From the Department of Cellular and Molecular Pharmacology, University of California School of Medicine, San Francisco, California 94129
Received for publication, July 19, 2000, and in revised form, September 27, 2000
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
ActA is a bacterially encoded protein that
enables Listeria monocytogenes to hijack the host cell
actin cytoskeleton. It promotes Arp2/3-dependent actin
nucleation, but its interactions with cellular components of the
nucleation machinery are not well understood. Here we show that two
domains of ActA (residues 85-104 and 121-138) with sequence
similarity to WASP homology 2 domains bind two actin monomers with
submicromolar affinity. ActA binds Arp2/3 with a Kd
of 0.6 µM and competes for binding with the WASP family proteins N-WASP and Scar1. By chemical cross-linking, ActA, N-WASP, and
Scar1 contact the same three subunits of the Arp2/3 complex, p40, Arp2,
and Arp3. Interestingly, profilin competes with ActA for binding of
Arp2/3, but actophorin (cofilin) does not. The minimal Arp2/3-binding
site of ActA (residues 144-170) is C-terminal to both actin-binding
sites and shares sequence homology with Arp2/3-binding regions of WASP
family proteins. The maximal activity at saturating concentrations of
ActA is identical to the most active domains of the WASP family
proteins. We propose that ActA and endogenous WASP family proteins
promote Arp2/3-dependent nucleation by similar mechanisms
and require simultaneous binding of Arp2 and Arp3.
The actin cytoskeleton participates in many essential functions in
eukaryotic cells including motility, endocytosis, and cytokinesis. These processes rely on the rapid and localized assembly and
disassembly of actin filaments. Cellular signals, such as activated Rho
family G-proteins, direct construction of new actin filaments de
novo by localizing and activating the nucleation machinery. The
actin nucleation machinery consists of the Arp2/3 complex, a
multiprotein complex that nucleates and cross-links actin filaments
into orthogonal arrays, and a nucleation promoting factor that
activates or enhances the activity of the Arp2/3 complex. Both the
mechanism of Arp2/3-mediated nucleation and its enhancement by
nucleation promoting factors are poorly understood. Cellular nucleation
promoting factors identified to date are all members of the WASP family
of proteins, which includes isoforms of WASP, N-WASP, and Scar. Other
proteins, including fungal myosin I (1, 2) and p150 Spir (a possible
c-Jun N-terminal kinase substrate in humans and Drosophila
(3)), have been identified as potential nucleation promoting factors
based on genetic and biochemical interactions with Arp2/3 and/or
sequence similarity with regions of WASP family proteins.
The bacterium Listeria monocytogenes recruits the host cell
cytoskeleton to power its own motility and migrate from cell to cell to
avoid the humoral immune system. The only bacterial protein required
for this activity is ActA (4, 5), a nucleation promoting factor that
recruits and activates Arp2/3. Although ActA was the first protein
found to stimulate Arp2/3-dependent actin nucleation (6),
we know much less about how actin and Arp2/3 interact with ActA than
with the WASP family proteins. WASP family proteins contain an acidic
C-terminal domain that binds Arp2/3 (7) and one or two WASP homology 2 (WH2)1 domains that bind
actin (8, 9). Biochemical analysis of truncation mutants suggests that
both the acidic and WH2 domains are required to promote
Arp2/3-dependent nucleation (10, 11). The nucleation
promoting activity of ActA has been shown to reside in the N-terminal
262 amino acids of the molecule (6), but the location, number, and
activity of actin- and Arp2/3-binding sites have not been determined.
Understanding the structure and function of ActA provides insight into
the mechanism of Arp2/3-mediated actin polymerization. In addition,
comparison of ActA with endogenous nucleation promoting factors shows
us how relevant conclusions based on studying Listeria motility are to normal cellular motility. In the present study we find
that ActA binds two actin monomers with submicromolar affinity using
domains with some sequence similarity to WH2 domains from endogenous
nucleation promoting factors. The binding site for Arp2/3 is located
C-terminal to the actin-binding sites, and although it does not contain
the characteristic cluster of acidic residues, it shares limited
sequence homology with the Arp2/3-binding domains found in WASP family
proteins. By chemical cross-linking and polarization anisotropy, we
show that ActA and the WASP family proteins hScar1 and N-WASP contact
the same subunits on Arp2/3 and compete for the same binding site. This
binding site is much more extensive than previously thought and
includes both of the actin-related proteins, Arp2 and Arp3. In
vitro the maximal activity of full-length ActA is nearly identical
to the endogenous nucleation promoting factor N-WASP.
Protein Purification--
L. monocytogenes 4035 genomic DNA was a generous gift from A. K. Benson, University of
Nebraska, Lincoln. Oligonucleotide primers were designed that
correspond to the following: FACTA30N, GATCGAATTCTCCAGTCTGAACACAGATGAATGGG; FACTA120N,
GATCGGATCCATGGCTTCAGGAGCCGACCGACC; FACTA152N,
GATCGGATCCATGATAGCATCATCGGATAGTGAGC; FACT180N,
GGATCCATGTCAGTTGCGGATGCTTCTGAA; RACTA170N,
GATCGAATTCTTAACATTTTGTTGGTTTATCCGGATAAGTAAGGC; and RACTA612,
GAATTCTTAACACGTCGTATGGTTCCCTGGTTCTTCCTTCGC. Polymerase chain
reactions were performed with proofreading polymerase (Roche Molecular
Biochemicals) under standard conditions. DNA fragments were subcloned
into the pET-5a expression vector (Novagen, Madison, WI).
ActA-(30-120) and ActA-(121-170) were constructed either by dropout
and/or EcoRI partial digestion of the ActA-(30-170) construct.
