From the Department of Pathology, University of Alabama at
Birmingham, Birmingham, Alabama 35294
Received for publication, August 1, 2000, and in revised form, December 4, 2000
Osteoprotegerin (OPG), an osteoblast-secreted
decoy receptor, specifically binds to osteoclast differentiation factor
and inhibits osteoclast maturation. Members of the transforming growth factor-
superfamily including bone morphogenetic proteins (BMPs) stimulate OPG mRNA expression. In this study, we have characterized the transcription mechanism of BMP-induced OPG gene expression. Transfection of Smad1 and a constitutively active BMP type IA receptor
ALK3 (Q233) stimulated the OPG promoter. Deletion analysis of the OPG
promoter identified two Hoxc-8 binding sites that respond to BMP
stimulation. Glutathione S-transferase-Hoxc-8 protein binds to these two Hox sites specifically. Consistent with the transfection results of the native promoter, ALK3 or Smad1 linker region, which interacts with Hoxc-8, stimulated the activation of the reporter construct with the two Hox sites. Overexpression of Hoxc-8 inhibited the induced promoter activity. When the two Hox binding sites were
mutated, ALK3 or Smad1 linker region no longer activated the
transcription. Importantly, Smad1 linker region induced both OPG
promoter activity and endogenous OPG protein expression in 2T3
osteoblastic cells. The medium from cells transfected with Smad1 linker
region expression plasmid effectively inhibited osteoclastogenesis. Collectively, our data indicate that Hox sites mediate both OPG promoter construct activity and endogenous OPG gene expression in
response to BMP stimulation.
 |
INTRODUCTION |
Bone remodeling mainly depends on a balance between bone
resorption by osteoclasts and bone formation by osteoblasts (1, 2).
Cell to cell contact between osteoblasts and osteoclasts is critical
for osteoclast differentiation and maturation (3, 4). It is clear that
osteoprotegrin (OPG)1 and
osteoprotegrin ligand (OPGL), both produced by osteoblasts, determine
the destiny of osteoclast progenitors with the involvement of the
osteoclast surface receptor, which is called receptor activator of
NF-
B. Thus, OPGL and its receptors mediate the communication between osteoblasts and osteoclasts and maintain the balanced bone
metabolism (5, 6). OPGL, also known as osteoclast differentiation factor, activates osteoclast differentiation. OPG is a secreted receptor of the tumor necrosis factor receptor family without transmembrane domain. It binds directly to OPGL on the
osteoblasts/stromal cell surface, inhibiting OPGL-mediated
osteoclastogenesis (7, 8). OPG has also been shown to inhibit bone
resorption both in vitro and in vivo (9, 10).
OPG-deficient mice exhibited severe osteopenia due to the accelerated
bone resorption (11, 12). In addition, OPG prevents bone and cartilage
loss in a T-cell-dependent arthritis model (13). OPG
mRNA was localized mainly to the cartilaginous aspects of
developing bone, arteries, skin, and gastrointestinal tract (7),
although OPG is also expressed in a variety of tissues, including the
kidney, lung, liver, brain, placenta, heart, and hematopoietic cell
lines (14, 15).
OPG mRNA expression is regulated by many bone metabolic regulators,
such as IL-1 (16), tumor necrosis factors (17), TGF-
(18, 19),
vitamin D (20), and prostaglandin E2 (21) in osteoblastic
cells. In particular, bone morphogenetic proteins (BMPs), osteotropic
growth factors, significantly induce OPG expression both at the
mRNA and the protein level in human fetal osteoblast cells (20).
BMPs induce de novo bone formation in postfetal life through
the process of intramembranous and endochondrial ossification. BMP-2,
BMP-4, and BMP-7 are the most potent growth factors that promote new
cartilage and bone formation (22-25). The BMPs initiate the cascades
of transcription program for mesenchymal stem cell differentiation into
osteoblasts and chondrocytes. Studies of the mechanisms of BMP-induced
OPG gene transcription should provide us with a better understanding of
the roles of BMPs and OPG in skeletal formation and bone remodeling.
BMPs form the largest group in the TGF-
superfamily. The TGF-
signal transduction pathway has been elucidated in recent years (26,
27). Like other members of the superfamily, BMPs bind to two types of
transmembrane receptors, known as type I and type II, with
serine/threonine kinase activity (28). Upon binding to BMP ligands,
type I receptors phosphorylate a family of conserved downstream Smad
proteins. Smad1 is the downstream effector of BMP signaling (29, 30).
The phosphorylated Smad1 interacts with Smad4, which then translocates
into the nucleus and regulates gene transcription by associating with a
nuclear transcription factor (31) or by binding directly to DNA (32). Previously, we reported that Smad1 interacts with Hoxc-8, a homeodomain transcription factor, and dislodges Hoxc-8 from its DNA binding element, resulting in the induction of gene expression (33). The
interaction domains of Smad1 with Hoxc-8 have been characterized. Overexpression of these domains in osteoblast precursors stimulated osteoblast differentiation-related gene expression and led to mineralized bone matrix formation (34). Hox binding elements widely
exist in promoters of osteoblast differentiation marker genes,
especially those that rapidly respond to BMP stimulation, such as OPG
(20), BMP-4 (35), and osteonectin (36). It appears that the interaction
between Smad1 and Hox transcription factors may represent the major
initiation mechanism of osteoblast differentiation in the BMP signaling pathway.
In the present study, we reported that constitutively active BMP type
IA receptor ALK3 (Q233) stimulates OPG promoter activity. By
characterization of the OPG promoter, we found that the two Hox binding
sites are essential for OPG transcription activation induced by BMP.
