From the Department of Molecular Biology and Biochemistry, University of California Irvine, Irvine, California 92697
Received for publication, September 18, 2000, and in revised form, November 6, 2000
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Human endothelial cells can be induced to form
capillary-like tubular networks in collagen gels. We have used this
in vitro model and representational difference analysis to
identify genes involved in the formation of new blood vessels. HESR1
(HEY-1/HRT-1/CHF-2/gridlock), a basic helix-loop-helix protein related
to the hairy/enhancer of split/HES family, is absent in migrating and
proliferating cultures of endothelial cells but is rapidly induced
during capillary-like network formation. HESR1 is detectable in all
adult tissues and at high levels in well vascularized organs such as
heart and brain. Its expression is also enriched in aorta and purified
capillaries. Overexpression of HESR1 in endothelial cells
down-regulates vascular endothelial cell growth factor receptor-2
(VEGFR2) mRNA levels and blocks proliferation, migration, and
network formation. Interestingly, reduction of expression of HESR1 by
antisense oligonucleotides also blocks endothelial cell network
formation in vitro. Finally, HESR1 expression is altered in
several breast, lung, and kidney tumors. These data are consistent with
a temporal model for HESR1 action where down-regulation at the
initiation of new vessel budding is required to allow VEGFR2-mediated
migration and proliferation, but re-expression of HESR1 is necessary
for induction of tubular network formation and continued maintenance of
the mature, quiescent vessel.
The formation of new blood vessels by angiogenesis is critical to
development of normal tissues as well as growth of solid tumors (1, 2).
Angiogenesis is a multistep sequence of distinct cellular processes
beginning with degradation of extracellular matrix, then proliferation,
and migration of endothelial cells (EC),1 followed by lumen
formation and functional maturation (3, 4). Currently, two families of
EC-specific growth factors are known to regulate these steps. The
vascular endothelial growth factors (VEGFs), together with the more
widely expressed and pleiotropic fibroblast growth factors (FGFs),
promote EC migration, proliferation, and tube formation (5-9). The
second family is composed of angiopoietins (Ang) 1-5, of which Ang-1
and Ang-2, acting through the Tie-2 receptor tyrosine kinase, are known
to be critical for the later processes of vessel maturation and
stabilization (10-12). The VEGFs, which can drive all of the early
stages of angiogenesis, act through two tyrosine kinase receptors,
VEGFR1 (flt-1) (13) and VEGFR2 (KDR/flk-1) (14).
EC also express neuropilin-1 and neuropilin-2, which only bind the
VEGF165 isoform (15).
Although transcription factors such as HIF and Tfeb are known to
mediate EC responses to specific angiogenic inducers (hypoxia and
placental growth, respectively (16, 17)), downstream events coordinating EC responses to general angiogenic growth factors remain
unknown. In particular, it is not clear how sequential cellular
processes can be triggered by continued or repeated exposure to the
same stimulus, although a model for reiterative signaling has been
proposed to explain FGF-induced branching morphogenesis in lung
development (18).
To aid in further understanding the process of vessel formation, we
wish to identify genes up-regulated in cultured EC induced to
differentiate into capillary-like tubular networks. As a first step we
have used the well characterized system of cultured EC forming networks
in collagen gels (three-dimensional cultures) (19-22) and compared
these to EC growing on top of collagen (two-dimensional cultures) using
the PCR-based subtractive hybridization technique of representational
difference analysis (RDA). This system models the temporally regulated
angiogenic processes of migration, alignment, and tube formation and
likely involves many of the same genes. This screen yielded the novel
bHLH transcription factor HESR1, which has recently been identified as
one of a new 3-member family of Hairy and E(spl)-related bHLH
transcription factors, and is variously called HESR1 (23), HRT-1 (24),
HEY-1 (25), and CHF-2 (26). The gene will be referred to as
HESR1 in this report.
HESR1 is widely expressed in the developing vasculature as well as in
the presomitic mesoderm, brain, and limbs (23-25, 27). It is
specifically expressed in atrial precursors, in the cardiac outflow
tract, in aortic arch arteries, and in the dorsal aorta (24, 25). In
adult tissues HESR1 has been detected in heart, brain, and lung but was
not localized to particular cells (24). Recently, the gene responsible
for the gridlock mutation in zebrafish was cloned and shown to be
identical to Hey-2 (Hrt-2, CHF-1), the second member of this family.
Mutation of gridlock disrupts caudal blood flow due to failure of the
anterior lateral dorsal aortae to merge into the single midline aorta
(27).
There is a high degree of homology in the bHLH domain between HESR1,
HES, and Hairy; however, homology outside of the bHLH is low until the
C terminus. HESR1 has a C-terminal tetrapeptide YRPW sequence
homologous to the WRPW motif in the Hairy/HES family and the WRPY motif
in the Runt family (28). This domain interacts with groucho in flies
(29) and the TLE family in mammals (30) and is necessary for
transcriptional repression of downstream targets such as achaete-scute
in flies and MASH in mammals.
We have now analyzed the function of HESR1 in cultured EC and show that
expression is essential for capillary-like network formation.
