From the Institute of Protein Biochemistry and
Enzymology, Consiglio Nazionale delle Ricerche, Via Marconi 10, 80125 Naples, Italy and the § Centre for Biomolecular Science, St.
Andrews University, KY16 9ST, St. Andrews, United
Kingdom
Received for publication, November 26, 2000, and in revised form, January 4, 2001
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In hyperthermophilic Archaea genomic DNA
is from relaxed to positively supercoiled in vivo because
of the action of the enzyme reverse gyrase, and this peculiarity is
believed to be related to stabilization of DNA against denaturation. We
report the identification and characterization of Smj12, a novel
protein of Sulfolobus solfataricus, which is homologous to
members of the so-called Bacterial-Archaeal family of regulators, found
in multiple copies in Eubacteria and Archaea. Whereas other members of
the family are sequence-specific DNA- binding proteins and have been
implicated in transcriptional regulation, Smj12 is a nonspecific
DNA-binding protein that stabilizes the double helix and induces
positive supercoiling. Smj12 is not abundant, suggesting that it is not
a general architectural protein, but rather has a specialized function
and/or localization. Smj12 is the first protein with the described
features identified in Archaea and might participate in control of
superhelicity during DNA transactions.
Microorganisms belonging to the domain Archaea, most of which are
adapted to life under extreme conditions, display a peculiar melange of
prokaryotic and eukaryotic cellular components, in particular in
processes pertaining to genome structure and function. For instance,
basic transcription apparatus is of eukaryotic type (1, 2), whereas the
few transcription regulators studied so far are similar to bacterial
helix turn helix regulators (3-7). Such proteins are abundant in
bacterial and archaeal genomes but scarce or highly divergent in
Eukarya, and therefore the definition of Bacterial-Archaeal
(BA)1 regulators has been
recently proposed (5).
As for genome structure, a striking difference exists between the two
archaeal subdomains Euryarchaeota and
Crenarchaeota; true histones, structurally and
functionally homologous to eukaryal histones, have been identified in
several members of Euryarchaeota (reviewed in Refs. 8 and
9). In contrast, histones have not been found so far in
Crenarchaeota. Although several crenarchaeal DNA-binding
proteins have been identified, mainly in the thermoacidophilic genus
Sulfolobus (10-15), little is known about nucleoid
structure and composition in these organisms.
In recent years physical and functional interaction between chromatin
and multiprotein complexes performing basic processes like
transcription, replication, recombination, and repair has been reported
both in eukaryotes and Eubacteria, suggesting that chromatin components
have not only structural but also regulative functions (16-21).
Eukaryal and archaeal histones, chromatin-associated proteins, and
bacterial nucleoid proteins affect DNA structure by inducing
compaction, bending, and/or supercoiling (9, 18, 22). DNA supercoiling
participates in essential functions in the cell, such as control of
gene expression, DNA condensation, decatenation and segregation of
replicated DNA molecules, and homologous DNA pairing (see Refs. 23 and
24 and references therein). Whereas negative supercoiling is required
to provide melting potential, positive supercoiling stabilizes the
double helix; consistently, DNA is negatively supercoiled in
mesophiles, both prokaryotes and eukaryotes, whereas it is from relaxed
to positively supercoiled in hyperthermophilic Archaea (25, 26). Positive supercoiling is considered a key element of the adaptation to
high temperature and correlates with the presence of the enzyme reverse
gyrase, which introduces positive superturns into DNA molecules
(reviewed in Refs. 27 and 28). On the other hand, hyperthermophilic
Archaea also contain classical topoisomerases, such as TopoVI (29) and
TopoV (30), which relax positive and negative superturns, and
architectural proteins showing unwinding activity (13, 14, 31). As
shown for other organisms, rapid changes in DNA topology are associated
with cold and heat shock in these organisms (26). These findings
suggest that different factors cooperate in achieving careful
regulation of general and local DNA topology in hyperthermophilic
Archaea; mechanisms and elements taking part in this complex
homeostatic process are poorly understood.
Here we report the identification of a novel DNA-binding protein
of Sulfolobus solfataricus, named Smj12, which is
homologous to the transcription regulator Lrs14, an archaeal repressor
belonging to the BA family; however, unlike Lrs14, Smj12 is a
nonspecific DNA-binding protein. It is highly basic and thermostable,
binds double-stranded DNA, and protects it from thermal denaturation. By using topoisomerase I assays we show that Smj12 induces positive supercoiling of minicircle and plasmid DNA. Whereas abundant proteins inducing negative supercoiling in Sulfolobus have been
reported (13, 14, 31), this is the first protein showing the opposite activity described in this organism. Moreover, Smj12 is not abundant as
expected for architectural proteins. The possible function of Smj12 in
the regulation of DNA conformation is discussed.
Purification of Smj12 from Sulfolobus--
Smj12 was identified
while searching for activities able to recognize Holliday junctions
(HJ) in Sulfolobus strains. The cells of two archaeal
species, S. solfataricus MT4 and S. shibate B12, were supplied by the Center for
Extremophile Research, Porton Down, UK. Cell lysis, centrifugation, and
chromatography steps were carried out at 4 °C. 50-g cells were
thawed in 150 ml of lysis buffer (50 mM Tris-HCl, pH
7.5, 300 mM NaCl, 1 mM EDTA, 1 mM
dithiothreitol, 1 mM benzamidine, 1 mM
4-(2-aminoethyl)benzenesulfonylfluoride, HCl) and immediately
sonicated for 5 × 1 min with cooling. The lysate was centrifuged
at 40,000 × g for 30 min. The supernatant was diluted
4-fold with Buffer A (50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1 mM dithiothreitol, and 50 mM NaCl) and applied to an SP-Sepharose high
performance 26/10 column (Hi-Load; Amersham Pharmacia Biotech) equilibrated with Buffer A. A 500-ml linear gradient comprising 50 to
600 mM NaCl was used to elute cationic proteins. Fractions were assayed for four-way DNA junction-specific binding by gel electrophoresis mobility shift analysis using the
32P-labeled synthetic four-way DNA junction Z28 (32). An
activity peak was detected in the fractions eluted from the column at
370 to 400 mM NaCl, and these fractions were pooled and
concentrated. The concentrated protein (7 ml) was loaded onto a 26/70
gel filtration column (Superdex 200 Hi Load; Amersham Pharmacia
Biotech) and developed with Buffer A containing 300 mM
NaCl. Active fractions eluted at 210 to 225 ml were pooled and diluted
with an equal volume of Buffer A. The protein was loaded onto a 1-ml
HiTrap heparin column (Amersham Pharmacia Biotech) pre-equilibrated
with Buffer A. Proteins were eluted with a linear gradient of NaCl (80 ml; 0.05 to 1 M NaCl), and active fractions were pooled and diluted 5-fold with Buffer A. Finally, the enzyme was loaded onto a
Mono-S column (Amersham Pharmacia Biotech) pre-equilibrated with Buffer
A and eluted with a linear gradient of 100 ml of 50 to 1,000 mM NaCl. The active fractions were analyzed by SDS-PAGE and
stored at 4 °C until needed.