Most importantly, overexpression of the Smad1 linker region, which
interacts with Hoxc-8, induced both OPG promoter activity and
endogenous OPG protein expression in 2T3 osteoblastic cells. Finally,
the medium from the cells transfected with the Smad1 linker region
expression plasmids effectively inhibited OPGL-induced osteoclastogenesis.
 |
EXPERIMENTAL PROCEDURES |
Plasmid Constructions--
The OPG promoter from
1104 to +59
relative to the transcription start site was amplified by polymerase
chain reaction from human genomic DNA and cloned into MluI
and BglII sites of the pGL3-basic vector (Promega) to
generate a luciferase reporter construct (OPG-1). A deletion series
(OPG-2,
999 to +59; OPG-3,
937 to +59; OPG-4,
700 to +59; OPG-5,
564 to +59) was also cloned into MluI and BglII
sites of the pGL3-basic vector. OPG-SV40 (
1104 to
624) reporter
bearing the two Hoxc-8 binding sites was constructed using the same
strategy but was put into the pGL3-control vector (Promega). The
mutants, mOPG-SV40, m1OPG-SV40, and m2OPG-SV40, were generated by
replacing both, the first, or the second Hox recognition core sequences
TAAT with TCCT (mutated nucleotides are in
boldface type), respectively, in the OPG promoter region (
1104
to
624) using polymerase chain reaction. A Smad1C mutant construct
(m-Smad1C) was generated by deletion of the Hoxc-8 interaction domain
(amino acids 148-191) of Smad1C (amino acids 148-278).
Transfection and Luciferase Assay--
C3H10T1/2 mesenchymal
cells (5 × 104 cells/12-well plate) were transiently
transfected using Tfx-50 reagent (33) with a total of 0.3 µg of
luciferase reporter plasmid (OPG1, OPG-SV40, mOPG-SV40, m1OPG-SV40, or
m2OPG-SV40) and different expression plasmids as indicated. Total DNA
was kept constant by the addition of PCDNA3 plasmid. Luciferase
activities were assayed 42 h post-transfection using the Dual
Luciferase assay kit (Promega) according to the manufacturer's
directions. Luciferase values shown in the figures are representative
of transfection experiments performed in triplicate in at least three
independent experiments.
Purification of GST Fusion Proteins--
A GST fusion construct
of GST-Hoxc-8 was generated as described in our previous study (33).
The expression and purification of the fusion proteins were performed
as described elsewhere (37).
Electrophoretic Mobility Shift Assay (EMSA)--
For EMSA,
various amounts of recombinant proteins were incubated with 5 × 104 cpm 32P-labeled probes for 15 min at room
temperature in a binding buffer (50 mM Tris-Cl, pH 7.5, 500 mM KCl, 5 mM EDTA, 50% glycerol, 5 mg/ml
bovine serum albumin, 5 mM dithiothreitol, 10 µg/ml
poly(dI-dC)). The protein-DNA complexes were resolved on a 4%
nondenaturing polyacrylamide gel in 0.5% TBE. Double-stranded
oligonucleotide probes used in the EMSA are as follows:
OPG-2Hox (OPG promoter region,
1104 to
907; two consensus
Hox binding sites are in boldface type),
5'-CTGGAGACATATAACTTGAACACTTGGCCCTGATGGGGAAGCAGCTCTGCAGGGACTTTTTCAGCCATCTGTAAACAATTTCAGTGGCAACCCGCGAACTGTAATCCATGAATGGGACCACACTTTACAAGTCATCAAGTCTAACTTCTAGACCAGGGAATTAATGGGGGAGACAGCGAACCCTAGAGCAAAGTGCCA-3'; OPG-Hox1 (OPG promoter region,
1013 to
994; the consensus Hox binding site is in boldface type),
5'-CCGCGAACTGTAATCCATGA-3'; OPG-mHox1 (OPG promoter region,
1103 to
994; the mutated Hox binding site is in boldface type),
5'-CCGCGAACTGTCCTCCATGA-3'; OPG-Hox2 (OPG promoter region,
956 to
932; the consensus Hox binding site is in boldface type),
5'-TAGACCAGGGAATTAATGGGGGAG-3'; fragment 5 (OPG promoter
region,
956 to
932; the mutated Hox binding site is in boldface
type), 5'-TAGACCAGGGAATTCCTGGGGGAGA-3'. These
oligonucleotides were end-labeled using T4 polynucleotide kinase.
Immunoblotting--
2T3 cells were transiently transfected with
5 µg of Smad 1C-NLS, the linker region of full-length Smad1, which is
identified as the Hoxc-8 interaction domain (34). Cell lysate was
collected at different times (0, 24, 33, 40, and 48 h),
fractionated by 12% SDS-polyacrylamide gel electrophoresis, and
electrophoretically transferred to nitrocellulose filters. Filters were
blocked at room temperature for 1 h in 3% nonfat milk in
phosphate-buffered saline containing 0.05% Tween 20 and then incubated
for >1 h at room temperature with 1:100 anti-OPG polyclonal antibody
(Santa Cruz Biotechnology, Inc., Santa Cruz, CA). After washing, the blots were incubated with a horseradish peroxidase-conjugated 1:1000
anti-goat antibody (Santa Cruz Biotechnology). The blots were washed
five times and visualized by enhanced chemiluminescence kit (Amersham
Pharmacia Biotech) and exposed to x-ray film. The specificity of the
blot was examined by incubating 1 µg/ml excess OPG blocking peptide
(Santa Cruz Biotechnology) with primary antibody.