Cell Culture--
Human capillary endothelial (HUCE) cells were
prepared from liposuction adipose tissue using anti-CD31-coated
magnetic beads exactly as described (31). Tissue was obtained under
protocols approved by the appropriate IRB committees. To induce
capillary formation, HUCE cells were seeded onto fibronectin-coated rat tail type I collagen, rested for 1 h, and then overlaid with a second layer of collagen (1.5 mg/ml) to provide a three-dimensional matrix. Cells were grown in Medium 199 with 20% FBS, 25 ng/ml recombinant human vascular endothelial cell growth factor (VEGF, Genzyme), and 25 ng/ml recombinant human basic fibroblast growth factor
(bFGF, R & D Systems). Two-dimensional cultures were identical except
for the absence of the second layer of collagen. For the sorting
experiments cells were resuspended in collagen, and 100-µl drops were
added to bacteriological grade 100-mm dishes on ice. After 15 min to
allow cells to settle, the plates were moved to a 37 °C incubator to
allow gelling. In some experiments early passage (p1-2) human
umbilical vein EC (HUVEC) were used (32). Results were identical to
those obtained with HUCE.
Representational Difference Analysis--
For RDA, HUCE cultures
were harvested after 18 h. Monolayers were lysed in
situ using RNA isolation kits (Stratagene). Cells in collagen gels
were harvested by digestion of the gel with 0.4% collagenase I
(Worthington), and RNA was prepared as for monolayer cultures.
Poly(A)+ mRNA was purified over oligo(dT) columns
(Stratagene). RDA was performed exactly as described (33). mRNA
from monolayer EC (Driver) and tube-forming EC (Tester) was
reverse-transcribed, and double-stranded cDNAs were digested with
DpnII, ligated to linkers, amplified, and subtracted. Three
rounds of subtractive hybridization were performed with increasing
ratios of tester to driver: DP1, 1:100; DP2, 1:800; and DP3, 1:400,000.
DP3 was cloned into pBluescript II-KS, and transformants were selected for analysis. IMAGE clones corresponding to the human (R60704) and
mouse (AA980080) A21 genes (HESR1) were obtained and sequenced.
RT-PCR and Northern Blotting--
Poly(A)+ mRNA
was prepared as above and resolved on standard formaldehyde gels. After
cross-linking to nylon membranes, blots were hybridized to
Psoralen-Biotin labeled probes (Ambion). After hybridization, blots
were washed and developed according to the manufacturer's
instructions. For detection of VEGFR2, total RNA from control
(pcDNA3) or pcDNA3-HESR1-transfected EC was resolved and
blotted as above. Membranes were hybridized with a
[ Plasmids--
The full-length coding sequence of
HESR1 was cloned into either pcDNA3 (human gene, clone
A21) or pIRES2-EGFP (mouse gene) using standard protocols. In
experiments where pcDNA3-HESR1 was used, pEGFPN-1 was used to
monitor transfection efficiency.
Transfections and Cell Sorting--
Transfection of EC was
performed using LipofectAMINE reagent in Opti-MEM (Life Technologies,
Inc.). Three-day confluent (synchronized) EC were plated into 6-well
plates 1 day before transfection. After incubation with DNA/liposome
for 1.5 h, medium was changed. Transfection efficiency was
monitored by FACS analysis. We routinely obtained 10-30% of cells
expressing GFP. In some experiments transfected cells coexpressing GFP
were sorted on a Cytomation Mo-Flo and then cultured for 24 h to
allow recovery. Cells were then replated in 100-µl collagen gels as indicated.
Migration and Proliferation Assays--
To monitor EC migration,
control or HESR1-transfected cells were plated onto gelatin-coated
Transwell filters (PET membrane, 24-well, Falcon) with a pore size of 8 µm. Medium M199 + 5% FBS was added to the Transwell and M199, 5%
FBS + VEGF and bFGF at 25 ng/ml was added to the lower chamber. After
24 h cells were fixed in 3.7% formaldehyde and stained with
crystal violet (0.5% in 25% methanol). Cells on the upper surface
were then removed with a cotton swab, and the remaining dye (from
transmigrated cells) was solubilized in 0.1 M citric acid
in 50% ethanol, and the absorbance was read at 590 nm. Readings
were normalized to the total number of cells plated by assaying
membranes from parallel cultures that did not have the cells on the
upper surface removed. Proliferation was measured by direct counting of
replicate cultures in 24-well plates or by XTT assay (Sigma) with
10-12 replicates for each time point in 96-well plates (34).
7AAD--
HUVEC were transfected with pcDNA-3 control and
pEGFPN-1 or pcDNA3-HESR1 and pEGFPN-1 and stained 2 days later with
20 µg/ml 7AAD (Sigma) for 20 min at 4 °C in the dark (35). Cells
were then analyzed by FACS.
Immunostaining--
Cells growing in collagen gels were fixed in
4% paraformaldehyde and stained with either CD34 monoclonal antibody
(BioGenex, San Ramon, CA) or anti- In Vitro Transcription/Translation--
2 µg of plasmid DNA
was used in the TNT T3/T7 coupled transcription/translation system
(Promega) according to the manufacturer's instructions. After a 90-min
reaction at 30 °C, 35S-labeled translated products were
resolved by SDS-polyacrylamide gel electrophoresis. Dried gels were
exposed to film overnight.
Quantitation of Tube Formation--
Photomicrographs of the
developing tubular networks were skeletonized using a digitizing tablet
by an observer blinded to the experimental conditions. A number of
branch points were then enumerated, and the average interbranch
distance was calculated. Three to five randomized fields for each gel
were quantitated.
