From the Division of Biological Sciences and
¶ Division of Chemistry, Graduate School of Science, Hokkaido
University, Sapporo, Hokkaido 060-0810, Japan and the
Biomolecular Research Group, National Institute for Advanced
Interdisciplinary Research, Tsukuba, Ibaraki 305-8562, Japan
Received for publication, June 20, 2000, and in revised form, August 30, 2000
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The alternatively spliced isoform of nonmuscle
myosin II heavy chain B (MHC-IIB) with an insert of 21 amino acids in
the actin-binding surface loop (loop 2), MHC-IIB(B2), is expressed
specifically in the central nervous system of vertebrates. To examine
the role of the B2 insert in the motor activity of the myosin II
molecule, we expressed chimeric myosin heavy chain molecules using the
Dictyostelium myosin II heavy chain as the backbone. We
replaced the Dictyostelium native loop 2 with either the
noninserted form of loop 2 from human MHC-IIB or the B2-inserted form
of loop 2 from human MHC-IIB(B2). The transformant
Dictyostelium cells expressing only the B2-inserted chimeric myosin formed unusual fruiting bodies. We then assessed the
function of chimeric proteins, using an in vitro motility assay and by measuring ATPase activities and binding to F-actin. We
demonstrate that the insertion of the B2 sequence reduces the motor
activity of Dictyostelium myosin II, with reduction of the maximal actin-activated ATPase activity and a decrease in the affinity
for actin. In addition, we demonstrate that the native loop 2 sequence
of Dictyostelium myosin II is required for the regulation
of the actin-activated ATPase activity by phosphorylation of the
regulatory light chain.
Myosin is a member of a diverse superfamily of mechanochemical
proteins (1, 2). It produces motor activity together with actin
filaments coupled with ATP hydrolysis. Myosin II (referred to simply as
myosin hereafter) molecules are the best studied members of the
superfamily and are composed of a pair of heavy chains and two pairs of
light chains. The amino-terminal half of the heavy chain forms the head
region, termed subfragment 1 (S1),1 containing both ATP
and actin binding sites.
It is well known that two proteolytically susceptible areas are present
in the head region of skeletal muscle myosin, and the proteolytic
cleavage of the myosin heavy chain (MHC) with trypsin produces
fragments of 25, 50, and 20 kDa (see Fig. 1) (3). Two regions
corresponding to the 25/50-kDa and 50/20-kDa junctions were not
resolved in the crystal structure of chicken skeletal myosin S1,
suggesting that they might exist as flexible surface loops (4). The
locations of these two loops are of interest, since the 25/50-kDa loop
is near the ATP binding pocket, while the 50/20-kDa loop is near the
actin binding site. The amino acid sequence and the length of these two
loops vary among different kinds of myosin molecules (5). Based on
these observations, Spudich proposed that these regions (named loop 1 and loop 2 for 25/50-kDa and 50/20-kDa junctions, respectively) would
play important roles in the tuning of motor activity of myosin (6).
Recently, it was demonstrated that the amino acid sequences of these
loop regions appeared to be more conserved than those of the rest of the myosin molecule among myosins with kinetically or developmentally similar properties, suggesting their functional roles (7).
Nonmuscle myosin plays a role in cell motile processes such as
cytokinesis, migration, and shape change (for a review, see Ref. 8). To
date, two different isoforms of the MHC have been identified in
nonmuscle cells of vertebrates (9, 10). They were referred to as MHC-A
and MHC-B or MHC-IIA and MHC-IIB. These two isoforms are expressed in a
tissue-dependent manner. For example, MHC-IIA is abundant
in spleen and intestines, while MHC-IIB is abundant in brain and testis
(9-12).
It has been demonstrated that the two loops serve as sites for
alternative splicing of mRNA to produce inserted isoforms of MHC-IIB (13-15). One insert of 10 amino acid residues is located at
loop 1, and another insert of 21 amino acid residues is located at loop
2. These inserts are referred to as B1 and B2, respectively. These
inserted isoforms are expressed specifically in the brain and the
spinal cord (12-14), and the expression of these inserted isoforms is
regulated developmentally in brain (12, 14, 16, 17). Pato et
al. (18) characterized the B1-inserted isoform, myosin IIB(B1),
using the baculovirus expression system. However, to date, there has
been no biochemical characterization of myosin IIB(B2) consisting of
the B2-inserted MHC. This has mainly been due to the inability to
purify sufficient quantities of pure myosin IIB(B2) from brain tissue.
The importance of loop 2 for myosin function was first suggested by
proteolytic cleavage studies (19-22). The actin-activated ATPase
activity was decreased by proteolytic cleavage in the loop 2 region
(19, 21). The proteolytic cleavage of loop 2 was inhibited in the
presence of F-actin (19, 20), and it reduced the affinity of myosin for
F-actin (22). The importance of loop 2 was also indicated by molecular
genetic studies. It was demonstrated that the substitution of loop 2 of
Dictyostelium myosin with that of other myosins caused a
change in the actin-activated ATPase to values correlating with the
activity of the donor myosins (23). A further detailed study by Murphy
and Spudich (24) showed that the Vmax of
actin-activated ATPase activity and the affinity of myosin for actin
are both affected by substitutions with loop 2 sequence. To examine the
role of the B2 insert in the motor activity of the myosin molecule, we
adopted a similar strategy. We expressed chimeric heavy chains of
Dictyostelium myosin and S1 in which the loop 2 sequence was
replaced with either the noninserted form or the B2-inserted form of
human MHC-IIB (see Fig. 1) and assessed
the function of these chimeras using an in vitro motility assay system and by measuring steady state ATPase activities and interaction with F-actin.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (12K):
[in a new window]
Fig. 1.