In Vitro Generation of Osteoclasts--
Mouse bone marrow
macrophages (BMMs) were isolated from 8-week mice (C57/B1) (38). To
generate osteoclasts, BMMs were cultured in
-minimal essential
medium containing 10% fetal bovine serum in 24-well plates (1 × 105 cells/well) in the presence of murine recombinant M-CSF
(10 ng/ml) from R & D Systems (Minneapolis, MN) and GST-OPGL (50 ng/ml) (39). Culturing medium was changed every 3 days, and M-CSF and
GST-OPGL were freshly added to the culture after the medium change.
Osteoclasts started to form at day 4, and the cultures were stained for
tartrate-resistant phosphatase (TRAP) activity using a
commercial kit from Sigma at day 5. In selected wells, 25% of the
culturing medium was the conditioned medium from 2T3 cells transfected
with plasmid Smad1C or empty vector (PCDNA3).
 |
RESULTS |
Identification of BMP Response Elements in the OPG
Promoter--
BMPs induce OPG gene expression (20). To investigate the
mechanisms of the BMP-activated OPG gene transcription, we have cloned
an approximately 1-kilobase pair DNA fragment of the OPG promoter
(
1104/+59). The OPG promoter was ligated into a luciferase reporter
expression vector to examine its responsiveness to BMP stimulation.
Transient transfection of this construct in C3H10T1/2 cells with Smad1
and a constitutively active type IA BMP receptor (ALK3) expression
plasmid resulted in a significant increase in luciferase
activity. We then attempted to localize the BMP response elements by
promoter deletion analysis. As shown in Fig.
1, a series of OPG 5'-flanking region
deletion constructs were generated. These constructs were transfected
in C3H10T1/2 cells and challenged with BMP stimulation. Deletion of the
DNA fragment from
1104 to
938 abrogated BMP-induced transcription
activity (Fig. 1). Further deletion did not significantly change
luciferase activity. Analysis of the DNA sequence of this promoter
fragment (
1104 to
938) revealed two putative Hox binding sites,
located at
1003 to
1000 or
943 to
940, respectively. We have
shown previously that Smad1 interaction with Hoxc-8 dislodges Hoxc-8
from its DNA binding element to activate osteopontin gene expression
(33). We therefore examined whether the interaction between Hoxc-8 and Smad1 is also the transcription mechanism in response to BMP
stimulation. Hoxc-8 was cotransfected with Smad1 and ALK3 in C3H10T1/2
cells. As expected, Hoxc-8 significantly inhibited BMP-induced OPG
transcription (Fig. 1), suggesting that Hoxc-8 mediates BMP
stimulation. This result indicates that the promoter fragment bearing
two Hox binding sites may be responsible for the BMP-induced
transcription.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1.
Smad1 and ALK3 (Q233D) activate the OPG
promoter. Left, schematic description of the constructs
used in the transfection assay on the right. Nucleotides are
numbered relative to the transcription start site. Right,
BMP stimulates OPG promoter expression. C3H10T1/2 cells plated at a
density of 5 × 104 cells/well in 12-well plates for
transfections. A deletion series of OPG promoter constructs (0.3 µg)
were cotransfected in C3H10T1/2 cells with or without Smad1 (0.1 µg)
and ALK3 (0.025 µg) plasmids or in combination with Hoxc-8 plasmid.
Transfected cells were harvested and lysed for 42 h. The
luciferase activity was measured and normalized to Renilla
luciferase level as internal controls. Data are shown with the
mean ± S.D. of triplicates.
|
|
To verify that the promoter region with two Hox sites function as BMP
response elements, we cloned the fragment (
1104/
624) containing the
two Hox binding sites into the pGL3-control luciferase reporter vector
under the control of the SV40 promoter (OPG-SV40) (Fig.
2A). When this construct was
cotransfected in C3H10T1/2 cells with full-length Smad1 and ALK3
(Q233D), the transcription activity was significantly stimulated (Fig.
2B). Furthermore, the core nucleotides TAAT of these two Hox
binding sites were mutated to TCCT, designated as mOPG-SV40. As
expected, transfection of the mutant construct completely abolished the
Smad1- and ALK3-induced reporter activity and eliminated Hoxc-8
inhibition in C3H10T1/2 cells. Effects of Hoxc-8 alone on both wild
type and mutant promoter constructs were also examined. Hoxc-8
significantly inhibited basal activity in the wild type promoter (Fig.
2B). Two Hox sites were also mutated individually to assess
the relative contribution to the BMP stimulation (Fig. 2A).
Transfection analysis of these two Hox mutant constructs suggests that
mutation of either of the Hox sites abolish Hoxc-8-mediated inhibition
(Fig. 2C). However, the OPG-Hox1 (
1003/
1000) appears to
contribute more in response to BMP stimulation. These results indicate
that the two Hox binding sites are essential to BMP-induced OPG
promoter transcription.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
Hox binding sites mediate BMP
stimulation. A, schematic description of the constructs
used in the transfection assay in B. Filled
boxes indicate putative Hox binding sites (TAAT). Boxes
marked × indicate mutated Hox binding sites (TCCT). All of the
constructs were generated by ligating DNA fragments from the OPG
promoter to the SV40 promoter. B, OPG promoter fragment
containing two Hox sites responds to Smad1 and ALK3 treatments.
C3H10T1/2 cells plated at a density of 5 × 104
cells/well in 12-well plates for transfections. OPG promoter constructs
(0.3 µg) with two Hox sites or with two mutated Hox sites were
cotransfected in C3H10T1/2 cells, respectively, with or without Smad1
(0.1 µg) and ALK3 (0.025 µg) plasmids, Hoxc-8 plasmid, or a
combination of these two. C, the first Hox site of the OPG
promoter is more important for responding to Smad1 and ALK3 treatments.