Peptide Sequence Analysis--
A sample of the purified Smj12
protein was subjected to SDS-PAGE. The protein band was identified by
staining with Coomassie Blue, excised, and destained with 0.1 M ammonium bicarbonate in 50% acetonitrile. The gel piece
was cut in 1-mm cubes and digested with 12.5 µg/ml modified trypsin
(Roche Molecular Biochemicals) in 20 mM ammonium
bicarbonate at 30 °C for 18 h. The gel pieces were removed by
centrifugation (at 13,000 rpm for 15 min in a microcentrifuge) and
subsequently washed with 50% acetonitrile:1% trifluoroacetic acid in
water followed by centrifugation as above. The supernatants were
pooled, and an aliquot of the mixture was analyzed by matrix-assisted
laser desorption ionization-time of flight mass spectrometry in a
Perceptive Biosystems Elite STR mass spectrometer using
alpha-cyanocinnamic acid as the matrix. The supernatant was dried and
resuspended in 0.1% trifluoroacetic acid in water and subjected to
reverse phase HPLC on a 150 × 0.5-mm C18 column
(PerkinElmer Life Sciences) coupled to an Applied Biosystems 173A microblotter HPLC system. The column was developed with a gradient
of 0.1% trifluoroacetic acid in water versus 70%
acetonitrile:30% water in 0.09% trifluoroacetic acid. Peptides were
detected at 210 nm, and fractions were collected onto a Problot/
polyvinylidene difluoride membrane fitted to the microblotter. After
allowing the membrane to dry, relevant regions of the blot were excised and subjected to Edman sequence analysis in either an Applied Biosystems 492A or 476A protein sequencer.
Protein Expression in Escherichia coli--
A synthetic gene
encoding Sulfolobus Smj12 was constructed from the following
six oligonucleotides shown below by recursive polymerase chain
reaction (33): Oligo 1, CGTCGGATCCCCATGGCCATCGAAATCTCCGAAAAATCCTTCCTGCTGAAACGTTTCCTGATCGTTGCTTACG; Oligo 2, TTTCGCTCGAGACGATTTTGATGAAAGCGTCAACGTCAGCTTCGGACAGACCGTAAGCAACGATCAGGAAACGTTTCAGC; Oligo 3, ATCGTCTCGAGCGAAACCGGTAAAGACGTTGACGCTATCGCTGGTGAACTGGGTATCTCCAAATCCCGTGCTTCCCTGATCC; Oligo 4, CACCTCTAGAAACGGAGGTTTTTTCTTTTTCAACCAGACCAGCGTCAGCCAGTTTTTTCAGGATCAGGGAAGCACGGGATTTGG; Oligo 5, CCGTTTCTAGAGGTGGTCGTCCGAAATTCCTGTACCGTATCAACAAAGAAGAACTGAAAAAGAAACTGATCAAACGTTCCGAAG; and Oligo 6, GGATCCGTCGACTTACAGGAAGGAGGAGATGATGGTGTGCAGGTCTTTGCAGGTTTCTTCGGAACGTTTGATCAGTTTCTTTTTCAG.
Codon bias was optimized for expression in E. coli. The
full-length polymerase chain reaction product was cloned into the BamHI site of vector pUC119 (CLONTECH),
creating the plasmid pUC119-Smj12, whose insert was
sequenced completely to ensure that no errors had been introduced in
the amplification process. The Smj12 gene was subcloned from
pUC119 into the BamHI and NcoI sites of the expression vector pET19b (Novagen), allowing expression of Smj12 with a
native N terminus in BL21 CodonPlus (DE3) RIL cells
(Stratagene). Transformed cultures were induced with 0.2 mM
isopropyl-1-thio-
The synthetic gene, amplified with the addition of BglII and
HindIII tails at the 5' and 3' ends, respectively, was also
cloned in pQE-31 (Qiagen) cut with BamHI and
HindIII. The resulting plasmid (after resequencing of the
insert) was transformed in E. coli BL21 trx; the recombinant
protein, containing a six-histidine tail at the N terminus, was
purified by affinity chromatography on nickel-nitrilotriacetic
acid (Ni-NTA)-agarose as reported (3). Recovered protein was >95%
pure as estimated by SDS-PAGE (not shown).
Nucleotide Sequence Accession Number--
The nucleotide
sequence data reported in this paper will appear in the
GenBankTM/EBI data bases under accession number
AJ133494.
Northern Analysis--
S. solfataricus P2 cultures
(200 ml) were grown at different A600 at
80 °C as indicated; total RNA was extracted using the RNAeasy kit
(Qiagen). The amount of RNA loaded was normalized by the fluorescence
of ribosomal RNAs in ethidium bromide-stained gels and by staining the
filters with methylene blue. The same filters were hybridized
sequentially with two random-primed probes, a 375-bp fragment
containing the Smj12 coding sequence and a 390-bp fragment
containing the Lrs14 coding sequence (3).
