From the Biochemie-Zentrum Heidelberg (BZH), University of
Heidelberg, Im Neuenheimer Feld 328, D-69120 Heidelberg, Germany and
Laboratoire de Biochemie, Institut de Biologie
Moléculaire et Cellulaire du CNRS, 15 rue Rene Descartes,
F-67084 Strasbourg Cedex, France
Received for publication, September 22, 2000, and in revised form, November 7, 2000
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Eukaryotic aminoacyl-tRNA synthetases, in
contrast to their prokaryotic counterparts, are often part of high
molecular weight complexes. In yeast, two enzymes, the methionyl- and
glutamyl-tRNA synthetases associate in vivo with the
tRNA-binding protein Arc1p. To study the assembly and function of this
complex, we have reconstituted it in vitro from
individually purified recombinant proteins. Our results show that Arc1p
can readily bind to either or both of the two enzymes, mediating the
formation of the respective binary or ternary complexes. Under
competition conditions, Arc1p alone exhibits broad specificity and
interacts with a defined set of tRNA species. Nevertheless, the
in vitro reconstituted Arc1p-containing enzyme complexes
can bind only to their cognate tRNAs and tighter than the corresponding
monomeric enzymes. These results demonstrate that the organization of
aminoacyl-tRNA synthetases with general tRNA-binding proteins into
multimeric complexes can stimulate their catalytic efficiency and,
therefore, offer a significant advantage to the eukaryotic cell.
The function of aminoacyl-tRNA synthetases establishes the
faithful translation of the genetic code, since these enzymes catalyze the coupling of tRNAs to their cognate amino acids (1, 2). The 20 different aminoacyl-tRNA synthetases, one for each amino acid, can be
assigned to two classes (I and II), depending on the sequence and
structure of their conserved catalytic domains (3, 4). The enzymes also
contain additional idiosyncratic domains that are attached to or
inserted in the class-defining catalytic core and are responsible for
binding the cognate tRNAs (5). Enzymes from yeast and higher eukaryotes
are further characterized in comparison to the corresponding
prokaryotic enzymes by the addition of extensions to the N or C
termini, which are often dispensable for activity (6-10). However,
more recent data suggest that, in several cases, these appended domains
can bind nonspecifically to RNA and, therefore, may facilitate the
association of the synthetases with their cognate tRNAs (10-16). An
alternative function of the eukaryote-specific appendices may be
protein interactions that lead to the assembly of multisynthetase
complexes (17-20), although the catalytic domains may also contribute
to the formation of these complexes (20). Higher eukaryotes indeed
contain a supramolecular multienzyme complex comprised of nine
aminoacyl-tRNA synthetases and three nonenzymatic polypeptides of 43, 38, and 18 kDa called p43 (pro-EMAPII), p38, and p18, respectively
(21-24). The function of this complex is still unclear. It is possible
that the association of the synthetases with the other components of
the complex may modulate their activity, as has been shown in the case
of human ArgRS, whose activity can be stimulated by the interaction
with p43 (25).
We previously identified in yeast a smaller complex of aminoacyl-tRNA
synthetases consisting of two class I enzymes, methionyl-tRNA (MetRS)1 and glutamyl-tRNA
(GluRS) synthetases, and the protein Arc1p, which is the yeast
homologue of p43 (26, 27). Subsequently, it was shown that Arc1p
associates with the two enzymes of the complex through its N-terminal
domain, whereas its C-terminal part harbors a tRNA binding domain
(TRBD) (28). The biggest part of the TRBD is conserved between yeast
Arc1p and mammalian p43 and is also found fused at the C-terminal end
of the catalytic domain of the human tyrosyl-tRNA synthetase (29).
Human TyrRS as well as p43 can be targets of proteolytic enzymes during
apoptosis (30-33). This results in the release of the corresponding
TRBDs, which can act as EMAP II (endothelial monocyte-activating
polypeptide)-like cytokines, possibly linking the progression of
apoptosis to the inhibition of protein translation (reviewed in Ref.
34). Recently, the structure of the TRBD of p43 has been solved,
showing that it adopts an OB fold, an oligonucleotide binding
structural motif also found in the anticodon binding domains of class
IIb aminoacyl-tRNA synthetases (35). Part of the TRBD of Arc1p is also
conserved in prokaryotes as a domain of two synthetases, MetRS and
PheRS (26), or as an independent polypeptide, Trbp111 (36). Trbp111 has
indeed been characterized as a structure-specific tRNA-binding protein,
which may stabilize the L-shape of tRNA (36). In yeast, the presence of
TRBD in Arc1p is necessary for the stimulation of the catalytic
efficiency of MetRS by increasing its apparent affinity for
tRNAMet (28). Arc1p is required for optimal cell growth and
is essential for viability in the absence of the tRNA nuclear export
factor Los1p (26). Indeed, tRNA aminoacylation has been shown to be required for efficient nuclear tRNA export in yeast (37, 38).
To understand the molecular details of the function of Arc1p in tRNA
aminoacylation, we attempted the in vitro reconstitution of
its complex with tRNA and/or the two aminoacyl-tRNA synthetases. Our
results show that the formation of the Arc1p·MetRS·GluRS complex can occur in vitro, requiring no other factors. Furthermore,
although Arc1p has a broad specificity for tRNAs, its association with the synthetases facilitates the interaction exclusively with the corresponding cognate tRNAs and leads to stimulation of aminoacylation efficiency. These data can explain why eukaryotic aminoacyl-tRNA synthetases are organized into multimeric complexes containing additional tRNA-binding proteins of broad specificity.
