From the
Instituto de Bioquímica Vegetal y
Fotosíntesis, Centro de Investigaciones Científicas Isla de la
Cartuja, Universidad de Sevilla-CSIC, c/Americo Vespucio s/n, 41092-Sevilla,
Spain and the
Department of Biochemistry,
Michigan State University, East Lansing, Michigan 48824
Received for publication, April 23, 2003 , and in revised form, May 12, 2003.
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
ADP-Glc PPases are tetrameric enzymes. However, whereas the bacterial
enzyme is composed of four identical subunits (4)
(18,
19). ADP-Glc PPase from higher
plants is a heterotetramer (
2
2) composed of
two closely related but different types of subunits
(2023).
The small subunit (SS) is responsible for the catalytic activity, whereas the
large subunit (LS) plays a regulatory function
(3). Different isoforms for
ADP-Glc PPase subunits have been described, and many cDNAs and genomic DNAs
encoding for them have been isolated from both monocot and dicot plants. The
most frequent situation is the existence of one SS gene and several LS genes
that are differentially expressed
(3,
9,
2329).
In Arabidopsis one SS gene (ApS1) and three LS genes
(ApL1, ApL2, and ApL3) have been previously identified
(30). Recently, the
Arabidopsis Genome Initiative provided evidence for the existence of two new
putative ADP-Glc PPase encoding genes: one with homology to SS (At1g05610) and
another with homology to LS (At2g21590) that we designated ApS2 and
ApL4, respectively.
Many attempts have been made to determine the function of the higher plants ADP-Glc PPase subunits. Studies with the potato tuber recombinant ADP-Glc PPase shows that the large subunit regulates the activity of the small subunit, increasing its apparent affinity for the activator and decreasing the affinity for the inhibitor. The function of the large subunit would be to modulate the activity of the heterotetramer in response to the levels of allosteric effectors (31). This fact together with the tissue-specific pattern of expression of LS genes (9, 32, 33) have led us to propose that the LS isoforms could confer different allosteric sensitivities to ADP-Glc PPase related to the specific metabolic conditions of each tissue and organ. Nevertheless, there is no comprehensive study on the possible role played by all the different isoforms of ADP-Glc PPase present in a single species. The identification of all ADP-Glc PPase encoding genes in Arabidopsis thaliana opens the possibility of performing studies on subunit interactions paying special attention to the role of the different large subunits.
In this study, all six Arabidopsis ADP-Glc PPase cDNAs were cloned and co-expressed in Escherichia coli. The activity of the recombinant enzymes was studied and analyzed kinetically. No catalytic activity was detected for APS2, suggesting that APS2 may not be an active ADP-Glc PPase small subunit. The co-expression of APS1 with the different Arabidopsis LS (APL1, APL2, APL3, and APL4) resulted in heterotetramers showing distinct affinity for the substrates as well as different regulatory properties. This is the first experimental study on the kinetic and regulatory properties of all the ADP-Glc PPase isoforms from a single species. Our results strongly indicate that ADP-Glc PPases heterotetramers can be formed in different tissues and organs of Arabidopsis based on the presence of a specific LS isoform. The heterotetramers formed in a specific tissue or organ would respond to substrates and allosteric effectors attending to its sink source nature, thus controlling starch synthesis and carbon partition in a tissue-specific manner.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plant Material and Bacterial Strains
A. thaliana plants were ecotype Columbia. E. coli
DH5 strain was used to clone the cDNAs, and an E. coli B
mutant deficient in ADP-Glc PPase activity (AC70RI-540; 14) was used in the
expression and purification of the Arabidopsis ADP-Glc PPases.