All ActA proteins were expressed and purified as follows. Fresh
transformations of BL-21(DE3) cells were grown at 37 °C in TPM (20 g
of tryptone, 15 g of yeast extract, 8 g of NaCl, 2 g of
Na2HPO4, 0.2% glucose, 50 µg/ml ampicillin)
to A650 of ~0.6, then induced with 0.25 mM isopropyl-1-thio-
Arp2/3 was purified as described previously (12) but with a few
modifications. Poly-L-proline flow-through was passed over a C-200 cation exchange column. The flow-through was adsorbed onto a
C-500 anion exchange column and eluted with a linear gradient from
0 to 0.2 M KCl in column buffer. Protein-containing
fractions were concentrated by dialysis against solid sucrose and run
on an S-300 column equilibrated in high salt complex buffer (10 mM imidazole, pH 7.5, 150 mM NaCl, 750 mM KCl, 0.1 mM EGTA, 0.2 mM MgCl2, 1 mM DTT, 0.2 mM ATP).
Purified Arp2/3 was stored in complex buffer supplemented with 35-50% sucrose.
Acanthamoeba actin and rabbit skeletal muscle actin were
purified according to Refs. 13 and 14. Plasma gelsolin was purified as
described previously (15, 16).
Fluorescent Labeling--
Purified proteins were dialyzed
against 50 mM KCl, 1 mM MgSO4, 1 mM EGTA, 10 mM imidazole, pH 7, and incubated
with a 4-7-fold molar excess of rhodamine maleimide (Molecular Probes,
Eugene, OR) for 1 h at room temperature and overnight at 4 °C.
Samples were spun at 65,000 rpm, and the supernatant was
chromatographed on a Sephacryl S-300 column to remove unreacted dye. In
Arp2/3-mediated polymerization assays, the activity of the
rhodamine-labeled ActA was indistinguishable from that of unlabeled ActA.
Freshly purified Arp2/3 was dialyzed into labeling buffer (10 mM imidazole, pH 7, 50 mM KCl, 0.1 mM MgCl2, 0.1 mM ATP, 0.5 mM TCEP) overnight and centrifuged at 13,000 rpm to remove
precipitated protein. The supernatant was concentrated to 1-2 mg/ml
with a microcon concentrator and mixed with an equimolar amount of
rhodamine maleimide for 1.5 h at 24 °C under cover of darkness.
The reaction was quenched with excess DTT, and the sample was spun at
70,000 rpm for 30 min at 4 °C to remove precipitated dye. The
supernatant was chromatographed on a 10-ml Sephadex G-25 column to
remove unreacted dye. This labeling protocol results in ~15%
labeling of Arp2/3, almost exclusively on the Arp3 subunit. Higher
concentrations of rhodamine maleimide produce elevated percentages of
labeling, and the complex becomes labeled on both the Arp3 and p18
subunits. To determine the effect of labeling on Arp2/3 activity, we
tested 60% rhodamine-labeled Arp2/3 and found no effect on either
nucleation or pointed end capping.
Acanthamoeba and Rabbit skeletal muscle actin were labeled with pyrene
iodoacetamide as described (17).
Actin Polymerization--
We mixed unlabeled
Acanthamoeba actin with pyrene-labeled amoeba or rabbit
skeletal muscle actin to 10-15% of final actin concentration.
Polymerization reactions contained 50 mM KCl, 1 mM MgSO4, 1 mM EGTA, 10 mM imidazole, pH 7. Ca2+-actin was converted to
Mg2+-actin prior to each polymerization reaction by a 2-min
incubation with 50 µM MgCl2, 200 µM EGTA. Gelsolin-actin dimers were prepared according to
Ref. 15. Pyrene fluorescence was measured by a K2 Multifrequency
Fluorometer (ISS, Champagne, IL). Data were analyzed using KaleidaGraph
(Synergy Software, Reading, PA).
Polarization Anisotropy--
Rhodamine-labeled ActA-(30-170)
(500 nM) or Arp2/3 (750 nM) was mixed with the
appropriate unlabeled proteins to the indicated concentrations. Samples
were degassed under vacuum at room temperature before data collection.
Data were collected with a K2 Multifrequency Fluorometer and analyzed
using KaleidaGraph. Under the conditions used in our study, anisotropy
is a measure of the rotational mobility of the fluorescently labeled
protein. We excited the fluorophore with plane polarized light at 543 nm, and measured emission at 575 nm at polarizations both parallel
(I
We determined dissociation equilibrium constants by fitting
anisotropy data to the function shown in Equation 2,
In experiments where nonfluorescent ligands compete with
rhodamine-labeled ActA (Fig. 4), we determined dissociation constants by fitting anisotropy data to the function (18) shown in Equation 3,
Chemical Cross-linking--
The indicated concentrations of
ActA-(121-170) and Arp2/3 were dialyzed into 50 mM KCl, 1 mM MgSO4, 1 mM EGTA, 10 mM imidazole, pH 7, to facilitate cross-linking. Stock
solutions of 100 mM
1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and
N-hydroxysuccinimide (NHS) (Pierce) were prepared in
Me2SO. Cross-linking reactions were carried out at room temperature at the indicated concentrations of proteins and cross-linkers for 45 min. The reaction was quenched with 10 mM Tris, 100 mM glycine. Reaction products were
precipitated with methanol and chloroform and analyzed by
SDS-polyacrylamide gel electrophoresis and immunoblotting.
Atomic Models--
The atomic model for actin was taken from
Schutt et al. (19), and the model of Arp2 was constructed by
Joe Kelleher based on homology with conventional actin combined with
molecular dynamics simulations (20). Visualization and rendering were
performed with Molscript (21) and Raster3d (22).