Chimeric myosins construction. The
boxed sequences represent the loop 2 located at
the 50/20-kDa junction region. The loop 2 sequence of
Dictyostelium myosin was replaced with the loop 2 sequence
from human nonmuscle myosin IIB and its B2-inserted isoform, myosin
IIB(B2).
Our work suggests that the motor activity of myosin is reduced by the
insertion of the B2 sequence, with a reduction of
Vmax and a decrease of the affinity for actin.
In addition, we demonstrate that the native loop 2 sequence of
Dictyostelium myosin is required for the proper regulation
of the actin-activated ATPase activity by phosphorylation of the
regulatory light chain.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plasmid Construction-- All DNA manipulations were done using standard procedures (25). The template for mutagenesis was pMyDAP (26), carrying the entire Dictyostelium MHC gene. The plasmids encoding the MHC with chimeric loop 2 replacements were constructed by polymerase chain reaction-directed mutagenesis according to the method of Uyeda et al. (23). Mutant Dic-B2 was made by replacing the loop 2 sequence with that of the human nonmuscle MHC-IIB, as follows. The 5' fragment was synthesized using a 5' primer GGAATTCAGATCTCGAACTTTGCTTCA and a 3' mutagenic primer starting inside the region of substitution, ACGCGTCGACCGGTAACTTGATCTAAACCAACAATACGATCAACATCTTTCCAAAGTTTGGTGACAACGTT. The 3' fragment was synthesized using a 3' primer GGGGTACCATGGCCATGATTTGAAAT and a 5' mutagenic primer starting inside the region of substitution, GCGTCGACCGGTATGACTGAAACCGCCTTCGGTTCAGCCTACAAGACCAAGAAAGGTGCAAACTT. The mutagenic primers contain some overlapping sequence to allow subsequent fusion of the 5' and 3' fragments by restriction enzyme digestion followed by ligation. The resulting 5' fragment was digested with EcoRI/SalI and subcloned into the EcoRI and SalI sites of pBluescriptIISK+. The resulting 3' fragment was digested with AgeI/KpnI and subcloned into the AgeI and KpnI sites of the plasmid carrying the 5' fragment. This plasmid was digested with BglII/NcoI, and the resulting BglII-NcoI fragment was used to replace the corresponding wild-type sequence of the MHC gene in pTIKLMyDAP (27). Mutant Dic-B2 was made by inserting the B2 insert sequence of the human MHC-IIB(B2) into Dic-B, as follows. The 5' fragment was synthesized using a 5' primer, GGAATTCAGATCTCGAACTTTGCTTCA, and a 3' mutagenic primer starting inside the region of substitution, ACGCGTCGACAAGCTTGCACGCTGGATGTTCTGGATTTCATCTTTCCAAAGTTTGGT. The 3' fragment was synthesized using a 3' primer, GGGGTACCATGGCCATGATTTGAAAT, and a 5' mutagenic primer starting inside the region of substitution, GCGTCGACAAGCTTCTACGACTCAGTCTCCGGTCTCCACGAACCACCAGTTGATCGTATTGTTGGT. The resulting 5' fragment was digested with EcoRI/HindIII and subcloned into the EcoRI and HindIII sites of pBluescriptIISK+. The resulting 3' fragment was digested with HindIII/KpnI and subcloned into the HindIII and KpnI sites of the plasmid carrying the 5' fragment. This plasmid was digested with BglII/NcoI, and the resulting BglII-NcoI fragment was used to replace the corresponding wild-type sequence of the MHC gene in pTIKLMyDAP. All sequences of the primers are shown 5' to 3', and mutated sequences are underlined. All DNA constructs were confirmed by sequencing.
The plasmids for the expression of chimeric S1 fragments of Dic-B and Dic-B2 were constructed by replacing the BglII-NcoI fragments of the pTIKL·OE·S1-His63 with each of the BglII-NcoI fragments as described above.
Manipulation of Dictyostelium Cells-- Dictyosteliumcells were grown in HL5 medium (28) supplemented with 60 µg each of streptomycin and ampicillin per ml at 23 °C. The plasmids carrying either mutant or wild-type MHC gene were transformed into HS1, an MHC null strain (29), by electroporation (30). The plasmids carrying either mutant or wild-type S1 were transformed into HS1 or Ax2 cells. Transformants were selected in a medium supplemented with 12 µg/ml G418 (Roche Diagnostics) and maintained with 8 µg/ml G418 at 23 °C. For the isolation of myosin or S1-His6 protein, the cells expressing either the mutant or wild-type myosin were grown in 3-liter flasks containing 1.2 liters of medium supplemented with 8 µg/ml G418 on a rotary shaker at 23 °C.