Cloning of cDNA and Construction of Plasmids
cDNA fragments encoding the mature sequence of the Arabidopsis
ADP-Glc PPase proteins were obtained by reverse transcription-PCR from total
RNA isolated from leaves and influorescences and cloned into the pGEMTM-T
Easy vector. The following oligonucleotides were used to clone the
Arabidopsis ADP-Glc PPase cDNAs: SA239
(ccccatatggtctcagattctcaaaactct) and SA240 (gtggaattcagatgacagtgccggttggga)
for ApS1; SA241 (aaccatatggtttcaaactctcagcacctt) and SA242
(aaagaattcagaggatggagtcgttcggga) for ApS2; SA265
(gaaccatggcgtctctaaatagtgtagctg) and SA244 (gttggtaccattagatcttaaaagtatcat)
for ApL1; SA266 (caccatggccgttcttactccatttgttg) and SA246
(agaggtaccaaagcttaaatatgcagacca) for ApL2; SA267
(ttgccatggctattgctacctcaaagaatg) and SA248 (ggcggtaccgagatcgttttgttcatatca)
for ApL3; and SA268 (gttgccatggctgttgccacttcagat) and SA250
(ggaggtaccttcaagctctccattcatatt) for ApL4. A methionine in the SS or
a methionine and an alanine in the LS were engineered by PCR-based
mutagenesis, and restriction sites for cloning in the expression vectors were
also introduced. NdeI-EcoRI fragments containing the SS
cDNAs were subcloned into pMAB5, a modified version of the expression vector
pMON17335 (14) with a
NdeI restriction site in the N-terminal coding region, to generate
plasmids pSAT403 (APS1) and pSAT465 (APS2). The NcoI-KpnI
fragments containing the LS cDNAs were cloned into the pMON17336
(14) to generate the plasmids
pSAT516 (APL1), pSAT524 (APL2), pSAT532 (APL3), and pSAT544 (APL4).
Expression and Purification of Recombinant Enzymes
The ADP-Glc PPase SS alone or together with the LS cDNAs were expressed in
E. coli strain AC70R1504, which is deficient in endogenous
ADP-Glc PPase activity. In small scale expression assays, single colonies were
grown in 50 ml of LB medium at 37 °C with the suitable antibiotic until
the A600 reached 1.11.3. Induction of the small
subunits was initiated by adding 400 µM of
isopropyl--D-thiogalactopyranoside, and 5 µg/ml of
nalidixic acid was added to induce the expression of the large subunits. After
16 h of induction at room temperature, the cells were chilled on ice and
harvested by centrifugation. Cell pastes were resuspended in 3 ml of buffer A
containing 50 mM HEPES (pH 7.9), 5 mM MgCl2,
0.1 mM EDTA, and 10% sucrose and disrupted by sonication. The
sonicated suspensions were centrifuged for 20 min at 10,000 x
g, and the supernatants (crude extracts) were retained. The activity
of the constructions was tested using 10 µl of 10- or 5-fold diluted crude
extracts in the pyrophosphorolysis assay that is described below.
Recombinant enzymes were purified for kinetic and regulatory studies. To purify the recombinant APS1 homotetramer and the APS1 plus the four large subunits, the cells were grown in 10 liters of LB medium. The induction and sonication was followed as described above, but sonicated cells were resuspended in 100 ml of buffer A. All subsequent protein purification steps were performed at 04 °C. The pyrophosphorolysis assay was used to monitor the ADP-Glc PPase activity during the purification steps. Crude extracts were subject to heat treatment at 65 °C (or 70 °C for the APS1 homotetramer) as described for purification of the potato recombinant ADP-Glc PPase (31). The supernatants obtained after the heat treatment were absorbed onto a DEAE-Fractogel column of 40-ml bed volume equilibrated with buffer A. The enzymes were eluted with a NaCl linear gradient (10 bed volumes, 00.5 M) in buffer A, and fractions of 24 ml were collected. Fractions containing ADP-Glc PPase activity were pooled, and an ammonium sulfate fractionation (3060%) was performed, with centrifugation for 20 min at 12,000 x g. The ammonium sulfate pellets were resuspended in 6 ml of buffer A and desalted on Econo-PacTM 10DG columns (Bio-Rad) equilibrated in buffer A. The desalted samples were applied to a MonoQ HR 10/10 column equilibrated with buffer A. To elute the enzymes, a NaCl linear gradient (20 bed volumes, 00.5 M) was applied, and fractions of 4 ml were collected. Fractions containing ADP-Glc PPase activity were pooled, concentrated by Ultra Free-4TM centrifugal filters with 10-kDa molecular mass cut-off (Millipore) and stored at80 °C. ADP-Glc PPase activity of the samples was stable for at least 3 months.
Protein Assay
Protein concentrations of the fractions obtained during the purification
were determined by using bincichoninic acid reagent
(34) from Pierce, using bovine
serum albumin as the standard.