ActA Binds Two Actin Monomers via WH2-like Motifs--
Full-length
ActA (amino acids 30-612) and several smaller truncation mutants
inhibit spontaneous actin polymerization and elongation from the
pointed end of existing actin filaments but have no effect on
elongation from the barbed end (Fig. 1,
A and B, inset). This activity is similar to that
reported for fragments of N-WASP (23) and Scar1 (11). Unlike Scar and
N-WASP, which almost completely inhibit pointed end elongation,
saturating concentrations of ActA inhibit pointed end elongation
by 80%.
We used the effect on pointed end elongation to quantitate actin
monomer binding by ActA-(30-612) (Fig. 1B). The decrease in
elongation rate as a function of ActA concentration is not well fit by
a model in which an individual ActA molecule binds a single actin
monomer (right line). The data fit much better to a
model in which one ActA binds two actin monomers, each with a
Kd of 0.7 ± 0.2 µM suggesting
that ActA contains at least two actin monomer-binding sites. Previous
studies identified a putative actin-binding site (24, 25) between amino
acids 60 and 90. To extend this work we used truncation mutants to
perform a systematic search for actin-binding sites throughout the
entire molecule. We expressed truncation mutants spanning the entire molecule (Fig. 1C) and assayed the monomer binding activity
of each by its effect in three assays as follows: spontaneous actin polymerization, elongation from the barbed end, and elongation from the
pointed end of existing filaments.
The construct spanning amino acids 30-120 weakly inhibited spontaneous
polymerization (data not shown), consistent with previous reports of an
actin-binding site between amino acids 60 and 100 (24). In addition,
the construct spanning amino acids 120-612 inhibited spontaneous
polymerization and elongation from both the pointed and barbed ends of
existing filaments. We further localized this second actin-binding site
to a region of the protein between amino acids 121 and 152. We
estimated a dissociation constant of 2.1 ± 0.5 µM
for the actin-binding site on ActA-(120-612) from barbed end
elongation assays (data not shown). The lower affinity of this binding
site compared with that predicted from ActA-(30-612) and the fact that
it blocks barbed as well as pointed end elongations are probably
artifacts caused by some degree of misfolding of the ActA-(120-612)
construct. Cicchetti et al. (24) found that deletions in the
N-terminal region of ActA perturb the secondary structure and decrease
the stability of the protein.
We conclude that full-length ActA contains two actin monomer-binding
sites. We further localized them based on sequence similarity to the
actin-binding WH2 domains from WASP family proteins (Fig. 1D).
The Arp2/3-binding Site of ActA--
Amino acids 143-169 of ActA
constitute a minimal Arp2/3-binding site. Full-length ActA and
truncations spanning residues 30-170, 120-612, and 121-170 all
stimulated Arp2/3-dependent nucleation (Figs. 1C
and 2A). Therefore, residues 121-170 contain the minimal requirements to promote nucleation - actin monomer binding activity and
an Arp2/3-binding site. Within this region we identified residues 143-169 as the Arp2/3-binding site by sequence similarity to the C-terminal portions of WASP, Scar, and N-WASP (Fig. 1D).
This domain contains very few acidic residues compared with the
Arp2/3-binding sites of most WASP family proteins but is most similar
to the yeast protein Las17p/Bee1p. At saturating concentrations the
ActA-(120-612) truncation is less efficient at stimulating actin
polymerization than proteins containing amino acids 30-120. Under our
assay conditions (2 µM actin, 50 nM Arp2/3),
the time to half-maximal polymerization stimulated by saturating
concentrations of ActA-(30-612) and ActA-(30-170) is ~75 s compared
with t1/2 of ~500 s for ActA-(120-612) (Fig.
2A).
We determined the affinity of the 30-612 and 30-170 ActA proteins for
Arp2/3 by polarization anisotropy (Fig. 2B). To characterize the interaction with ActA-(30-612) we labeled Arp2/3 with rhodamine maleimide. Our labeling conditions produced 5-15% labeling, almost exclusively on the Arp3 subunit. From preparation to preparation, free
Arp2/3 had an anisotropy that varied between 0.215 and 0.26. Addition
of saturating concentrations of ActA-(30-612) consistently increased
the steady-state anisotropy by 0.015. From this change we measured a
Kd of 0.5 ± 0.2 µM.
To measure Arp2/3 binding to the smaller truncation mutants, we labeled
ActA with rhodamine maleimide. We designed all our ActA proteins with a
cysteine at the extreme C terminus for efficient labeling with
sulfhydryl-reactive fluorophores. We labeled each construct with
rhodamine maleimide and measured its anisotropy alone and in the
presence of Arp2/3. ActA-(30-612) had a very low anisotropy (0.05)
similar to that of free dye, which did not change upon addition of
Arp2/3 suggesting that the C terminus of the protein is flexible and
possibly disordered. ActA-(30-170) was much more well behaved, and in
the absence of Arp2/3 it had an anisotropy of 0.095 and in the presence
of saturating Arp2/3 concentrations of 0.21. From this anisotropy
change, we measured a Kd of 4.8 ± 0.3 µM. The lower affinity of ActA-(30-170) suggests that
residues C-terminal to 170 may also interact with Arp2/3.
ActA and Scar1 Bind Arp2/3 at the Junction between p-40, Arp2, and
Arp3--
To localize the binding sites for nucleation promoting
factors on Arp2/3, we carried out identical cross-linking experiments with the active fragment of hScar1 and the smallest fragment of ActA
capable of stimulating Arp2/3-dependent nucleation,
ActA-(121-170). We identified three Arp2/3 subunits that directly
contact both ActA and hScar1 by cross-linking each protein to Arp2/3
with the zero-length cross-linker EDC together with NHS. After
cross-linking, antibodies that recognize the T7 tag on ActA-(121-170)
or the His6 tag on hScar1 react with three prominent new
bands (Fig. 3, A and
B). The new bands are also recognized by monospecific antibodies against the p40, Arp2, and Arp3 subunits of Arp2/3.
