From the Imperial College of Science, Technology and
Medicine, Department of Biology, Imperial College Road,
London SW7 9AX, United Kingdom, § Università `La
Sapienza,' Istituto di Parassitologia, P. le Aldo Moro 5, 00185 Rome, Italy, and the ¶ European Molecular Biology
Laboratory, Meyerhofstrasse 1, Heidelberg D-69117, Germany
Received for publication, June 23, 2000, and in revised form, August 23, 2000
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The Anopheles gambiae trypsin family
consists of seven genes that are transcribed in the gut of female
mosquitoes in a temporal coordinated and mutually exclusive manner,
suggesting the involvement of a complex transcription regulatory
mechanism. We identified a highly conserved 12-nucleotide motif present
in all A. gambiae and Anopheles
stephensi trypsin promoters. We investigated the role of this
putative trypsin regulatory element (PTRE) in controlling the
transcription of the trypsin genes. Gel shift experiments demonstrated
that nuclear proteins of A. gambiae cell lines formed two
distinct complexes with probes encompassing the PTRE sequence. Mapping
of the binding sites revealed that one of the complex has the
specificity of a GATA transcription factor. Promoter constructs containing mutations in the PTRE sequence that selectively abolished the binding of either one or both complexes exerted opposite effects on
the transcriptional activity of trypsin promoters in A. gambiae and Aedes aegypti cell lines. In addition,
the expression of a novel GATA gene was highly enriched in A. gambiae guts. Taken together our data prove that factors binding
to the PTRE region are key regulatory elements possibly involved in the
blood meal-induced repression and activation of transcription in
early and late trypsin genes.
After female mosquitoes feed on a vertebrate host the blood meal
is digested by the combined action of several enzymes including trypsin
serine proteases (1). In Anopheles gambiae, seven trypsin genes have been identified, Antryp1 to Antryp7,
all clustered together in a relatively small chromosomal locus of 11 kb1 (2). These genes were
arranged in the following two distinct groups on the basis of their
expression pattern: constitutively expressed "early " trypsins (Antryp3, -4, -5, -6, and -7) and blood
meal induced "late " trypsins (Antryp1 and
-2). Unfed female mosquitoes were shown to constitutively
transcribe in their gut Antryp1 and Antryp4 and
to a lesser extent Antryp3, -5, -6, and -7. After
blood feeding, the transcription of Antryp1 and
-2 was rapidly induced, whereas the expression of
Antryp3, -4, -5, -6, and -7 appeared to be down-regulated (3). The identification of the DNA
elements and transcription factors that regulate the expression of the
early and late trypsin genes has important
implications to understand the molecular mechanisms that control gene
expression in the mosquito gut. This information is anticipated to shed
new light on how distinct members of complex gene families in different organisms are differentially transcribed in a spatial and temporal regulated manner. Moreover, the functional characterization of early and late trypsin promoters may prove
invaluable for the development of control measures against vector-borne
diseases based on transgenic mosquitoes expressing anti-parasitic or
antiviral agents in the gut.
Transformation experiments of Drosophila melanogaster with
Anopheles gambiae trypsin promoter constructs revealed that
promoter sequences of Antryp1 and -2 were
constitutively active in the gut of the fruit fly (4). The
cis-acting elements were mapped to DNA sequences
encompassing nucleotides Sequence analysis of the trypsin locus revealed the presence of a
highly conserved motif of 12 nucleotides upstream to the TATA box of
all seven trypsin genes outside the region controlling tissue-specific
transcription in transgenic flies (Fig. 1). The sequence and the
structural organization of this motif and its upstream region suggested
that it could be implicated in controlling the transcription of the
early and late trypsin genes in a mutually exclusive manner. This putative trypsin regulatory element (PTRE) encompassed a TATCA-conserved motif and a TTAATC consensus sequence, which are known to function as binding sites for GATA transcription factors and homeobox genes, respectively. The analysis of the DNA
sequences immediately upstream to the PTRE motifs showed a structural organization that substantially differed in early
and late trypsin genes. In the late trypsin
genes, Antryp1 and -2, the PTRE is part of a
large palindromic sequence (4). This organization generates a second
GATA-binding site oriented in opposite direction to the PTRE. With the
exception of Antryp7, the palindromic structure of the
early trypsin genes appears largely degenerated and contains
only a few conserved nucleotides. The PTRE palindrome of
Antryp7 is highly conserved; however, this sequence contains
a single nucleotide substitution that disrupts the GATA consensus
sequence upstream to the PTRE thus suggesting that Antryp7
may have switched from late to early trypsin
after losing this second GATA site.
We report here on a series of experiments aimed at identifying factors
able to bind to the PTRE and its palindrome and at investigating the
ability of these DNA elements to regulate the transcription of the
trypsin genes. Oligonucleotides spanning the PTRE of early
and late trypsin genes and a series of PTRE mutated versions
were used in electrophoretic mobility shift assays together with
nuclear extracts from a collection of A. gambiae cell lines.
Different early and late trypsin promoter
constructs carrying either single nucleotide substitutions and/or
deletions in the PTRE and its palindromic sequence were assessed in
transient transfection experiments to analyze their transcriptional activity.
Plasmid Constructs--
All plasmid constructs were generated by
subcloning the DNA inserts into pBluescript SK plasmid (Stratagene).
