From the Department of Biochemistry, Albert Einstein College of Medicine, Bronx, New York 10461
Received for publication, September 20, 2000, and in revised form, November 14, 2000
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Pathogen-specific antibiotics kill the offending
species without inviting the patient's flora to help develop a
resistance mechanism. The current scarcity of
pathogen-specific antibiotics reflects the rarity of essential genes
that are also not widely represented in and conserved among species.
The FemX enzyme that initiates the synthesis of the interchain peptide
of the peptidoglycan in a subset of bacterial species was purified from
Lactobacillus viridescens. Subsequently, the encoding
femX gene was cloned and sequenced using reverse genetics.
The femX gene is a member of the femAB family,
a large family of genes previously implicated in interchain peptide
synthesis but with unknown specific functions. Mutagenesis of the
femX gene identified the members of the extended FemABX
family as novel nonribosomal peptidyltransferases. Determinants of FemX
complex substrate recognition and a strong stimulator of FemX activity
were also identified. The FemABX family members are ideal candidates
for pathogen-specific antibiotic development.
Antibiotic resistance in pathogenic bacteria is reaching alarming
levels as exemplified by the emergence of vancomycin-resistant Enterococci and Staphylococci (1, 2). This
phenomenon is accelerated by the extensive use of broad-spectrum
antibiotics, which do not discriminate between targeted pathogens and
nontargeted natural flora (2). This situation places critical
importance on the identification of new antibiotic targets and the
development of new antibiotics. Of particular interest are targets that
allow for the development of pathogen-specific antibiotics as
pathogen-specific drugs are expected to have both extended clinical
lifetimes and increased benefit to risk ratios (3). The enzymes that
synthesize the interchain peptide of peptidoglycan are intriguing
pathogen-specific antibiotic targets because the interchain peptide:
(a) is an essential component of the cell wall,
(b) requires several enzymatic steps allowing interchain
peptide terminators to be developed as antibiotics, (c) is
synthesized in only a subset of Gram-positive species where it varies
in both length and sequence, and (d) is synthesized in very
few Gram-negative species, including the pathogenic spirochetes but
excluding the nonpathogenic enterobacteriaceae of the flora (4).
The peptidoglycan fraction of the bacterial cell wall contains linear
chains of alternating N-acetylglucosamine and
N-acetylmuramic acid (see "Disaccharide" in
Fig. 1). The N-acetylmuramic
acid moieties are linked via a lactyl group to the pentapeptide
(L-Ala)-(D-Glu)-X-(D-Ala)-(D-Ala); where X is the diamino acid meso-diaminopimelic
acid (Dap),1 Lys, or
ornithine (Orn), depending on species. The pentapeptides in neighboring
disaccharide chains are cross-linked to each other either directly or
via the interchain peptide, depending on the species. In contrast to
other nonribosomal peptide synthesis, interchain peptide synthesis
proceeds via aminoacyl-tRNA intermediates (5). It is not known whether
the interchain peptide is synthesized directly from aminoacyl-tRNAs or
whether the aminoacyl residues are first captured as acyl-enzyme
intermediates. The final cross-linking step in cell wall synthesis
occurs via a transpeptidation reaction that displaces the terminal
D-Ala of the pentapeptide (Fig. 1). Transpeptidation is the
essential cellular process inhibited by both
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-lactam antibiotics and
vancomycin (6). In addition, the interchain peptide acts as an anchor
for the surface proteins that play important roles in adhesion and
pathogenicity by interacting with host matrix proteins (7).
View larger version (18K):
[in a new window]
Fig. 1.