We next investigated whether the binding site for ActA overlapped that
of endogenous WASP family proteins by performing competition binding
assays. Addition of the active C-terminal domain of N-WASP to a mixture
of Arp2/3 and rhodamine ActA-(30-170) decreases the anisotropy of
labeled ActA down to the level of free ActA (Fig. 4), suggesting that the two proteins bind
in a mutually exclusive manner. From these competition experiments we
estimate a Kd of 1.9 ± 0.3 µM
for N-WASP binding to Arp2/3. Similar results were obtained with hScar1
(Kd = 2.0 ± 0.4 µM, data not shown).
Our results suggest that Arp2 interacts directly with ActA and WASP
family proteins. To further localize the binding site for nucleation
promoting factors, we tested the effects of two proteins known to bind
Arp2, profilin and actophorin, on the binding of ActA to Arp2/3.
Interestingly, profilin decreases the fraction of ActA bound to Arp2/3
in a dose-dependent manner, suggesting that its binding
site overlaps that of ActA. Fitting the data with a competitive binding
model yields a Kd of 3.4 ± 0.3 for profilin
binding, somewhat lower than our previous estimate of 7 µM from analytical ultracentrifugation (26). Profilin, however, is not as effective as N-WASP at displacing ActA from Arp2/3.
In the presence of Arp2/3, saturating concentrations of profilin do not
decrease the anisotropy of rhodamine ActA-(30-170) down to the levels
of free protein suggesting that the binding sites do not completely
overlap. The data are consistent with an increase in the
Kd for ActA binding from 4.8 to ~30 µM. Although actophorin binds Arp2/3 with approximately
the same affinity as profilin, actophorin does not displace rhodamine
ActA even at high concentrations (Fig. 4).
Kinetics of Arp2/3-dependent Nucleation--
Although
we do not understand the molecular details of
Arp2/3-dependent nucleation, several characteristics of the
process have been well described. Addition of WASP family proteins to Arp2/3 accelerates filament formation but, even at high concentrations, does not completely abolish the initial lag phase of polymerization (10, 27, 28). This suggests that nucleation promoting factors do not
convert Arp2/3 into a bona fide actin nucleus but promote nucleation via a multistep mechanism. In addition, pre-existing filaments accelerate the nucleation reaction so that the majority of
new actin filaments grow from the sides of pre-existing filaments in a
characteristic branching pattern (7, 11, 15, 29). To compare the
activity of ActA to that of endogenous nucleation promoting factors, we
asked the following three questions. 1) Does addition of ActA abolish
the lag phase of polymerization? 2) How does the maximal activity of
ActA compare with that of an endogenous nucleation promoting factor? 3)
Do pre-existing actin filaments enhance ActA-stimulated filament formation?
The maximal activity of either ActA-(30-612) or ActA-(30-170) is
nearly identical to the most active C-terminal fragment of N-WASP (Fig.
5A). The initial lag phase of
actin polymerization is reduced in the presence of both proteins but,
even at saturating concentrations, is not abolished. We also find that
prepolymerized actin seeds enhance the rate of ActA stimulated
polymerization (Fig. 5B). Under these conditions the lag
phase is either abolished or so short that the dead time of our assay
prevents us from detecting it.
Understanding the functional organization of the ActA protein is
fundamental to the study of cellular actin dynamics. Motility of
Listeria or beads coated with ActA is widely used as a model for in vivo actin assembly (30) and actin-based force
generation (31). ActA, however, is a prokaryotic protein and a
constitutive Arp2/3 activator and thus might operate by a different
mechanism from that of the endogenous WASP family proteins. The present study, therefore, not only provides insight into the function of the
Arp2/3 complex but also indicates the relevance of conclusions drawn
from the study of Listeria motility to regulation of actin assembly by endogenous factors.
The structural and kinetic similarities identified by this study
indicate that the constitutive Arp2/3 activator ActA and the tightly
regulated WASP family proteins operate via a common mechanism and that
ActA-dependent actin assembly closely mimics endogenous
processes. In addition, for the first time we have identified the
subunits of Arp2/3 that bind nucleation promoting factors, including
ActA and the WASP family proteins.
Our results show that ActA binds two actin monomers and has
actin-binding properties similar to WH2-containing WASP family proteins. The domain organization of ActA most closely resembles that
of N-WASP (Fig. 2B) with two actin-binding sites N-terminal to an Arp2/3-binding site. The smallest ActA proteins that promote Arp2/3-dependent nucleation contain both an actin and an
Arp2/3-binding site separated by a very short (five residues) and
apparently flexible linker suggesting that nucleation promoting
activity involves delivery of actin monomers to Arp2/3. The maximal
activity of ActA is insensitive to a 10-fold change in the affinity for Arp2/3, but the maximal activity is very sensitive to the loss of
residues 30-120. This may be caused by loss of one actin-binding site
or possibly by a misfolding artifact. Cicchetti et al. (24) report that N-terminal truncations of ActA are unstable, and we find
that, whereas ActA-(30-612) inhibits only pointed end elongation, ActA-(120-612) inhibits both pointed and barbed end elongation.
The most interesting result of our study is the identification of the
binding site for nucleation promoting factors on the Arp2/3 complex. It
is interesting because it tells us a lot about both the organization
and activation of the Arp2/3 complex. We find that ActA and the
endogenous WASP family proteins bind Arp2/3 in a mutually exclusive
manner and by chemical cross-linking these proteins interact with the
Arp2, Arp3, and p40 subunits of the Arp2/3 complex. Previous chemical
cross-linking studies (32) identified interactions between Arp2 and p40
but found no evidence of a contact between Arp3 and either Arp2 or p40.