Band Shift Assays--
Standard reactions (10 µl) contained
the following: 1× binding buffer (20 mM Tris-HCl, pH 7.5, 10% glycerol, 50 mM KCl, 0.1 mM
dithiothreitol), purified Smj12, cold competitor DNA if appropriate, and 2-5 × 103 cpm of end-labeled probe (0.5 nM). After incubations at indicated temperatures samples
were immediately loaded on native 5% polyacrylamide gels in 0.5× Tris
borate buffer and run at room temperature. The gels were dried, and the
autoradiograms were exposed at Western Analysis--
S. solfataricus P2 cultures
were grown at 80 °C until the A600 reached
0.5; cells were collected by centrifugation, resuspended in Buffer E
(50 mM phosphate buffer, pH 8.0, 1 mM EDTA, 10 mM MgCl2) containing 500 mM NaCl,
and lysed by sonication. Extracts were centrifuged for 5 min at 15,000 rpm to pellet cell debris and dialyzed against 50 mM
phosphate buffer, pH 8.0. The protein concentration was determined
using a Bio-Rad protein assay kit. Appropriate volumes of extracts were
denatured, loaded on polyacrylamide SDS gels, and electroblotted to
nitrocellulose membranes. Polyclonal antibodies were raised in rabbit
against Lrs14 and Sso7d and in goat against Smj12; secondary
anti-rabbit and anti-goat peroxidase-conjugated antibodies were used
(Amersham Pharmacia Biotech). Blots were developed using the Amersham
ECL-plus kit.
Preparation of Minicircle Topoisomers--
The procedure
reported (34) was as follows: a 371-bp DNA fragment isolated from pUC18
by AclI restriction cleavage was dephosphorylated with
alkaline phosphatase and 5'-end labeled by T4 polynucleotide kinase
with 32P- TopoI Assay on DNA Minicircles--
Assays were performed as
reported (35) with the following modifications: Smj12 minicircles
binding reaction mixes containing 0.8 ng of probe (0.33 nM)
and indicated Smj12 amounts were incubated with 2 units of DNA
topoisomerase I from wheat germ (Promega) for 1 h at 37 °C.
After SEVAG extraction and ethanol precipitation, samples were loaded
on nondenaturing 5% polyacrylamide gels and run at room temperature in
0.5 × TBE buffer. The gels were dried, and the autoradiograms
were exposed at TopoI Assay on Plasmid DNAs--
Relaxed pGEM3 plasmid DNA was
prepared using DNA topoisomerase I (Promega) according to the
manufacturer's conditions. Reaction mixture contained 300 ng (11 nM) of relaxed plasmid DNA, 4 units of topoisomerase I, and
the indicated amount of Smj12 where appropriate. After incubation at
37 °C for 45 min, the reaction was stopped by adding 1% SDS and by
SEVAG extraction followed by ethanol precipitation. Reaction products
were analyzed on 1% agarose gel in TBE buffer. Electrophoresis
was performed at room temperature. Negatively to positively supercoiled
plasmids were separated using no intercalating agent during the first
dimension and 10 ng/ml ethidium bromide during the second dimension.
Running conditions were 25 mA for 16-17 h and 15 mA for 22 h,
respectively. Stained gels were photographed under UV light.
Purification and Identification of Smj12--
In the frame
of a project aimed at identification of components of the recombination
pathway in archaea, we searched for activities able to recognize
HJ in two Sulfolobus strains (S. solfataricus MT4 and S. shibate B2). Starting with a
50-g wet weight of cells, we assayed extracts for HJ-specific binding
activity using a synthetic four-way DNA junction substrate (32). The
activity was detected in both archaeal species investigated after the
fractionation of the cell lysates by cation exchange chromatography.
The protein responsible for the activity was purified from S. solfataricus by means of four column chromatography steps,
resulting in a 500-fold purification with an overall yield of some 15 µg of protein, which was >95% pure as assessed by SDS-PAGE (Fig.
1). The subunit molecular mass estimated
by SDS-PAGE was 15,000 ± 1,000 Da, and the protein was eluted
from a calibrated size exclusion column with a retention time
consistent with a molecular mass of 31 ± 4,000 Da (data not shown), suggesting a dimeric composition in solution. Although the N
terminus was blocked, in gel trypsin digestion after denaturing SDS-PAGE yielded ~20 peptides. Nine were sequenced, and the longest sequence obtained (amino acid sequence IVSSETGKDVDAIAGELGISK) was used
to search the S. solfataricus P2 genome
sequence.2 A perfect match was found for a
single open reading frame encoding a protein of 116 amino acids
(GenBankTM/EBI accession number AJ133494). Other tryptic
peptide sequences (80 residues in total) were also matched to this
protein. The theoretical protein, designated Smj12, has a calculated
molecular mass of 12,890 Da and an isoelectric point of 9.3, in
agreement with the biochemical properties of the purified protein. The
open reading frame annotated in the S. solfataricus data
base starts with a TTG codon, which is not unusual in Archaea (36). It
was not possible to confirm the authenticity of this initiation codon, because the N terminus of the protein was blocked.
Data base searches showed that the predicted Smj12 protein shares
significant sequence similarity with the Lrs14 protein of S. solfataricus (3); sequence homologs were found among hypothetical proteins of S. solfataricus and other Archaea whose genomes
have been completed. The alignment with the best matches is shown in Fig. 2.
Expression of Smj12 in S. solfataricus--
We have analyzed
transcription in vivo of the Smj12 gene by
Northern blot (Fig. 3A). Total
RNA was extracted from S. solfataricus cells at different
growth stages and was probed with a DNA fragment corresponding to the
Smj12 coding sequence. The probe hybridized to a 0.4 kb-long
transcript, accounting for a monocistronic transcription of the gene.
This finding suggests that the Smj12 promoter is adjacent to
its coding sequence; indeed sequences matching the consensus for the
archaeal Tf-B responsive element and TATA elements (37) were
found in the region 49-34 upstream of the first TTG (Fig.
3C). Interestingly the steady-state Smj12 RNA was
only present during the exponential phase (Fig. 3A,
lanes 2 and 3) and declined in later growth
stages, a pattern different from that of three members of the Lrp/AsnC
family, namely Lrs14, Sa-Lrp from S. acidocaldarius, and the
E. coli Lrp, whose levels are sustained in the stationary
phase (Fig. 3B; see Refs. 3, 7, and 38).