C3H10T1/2 cells plated at a density of 5 × 104
cells/well in 12-well plates for transfections. OPG promoter constructs
(0.3 µg) with two Hox sites, the first Hox site mutation, or the
second Hox site mutation were cotransfected in C3H10T1/2 cells,
respectively, with or without Smad1 (0.1 µg) and ALK3 (0.025 µg)
plasmids or in combination with Hoxc-8 plasmid. Transfected cells were
harvested and lysed in 42 h. The luciferase activity was measured
and normalized to the Renilla luciferase level as internal
controls. Data are shown with the mean ± S.D. of
triplicates.
|
|
Hoxc-8 Binds to OPG Promoter Specifically--
To examine whether
Hoxc-8 binds to the two consensus Hox binding sites, we performed EMSA.
Isotope 32P-labeled DNA fragments, containing either one or
both of the Hox binding sites, were used in incubation with purified
GST-Hoxc-8 (Fig. 3A). When a
longer fragment comprising both Hox binding sites was used, Hoxc-8
protein formed a retarded band (Fig. 3B). Thus, Hoxc-8
protein binds to the DNA fragment. Then, two shorter fragments
(
1013/
994 and
956/
932), each containing a Hox binding site,
were used, respectively. As seen in Fig. 3C, Hoxc-8 binds efficiently to both of the individual Hox binding sites (Fig. 3C, lanes 3 and 8). We have
previously shown that Smad1 inhibits Hoxc-8 binding in activating gene
transcription (33, 34). The binding specificity of Hoxc-8 to these two
Hox sites was examined by both DNA competition studies and Hox site
mutation experiments. Each 50-fold unlabeled Hox site displaced the
binding of Hoxc-8 to its corresponding Hox site, respectively (Fig.
3C, lanes 4 and 9). As
expected, Hoxc-8 binding was abolished when mutated Hox sites were used
as probes (Fig. 3C, lanes 5 and
10), in which the core sequence TAAT was mutated into TCCT
for both Hox sites. Thus, these results confirm that Hoxc-8 binds to
two Hox binding sites of OPG promoter specifically.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
Characterize hox binding sites
from OPG promoter. A, OPG promoter fragments used
for gel shift assays in B and C. Nucleotides are
numbered relative to the transcription start site. Filled
boxes indicate putative Hox binding sites (TAAT). Boxes
marked × indicate mutated Hox binding sites (TCCT). B,
Hoxc-8 binds to OPG-2Hox. 32P-Labeled
OPG-2Hox was used in gel shift assays in incubation with
GST-Hoxc-8 (0.2 or 0.6 µg). C, Hoxc-8 specifically binds
to OPG-Hox1 and OPG-Hox2. A series of 32P-labeled OPG
promoter fragments, indicated in A, were used in gel shift
assays in incubation with GST-Hoxc-8 (0.6 µg), fragments alone
(lanes 1 and 6), fragments with 0.6 µg of GST (lanes 2 and 7), or 0.6 µg of GST-Hoxc-8 (lanes 3 and 8).
Lanes 4 and 8 contained a 50-fold
molar excess of unlabeled indicated fragments. OPG-mHox1 and OPG-mHox2
were incubated with 0.6 µg of GST-Hoxc-8 as shown in lanes
5 and 10, respectively.
|
|
Hoxc-8 Interaction Domain of Smad1 Are Sufficient to Induce
OPG Promoter Activation--
We have previously established the
BMP-induced gene transcription model (27, 40), in which Smad1 removes
Hoxc-8 binding via direct interaction between these two proteins (33).
We also mapped the interaction domains for both proteins. The Smad1
linker region is one of the domains (Smad1C, Fig.
4A) that interacts with Hoxc-8
and blocks Hoxc-8 binding to its DNA element (34). The binding of
Hoxc-8 to OPG promoter predicts that overexpression of the Smad1 linker
region activates OPG promoter transcription activity. To determine
whether such was the case, we cotransfected Smad1C expression plasmids
in C3H10T1/2 cells with the OPG promoter construct (OPG1) or the SV40
promoter linked to the two OPG Hox sites (OPG-SV40). Smad1C
dramatically stimulates transcription activity for both constructs, and
Hoxc-8 inhibits Smad1C-induced transcription activity. Notably, Smad1C
with deletion of Smad1 interactin domain did not have such an effect
(Fig. 4B). The construct with both mutated Hox sites
(mOPG-SV40) or a single Hox site mutation (m1OPG-SV40 and m2OPG-SV40)
was transfected in C3H10T1/2 cells. Fig. 4C shows that
mutation of one or both Hox sites significantly decreased
Smad1C-induced OPG promoter transcription. These results establish that
the interaction between Smad1 and Hoxc-8 mediates BMP signals and
support our proposed model for BMP-induced gene transcription.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 4.