Antisense Treatment--
The following sequence-specific
S-oligonucleotides were used: HESR1 A1, 5' TCCGCACTCTCCTTCTCC 3'; A2,
5' TCGTCGGCGCTTCTCAAT 3'; A3, 5' TCCCGAAATCCCAAACTC 3'; nonsense
control, 5' CCCTCCCTTGTTACTCCC 3', and VEGFR2, positive control,
5'CGGACTCAGAACCACATC 3'. EC were loaded with antisense oligonucleotides
using Influx pinocytic cell-loading reagent (Molecular Probes). After
loading, cells were allowed to recover for at least 10 min before
plating in collagen gels. Assays were performed in triplicate. Cultures
were scored 24 h after plating, by two individuals blinded to the
experimental set up. The degree of tube formation was graded in 5 levels from 0 to ++++. For RT-PCR analysis of antisense action, cells
were harvested after 24 h in collagen.
Human EC, seeded into three-dimensional collagen gels, formed
capillary-like networks within 18-24 h (Fig.
1B), whereas cells growing on
top of collagen continued to proliferate and eventually formed a
monolayer (Fig. 1A). Network-forming cells retain their EC
phenotype as shown by their continued expression of CD34 (Fig. 1C), a commonly used immunohistochemical blood vessel
marker. The networks are composed of tubes as evidenced by the presence of lumens (Fig. 1D), outlined by staining for the
extracellular matrix protein
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]dATP-labeled, random-primed probe, generated by
PCR. Blots were washed and exposed either to film for 12-18 h or to
PhosphorImager screens (Molecular Dynamics). A multiple tissue tumor
blot was obtained from CLONTECH and probed
according to the manufacturer's instructions. For RT-PCR, 2 µg of
DNase I-treated total RNA isolated from cells or mouse tissues was
primed with random hexamers and reversed-transcribed using SuperScript
II (Life Technologies, Inc.). Tissue was obtained under IACUC-approved
protocols. 2-5 µl of cDNA reaction was subjected to PCR
amplification using gene-specific primers. The following primer pairs
were used: GAPDH, sense 5' ACCACAGTCCATGCCATCAC 3' and antisense 5'
TCCACCACCCTGTTGCTGTA 3' (product size, 450 bp, annealing temperature,
67 °C, 25 cycles); human HESR1, sense 5' GGAGAGGCGCCGCTGTAGTTA 3'
and antisense 5' CAAGGGCGTGCGCGTCAAAGTA 3' (product size, 429 bp,
annealing temperature, 63.5 °C, 30 cycles); and mouse HESR1, sense
5' AGGGTGGGATCAGTGTGC 3' and antisense 5' TGCTTCTCAAAGGCACTG 3'
(product size, 355 bp, annealing temperature, 56 °C, 30 cycles). The
amplification profile was 94 °C, 5 min for hot start, followed by
denaturation at 94 °C, 30 s; annealing as indicated, extension
at 72 °C, 1 min for the indicated number of cycles with a final
extension at 72 °C for 10 min. Amplifications were run on a PTC-200
(MJ Research). To confirm the absence of contaminating genomic DNA, the
RT step was omitted as indicated.
igh3 (gift of Tony Purchio,
Hepatix, San Diego, CA). Detection was by peroxidase-conjugated
secondary antibody (Biorad) and 3,3'-diaminobenzidine (DAKO).
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
igh3 (36). Significantly, when the gels
containing the neovessels are transplanted into a skin pocket on a SCID
mouse, the human vessels anastomose with ingrowing mouse vessels and are perfused with blood, indicating that the cultured cells are fully
competent to form mature vascular
networks2 (37).
View larger version (110K):
[in a new window]
Fig. 1.
Endothelial cells form tubes in collagen
gels. A, cultured ECs grow to form a monolayer when
plated on top of collagen gels. B, ECs form capillary-like
tubes 18 h after seeding into three-dimensional collagen gels.
C, tube-forming cells continue to express EC-specific
markers as demonstrated by staining with an anti-CD34 antibody.
Staining with an isotype-matched control antibody was negative.
D, ECs form capillary-like structures with patent lumens,
demonstrated by staining with a polyclonal antibody to the
EC-associated extracellular matrix protein igh3. Staining with
nonimmune serum was negative. All cultures contained 25 ng/ml bFGF and
VEGF.
Genes differentially expressed between these two culture geometries
were identified by RDA. Several well characterized "angiogenic" genes were obtained, including the v integrin and
plasminogen activator inhibitor, suggesting overlap in gene expression
between tube-forming cells in vitro and in
vivo.3 A highly
represented fragment (27/138 clones) we obtained after three rounds of
subtraction showed homology to human and Drosophila Hairy
protein and mammalian hes genes and was further
characterized. The A21 cDNA contained a single large open reading
frame coding for a protein of 304 amino acids and was recently
independently named HESR1 (23). We also cloned and sequenced the mouse
homologue, which has been variously named HEY-1 (25), HRT-1 (24), and CHF-2 (26).
To confirm the differential expression of HESR1 in EC-forming tubes
compared with migrating and proliferating EC growing in two dimensions,
we isolated poly(A)+ mRNA from three- and
two-dimensional cultures and used this for Northern blotting. A single
species of ~2.0-2.5 kb was detected in the three-dimensional tube
but not in the two-dimensional cultures (Fig.