The S. aureus
peptidoglycan. S. aureus peptidoglycan contains
Gly5 interchain peptides and pentapeptides with lysine in
the X position. The free amino group of lysine is bonded to
the COOH-terminal glycine residue of the interchain peptide. FemX is
postulated to add this first residue of the interchain peptide. FemA
and FemB are required for the addition of Gly2-3 and
Gly4-5, respectively. The NH2-terminal
Gly5 residue is bonded to the penultimate
D-alanine residue of a neighboring pentapeptide. This step
is the transpeptidation reaction inhibited by both -lactam
antibiotics and vancomycin (V; vancomycin binds the terminal
D-Ala-D-Ala). Transpeptidation releases the
COOH-terminal D-alanine residue of the neighboring
pentapeptide (curved arrow). E. coli and B. subtilis synthesize a pentapeptide with Dap in the X
position of their pentapeptides and lack an interchain peptide. In
these species, the free amino group of Dap is bonded directly to the
D-alanine residue of the neighboring pentapeptide by the
transpeptidase. B. burgdorferi, the etiologic agent of Lyme
Disease, synthesizes a pentapeptide with Orn in the X
position and an interchain peptide with a single glycine residue.
S. pyogenes and L. viridescens synthesize
pentapeptides with lysine in the X position and interchain
peptides of sequence Ala2 and alanine-serine, respectively.
Interchain peptide sequences are indicated from their carboxyl termini
to their amino termini, the direction of their syntheses.
Wild-type Staphylococcus aureus cells synthesize a Gly5 interchain peptide. S. aureus femA mutants and femAB double mutants synthesize the truncated interchain peptides Gly3 and Gly1, respectively (8-10). A third gene named femX is postulated to be essential for initiation of the interchain peptide. The existence of additional femAB family members beyond bona fide femA and femB in bacterial genomes and femAB genes in species that synthesize only a single residue interchain peptide suggests that FemX might be encoded by a femAB homolog (11, 12). One of the extra femAB family members from S. aureus named fmhB is essential for cell viability, and inhibition of its synthesis results in a drastic accumulation of uncross-linked UDP-MurNAc pentapeptide precursors of peptidoglycan. Those data are consistent with fmhB assignment as femX (13). However, to date no enzymatic activity has been demonstrated for FmhB or any other FemAB family member.
FemX reactions fall into two classes depending on the enzyme solubility
and whether the formation of UDP-MurNAc hexapeptide follows conjugation
of UDP-MurNAc pentapeptide to a carrier lipid. In S. aureus
and most other characterized species, FemX activity purifies as a large
multienzyme "particle" that acts after conjugation of its
UDP-MurNAc pentapeptide substrate to the carrier lipid (14). This
statement follows from the isolation of only UDP-MurNAc pentapeptide
from S. aureus cytoplasm, the substrate of FemX
reaction (15). By contrast, FemX activity in the naturally
vancomycin-resistant species Lactobacillus viridescens (ATCC
12706) is a soluble enzyme that acts before conjugation to the carrier
lipid (16). This statement follows from our isolation of UDP-MurNAc
hexapeptide from the cytoplasm of L. viridescens, the
product of the FemX reaction (see below). Here we report the
purification of L. viridescens FemX, identification of the
femX gene, recombinant expression of active FemX, a partial
characterization of FemX complex substrate specificity, and a strong
stimulator of FemX activity from Escherichia coli.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Isolation of UDP-MurNAc Pentapeptides-- UDP-MurNAc pentapeptides from bacterial cultures were isolated and purified as described previously (15) with DEAE-Sepharose and Sephadex G-10/Bio-Gel P-2 chromatography being substituted in our purification scheme. UDP-MurNAc hexapeptides, UDP-MurNAc heptapeptides, and UDP-MurNAc octapeptides from L. viridescens cultures were isolated using the same procedures. S. aureus cultures were grown as described previously (15). Bacillus subtilis cultures were grown in nutrient broth medium at 37 °C to mid-log phase (A600 = 1.0), vancomycin was added to a concentration of 5 µg/ml, and the flasks were incubated for an additional 3 h. L. viridescens cultures were grown in MRS medium (Difco) at 30 °C to mid-log phase (A600 = 1.0), vancomycin was added to a concentration of 5 µg/ml, and the flasks were incubated for an additional 3 h. Borrelia burgdorferi cultures were grown in BSK-H medium (Sigma) at 30 °C in tightly capped bottles under mild agitation (40 rpm). Vancomycin was added to a final concentration of 0.4 µg/ml after 84 h, and incubation was continued for 48 h. An additional aliquot of vancomycin (0.4 µg/ml) was added and incubated for 24 h. E. coli cultures containing the femX gene (pQE-12) were grown in LB medium. FemX expression was induced by the addition of 25 µM IPTG when the A600 reached 0.6 followed by incubation for an additional 3 h.