Smj12 Is a Nonspecific DNA-binding Protein--
To obtain suitable
amounts of the protein we constructed a synthetic Smj12 gene
with codons optimized for expression in E. coli; the gene
was cloned both in vector pET9a, for expression from the presumptive
first codon, and in vector pQE-31, for expression as a fusion protein
with a histidine tag at the N terminus. The two recombinant proteins
were identical in thermostability and binding properties (data not
shown); unless otherwise specified, the experiments shown were obtained
with the His-tailed protein.
To characterize Smj12 binding properties we tested a variety of
different fragments as probes in band shift experiments (Fig. 4). The protein was able to bind linear
(A and B) or circular (C) fragments
and plasmids (not shown) of different length and sequence. In all cases
the protein produced ladders of multiple complexes whose mobility
decreased with increasing protein concentration; at higher
concentrations the complexes hardly entered the gels. The binding
affinity was comparable with all probes tested; the Kapp calculated from data in Fig. 4 and data not
shown was about 40 nM. Although the protein was identified
for its ability to bind synthetic fragments containing HJ, Smj12 did
not show higher affinity for such substrates (data not shown).
Single-stranded DNA was not bound (data not shown). We conclude that
Smj12 is a sequence-nonspecific DNA-binding protein and does not show
DNA structure preference.
Nonspecific DNA-binding proteins often induce compaction of DNA,
a conformational change resulting in reduction of the hydrodynamic volume of DNA-protein complexes, which show electrophoretic
acceleration rather than retardation; for instance, the archaeal
proteins MC1 and Sso7d induce compaction of negative or positively
supercoiled DNA molecules, respectively (39).3
Complexes formed by Smj12 with DNA molecules of different nature (plasmids, minicircles of any topology, and linear fragments) were always retarded, and therefore there was no evidence of compaction (Fig. 4 and data not shown).
Smj12 Binding Activity Is Thermostable and Stabilizes DNA
against Heat Denaturation--
Because S. solfataricus is a
hyperthermophilic organism optimally living at 80-85 °C we tested
the effect of temperature on Smj12 binding activity (Fig.
5). Binding efficiency was unchanged in
the range 37-75 °C, was reduced above 80 °C, and at 95 °C no stable complex was formed; in reactions performed above 80 °C the
fraction of unbound probe was denatured. In contrast, when the protein
was preincubated with DNA at 37 °C and then shifted to high
temperatures, all the probe was bound up to 85 °C, and a stable
complex was formed even at 90 °C. This experiment indicates that
Smj12 is intrinsically stable up to 90 °C under the conditions used,
and it protects DNA from heat denaturation; in the experiment shown in
Fig. 5 the probe Tm is raised by about 10 °C. Protection of DNA from
thermal denaturation has been reported for a number of nonspecific
DNA-binding proteins from hyperthermophiles (40, 41); in contrast, the
sequence-specific factor Lrs14 was not able to protect DNA fragments or
plasmids containing its target sequences (data not shown).
Smj12 and Lrs14 Are Not Abundant Proteins--
To estimate
the intracellular abundancy of Smj12 with respect to its homolog Lrs14
and to the architectural dsDNA-binding protein Sso7d, polyclonal
antibodies were raised against the three proteins and used in
quantitative Western blot experiments using known amounts of the three
purified proteins as standards (Fig. 6).
As expected from their sequence similarity, Lrs14 and Smj12 cross-reacted with both specific antibodies, although with different affinity, whereas Sso7d reacted only with the specific antibody. Moreover, because Lrs14 and Smj12 also have a very similar molecular weight (12.9 versus 14), they were not distinguishable in
cell extracts, and therefore a differential quantitation of the two proteins was impaired. However, we could conclude that together they
represent less than 0.1% of total protein and are therefore of far
lower abundance than Sso7d (Fig. 6C), which accounts for more than 1% of total cell protein. Similarly, the E. coli
Lrp protein is far less abundant than architectural proteins such as
HU or Fis (42).
Smj12 Induces Positive Supercoiling--
A feature shared by
different classes of nonspecific DNA-binding proteins in Eukarya,
Eubacteria, and Archaea is the ability to induce DNA bending and/or
supercoiling upon binding. The relationships between Smj12 and
DNA conformation were initially addressed using DNA minicircles.
Minicircle DNA probes of different topology (
To analyze DNA conformation in Smj12-DNA complexes we used TopoI
assays (35). Binding reactions of Smj12 with different minicircles were
incubated with eukaryotic TopoI, which relaxes positive/negative
superturns; deproteinated reaction products were analyzed by
nondenaturing polyacrylamide gel electrophoresis, allowing for
separation of different topoisomers (Fig.
7). We used four different topoisomers of
the 371-bp fragment, with
To confirm the DNA positive supercoiling activity of Smj12 we
performed a similar experiment using a completely different substrate,
a highly negatively supercoiled plasmid DNA, and separated the reaction
products by bidimensional gel electrophoresis (Fig. 8A). Only relaxed plasmid was
present in the presence of TopoI alone (lane TopoI); when
increasing amounts of Smj12 were added, positive topoisomers were
produced. The maximum
We conclude that Smj12 induces positive supercoiling in DNA
substrates of any topology upon binding, a conformational change that,
in cooperation with the topoisomerase activity, is translated into
topological change.
We have identified and characterized Smj12, a novel S. solfataricus member of the BA family of proteins whose prototype
is the E. coli Lrp transcriptional regulator (44). Smj12
shares sequence and immunological similarity with the S. solfataricus Lrs14 protein; however, whereas Lrs14 specifically
binds to sequences in its own promoter (3, 5), Smj12 shows no sequence
specificity and affects DNA structure inducing positive supercoiling.
BA regulators are present in multiple copies in Eubacteria and
Archaea; those for which functional data are available are sequence-specific DNA-binding proteins implicated in transcription regulation (5, 6, 44). During the preparation of this manuscript the
finding that the Bacillus subtilis LrpC protein is a
nonspecific DNA-binding protein affecting DNA supercoiling was reported
(45). Therefore in both Archaea and Gram-positive Eubacteria two
classes of BA regulators are present that differ in binding specificity
and consequently in function. B. subtilis lrpC null strain
is viable and has a pleiotropic phenotype (46), but the function of
LrpC is still elusive. Interestingly, both B. subtilis and
Sulfolobus lack histones, suggesting that nonspecific members of the family might affect chromatin structure in the absence
of histones.