Construction of Plasmids Expressing His8-MetRS and
His8-GluRS--
To overproduce eight histidine-tagged
MetRS and GluRS in yeast, the vector pEMBLyex4, with the selectable
markers URA3 and the poorly expressed leu2-d
allele of LEU2, which increases the copy number of the
plasmid under leucine-selecting conditions (39, 40), was modified to
create vector pEMBLyex4-His8. A small DNA piece,
constructed by annealing two complementary synthetic oligonucleotides,
was inserted at the BamHI site at the 5' end of the
polylinker of pEMBLyex4, adding the sequence 5'- GATCGATGCACCACCACCACC ACCACCACCACCTGGAGG-3'. This codes for the start methionine
followed by eight histidines and contains a XhoI restriction
site at the 3' end (underlined) to facilitate the selection of the
correctly ligated constructs. Only the BamHI site at the 3'
end of the new sequence was regenerated. The ORF of MetRS was amplified
by polymerase chain reaction using as template plasmid pUN100-MES1 (26)
and primers that created a BamHI restriction site before the
second codon and a PstI restriction site in the
3'-untranslated region of the gene. The ORF was then cloned into
pEMBLyex4-His8 previously cut with
BamHI/PstI, which created a coding
sequence for an in-frame fusion protein of eight histidine residues
joined by a spacer Leu-Glu-Gly tripeptide to the amino acid immediately
after the start methionine of the original MetRS ORF (plasmid
pEMBLyex4-His8-MetRS). The ORF of GluRS was amplified by
polymerase chain reaction using as template yeast genomic DNA and
primers that created a XbaI restriction site before the
second codon and a PstI restriction site in the
3'-untranslated region of the gene. The ORF was then also cloned into
pEMBLyex4-His8 previously cut with
XbaI/PstI, which created a coding sequence
for a fusion protein containing eight histidine residues joined by a
spacer Leu-Glu-Gly-Ser-Ser-Arg hexapeptide to the amino acid
immediately after the start methionine of the original GluRS ORF
(plasmid pEMBLyex4-His8-GluRS). The inserts containing the
fusion proteins were sequenced, and no mutations could be found.
Protein Purification--
Purification of recombinant epitope
(His6)-tagged Arc1p and Arc1p deletion mutants or Arc1p
domains from Escherichia coli and untagged full-length MetRS
from an overproducing yeast strain was performed as described
previously (26, 28, 41). The epitope-tagged His8-MetRS and
His8-GluRS were purified as follows: plasmids
pEMBLyex4-His8-MetRS and pEMBLyex4-His8-GluRS
were transformed to haploid RS453 yeast cells. Cultures of the
transformed yeast cells were grown in SDC-leu medium to an
A600 nm between 0.5 and 1. The cells
were then collected by centrifugation, re-suspended in 1 liter of
galactose containing SGC-leu minimal medium at an A600 nm of 0.4, and grown for 14 h
to an A600 nm of ~1.7. The cells were
collected by centrifugation, spheroplasted with Zymolyase 20T
(Seikagaku Corp.), and stored at Binding Assays and Gel Filtration--
Protein-protein and
protein-tRNA binding reactions were performed by mixing the individual
proteins, yeast tRNAPhe (Sigma) or total yeast tRNA (Roche
Molecular Biochemicals) in a total volume of 150-250 µl of binding
buffer (20 mM HEPES, pH 7.4, 150 mM NaCl, 5 mM MgCl2, 10% glycerol) and incubating at 30 °C for 30 min. After the end of the incubation, the mixture was
spun at 14.000 rpm on an Eppendorf tabletop centrifuge for 15 min at
4 °C, and 100-200 µl of the supernatant were loaded onto a
Superdex 200 HR 10/30 column (Amersham Pharmacia Biotech). The column
was eluted with binding buffer at a flow rate of 0.4 ml/min, and 0.5-ml
fractions were collected. The fractions that exhibited detectable
absorption at 280 nm were analyzed by SDS-PAGE and, when appropriate,
by RNA extraction followed by electrophoresis on 10%
urea-polyacrylamide denaturing gels. To calculate apparent molecular
masses from the elution volumes, the column was calibrated using the
gel filtration standard by Bio-Rad.
Aminoacylation Assay--
The aminoacylation activity of
His8-GluRS alone or in complex with Arc1p was determined as
follows. 50 nM of enzyme was added to 200 µl of reaction
mixture containing 144 mM Tris-Cl, pH 7.8, 10 mM MgCl2, 5 mM dithiothreitol, 1.2 mg/ml bovine serum albumin, 2 mM ATP, 6 mg/ml total yeast
tRNA (Roche Molecular Biochemicals), and 0.1 mM
L-[1-14C]glutamic acid (specific activity 56 mCi/mmol), and the reaction mixture was incubated at 25 °C. At
various time intervals 40-µl aliquots were spotted onto Whatman paper
discs pre-soaked with 5% trichloroacetic acid to quench the reaction.
The filters were washed three times with cold trichloroacetic acid
containing 1 mM glutamic acid and three times with 70%
ethanol, dried, and counted for radioactivity in scintillation liquid.
Miscellaneous Procedures--
Protein concentrations were
determined using the protein assay reagent from Bio-Rad. SDS-PAGE, DNA
manipulations (restriction digests, ligations, polymerase chain
reaction amplifications, etc.), RNA extraction, and Northern analysis
were performed according to standard protocols. Detection of tRNAs on
Northern blots was done using end-labeled synthetic DNA
oligonucleotides complementary to tRNA-specific sequences. The
sequences of the oligonucleotides used for polymerase chain reaction or
Northern are available upon request.
Arc1p Binds Preferentially to a Subset of tRNA Species--
To
reconstitute and isolate Arc1p complexes with tRNA or aminoacyl-tRNA
synthetases, we chose to use gel filtration as a method for separating
the bound from the free complex components. We first analyzed the
migration of recombinant Arc1p on a Superdex 200 gel filtration column.
According to its amino acid sequence, Arc1p has a predicted molecular
mass of 42 kDa. However, recombinant Arc1p was eluted from the column
as a symmetrical peak with an apparent molecular mass of 90 kDa (Fig.
1A). To find out which part of
Arc1p may be responsible for this aberrant migration, we analyzed
individual Arc1p domains or Arc1p deletion mutants. The results show
that the N- and C-terminal domains of Arc1p behaved as monomers (Table
I). The Arc1-
To isolate a stable Arc1p·tRNA complex, recombinant Arc1p was
incubated with yeast tRNAPhe, and the mixture was then
loaded on the Superdex 200 column. Elution revealed two peaks (Fig.