Assay of ADP-Glc PPase Activity
Pyrophosphorolysis Direction[32P]ATP formed in
the pyrophosphorolysis of ADP-Glc was determined according to Morell et
al. (20). The reaction
mixture consisted of 50 mM HEPES (pH 7.9), 7 mM
MgCl2, 2 mM dithiothreitol, 2 mM ADP-Glc, 10
mM NaF, 0.2 mg/ml bovine serum albumin, 1 mM
[32P]PPi (1000 cpm/nmol), 3-PGA, and the aliquot of the
enzyme in a final volume of 0.25 ml. For kinetic characterization the reaction
mixture also contained 0.2 or 2 mM NaPPi. The
concentration of 3-PGA was 10 mM in the small scale induction
experiments and was the indicated range in the kinetic characterizations.
Synthesis DirectionSynthesis of ADP-Glc was measured as described by Ghosh and Preiss (35) and was used to characterize the response to effectors and the apparent affinity for the substrates. The reaction mixture contained 50 mM HEPES (pH 7.9), 7 mM MgCl2, 2 mM dithiothreitol, 0.0015 unit/µl pyrophosphatase, 0.2 mg/ml bovine serum albumin, 1.5 mM ATP, 0.5 mM [14C]Glc-1-P (1000 cpm/nmol), 3-PGA, and the enzyme in final volume of 0.2 ml. 0.2 or 2 mM sodium phosphate was included in the mixture to determine sensitivity to phosphate inhibition. The Glc-1-P S0.5 was determined measuring the ADP-Glc PPase activity, and in this case, the reaction mixture included [14C]Glc-1-P (4000 cpm/nmol). To determine the S0.5 of the substrates, we used 3-PGA at concentrations 5-fold the 3-PGA A0.5 determined for each enzyme. This approach compensated for the differences in sensitivity to the activator of the different recombinant tetramers and allowed us to compare the values obtained. One unit of enzyme activity in the pyrophosphorolysis and synthesis direction assays was defined as 1 µmol of product formed per minute.
Kinetic Characterization
The A0.5 and S0.5 values, which
correspond to the concentration of activator and substrate giving 50% of the
maximal velocity respectively, and Hill coefficients (nH)
were calculated by fitting the data with a nonlinear least square formula and
the Hill equation using the software OriginTM 6.0. All of the kinetic
parameters are the means of at least two determinations. The standard
deviation was between 20% and 20% of the average value.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Expression of the different constructs was carried out in E. coli
strain AC70R1504, mutated in the structural gene of the bacterial
ADP-Glc PPase. Crude extracts of E. coli AC70R1504 cells
transformed with the different plasmids were analyzed for ADP-Glc PPase
activity in the pyrophosphorolysis direction at saturating concentrations of
3-PGA. When the APS1 subunit was expressed alone, an activity of 0.13
units mg1 protein was determined. Similar results
were obtained in extracts of E. coli AC70R1504 cells
co-expressing APS1 with any of the LS. No ADP-Glc PPase activity was detected
for APL subunits expressed alone in accordance with previous data obtained for
the potato ADP-Glc PPase recombinant enzyme
(14,
31). On the other hand, no
significant activity was detected for APS2 subunit expressed alone (<0.003
units mg1 protein) or co-expressed with any of
the LS.
The absence of activity of APS2 could be explained by analyzing the sequence of the protein. Aspartate residues 142 of E. coli and 145 in potato ADP-Glc PPase have been demonstrated to be essential for catalysis (37, 38). It is one of the highly conserved residues among the superfamily of pyrophosphorylases (39, 40) and is present in all plant ADP-Glc PPases. In the case of APS2 protein, the aspartate residue is substituted by a histidine residue (amino acid 136) (Fig. 1). A sequence comparison between APS2 and other SS of the region comprising the ATP, Glc-1-P, and the activator sites, as defined by Sivak and Preiss (3), is also shown in Fig. 1. Although the ATP site in APS2 is well conserved when compared with other SS, the Glc-1-P site shows significant sequence variations in relation to both plant and bacterial ADPG PPases. In addition, the activator site, which is conserved among cyanobacteria, plant SS, and plant LS ADP-Glc PPases (3), shows several amino acid substitutions in the APS2 protein (Fig. 1). These sequence divergences suggest that Arabidopsis APS2 is a nonfunctional ADP-Glc PPase subunit, although further studies will be necessary to discern the role of the ApS2 gene.