2A) consistent with the
cDNA size of 2.2 kb and the reported transcript size for mouse of
~2.3 kb (24). To analyze the time course of HESR1 expression during
network formation, we harvested RNA and performed RT-PCR (Fig.
2B). In migrating and proliferating cells (two-dimensional
cultures) HESR1 was absent or present at very low levels. Induction was
rapid when the cells were embedded in collagen gels (three-dimensional)
with expression peaking by 2 h. Expression then fell slowly over
the next 15-18 h to a level still considerably higher than that seen
in two-dimensional cultures.
|
To investigate tissue distribution in the adult, we used RT-PCR on
mRNA prepared from several adult mouse tissues. A single band of
the predicted size was detected (Fig.
3A), and its identity as mouse
HESR1 was confirmed by sequencing. No bands were present when the RT
step was omitted, confirming the absence of genomic contamination (data
not shown). As a semi-quantitative estimate of relative abundance, we
normalized HESR1 band intensities to those of GAPDH amplified in
parallel and compared these to the tissue expressing the lowest level
of HESR1 (kidney). This revealed a dramatic enrichment of HESR1
transcripts in well vascularized tissues such as brain (7.5 times) and
heart (4.8 times), as well as high levels in aorta (4.5 times). These
data are consistent with recently published data showing expression in
brain and heart by multiple tissue Northern blot. The high level of
sensitivity provided by RT-PCR allowed us to detect transcripts in
other tissues not revealed by Northern blotting. So far we have been
unable to detect HESR1 mRNA in adult tissues by in situ
hybridization, presumably due to low levels of transcript. All previous
in situ hybridization studies have been on embryos. As an
alternative strategy to confirm vascular expression of HESR1 in
vivo, we used RT-PCR on mRNA prepared from highly purified,
freshly isolated adipose-derived capillaries (Fig. 3B). We
obtained a strong signal indicating that HESR1 is indeed expressed in
capillaries in vivo, most likely by EC; however, expression
in both EC and pericytes cannot be ruled out by our data. No signal was
obtained in the absence of the RT step (data not shown). We also wished
to determine whether levels of HESR1 are altered in the vasculature of
tumors, but again in situ hybridization proved too
insensitive. We therefore analyzed HESR1 expression in a multiple
tissue tumor blot spotted with amplified cDNA from matched normal
and tumor tissue. A potential problem with this kind of analysis is
that up- or down-regulation of a gene may only be occurring in a
discrete subset of cells and at discrete time points. In an analysis of
bulk RNA, therefore, a signal may be masked by background noise. We
believe this to be the case for HESR1 as we saw up-regulation in 3 of 3 lung tumors but down-regulation in 11 of 15 kidney tumors and 5/9
breast tumors (data not shown). This variation may reflect site of
sampling (angiogenic edge or quiescent middle of the tumor), state of
the tumor (rapidly growing compared with static or slow growing), or
may reflect tissue-specific effects. More sensitive in situ hybridization will help resolve this question.
|
Our in vitro and in vivo data suggest that in the
adult HESR1 is expressed in mature vessels in all tissues, is decreased during migration and proliferation (two-dimensional cultures), and is
re-expressed during the tube-forming stage of new vessel formation
(three-dimensional cultures). This temporal expression pattern suggests
that the level of HESR1 may regulate the phenotype of the EC, high
levels acting to maintain quiescence while reduced levels may allow
migration and proliferation. To test this hypothesis we constructed a
HESR1 expression vector and used this to test the effect of HESR1
overexpression on EC phenotype. As a test of the plasmid, we
performed in vitro transcription/translation of the
pcDNA3-HESR1 plasmid, which revealed a single band of 31-33 kDa,
consistent with the predicted size of 32,627 kDa for the conceptually
translated protein (Fig. 4A).
To examine the effect of HESR1 on cell proliferation, ECs were
transfected with pcDNA3-HESR1 or pcDNA3 control, along with
pEGFPN-1 to monitor transfection efficiency, and cell number was
monitored over 3 days by direct counting or XTT assay. By both assays
there was a reproducible decrease in cell proliferation at all time
points. In the XTT assay shown (Fig. 4B) the decrease in
proliferation was consistent with the transfection efficiency for this
experiment of ~10%. To confirm that HESR1 overexpression was not
killing cells by inducing apoptosis, we stained HESR1 and
control-transfected cells with 7AAD (35). By FACS, transfected and
apoptotic cells appear GFP bright and 7AAD bright, respectively. This
population represented 2.9% of the total in control-transfected cells
and 2.1% of the HESR1-transfected cells (data not shown).
Salicylate-induced apoptosis was used as a positive control and yielded
27% positive cells. These data indicate that there is no increase in
apoptosis in response to HESR1 expression. Finally, we counted floating
(dead) cells directly, and again there was no significant difference at
3 days between control and HESR1-transfected cells (data not shown).
|
To examine migration of EC-overexpressing HESR1, we plated transfected
cells onto the upper chamber of 8-µm pore size transwells and
measured transmigration in response to VEGF and bFGF after 24 h.