1B), as compared with one peak when tRNA was analyzed alone
(Fig. 1C). Protein and RNA electrophoresis demonstrated that
the 35-kDa peak contained only tRNAPhe, whereas the 90-kDa
peak contained both Arc1p and tRNAPhe. Therefore, a
significant amount of tRNA was bound to Arc1p. We then went on to
investigate the specificity of Arc1p by challenging it with a
population of different tRNAs. Arc1p was incubated with total yeast
tRNA, and the mixture was then loaded onto the column (Fig. 1D). As a
control, total yeast tRNA was also analyzed in the absence of Arc1p
(Fig. 1E). The Arc1-tRNA mixture gave two peaks, one
corresponding to free tRNAs (Pool B) and one corresponding to Arc1p and
the Arc1p·tRNA complexes (Pool A). RNA extraction followed by
electrophoresis revealed the presence of several tRNA species in this
latter peak. To identify the tRNAs that associate with Arc1p, we
performed extensive Northern analysis using probes against 16 different
major isoacceptor tRNAs. As can be seen in Fig.
2A, these tRNAs can be divided
in three groups. The first group ("strong binders") contains tRNAs
that bind significantly to Arc1p and includes tRNAGlu,
elongator tRNAMet, tRNAPhe,
tRNALys, and tRNAArg. In the second group
("weak binders"), the amount of bound tRNA represents only a small
fraction of the total tRNA. Finally, in the third group
("nonbinders"), no tRNA could be detected comigrating with
Arc1p.
To confirm these results and to check whether the N-terminal domain of
Arc1p plays a role in tRNA binding specificity, we repeated the
analysis using the Arc1- The Arc1p·MetRS Complex Binds Specifically to Elongator
tRNAMet--
We then tried to reconstitute the
Arc1p·MetRS complex to test its tRNA binding abilities compared with
monomeric MetRS. First, purified MetRS was applied to the gel
filtration column. The elution profile shows that MetRS migrated with
an apparent molecular mass of 90 kDa, confirming its monomeric nature
(Fig. 3A). When MetRS was
pre-mixed with recombinant Arc1p, they were both eluted together as a
heterodimer (Fig. 3A). This shows that Arc1p and MetRS can readily associate in vitro, forming a stable complex. The
size of this complex as well as its composition as analyzed by SDS-PAGE strongly suggest that it contains equimolar amounts of Arc1p and MetRS.
Previous in vivo data suggest that the Arc1p-MetRS
interaction is mediated by the N domain of Arc1p (28). To also show
that in vitro, we used the N domain instead of full-length
Arc1p. As can be shown in Fig. 3B, Arc1-N and MetRS
associate readily to form a 132-kDa complex (the second peak with a
molecular mass of 20 kDa corresponds to free Arc1-N, which was added in
excess).
We then tested both monomeric MetRS and the Arc1p·MetRS complex for
binding to tRNA by incubating them with total yeast tRNA. Analysis of
the MetRS-tRNA mixture by gel filtration showed that no tRNA could be
detected in the fractions containing MetRS, indicating a lack of stable
binding (Fig. 4). In contrast, one or
possibly two tRNA species coeluted with the Arc1p·MetRS complex. To
identify these tRNA species, we used Northern analysis as described
above. This analysis (Fig. 4B) showed that elongator
tRNAMet shifted completely from the fractions containing
the free pool of tRNA to the fractions containing the Arc1p·MetRS
complex, indicating high affinity binding of this tRNA to the complex.
Initiator tRNAMet could also be detected in association
with the Arc1p·MetRS complex; however, the amount was smaller
compared with what remained in the free pool. This confirms the
previous observation that initiator tRNAMet is a poor
binder for Arc1p. Apart of elongator and initiator tRNAMet,
none of the other 11 tRNAs that were tested could be significantly recovered in the Arc1p·MetRS peak. These results show that high affinity binding of the cognate tRNA to MetRS can only be achieved when
the enzyme is associated with Arc1p. In the Arc1p·MetRS complex, therefore, MetRS determines the specificity, whereas Arc1p provides the
affinity for the interaction with tRNA.
Overexpression and Purification of Histidine-tagged GluRS and MetRS
from Yeast--
To reconstitute the ternary Arc1p· MetRS·GluRS
complex, we needed to produce GluRS, which had never been purified
before from yeast, as well as additional amounts of MetRS. To
facilitate purification, the two enzymes were tagged at their N termini
with a stretch of eight histidines and overexpressed in yeast cells.
Soluble cell lysates were passed through a nickel nitrilotriacetic acid column, and elution by 250 mM imidazole led to the
efficient recovery of His8-MetRS or His8-GluRS
(Fig. 5). To ensure removal of minor contaminants, the proteins were further purified by ion exchange chromatography on a MonoQ column (Fig. 5). The purification scheme proved to be very efficient since ~1.2 mg of purified tagged MetRS or
GluRS could be recovered from a 1-liter culture of the corresponding overexpressing yeast cells.
Reconstitution of the Ternary Arc1p·MetRS·GluRS
Complex--
Purified His8-MetRS and
His8-GluRS were loaded onto the gel filtration column alone
or after being mixed and incubated with one another or with roughly
equimolar amounts of Arc1p. The results of these experiments are
summarized in Fig. 6A and
Table I. When applied alone, both enzymes were eluted from the column
as monomers. When incubated together, His8-MetRS and
His8-GluRS remained monomeric, showing that no direct
interaction can take place between them in vitro. However,
incubation with Arc1p resulted in the formation of stable dimeric and
stoichiometric complexes, both, in the case of His8-MetRS
and His8-GluRS. Finally, incubation of both enzymes together with Arc1p led to the assembly of all three components into a
ternary complex with an apparent stoichiometry of 1:1:1. As in the case
for the Arc1p·MetRS complex, the N domain of Arc1p was sufficient to
convey association with His8-GluRS (Fig. 6B and
Table I). Moreover, the 20-kDa N domain of Arc1p could accommodate the
interactions with both aminoacyl-tRNA synthetases (Fig. 6B). Therefore, the N domain of Arc1p is the central component of the Arc1p-synthetase complex and must contain binding sites for both MetRS
and GluRS.
Arc1p Enhances the Interaction between GluRS and the
Cognate tRNAGlu and Stimulates Its Aminoacylation
Efficiency--
To test the effect of Arc1p on GluRS, monomeric
His8-GluRS or the in vitro reconstituted
Arc1p·His8-GluRS binary complex was incubated with total
yeast tRNA and applied to the gel filtration column. As shown in Fig.