Smad1-Hoxc-8 interaction domain activates OPG
gene transcription. A, constructs of Smad1C and
m-Smad1C. B, Smad1-Hoxc-8 interaction domain (Smad1C)
stimulates OPG gene transcription. C3H10T1/2 cells plated at a density
of 5 × 104 cells/well in 12-well plates were
cotransfected with 0.3 µg of different OPG luciferase reporter
constructs as indicated and 0.1 µg of Smad1-Hoxc-8 interaction domain
construct (Smad1C) or Smad1C mutant construct (Smad1C), respectively,
in the absence or presence of 0.1 µg of Hoxc-8. C, Hox
binding site mutation constructs of OPG inhibit the activation of
Smad1C. C3H10T1/2 cells plated at a density of 5 × 104 cells/well in 12-well plates were cotransfected with
0.3 µg of luciferase reporter plasmids indicated above with 0.1 µg
of Smad1C expression plasmids or cotransfected with 0.1 µg of Hoxc-8
expression plasmid. After 42 h, cells were lysed to measure
luciferase activity, which was normalized to Renilla
luciferase level. Data are shown with the mean ± S.D. of
triplicates.
|
|
Smad1-Hoxc-8 Interaction Induces Endogenous OPG Gene
Expression--
Having characterized the BMP-induced transcription
mechanism for the OPG promoter, we then examined if the OPG promoter
analysis-derived transcription mechanism reflects Smad1-mediated
endogenous OPG gene expression. C3H10T1/2 cells were transfected with
Smad1C expression plasmids. The OPG protein expression levels were
measured by Western blot from the Smad1C-transfected 2T3 cells. As seen in Fig. 5A, a 55-kDa band was
significantly induced. Another band above 79 kDa appeared later at
32 h after Smad1C transfection, indicating that a large amount of
monomer and a small amount of dimer exist in cells. Simonet et
al. (7) demonstrated that OPG is synthesized as an ~55-kDa
monomer within the cell, and the monomers are then converted to
disulfide-linked dimers of ~110 kDa. The dimers are then secreted
into the medium. The specificity of the OPG band recognized in
Western blot is confirmed by completely blocking the band with excess
of OPG antigen (Fig. 5B).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Endogenous OPG was induced by Smad1-Hoxc-8
interaction domain. 2T3 cells were plated in 100-mm plates and
transfected (when ~70% confluent) with 5 µg of empty expression
vector (V) or 5 µg of Smad1C-NLS. The transfected cells
were harvested at 24, 32, 40, and 48 h after transfection. Cell
lysates were analyzed by SDS-polyacrylamide gel electrophoresis.
A, Western blot was performed using anti-OPG polyclonal
antibody alone. B, Western blot was performed using anti-OPG
polyclonal antibody with the addition of 1 µg/µl OPG blocking
peptide.
|
|
Finally, we examined the biological activity of secreted OPG in the
medium from Smad1C-transfected cells. Osteoclasts normally differentiate from members of the monocyte-macrophage lineage when
exposed to OPGL and M-CSF, but OPG inhibits osteoclast differentiation. Primary mouse BMMs were cultured (38) in the presence or absence of
M-CSF and OPGL in combination with one-fourth of the medium from
Smad1C- or vector-transfected 2T3 cells. A significant quantity of
TRAP+ multinucleated osteoclasts was formed in cells
treated with M-CSF and OPGL (Fig.
6A), and the addition of
medium from cells transfected with the empty vector did not change
TRAP+ multinucleated osteoclast formation (Fig.
6C). The addition of Smad1C-transfected medium significantly
blocked TRAP+ multinucleated osteoclast differentiation
(Fig. 6D), similar to macrophages cultured without M-CSF and
OPGL (Fig. 6B). These results demonstrate that Smad1C
induces secretion of functional OPG protein, which inhibits
osteoclastogenesis.

View larger version (157K):
[in this window]
[in a new window]
|
Fig. 6.
Osteoclast formation from bone marrow
precursors was inhibited by the media from Smad1C transfected 2T3
cells. Mouse bone marrow macrophages (BMMs) were cultured with
(A, C, and D) or without
(B) M-CSF (10 ng/ml) and GST-OPGL (50 ng/ml). Media from 2T3
cells transfected with PCDNA3 empty vector (C) or
Smad1C construct (D) were added to M-CSF- and
GST-OPGL-stimulated BMMs (media from transfected 2T3 cells/bone marrow
cell media = 1:3). Multinucleated osteoclasts were shown by TRAP
staining. Upper panels, direct scan of the
stained 12-well plate; bottom panels,
representative photomicrographs (× 10 objective) of TRAP-stained
cultures.
|
|
 |
DISCUSSION |
The aim of this study is to elucidate the transcription mechanism
of BMP-induced OPG gene expression and further explore the interaction
between Smad1 and Hoxc-8 as an initial cascade in BMP-induced
osteoblast differentiation. We characterized BMP response elements in
the OPG promoter. Promoter deletion analysis demonstrates that the OPG
promoter fragment bearing two Hox binding sites responds to BMP
stimulation. Deletion of the two Hox binding sites abolished BMP-induced OPG promoter activity, and further deletion of other putative Hox binding sites did not change the luciferase activity in
response to BMP stimulation. This observation was validated by
transfection studies with the construct containing mutations of the two
Hox binding sites (Fig. 2B). Furthermore, gel shift assays
demonstrate that Hoxc-8 binds to the two Hox sites specifically. There
are other putative Hox binding sites identified by the core sequence
TAAT in the OPG promoter. However, these Hox sites did not appear to
mediate BMP signals in the osteogenic cells. The flanking regions of
the "core" are important in determining the specificity of Hox
binding, since there are 39 members in the Hox family. It is possible
that these Hox binding sites play an essential role in regulating OPG
gene expression in different tissues during development.
We then examined whether Smad1 interaction with Hoxc-8 mediates the BMP
signals via the two Hox binding sites. We previously showed that the
Smad1 linker region interacts with Hoxc-8 to induce osteopontin gene
transcription. Overexpression of this interaction domain is sufficient
to induce osteoblast differentiation and bone cell formation (34).