Plasmid pBLuc contains the luciferase cDNA (1.7 kb) followed by 0.9 kb of SV40 polyadenylation signal. Plasmid pT4-Luc contains the
luciferase cDNA and SV40 polyadenylation signal under the control
of 1.375 kb of the Antryp4 putative promoter sequences, from
nucleotide Cloning of Anopheles stephensi Trypsin Genes--
A
Sau3AI partially digested A. stephensi genomic
library was prepared in Establishment of Cell Lines, Culture, and Transfection--
The
A. gambiae lines Sua 1.0, Sua 1B, Sua 4.0, Sua 5.0, Sua 5B,
4a-3A, 4a-2.4, and L35-5 were established as described for cell line
4a-3A (6) using mosquito strains Suakoko 2La, 4a r/r, and L35. Insect
cells were grown at 22-26 °C in Schneider's medium prepared as
recommended by Sigma, supplemented with 5-10% fetal calf serum, 100 units/ml penicillin, and 100 µg/ml streptomycin. MOS 20 cells were
grown at 22-26 °C in M199 medium containing 11 g/liter M199, 4 g/liter lactalbumin, 12.5 ml/liter yeastolate, 0.35 g/liter sodium
bicarbonate, 5-10% fetal calf serum (Sebam), 100 units/ml penicillin,
and 100 µg/ml streptomycin (Life Technologies, Inc.). For
transfection, 1-4 × 105 per cm2 cells
were plated in 24-well (2 cm2 each) plates (Costar) in M199
supplemented with 10% fetal calf serum and antibiotics. After
approximately 24-48 h, when optimal cell density was reached, cell
medium was replaced with 0.9 ml of incomplete M199 medium, lacking
fetal calf serum and antibiotics. In 1.5-ml sterile
microcentrifuge tubes, a mixture containing 95 µl of
incomplete M199, 5 µl of Lipofectin reagent (Life Technologies, Inc.), 1.5 µg of DNA trypsin promoter constructs, and 1.5 µg of pAct-LacZ for normalization purposes was incubated for 15 min at room
temperature and then added to each well. The cells were incubated in
transfection mixture for 6 h up to overnight at 26 °C. After
transfection, medium was replaced with complete M199 or Schneider's
medium, and cells were incubated for approximately 24 h before
lysis. Cells were then washed once with phosphate-buffered saline and
lysed in Cell Culture Lysis Reagent (Promega). Plates were stored at
Preparation of Nuclear Extracts--
A. gambiae and
Aedes aegypti cells were grown at 26 °C as described
above in 75-cm2 flasks. Cultured cells were harvested
either by vigorous pipetting or by scraping. The cells were washed in
phosphate-buffered saline, centrifuged at 1000 × g,
and resuspended in hypotonic buffer, containing 10 mM
Hepes, pH 7.9, at 4 °C, 1.5 mM MgCl2, 10 mM KCl, 0.2 mM PMSF, 0.5 mM DTT, 10 µg/liter leupeptin and antipain (Sigma). PMSF, DTT, leupeptin, and
antipain were added just before use. The cells were allowed to swell on
ice for 10 min and then lysed in a Dounce homogenizer, with 20 strokes
of a type B pestle. Homogenates were centrifuged 15 min at 3300 × g. The supernatants were collected and directly dialyzed for
cytoplasmic extract. Nuclear pellets were resuspended in half-packed
volume of low salt buffer, containing 20 mM Hepes, pH 7.9, at 4 °C, 1.5 mM MgCl2, 20 mM
KCl, 0.2 mM EDTA, pH 8, 25% glycerol, 0.2 mM
PMSF, 0.5 mM DTT, 10 µg/liter leupeptin and antipain. An
equal volume of high salt buffer, containing 20 mM Hepes,
pH 7.9, at 4 °C, 1.5 mM MgCl2, 1.2 M KCl, 0.2 mM EDTA, pH 8, 25% glycerol, 0.2 mM PMSF, 0.5 mM DTT, 10 µg/liter leupeptin
and antipain, was slowly added to the nuclei. After 30 min of
incubation with gentle stirring, the extracted nuclei were centrifuged
for 30 min at 17,000 × g. The supernatant, containing the nuclear proteins, was recovered and dialyzed against dialysis buffer, containing 20 mM Hepes, pH 7.9, at 4 °C, 100 mM KCl, 0.2 mM EDTA, pH 8, 20% glycerol, 0.2 mM PMSF, and 0.5 mM DTT. All incubations and
centrifugations were carried out at 4 °C. Nuclear extracts were
distributed in aliquots and stored at Electrophoretic Mobility Shift Assay
(EMSA)--
Oligonucleotides designed according to the putative
regulatory sequences of Antryp1, -2, and
-4 were annealed to the complementary strand, in order to
constitute a double strand probe. Each oligonucleotide contained a
5'-protruding tail of four deoxythymidine residues that did not anneal
to the complementary strand, to allow labeling by fill-in procedure.
Approximately 10 pmol of double strand oligonucleotides were
radiolabeled in 10 µl of labeling buffer containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM
MgCl2, 5 µM each dCTP, dGTP, dTTP, 2-3 µl
of Cloning of AgGATA--
Genomic DNA from Sua 4.0 cells was
extracted according to a standard procedure (7). Approximately
300 ng of genomic DNA was used in PCR amplification with primers
BAC-ZFS (5'-GAGGGACGAGAGTGCGTCAAC-3') and GATA-Rev-Deg-Xba
(5'-GATCTCTAGADCCRCANGCRTTRCANACNGGRTCDCC-3'). Primer BAC-ZFS was
designed from a sequence found in the A. gambiae Genoscope
data base and sharing high homology to the first zinc finger motif of
GATA factors. The degenerate GATA-Rev-Deg-Xba primer encompassed the
amino acid sequence GDPVCNACG and was previously used by Drevet
et al. (9) to identify two GATA factors from the silkworm
Bombyx mori. PCR was carried out for 35 cycles using an
annealing temperature of 50 °C for the first 3 cycles and 55 °C
for the next 32 cycles. A PCR product of the expected size (376 base
pairs) was cloned in pGEM-T Vector (Promega) and sequenced (GenBankTM accession number AJ404478).
RNA Extraction and RT-PCR Procedure--
Total RNA was extracted
from guts and carcasses of young male and freshly emerged female
A. gambiae mosquitoes as well as from Sua 4.0 and Sua 5.0 cells as described previously (10). DNase I-treated total RNA (2-5
µg) was incubated for 5 min at 65 °C with 50 ng of random hexamer
oligonucleotides (Promega) before adding RT buffer (Promega), 40 units
of RNAsin Ribonuclease Inhibitor (Promega), 1.25 µl of 10 mM each dNTP, and 200 units of Moloney murine leukemia
virus-reverse transcriptase (Promega)-reverse transcriptase. The
equivalent of approximately 200 ng of reverse-transcribed RNA was
processed for PCR using the primers 3/10-RT1S
(5'-CGTGCGCGCTATACACGAGACA-3'), 3/10-AS2 (5'-ATGCGTTGCAGACCGATCGCC-3'),
and 3/10-AS3 (5'-AGTTGGCACAGGTCACGCCCGAA-3'), annealing to different
regions of the AgGATA sequence. Products obtained with
3/10-RT1S and 3/10-AS2 were cloned and sequenced. Alternatively, the
identity to the AgGATA product was confirmed by PCR with
nested primer 3/10-AS3. As control the cDNA was amplified using the
primers Act-F1 (5'-ACCCCATCTCACACAC-TTC-3') and Act-R1 (5'-ATGTCTTTCATTGCCGCC-3') annealing to the A. gambiae actin
5C gene. A duplicate of each RNA sample was processed for PCR
without the reverse transcriptase, to detect genomic DNA contamination.