7A, a single tRNA species
bound to and coeluted with His8-GluRS (Pool III). Northern
analysis (Fig. 7B) demonstrated that this tRNA species
corresponds to the cognate tRNAGlu. As estimated by
scanning the autoradiograms, almost 40% of the tRNAGlu in
the total yeast tRNA mixture shifted to fractions containing His8-GluRS, showing that, unlike MetRS, monomeric
His8-GluRS is able to form a stable complex with its
cognate tRNA. The stability of this complex was significantly increased
in the presence of Arc1p. More than 80% of the total
tRNAGlu shifted to the fractions (Pools I-III) containing
the Arc1p·His8-GluRS complex (Fig. 7B).
Noncognate tRNAs were not enriched in these fractions. The fact that
Arc1p can stimulate the binding of tRNAGlu to GluRS
suggests that Arc1p can also modulate the aminoacylation efficiency of
GluRS. To test this, we performed aminoacylation assays using as enzyme
source monomeric His8-GluRS or equimolar amounts of the
pre-formed Arc1p·His8-GluRS complex. As shown in Fig.
8, the aminoacylation activity of the
complex was more than 2-fold higher than that of monomeric
His8-GluRS. When instead of using the pre-formed complex,
Arc1p was simply mixed with His8-GluRS before the assay, a
stimulation of the activity was also observed. However, this
stimulation was lower, probably due to the fact that not all of
His8-GluRS associated with Arc1p under the conditions of
the assay. From these results we can conclude that Arc1p can stimulate
the catalytic efficiency of both the aminoacyl-tRNA synthetases it
associates with.
The Ternary Arc1p·MetRS·GluRS Complex Can Select and Bind
Efficiently to Both Cognate tRNAs--
We have shown so far that the
binary Arc1p·MetRS and Arc1p·GluRS complexes are capable of
interacting with their corresponding cognate tRNAs more efficiently
than the respective monomeric enzymes. We then tested if this is also
true for the Arc1p·MetRS·GluRS ternary complex. As shown in Fig.
9, incubation of the ternary complex with
total yeast tRNA followed by gel filtration resulted in a dramatic
shift of both elongator tRNAMet and tRNAGlu
from the pool of the free tRNA to the fractions containing the protein
complex. This suggests a very efficient tRNA selection and binding. The
initiator tRNAMet, in contrast, was only very weakly bound,
whereas the noncognate tRNAPhe was completely absent from
the fractions containing the complex. The exact comigration of the two
tRNAs that bind to the complex might suggest that two tRNA molecules,
one for Glu and the other for Met, can simultaneously bind to the
ternary complex in an Arc1p-dependent way. However, because
the binding of the tRNAs does not cause a significant shift in the
molecular mass of the complex (see Table I), it is also possible that
two comigrating complex populations are formed, one containing only
tRNAMet and the other only tRNAGlu. In either
case, these results show clearly that association of the two enzymes
with Arc1p offers them a strong advantage in terms of specific tRNA
binding.
Our previous identification of a stable in vivo complex
between Arc1p and two aminoacyl-tRNA synthetases in yeast, GluRS and MetRS (26, 28), and its implication in both aminoacylation and tRNA
intracellular transport raised a number of questions. Is this complex
important for the folding and stability of its protein components? Are
other factors such as protein chaperones and tRNA required for the
efficient assembly of the complex? How can the apparent nonspecific
tRNA binding properties of Arc1p be reconciled with the highly specific
synthetase-cognate tRNA interaction? Finally, how does association with
Arc1p affect the activity of the enzymes? To address these questions,
we first had to purify the individual components, Arc1p, MetRS, and
GluRS. Arc1p was produced in E. coli (28). The purification
of yeast GluRS, which has never been tried successfully before, was
achieved by combining epitope tagging and overexpression in yeast. This allowed the recovery of essentially pure GluRS in a single
chromatographic step, which minimized protein degradation and allowed
high yields. The general applicability of this method was demonstrated
for yeast MetRS, which was also purified conventionally (41).
Having the individual proteins in hand, we then attempted the in
vitro reconstitution of their complex. It is now clear from our
results that Arc1p or even its N-terminal domain alone can associate
readily with either or both of GluRS- and MetRS-forming stable binary
or ternary complexes, respectively. Furthermore, we have shown that
under competition conditions, when Arc1p is challenged with a mixture
of different tRNAs, it exhibits a certain degree of specificity and
binds strongly to a limited number of tRNA species. Therefore, the
presence of Arc1p in the complex may mediate the pre-selection of a
certain class of tRNA species with common sequence elements, thus
facilitating the final selection of the cognate tRNAs by the
synthetases. Indeed, our binding experiments have shown that only the
cognate tRNAs can bind tightly to the enzymes when in complex with
Arc1p, so their binding specificity is not at all compromised while
their binding affinity is significantly enhanced. This cooperation
between Arc1p and the synthetases in tRNA binding may not only be due
to the addition of the corresponding affinities but may also reflect
the stabilization of favorable conformational states upon complex
formation. In either case, the properties of Arc1p demonstrate a
general principle that has recently emerged in the field of
aminoacyl-tRNA synthetases: nonspecific tRNA binding domains (that
recognize structural features of the tRNA) can facilitate the specific
interactions between a synthetase and the cognate tRNA.
The function of these, usually nonessential, nonspecific tRNA binding
domains has been established in a number of cases. Yeast glutaminyl-tRNA synthetase contains an N-terminally appended
noncatalytic domain that has general RNA binding properties (14, 15).
Fusion of this sequence to the E. coli
glutaminyl-tRNA synthetase, which lacks a similar domain,
renders the bacterial enzyme capable of substituting yeast
glutaminyl-tRNA synthetase both in vitro and in
vivo (13). Yeast aspartyl-tRNA synthetase also contains an N-terminal extension that can bind to tRNA (16). This domain is not
found in the prokaryotic homologue but is conserved in other eukaryotic
class IIb synthetases. In the mammalian bifunctional glutamylprolyl
synthetase, the linker sequence between the two catalytic domains
contains repeats of a 50-amino acid long motif, which is also conserved
in the appended domains of six other metazoan synthetases (12). This
motif forms an antiparallel coiled-coil and has general RNA binding
capacity (12). In all these cases, the nonspecific RNA binding domains
always serve as cis-acting cofactors since they are part of
the same polypeptide as the catalytic core. This is in contrast to the
TRBD of Arc1p that appears to act only in trans in yeast,
although it may act both in trans (as part of the
noncatalytic multisynthetase complex component p43) or in
cis (connected to the catalytic domain of TyrRS) in human.