As shown in Fig. 5, HESR1 overexpression
decreased migration by 25%. Taken with the effect on proliferation,
these data suggest that HESR1 maintains EC quiescence and that HESR1
down-regulation may be essential to allow expression of the angiogenic
phenotype.
|
We next asked whether overexpression of HESR1 would promote or disrupt capillary-like network formation. Our prediction was that, given the importance of EC migration in the early stages of angiogenesis, preventing migration by overexpression of HESR1 would block migration and proper alignment of the EC and therefore disrupt formation of the network. This indeed was the case. EC were transfected with control or pIRES2-EGFP-HESR1 and then sorted for GFP expression. When compared with EC transfected with a control plasmid, HESR1-overexpressing cells survived but were unable to generate extensive branching networks (Table I). There appeared to be a failure of "islands" of cells to interconnect, due to a lack of budding and branching. When the cultures were quantitated the data revealed an ~50% decrease in the number of branch points in HESR1-transfected cells (Table I).
|
Both EC migration and proliferation are driven by VEGF acting through
VEGFR2, and consequently the receptor has a critical role in
vasculogenesis and angiogenesis. Moreover, the promoter of VEGFR2
contains several E boxes, including one at position 175 that has been
suggested to bind an EC-specific factor (38). We wondered, therefore,
whether VEGFR2 is a downstream target of HESR1 and whether HESR1
overexpression might down-regulate VEGFR2 expression. To test this, ECs
were transfected with control vector or pcDNA3-HESR1 expression
vector and harvested for RNA isolation 24 h later. Northern
analysis revealed that overexpression of HESR1 in EC led to a dramatic
down-regulation of VEGFR2 mRNA levels (Fig.
6). Preliminary experiments suggest that
HESR1 is acting at the transcriptional level as cotransfection of
pcDNA3-HESR1 into EC blocks VEGFR2 promoter-driven
luciferase expression. A similar effect is seen with the
VEGFR1 promoter.4 HESR1, like Hairy, HES,
and E(spl), therefore appears to have a role in negative regulation of
gene expression. These data suggest that HESR1-mediated inhibition of
EC migration and proliferation is due, at least in part, to
down-regulation of VEGFR2 and loss of responsiveness to VEGF. This
interpretation is supported by our antisense experiments (see below)
where we used a VEGFR2 antisense oligonucleotide as a positive control
to block network formation.
|
By having determined that HESR1 is expressed in mature, quiescent
vessels and that its down-regulation is necessary for the early stages
of angiogenesis, namely migration and proliferation, we next wanted to
determine whether re-expression of HESR1 is required for the later
stages of EC alignment, tube formation, and network maturation. We
designed several antisense oligonucleotides to HESR1 and tested these
in the three-dimensional culture model. Based on lack of sequence
homology, none of the oligonucleotides are predicted to cross-react
with other family members. The positive control sequence from the
VEGFR2 gene blocked network formation in a
dose-dependent manner to a maximum of 88% at 3 µM (Fig. 7A). Two of the HESR1 oligonucleotides also blocked network formation. A1
was most potent, blocking by 75% at 0.3 µM and greater
than 95% at 3 µM; A3 was less effective, only showing
significant blocking at 3 µM; A2 did not block. Variable
effectiveness between different oligonucleotides is a common occurrence
when using antisense to block gene expression. Matched nonsense
oligonucleotides were ineffective at blocking. Neither the antisense
nor the nonsense oligonucleotides had any effect on the morphology of
monolayer cultures (data not shown). To rule out a nonspecific action
of the antisense compounds, we analyzed HESR1 mRNA levels in cells treated with antisense or nonsense oligonucleotides. In the presence of
3 µM A1 oligonucleotide, no HESR1 message was detectable,
whereas levels of GAPDH message were unaffected (Fig. 7B).
Nonsense oligonucleotides had no effect on expression of either gene.
These experiments indicate that HESR1 expression is necessary for
establishment of the mature EC network.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In a screen to isolate EC genes up-regulated during in vitro capillary-like network formation, we identified the bHLH transcription factor HESR1 (23). This gene is homologous to the Hairy/HES family of genes that act downstream of Notch to regulate neuronal development in Drosophila and mice (39, 40) and has recently been independently identified and named HEY-1 (Hairy, E(spl) related with YRPW) (25), HRT-1 (Hairy-related transcription factor), and CHF-2 (cardiovascular helix-loop-helix factor 2) (26). There are two other members of the family so far identified (24, 25, 27), with similar structure and overlapping expression patterns. To date, expression of HESR1 has been examined mostly in embryos, by whole-mount in situ hybridization. HESR1 is observed in the atrium of the heart, in the cardiac outflow tract, in the aorta, and in the somitic mesoderm, several regions of the central nervous system, and in limbs.
We found HESR1 expression in all adult tissues examined including aorta and purified capillaries, indicating that it might be expressed by EC throughout the body. Expression was down-regulated in migrating and proliferating EC in culture suggesting that HESR1 may be involved in induction and/or maintenance of the mature, quiescent vascular phenotypes. test this hypothesis we overexpressed HESR1 in EC and examined migration and proliferation, as well as expression of VEGFR2. This gene, in contrast to VEGFR1, delivers a proliferative signal to EC (5) and has been demonstrated in the proliferating EC of vascular sprouts in the brain (8). Moreover, VEGFR2 expression was shown to be dramatically down-regulated in adult brain where no angiogenesis is occurring, compared with the embryo where all new vessels in the brain are generated by angiogenesis. When we overexpressed HESR1 in our system, to mimic quiescent vessels, it down-regulated VEGFR2 expression and slowed migration and proliferation of EC. Furthermore, expression of HESR1 blocked network formation in three-dimensional gels, presumably due to suppressed EC migration. Adding further support to this interpretation is the finding that antisense to VEGFR2 likewise prevented network formation. Thus, down-regulation of VEGFR2 by HESR1 may be a switch that regulates the transition from the proliferating, migrating phenotype to the network-forming and vessel maturation phenotype.