Similar to osteopontin promoter, transfection of the Smad1 linker
region significantly activated OPG promoter transcription in C3H10T1/2
cells, and the induced promoter activity is inhibited by Hoxc-8. Thus,
these data suggest the interaction between Smad1 and Hoxc-8 is a
general transcription mechanism in the BMP signaling pathway.
The most important functional finding is that the overexpression of
Smad1 linker region stimulated endogenous OPG protein expression in
C3H10T1/2 cells. The induced OPG protein was secreted into medium,
which effectively inhibited osteoclastogenesis. It is known that BMPs
play a critical role in bone remodeling and in maintaining the
structural integrity of the skeletal system, due to their ability to
induce osteoblast differentiation (22-25). OPG, on the other hand,
mediates the communication between osteoblast and osteoclast to sustain
bone density. The BMP-induced OPG transcription mechanism revealed in
the current study involves Smad1 interaction with Hoxc-8, which is a
quick response to BMP stimulation, since it only requires Smad1
phosphorylation. This logically explains the importance of the balance
between osteoblast activity and osteoclast activity. The regulation of
bone cell differentiation is a very complicated process. OPG is a
potent inhibitor of osteoclast-mediated bone resorption produced by
osteoblast. It was recently shown that OPG mRNA expression is
stimulated by many bone metabolic growth factors, such as tumor
necrosis factor-
(20), TGF-
(18, 19), and BMP-2 (20), while
down-regulated by osteoclast formation agents, such as
1,25-(OH)2D3, prostaglandin E2, and parathyroid hormone (19). To our knowledge, this is the first study to
characterize the OPG transcription mechanism in osteoblastic cells,
which may provide a potential anti-resorption therapeutic opportunity.
BMPs initiate the entire transcription program in osteoblast
differentiation. Their signals are mediated by phosphorylation of BMP
receptor-regulated Smads, including Smad1, Smad5, and Smad8. Hoxc-8 has
been characterized as the downstream transcription factor of Smad1 in
BMP-induced osteoblast differentiation (33), and our data also indicate
that Hoxc-8 is specific for the BMP signaling pathway. Data presented
in this paper provide additional evidence supporting the hypothesis
that the interaction of Smad1 with Hoxc-8 represents the initiation
mechanism for BMP-induced osteoblast differentiation. Smad1-Hoxc-8
interaction is the mechanism in activating OPG gene expression, another
early marker gene, in response to BMP stimulation. A wide existence of
putative Hox binding sites in many other early BMP-responsive genes
(35, 36) also suggests the role of Smad1-Hoxc-8 interaction in their BMP-induced gene transcription. However, since Smad1 itself is a
sequence-specific transcription factor and there are other
BMP-regulated Smads, such as Smad5 and Smad8, an intricate BMP-induced
transcription network is anticipated. The BMP-induced transcription
cascades will become clear when more BMP downstream transcription
factors are identified and more transcription mechanisms are
characterized from BMP-regulated genes.
We are grateful to J. Wrana for kindly
providing the constitutively active BMP type IA (ALK3) receptor
expression vector, R. Derynck for human Smad1 cDNA clones, and H. Le Mouellic for Hoxc-8 cDNA expression vectors.
Published, JBC Papers in Press, January 3, 2001, DOI 10.1074/jbc.M006918200
The abbreviations used are:
OPG, osteoprotegrin;
OPGL, osteoprotegrin ligand;
TGF-
, transforming growth factor-
;
BMP, bone morphogenetic protein;
EMSA, electrophoretic mobility shift
assay;
BMM, bone marrow macrophage;
M-CSF, macrophage
colony-stimulating factor;
TRAP, tartrate-resistant phosphatase;
GST, glutathione S-transferase;
Hox, homeobox gene.
1.
|
Manolages, S. C.,
and Jilka, R. L.
(1995)
N. Engl. J. Med.
332,
305-311[Free Full Text]
|
2.
|
Horowitz, M. C.
(1993)
Science
260,
626-627[Medline]
[Order article via Infotrieve]
|
3.
|
Suda, T.,
Takahashi, N.,
and Martin, T. J.
(1992)
Endocr. Rev.
13,
66-80[Medline]
[Order article via Infotrieve]
|
4.
|
Chambers, T. J.,
Owens, J. M.,
Hattersley, G.,
Jat, P. S.,
and Noble, M. D.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5578-5582[Abstract]
|
5.
|
Yasuda, H.,
Shima, N.,
Nakagawa, N.,
Yamaguchi, K.,
Kinosaki, M.,
Mochizuki, S.,
Tomoyasu, A.,
Yano, K.,
Goto, M.,
Murakami, A.,
Tsuda, E.,
Morinaga, T.,
Higashio, K.,
Udagawa, N.,
Takahashi, N.,
and Suda, T.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
3597-3602[Abstract/Free Full Text]
|
6.
|
Lacey, D. L.,
Timms, E.,
Tan, H. L.,
Kelley, M. J.,
Dunstan, C. R.,
Burgess, T.,
Elliott, R.,
Colombero, A.,
Elliot, G.,
Scully, S.,
Hsu, H.,
Sullivan, J.,
Hawkins, N.,
Davy, E.,
Capparelli, C.,
Eli, A.,
Qian, Y. X.,
Kaufman, S.,
Sarosi, I.,
Shalhoub, V.,
Senaldi, G.,
Guo, J.,
Delaney, J.,
and Boyle, W. J.