|
Purification of the Arabidopsis Recombinant ADP-Glc PPasesArabidopsis APS1 homotetramer or heterotetramers formed by APS1 with any of the LS were partially purified to study the subunit interactions between the four Arabidopsis LS and the fully active Arabidopsis SS. Purification was carried out through heat treatment, followed by two anion-exchange chromatography steps on DEAE-Fractogel and MonoQ HR columns, as described under "Experimental Procedures." We detected the presence of SS homotetramers during the purification of heterotetramers, probably because of the imbalanced expression of the small and the large subunit genes in E. coli. It has been described that the activity of plant ADP-Glc PPase heterotetramers has a lower 3-PGA A0.5 than the homotetramers (31). To select those fractions containing the heterotetrameric forms, the activity was monitored during the purification at two different concentrations of the activator 3-PGA (0.5 mM and 10 mM). Thus, only fractions that showed activity in both conditions were pooled and considered in further steps. It is the first time that this situation has been reported for the purification of a plant recombinant ADP-Glc PPase, and it should be considered in further purifications.
The specific activities in the pyrophosphorolysis direction obtained for
the partially purified Arabidopsis recombinant ADP-Glc PPases in the
presence of 10 mM 3-PGA were 16.0 units
mg1 protein for the APS1 homotetramer and 3.7,
5.0, 2.5, and 17.0 units mg1 protein for the APS1
plus APL1, APL2, APL3, and APL4 heterotetramers, respectively. The enzymes
were estimated to be 425% pure, considering a specific activity
for the pure enzyme of
60 units mg1 protein
(14). It was of importance
that no degrading reactions for either ADP-Glc or Glc-1-P were noted during
the kinetic assays. The recombinant enzymes were subjected to inmunoblot
analysis using antibodies against spinach-leaf ADP-Glc PPase
(20) and showed no apparent
degradation during the purification process (data not shown).
Kinetic Parameters of the Arabidopsis Recombinant ADP-Glc PPase in the Pyrophosphorolysis DirectionThe kinetics for the response to 3-PGA conferred by the different Arabidopsis LS were studied in detail. The A0.5 for 3-PGA values in pyrophosphorolysis direction are shown in Table I. The data indicate that, as previously reported for other plant recombinant enzymes (14, 31), the APS1 homotetramer has a much lower apparent affinity for the activator, 3-PGA, than the heterotetrameric enzymes. The A0.5 for the homotetrameric APS1 enzyme was 1.2 mM, whereas the A0.5 of the heterotetrameric enzyme composed of APS1 and APL1 is 3 orders of magnitude lower (0.0017 mM). The A0.5 values for APS1/APL3 or APS1/APL4 are 40-fold lower, and the corresponding A0.5 for the APS1/APL2 is 5-fold lower (Table I). The different responses of the Arabidopsis recombinant ADP-Glc PPases are plotted in Fig. 2. These results indicated that the different Arabidopsis LS confer distinct regulatory properties to ADP-Glc PPase, with the heterotetramer APS1/APL1 being the most sensitive to 3-PGA.
|
|
The effect of the inhibitor was also studied in the pyrophosphorolysis direction. The magnitude of Pi inhibition is dependent on the concentration of the activator, 3-PGA, and to compare the effect of Pi on the different enzymes, we studied the shift in the 3-PGA A0.5 caused by the presence of Pi. This strategy allowed us to avoid the differences in affinity for 3-PGA. The data in Table I show that the sensitivity to Pi was also different between the Arabidopsis recombinant enzymes. The presence of 0.2 mM Pi induced a 4.6-fold increase on the 3-PGA A0.5 for the APS1 homotetramer. However, A0.5 for 3-PGA of the APS1/APL1 heterotetramer was 11-fold higher in the presence of Pi 0.2 mM and 280-fold higher with 2.0 mM Pi. This shift was less pronounced for the other heterotetramers (Table I). This results indicate that the APS1/APL1 heterotetramer is more sensitive to both allosteric effectors in the pyrophosphorolysis direction than the other heterotetramers.