Interestingly, antisense inhibition of HESR1 expression also inhibits network formation, demonstrating that the gene is essential for this process. Our interpretation is that while HESR1 down-regulation is essential in the early stages of migration, presumably to allow VEGFR2 expression, re-expression of HESR1 is required at a later stage to allow alignment, tube formation and vessel maturation. Antisense knockout of HESR1, therefore, prevents this stage in network formation.
To summarize, we hypothesize that HESR1 is required to induce and
maintain the mature vascular phenotype, in part by preventing EC
proliferation and migration (Fig. 8).
During the early stages of angiogenesis HESR1 expression would be
expected to fall, allowing cells to migrate away from the parent
vessel, express VEGFR2, and proliferate. Later, re-expression of HESR1
would be required for down-regulation of VEGFR2, leading to cessation
of proliferation, and for tube formation and re-establishment of the
mature vessel phenotype. Our data are consistent with this model in
that HESR1 is expressed in mature blood vessels (Fig. 3); its
expression is suppressed in migrating and proliferating cells, and it
is rapidly reinduced in network-forming cells (Fig. 2). Overexpression of HESR1 prevents VEGFR2-mediated migration and proliferation (Figs. 4
and 5), whereas antisense reduction of HESR1 expression prevents the
switch from the migrating and proliferating phenotype of cells in two
dimensions to the tube-forming phenotype in three-dimensions (Fig. 7).
As HESR1 overexpression does not induce tube formation directly in
two-dimensional culture, we propose that re-expression of HESR1 is
permissive for network formation and vessel maturation, rather than
instructive. Although this model is somewhat speculative, it does
provide a framework for future experiments.
|
Most bHLH proteins bind to DNA as either homo- or heterodimers. Most bind to the canonical E box (CANNTG), although Hairy proteins bind a variant called the N box (CACNAG) due to a conserved proline in the basic region. HESR1 has a glycine at this position and is predicted to bind to an E box. HESR1 is likely acting in our system by dimerizing with other bHLH proteins. Indeed, a recent report identified CHF-1 and CHF-2 (HESR1) in a two-hybrid screen using as bait the bHLH domain of the aryl hydrocarbon receptor nuclear translocator (ARNT) (26). ARNT has been shown to regulate VEGF expression by binding to the HIF-1 site in the VEGF promoter. CHF-1 was shown to displace ARNT from this site and down-regulate VEGF promoter activity. CHF-2 was not tested. It is not possible to predict, based on sequence alone, whether HESR1 will positively or negatively regulate other target genes, or whether it will interact with corepressors such as groucho/TLE (29, 30). By analogy with the Hairy family, and based on the presence of the YRPW motif, a role in negative regulation in mature vessels may be expected, possibly of Achaete-Scute complex homologues (41), potentially of other proangiogenic genes such as matrix metalloproteinases and angiopoeitin-2. Clearly, our data on VEGFR2 expression are consistent with this hypothesis. Interestingly, however, there is good evidence that the Runt family of genes, which contain the WRPY motif, are capable of mediating both negative and positive regulation of transcription (42, 43). HESR1 may behave similarly as it also carries a variant of the WRPW motif, namely YRPW. Binding of groucho to the WRPY motif of Runt appears to be regulated, in contrast to the constitutive binding of groucho to the WRPW motif found in the Hairy/HES family. Context-dependent binding of groucho to target promoters appears to determine whether positive or negative regulation occurs.
Hairy/HES genes act downstream of Notch to determine cell fate decisions in neurons by regulating the expression of the pro-neural achaete-scute complex genes (39). Notch has also been implicated in angiogenesis; Zimrin et al. (44) demonstrated that inhibiting expression of the Notch ligand Jagged-1 potentiated the ability of EC to form capillary-like networks in culture. The direct demonstration in mice that HESR1 is downstream of Notch in presomitic mesoderm (23) suggests that HESR1 may be downstream of Notch in EC, further supporting a role for HESR1 in angiogenesis. Interestingly, mutations in the human Jagged-1 ligand are reported to be responsible for Alagille syndrome, which manifests as cerebral vascular hemorrhaging (45), whereas a number of the notch and notch ligand knock-out mice show vascular phenotypes (46). We are currently investigating the expression of Notch proteins in human EC.
In conclusion, our findings suggest that HESR1 may be a genetic switch,
the control of which may regulate EC phenotype and the multiple stages
of angiogenesis.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Stephen Hou for help with cell sorting. We thank Cam Patterson for the VEGFR2 promoter construct. All sorts were performed at the University of California, Irvine, Cell Sorting Facility.
![]() |
FOOTNOTES |
---|
* This work was supported by United States Army IDEA Grant DAMD17-98-1-8291 and National Institutes of Health Grant HL60067.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 949-824-8771;
Fax: 949-824-8551; E-mail: cchughes@uci.edu.