Protein Purification-- All procedures were carried out at 4 °C. Myosins were purified by the method of Uyeda and Spudich (31) with some modifications. In brief, cells were harvested and then washed with 20 mM Tris-HCl (pH 7.5). Approximately 10 g of cells were obtained from 1.2 liter of the culture. The volume of the buffer at each step hereafter was determined on the basis of the weight of the cells. The cells were resuspended in five volumes of a lysis buffer (25 mM Hepes (pH 7.4), 2 mM EDTA, 50 mM NaCl, and 1 mM DTT)/g of cells. The cell suspension was mixed with four volumes of lysis buffer containing Triton X-100/g of cells. The final concentration of Triton X-100 was 0.4%. The lysate was centrifuged at 36,000 × g for 20 min, and the pellet was homogenized in nine volumes of a washing buffer (10 mM Hepes (pH 7.4), 150 mM NaCl, 3 mM MgCl2, and 1 mM DTT)/g of cells. The homogenate was centrifuged at 36,000 × g for 20 min. The pellet was suspended in 1.5 volumes of an extraction buffer (10 mM Hepes (pH 7.4), 125 mM NaCl, 3 mM MgCl2, and 1 mM DTT)/g of cells. The suspension was made 5 mM with respect to ATP and immediately centrifuged at 115,000 × g for 30 min. The supernatant was recovered, and RNase A (Roche Diagnostics) was added to 5 µg/ml. The sample was dialyzed against a buffer containing 10 mM MOPS (pH 6.8), 50 mM NaCl, 10 mM MgCl2, 1 mM DTT, 0.1 mM phenylmethylsulfonyl fluoride, and 5 mM benzamidine for 4 h. The sample was then centrifuged at 36,000 × g for 20 min. The resulting pellet was resuspended in 0.2 volumes of a high salt buffer (10 mM Hepes (pH 7.4), 300 mM NaCl, 3 mM MgCl2, and 1 mM DTT) containing 0.5 mM ATP. The sample was made 5 mM with respect to ATP and centrifuged immediately at 265,000 × g for 20 min. The supernatant was diluted 5-fold with a buffer containing 10 mM MOPS (pH 6.8), 10 mM MgCl2, and 1 mM DTT and incubated for 40 min on ice. The precipitate was recovered by centrifugation at 115,000 × g for 30 min and was dissolved in 0.1 volume/g of cells of a high salt buffer. The sample was finally centrifuged at 265,000 × g for 10 min to remove the insoluble materials. The lysis, washing, and extraction buffers contained the following protease inhibitors: 0.1 mM phenylmethylsulfonyl fluoride, 50 µg/ml 1-chloro-3-tosylamido-7-amino-L-2-heptanone, 80 µg/ml N-tosyl-L-phenylalanine chloromethyl ketone, 2 µg/ml pepstatin, 5 µg/ml leupeptin, and 5 mM benzamidine.
S1-His6 proteins were purified by the method of Giese and Spudich (32) with some modifications. In brief, the harvested cells were resuspended in four volumes of lysis buffer (50 mM NaCl, 20 mM Tris-HCl (pH 7.5), 3 mM MgCl2) containing 3.5 mM 2-mercaptoethanol, 10 mM glucose. The cells were lysed by inverting the tube several times with an additional four volumes of lysis buffer containing 1% Triton X-100 and 10 mM glucose. The lysate was incubated on ice for 20 min with the addition of 5 mg/ml hexokinase (Sigma) to deplete the endogenous ATP and then centrifuged at 36,000 × g for 20 min. The pellet was resuspended with nine volumes of lysis buffer and centrifuged at 36,000 × g for 20 min. The pellet was resuspended with 1.5 volumes of lysis buffer, made 5 mM with respect to ATP, and immediately centrifuged at 265,000 × g for 10 min. S1-His6 proteins were purified by using a Ni2+ affinity resin (His-Bind; Novagen) according to the manufacturer's procedure. The eluted S1-His6 proteins were dialyzed against a buffer containing 50 mM KCl, 20 mM Tris-HCl (pH 7.5) overnight. The sample was finally centrifuged at 14,000 × g for 10 min to remove insoluble materials and made 2 mM with respect to DTT.
Rabbit skeletal muscle actin was purified by the method of Pardee and Spudich (33), and its concentration was determined from the absorbance at 280 nm using an absorption coefficient of 1.1 for a 1 mg/ml solution. The concentration of the purified myosins, S1-His6 proteins, and myosin light chain kinase were measured by the method of Bradford (34) using BSA as the standard.
Phosphorylation of Myosin-- Phosphorylation of the regulatory light chains of purified myosins was performed using bacterially expressed Dictyostelium myosin light chain kinase, which carried a T166E mutation (35), according to the method of Ruppel et al. (29). The purified chimeric and wild-type myosins (0.4 mg/ml) were incubated in a buffer containing 10 mM Hepes (pH 7.4), 60 mM NaCl, 4 mM MgCl2, 1 mM DTT, 2 mM ATP, and 25 µg/ml myosin light chain kinase (T166E) overnight on ice. The phosphorylated myosin was recovered by centrifugation at 265,000 × g for 10 min and redissolved in a buffer containing 250 mM KCl, 10 mM Hepes (pH 7.4), 4 mM MgCl2, and 1 mM DTT. The solution was finally centrifuged at 265,000 × g for 10 min to remove insoluble materials. Phosphorylation of the regulatory light chains was confirmed by polyacrylamide gel electrophoresis in the presence of urea (36).
In Vitro Motility Assay-- Sliding filament in vitro motility assays were performed according to standard methods (37) at 30 °C. Phosphorylated myosin was diluted to 0.5 mg/ml with a buffer containing 250 mM KCl, 10 mM Hepes (pH 7.4), 4 mM MgCl2, 1 mM DTT and centrifuged at 265,000 × g for 10 min immediately after the addition of 0.2 mg/ml F-actin and 2 mM ATP to remove denatured myosin molecules that bind irreversibly to actin. Velocities of ~50 filaments were scored for each myosin.