Kinetic Parameters of the Arabidopsis Recombinant ADP-Glc PPase in the Synthesis DirectionThe characterization of the Arabidopsis recombinant ADP-Glc PPases was completed studying the activity in the physiological direction. The data of the response to the allosteric effectors (Table II) confirm the results obtained in the pyrophosphorolysis direction. Moreover, our 3-PGA A0.5 data are in accordance with a previously reported work on the recombinant APS1/APL1 enzyme (36) and the native Arabidopsis leaf enzyme (41). Based on the values in Tables I and II, we can divide the Arabidopsis ADPG PPase heterotetramers attending to the response to the 3-PGA and Pi. The APS1/APL1 heterotetramer showed the higher response and sensitivity to the allosteric effectors, whereas the heterotetramer composed of APS1 and APL3 or APL4 has an intermediate response, and the APS1/APL2 heterotetramer has the lower one. The possible physiological implications of these results will be further discussed.
|
The catalytic activity of the ADP-Glc PPase is considered to be mainly due to the action of the SS (37, 38, 42, 43). LS appeared to interact with the substrate but does not play a direct role in catalysis (44). We investigated whether the different large subunits affect the affinity of ADP-Glc PPases for its substrates, Glc-1-P and ATP. As shown in Table III, APL1 induced a 4-fold increase in the apparent affinity for the Glc-1P compared with the APS1 homotetramer, whereas the other APLs did not significantly affect the S0.5 for Glc-1-P. In contrast, the ATP S0.5 was affected for Arabidopsis APL1, APL4, and APL3 (Table III). The ATP S0.5 APS1/APL1 heterotetramer was 6-fold lower than the APS1 homotetramer, whereas the APS1/APL3 or APS1/APL4 heterotetramers were 4-fold lower. On the other hand, the APS1/APL2 heterotetramer showed a similar S0.5 for ATP in relation to the APS1 homotetramer. In summary, the Arabidopsis APL1, APL3, and APL4 confer higher affinity for ATP, whereas APL2 confers an affinity for ATP similar to the APS1 homotetramer. These are novel data supporting the idea that the role of large subunits is not only to modulate ADP-Glc PPase in response to the allosteric effectors, but they can also change the apparent affinity for the substrates.
|
Sequence Analysis of ADP-Glc PPase SubunitsThe predicted amino acid sequences of several plant ADP-Glc PPases can be divided in two groups corresponding to APS and APL subunits (23, 24). To analyze the putative function of the different Arabidopsis ADP-Glc PPase subunits, we compare a set of ADP-Glc PPase amino acid sequences analyzing the tissue where the proteins are present. A phylogenetic tree built with protein sequences deposited in the EMBL/GenBank/DDBJ data bases including the six Arabidopsis ADP-Glc PPase subunits is shown in Fig. 3. As previously reported, sequences can be divided in two main groups corresponding to small and large subunits. The higher plant SS group can be divided in two subgroups: one corresponding to monocots and a second one corresponding to dicots (including APS1 from Arabidopsis). APS1 from Arabidopsis is essential to starch synthesis in vivo as revealed the study of starch-lacking mutant plants (45). Small subunits are considered to be ubiquitous, although in the case of rice, Vicia faba, and pea, for which two genes coding for different APS subunits have been described, distinct patterns of expression have been reported (9, 13, 46). The Arabidopsis APS2 protein appears in a separate branch of the tree. Although APS2 is related to ADP-Glc PPase SS, its sequence is clearly different from any other ADP-Glc PPase sequence present in the data bases. This is reflected in Fig. 3, supporting the idea of the nonfunctionality of the APS2 protein, with APS1 being the only functional SS in Arabidopsis.
|
The LS group can be divided into two subgroups corresponding to sink (sites of net sugar import like endosperm, roots, and young leaves) and source (sites of net sugar export like mature leaves) tissues, with the exception of the sugar beet large subunit that is expressed in sink and source leaves (27) and is included in the sink group of LS. Arabidopsis APL1 is considered to be the main isoform expressed in leaves (36). Correspondingly, APL1 is grouped with other LS expressed in leaf. We can also distinguish three subgroups in the sink LS group: one group corresponding to monocot endosperm LS isoforms; a second group that includes the Arabidopsis APL2 and LS present in young leaves, fruits, and roots; and a third group comprising LS from storage organs like tubers or expressed in the stem. Arabidopsis APL3 and APL4 share a very high level of identity at the amino acid sequence (88%) and are included in the latter group. It has been shown that Arabidopsis APL3 is restricted to the starch sheath layer below the major veins in leaves and petioles and that its expression is strongly induced by sucrose or trehalose in the mesophyl of the leaf (33, 47). Induction by sucrose has also been reported for the tomato and potato LS1 genes (48, 49) that are closely related to Arabidopsis APL3 (Fig. 3). Therefore, it seems that for several plant species, ADP-Glc PPase large subunits can be grouped according to their sequences and their pattern of expression. This fact could be related to the specific regulatory and substrate affinity properties that we have demonstrated for different A. thaliana APLs and opens the possibility that combinations of SS with different LS could represent a mechanism for the controlling carbon partitioning among different plants species.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In the present study, we have cloned the six A. thaliana mature cDNAs coding for ADP-Glc PPase isoforms in expression vectors and characterized the regulatory properties of the different ADP-Glc PPase heterotetramers. Recombinant enzymes expressed in E. coli were partially purified, and the regulatory and kinetic properties were studied.
