C., Wolfraim, L. A., Gross, C., Truss, M., Engeland, K., and Muller, R. (1995) EMBO J. 14, 4514-4522[Abstract] |
40. |
Liberati, C.,
Ronchi, A.,
Lievens, P.,
Ottolenghi, S.,
and Mantovani, R.
(1998)
J. Biol. Chem.
273,
16880-16889 |
41. |
Romier, C.,
Cocchiarella, F,
Mantovani, R.,
and Moras, D.
(2003)
J. Biol. Chem.
278,
1336-1345 |
42. |
Fry, C. J.,
Pearson, A.,
Malinowski, E.,
Bartley, S. M.,
Greenblatt, J.,
and Farnham, P. J.
(1999)
J. Biol. Chem.
274,
15883-15891 |
43. |
Munshi, N.,
Agalioti, T.,
Lomvardas, S.,
Merika, M.,
Chen, G.,
and Thanos, D.
(2001)
Science
293,
1133-1136 |
44. | Barlev, N. A., Liu, L., Chehab, N. H., Mansfield, K., Harris, K. G., Halazonetis, T. D., and Berger, S. L. (2001) Mol. Cell 8, 1243-1254[Medline] [Order article via Infotrieve] |
45. |
Puri, P. L.,
Avantaggiati, M. L.,
Balsano, C.,
Sang, N.,
Graessmann, A.,
Giordano, A.,
and Levrero, M.
(1997)
EMBO J.
16,
369-383 |
46. | Sartorelli, V., Puri, P. L., Hamamori, Y., Ogryzko, V., Chung, G., Nakatani, Y., Wang, J. Y. J., and Kedes, L. (1999) Mol. Cell 4, 725-734[Medline] [Order article via Infotrieve] |
47. |
Sciortino, S.,
Gurtner, A.,
Manni, I.,
Fontemaggi, G.,
Dey, A.,
Sacchi, A.,
Ozato, K.,
and Piaggio, G.
(2001)
EMBO Rep.
2,
1018-1023 |
48. |
Arcot, S. S.,
Flemington, E. K.,
and Deininger, P. L.
(1989)
J. Biol. Chem.
264,
2343-2349 |
49. | Park, J. B., and Levine, M. (2000) Biochem. Biophys. Res. Commun. 267, 651-657[CrossRef][Medline] [Order article via Infotrieve] |