Measurement of ATPase Activity-- The steady-state rate of ATPase was determined from the time course of Pi liberation at 25 °C. The concentration of Pi was determined by the method of Gonzalez-Romo et al. (38). The assay conditions for Ca2+-ATPase were 0.05-0.2 µM S1-His6, 0.6 M KCl, 10 mM CaCl2, 1 mM DTT, 0.5 mg/ml BSA, 20 mM Tris-HCl (pH 7.5), 2 mM ATP. The conditions for Mg2+-ATPase were 1-4 µM S1-His6, 25 mM KCl, 4 mM MgCl2, 1 mM DTT, 0.5 mg/ml BSA, 20 mM Tris-HCl (pH 7.5), 1 mM ATP. The conditions for actin-activated ATPase activities were 0.5 µM S1-His6, 0-170 µM F-actin, 8 mM KCl, 4 mM MgCl2, 1 mM DTT, 0.5 mg/ml BSA, 20 mM Tris-HCl (pH 7.5), 1 mM ATP. In the case of myosin, the conditions for actin-activated ATPase activities were 0.2 µM myosin, 0-140 µM F-actin, 25 mM KCl, 4 mM MgCl2, 2 mM DTT, 0.5 mg/ml BSA, 10 mM Hepes (pH 7.4), 1 mM ATP.
Cosedimentation Assay--
The affinity of S1 for actin in the
presence of ATP was measured by cosedimentation assays according to the
procedure of Giese and Spudich (32). F-actin (6 µM) and
various concentrations of S1 (025 µM) were mixed in a
buffer containing 25 mM KCl, 20 mM Tris-HCl (pH
7.5), 4 mM MgCl2, and 1 mM DTT. The
mixtures were centrifuged at 435,000 × g for 10 min at
4 °C immediately after the addition of 2 mM ATP. The
resulting supernatant and pellets were run on SDS-10% polyacrylamide
gels (39). The original uncentrifuged samples were also run on SDS-PAGE
gels. The concentration of S1 was determined by densitometry of the
Coomassie Brilliant Blue-stained bands of the gels.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Phenotypic Analysis of Cells Expressing Chimeric Myosins-- The plasmids containing the wild-type MHC gene (pTIKLMyDAP), Dic-B gene with replacement of the loop 2 sequence with that of human nonmuscle MHC-IIB (pTIKLMyDAP-B), or Dic-B2 gene with that of human nonmuscle MHC-IIB(B2) (pTIKLMyDAP-B2) were introduced into the MHC null cell line HS1, and the transformed cells were selected for G-418 resistance. The expression of the full-length chimeric or wild-type MHCs was confirmed by immunoblot analysis (data not shown). We also confirmed that each transformant expressed MHC at levels comparable with the parental wild-type strain, Ax2.
To assess chimeric myosin function in vivo, we analyzed the
ability of the transformants to form fruiting bodies, a process known
to depend on myosin functions (40, 41). The transformants expressing
the wild-type myosin and the chimeric myosin Dic-B were capable of
forming normal fruiting bodies similar to that of the Ax2 cells (Fig.
2). However, the transformant expressing the chimeric myosin Dic-B2 showed an unusual fruiting body. The height
of the stalks was only one-fourth of the normal ones. This result
suggested that the motor activity of Dictyostelium myosin was apparently modulated by replacement of the loop 2 sequence with
that of human nonmuscle MHC-IIB(B2).
|
In Vitro Motility Assay of Chimeric Myosins--
Each of the
chimeric myosins was purified from the transformed cell lines and was
completely phosphorylated by recombinant Dictyostelium
myosin light chain kinase. To characterize the chimeric myosins at a
molecular level, we first measured the sliding velocities of actin
filaments on myosin-coated surfaces using an in vitro motility assay system. The results are summarized in Fig.
3. Dic-B myosin moved actin filaments at
an average velocity of 1.4 µm/s, which was 75% of the wild-type
myosin. On the other hand, the average sliding velocity of actin
filaments propelled by Dic-B2 myosin was 0.7 µm/s, which was about
37% of the wild-type and ~50% of Dic-B myosin. This result
demonstrates that the insertion of the B2 sequence into the loop 2 of
myosin depresses the motile ability of myosin molecule.
|
Solution ATPase Analysis of Chimeric S1s and Myosins--
We
constructed an expression system for Dictyostelium S1 and
the chimeric S1s derived from Dic-B and Dic-B2 myosins to analyze the
ATPase activity in solution. The high salt Ca2+-ATPase
activities of both Dic-B and Dic-B2 chimeric S1 were almost identical,
although they were ~1.3-fold higher than the value of wild-type S1
(Fig. 4A). The
Mg2+-ATPase activities of both chimeric S1s showed
comparable values, although they were also 1.4-fold higher than that of
wild-type S1 (Fig. 4B). These results suggest that the core
structure of the motor domain is only slightly affected by replacement
of the loop 2 sequence of Dictyostelium wild-type with that
of human nonmuscle myosin IIB and that the insertion of the B2 sequence does not have a further effect.
|
We then measured the actin-activated ATPase of the chimeric S1s as a
function of actin concentration (Fig.