Proteins collectively defined as architectural have been found in
every organism, and, although unrelated in both structure and function,
they usually share the ability to induce DNA bending and/or
supercoiling upon binding and/or to preferentially interact with bent,
supercoiled, or crossed DNA. They include the HMG1 proteins, members of
the HMGI-Y family, histones, the SWI/SNF complex, and a number
of eubacterial proteins (reviewed in Ref. 47). Although most of these
proteins have a structural role, some of them may have very specific functions.
Most architectural proteins induce negative supercoiling. These
include bacterial HU, eukaryal histones, the archaeal MC1, Sso7d, and
SacI0b families (13, 14, 31, 39, 48). Positive supercoiling has been
reported so far for few proteins, including the euryarchaeal histone
homologs HmfB and Htz, for which controversial data are available:
whereas they induce positive supercoiling at low salt and high protein
concentrations, at physiological salt concentration they wrap DNA into
negative supercoils (49, 50). Smj12 induces positive supercoiling at a
wide range of concentrations, and the conditions of our assay are, with
respect to ionic strength, physiological for Sulfolobus.
Complexes formed by Smj12 with DNA molecules of any type are always
retarded (Fig. 4 and data not shown), suggesting that Smj12 does not
compact DNA; moreover, it does not induce bending nor show preference for cruciform DNA (data not shown) and, most important, is not abundant
(Fig. 6), suggesting that it is unlikely to organize higher order
structures over the whole chromosome. A specific localization and/or
function must be hypothesized.
Recently both positive and negative supercoiling activity has
been associated with the Rad51/Rad53 complex during recombination (24),
and positive supercoiling activity has been shown for the so-called
condensins, multiprotein complexes that contain the evolutionary
conserved structural maintenance of chromosome proteins (51).
Interestingly, structural maintenance of chromosome proteins show high
affinity for cruciform DNA fragments (52) and have been found
associated to recombination complexes (53). Smj12 recognizes four-way
junctions, although with affinity comparable than double-stranded
substrates; whether this ability reflects any physiological activity is
currently only a matter for speculation. Cruciform DNAs are
intermediates in recombination, as well as in DNA replication; Smj12
might act as an accessory protein in one or both processes, for
instance stabilizing such intermediates.
Although the actual DNA topology of hyperthermophilic Archaea is
unknown, it has been suggested that these organisms stabilize their DNA
through a general linking excess, which is imputable to reverse gyrase
activity (54). However, it has been argued that such torsional
constraint could not be maintained in the presence of strand breaks
introduced during replication, repair, and recombination (55); one
fascinating hypothesis is that Smj12 is required to maintain local
positive supercoiling during DNA transactions. Unfortunately, it is
currently not possible to obtain targeted mutants in
Sulfolobus, and therefore the function of the protein cannot
be directly addressed. It would be interesting to investigate the
possible connection between Smj12 and proteins of the recombination
pathway, such as RadA, the archaeal homolog of Rad51/RecA (56), and the
Holliday junction resolvases Hjc and Hje (57), as well as the
replication complex (58, 59). Physical association and/or functional
interaction of Smj12 with one (or more) of these proteins might suggest
its involvement in one (or both) of these processes.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-galactopyranoside at 37 °C for
2.5 h; cells were lysed, and total extracts, showing strong
expression of an ~12-kDa protein band (data not shown) were heated
for 20 min at 70 °C to precipitate E. coli proteins. Smj12 was purified by ion exchange and gel filtration chromatography using SP-Sepharose or heparin columns.
80 °C. The probe BEN (300 bp) contained 280 bp of the upstream region of the Lrs14
gene, amplified by polymerase chain reaction, cloned in pGEM-Teasy
(Promega), and cut with EcoRI; the probe AMP
contained 221 bp of the ampicillin gene obtained from pGEM3 by
AvaII digestion. Probes were prepared by restriction
digestion of the appropriate plasmid DNA, gel-purified,
dephosphorylated with alkaline phosphatase, and end-labeled using
32P-
ATP and T4 polynucleotide kinase. Relaxed circular
probes were obtained by ligation of labeled fragments in the absence of
any intercalating agents; minicircle probes with different topology were obtained as described below.
ATP followed by a chase with cold ATP (1 mM). Labeled DNA fragments were incubated at a DNA
concentration of 0.11 µg/ml (final volume 250 µl) in ligase buffer
in the presence of 400 units of T4 DNA ligase (New England Biolabs) for
18 h at 16 °C and ethidium bromide at 0, 0.2, 0.6, or 1.2 µg/ml. After incubation 1% SDS and 1 M NaCl were added,
and samples were extracted with 1 volume of chloroform (SEVAG
extraction) and ethanol-precipitated. Samples were loaded on
preparative 5% polyacrylamide gel and run at room temperature in
0.5 × TBE buffer (30 mM Tris borate, 2 mM
EDTA, pH 8). Topoisomers were identified by their mobility relative to
that of the topoisomer of
Lk = 0, which is the slowest (34);
minicircles of
Lk =
2 and
3, obtained at the highest
ethidium bromide concentrations, migrated less than topoisomer
1,
suggesting that they deviate from the B form of DNA, as previously
reported (34). DNA minicircle molecules were extracted from gel and
purified by SEVAG extraction and ethanol precipitation. The identity of
each purified topoisomer was confirmed by topoisomerase I assay (35).
80 °C.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (64K):
[in a new window]
Fig. 1.
Purification of Smj12 from S. solfataricus. A sample of protein was analyzed by
SDS-PAGE after the following chromatography steps: 1) high performance
SP-Sepharose; 2) size exclusion Superdex 200 26/70; 3) HiTrap
heparin-Sepharose; and 4) Mono-S. Molecular weight markers are
shown.
View larger version (72K):
[in a new window]
Fig. 2.
Smj12 and its relatives. Alignment of
Smj12 with some of the highest hits from a Blast search is shown; it
concerns Lrs14 (3) and four sequences of archaeal hypothetical proteins
(Ss014 and Ss023 are found in S. solfataricus, MJ1503 in the
M. jannaschii, and AF1846 in the A. fulgidus data
bases, respectively. Amino acid residues that are identical or similar
in at least four sequences are boxed.