A reason for this inter-molecular (trans) mode of action may
simply be economy; Arc1p as part of the Arc1p·MetRS·GluRS complex can simultaneously "serve" two synthetases, whereas p43 is in contact with almost all the enzymes of the multisynthetase complex (42)
and can potentially modulate the activities of several of them.
Although MetRS and GluRS were the only enzymes that could be coisolated
with Arc1p by affinity purification (26), it is still possible that
Arc1p may interact with additional synthetases, forming weaker and
therefore not easily detectable complexes. This could explain the
preferential binding of Arc1p not only to tRNAGlu and
tRNAMet but also to tRNAPhe,
tRNALys, and tRNAArg (Fig. 2A). When
the tRNA sequences are compared, a combination of bases can be found
that is unique for these five tRNAs (shown in Fig. 2B). Most
of these elements are located close to the central core of the tRNA
structure and, together with the invariant bases, may constitute
positive determinants for the interaction with Arc1p, which requires
the L-shape of the tRNA (26).
It is not clear from our data if Arc1p is a monomer in solution or if
it forms dimers. Our gel filtration experiments show an aberrant
migration of recombinant Arc1p, which is clearly due to the presence of
the middle (M) domain (Table I). The most likely explanation is that
this domain triggers dimerization of Arc1p. However, we were not able
to detect an Arc1p homodimer in vivo when a protein A-tagged
version of Arc1p was expressed in yeast cells containing also
endogenous Arc1p.2 It may
also be possible that the largely unstructured and positively charged M
domain (26), which lies between the two globular N and C domains,
causes the Arc1p monomer to display a larger Stokes radius that
predicted. Another interesting possibility that could reconcile our
data is that when Arc1p is alone in solution, a homodimer is formed,
which, however, dissociates upon binding of tRNA or the aminoacyl-tRNA
synthetases. Indeed, the Arc1p·tRNA complex displays a similar
apparent molecular mass as Arc1p (Fig. 1B), and the
Arc1p·synthetase complexes are stoichiometric. Certainly, additional
biophysical experiments such as sedimentation or light-scattering analyses are required to establish unequivocally the monomeric or
dimeric nature of recombinant Arc1p in solution.
Arc1p not only affects the binding affinity of MetRS and GluRS for
their cognate tRNAs but also modulates their catalytic efficiency. We
have previously shown that when Arc1p is bound to MetRS, it increases
almost 500-fold its catalytic efficiency mainly due to the dramatic
decrease of Km (28). In this report we show that
Arc1p can also stimulate the aminoacylation efficiency of GluRS.
Although we were not able to determine the catalytic constants of this
reaction due to the unavailability of purified yeast
tRNAGlu, we think that this stimulation is, at least
to some extent, due to the higher apparent affinity of the
Arc1p·GluRS complex for tRNAGlu. Therefore, both enzymes
that associate with Arc1p in yeast obtain a catalytic advantage. An
additional feature of the TRBD of Arc1p is that it can remain
functional when it is artificially transplanted to the catalytic domain
of a synthetase other than MetRS or GluRS. Previous experiments show
that the fusion of the TRBD to the E. coli
glutaminyl-tRNA synthetase allows the enzyme to aminoacylate the
heterologous yeast tRNAGln, whereas fusion of the TRBD to a
fragment of E. coli alanine-tRNA synthetase AlaRS stimulates
its activity toward a microhelix (14, 43). In both these cases, the
fusion proteins must be exploiting the general RNA binding properties
of the TRBD.
Taking into account the results discussed above, the following question
can be raised. Why do the eukaryotic aminoacyl-tRNA synthetases need
the higher affinity for tRNA, which is provided by the cis-
or trans-acting nonspecific tRNA binding domains? The answer
to this question may lie in the fact that the eukaryotic cell is highly
compartmentalized. Recent observations indicate that aminoacyl-tRNA
synthetases may also be found inside the nucleus where they charge the
newly synthesized mature tRNAs (38, 44-46). Indeed, aminoacylation of
tRNAs facilitates their nuclear export both in yeast and higher
eukaryotes (37, 38, 44). Experiments based on fluorescent in
situ hybridization show that the concentration of mature tRNAs
inside the yeast nucleus is significantly lower than in the cytoplasm
(37, 47). Therefore, the nuclear aminoacyl-tRNA synthetases have to
work efficiently with low concentrations of tRNA, and in this case, a
high tRNA affinity becomes indispensable. The additional affinity for
tRNA may actually also be required to facilitate the release of mature
tRNA from the nuclear tRNA-processing and modification machinery and,
thus, enhance the efficiency of transport into the cytoplasm (48).
Therefore, it is not by chance that Arc1p was originally identified by
its strong genetic interaction with Los1p, a yeast nuclear tRNA export
factor (49, 50). Even in the cytoplasm, the concentration of free tRNA
is thought to be very low, as tRNAs are "channeled" between the
components of the translation machinery and do not simply dissociate
and diffuse between ribosomes, aminoacyl-tRNA synthetases, and
translation factors (51, 52). Therefore, the importance of the inter- or even intramolecular association of aminoacyl-tRNA synthetases with
protein domains that increase tRNA affinity may be underestimated by
in vitro experiments and only become vital for efficient
aminoacylation as well as transport of tRNA in vivo.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
20 °C. 2 g of frozen
spheroplasts were re-suspended in 40 ml of lysis buffer (LB: 50 mM Tris-Cl, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol, 10%
glycerol, 20 mM imidazole) containing a mixture of protease inhibitors (Complete, EDTA-free from Roche Molecular Biochemicals) and
1 mM Pefabloc (Roth) and lysed with 20 strokes in a Dounce homogenizer. The homogenate was cleared by centrifugation at 27000 × g for 30 min, and the supernatant was applied onto a
nickel nitrilotriacetic acid resin (Qiagen, Hilden, Germany) column
(bed volume: 0.5 ml) that was then washed with lysis buffer until no more protein could be detected in the eluate. Bound proteins were then
eluted by 4 ml of LB containing 250 mM imidazole, dialyzed against MonoQ buffer (20 mM Tris-Cl, pH 8.0, 5 mM MgCl2, 1 mM dithiothreitol, 10%
glycerol), loaded onto a MonoQ HR 5/5 column (Amersham Pharmacia
Biotech) equilibrated in the same buffer and, eluted with a NaCl
gradient. His8-MetRS was eluted with ~230 mM NaCl, whereas His8-GluRS was eluted with ~130
mM NaCl. The peak fractions were frozen in liquid nitrogen
and kept at -80 °C. In all purification steps the identity of the
purified protein bands was verified with Western blotting using
anti-MetRS polyclonal antibodies for the detection of
His8-MetRS and monoclonal antibodies against the histidine
tag (BAbCO, Berkeley, CA) for the detection of
His8-GluRS.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
M mutant, lacking the
middle (M) domain, migrated with an apparent molecular mass close to the theoretical one. In contrast, the mutants Arc1-
N and Arc1-
C, both containing the M domain, displayed a much higher apparent molecular mass than predicted. Therefore, the aberrant migration of
Arc1p must be due to the presence of the M domain, which may cause
formation of dimers (see also "Discussion").