The oligonucleotides used for EMSA are as follows: T4-Eco-S,
CCCCAATCTTCTGAATTCACGT; T4-Eco-AS, TGATACGATGAATTCTGATTTTCTACATG; T4
PTRE, TTTTAGTATCAGTTAATCAG; T4 5'-Flk, TTTTACGATCATTCACGATC; T2 PTRE,
TTTTAGTATCAAATAATCAG; T2 5'-Flk, TTTTGCAGTATTTGATAGTG; T2 Ups,
TTTTTGCTATCAGTATTTCG; T1 PTRE, TTTTAGTATCAATTAATAAG; T1 5'-Flk,
TTTTGCAGCAATTGATATCG; T1 Ups, TTTTACGATCAGCAATTGCG; h-GATA, TTTTGGCCTTATCTCTTTACCCCCCAC; h-GATA CT, TTTTGGCCTTAAGTCTTTACCCCCCAC.
Distribution of the PTRE Sequence in Trypsin Genes of Different
Mosquito Species--
To facilitate the structural and functional
analysis of the trypsin promoters in Anopheles mosquitoes,
we have analyzed the DNA regions flanking the trypsin genes of A. stephensi. We have isolated the genomic clones of two trypsin
genes from A. stephensi. Sequence analysis allowed the
identification of two genes named Astryp1 and
Astryp3 for the sequence similarities with their A. gambiae homologues Antryp1 and Antryp3. The
putative promoter proximal regions of Astryp1 and
Astryp3 contained a sequence showing a high degree of
similarity to the PTRE regions of A. gambiae trypsin genes
(Fig. 1). The PTRE and 5'-Flk regions of
Astryp1 and Astryp3 showed the same structural
organization found in Antryp1. Sequence alignment of the
upstream regions of A. aegypti trypsin genes (11) with
the corresponding region of anopheline genes revealed the presence
of a DNA motif showing some homology to the PTRE. Similarly to what has
been observed in A. gambiae, early and late
trypsin genes of A. aegypti differed for the distribution of
potential GATA sites in front of the PTRE sequence. These findings indicated that early and late trypsin genes share
a similar structural organization in the distribution and orientation
of PTRE sequences near the TATA box thus suggesting the presence of a
common transcription regulatory mechanism in anopheline species,
possibly conserved in distantly related mosquitoes.
Nuclear Proteins of A. gambiae Cells Bind to the PTRE
Sequence--
To search for A. gambiae nuclear proteins
selectively binding to the PTRE and its 5'-flanking sequence (5'-Flk)
we have designed a series of double strand oligonucleotide probes that
encompassed the PTRE and the 5'-Flk region of different
early and late trypsin genes (Fig. 1). These
probes were used in EMSAs using nuclear extracts from a collection of
A. gambiae cell lines that have been recently developed (6).
The cell lines were employed in this study as an alternative to
mosquito guts that proved not to represent a useful source of nuclear
extracts for EMSA experiments. After dissecting thousands of A. gambiae guts, we could not recover suitable material to study
DNA-protein interactions, possibly because of the low number of
epithelial cells and the presence of high concentrations of activated
proteases (12). EMSA experiments revealed that the nuclear extract of
the larvae-derived A. gambiae Sua 4.0 cells contained
factors forming two different complexes (A and B) with a probe spanning
the PTRE of Antryp4 (T4 PTRE) (Fig.
2A). A single band that showed
an electrophoretic mobility similar to complex A was also observed when
incubating the same nuclear extracts with a probe encompassing 12 nucleotides upstream to Antryp4 PTRE (T4 5'-Flk) (Fig.
2A). Proteinase K treatment prevented the formation of
complexes A and B thus demonstrating that the electrophoretic mobility
shift of T4 PTRE and T4 5'-Flk were due to the presence of nuclear
proteins that bound to these probes. To rule out the possibility that
additional complexes were binding to target sites spanning across the
PTRE and the 5'-Flk probes, we have carried out EMSAs using a probe
that encompassed both sequences. This analysis revealed that no
additional complexes bound to the PTRE and the 5'-flanking sequences of
Antryp4 (data not shown).
We have extended the search of factors binding to the PTRE to a vast
repertoire of A. gambiae cell lines and S2 cells from D. melanogaster. Our results indicated that nuclear proteins
from most of the A. gambiae cell lines with the exception of
Sua 5.0 and Sua 5B showed a binding pattern to T4 PTRE and T4 5'-Flk
similar to that observed with Sua 4.0 cells (Fig. 2B).
D. melanogaster S2 nuclear extracts formed a complex showing
an electrophoretic motility similar to complex B. Nuclear extracts from
Sua 5.0 and Sua 5B cells formed with the T4 PTRE probe only complex A
and complex B, respectively. Moreover, nuclear extract from the
A. aegypti cell line MOS 20 incubated with a probe
encompassing both PTRE and 5'-Flk motifs formed two complexes showing
the electrophoretic mobility of complex A and complex B of A. gambiae cells (not shown). These findings would indicate that the
expression of the two complexes is not ubiquitous and can be
independently regulated. These experiments also provided the rationale
to employ Sua 4.0, Sua 5.0, and Sua 5B cells for further analyzing the
transcriptional activity of complex A and B on promoter constructs.
Complex A and B Interact with Different Residues of the PTRE
Sequence--
To investigate the specificity of the interaction
between nuclear proteins and the T4 PTRE and T4 5'-Flk probes, we
carried out EMSA experiments in the presence of different competitor
oligonucleotides. The binding of Sua 4.0 nuclear proteins to T4 PTRE
was abolished by the presence of an excess of the corresponding
unlabeled oligonucleotide. A mutated T4 PTRE probe, carrying two
nucleotide substitutions at position 3 and 9 (G3C9), was unable to
inhibit the formation of complex A and B (Fig.