View larger version (17K):
[in a new window]
Fig. 3.
Expression of Smj12 in
vivo. S. solfataricus RNAs were extracted
from cultures grown at different optical density as follows: lane
1, 0.2 A600; lane 2, 0.4 A600; lane 3, 0.6 A600; and lane 4, 0.8 A600. The same amount of RNA (2 µg) was loaded
in each lane; the filter was hybridized with (A)
the 375-bp Smj12 coding sequence and (B) with the 390-bp
BamHI-SalI DNA fragment from pGEM-Hom, containing
the whole Lrs14 coding sequence (3). C, DNA sequence of the
region spanning nucleotides 58/+3 of Smj12 relative to the
first TTG, which is indicated by an arrow. The putative Tf-B
responsive element and TATA sequences are boxed.
View larger version (20K):
[in a new window]
Fig. 4.
Band shift analysis. Binding of Smj12
purified from E. coli to the following is shown:
A, the linear probe BEN, containing 280 bp of the upstream
region of the Lrs14 gene; B, the
linear probe AMP, containing 221 bp of the ampicillin gene; and
C, the circular probe BEN. All gels contained the following:
lane 1, naked probe (0.5 nM); and lanes
2-5, 3.5, 10, 35, and 100 ng of Smj12 (25, 72, 250, and 720 nM), respectively. Binding reactions were incubated at
37 °C for 30' and run on 5% polyacrylamide gels.
View larger version (29K):
[in a new window]
Fig. 5.
Smj12 is a thermostable DNA-binding protein
and stabilizes DNA against denaturation. Binding of Smj12 to the
probe BEN at different temperatures is shown. Lane 1, naked
probe (0.5 nM), denatured by incubation at 90 °C for 10 min; lanes 2 and 10, naked probe, double-stranded
(ds); lanes 3-8 and 11-17, the
double-stranded probe was incubated with Smj12 (100 ng, 720 nM) at the following temperatures for 10 min: lanes
3 and 11, 37 °C; lanes 4 and
12, 50 °C; lanes 5 and 13,
70 °C; lanes 6 and 14, 75 °C; lanes
7 and 15, 80 °C; lanes 8 and
16, 85 °C; and lanes 9 and 17,
90 °C. Samples 10-17 were preincubated at 37 °C for
10 min to allow binding and then shifted to the indicated temperatures
for 10 min, after which binding samples were immediately loaded on 5%
polyacrylamide gels.
View larger version (21K):
[in a new window]
Fig. 6.
Western blot. A, lanes
1-3, purified His-tailed Lrs14, 1, 0.5, and 0.2 µg,
respectively; lane 4, S. solfataricus cell
extract, 500 µg; and lanes 5-7, purified His-tailed
Smj12, 0.3, 0.2, and 0.1 µg, respectively. B, lanes
1-3, purified His-tailed Lrs14, 0.2, 0.1, and 0.05 µg,
respectively; lane 4, S. solfataricus cell
extract, 500 µg; and lanes 5-7, purified His-tailed
Smj12, 2.5, 1, and 0.4 µg, respectively. C, lanes
1-3, Sso7d, 4, 2, and 1 µg, respectively; and lane
4, S. solfataricus cell extract, 200 µg. Proteins
were separated on 12% polyacrylamide SDS gels. Polyclonal antibodies
against Smj12 (A), Lrs14 (B), and Sso7d
(C) were used. Bands corresponding to purified
Lrs14 and Smj12 migrate slower than those in extracts for the presence
of the histidine tag in the recombinant proteins (about 3 kDa in Lrs
and about 1 kDa in Smj12).
Lk = +1, 0,
1,
and
2, respectively) were obtained by ligation of a 371-bp DNA
fragment in the presence of increasing concentrations of ethidium
bromide (34). In band shift assays all topoisomers were bound with
comparable efficiency by Smj12 (data not shown).
Lk = +1, 0,
1, and a mixture of
2/
3. As expected, only the relaxed topoisomer was produced by TopoI
alone (lanes 2, 7, 12, and
17); incubation with increasing amounts of Smj12 followed by
TopoI action resulted in an increase of the linking number of
topoisomers, implying that Smj12 induces local positive supercoiling
upon binding, which is compensated in free regions by negative
superhelicity, that can be efficiently relaxed by TopoI, resulting in
net positive supercoiling. Despite the starting topology, the
predominant product of the reaction was a +1 minicircle, which was most
evident at the highest concentration used (6 Smj12 dimers/bp); higher
Lk values were never observed even at higher protein concentrations (data not shown). This result might indicate that the positive supercoiling activity of Smj12 is weak; however, it is also possible that the DNA fragment used can accommodate only one positive superturn per molecule because of length constraints. Indeed ligation of this
371-bp fragment in the presence of netropsin, an intercalator that
induces positive supercoiling, failed to produce topoisomers of higher
Lk values (data not shown); this finding is consistent with the
notion that, in circles smaller than 500 bp, the energy required to
change Lk values by one unit is large, and only one, or at most two,
topoisomers are produced (43). Indeed, on a circle of this length a
Lk = +1 gives a specific linking difference (
) of +0.028,
corresponding to a significant torsional stress similar to that found
in vivo (26).
View larger version (24K):
[in a new window]
Fig. 7.
Smj12 induces positive supercoiling on
minicircle topoisomers. TopoI assay on minicircle DNAs is shown.
371-bp topoisomers of Lk +1, 0,
1, and
2/
3 were obtained (see
"Experimental Procedures"). Lanes 1, 6,
11, and 16, topoisomers +1, 0,
1, and
2/
3
(0.33 nM), respectively. Lanes 2, 7,
12, and 17, topoisomer +1, 0,
1, and
2/
3,
respectively, incubated with 2 units of TopoIsomerase I. 10, 35, and
100 ng of Smj12 (72, 250, and 720 nM), respectively, were
incubated with the following: lanes 3-5, topoisomer +1;
lanes 8-10, topoisomer 0; lanes 13-15,
topoisomer
1; and lanes 18-20, topoisomer
2/
3. An
autoradiogram is shown. Topoisomers
2/
3 deviate from the predicted
migration (i.e. are slower than topoisomer
1)
suggesting a structural departure from the B form of the double helix
in this molecule that may be induced by negative torsional stress
(34).