We could not detect activity for the APS2 homotetramer or for heterotetramer composed of APS2 and any of the LS. The lack of activity of APS2 subunit is probably due to the absence of essential amino acids for catalysis and/or amino acids implicated in the binding of Glc-1-P and the allosteric activator (Fig. 1). Besides, ApS2 mRNA can only be detected by reverse transcription-PCR, indicating that its level of expression is very low.2 So, it is possible that APS2 is a noncatalytic subunit. Nevertheless, further studies are required to confirm this hypothesis and discard other possible roles of the protein.
When analyzed in the pyrophosphorolysis direction, APL1 conferred to the
ADP-Glc PPase heterotetramer a very high sensitivity to both 3-PGA and
Pi (Table I). The
A0.5 for 3-PGA was estimated to be 0.0017 mM
for APS1/APL1 heterotetramer. The corresponding values for were 100-fold
higher APS1/APL2 and
10-fold higher for APS1/APL3 or APL4. The response
of the LS isoforms to 3-PGA are graphically represented in
Fig. 2, indicating the great
differences in the response to the effector 3-PGA. The inhibition by
Pi is more drastic for the APS1/APL1 heterotetramer, inducing a
10-fold increase of the A0.5 for 3-PGA at 0.2
mM and an approximately 280-fold increase at 2.0 mM. The
effect of Pi was less pronounced for heterotetramers formed by APS1
and any of the other three APLs and showed an increase in the range of
34-fold at 0.2 mM and 1030-fold at 2.0 mM
Pi. The regulatory properties of the different ADP-Glc PPase
heterotetramers were corroborated by studying the effect of 3-PGA and
Pi in the synthesis direction
(Table II). Our results are
consistent with the idea that ADP-Glc PPase regulatory properties in a given
tissue would be dependent on the expression of specific isoforms that could
generate different heterotetramers. APS1/APL1 heterotetramers, the main enzyme
in leaves, should respond in a more sensitive manner to changes in 3-PGA
concentration than source enzymes. It has been shown that tomato leaf ADP-Glc
PPase is more sensitive to 3-PGA than the fruit enzyme
(25,
26). In photosynthetic
tissues, the levels of 3-PGA and Pi will fluctuate according to the
photosynthetic process and is considered to be one of the mechanisms
controlling carbon partitioning between sucrose and starch. Changes in these
metabolites are involved in the physiological regulation of starch synthesis
in leaves (50). The high
sensitivity of APS1/APL1 ADP-Glc PPase heterotetramer to the allosteric
effectors strongly suggests that starch synthesis in Arabidopsis
leaves would be finely tuned by the ratio 3-PGA/Pi. In contrast,
heterotetramers of APS1 with APL2, APL3, or APL4 would only respond to more
drastic changes in the levels of the allosteric effectors. A distinction can
also be made between the regulatory properties conferred by APL2 and APL3/APL4
to ADP-Glc PPase. The enzyme formed by APS1/APL2 is the less sensitive to both
3-PGA and Pi, than the APS1/APL1 enzyme, whereas APL3 and APL4
conferred an intermediate response to the effectors. The high level of
identity between APL3 and APL4 (88%) would explain the similar response of
both isoforms to the effectors. Our data strongly suggest that different LS
confer distinct regulatory properties to ADP-Glc PPase that may be related to
the metabolic profile of different tissues. It would, however, be necessary to
determine the pattern of expression of the different genes by in situ
hybridization to have a clear view on the tissue and the type of cells
expressing each isoform.