Electrospray Ionization Mass Analysis-- Mass analysis of UDP-MurNAc peptides and larger species isolated from bacteria and FemX reaction products were carried out using a Finnigan LCQ mass spectrometer in a negative ion mode.
FemX Assays-- FemX activities were assayed by monitoring the incorporation of [14C]Ala into purified UDP-MurNAc pentapeptides. FemX assays were carried out according to Plapp and Strominger (16) with minor modifications. Fifty-microliter assay mixtures contained 30 µM UDP-MurNAc pentapeptide, 500 µM ATP, 50 µg of E. coli tRNA (Sigma), 18 µM [14C]Ala (Amersham Pharmacia Biotech), 500 units E. coli aminoacyl-tRNA synthetase (Sigma), 2 µl of appropriately diluted FemX in 50 mM Tris buffer, pH 7.6, 20 mM MgCl2, and 50 mM NaCl. FemX reactions were incubated at room temperature for 30 min and stopped by the addition of 1 µl of 2.0 n NaOH. 3 µl of each reaction mixture was spotted onto precoated cellulose TLC plates (Selecto Scientific) and fractionated using ethanol:1 M ammonium acetate (7.5:3 v/v) as the solvent. Spots were visualized by autoradiography, excised, and quantitated by counting in liquid scintillation fluid. One unit of enzyme activity is defined as the amount of the protein that catalyzes the incorporation of 1 nmol of [14C]Ala into UDP-MurNAc pentapeptide per min under standard assay conditions. FemA assays were carried out as described above but used UDP-MurNAc hexapeptides isolated from L. viridescens as the acceptor substrate (see above).
Purification of FemX-- L. viridescens cells were grown to late logarithmic phase (A600 = 1.7) in MRS medium (Difco) at 30 °C, harvested by centrifugation, and washed once with 50 mM Tris buffer, pH 7.8. All purification steps were carried out in 50 mM Tris buffer, pH 7.8, at 4 °C. Cells were lysed by grinding with alumina (16), and the supernatant was fractionated by ammonium sulfate precipitation (45-90% saturation), DEAE-Sephacryl chromatography (bound FemX activity was eluted with 0-0.5 M KCl gradient), and Sephadex G-75 chromatography. The FemX-containing fraction was further fractionated by fast protein liquid chromatography on Mono-Q (eluted with 0-1 M KCl gradient), phenyl-Sepharose (eluted with 1.7-0 M ammonium sulfate gradient), and Superose-12 columns to yield a single polypeptide as visualized by SDS-polyacrylamide gel electrophoresis. The final yield from 20 g of wet cells was ~150 µg of protein. Purified FemX was digested with trypsin (1:50, w/w, 37 °C, 24 h), and the tryptic peptides were separated by reverse phase high pressure liquid chromatography on a C18 column (Vydac, 1 × 150 mm) using a linear gradient of acetonitrile (0-100% in 0.1% trifluoroacetic acid) at a flow rate of 150 µl/min over 45 min. Native FemX and two of its tryptic peptides were subjected to automated Edman degradation to obtain NH2-terminal (N) and internal peptide (IP) sequence information: N = PVLNLNDPQAVERYEEFMRQSPY, IP1 = TTLDLYPQK, and IP2 = EYIGEIDKVLDPEVYAEL. None of these peptides had significant matches in available sequence data bases or with any of the known FemAB family members.