Published, JBC Papers in Press, November 7, 2000, DOI 10.1074/jbc.M008506200
2 J. Mestas and C. C. W. Hughes, unpublished observations.
3 M. Aitkenhead, S.-J. Wang, J. Mestas, C. Heard, and C. C. W. Hughes, submitted for publication.
4 A. M. Henderson and C. C. W. Hughes, unpublished observations.
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: EC, endothelial cell(s); RDA, representational difference analysis; HUVEC, human umbilical vein endothelial cells; HUCE, human capillary endothelial cells; bHLH, basic helix-loop-helix; RT-PCR, reverse transcriptase-polymerase chain reaction; GFP, green fluorescent protein; EGFP, enhanced GFP; VEGFR, vascular endothelial cell growth factor receptor; VEGFs, vascular endothelial growth factors; bFGF, basic fibroblast growth factor; bp, base pair; FACS, fluorescence-activated cell sorter; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FBS, fetal bovine serum; 7AAD, 7-aminoactinomycinD; XTT, (2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide); kb, kilobase pair; ARNT, aryl hydrocarbon receptor nuclear translocator.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Hanahan, D., and Folkman, J. (1996) Cell 86, 353-364[Medline] [Order article via Infotrieve] |
2. | Bouck, N., Stellmach, V., and Hsu, S. C. (1996) ADV Cancer Res 69, 135-174[Medline] [Order article via Infotrieve] |
3. | Risau, W. (1997) Nature 386, 671-674[CrossRef][Medline] [Order article via Infotrieve] |
4. | Carmeliet, P. (2000) Nat. Med. 6, 389-395[CrossRef][Medline] [Order article via Infotrieve] |
5. |
Neufeld, G.,
Cohen, T.,
Gengrinovitch, S.,
and Poltorak, Z.
(1999)
FASEB J.
13,
9-22 |
6. | Fong, G. H., Rossant, J., Gertsenstein, M., and Breitman, M. L. (1995) Nature 376, 66-70[CrossRef][Medline] [Order article via Infotrieve] |
7. | Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsenstein, M., Wu, X. F., Breitman, M. L., and Schuh, A. C. (1995) Nature 376, 62-66[CrossRef][Medline] [Order article via Infotrieve] |
8. | Millauer, B., Wizigmann-Voos, S., Schnurch, H., Martinez, R., Moller, N. P., Risau, W., and Ullrich, A. (1993) Cell 72, 835-846[Medline] [Order article via Infotrieve] |
9. |
Friesel, R. E.,
and Maciag, T.
(1995)
FASEB J.
9,
919-925 |
10. | Suri, C., Jones, P. F., Patan, S., Bartunkova, S., Maisonpierre, P. C., Davis, S., Sato, T. N., and Yancopoulos, G. D. (1996) Cell 87, 1171-1180[Medline] [Order article via Infotrieve] |
11. | Sato, T. N., Tozawa, Y., Deutsch, U., Wolburg-Buchholz, K., Fujiwara, Y., Gendron-Maguire, M., Gridley, T., Wolburg, H., Risau, W., and Qin, Y. (1995) Nature 376, 70-74[CrossRef][Medline] [Order article via Infotrieve] |
12. |
Maisonpierre, P. C.,
Suri, C.,
Jones, P. F.,
Bartunkova, S.,
Wiegand, S. J.,
Radziejewski, C.,
Compton, D.,
McClain, J.,
Aldrich, T. H.,
Papadopoulos, N.,
Daly, T. J.,
Davis, S.,
Sato, T. N.,
and Yancopoulos, G. D.
(1997)
Science
277,
55-60 |
13. | de Vries, C., Escobedo, J. A., Ueno, H., Houck, K., Ferrara, N., and Williams, L. T. (1992) Science 255, 989-991[Medline] [Order article via Infotrieve] |
14. | Terman, B. I., Dougher-Vermazen, M., Carrion, M. E., Dimitrov, D., Armellino, D. C., Gospodarowicz, D., and Bohlen, P. (1992) Biochem. Biophys. Res. Commun. 187, 1579-1586[Medline] [Order article via Infotrieve] |
15. | Soker, S., Takashima, S., Miao, H. Q., Neufeld, G., and Klagsbrun, M. (1998) Cell 92, 735-745[Medline] [Order article via Infotrieve] |
16. | Carmeliet, P., Dor, Y., Herbert, J. M., Fukumura, D., Brusselmans, K., Dewerchin, M., Neeman, M., Bono, F., Abramovitch, R., Maxwell, P., Koch, C. J., Ratcliffe, P., Moons, L., Jain, R. K., Collen, D., Keshert, E., and Keshet, E. (1998) Nature 394, 485-490[CrossRef][Medline] [Order article via Infotrieve] |
17. |
Steingrimsson, E.,
Tessarollo, L.,
Reid, S. W.,
Jenkins, N. A.,
and Copeland, N. G.
(1998)
Development
125,
4607-4616 |
18. |
Metzger, R. J.,
and Krasnow, M. A.