The interaction of the small (49 residue) ActA-(121-170) protein with
all three subunits suggests that they are in close physical proximity
(Fig. 6A). Arp2 and Arp3 were
previously predicted to form a heterodimer (20), but ours is the first
experimental evidence that they are in close proximity within the
Arp2/3 complex.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
-D-galactopyranoside (Sigma), and grown an additional 2 h. Cells were harvested at 5000 rpm and pellets stored
80 °C. Cells were thawed and resuspended in
lysis buffer (10 mM Tris, pH 8, 0.2 M sucrose,
1000 units of DNase, 1000 units of RNase, 5 mM DTT, 5 mM phenylmethylsulfonyl fluoride) and lysed by three passes
in a microfluidizer (Microfluidics International Corp., Newton, MA).
The extract was spun at 15,000 rpm, and the supernatant was
fractionated by gel filtration on a 500-ml Sephacryl S-300 column
equilibrated in high salt buffer (10 mM Tris, pH 8, 500 mM KCl, 1 mM EDTA, 1 mM DTT).
ActA-containing fractions were pooled and dialyzed against DEAE buffer
(10 mM Tris, pH 8, 1 mM EDTA, 1 mM
DTT). Protein was then purified by anion exchange chromatography using
DE52 resin. Proteins were concentrated either by dialysis against solid
sucrose or with a Centriprep spin column. Purified proteins were
flash-frozen and stored at
80 °C. The WA constructs of hSCAR1 and
N-WASP were expressed with C-terminal His tags and purified on
nickel-nitrilotriacetic acid-agarose (Qiagen, Valencia, CA). Cell
growth conditions, buffers, and lysis conditions were identical to
those used for ActA mutants.
) and perpendicular (I
) to the excitation source. We then
calculated anisotropy (r) as shown in Equation 1,
(Eq. 1)
where rf and rb are the
anisotropies of free and bound rhodamine ActA; [A] and
[R] are the total concentrations of ActA and Arp2/3, and
Kd is the dissociation equilibrium constant. Fitting
with this function makes no assumptions about the relative
concentrations of ActA and Arp2/3.
(Eq. 2)
where Kd,2 is the dissociation
constant of the nonfluorescent competitor; [C] is the
total concentration of the competitor, and [Ro] is
the concentration of free Arp2/3 when [C] = 0. For this
analysis [Ro] and Kd are
determined from the anisotropy in the absence of competitor and
Kd,2 is determined from fitting Equation 3 to experimental data. This function is an approximation and only
valid when Arp2/3 and the competitor are in excess over labeled ActA.
These conditions were met in all our competition binding experiments.
(Eq. 3)
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (45K):
[in a new window]
Fig. 1.
ActA binds two actin monomers.
A, inhibition of spontaneous actin polymerization by
ActA-(30-612). 5 µM actin monomers were polymerized by
addition of KCl and MgCl2 in the presence of the following
concentrations of ActA-(30-612): , 0.0 µM;
, 3 µM;
, 5 µM;
, 10 µM
(conditions, actin was 15% pyrene-labeled; buffer, 50 mM
KCl, 1 mM MgSO4, 1 mM EGTA, 10 mM imidazole, pH 7, temperature, 24 °C). B,
ActA-(30-612) blocks addition of actin monomers to the pointed ends of
existing filaments. We polymerized 3 µM actin (10%
pyrene-labeled) from the pointed ends of gelsolin-capped actin seeds in
the presence of various concentrations of ActA-(30-612).
Inset, time courses of polymerization in the presence of
0.0, 0.8, 1.6, 3.0, 4.0, and 6.0 µM ActA-(30-612)
(conditions, buffer, and temperature same as A).
Straight lines represent infinitely tight binding to either
one (right) or two (left) binding sites.
The heavy curve is the best fit to a two binding site model
with equal dissociation equilibrium constants of 0.7 ± 0.2 µM. C, domain organization of ActA. ActA
truncation mutants used in this study and their relative activities in
inhibiting spontaneous actin polymerization and promoting
Arp2/3-dependent nucleation activity. D, actin
and Arp2/3-binding sites in the N-terminal portion of ActA. The
heavy dark lines indicate the minimal fragment of ActA
capable of promoting Arp2/3-dependent nucleation
(top) and the putative actin and Arp2/3-binding sites
identified by homology with domains from WASP family proteins
(bottom). The domains from WASP family proteins begin at the
following amino acids: Bee1p, 547, 570, and 613; human
N-WASP, 345, 372, and 413; Rat N-WASP, 401, 428, and
469; Mouse WASP, 447 and 490; Human Scar1, 495 and 533; and Dicty Scar, 380 and 418.
View larger version (22K):
[in a new window]
Fig. 2.
Binding and activation of the Arp2/3 complex
by ActA. A, comparison of the maximal activities of
different ActA truncations. 50 nM Arp2/3 complex and 2 µM actin were polymerized in the presence of saturating
concentrations of ActA proteins (conditions, amoeba actin was 15%
pyrene-labeled; temperature, 24 °C; buffer conditions, 50 mM KCl, 1 mM MgSO4, 1 mM EGTA, 10 mM imidazole, pH 7). , Arp2/3
alone;
, 100 nM ActA-(30-612);
, 5.7 µM ActA-(30-170);
, 200 nM
ActA-(120-612). B, polarization anisotropy measurements of
Arp2/3 binding ActA-(30-612) and ActA-(30-170). We measured either
the anisotropy of rhodamine-labeled Arp2/3 (750 nM) in the
presence of unlabeled ActA-(30-612) (
) or the anisotropy of
rhodamine-labeled ActA-(30-170) (500 nM) in the presence
of unlabeled Arp2/3 (
). Buffer conditions, 50 mM KCl, 1 mM MgCl2, 1 mM EGTA, 10 mM imidazole, pH 7.0.