View larger version (35K):
[in a new window]
Fig. 1.
Reconstitution of a stable Arc1p·tRNA
complex and separation by gel filtration. Samples (100 µl)
containing 60 µg of Arc1p alone (A), 60 µg of Arc1p
pre-incubated with 35 µg of tRNAPhe (B), 35 µg of tRNAPhe alone (C), 60 µg of Arc1p
pre-incubated with 100 µg of total yeast tRNA (D), and 100 µg of total yeast tRNA alone (E) were passed through the
Superdex 200 column. Absorption at 280 nm was monitored during the
elution. 10 µl of each fraction (as indicated by numbers)
were analyzed for protein by SDS-PAGE and Coomassie Blue staining, and
60 µl were analyzed for RNA by phenol extraction and electrophoresis
on urea-polyacrylamide gels followed by ethidium bromide staining. Only
the relevant parts of the gels are shown, and the positions of Arc1p,
tRNA, and 5 S rRNA are indicated. In A-C, the
arrows indicate the molecular masses that correspond to the
elution volume of the absorption peaks. In D and
E, the brackets indicate the fractions that would
contain Arc1p (Pool A) and the ones containing free tRNA
(Pool B).
Predicted and apparent molecular masses of Arc1p, Arc1p domains, and
Arc1p-complexes, as calculated from the amino acid sequences and the
elution volumes of Superdex 200
View larger version (55K):
[in a new window]
Fig. 2.
Arc1p binds to a subset of tRNA species.
A, the column fractions of the experiments shown in Fig.
1D (right panels) and 1E (left
panels) were analyzed by Northern using oligonucleotide probes
directed against the indicated major tRNA isoacceptors. Only the
relevant parts of the autoradiograms are shown. In the right
panels of Fig. 1, fractions 17-19 (Pool A) contain
tRNAs bound to Arc1p, whereas fractions 20-23 (Pool B)
contain free tRNAs. Note that in the absence of Arc1p (left
panels), the Pool A fractions do not contain any tRNA.
B, schematic representation of the three-dimensional
structure yeast tRNAPhe. Positions shown in gray
contain the invariable bases. Positions shown in black
contain the bases that are conserved in all the tRNA species that
interact strongly with Arc1p.
N mutant form. We obtained exactly the same
results (data not shown), showing that the relative affinity of Arc1p
for the tRNA species is determined solely by the TRBD that comprises
the middle (M) and C-terminal (C) parts of Arc1p. The TRBD recognizes
structural features that are common to all tRNAs. However, under
competition conditions, which better mimic the in vivo
situation, the TRBD binds preferentially to a subset of tRNA species,
i.e. it exhibits broad specificity. It is possible that the
tRNA species that binds strongly to Arc1p contains certain elements
that facilitate the TRBD-tRNA interaction. Indeed, examination of the
sequences of these tRNAs revealed a combination of nucleotides in
certain positions that is unique for the strong binders. Some of these
nucleotides, which include C2, G10,
C25, C32, A44, G45,
G51, G57, C63, and G71
(highlighted in Fig. 2B) may actually act as positive
determinants for the interaction with Arc1p (see also
"Discussion").
View larger version (30K):
[in a new window]
Fig. 3.
Reconstitution of the Arc1p·MetRS
complex. A, Arc1p forms a stable complex with MetRS.
Samples (100 µl) containing either 120 µg of purified MetRS alone
(dashed line and lower gel panel) or 120 µg of
purified MetRS pre-incubated with 60 µg of recombinant Arc1p
(continuous line and upper gel panel) were passed
through the Superdex 200 column. 12 µl of the indicated fractions
were analyzed by SDS-PAGE and Coomassie Blue staining. The
arrowheads point to the positions of Arc1p and full-length
MetRS in the gels. The weak band that runs faster than Arc1p and is
marked by an asterisk corresponds to a stable degradation
product of MetRS. B, the N-terminal domain of Arc1p (Arc1-N)
is sufficient for stable association with MetRS. A sample (100 µl)
containing 65 µg of MetRS pre-incubated with 65 µg of Arc1-N was
passed through the Superdex 200 column. 12 µl of the indicated
fractions were analyzed by SDS-PAGE. The positions of Arc1-N and
full-length MetRS in the gel are indicated by arrowheads.
The weak band that runs between MetRS and Arc1-N and is marked by an
asterisk corresponds to a stable degradation product of
MetRS.
View larger version (54K):
[in a new window]
Fig. 4.
The association of Arc1p with MetRS
stimulates binding of the cognate tRNA. A, a sample
(100 µl) containing 65 µg of purified MetRS pre-incubated with 100 µg of total yeast tRNA (left panels) or 65 µg of
purifIed MetRS pre-incubated with 35 µg of recombinant Arc1p and 300 µg of total yeast tRNA (right panels) was chromatographed
through a Superdex 200 column. 60 µl of each column fraction were
analyzed for RNA as in Fig. 1. B, the column fractions of
the experiments shown in A were analyzed by Northern blot
using oligonucleotide probes directed against the indicated major tRNA
isoacceptors.
View larger version (63K):
[in a new window]
Fig. 5.