(1999)
Science
284,
1635-1639 |
19. | Montesano, R., Orci, L., and Vassali, P. (1983) J. Cell Biol. 97, 1648-1652[Abstract] |
20. | Villaschi, S., and Nicosia, R. F. (1994) Lab. Invest. 71, 291-299[Medline] [Order article via Infotrieve] |
21. | Pepper, M. S., Ferrara, N., Orci, L., and Montesano, R. (1992) Biochem. Biophys. Res. Commun. 189, 824-831[Medline] [Order article via Infotrieve] |
22. | Madri, J. A., Pratt, B. M., and Tucker, A. M. (1988) J. Cell Biol. 106, 1375-1384[Abstract] |
23. | Kokubo, H., Lun, Y., and Johnson, R. L. (1999) Biochem. Biophys. Res. Commun. 260, 459-465[CrossRef][Medline] [Order article via Infotrieve] |
24. | Nakagawa, O., Nakagawa, M., Richardson, J. A., Olson, E. N., and Srivastava, D. (1999) Dev. Biol. 216, 72-84[CrossRef][Medline] [Order article via Infotrieve] |
25. | Leimeister, C., Externbrink, A., Klamt, B., and Gessler, M. (1999) Mech. Dev. 85, 173-177[CrossRef][Medline] [Order article via Infotrieve] |
26. |
Chin, M. T.,
Maemura, K.,
Fukumoto, S.,
Jain, M. K.,
Layne, M. D.,
Watanabe, M.,
Hsieh, C. M.,
and Lee, M. E.
(2000)
J. Biol. Chem.
275,
6381-6387 |
27. |
Zhong, T. P.,
Rosenberg, M.,
Mohideen, M. A.,
Weinstein, B.,
and Fishman, M. C.
(2000)
Science
287,
1820-1824 |
28. |
Fisher, A. L.,
and Caudy, M.
(1998)
Genes Dev.
12,
1931-1940 |
29. | Paroush, Z., Finley, R. L., Jr., Kidd, T., Wainwright, S. M., Ingham, P. W., Brent, R., and Ish-Horowicz, D. (1994) Cell 79, 805-815[Medline] [Order article via Infotrieve] |
30. | Grbavec, D., and Stifani, S. (1996) Biochem. Biophys. Res. Commun. 223, 701-705[CrossRef][Medline] [Order article via Infotrieve] |
31. | Springhorn, J. P., Madri, J. A., and Squinto, S. P. (1995) Invitro Cell Dev-An. 31, 473-481 |
32. | Gimbrone, M. A., Jr. (1976) Prog. Hemostasis Thromb. 3, 1-28[Medline] [Order article via Infotrieve] |
33. | Hubank, M., and Schatz, D. G. (1994) Nucleic Acids Res. 22, 5640-5648[Abstract] |
34. | Murphy, L. L., Mazanet, M. M., Taylor, A. C., Mestas, J., and Hughes, C. C. (1999) Cell Immunol. 194, 150-161[CrossRef][Medline] [Order article via Infotrieve] |
35. |
Philpott, N. J.,
Turner, A. J.,
Scopes, J.,
Westby, M.,
Marsh, J. C.,
Gordon-Smith, E. C.,
Dalgleish, A. G.,
and Gibson, F. M.
(1996)
Blood
87,
2244-2251 |
36. | Skonier, J., Neubauer, M., Madisen, L., Bennett, K., Plowman, G. D., and Purchio, A. F. (1992) DNA Cell Biol. 11, 511-522[Medline] [Order article via Infotrieve] |
37. |
Schechner, J. S.,
Nath, A. K.,
Zheng, L.,
Kluger, M. S.,
Hughes, C. C.,
Sierra-Honigmann, M. R.,
Lorber, M. I.,
Tellides, G.,
Kashgarian, M.,
Bothwell, A. L.,
and Pober, J. S.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
9191-9196 |
38. |
Patterson, C.,
Perrella, M. A.,
Hsieh, C. M.,
Yoshizumi, M.,
Lee, M. E.,
and Haber, E.
(1995)
J. Biol. Chem.
270,
23111-23118 |
39. | Lee, J. E. (1997) Curr. Opin. Neurobiol. 7, 13-20[CrossRef][Medline] [Order article via Infotrieve] |
40. | Kageyama, R., and Nakanishi, S. (1997) Curr. Opin. Genet. & Dev. 7, 659-665[CrossRef][Medline] [Order article via Infotrieve] |
41. | Ishibashi, M., Ang, S. L., Shiota, K., Nakanishi, S., Kageyama, R., and Guillemot, F. (1995) Genes Dev. 9, 3136-3148[Abstract] |
42. | Aronson, B. D., Fisher, A. L., Blechman, K., Caudy, M., and Gergen, J. P. (1997) Mol. Cell. Biol. 17, 5581-5587[Abstract] |
43. | Duffy, J. B., and Gergen, J. P. (1994) Adv. Genet. 31, 1-28[Medline] [Order article via Infotrieve] |
44. |
Zimrin, A. B.,
Pepper, M. S.,
McMahon, G. A.,
Nguyen, F.,
Montesano, R.,
and Maciag, T.
(1996)
J. Biol. Chem.
271,
32499-32502 |
45. | Oda, T., Elkahloun, A. G., Pike, B. L., Okajima, K., Krantz, I. D., Genin, A., Piccoli, D. A., Meltzer, P. S., Spinner, N. B., Collins, F. S., and Chandrasekharappa, S. C. (1997) Nat. Genet. 16, 235-242[Medline] [Order article via Infotrieve] |
46. |
Krebs, L. T.,
Xue, Y.,
Norton, C. R.,
Shutter, J. R.,
Maguire, M.,
Sundberg, J. P.,
Gallahan, D.,
Closson, V.,
Kitajewski, J.,
Callahan, R.,
Smith, G. H.,
Stark, K. L.,
and Gridley, T.
(2000)
Genes Dev.
14,
1343-1352 |