The apparent affinity of ADP-Glc PPase for the substrates ATP and Glc-1-P was also dependent on the large subunit co-expressed with APS1. APL1 confers the highest affinity for the substrates to ADP-Glc PPase (A0.5 for ATP 0.067 mM; A0.5 for Glc-1-P 0.019 mM), and APL2 confers the lowest affinity (A0.5 for ATP 0.575 mM; A0.5 for Glc-1-P 0.085 mM), whereas APL3 and APL4 confer an intermediate affinity (Table III). These results indicate that APL subunits affect not only the response of ADP-Glc PPase to the allosteric regulator but also the binding of the substrates, with the tetramer formed by APS1 and APL1 being the one showing the most sensitive response to the regulators and at the same time the highest affinity for the substrates. Studies in tomato have also shown differences in the apparent affinity for the substrates between ADP-Glc PPase enzymes from fruit and leaves (25, 26). Our results strongly indicate that the distinct properties of the different APL subunits may control the synthesis of starch in sink and source tissues attending to the levels of 3-PGA, Pi, ATP, and Glc-1-P. In photosynthetic tissues ADP-Glc PPase would be finely regulated by the ratio 3-PGA/Pi, whereas in nonphotosynthetic tissues the rate of starch synthesis would be controlled by the supply of the substrates.
As inferred from Fig. 3, SS genes are expressed in both photosynthetic and nonphotosynthetic tissues, whereas LS genes are expressed preferentially in a tissue-specific manner (9, 23, 27). Arabidopsis ApL1 is mainly expressed in leaves (36) and, correspondingly, is included in the leaf group of APLs (Fig. 3). The other three APL from Arabidopsis are included in the sink group of dicot plants. This division between sink and source APL isoforms is consistent with the kinetic properties of the different heterotetramers discussed above. Expression studies using the Arabidopsis ApL3 promoter indicates that it is expressed in sink tissues (33) and that sucrose feeding induced ApL3 expression in mesophyl cells, in a tissue-specific pattern similar to that reported in potato (32). Induction by sucrose has also been described for the Arabidopsis ApL2 and ApL3 genes in leaves, whereas expression of ApL1 gene is repressed by sucrose (51). This suggests that APL3 and/or APL2 could participate in starch synthesis in photosynthetic tissues in the presence of an excess of sugars. It has been shown in Arabidopsis that sucrose feeding in the dark induces a 2-fold increase in starch levels without a significant effect on the level of ADP-Glc PPase activity and protein (51). So, it is possible that changes in the allosteric properties of ADP-Glc PPase account for starch synthesis when the ApL1 gene is repressed by sucrose. In this situation, expression of ApL3 gene (ApL2 and/or ApL4) will permit the formation of heterotetramers with different regulatory properties, thus allowing starch synthesis to proceed. In sink tissues the allosteric effectors are unlikely to fluctuate; thus APL2, APL3, and APL4 would participate in the synthesis of starch attending to the supply of the substrates Glc-1-P and ATP. However, to be able to ascertain the role of the different APL isoforms, it will be necessary to determine the level of 3-PGA and Pi in the plastids of the different tissues where they are expressed.
In conclusion, we have studied the kinetic and regulatory interactions between all of the ADP-Glc PPase subunits present in A. thaliana. We have found differences on the regulatory properties conferred by the Arabidopsis large subunits to ADP-Glc PPase in vitro. The distinction between sink and source APL proteins points to the possibility that starch synthesis is modulated in response to 3-PGA and Pi, as well as to the level of substrates, in a tissue-specific manner. As depicted in Fig. 4, ADP-Glc PPase heterotetramers formed by APS1 and APL1 are very sensitive to the effectors, display high apparent affinity for the substrates, and would by finely regulated in source tissues. On the other hand, in sink tissues heterotetramers could be formed by APS1 and APL2, APL3, and APL4, with lower sensitivity to the effectors and lower affinity for substrates. However, combination of the different LS would provide even more plasticity to ADP-Glc PPase because in different situations more than one LS could be expressed in a given tissue. This situation could take place in other plants having different isoforms of ADP-Glc PPase and may be a general system by which starch synthesis is differentially controlled in sink and source tissues and organs.
|
![]() |
FOOTNOTES |
---|
¶ To whom correspondence should be addressed. Tel.: 34-954489526; Fax: 34-954460065; E-mail: jmromero{at}ibvf.csic.es.
1 The abbreviations used are: ADP-Glc, adenosine diphosphate glucose; ADP-Glc
PPase, ADP-glucose pyrophosphorylase; Glc-1-P, glucose-1-phosphate; 3-PGA,
3-phosphoglycerate; LS, ADP-Glc pyrophosphorylase large subunit(s); SS,
ADP-Glc pyrophosphorylase small subunit(s).
2 P. Crevillén, unpublished results.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|