3A); accordingly, nuclear
extracts of Sua 4.0 cells failed to bind to this probe. Interestingly,
an excess of unlabeled T4 5'-Flk oligonucleotide efficiently inhibited the formation of complex A with T4 PTRE, whereas complex B was not
affected. Similarly, the formation of complex A with the T4 5'-Flk
probe was inhibited by an excess of unlabeled T4 PTRE and T4 5'-Flk
oligonucleotides (Fig. 3A), thus indicating that complex A
proteins could bind to both T4 PTRE and T4 5'-Flk probes. These experiments also showed that complex B differed from complex A in terms
of size and DNA sequence specificity.
To map exactly the nucleotide residues forming the binding sites of
complex A and B within the PTRE sequence, we carried out EMSAs using a
series of oligonucleotides that contained point mutations in each of
the 12 residues of T4 PTRE. The mutated probes were incubated with
nuclear extracts of Sua 4.0 and Sua 5.0 cells. Mutations in the
residues spanning the TATCA motif either reduced or abolished the
ability of the oligonucleotides to form complex B with nuclear extracts
of Sua 4.0 cells. The formation of complex A with Sua 4.0 nuclear
extracts was severely impaired by mutations in any of the 12 residues
of the PTRE sequence (Fig. 3B). When using Sua 5.0 extracts,
which lacked complex B, some differences could be detected in the
binding of complex A to the mutated probes (Fig. 3B).
Substitutions in the residues 2, 4, 5, 7, 10, and 11 completely
inhibited the formation of complex A with the PTRE, whereas mutations
at the other positions still allowed a reduced binding to occur.
Sequence comparison revealed that most of these residues form a motif
(ATCANTNA) that is present in both the PTRE and 5'-Flk regions
of Antryp4 thus providing the basis for understanding the
binding of complex A to both T4 PTRE and T4 5'-Flk. Competition experiments using mutated T4 5'-Flk oligonucleotides confirmed that the
ATCA sequence is implicated in the formation of complex A with the
5'-Flk region (data not shown).
The identification of complex B-binding site revealed that this complex
had the binding specificity of GATA transcription factors (13). To
investigate this property further, we have analyzed the ability of Sua
4.0 nuclear extracts to bind to a probe (h-GATA) designed to encompass
a sequence of the human porphobilinogen deaminase promoter. This probe
contained a GATA site (14) and flanking sequences totally unrelated to
the PTRE region. Our results indicated that the h-GATA probe formed
with nuclear extracts of Sua 4.0 cells a single complex that showed the
electrophoretic mobility of complex B and was competed by an excess of
T4 PTRE and T2 5'-Flk, (Fig.
4A). Moreover, the h-GATA
oligonucleotide selectively competed the binding of complex B to T4
PTRE (Fig. 4B), whereas oligonucleotides either lacking a
GATA sequence (T4 5'-Flk) or containing mutations in this motif
(h-GATA-CT) had no effect (Fig. 4, A and B).
While the PTRE showed little sequence variation among the trypsin
genes, the 5'-Flk sequences significantly differed in the early and late trypsin genes for the presence of
additional GATA sites. This observation prompted us to compare the PTRE
and the 5'-Flk sequence of early (Antryp4) and
late (Antryp1 and 2) trypsin genes for
their binding pattern to nuclear extracts of Sua 4.0 cells (Fig. 5).
Our results indicated that the PTRE and the 5'-Flk probes of
Antryp1 and Antryp2 efficiently bound to complex
B which is in agreement with the presence of palindromic GATA sites in the 5'-Flk sequences of the late trypsin promoters. The T2
Ups probe, encompassing a sequence immediately upstream to the 5'-Flk of T2, showed a strong binding to complex B, whereas the corresponding T1 Ups probe that lacked a GATA sequence did not bind to any factor (Fig. 5). The binding of complex A to the
T1 and T2 5'-Flk and T2 PTRE probes was detectable but weak (Fig.
7).
Mosquito Guts and Sua 4.0 Cells Express the Same GATA Transcription
Factor--
The observation that nuclear extracts of distinct A. gambiae cell lines contained proteins with the binding specificity
of GATA factors raises questions about the nature of these molecules and their expression in the mosquito gut. To address these issues, we
have attempted to clone A. gambiae GATA factors and
investigate their transcription pattern in mosquito tissues, organs,
and cell lines. Primers designed to anneal to the conserved DNA binding domain of GATA factors were employed in PCR experiments using as
template genomic DNA extracted from the A. gambiae cell line Sua 4.0. We cloned a 376-base pair PCR product (AgGATA) that
showed a strong sequence homology to GATA factors and encoded two
conserved zinc finger structures
Cys-X2-Cys-X17-Cys-X2-Cys
(Fig. 6A). Analysis of the
genomic locus of AgGATA revealed that the coding sequence contained a putative intron region. We have used oligonucleotides annealing within the AgGATA sequence to investigate the
expression of the corresponding gene in cell lines as well as in gut
and carcasses of female and male mosquitoes. As control all cDNA
samples were also processed for RT-PCR using primers annealing to the actin gene of A. gambiae. The RT-PCR analysis showed that
AgGATA was expressed in Sua 4.0 cells but not in Sua 5.0 cells that were previously shown to be negative for the complex B in
gel shift experiments (Fig. 6B). Specific RT-PCR products
were detected in both female and male guts, whereas carcasses were
mostly negative (Fig. 6B). Sequence analysis confirmed that
the PCR products amplified from mosquito tissues encompassed the
AgGATA coding region, and the smaller RT-PCR product size
was explained by the lack of the intron sequence. The faint
AgGATA product occasionally amplified from mosquito
carcasses could either be due to a contamination of the sample
preparation with gut RNA or to a low level of AgGATA transcription in other mosquito tissues.
Transcriptional Activity of the PTRE and the 5'-Flk Sequences in A. gambiae and A. aegypti Cells--
We have analyzed the transcriptional
activity of the PTRE and 5'-Flk sequences by transfecting Sua 4.0 cells
and the A. aegypti cell line MOS20 with constructs
encompassing the corresponding sequences of Antryp4 (Fig.