Lk value reached was +5 (
= +0.019),
obtained at a protein/DNA ratio of 0.75 Smj12 dimers/bp; higher Smj12
concentrations did not increase the number or
Lk value of the
products. Similar results were obtained using a relaxed plasmid (Fig.
8B).
View larger version (43K):
[in a new window]
Fig. 8.
Smj12 induces positive supercoiling on
plasmids. TopoI assay on plasmid DNA is shown. A,
negatively supercoiled pGEM3 plasmid DNA (11 nM) was
incubated with 2.5 units of TopoI or with the same amount of TopoI plus
0.3 and 0.9 µg of Smj12 (1.4 and 4.2 µM), as indicated.
B, relaxed pGEM3 (11 nM) was incubated with 0.3, 0.9, and 1.8 µg of Smj12 (1.4, 4.2, and 8.4 µM), as
indicated. Incubation was for 45 min at 37 °C. Deproteinated samples
were separated on bidimensional agarose gels with ethidium bromide in
the second dimension. Positive topoisomers migrate in the right
part of the gels.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]() |
ACKNOWLEDGEMENTS |
---|
We are grateful to Neil Raven for supply of the archaeal biomass, to Nick Morrice for mass spectroscopy, to Marco Moracci for useful discussion, and to Ottavio Piedimonte and Giovanni Imperato for technical assistance.
![]() |
FOOTNOTES |
---|
* This work was partially supported by the European Union project "Extremophiles as cell factories" and by the CNR Special Program "Biomolecole per la salute umana."The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AJ133494.
¶ To whom correspondence should be addressed. Tel.: 390817257246; Fax: 390812396525; E-mail: ciaramel@dafne.ibpe.na.cnr.it.
Published, JBC Papers in Press, January 8, 2001, DOI 10.1074/jbc.M010611200
2 S. solfataricus P2 genome project, unpublished results.
3 A. Napoli, Y. Zivanovic, C. Bocs, C. Buhler, M. Rossi, P. Forterre, and M. Ciaramella, submitted for publication.
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: BA, Bacterial-Archaeal; TopoX, topoisomerase X; HJ, Holliday junctions; PAGE, polyacrylamide gel electrophoresis; HPLC, high pressure liquid chromatography; bp, base pair.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. | Bell, S. D., and Jackson, S. P. (1998) Trends Microbiol. 6, 222-228[CrossRef][Medline] [Order article via Infotrieve] |
2. | Soppa, J. (1999) Mol. Microbiol. 31, 1295-1305[CrossRef][Medline] [Order article via Infotrieve] |
3. |
Napoli, A.,
van der Oost, J.,
Sensen, C. W.,
Charlebois, R. L.,
Rossi, M.,
and Ciaramella, M.
(1999)
J. Bacteriol.
181,
1474-1480 |
4. | Bell, S. D., Cairns, S. S., Robson, R. L., and Jackson, S. P. (1999) Mol. Cell 4, 971-982[Medline] [Order article via Infotrieve] |
5. |
Bell, S. D.,
and Jackson, S. P.
(2000)
J. Biol. Chem.
275,
31624-31629 |
6. |
Brinkman, A. B.,
Dahlke, I.,
Tuininga, J. E.,
Lammers, T.,
Dumay, V.,
de Heus, E.,
Lebbink, J. H.,
Thomm, M.,
de Vos, W. M.,
and van der Oost, J.
(2000)
J. Biol. Chem.
275,
38160-38169 |
7. |
Enoru-Eta, J.,
Gigot, D.,
Thia-Toong, T. L.,
Glansdorff, N.,
and Charlier, D.
(2000)
J. Bacteriol.
182,
3661-3672 |
8. | Reeve, J. N., Sandman, K., and Daniels, C. J. (1997) Cell 89, 999-1002[Medline] [Order article via Infotrieve] |
9. | Sandman, K., and Reeve, J. N. (2000) Arch. Microbiol. 17, 165-169[CrossRef] |
10. |
Choli, T.,
Wittmann-Liebold, B.,
and Reinhardt, R.
(1988)
J. Biol. Chem.
263,
7087-7093 |
11. |
Reddy, T. R.,
and Suryanarayana, T.
(1989)
J. Biol. Chem.
264,
17298-17308 |
12. | Kulms, D., Schafer, G., and Hahn, U. (1997) Biol. Chem. 378, 545[Medline] [Order article via Infotrieve] |
13. |
Mai, V. Q.,
Chen, X.,
Hong, R.,
and Huang, L.
(1998)
J. Bacteriol.
180,
2560-2563 |
14. |
Xue, H.,
Guo, R.,
Wen, Y.,
Liu, D.,
and Huang, L.
(2000)
J. Bacteriol.
182,
3929-3933 |
15. | Forterre, P., Confalonieri, F., and Knapp, S. (1999) Mol. Microbiol. 32, 669-670[CrossRef][Medline] [Order article via Infotrieve] |
16. | Struhl, K. (1999) Cell 98, 1-4[Medline] [Order article via Infotrieve] |
17. |
Jones, K. A.,
and Kadonaga, J. T.
(2000)
Genes Dev.
14,
1992-1996 |
18. | Kornberg, R. D., and Lorch, Y. (1999) Cell 98, 285-294[Medline] [Order article via Infotrieve] |
19. | Newlon, C. S. (1997) Cell 91, 717-720[CrossRef][Medline] [Order article via Infotrieve] |
20. |
Ridgway, P.,
and Almouzni, G.