5A). The
Vmax and the apparent Km for
actin of the wild-type S1 were 2.37 s1 and
147 µM, respectively. The activities of Dic-B S1 were
~60% of those of the wild-type S1 at all actin concentration. Dic-B2 S1 showed much lower activities than those of Dic-B S1. However, in the
case of the chimeric S1s, the activities hardly reached the saturation
level within the available actin concentrations of our experimental
conditions, so that the values for Vmax and the
apparent Km obtained by data fitting were
uncertain.
|
Fig. 5B shows the results of measurements of the
actin-activated ATPase activities of chimeric myosins as a function of
actin concentration. The regulatory light chains of the purified
myosins were completely phosphorylated by using recombinant
Dictyostelium myosin light chain kinase. The activities of
both Dic-B myosin and Dic-B2 myosin were lower than that of wild-type
myosin at all actin concentration in a manner similar to those of Dic-B S1 and Dic-B2 S1, respectively. Replacement of the amino acid residues
of Dictyostelium wild-type myosin loop 2 with that of nonmuscle myosin IIB caused a decrease in Vmax
of 1.4-fold from 1.82 to 1.34 s1.
Furthermore, the insertion of B2 amino acid residues into the Dic-B
myosin decreased the Vmax by 2.2-fold from 1.34 to 0.61 s
1. The values for apparent
Km of the wild-type, Dic-B, and Dic-B2 myosins were
29.7, 42.6, and 73.0 µM, respectively. These results
suggest that the insertion of 21 amino acid residues into loop 2 of the
nonmuscle myosin IIB suppresses the actin-activated ATPase activity
with a decrease of the Vmax and the increase of the apparent Km for actin.
Actin Binding Affinity of Chimeric S1s--
To examine the
affinity of chimeric S1s to F-actin, we performed cosedimentation
assays in the presence of ATP (Fig. 6).
Both Dic-B S1 and Dic-B2 S1 sedimented with F-actin in the absence of
ATP (data not shown). In the presence of 2 mM ATP, Dic-B S1 showed a weaker affinity (Kd = 21.2 µM) compared with wild-type S1 (6.3 µM).
Dic-B2 S1 showed a slightly weaker affinity (28.7 µM)
than Dic-B S1. The maximal, extrapolated binding of the Dic-B S1 and
Dic-B2 S1 to actin in the presence of ATP is the same as in wild type
S1 (~1.0). These results indicate that the affinity of S1 for F-actin
is affected by the insertion of B2 amino acid residues into loop 2.
|
Regulation of the Actin-activated ATPase Activities of Chimeric
Myosins by Phosphorylation of the Regulatory Light Chain--
During
the course of this investigation, we noticed an interesting phenomenon
on the regulation of the actin-activated ATPase activity by
phosphorylation of the regulatory light chain of
Dictyostelium myosin. The actin-activated ATPase activities
of unphosphorylated and phosphorylated wild-type myosin, Dic-B myosin,
and Dic-B2 myosin were determined. The results demonstrate that the
chimeric substitutions of loop 2 caused a loss of the
phosphorylation-dependent regulation of actin-activated
ATPase activity by the regulatory light chain (Fig.
7), suggesting that the native loop 2 sequence is required for proper regulation of Dictyostelium
myosin.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In this report, we describe the biochemical characterization of chimeric proteins of Dictyostelium myosin and S1, in which the native loop 2 is replaced with either human nonmuscle MHC-IIB or its B2-inserted isoform. We showed that the high salt Ca2+-ATPase activities and the basal level of Mg2+-ATPase activities of chimeric S1s are slightly increased compared with those of the wild type in agreement with the previous observation (23). The replacement of native loop 2 of Dictyostelium myosin with those of other myosin molecules might cause a slight change in the structure of the motor domain to facilitate spontaneous Pi release. Despite the fact that Dic-B2 contains an additional 21 amino acid residues in loop 2, it did not show any further changes in these activities compared with Dic-B. These results indicate that the chimeric S1s do not have any notable defects in their basal ATPase activity. The crystal structures of the motor domain were quite similar between chicken skeletal muscle myosin (4) and Dictyostelium myosin (42) and showed that the core structure of the motor domain is conserved. These results validated our use of chimeric myosins of Dictyostelium for evaluating the effects of the human B2 insertion in loop 2 on the interaction with actin as reported in the previous studies (23, 24).
The Dic-B chimera showed a lower activity with respect to both the motor activity and the actin-activated ATPase activity compared with those of the wild type with no effect on the formation of fruiting bodies. This result is similar to that of the chimera myosin with the chicken smooth loop 2 sequence (23), which is reasonable considering the similarity of the sequence of loop 2 between the human nonmuscle MHC-IIB and the chicken smooth muscle MHC. In contrast, the Dic-B2 chimera showed much lower activities, which are almost half of those of the Dic-B chimera. The cells expressing the Dic-B2 chimera formed unusual fruiting bodies with short stalks, indicating that the insertion of the B2 sequence of the nonmuscle MHC-IIB causes a significant reduction in the motor activity as well as the actin-activated ATPase activity.
The results of this study showed that both Vmax of the actin-activated ATPase activities and the affinity for F-actin were progressively reduced in Dic-B and Dic-B2. Previous studies have shown that the biochemical modification and the molecular biological substitution of loop 2 change the affinity of myosin for actin and the actin-activated ATPase activity (19-24, 43-46). Recently Furch et al. demonstrated that the net charge of loop 2 caused changes in the actin-activated ATPase activity by studying the substitution of the native loop 2 with synthetic loop constructs (47). They suggested that the increase of the number of positive charges in loop 2 caused a progressive increase in the affinity of myosin for actin. In this study, the replacement of loop 2 with noninserted and B2-inserted sequences of human nonmuscle MHC-IIB added one and three more net negative charges compared with the wild type, respectively. The increase of the negative charges could be responsible for the reduction of the affinity for F-actin in Dic-B and Dic-B2 by repulsion of the N-terminal negative charges of actin (48, 49).