(1998)
Cell
93,
165-176[Medline]
[Order article via Infotrieve]
|
7.
|
Simonet, W. S.,
Lacey, D. L.,
Dunstan, C. R.,
Kelley, M.,
Chang, M. S.,
Luthy, R.,
Nguyen, H. Q.,
Wooden, S.,
Bennett, L.,
Boone, T.,
Shimamoto, G.,
DeRose, M.,
Elliott, R.,
Colombero, A.,
Tan, H. L.,
Trail, G.,
Sullivan, J.,
Davy, E.,
Bucay, N.,
Renshaw-Gegg, L.,
Hughes, T. M.,
Hill, D.,
Pattison, W.,
Campbell, P.,
Sander, S.,
Van, G.,
Tarpley, J.,
Derby, P.,
Lee, R.,
and Boyle, W. J.
(1997)
Cell
89,
309-319[Medline]
[Order article via Infotrieve]
|
8.
|
Kong, Y-Y.,
Yoshida, H.,
Sarosi, I.,
Tan, H. L.,
Timms, E.,
Capparelli, C.,
Morony, S.,
Oliveira-dos-Santos, A. J.,
Van, G.,
Itie, A.,
Khoo, W.,
Wakeham, A.,
Dunstan, C. R.,
Lacey, D. L.,
Mak, T. W.,
Boyle, W. J.,
and Penninger, J. M.
(1999)
Nature
397,
315-323[CrossRef][Medline]
[Order article via Infotrieve]
|
9.
|
Hakeda, Y.,
Kobayashi, Y.,
Yamaguchi, K.,
Yasuda, H.,
Tsuda, E.,
Higashio, K.,
Miyata, T.,
and Kumegawa, M.
(1998)
Biochem. Biophys. Res. Commun.
251,
796-801[CrossRef][Medline]
[Order article via Infotrieve]
|
10.
|
Tsuda, E.,
Goto, M.,
Mochizuki, S.,
Yano, K.,
Kobayashi, F.,
Morinaga, T.,
and Higashio, K.
(1997)
Biochem. Biophys. Res. Commun.
234,
137-142[CrossRef][Medline]
[Order article via Infotrieve]
|
11.
|
Bocay, N.,
Sarosi, I.,
Dunstan, C. R.,
Morony, S.,
Tarpley, J.,
Capparelli, C.,
Scully, S.,
Tan, H. L.,
Xu, W.,
Lacey, D. L.,
Boyle, W. J.,
and Simonet, W. S.
(1998)
Genes Dev.
12,
1260-1268[Abstract/Free Full Text]
|
12.
|
Mizuno, A.,
Amizuka, N.,
Irie, K.,
Murakami, A.,
Fujise, N.,
Kanno, T.,
Sato, Y.,
Nakagawa, N.,
Yasuda, H.,
Mochizuki, S.,
Gomibuchi, T.,
Yano, K.,
Shima, N.,
Washida, N.,
Tsuda, E.,
Morinaga, T.,
Higashio, K.,
and Ozawa, H.
(1998)
Biochem. Biophys. Res. Commun.
247,
610-615[CrossRef][Medline]
[Order article via Infotrieve]
|
13.
|
Kong, Y-Y.,
Feige, U.,
Sarosi, L.,
Bolon, B.,
Tafuri, A.,
Morony, S.,
Capparelli, C.,
Li, J.,
Elliott, R.,
McCabe, S.,
Wong, T.,
Campagnuolo, G.,
Moran, E.,
Bogoch, E.,
Van, G.,
Nguyen, L.,
Ohashi, P.,
Lacey, D.,
Fish, E.,
Boyle, W.,
and Penninger, J.
(1999)
Nature
402,
304-309[CrossRef][Medline]
[Order article via Infotrieve]
|
14.
|
Yasuda, H.,
Shima, N.,
Nakagawa, N.,
Mochizuki, S. I.,
Yano, K.,
Fujise, N.,
Sato, Y.,
Goto, M.,
Yamaguchi, K.,
Kuriyama, M.,
Kanno, T.,
Murakami, A.,
Tsuda, E.,
Morinaga, T.,
and Higashio, K.
(1998)
Endocrinology
139,
1329-1337[Abstract/Free Full Text]
|
15.
|
Kwon, B. S.,
Wang, S.,
Udagawa, N.,
Haridas, V.,
Lee, Z. H.,
Kim, K. K.,
Oh, K. O.,
Green, J.,
Li, Y.,
Su, J.,
Gentz, R.,
and Aggarwal, B. B.
(1998)
FASEB J.
12,
845-854[Abstract/Free Full Text]
|
16.
|
Vidal, O. N.,
Sjogren, K.,
Eriksson, B. I.,
Ljunggren, O.,
and Ohlsson, C.
(1998)
Biochem. Biophys. Res. Commun.
248,
696-700[CrossRef][Medline]
[Order article via Infotrieve]
|
17.
|
Brandstrom, H.,
Jonsson, K. B.,
Vidal, O.,
Ljunghall, S.,
Ohlsson, C.,
and Ljunggren, O.
(1998)
Biochem. Biophys. Res. Commun.
248,
454-457[CrossRef][Medline]
[Order article via Infotrieve]
|
18.
|
Takai, H.,
Kanematsu, M.,
Yano, K.,
Tsuda, E.,
Higashio, K.,
Ikeda, K.,
Watanabe, K.,
and Yamada, Y.
(1998)
J. Biol. Chem.
273,
27091-27096[Abstract/Free Full Text]
|
19.
|
Murakami, T.,
Yamamoto, M.,
Yamamoto, M.,
Ono, K.,
Nishikawa, M.,
Nagata, N.,
Motoyoshi, K.,
and Akatsu, T.
(1998)
Biochem. Biophys. Res. Commun.