View larger version (51K):
[in a new window]
Fig. 3.
ActA and Scar1 contact three subunits of the
Arp2/3 complex. A, chemical cross-linking of
ActA-(121-170) to the Arp2/3 complex reveals interactions with the
p40, Arp2, and Arp3 subunits. We incubated 33.7 µM
ActA-(121-170) with 1.5 mM EDC and NHS in the absence and
presence of 1 µM Arp2/3 (conditions: buffer, 50 mM KCl, 1 mM MgSO4, 1 mM EGTA, 10 mM imidazole, pH 7; temperature,
24 °C; time, 45 min) and analyzed the results by immunoblot using an
anti-T7 antibody that recognizes the recombinant ActA. We found three
cross-links between ActA and Arp2/3 that ran at or just below the
50-kDa marker (left panel). We identified the Arp2/3
subunits involved by blotting with monospecific antibodies against
Arp2/3 subunits (right panel, cross-linked products marked
with an asterisk). B, hSCAR1WA also cross-links
to the p40, Arp2, and Arp3 subunits of the Arp2/3 complex. 40 µM hSCAR1WA was incubated with 1 µM of
Arp2/3 under the same conditions as described above, and the Western
blot was probed with an anti-His6 antibody that recognizes
the recombinant hSCAR1WA protein. Three cross-links were detected
between Arp2/3 and hSCAR1WA (left panel). These new bands
were identified as described in A.
View larger version (18K):
[in a new window]
Fig. 4.
N-WASP and profilin compete with ActA for
binding to Arp2/3. Actophorin, which also binds Arp2, fails to
compete. We mixed 4.8 µM Arp2/3 and 1 µM
rhodamine ActA-(30-120) with the indicated concentrations of
actophorin ( ), profilin (
), or N-WASP (
), and we measured the
polarization anisotropy of the labeled ActA. Displacement of ActA from
Arp2/3 results in a concentration-dependent decrease in
anisotropy. Solid lines are best fits to Equation 3 and
predict dissociation equilibrium constants of 3.4 ± 0.3 µM for profilin and 1.3 ± 0.3 µM for
N-WASP binding to Arp2/3 (conditions: buffer, 50 mM KCl, 1 mM MgSO4, 1 mM EGTA, 10 mM imidazole, pH 7; temperature, 24 °C).
View larger version (25K):
[in a new window]
Fig. 5.
Comparison of ActA activity with that of WASP
family proteins. A, ActA exhibits similar actin
polymerization kinetics to N-WASP VCA. Shown is a plot of the
polymerization half-time with respect to either N-WASP VCA ( ) or
ActA-(30-612) (
) concentrations. Inset shows comparison
of the maximal activities of ActA and N-WASP in the presence of 50 nM Arp2/3 and 2 µM actin.
, 100 nM ActA-(30-612);
, 100 nM N-WASP VCA;
,
5.7 µM ActA-(30-170);
, Arp2/3 alone (conditions:
amoeba actin was 15% pyrene-labeled; temperature, 24 °C; buffer
conditions, 50 mM KCl, 1 mM MgSO4,
1 mM EGTA, 10 mM imidazole, pH 7).
B, prepolymerized actin filaments decrease the lag time. 15 nM Arp2/3 and 2.4 µM actin were mixed with
Arp2/3 alone (
), 150 nM prepolymerized actin (
), 200 nM ActA-(120-612) (
), 200 nM
ActA-(120-612) (
), and 150 nM prepolymerized actin
(conditions: same as Fig. 4A).
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (29K):
[in a new window]
Fig. 6.
Location of the ActA-binding site on the
Arp2/3 complex and the Arp2 subunit. A,
nearest-neighbor model of the Arp2/3 complex showing the location of
the binding site for ActA and Scar. The model is based on chemical
cross-linking (open circles and dark lines) (32)
and two-hybrid analysis (ovals) (7). Subunits that
cross-link to ActA, N-WASP, and Scar1 are shaded. B, atomic
model of actin in the standard view (45) showing the regions
involved in binding profilin and actophorin. C, homology
model of Arp2 based on the crystal structure of conventional actin (20)
showing the ActA-binding site deduced from competition binding
experiments.
A yeast two-hybrid screen originally identified an interaction between the vertebrate p21arc subunit of the Arp2/3 complex and the Scar protein (7). We do not detect a direct interaction between p18 (the amoeba homolog of p21arc) and either ActA or hScar1, but our experiments do not rule it out. The p18-Scar-binding interface may not involve close proximity of amino and carboxyl groups required for chemical cross-linking by EDC. Regardless, p21arc does not appear to be required for Arp2/3 binding since Winter et al. (33, 34) found that a yeast Arp2/3 complex lacking p18 (yeast homolog of p21arc) and/or p40 can still bind Las17p/Bee1p (a yeast protein similar to N-WASP).
We propose that the essential interaction required for Arp2/3 activation is between the nucleation promoting factor and the actin-related protein Arp2 (Fig. 6). Three experiments argue for this. 1) We find that ActA, Scar, and N-WASP directly interact with Arp2. 2) Winter et al. (Winter, 1997) found that a yeast Arp2/3 complex lacking p40 coimmunoprecipitates with Las17p but that a complex lacking Arp2, p40, and p15 does not. 3) We previously showed that anti-Arp2 antibodies that do not affect the base-line nucleation or pointed end capping of purified Arp2/3 block its activation in cell extracts (44). We also detect direct interaction between ActA, Scar, N-WASP, and Arp3, but we can say less about the role of this interaction in nucleation. Our data are consistent with the two most likely models for Arp2/3 activation as follows: 1) nucleation promoting factor binding induces a reorganization of subunits and converts Arp2 and Arp3 into an actin-like nucleus (35), or 2) nucleation promoting factors deliver actin monomers to Arp2 or Arp3 (7).