Purification of eight histidine-tagged MetRS
(A) and GluRS (B) from overexpressing
yeast strains. The panels show SDS-PAGE analysis of 10 µl of the following fractions: crude homogenate (H) of
yeast spheroplasts overexpressing His8-MetRS (A)
or His8-GluRS (B); pellet (P) and
supernatant (S) after centrifugation at 15000 × g for 15 min; flow-through (FT) and 250 mM imidazole eluate (E) of the nickel
nitrilotriacetic acid column; eluted fractions (as indicated by
numbers) from the MonoQ column. The positions of the tagged proteins
are indicated by arrows.
View larger version (36K):
[in a new window]
Fig. 6.
Reconstitution of the Arc1p·MetRS·GluRS
ternary complex. A, a ternary complex can be formed
in vitro between Arc1p, MetRS, and GluRS. Arc1p (35 µg),
His8-MetRS (70 µg), and His8-GluRS (70 µg)
were incubated alone or in the indicated combinations in a solution of
200 µl and were loaded onto the Superdex 200 column. B,
the N domain of Arc1p is sufficient for the formation of the ternary
complex. Arc1-N (20 µg) was incubated alone or with 70 µg of
His8-GluRS or with both His8-MetRS (70 µg)
and His8-GluRS (70 µg) in a solution of 200 µl that was
subsequently loaded onto the Superdex 200 column. 15 µl of each
fraction were analyzed by SDS-PAGE and Coomassie Blue staining. The
arrowheads indicate the apparent molecular masses of the
protein elution peaks.
View larger version (62K):
[in a new window]
Fig. 7.
Binding of Arc1p to GluRS stimulates
association with the cognate tRNA. A,
His8-GluRS (60 µg) was incubated with 200 µg of total
yeast tRNA (left panels) or with 40 µg Arc1p and 200 µg
total yeast tRNA (right panels) in a volume of 200 µl. The
mixtures were then chromatographed through a Superdex 200 column. The
arrows indicate the position of the elution peak of
His8-GluRS (left) or of the
His8-GluRS·Arc1p complex (right). 60 µl of
each column fraction were analyzed for RNA as in Fig. 1. Column
fractions are indicated by brackets, and roman numerals
indicate the pooled fractions that were analyzed in (B). B,
the pooled column fractions of the experiments shown in A
were analyzed by Northern using oligonucleotide probes directed against
the indicated major tRNA isoacceptors.
View larger version (14K):
[in a new window]
Fig. 8.
Arc1p stimulates the aminoacylation activity
of GluRS. Time course of the aminoacylation of yeast tRNA by 50 nM His8-GluRS (squares), 50 nM His8-GluRS mixed with Arc1p before the assay
(triangles), and 50 nM of the pre-formed and
isolated Arc1p·His8-GluRS complex (circles).
Each point corresponds to the average of three independent
determinations.
View larger version (64K):
[in a new window]
Fig. 9.
The ternary Arc1p·MetRS·GluRS complex
selects the cognate tRNAs. A, Arc1p (40 µg) was
incubated together with His8-MetRS (60 µg),
His8-GluRS (60 µg), and total yeast tRNA (200 µg), and
the incubation mixture (200 µl) was applied onto a Superdex 200 column. 60 µl of each column fractions were analyzed for RNA as in
Fig. 1. B, the column fractions of the experiments shown in
A were analyzed by Northern using oligonucleotide probes
directed against the indicated major tRNA isoacceptots.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]() |
ACKNOWLEDGEMENTS |
---|
We thank M. Künzler and H. Grosshans for useful comments on the manuscript.
![]() |
FOOTNOTES |
---|
* This work was supported by Deutsche Forschungsgemeinschaft Research Grant SI 661/2-1 (to G. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ To whom correspondence should be addressed. Tel.: 06221-54-6757; Fax: 06221-54-43-69; E-mail: cg2@ix.urz.uni-heidelberg.de.
Published, JBC Papers in Press, November 7, 2000, DOI 10.1074/jbc.M008682200
2 G. Simos, unpublished observations.
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: MetRS, methionyl-tRNAsynthetase; GluRS, glutamyl-tRNA synthetase; TRBD, tRNA binding domain; ORF, open reading frame; PAGE, polyacylamide gel electrophoresis.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Martinis, S. A., Plateau, P., Cavarelli, J., and Florentz, C. (1999) Biochimie (Paris) 81, 683-700[CrossRef][Medline] [Order article via Infotrieve] |
2. |
Martinis, S. A.,
Plateau, P.,
Cavarelli, J.,
and Florentz, C.
(1999)
EMBO J.
18,
4591-4596 |
3. | Cusack, S. (1997) Curr. Opin. Struct. Biol. 7, 881-889[CrossRef][Medline] [Order article via Infotrieve] |
4. | Francklyn, C., Musier-Forsyth, K., and Martinis, S. A. (1997) RNA (N. Y.) 3, 954-960[Medline] [Order article via Infotrieve] |
5. | Ibba, M., Curnow, A. W., and Soll, D. (1997) Trends Biochem. Sci. 22, 39-42[CrossRef][Medline] [Order article via Infotrieve] |
6. | Mirande, M. (1991) Prog. Nucleic Acid Res. Mol. Biol. 40, 95-142[Medline] [Order article via Infotrieve] |
7. |
Reed, V. S.,
and Yang, D. C.
(1994)
J. Biol. Chem.
269,
32937-32941 |
8. | Kisselev, L., and Wolfson, A. D. (1994) Prog. Nucleic Acid Res. Mol. Biol. 48, 83-141[Medline] [Order article via Infotrieve] |
9. |
Weygand-Durasevic, I.,
Lenhard, D.,
Filipic, S.,
and Söll, D.
(1996)
J. Biol. Chem.
271,
2455-2461 |
10. | Wu, H., Nada, S., and Dignam, J. D. (1995) Biochemistry 34, 16327-16336[Medline] [Order article via Infotrieve] |
11. |
Rho, S. B.,
Lee, J. S.,
Jeong, E. J.,
Kim, K. S.,
Kim, Y. G.,
and Kim, S.
(1998)
J. Biol. Chem.
273,
11267-11273 |
12. |
Cahuzac, B.,
Berthonneau, E.,
Birlirakis, N.,
Guittet, E.,
and Mirande, M.