7). To correlate the binding of complex A
and B with the expression pattern of early and
late trypsin genes, we have developed a series of promoter
constructs in which the PTRE and 5'-Flk sequences have been mutated.
The transcription of the wild type Antryp4 promoter in Sua
4.0 and MOS 20 cells was compared with the activity of promoter
constructs in which the entire PTRE, the 5'-Flk motif, or a sequence
immediately upstream to it had been replaced by unrelated sequences.
This mutation-scanning analysis revealed that in Sua 4.0 and MOS 20 cells the disruption of the PTRE (construct pT4
These findings together with the information concerning the
differential expression of complex A and B in different cell lines and
their binding specificity suggested the following conclusion. The
binding of complex A to the 5'-Flk may have a positive transcriptional activity that could be either enhanced or down-regulated by the binding
of complex B and complex A to the PTRE, respectively.
We have demonstrated that a conserved motif of 12 nucleotides
found upstream to all A. gambiae and A. stephensi
trypsin genes, the putative trypsin regulatory element, or PTRE bound
to two nuclear protein complexes (A and B) that showed different DNA specificity and electrophoretic mobility. Competition and binding experiments to mutated oligonucleotides revealed that complex B
selectively bound to the TATCA sequence of the PTRE thus indicating that a specific A. gambiae GATA factor could account for the
formation of this complex. This hypothesis was supported by experiments demonstrating that Sua 4.0 cells expressed a novel gene
AgGATA with sequence homology to GATA transcription factors.
Accordingly, Sua 5.0 cells, which in EMSA were shown to lack complex B,
did not express AgGATA. We have also shown that
AgGATA is selectively transcribed in the gut of A. gambiae mosquitoes. These observations indicated that Sua 4.0 cells represent a valuable experimental system to study the
transcriptional activity of trypsin promoters and that
AgGATA is a strong candidate for playing a role in the regulation of A. gambiae trypsin genes. This notion is in
agreement with experimental evidence indicating that GATA transcription factors are widely conserved key regulators of cell-specific functions. They are expressed in different tissues in a variety of organisms including vertebrates, insects (9, 15), Caenorhabditis
elegans (16), and fungi (17). GATA factors were shown to control
the transcription of genes expressed in a sex-restricted,
tissue-specific, and time-dependent manner, and in some
cases, such as the mammalian globin genes, in a mutually exclusive
pattern (18-20). GATA-1, which contributes to the control of the
globin locus genes, has been shown to act either as an activator (21,
22) or a repressor (23), depending on specific interactions with
additional proteins. AgGATA showed a high degree of homology
with MGATA-6 and HGATA-6, members of the GATA-6 subfamily, that are
expressed by cells of different organs and tissues including gut
epithelial cells (24, 25).
Nuclear extracts of A. gambiae cell lines were also shown to
contain proteins forming with the PTRE of early
(Antryp4) and late (Antryp1 and
2) trypsin genes complex A, which migrated slower than
complex B in EMSA. Mapping experiments suggested that the binding site
of complex A could span most of the PTRE sequence including the GATA
sequence. This conclusion was supported by the observation that
nucleotide substitutions in most of the 12 residues of the PTRE
impaired the binding of complex A to the mutated probes. To rule out
the possibility that the binding of complex A to the mutated probes was
altered by the presence of complex B, we repeated the mapping
experiment using nuclear extracts of Sua 5.0. Sequence analysis
revealed that the (ATCANTNA) motif was found in the flanking
region of Antryp4 PTRE, suggesting that the binding pattern
of complex A to the PTRE and to the 5'-flanking sequence of
early and late trypsin genes may reflect the
distribution of these conserved nucleotide residues, forming its
binding site. Complex A efficiently bound to the sequence immediately
upstream to the PTRE of the early trypsin gene
Antryp4, whereas it showed only a weak interaction with the
corresponding regions of the late trypsin gene Antryp1 and
Antryp2.
Our findings indicated that the PTRE encompasses two partially
overlapping sites for complex A and B. In the 5'-flanking region the
binding sites of complex A and B are distributed in a mutually exclusive manner in the early and late trypsin
genes. We have shown that complex B bound to the 5'-Flk region of the
late trypsin genes Antryp1 and
Antryp2, whereas complex A preferentially bound to probes
encompassing the corresponding sequences of the early trypsin gene Antryp4. The differential distribution of the
binding sites for complex A and B in the 5'-Flk region could be of
functional significance for regulating early and
late trypsin genes in a mutually exclusive temporal manner.
This hypothesis is consistent with the observation that in a number of
promoters, palindromic GATA sequences were shown to bind to GATA
factors with higher affinity than single GATA sites, due to the
involvement of the N-terminal zinc finger (26). Moreover, our data
indicate that mutations or substitutions, anticipated to change the
binding of complex A and B to the PTRE and to its 5'-flanking sequence, exerted opposite effects on the transcriptional activity of the Antryp4 promoter in mosquito cell lines. In Sua 4.0 and MOS
20 cells the optimal activation of Antryp4 promoter over its
base-line activity was achieved by constructs that exclusively allowed
the binding in tandem of complex A and complex B to the 5'-flanking sequence and the PTRE, respectively. Mutated constructs allowing the
binding of either complex A or B to the 5'-flanking sequence and the
PTRE showed very low activity.
These findings all together provide a framework for a transcriptional
model that could explain the molecular mechanisms regulating the
differential expression of the early and late
trypsin genes in the mosquito gut. This model is based on the
assumption that relative abundance of complex A and complex B
determines the combinations of complexes binding to the 5'-flanking
sequence and to the PTRE of the early and late
trypsin genes. An excess of complex B is anticipated to displace
complex A from the PTRE and to bind to the 5'-flanking sequence of
Antryp1 and Antryp2. Under these conditions complex A could still bind to the 5'-flanking sequence of
Antryp4 in tandem with complex B bound to the PTRE thus
inducing the expression of this early trypsin gene. On the
contrary, an excess of complex A would activate the late
trypsin genes by allowing the binding in tandem of complex A and B
to the PTRE and to the 5'-flanking sequence of Antryp1 and
Antryp2.