(2000)
J. Cell Sci.
113,
2647-2658 |
21. | Ritzi, M., and Knippers, R. (2000) Gene 245, 13-20[CrossRef][Medline] [Order article via Infotrieve] |
22. | Travers, A. A., Ner, S. S., and Churchill, M. E. A. (1994) Cell 77, 167-169[Medline] [Order article via Infotrieve] |
23. |
Holmes, V. F.,
and Cozzarelli, N. R.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
1322-1324 |
24. | Van Komen, S., Petukhova, G., Sigurdsson, S., Stratton, S., and Sung, P. (2000) Cell 6, 563-572 |
25. | Charbonnier, F., and Forterre, P. (1994) J. Bacteriol. 176, 1251-1259[Abstract] |
26. | Lopez-Garcia, P., and Forterre, P. (1997) Mol. Microbiol. 23, 1267-1279[Medline] [Order article via Infotrieve] |
27. | Duguet, M. (1995) in Nucleic Acids and Molecular Biology (Eckstein, F. , and Lilley, D. M. J., eds), Vol. 9 , pp. 84-114, Springer-Verlag, Berlin |
28. | Forterre, P., Bergerat, A., and Lopez-Garcia, P. (1996) FEMS Microbiol. Lett. 18, 237-248 |
29. |
Bergerat, A.,
Gadelle, D.,
and Forterre, P.
(1994)
J. Biol. Chem.
269,
27663-27669 |
30. | Slesarev, A. I., Stetter, K. O., Lake, J. A., Gellert, M., Krah, R., and Kozyavkin, S. A. (1993) Nature 364, 735-737[CrossRef][Medline] [Order article via Infotrieve] |
31. |
Lopez-Garcia, P.,
Knapp, S.,
Ladenstein, R.,
and Forterre, P.
(1998)
Nucleic Acids Res.
26,
2322-2328 |
32. |
Kvaratskhelia, M.,
Wardleworth, B. N.,
Norman, D. G.,
and White, M. F.
(2000)
J. Biol. Chem.
275,
25540-25546 |
33. | Prodromou, C., and Pearl, L. H. (1992) Protein Eng. 5, 827-829[Medline] [Order article via Infotrieve] |
34. | Goulet, I., Zivanovic, Y., and Prunell, A. (1987) Nucleic Acids Res. 15, 2803-2821[Abstract] |
35. | Zivanovic, Y., Goulet, I., Revet, B., Le Bret, M., and Prunell, A. (1988) J. Mol. Biol. 200, 267-290[Medline] [Order article via Infotrieve] |
36. | Dennis, P. P. (1997) Cell 89, 1007-1010[Medline] [Order article via Infotrieve] |
37. |
Bell, S. D.,
Kosa, P. L.,
Sigler, P. B.,
and Jackson, S. P.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
13662-13667 |
38. | Landgraf, J. R., Wu, J., and Calvo, J. M. (1996) J. Bacteriol. 178, 6930-6936[Abstract] |
39. |
Toulmé, F.,
Le Cam, E.,
Teyssier, C.,
Delain, E.,
Sautiere, P.,
Maurizot, J.-C.,
and Culard, F.
(1995)
J. Biol. Chem.
270,
6286-6291 |
40. | Baumann, H., Knapp, S., Lundback, T., Ladenstein, R., and Hard, T. (1994) Nat. Struct. Biol. 1, 808-819[Medline] [Order article via Infotrieve] |
41. | Ronimus, R. S., and Musgrave, D. (1996) Mol. Microbiol. 20, 77-86[CrossRef][Medline] [Order article via Infotrieve] |
42. |
Azam, T. A.,
Iwata, A.,
Nishimura, A.,
Ueda, S.,
and Ishihama, A.
(1999)
J. Bacteriol.
181,
6361-6370 |
43. | Bates, A. D., and Maxwell, A. (1993) in DNA Topology (Rickwood, D. , and Hale, D., eds) , IRL Press at Oxford University Press, Oxford |
44. | Calvo, J. M., and Matthews, R. G. (1994) Microbiol. Rev. 58, 466-490[Abstract] |
45. |
Tapias, A.,
Lopez, G.,
and Ayora, S.
(2000)
Nucleic Acids Res.
28,
552-559 |
46. | Beloin, C., Ayora, S., Exley, R., Hirschbein, L., Ogasawara, N., Kasahara, Y., Alonso, J. C., and Hegarat, F. L. (1997) Mol. Gen. Genet. 256, 63-71[CrossRef][Medline] [Order article via Infotrieve] |
47. |
Zlatanova, J.,
and van Holde, K.
(1998)
FASEB J.
12,
421-431 |
48. | Rouviere-Yaniv, J., Yaniv, M., and Germond, J. E. (1979) Cell 17, 265-274[Medline] [Order article via Infotrieve] |
49. | Musgrave, D. M., Sandman, K. M., and Reeve, J. N. (1991) Proc. Natl. Acad. Sci U. S. A. 87, 10397-10401 |
50. | Musgrave, D. M., Forterre, P., and Slesarev, A. (2000) Mol. Microbiol. 35, 341-349[CrossRef][Medline] [Order article via Infotrieve] |
51. | Kimura, K., Rybenkov, V. V., Crisona, N. J., Hirano, T., and Cozzarelli, N. R. (1999) Cell 98, 239-248[Medline] [Order article via Infotrieve] |
52. |
Akhmedov, A. T.,
Frei, C.,
Tsai-Pflugfelder, M.,
Kemper, B.,
Gasser, S. M.,
and Jessberger, R.
(1998)
J. Biol. Chem.
273,
24088-24094 |
53. | Jessberger, R., Riwar, B., Baechtold, H., and Akhmedov, A. T. (1996) EMBO J. 15, 4061-4068[Abstract] |
54. | Lopez-Garcia, P. (1999) J. Mol. Evol. 49, 439-452[Medline] [Order article via Infotrieve] |
55. | Grogan, D. W. (1998) Mol. Microbiol. 28, 1043-1049[CrossRef][Medline] [Order article via Infotrieve] |
56. |
Seitz, E. M.,
Brockman, J. P.,
Sandler, S. J.,
Clark, A. J.,
and Kowalczykowski, S. C.
(1998)
Genes Dev.
12,
1248-1253 |
57. | Kvaratskhelia, M., and White, M. F. (2000) J. Mol. Biol. 297, 923-932[CrossRef][Medline] [Order article via Infotrieve] |
58. | Pisani, F. M., De Felice, M., Carpentieri, F., and Rossi, M. (2000) J. Mol. Biol. 301, 61-73[CrossRef][Medline] [Order article via Infotrieve] |
59. | Pisani, F. M., De Felice, M., Manco, G., and Rossi, M. (1998) Extremophiles 2, 171-177[CrossRef][Medline] [Order article via Infotrieve] |