Furch et al. also demonstrated that extensions of the length of loop 2 by up to 20 residues did not change the kinetic parameters of the myosin molecule (47). It is noted that the length of the loop 2 of MHC-IIB(B2) is the longest among the myosin II family (7). Dic-B2 is 38 residues longer than native Dictyostelium myosin in the loop 2. This mutant myosin still possesses the ability to interact productively with F-actin in an ATP-dependent manner. Further, it was shown that the myosin IX molecule has an extra 120 amino acid residues in the loop 2 region (50). Despite such a large insertion in loop 2, myosin IX is able to interact with F-actin in an ATP-dependent manner. Recently Knetsch et al. (51) demonstrated that deletion of 9 amino acids from loop 2 of Dictyostelium myosin affected actin binding and the communication between the actin- and nucleotide-binding sites. It has been suggested that the opening and closing of the 50-kDa cleft occurs correlating with the actin-myosin interaction and is essential to force generation (52-54). In view of the crystal structure of the Dictyostelium myosin motor domain (42), it is probable that deletion of 9 amino acids from the loop 2 provides a conformational distortion for the myosin molecule due to the abnormal closure of the 50-kDa cleft. On the other hand, extension of the length of loop 2 would not cause this conformational distortion. The B2 insert sequence in loop 2 might be located on the surface of myosin motor domain where it does not interfere the interaction with F-actin.
It has been demonstrated that the loop 2 of vertebrate smooth muscle myosin is important for optimal regulation mediated by the phosphorylation of the regulatory light chain (45, 55). With respect to the regulatory property of the loop 2, it is notable that the B2 sequence is inserted at the inhibitory domain in the loop 2 sequence as proposed by Rovner (55). The activities of vertebrate nonmuscle myosin are also regulated by the phosphorylation of its regulatory light chain (56), and the B2 insertion may modify the regulatory mechanism. This possibility can be examined with use of the baculovirus expression system for nonmuscle MHC-IIB sequence with or without the B2 insert. Since the native loop 2 sequence is involved in the optimal regulation in Dictyostelium myosin in the same manner as vertebrate smooth muscle myosin (Fig. 7), this could be a general property among the myosins regulated by the phosphorylation of the regulatory light chains.
Another flexible loop, loop 1, which is located at the 25/50-kDa junction, was proposed to be important for the ATPase mechanism of the myosin molecule also (6). Recently, it was demonstrated that loop 1 modulates the rate of ADP release from the nucleotide binding pocket of myosin molecule (57-59). Loop 1 is also a site for tissue specific alternative splicing of mRNA to produce inserted isoforms of nonmuscle MHC-IIB (13-15). An isoform containing a 10-amino acid insertion in loop 1, referred to as B1 insert, is specifically expressed in the central nervous system tissues, as is the isoform containing the B2 insert (13, 14). Pato et al. (18) demonstrated that insertion of B1 in loop 1 of the chicken MHC-IIB gave no major effect on either the actin-activated ATPase activities or the sliding velocities of actin filaments. They suggested that this insert might have other functional consequences rather than to alter these two parameters of myosin activities.
Why is the expression of the MHC-IIB isoforms containing each or both inserts at loop 1 and loop 2 restricted in the central nervous system? We speculate that the neuronal cells require a number of myosin molecules that exhibit different functional properties to deal with a variety of motile events. Creation of inserted isoforms at loop 1 and loop 2 of myosin IIB might be selected in evolution, because the alternative splicing is a rapid means to produce a number of new isoforms. In other words, loop 1 and loop 2 could be regions that enable tuning of the functional properties of myosin molecules. For example, other systems such as vertebrate smooth muscle (60, 61), Drosophila flight muscle (62), and scallop adductor muscle (63) adopt this alternative splicing at these loops to produce the diversity of the myosin molecule.
The expression of the B1-inserted isoform (14) or the B2-inserted
isoform (12, 14, 16, 17) and probably the isoform containing both
inserts is regulated developmentally in the brain. The B2-inserted
isoform becomes apparent with a different timing in distinct regions
during postnatal development of the rat brain (12, 17). It is probable
that these inserted myosin IIB isoforms play specific roles in the
brain by tuning the functional properties in a distinct temporal and
spatial manner. We demonstrate here that the B2-inserted chimeric
myosin exhibits lower motor activity than the noninserted one. This
result might indicate that the B2-inserted myosin IIB is involved in
slower motile events than those concerned with the non-B2-inserted
isoform in the brain.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Dr. Robert S. Adelstein for helpful discussion and critical reading of the manuscript. We also thank Drs. Fumi Morita and Tsuyoshi Katoh for helpful advice.
![]() |
FOOTNOTES |
---|
* This work was supported by a Grant-in-aid from the Ministry of Education, Science and Culture of Japan. This work was also supported by the Akiyama Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ To whom correspondence should be addressed. Tel.: 81-11-706-3810; Fax: 81-11-706-4909; E-mail: takahash@sci.hokudai.ac.jp.