In conclusion, our findings provide evidence for a key role of the PTRE
region in transcriptional regulation, possibly linked to the response
to activation and repression of late and early trypsin genes induced by the blood meal. Newly developed
Anopheles transformation protocol (27) will be helpful to
elucidate the role of these elements and factors in vivo,
and trypsin promoters will prove an invaluable tool toward the
generation of transgenic mosquitoes expressing disease-blocking genes.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
360 to
153 and
418 to
168 of the
Antryp1 and Antryp2 promoter, respectively (4), and binding sites to D. melanogaster nuclear factors were
identified (5). In this experimental system the trypsin promoters were transcribed in the gut of both female and male flies. These findings indicated that all A. gambiae and D. melanogaster
share DNA elements and factors that selectively control gene expression
in their gut, additional transcription control mechanisms are
responsible for the temporal, sex-restricted, and mutual exclusive
transcription of the trypsin genes in A. gambiae.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1 to
1375. Plasmids pAct-Luc and pAct-LacZ contain 2.7 kb of D. melanogaster 5C actin promoter followed by the
luciferase or the LacZ-coding sequences and SV40 polyadenylation
signal. In order to manipulate the DNA motifs of Antryp4
described in the Introduction, oligonucleotides T4-Eco-S and T4-Eco-AS
were used to engineer two EcoRI sites in positions
46 and
124, positions chosen to minimize the number of introduced mutations,
using a SculptorTM in vitro mutagenesis system
(Amersham Pharmacia Biotech). The intervening sequences encompassed the
putative regulatory elements of the Antryp4 promoter. This
procedure generated a DNA cassette that could be easily removed and
replaced with a given DNA sequence flanked by two EcoRI
sites. Sequence substitutions and point mutations were introduced in
the DNA regions encompassing the two EcoRI sites using an
overlap PCR approach. Briefly, two complementary oligonucleotides
containing the desired mutations and a short 5'-overlapping sequence
were used in two separate amplifications using external primers. The
products thus generated were gel-purified, mixed at equal
concentrations in a PCR mix containing the external primers, and
amplified to obtain a product carrying the desired mutations. This
product was then digested with EcoRI and inserted into
EcoRI-digested pT4. All mutated constructs were verified by
sequencing the DNA region using a T7 Sequencing kit following the
manufacturer's instructions (Amersham Pharmacia Biotech).
EMBL3A as described previously (2). For
library screening, a PCR-amplified 772-base pair DNA fragment,
corresponding to the complete coding sequence of Antryp1,
was labeled with digoxigenin (Roche Molecular Biochemicals) and used as
a probe, according to the manufacturer's protocol. Four positive
clones were identified, and the 14.5-kb clone
T3 was used for
subcloning and sequencing the A. stephensi trypsin genes
Astryp1 (GenBankTM accession number
U52359) and Astryp3 (GenBankTM
accession number AF012809).
80 °C before determination of reporter activity. Luciferase
activity was assessed according to manufacturer's protocol (Luciferase
Assay System, Promega) with a Berthold luminometer and measuring the
light emission for 20 s. The activity of
-galactosidase was
measured by incubating 5-20 µl of cell lysate diluted in a total of
150 µl of Cell Culture Lysis Reagent (Luciferase Assay System,
Promega) in a mixture containing 150 µl of 2× Assay Buffer (
-galactosidase Enzyme Assay System, Promega) at 37 °C. Reaction was stopped by adding 500 µl of 1 M Tris, and absorbance
was read at 420 nm. Only values within the linear range were
considered. Relative luciferase units were normalized to
-galactosidase units and expressed relative to the control plasmid
in each assay. All transfection experiments were performed in
triplicate wells for each construct, and all experiments were repeated
at least twice.
80 °C until use. Protein
concentrations was determined according to Bradford (7).
-35S-dATP (10 µCi/µl, 1000 Ci/mmol, Amersham
Pharmacia Biotech), and 1 unit of Taq DNA polymerase (Roche
Molecular Biochemicals) and incubated at 37 °C for 45 min. Labeled
probes were purified from the non incorporated
[
35S]dATP using ProbeQuant G-50 Micro Columns
(Amersham Pharmacia Biotech). EMSA were performed according to standard
procedures (8). A suspension containing approximately 1.5 µg of
nuclear extract was incubated for 20 min at room temperature with 0.2 pmol of radiolabeled probe, 0.5 µg of denatured herring sperm DNA, 1 µg of polydeoxyinosinic-deoxycytidylic acid, in 10% glycerol. The
binding buffer contained 10 mM Hepes, pH 7.6, 20 mM KCl, 1 mM EDTA, pH 8.0, 2.5 mM
DTT, in a final volume of 15 µl. For competition experiments, a
150-fold molar excess of cold competitor was added. The samples were
run on a 4% non-denaturing polyacrylamide-bisacrylamide (30:0.4) gel
containing 6.8 mM Tris-HCl, pH 7.9, 1 mM EDTA,
pH 8.0, 2.5% glycerol in Low Ionic Strength Electrophoresis buffer, containing 6.8 mM Tris-HCl, pH 7.9, 1 mM EDTA,
pH 8.0, 3.3 mM sodium acetate, pH 7.9. Gels were dried and
exposed for autoradiography.
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (42K):
[in a new window]
Fig. 1.
Sequence alignment of the PTRE regions of
A. gambiae, A. stephensi, and A. aegypti
trypsin genes. A, the conserved PTRE and 5'-Flk
sequences are boxed. Palindromic nucleotides are indicated
with an asterisk. All potential GATA sites are highlighted
in gray boxes. Non-conserved nucleotides in the TTAATC motif
are underlined. The A. gambiae and A. stephensi sequences are abbreviated as AgT and
AsT, respectively. Aedes sequences are
abbreviated Aeea (early) and Aela (late).
B, schematic representation of the regions encompassed by
the T1, T2, and T4 probes used in EMSA experiments.
View larger version (44K):
[in a new window]
Fig. 2.