Identification of the femX Gene and Construction of Recombinant Expression Systems-- Degenerate deoxyoligonucleotide primers were synthesized based on the NH2-terminal peptide and the two internal peptides. PCR using these primers amplified regions of L. viridescens genomic DNA to generate products of ~450 and 950 base pairs, respectively. The larger of these fragments was cloned and sequenced. This fragment of FemX was enzymatically active when expressed with COOH-terminal His6 tag. To complete the sequence of femX from L. viridescens, inside-out PCR was employed (PCR away from the center of the gene using small circles of genomic DNA as the template). Genomic DNA templates were prepared using the following procedure. L. viridescens genomic DNA (40 µg) was digested with Sau3A (0.5 unit) for 30 min and fractionated on an 0.8% agarose gel. DNA fragments in the range of 2-4 kilobase pairs were extracted from the gel, circularized (self-ligated in 250 µl), recovered in 25 µl by ethanol precipitation, and used as templates for PCR. Based on the completed FemX sequence, deoxyoligonucleotide primers were designed to express FemX bearing an NH2-terminal His6 affinity tag (BamHI fragment for expression in pQE8, Qiagen), a COOH-terminal His6 affinity tag (EcoRI/BamHI fragment for expression in pQE12, Qiagen), and without an affinity tag (EcoRI/BamHI fragment in pQE12). Primers for expression of COOH-terminal His6-tagged FemX in pQE12 were: LFQ12N = CCCGCTGAATTCATTAAAGAGGAGAAATTAACTATGCCAGTGTTAAATT and LFCH6 = CCCGCTGGATCCATCTTTAACTAATTC. Primers for expression of wild type FemX in pQE12 were: LFQ12N = CCCGCTGAATTCATTAAAGAGGAGAAATTAACTATGCCAGTGTTAAATT and LFCH6 = CCCGCTGGATCCTTAATCTTTAACTAATTC. Primers for expression of NH2-terminal His6-tagged FemX in pQE8 were: LvQ8N = CCCGCTGGA-TCCATGCCAGTGTTAAATTTG and LvQ8C = CCCGCTGGATCCATCTTTAACTAATTC. All primers are written from their 5'-3' ends.
Recombinant Expression of FemX and Its Homologs--
FmhB
(GenBankTM accession number AF106850) was expressed
bearing an NH2-terminal His6 affinity tag
(BglII fragment for expression in pQE8), a COOH-terminal
His6 affinity tag (EcoRI/BglII
fragment for expression in pQE12), and without any modifications
(EcoRI/BglII fragment for expression in pQE12).
Three FemAB homologs from Streptococcus pyogenes, 254-1,
297-2, and 297-3, were expressed with NH2-terminal His6 affinity tags (BamHI fragments for
expression in pQE8; numbers refer to current contigs as the sequencing
of the S. pyogenes genome is in progress). All clones were
transformed into E. coli strain DH5 containing pREP4
(Qiagen). Recombinant proteins bearing His6 affinity tags
were purified using immobilized metal affinity chromatography using
nickel-nitriloacetic acid agarose according to the manufacturer's
instructions (Qiagen). Purified enzymes and lysates were assayed for
FemX activity as described above.
Site-directed Mutagenesis-- Site-directed mutagenesis was carried out using the Quick Change site-directed mutagenesis kit (Stratagene). Deoxyoligonucleotide synthesis and other procedures were performed according to the manufacturer's instructions. COOH-terminal His6-tagged mutants were purified using immobilized metal affinity chromatography that used nickel-nitriloacetic acid agarose as described above.
Identification of a FemX Stimulator from E. coli--
Cultures
of E. coli strain DH5 were grown to an
A600 of 1.5, and the cells were lysed by
sonication. Cell lysate in 50 mM Tris buffer, pH 7.6, was
adsorbed onto DEAE-Sephacel and washed with 0.15 M NaCl.
The stimulating activity was eluted with 0.25 M NaCl. The
stimulating activity was further fractionated on phenyl-Sepharose in
the above buffer containing 1.7 M ammonium sulfate.
Stimulating activity was eluted with 0.6-0.4 M ammonium
sulfate and concentrated. Finally, the stimulating activity was
fractionated on Sephacryl S-200 where it eluted in the void volume.