Published, JBC Papers in Press, October 20, 2000, DOI 10.1074/jbc.M005370200
2 We refer to Dictyostelium chimeric myosins with the loop 2 of the human MHC-IIB and the human MHC-IIB(B2) as Dic-B and Dic-B2, respectively.
3 T. Q. P. Uyeda, unpublished data.
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: S1, subfragment 1; MHC, major histocompatibility complex; DTT, dithiothreitol; MOPS, 4-morpholinepropanesulfonic acid.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Sellers, J. R. (2000) Biochim. Biophys. Acta 1496, 3-22[Medline] [Order article via Infotrieve] |
2. |
Mermall, V.,
Post, P. L.,
and Moosker, M. S.
(1998)
Science
279,
527-533 |
3. | Balint, M., Wolf, I., Tarcsafalvi, A., Gergely, J., and Sréter, F. A. (1978) Arch. Biochem. Biophys. 190, 793-799[Medline] [Order article via Infotrieve] |
4. | Rayment, I., Rypniewski, W. R., Schmidt-Bäse, K., Smith, R., Tomchick, D. R., Benning, M. M., Winkelmann, D. A., Wesenberg, G., and Holden, H. M. (1993) Science 261, 50-58[Medline] [Order article via Infotrieve] |
5. | Warrick, H. M., and Spudich, J. A. (1987) Annu. Rev. Cell Biol. 3, 379-421[CrossRef] |
6. | Spudich, J. A. (1994) Nature 372, 515-518[Medline] [Order article via Infotrieve] |
7. | Goodson, H. V., Warrick, H. M., and Spudich, J. A. (1999) J. Mol. Biol. 287, 173-185[CrossRef][Medline] [Order article via Infotrieve] |
8. | Spudich, J. A., Finer, J., Simmons, B., Ruppel, K., Patterson, B., and Uyeda, T. (1995) Cold Spring Harbor Symp. Quant. Biol. 60, 783-791[Medline] [Order article via Infotrieve] |
9. | Katsuragawa, Y., Yanagisawa, M., Inoue, A., and Masaki, T. (1989) Eur. J. Biochem. 184, 611-616[Abstract] |
10. | Kawamoto, S., and Adelstein, R. S. (1991) J. Cell Biol. 112, 915-924[Abstract] |
11. | Phillips, C. L., Yamakawa, K., and Adelstein, R. S. (1995) J. Muscle Res. Cell Motil. 16, 379-389[Medline] [Order article via Infotrieve] |
12. | Takahashi, M., Hirano, T., Uchida, K., and Yamagishi, A. (1999) Biochem. Biophys. Res. Commun. 259, 29-33[CrossRef][Medline] [Order article via Infotrieve] |
13. |
Takahashi, M.,
Kawamoto, S.,
and Adelstein, R. S.
(1992)
J. Biol. Chem.
267,
17864-17871 |
14. |
Itoh, K.,
and Adelstein, R. S.
(1995)
J. Biol. Chem.
270,
14533-14540 |
15. |
Kawamoto, S.
(1996)
J. Biol. Chem.
271,
17613-17616 |
16. | Murakami, N., Trenkner, E., and Elzinga, M. (1993) Dev. Biol. 157, 19-27[CrossRef][Medline] [Order article via Infotrieve] |
17. | Miyazaki, T., Watanabe, M., Yamagishi, A., and Takahashi, M. (2000) Neurosci. Res. 37, 299-306[CrossRef][Medline] [Order article via Infotrieve] |
18. |
Pato, M. D.,
Sellers, J. R.,
Preston, Y. A.,
Harvey, E. V.,
and Adelstein, R. S.
(1996)
J. Biol. Chem.
271,
2689-2695 |
19. | Mornet, D., Pantel, P., Audemard, E., and Kassab, R. (1979) Biochem. Biophys. Res. Commun. 89, 925-932[Medline] [Order article via Infotrieve] |
20. | Yamamoto, K., and Sekine, T. (1979) J. Biochem. (Tokyo) 86, 1855-1862[Abstract] |
21. | Yamamoto, K., and Sekine, T. (1979) J. Biochem. (Tokyo) 86, 1869-1881[Abstract] |
22. | Botts, J., Muhlrad, A., Takashi, R., and Morales, M. F. (1982) Biochemistry 21, 6903-6905[Medline] [Order article via Infotrieve] |
23. | Uyeda, T. Q. P., Ruppel, K. M., and Spudich, J. A. (1994) Nature 368, 567-569[CrossRef][Medline] [Order article via Infotrieve] |
24. | Murphy, C. T., and Spudich, J. A. (1999) Biochemistry 38, 3785-3792[CrossRef][Medline] [Order article via Infotrieve] |
25. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY |
26. | Egelhoff, T. T., Manstein, D. J., and Spudich, J. A. (1990) Dev. Biol. 137, 359-367[Medline] [Order article via Infotrieve] |
27. |
Uyeda, T. Q. P.,
Abramson, P. D.,
and Spudich, J. A.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
4459-4464 |
28. | Sussman, M. (1987) Methods Cell Biol. 28, 9-29[Medline] [Order article via Infotrieve] |
29. |
Ruppel, K. M.,
Uyeda, T. Q. P.,
and Spudich, J. A.