(2000)
EMBO J.
19,
445-452 |
13. |
Whelihan, E. F.,
and Schimmel, P.
(1997)
EMBO J.
16,
2968-2974 |
14. |
Wang, C. C.,
and Schimmel, P.
(1999)
J. Biol. Chem.
274,
16508-16512 |
15. |
Wang, C. C.,
Morales, A. J.,
and Schimmel, P.
(2000)
J. Biol. Chem.
275,
17180-17186 |
16. |
Frugier, M.,
Moulinier, L.,
and Giege, R.
(2000)
EMBO J.
19,
2371-2380 |
17. |
Rho, S. B.,
Lee, K. H.,
Kim, J. W.,
Shiba, K.,
Jo, Y. J.,
and Kim, S.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10128-10133 |
18. | Agou, F., and Mirande, M. (1997) Eur. J. Biochem. 243, 259-267[Abstract] |
19. |
Rho, S. B.,
Kim, M. J.,
Lee, J. S.,
Seol, W.,
Motegi, H.,
Kim, S.,
and Shiba, K.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
4488-4493 |
20. |
Kim, T.,
Park, S. G.,
Kim, J. E.,
Seol, W.,
Ko, Y. G.,
and Kim, S.
(2000)
J. Biol. Chem.
275,
21768-21772 |
21. |
Filonenko, V. V.,
and Deutscher, M. P.
(1994)
J. Biol. Chem.
269,
17375-17378 |
22. | Quevillon, S., and Mirande, M. (1996) FEBS Lett. 395, 63-67[CrossRef][Medline] [Order article via Infotrieve] |
23. |
Norcum, M. T.,
and Warrington, J. A.
(1998)
Protein Sci.
7,
79-87 |
24. | Quevillon, S., Robinson, J. C., Berthonneau, E., Siatecka, M., and Mirande, M. (1999) J. Mol. Biol. 285, 183-195[CrossRef][Medline] [Order article via Infotrieve] |
25. |
Park, S. G.,
Jung, K. H.,
Lee, J. S.,
Jo, Y. J.,
Motegi, H.,
Kim, S.,
and Shiba, K.
(1999)
J. Biol. Chem.
274,
16673-16676 |
26. | Simos, G., Segref, A., Fasiolo, F., Hellmuth, K., Shevchenko, A., Mann, M., and Hurt, E. C. (1996) EMBO J. 15, 5437-5448[Abstract] |
27. |
Quevillon, S.,
Agou, F.,
Robinson, J. C.,
and Mirande, M.
(1997)
J. Biol. Chem.
272,
32573-32579 |
28. | Simos, G., Sauer, A., Fasiolo, F., and Hurt, E. C. (1998) Mol. Cell 1, 235-242[Medline] [Order article via Infotrieve] |
29. |
Kleeman, T. A.,
Wei, D.,
Simpson, K. L.,
and First, E. A.
(1997)
J. Biol. Chem.
272,
14420-14425 |
30. |
Wakasugi, K.,
and Schimmel, P.
(1999)
J. Biol. Chem.
274,
23155-23159 |
31. |
Wakasugi, K.,
and Schimmel, P.
(1999)
Science
284,
147-151 |
32. |
Knies, U. E.,
Behrensdorf, H. A.,
Mitchell, C. A.,
Deutsch, U.,
Risau, W.,
Drexler, H. C.,
and Clauss, M.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
12322-12327 |
33. | Behrensdorf, H. A., van de Craen, M., Knies, U. E., Vandenabeele, P., and Clauss, M. (2000) FEBS Lett. 466, 143-147[CrossRef][Medline] [Order article via Infotrieve] |
34. |
Weiner, A. M.,
and Maizels, N.
(1999)
Science
284,
63-64 |
35. |
Kim, Y.,
Shin, J.,
Li, R.,
Cheong, C.,
Kim, K.,
and Kim, S.
(2000)
J. Biol. Chem.
275,
27062-27068 |
36. |
Morales, A. J.,
Swairjo, M. A.,
and Schimmel, P.
(1999)
EMBO J.
18,
3475-3483 |
37. |
Grosshans, H.,
Hurt, E.,
and Simos, G.
(2000)
Genes Dev.
14,
830-840 |
38. |
Sarkar, S.,
Azad, A. K.,
and Hopper, A. K.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
14366-14371 |
39. | Cesareni, G., and Murray, J. A. H. (1987) Genet. Eng. 9, 135-154 |
40. | Dente, L., Cesareni, G., and Cortese, R. (1983) Nucleic Acids Res. 11, 1645-1655[Abstract] |
41. | Despons, L., Senger, B., Fasiolo, F., and Walter, P. (1992) J. Mol. Biol. 225, 897-907[Medline] [Order article via Infotrieve] |
42. |
Norcum, M. T.,
and Warrington, J. A.
(2000)
J. Biol. Chem.
275,
17921-17924 |
43. |
Chihade, J. W.,
and Schimmel, P.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
12316-12321 |
44. |
Lund, E.,
and Dahlberg, S. G.
(1998)
Science
282,
2082-2085 |
45. | Schimmel, P., and Wang, C. C. (1999) Trends Biochem. Sci. 24, 127-128[CrossRef][Medline] [Order article via Infotrieve] |
46. |
Nathanson, L.,
and Deutscher, M. P.
(2000)
J. Biol. Chem.
275,
31559-31562 |
47. |
Sarkar, S.,
and Hopper, A. K.
(1998)
Mol. Biol. Cell
9,
3041-3055 |
48. |
Wolin, S. L.,
and Matera, A. G.
(1999)
Genes Dev.
13,
1-10 |
49. | Simos, G., Tekotte, H., Grosjean, H., Segref, A., Sharma, K., Tollervey, D., and Hurt, E. C. (1996) EMBO J. 15, 2270-2284[Abstract] |
50. |
Hellmuth, K.,
Lau, D. M.,
Bischoff, F. R.,
Künzler, M.,
Hurt, E. C.,
and Simos, G.
(1998)
Mol. Cell. Biol.
18,
6374-6386 |
51. | Negrutskii, B. S., and Deutscher, M. P. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4991-4995[Abstract] |
52. | Stapulionis, R., and Deutscher, M. P. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7158-7161[Abstract] |