Nuclear proteins of A. gambiae
cells binding to the PTRE and 5'-Flk probes of Antryp4
(T4). A, EMSA showing the binding of factors
present in the nuclear (Nuc) and cytoplasmic (C)
extracts of Sua 4.0 cells. Proteinase K (pK) was added (+)
at a final concentration of 60 ng/µl. B, binding pattern
of nuclear extracts of A. gambiae (Sua 4.0, Sua 1.0, Sua
5.0, L35-5, 4a-2.4, 4a-3A, Sua 1B, and Sua 5B) and D. melanogaster (S2) cell lines to T4 PTRE and T4 5'-Flk
probes. The arrows indicate the migration of complex A, B,
and unbound probe.
View larger version (50K):
[in a new window]
Fig. 3.
Binding specificity of complex A and B to the
PTRE and 5'-Flk sequences of Antryp4 (T4).
A, Sua 4.0 nuclear extracts were incubated with T4 PTRE and
T4 5'-Flk in the presence of an excess (Comp) of T4 PTRE,
double mutant T4 PTRE G3C9, containing T-G and an A-C substitutions in
positions 3 and 9 of the PTRE, and T4 5'-Flk oligonucleotides.
Lane G3C9 shows incubation with the labeled probe T4 PTRE
G3C9. B, mapping of the binding sites of complex A and B to
the PTRE. Sua 4.0 (upper panel) and Sua 5.0 (lower
panel) nuclear extracts were incubated with T4 PTRE probes
containing point mutations in each of the 12-nucleotide motifs. The
letter and the number indicate the nucleotide
introduced and its position in the motif, respectively. Binding of
non-mutated (WT) T4 PTRE is also shown. The migration of
complex A and B bands is indicated.
View larger version (33K):
[in a new window]
Fig. 4.
Binding of Sua 4.0 nuclear factor(s) to the
h-GATA probe. A, nuclear extracts were incubated with
the h-GATA probe, encompassing a sequence of the human porphobilinogen
deaminase promoter. EMSA was carried out either in the absence or in
the presence of an excess (Comp) of the oligonucleotides
h-GATA, h-GATA CT, T4 PTRE, T4 5'-Flk, and T2 5'-Flk. The probe h-GATA
CT contains two nucleotide substitutions in the GATA site of the h-GATA
oligonucleotide. B, binding of the A and B complexes to the
T4 PTRE and T4 5'-Flk probes in the presence of the competitor
(Comp) oligonucleotides h-GATA and h-GATA CT.
Arrows indicate the migration of complex A and B.
View larger version (37K):
[in a new window]
Fig. 5.
Binding pattern differences in
early and late trypsins. Sua 4.0 nuclear extracts were incubated with probes encompassing the PTRE and
5'-Flk motifs of Antryp4 (T4), Antryp2 (T2), and
Antryp1 (T1) and the Ups sequence of
Antryp2 and Antryp1. Arrows indicate
complex A and B.
View larger version (15K):
[in a new window]
Fig. 6.
Cloning and expression of
AgGATA. A, alignment between the
predicted amino acid sequence of AgGATA and GATA factors
from D. melanogaster (D), Xenopus
laevis (X), mouse (M), and human
(H) showing the highest homology in the zinc finger domain.
Identical residues (*) and conserved amino acid substitutions (:) are
indicated. The position of the intron in AgGATA is
highlighted . Conserved cysteines of the zinc finger domain are
boxed. B, RT-PCR of total RNA extracted from Sua
4.0 and 5.0 cells, midguts (Gut), and carcasses
(Carc) dissected from female (F) and male
(M) A. gambiae mosquitoes. The amplification
reactions were carried out using primers specific either to the actin
(act) or the AgGATA (g) coding
sequence in absence (
) or in the presence (+) of Moloney murine
leukemia virus-reverse transcriptase. Arrows indicate the
migration of the actin and AgGATA PCR products.
76-87) resulted in
an increase of transcription (Fig. 7A). This activation
effect appeared to be dependent on the integrity of the 5'-Flk motif,
since mutations or the substitution of this region with the
corresponding Antryp1 sequence restored the base-line
transcription activity of the Antryp4 promoter (constructs
pT4
91-105/76-87) and pT4 T1 5'-Flk/
76-87) (Fig. 7A).
EMSA experiments would predict construct pT4
76-87 to bind only to
complex A at the 5'-Flk sequence. This notion suggested that the
binding of complex A to the 5'-Flk sequence resulted in a positive
transcriptional activity that may be down-regulated by either complex A
or B binding to the PTRE. To distinguish between these two
possibilities, we have analyzed the transcriptional activity of
Antryp4 promoter constructs in which the PTRE has been
selectively mutagenized to allow the binding of complex B only (Fig.
7B). This analysis revealed that mutations in the GATA site,
which are known to disrupt the binding of complex A and B to the PTRE,
had little effect on transcription of Antryp4 promoter in
Sua 4.0 cells. The constructs pT4-(G3) and pT4-(T4) showed only a
moderate decrease of the activity of the reporter gene when compared
with control construct pT4-luc (Fig. 7B). On the contrary
the constructs pT4-(C8) and pT4-(C9), carrying mutations that prevented
the binding of complex A to the PTRE, showed a marked increase of
reporter gene activity. In MOS 20 these mutated constructs showed a
moderate increase of transcription. The constructs were also analyzed
in Sua 5B cells that lack complex A, according to EMSA analysis. As
expected, in these cells the constructs pT4-(C8) and pT4-(G9) did not
show the increased transcriptional activity observed in Sua 4.0.
View larger version (20K):
[in a new window]
Fig. 7.
Transient transfection of Sua 4.0, 5B, and
MOS 20 cells with constructs containing mutations in the
Antryp4 PTRE region. A, schematic
representation of the plasmid pT4-Luc and the scanning mutations
introduced in the PTRE region of Antryp4. The pT4-Luc
mutated constructs were named with numbers in
brackets indicating the DNA sequences that have been
substituted. In pT4 (T1 5'-Flk/ 76-87) the 5'-Flk motif of
Antryp4 has been replaced with the corresponding motif of
Antryp1 (T1). In the diagram, bars
indicate the mean value of two independent experiments performed in
triplicate. Relative luciferase units are normalized to
-galactosidase for transfection efficiency, and values of pT4-Luc
are standardized to 1. Standard deviation is also shown. B,
schematic representation of the point mutations introduced in the PTRE
of Antryp4. The letters indicate the nucleotides
that were substituted, and the numbers indicate their
position in the motif. Diagram shows normalized relative luciferase
activity of pT4-Luc and pT4-Luc containing single and double point
mutations in the PTRE sequence.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]() |
ACKNOWLEDGEMENTS |
---|
We thank the Institut Pasteur-Genoscope Anopheles Gambiae STC project for providing A. gambiae sequences. We thank Manlio Di Cristina, Furio Spano, Bruno Arcà, and Fabrizio Lombardo for their critical discussions and suggestions; Silvia Naitza and Roberta Spaccapelo for their precious help in providing and dissecting A. gambiae mosquitoes; and Simona Panni for her initial contribution to this work.