![]() |
RESULTS AND DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
FemX Is a Homolog of FemA and FemB--
We purified FemX
from L. viridescens and cloned its encoding femX
gene using reverse genetics. Data base searches identified femX (GenBankTM accession number AY008262) as a
member of the femAB gene family, now called the
femABX family (Fig. 2). The
femABX family shows no homology to the
leucine/phenylalanine transferase family; the only other known
example of a bacterial enzyme that synthesizes a peptide bond using an
aminoacyl-tRNA substrate (17). Sequence data upstream and downstream of
the femX coding region (3-500 base pairs each way) revealed
that femX is not a part of an operon. Recombinant expression
of FemX yielded a soluble enzyme that initiated synthesis of an
interchain peptide in vitro (Fig.
3A). Recombinant FemX had a
molecular mass of 39,360, which is in agreement with the mass deduced
from the femX gene. The specific activities of the
His6-tagged and native enzymes were compared and are
equivalent. Purified FemX was soluble to >15 mg/ml, and gel
filtration chromatography suggested that the enzyme is a monomer.
|
|
Recombinant FemX Initiates Interchain Peptide Synthesis-- Incubation of FemX with UDP-MurNAc pentapeptide resulted in approximately equal rates of transfer of alanine and serine from their corresponding E. coli tRNAs to UDP-MurNAc pentapeptides containing lysine in their X position (see Fig. 1). Glycine was also transferred but at a much lower rate (Fig. 3A). Assays with mixtures of alanine-, serine-, and glycine-tRNAs resulted in mixtures of the expected UDP-MurNAc hexapeptides but no larger species (Fig. 3A). We conclude that FemX adds only the first residue of the interchain peptide. By contrast, recombinant expression of neither S. aureus FmhB nor any of the FemABX family members from the S. pyogenes showed FemX or FemA activity. Each inactive FemABX enzyme was readily overexpressed and purified from E. coli and showed a CD spectrum characteristic of a folded protein. These data suggest that FemX enzymes that purify as large multiprotein complexes require additional factors or lipid conjugation for their activity.
In Vivo Specificity of FemX--
Partial inhibition of S. aureus with vancomycin or -lactams results in the accumulation
of only UDP-MurNAc pentapeptides in the cytoplasmic precursor pools of
these cells, the substrates of FemX reaction (15). Those data form the
basis for the statement that FemX from S. aureus acts after
conjugation of UDP-MurNAc pentapeptide to the carrier lipid (15). By
contrast, partial inhibition of L. viridescens with
vancomycin resulted in the accumulation of UDP-MurNAc pentapeptides
conjugated in equal proportions to alanine, alanine-serine, and
Ala-Ser-Ala as indicated by mass analysis of cytoplasmic precursor
pools (mass numbers 1221, 1309, and 1380, respectively). These species
are the expected products of FemX and FemX + FemAB reactions (see Fig.
1).
No UDP-MurNAc pentapeptides were detected by mass analyses of L. viridescens cytoplasmic precursor pools. In addition, the UDP-MurNAc peptide mixtures isolated from L. viridescens were not substrates for the FemX reaction, confirming that no UDP-MurNAc pentapeptides were contained in these mixtures. Importantly, these same precursors were detected in similar proportions in the absence of vancomycin, although at much lower absolute concentrations. Those data reveal that the FemX enzyme from L. viridescens acts on UDP-MurNAc pentapeptides before the conjugation of this intermediate to a lipid precursor.
Interestingly, no UDP-MurNAc hexapeptide conjugated to serine was detected in the cytoplasmic precursor pools in L. viridescens by mass analysis, either in the presence or absence of vancomycin. The ability of purified recombinant FemX to make this product in vitro (see above) remains unexplained.
Substrate Specificity of FemX-- E. coli cells tolerated the expression of FemX at high levels. This lack of an observed phenotype for E. coli cells expressing FemX suggested that UDP-MurNAc pentapeptides containing Dap in the X position were not substrates for FemX because modification of UDP-MurNAc pentapeptide pools in E. coli is expected to be highly deleterious (see Fig. 1 for details). These statements follow from experiments demonstrating that: (a) the expression of murE from S. aureus in E. coli cells resulted in the substitution of lysine for Dap at the X position in <50% of E. coli pentapeptides (18); and (b) this relatively minor substitution blocked the transpeptidation reaction and arrested cell growth (18).