(1994)
J. Biol. Chem.
269,
18773-18780 |
30. | Egelhoff, T. T., Titus, M. A., Manstein, D. J., Ruppel, K. M., and Spudich, J. A. (1991) Methods Enzymol. 196, 319-334[Medline] [Order article via Infotrieve] |
31. | Uyeda, T. Q. P., and Spudich, J. A. (1993) Science 262, 1867-1870[Medline] [Order article via Infotrieve] |
32. | Giese, K. C., and Spudich, J. A. (1997) Biochemistry 36, 8465-8473[CrossRef][Medline] [Order article via Infotrieve] |
33. | Pardee, J. D., and Spudich, J. A. (1982) Methods Enzymol. 85, 164-181[Medline] [Order article via Infotrieve] |
34. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve] |
35. | Smith, J. L., Silveira, L. A., and Spudich, J. A. (1996) EMBO J. 15, 6075-6083[Abstract] |
36. | Perrie, W. T., and Perry, S. V. (1970) Biochem. J. 119, 31-38[Medline] [Order article via Infotrieve] |
37. | Kron, S. J., Toyoshima, Y. Y., Uyeda, T. Q. P., and Spudich, J. A. (1991) Methods Enzymol. 196, 399-416[Medline] [Order article via Infotrieve] |
38. | Gonzalez-Romo, P., Sanchez-Nieto, S., and Gavilanes-Ruiz, M. (1992) Anal. Biochem. 200, 235-238[Medline] [Order article via Infotrieve] |
39. | Laemmli, U. K. (1970) Nature 227, 680-685[Medline] [Order article via Infotrieve] |
40. | Knecht, D. A., and Loomis, W. F. (1987) Science 236, 1081-1086[Medline] [Order article via Infotrieve] |
41. | De Lozanne, A., and Spudich, J. A. (1987) Science 236, 1086-1091[Medline] [Order article via Infotrieve] |
42. | Fisher, A. J., Smith, C. A., Thoden, J. B., Smith, R., Sutoh, K., Holden, H. M., and Rayment, I. (1995) Biochemistry 34, 8960-8972[Medline] [Order article via Infotrieve] |
43. | Chaussepied, P., and Morales, M. F. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7471-7475[Abstract] |
44. | Yamamoto, K. (1991) J. Mol. Biol. 217, 229-233[Medline] [Order article via Infotrieve] |
45. |
Rovner, A. S.,
Freyzon, Y.,
and Trybus, K. M.
(1995)
J. Biol. Chem.
270,
30260-30263 |
46. |
Bobkov, A. A.,
Bobkova, E. A.,
Lin, S-H.,
and Reisler, E.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
2285-2289 |
47. | Furch, M., Geeves, M. A., and Manstein, D. J. (1998) Biochemistry 37, 6317-6326[CrossRef][Medline] [Order article via Infotrieve] |
48. | Sutoh, K., Ando, M., Sutoh, K., and Toyoshima, Y. Y. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7711-7714[Abstract] |
49. |
Cook, R. K.,
Root, D.,
Miller, C.,
Reisler, E.,
and Rubenstein, P. A.
(1993)
J. Biol. Chem.
268,
2410-2415 |
50. | Reinhard, J., Scheel, A. A., Diekmann, D., Hall, A., Ruppert, C., and Bähler, M. (1995) EMBO J. 14, 697-704[Abstract] |
51. |
Knetsch, M. L. W.,
Uyeda, T. Q. P.,
and Manstein, D. J.
(1999)
J. Biol. Chem.
274,
20133-20138 |
52. | Rayment, I., Holden, H. M., Whittaker, M., Yohn, C. B., Lorenz, M., Holmes, K. C., and Milligan, R. A. (1993) Science 261, 58-65[Medline] [Order article via Infotrieve] |
53. | Yount, R. G., Lawson, D., and Rayment, I. (1995) Biophys. J. 68 (suppl.), 44-49 |
54. |
Mendelson, R.,
and Morris, E. P.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
8533-8538 |
55. |
Rovner, A. S.
(1998)
J. Biol. Chem.
273,
27939-27944 |
56. | Tan, J. L., Ravid, S., and Spudich, J. A. (1992) Annu. Rev. Biochem. 61, 721-759[CrossRef][Medline] [Order article via Infotrieve] |
57. |
Sweeney, H. L.,
Rosenfeld, S. S.,
Brown, F.,
Faust, L.,
Smith, J.,
Xing, J.,
Stein, L. A.,
and Sellers, J. R.
(1998)
J. Biol. Chem.
273,
6262-6270 |
58. | Murphy, C. T., and Spudich, J. A. (1998) Biochemistry 37, 6738-6744[CrossRef][Medline] [Order article via Infotrieve] |
59. | Kurzawa-Goertz, S. E., Perreault-Micale, C. L., Trybus, K. M., Szent-Györgyi, A. G., and Geeves, M. A. (1998) Biochemistry 37, 7517-7525[CrossRef][Medline] [Order article via Infotrieve] |
60. |
Kelley, C. A.,
Takahashi, M., Yu, J. H.,
and Adelstein, R. S.
(1993)
J. Biol. Chem.
268,
12848-12854 |
61. |
White, S.,
Martin, A. F.,
and Periasamy, M.
(1993)
Am. J. Physiol.
264,
C1252-C1258 |
62. | Bernstein, S. I., and Milligan, R. A. (1997) J. Mol. Biol. 271, 1-6[CrossRef][Medline] [Order article via Infotrieve] |
63. |
Nyitray, L.,
Jancso, A.,
Ochiai, Y.,
Graf, L.,
and Szent-Györgyi, A. G.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
12686-12690 |