252,
747-752[CrossRef][Medline]
[Order article via Infotrieve]
|
20.
|
Hofbauer, L. C.,
Dunstan, C. R.,
Spelsberg, T. C.,
Riggs, B. L.,
and Khosla, S.
(1998)
Biochem. Biophys. Res. Commun.
250,
776-781[CrossRef][Medline]
[Order article via Infotrieve]
|
21.
|
Brandstrom, H.,
Jonsson, K. B.,
Ohlsson, C.,
Vidal, O.,
Ljunghall, S.,
and Ljunggren, O.
(1998)
Biochem. Biophys. Res. Commun.
247,
338-341[CrossRef][Medline]
[Order article via Infotrieve]
|
22.
|
Schmitt, J. M.,
Hwang, K.,
Shelley, R. W.,
and Jeffery, O. H.
(1999)
J. Orthop. Res.
17,
269-278[Medline]
[Order article via Infotrieve]
|
23.
|
Wang, E. A.,
Rosen, V.,
D'Alessandro, J. S.,
Bauduy, M.,
Cordes, P.,
Harada, T.,
Israel, D. I.,
Hewick, R. M.,
Kerns, K. M.,
and LaPan, P.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
2220-2224[Abstract]
|
24.
|
Ahrens, M.,
Ankenbauer, T.,
Schroder, D.,
Hollnagel, A.,
Mayer, H.,
and Gross, G.
(1993)
DNA Cell Biol.
12,
871-880[Medline]
[Order article via Infotrieve]
|
25.
|
Katagiri, T.,
Yamaguchi, A.,
Ikeda, T.,
Yoshiki, S.,
Wozney, J. M.,
Rosen, V.,
Wang, E. A.,
Tanaka, H.,
Omura, S.,
and Suda, T.
(1990)
Biochem. Biophys. Res. Commun.
172,
295-299[Medline]
[Order article via Infotrieve]
|
26.
|
Massague, J.
(1998)
Annu. Rev. Biochem.
67,
753-791[CrossRef][Medline]
[Order article via Infotrieve]
|
27.
|
Wrana, J. F.
(2000)
Cell
100,
189-192[Medline]
[Order article via Infotrieve]
|
28.
|
Kawabata, M.,
Inoue, H.,
Hanyu, A.,
Imamura, T.,
and Miyazono, K.
(1998)
EMBO J.
17,
4056-4065[Abstract/Free Full Text]
|
29.
|
Hoodless, P. A.,
Haerry, T.,
Abdollah, S.,
Stapleton, M.,
O'Connor, M. B.,
Attisano, L.,
and Wrana, J. L.
(1996)
Cell
85,
489-500[Medline]
[Order article via Infotrieve]
|
30.
|
Kretzschmar, M.,
Liu, F.,
Hata, A.,
Doody, J.,
and Massague, J.
(1997)
Genes Dev.
11,
984-995[Abstract]
|
31.
|
Verschueren, K.,
Remacle, J. E.,
Collart, C.,
Kraft, H.,
Baker, B. S.,
Tylzanowski, P.,
Nelles, L.,
Wuytens, G.,
Su, M. T.,
Bodmer, R.,
Smith, J. C.,
and Huylebroeck, D.
(1999)
J. Biol. Chem.
274,
20489-20498[Abstract/Free Full Text]
|
32.
|
Kim, J.,
Johnson, K.,
Chen, H. J.,
Carroll, S.,
and Laughon, A.
(1997)
Nature
388,
304-308[CrossRef][Medline]
[Order article via Infotrieve]
|
33.
|
Shi, X.,
Yang, X.,
Chen, D.,
Chang, Z.,
and Cao, X.
(1999)
J. Biol. Chem.
274,
13711-13717[Abstract/Free Full Text]
|
34.
|
Yang, X.,
Ji, X.,
Shi, X.,
and Cao, X.
(2000)
J. Biol. Chem.
275,
1065-1072[Abstract/Free Full Text]
|
35.
|
Feng, J.,
Chen, D.,
Cooney, A. J.,
Tsai, M.,
Harris, M. A.,
Tsai, S. Y.,
Feng, M.,
Mundy, G. R.,
and Harris, S. E.
(1995)
J. Biol. Chem.
270,
28364-28373[Abstract/Free Full Text]
|
36.
|
Zhou, H.,
Hammonds, R. G., Jr,
Findlay, D. M.,
Martin, T. J.,
and Ng, K. W.
(1993)
J. Cell. Physiol.
155,
112-119[Medline]
[Order article via Infotrieve]
|
37.
|
Sterner, J. M.,
Murata, Y.,
Kim, H. G.,
Kennett, S. B.,
Templeton, D. J.,
and Horowitz, J. M.
(1995)
J. Biol. Chem.
270,
9281-9288[Abstract/Free Full Text]
|
38.
|
Bizzarri, C.,
Shioi, A.,
Teitelbaum, S. L.,
Ohara, J.,
Harwalker, V. A.,
Erdmann, J. M.,
Lacey, D. L.,
and Civitelli, R.
(1994)
J. Biol. Chem.
269,
13817-13824[Abstract/Free Full Text]
|
39.
|
McHugh, K. P.,
Hodivala-Dilke, K.,
Zheng, M. H.,
Namba, N.,
Lam, J.,
Novock, D.,
Feng, X.,
Ross, F. P.,
Hynes, R. O.,
and Teitelbaum, S. L.
(2000)
J. Clin. Invest.
105,
433-440[Abstract/Free Full Text]
|
40.
|
Massague, J.,
and Wotton, D.
(2000)
EMBO J.
19,
1745-1754[Abstract/Free Full Text]
|