Arp2 is an actin-related protein with 50% sequence identity to conventional actin. The surfaces of actin that interact with profilin and actophorin are conserved in Arp2 (20, 26) so the ability of profilin and the failure of actophorin to compete with ActA allow us to localize further the ActA-binding site on Arp2. The profilin-binding site includes parts of subdomains 1 and 3 of the actin monomer (19), a surface that is exposed at the barbed end of a filament. The binding site for actophorin is less well characterized but is known to overlap the profilin-binding site (36) and to involve subdomain 1 (37). Based on our data we propose that ActA and the WASP family proteins interact with a site on Arp2 analogous to subdomain 3 in conventional actin (Fig. 6, B and C). This location is satisfying for two additional reasons. 1) It places the nucleation promoting factors in an ideal position to stabilize the interaction between the "barbed" end of Arp2 and a conventional actin monomer or filament. 2) This surface of Arp2 is not well conserved in conventional actin and contains an inserted loop that may allow ligands to discriminate between Arp2 and conventional actin (20, 38).
Profilin has been shown to decrease the efficiency of Arp2/3-mediated nucleation (10, 11). The effect was assumed to be caused by the binding of actin, and it was argued that profilin:actin is a poor substrate for the nucleation machinery. This creates a problem in understanding actin nucleation in vivo because in intact cells almost all polymerizable, monomeric actin is bound to profilin (39). We demonstrate that profilin competes directly with nucleation promoting factors for binding Arp2/3, and this competition may explain the previously observed inhibitory effects of profilin on nucleation. The ability of the nucleation machinery to create nuclei out of profilin:actin must be reinvestigated.
A similar study of ActA was published while this manuscript was under review. Based on analysis of deletion mutants, Skoble et al. (40) argue that actin binding is not essential for ActA activity in vivo and that perhaps the combination of VASP and profilin can deliver actin monomers to the Arp2/3 complex. We disfavor this model for two reasons. 1) The authors failed to remove the actin-binding site between amino acids 121 and 138 and so never directly tested an ActA molecule with no actin-binding sites in their motility assays. 2) Although VASP is known to enhance Listeria motility, this effect has been shown to be independent of its ability to bind profilin (41).
We do not understand the physiological significance of the interaction between profilin and Arp2/3. We estimated previously that in vivo a significant fraction of Arp2/3 is bound to profilin (26). The fact that profilin inhibits binding of nucleation promoting factors suggests that it may play a role in regulation of Arp2/3 activity.
During Listeria motility ActA remains attached to the
surface of the bacterium (4), whereas Arp2/3 remains attached to the
actin network (15). So for efficient motility ActA must dissociate
rapidly from Arp2/3 after a new filament is formed. To avoid retarding
bacterial motility, we estimate that the Arp2/3 must dissociate from
ActA before the bacterium has moved 25 nm (or approximately ~10
monomers). We measure an affinity of 0.6 µM for
Arp2/3-binding ActA. A diffusion-limited association rate constant of
10 µM1
s
1 predicts an upper limit for the
dissociation rate constant of 6 s
1 and a
lower limit of 0.13 s for the half-time of dissociation. The
cytoplasmic concentration of polymerizable actin is ~100
µM (42), and the rate constant for filament elongation at
the bacterial surface is between 3 and 10 µM
1
s
1 (31, 43) so filaments associated with the
bacterium should elongate at a rate of 300-1000 monomers/s. Thus the
bacterium will move by more than 75 nm (30-100 actin monomers) by the
time half the ActA has dissociated from Arp2/3. Thus we speculate that the in vivo rate of Arp2/3 dissociation is significantly
faster than the rate in vitro. Perhaps some step in the
nucleation reaction decreases the affinity of Arp2/3 for ActA.
![]() |
ACKNOWLEDGEMENTS |
---|
We are grateful to A. K. Benson for the generous gift of ActA genomic DNA; to C. Adler and C. Carroll who performed preliminary experiments; to L. Lempert and L. Haines for valuable technical assistance; to E. A. Holleran, M. Dayel, K. DeFea, J. Iwasa, J. Barry, and A. Kelley for helpful discussions and critical reading of the manuscript; and finally to M. R. Nuttie and L. Oko for inspiration and comic relief.
![]() |
FOOTNOTES |
---|
* This work was supported by Howard Hughes Medical Institute Research Resources Program Grant 76296-549901 and National Institutes of Health Grant GM61010-01 (to R. D. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Cellular and
Molecular Pharmacology, University of California School of Medicine,
513 Parnassus Ave., San Francisco, CA 94129. Tel.: 415-502-4838; Fax:
415-476-5233; E-mail: dyche@mullinslab.ucsf.edu.
Published, JBC Papers in Press, October 11, 2000, DOI 10.1074/jbc.M006407200
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: WH2, WASP homology 2; DTT, dithiothreitol; EDC, 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride; NHS, N-hydroxysuccinimide.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1. |
Lechler, T.,
Shevchenko, A.,
and Li, R.
(2000)
J. Cell Biol.
148,
363-373 |
2. |
Evangelista, M.,
Klebl, B. M.,
Tong, A. H.,
Webb, B. A.,
Leeuw, T.,
Leberer, E.,
Whiteway, M.,
Thomas, D. Y.,
and Boone, C.