This suggestion that Dap in the X position abolished recognition by FemX was confirmed directly. No UDP-MurNAc hexapeptides were detected in the isolated cytoplasmic precursor pools of E. coli strains overexpressing FemX. In addition, isolated UDP-MurNAc pentapeptide containing Dap in the X position (isolated from B. subtilis, see Fig. 1) was not a substrate for the FemX reaction (Fig. 3B). By contrast, UDP-MurNAc pentapeptide containing Orn in the X position (isolated from B. burgdorferi) was a substrate for the FemX reaction (Fig. 3B). Isolated pentapeptides with lysine in the X position were neither substrates nor inhibitors for the FemX reaction in the presence or absence of UDP and/or MurNAc. These data suggest (a) the deletion of a single methylene group from the side chain of lysine does not abolish recognition by FemX, but the addition of an acid group to lysine does and (b) there is a requirement of an intact UDP-MurNAc pentapeptide bond geometry for recognition by FemX.
FemX Mutagenesis-- Overall, the FemABX family is poorly conserved, and FemX is less than 20% similar to other known FemABX family members (Fig. 2). This low level of sequence conservation is noteworthy in light of the fact that each family member recognizes two large and relatively conserved substrates, an aminoacyl-tRNA and a UDP-MurNAc pentapeptide. Sequence alignments of FemABX family members revealed that the only conserved region greater than a single residue is the sequence Phe-305-Lys-306 (Fig. 2). However, mutagenesis experiments identified Gln-29 as the only conserved and potentially catalytic residue that was essential for FemX activity (Table I). Mutation of the conserved nonpolar residues proline 110 and glycine 292 also resulted in inactive enzyme despite normal yields of recombinant protein (Table I). Those data reveal that there are no absolutely conserved residues that might form acyl-enzyme intermediates in the FemABX family and identifies the FemABX family members as novel nonribosomal peptidyltransferases. The higher FemX activity of mutants F305Y and Y216F, relative to F305L and Y216L, is consistent with the participation of these conserved aromatic residues in an aromatic-aromatic interaction with aminoacyl-tRNA substrates. Despite the low level sequence conservation within the family, the COOH-terminal region of FemX is important for function as truncation by more than 10 residues at this end of the enzyme abolished its activity (data not shown).
|
Stimulation of FemX Activity--
Purified FemX was stimulated by
E. coli cell lysate 4-8-fold (Fig.
4). Fractionation of E. coli
lysate revealed that the stimulating activity is a protein or a complex
of proteins with a molecular mass > 200,000 daltons. Control
experiments were performed to further characterize the stimulating
activity. The stimulating activity lacked aminoacyl-tRNA synthetase
activity. The stimulating activity is not an ATP-dependent
protease because FemX was not processed or degraded during assays
(assayed by SDS-polyacrylamide gel electrophoresis). The stimulating
activity is not the GroESL molecular chaperone because
co-overexpression of the GroESL chaperone (17) did not increase the
specific activity of FemX from E. coli lysates or the
resultant purified FemX. The stimulating activity was not tRNA based on
the purification scheme, the spectrum of stimulator
(A260/280 = 0.6), and tRNA addition experiments.
Stimulation was not because of general molecular crowding effects
because stimulation was not observed for other and more concentrated
E. coli lysate fractions. Our working model is that the
stimulating activity is a UDP-MurNAc pentapeptide binding complex that
presents this substrate in an optimal conformation to FemX. This
statement follows from: (a) the existence of the stimulator
in E. coli, a species lacking FemX, and (b) data
demonstrating that each of the FemX mutants in Table I were stimulated
~4-fold by fractionated E. coli lysate.
|
This work identifies the members of the FemABX family as nonribosomal
peptidyltransferases. To our knowledge, this is the first demonstration
of a specific enzymatic activity for the members of the FemABX family
and identifies the members of this family as targets for
pathogen-specific antibiotic development.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank John Leong for B. burgdorferi cells and advice on working with spirochetes, Tina Henkin for B. subtilis Spores, and Linda Siconolfi-Baez and Eddie Nieves of the Albert Einstein College of Medicine Laboratory of Macromolecular Analysis for protein sequencing and mass spectra.