![]() |
FOOTNOTES |
---|
* This work was supported in part by a World Health Organization grant (to A. C. and F. G.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Supported by a fellowship of the Deutsche Forschungsgemeinschaft.
** Present address: Institut de Biologie Moléculaire et Cellulaire, UPR 9022 du Centre National de la Recherche Scientifique, 15 Rue René Descartes, F67084 Strasbourg, France.
To whom correspondence should be addressed. Tel.:
44-171-5945426; Fax: 44-171-5945439; E-mail:
a.drcrisanti@ic.ac.uk.
Published, JBC Papers in Press, October 2, 2000, DOI 10.1074/jbc.M005540200
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: kb, kilobase pairs; PTRE, putative trypsin regulatory element; PCR, polymerase chain reaction; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; EMSA, electrophoretic mobility shift assays; 5'-Flk, 5'-flanking sequence; h, human.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Billingsley, P. F., and Hecker, H. (1991) J. Med. Entomol. 28, 865-871[Medline] [Order article via Infotrieve] |
2. | Müller, H. M., Crampton, J. M., della Torre, A., Sinden, R., and Crisanti, A. (1993) EMBO J. 12, 2891-2900[Abstract] |
3. | Müller, H. M., Catteruccia, F., Vizioli, J., della Torre, A., and Crisanti, A. (1995) Exp. Parasitol. 81, 371-385[CrossRef][Medline] [Order article via Infotrieve] |
4. | Skavdis, G., Siden-Kiamos, I., Müller, H.-M., Crisanti, A., and Louis, C. (1996) EMBO J. 15, 334-350[Abstract] |
5. | Shen, Z., and Jacobs-Lorena, M. (1998) Insect Biochem. Mol. Biol. 28, 1007-1012[CrossRef][Medline] [Order article via Infotrieve] |
6. |
Müller, H. M.,
Dimopoulos, G.,
Blass, C.,
and Kafatos, F. C.
(1999)
J. Biol. Chem.
274,
11727-11735 |
7. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve] |
8. | Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. D., Smith, J. A., and Struhl, K. (1992) Short Protocols in Molecular Biology , 2nd Ed. , Greene Publishing Associates and John Wiley & Sons Publishers, New York |
9. |
Drevet, J. R.,
Skeiky, Y. A.,
and Iatrou, K.
(1994)
J. Biol. Chem.
269,
10660-10667 |
10. | Holmes, D. S., and Bonner, J. (1973) Biochemistry 12, 2330-2338[Medline] [Order article via Infotrieve] |
11. | Barillas-Mury, C., Noriega, F. G., and Wells, M. A. (1994) Insect Biochem. Mol. Biol. 25, 241-246[CrossRef] |
12. | Müller, H. M., Vizioli, J., della Torre, A., and Crisanti, A. (1993) Parassitologia 35 (suppl.), 73-76 |
13. | Orkin, S. H. (1992) Blood 80, 575-581[Medline] [Order article via Infotrieve] |
14. | Mignotte, V., Wall, L., deBoer, E., Grosveld, F., and Romeo, P. H. (1989) Nucleic Acids Res. 17, 37-54[Abstract] |
15. |
Ramain, P.,
Heitzler, P.,
Haenlin, M.,
and Simpson, P.
(1993)
Development
119,
1277-1291 |
16. | Spieth, J., Shim, Y. H., Lea, K., Conrad, R., and Blumenthal, T. (1991) Mol. Cell. Biol. 11, 4651-4659[Medline] [Order article via Infotrieve] |
17. | Kudla, B., Caddick, M. X., Langdon, T., Martinez-Rossi, N. M., Bennett, C. F., Sibley, S., Davies, R. W., and Arst, H. N., Jr. (1990) EMBO J. 9, 1355-1364[Abstract] |
18. | Evans, T., Reitman, M., and Felsenfeld, G. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5976-5980[Abstract] |
19. | Tsai, S. F., Martin, D. I., Zon, L. I., D'Andrea, A. D., Wong, G. G., and Orkin, S. H. (1989) Nature 339, 446-451[CrossRef][Medline] [Order article via Infotrieve] |
20. | Wall, L., deBoer, E., and Grosveld, F. (1988) Genes Dev. 2, 1089-1100[Abstract] |
21. | Reitman, M., and Felsenfeld, G. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 6267-6271[Abstract] |
22. |
Seshasayee, D.,
Gaines, P.,
and Wojchowski, D. M.
(1998)
Mol. Cell. Biol.
18,
3278-3288 |
23. | Raich, N., Clegg, C. H., Grofti, J., Romeo, P. H., and Stamatoyannopoulos, G. (1995) EMBO J. 14, 801-809[Abstract] |
24. | Huggon, I. C., Davies, A., Gove, C., Moscoso, G., Moniz, C., Foss, Y., Farzaneh, F., and Towner, P. (1997) Biochim. Biophys. Acta 1353, 98-102[Medline] [Order article via Infotrieve] |
25. |
Laverriere, A. C.,
MacNeill, C.,
Mueller, C.,
Poelmann, R. E.,
Burch, J. B.,
and Evans, T.
(1994)
J. Biol. Chem.
269,
23177-23184 |
26. | Trainor, C. D., Omichinski, J. G., Vandergon, T. L., Gronenborn, A. M., Clore, G. M., and Felsenfeld, G. (1996) Mol. Cell. Biol. 16, 2238-2247[Abstract] |
27. | Catteruccia, F., Nolan, T., Loukeris, T. G., Blass, C., Savakis, C., Kafatos, F. C., and Crisanti, A. (2000) Nature 405, 959-962[CrossRef][Medline] [Order article via Infotrieve] |