![]() |
FOOTNOTES |
---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AY008262.
To whom correspondence should be addressed: Dept. of Biochemistry,
Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY
10461. Tel.: 718-430-2892; Fax: 718-430-8565; E-mail: shrader@aecom.yu.edu.
Published, JBC Papers in Press, November 16, 2000, DOI 10.1074/jbc.M008591200
![]() |
ABBREVIATIONS |
---|
The abbreviations used are:
Dap, meso-diaminopimelic acid;
Orn, ornithine;
IPTG, isopropyl-1-thio--D-galactopyranoside;
PCR, polymerase
chain reaction;
contigs, groups of overlapping clones.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Perl, T. M. (1999) Am. J. Med. 106, 48S-52S[CrossRef] |
2. | Neu, H. C. (1992) Science 257, 1064-1073[Medline] [Order article via Infotrieve] |
3. | Casadevall, A. (1996) Clin. Infect. Dis. 23, 790-794[Medline] [Order article via Infotrieve] |
4. | Ghuysen, J. M. (1968) Bacteriol. Rev. 32, 425-464[Medline] [Order article via Infotrieve] |
5. | Matsuhashi, M., Dietrich, C. P., and Strominger, J. L. (1965) Proc. Natl. Acad. Sci. U. S. A. 54, 587-594[Medline] [Order article via Infotrieve] |
6. | Walsh, C. T., Fisher, S. L., Park, I. S., Prahalad, M., and Wu, Z. (1996) Chem. Biol. 3, 21-24[Medline] [Order article via Infotrieve] |
7. |
Ton-That, H.,
Labischinski, H.,
Berger-Bachi, B.,
and Schneewind, O.
(1998)
J. Biol. Chem.
273,
29143-29149 |
8. | Berger-Bachi, B., Barberis-Maino, B. L., Strassle, A., and Kayser, F. H. (1989) Mol. Gen. Genet. 219, 263-269[Medline] [Order article via Infotrieve] |
9. | de Jonge, B. L., Sidow, T., Chang, Y. S., Labischinski, H., Berger-Bachi, B., Gage, D. A., and Tomasz, A. (1993) J. Bacteriol. 175, 2779-2782[Abstract] |
10. | Stranden, A. M., Ehlert, K., Labischinski, H., and Berger-Bachi, B. (1997) J. Bacteriol. 179, 9-16[Abstract] |
11. | Tschierske, M., Mori, C., Rohrer, S., Ehlert, K., Shaw, K. J., and Berger-Bachi, B. (1999) FEMS Microbiol. Lett. 171, 97-102[CrossRef][Medline] [Order article via Infotrieve] |
12. |
Rohrer, S.,
Ehlert, K.,
Labischinski, H.,
and Berger-Bachi, B.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
9351-9356 |
13. |
Navarre, W. W.,
and Schneewind, O.
(1999)
Microbiol. Mol. Biol. Rev.
63,
174-229 |
14. |
Matsuhashi, M.,
Dietrich, C. P.,
and Strominger, J. L.
(1967)
J. Biol. Chem.
242,
3191-3206 |
15. |
Stickgold, R. A.,
and Neuhaus, F. C.
(1967)
J. Biol. Chem.
242,
1331-1337 |
16. |
Plapp, R.,
and Strominger, J. L.
(1970)
J. Biol. Chem.
245,
3675-3682 |
17. |
Ichetovkin, I. E.,
Abramochkin, G.,
and Shrader, T. E.
(1997)
J. Biol. Chem.
272,
33009-33014 |
18. |
Mengin-Lecreulx, D.,
Falla, T.,
Blanot, D.,
van Heijenoort, J.,
Adams, D. J.,
and Chopra, I. D.
(1999)
J. Bacteriol.
181,
5909-5914 |