(2000)
J. Cell Biol.
148,
353-362 |
3. | Otto, I. M., Raabe, T., Rennefahrt, U. E., Bork, P., Rapp, U. R., and Kerkhoff, E. (2000) Curr. Biol. 10, 345-348[CrossRef][Medline] [Order article via Infotrieve] |
4. | Kocks, C., Gouin, E., Tabouret, M., Berche, P., Ohayon, H., and Cossart, P. (1992) Cell 68, 521-531[Medline] [Order article via Infotrieve] |
5. | Smith, G. A., Portnoy, D. A., and Theriot, J. A. (1995) Mol. Microbiol. 17, 945-951[Medline] [Order article via Infotrieve] |
6. |
Welch, M. D.,
Rosenblatt, J.,
Skoble, J.,
Portnoy, D. A.,
and Mitchison, T. J.
(1998)
Science
281,
105-108 |
7. | Machesky, L. M., and Insall, R. H. (1998) Curr. Biol. 8, 1347-1356[Medline] [Order article via Infotrieve] |
8. | Miki, H., Miura, K., and Takenawa, T. (1996) EMBO J. 15, 5326-5335[Abstract] |
9. | Symons, M., Derry, J. M., Karlak, B., Jiang, S., Lemahieu, V., McCormick, F., Francke, U., and Abo, A. (1996) Cell 84, 723-734[Medline] [Order article via Infotrieve] |
10. |
Machesky, L. M.,
Mullins, R. D.,
Higgs, H. N.,
Kaiser, D. A.,
Blanchoin, L.,
May, R. C.,
Hall, M. E.,
and Pollard, T. D.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
3739-3744 |
11. | Higgs, H. N., Blanchoin, L., and Pollard, T. D. (1999) Biochemistry 38, 15212-15222[CrossRef][Medline] [Order article via Infotrieve] |
12. | Kelleher, J. F., Mullins, R. D., and Pollard, T. D. (1998) Methods Enzymol. 298, 42-51[CrossRef][Medline] [Order article via Infotrieve] |
13. |
Spudich, J. A.,
and Watt, S.
(1971)
J. Biol. Chem.
246,
4866-4871 |
14. | MacLean-Fletcher, S., and Pollard, T. D. (1980) Cell 20, 329-341[Medline] [Order article via Infotrieve] |
15. |
Mullins, R. D.,
Heuser, J. A.,
and Pollard, T. D.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
6181-6186 |
16. | Bryan, J., and Coluccio, L. M. (1985) J. Cell Biol. 101, 1236-1244[Abstract] |
17. | Cooper, J. A., Walker, S. B., and Pollard, T. D. (1983) J. Muscle Res. Cell Motil. 4, 253-262[Medline] [Order article via Infotrieve] |
18. | Vinson, V. K., De La Cruz, E. M., Higgs, H. N., and Pollard, T. D. (1998) Biochemistry 37, 10871-10880[CrossRef][Medline] [Order article via Infotrieve] |
19. | Schutt, C., Myslik, J. C., Rozychi, M. D., Goonesekere, N. C. W., and Lindberg, U. (1993) Nature 365, 810-816[CrossRef][Medline] [Order article via Infotrieve] |
20. | Kelleher, J. F., Atkinson, S. J., and Pollard, T. D. (1995) J. Cell Biol. 131, 385-397[Abstract] |
21. | Kraulis, P. K. (1991) J. Appl. Crystallogr. 24, 946-950[CrossRef] |
22. | Merritt, E., and Murphy, M. (1994) Acta Crystallogr. Sect. D Biol. Crystallogr. 50, 869-873[CrossRef][Medline] [Order article via Infotrieve] |
23. |
Laurent, V.,
Loisel, T. P.,
Harbeck, B.,
Wehman, A.,
Grobe, L.,
Jockusch, B. M.,
Wehland, J.,
Gertler, F. B.,
and Carlier, M. F.
(1999)
J. Cell Biol.
144,
1245-1258 |
24. |
Cicchetti, G.,
Maurer, P.,
Wagener, P.,
and Kocks, C.
(1999)
J. Biol. Chem.
274,
33616-33626 |
25. |
Lasa, I.,
Gouin, E.,
Goethals, M.,
Vancompernolle, K.,
David, V.,
Vandekerckhove, J.,
and Cossart, P.
(1997)
EMBO J.
16,
1531-1540 |
26. |
Mullins, R. D.,
Kelleher, J. F.,
Xu, J.,
and Pollard, T. D.
(1998)
Mol. Biol. Cell
9,
841-852 |
27. | Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T., and Kirschner, M. W. (1999) Cell 97, 221-231[Medline] [Order article via Infotrieve] |
28. | Yarar, D., To, W., Abo, A., and Welch, M. D. (1999) Curr. Biol. 20, 555-558[CrossRef] |
29. | Blanchoin, L., Amann, K. J., Higgs, H. N., Marchand, J. B., Kaiser, D. A., and Pollard, T. D. (2000) Nature 404, 1007-1011[CrossRef][Medline] [Order article via Infotrieve] |
30. | Theriot, J. A., Rosenblatt, J., Portnoy, D. A., Goldschmidt-Clermont, P. J., and Mitchison, T. J. (1994) Cell 76, 505-517[Medline] [Order article via Infotrieve] |
31. | van Oudenaarden, A., and Theriot, J. A. (1999) Nat. Cell Biol. 1, 493-499[CrossRef][Medline] [Order article via Infotrieve] |
32. |
Mullins, R. D.,
Stafford, W. F.,
and Pollard, T. D.
(1997)
J. Cell Biol.
136,
331-343 |
33. | Winter, D., Lechler, T., and Li, R. (1999) Curr. Biol. 9, 501-504[CrossRef][Medline] [Order article via Infotrieve] |
34. |
Winter, D. C.,
Choe, E. Y.,
and Li, R.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
7288-7293 |
35. | Mullins, R. D., and Pollard, T. D. (1999) Curr. Opin. Struct. Biol. 9, 244-249[CrossRef][Medline] [Order article via Infotrieve] |
36. |
Blanchoin, L.,
and Pollard, T. D.
(1998)
J. Biol. Chem.
273,
25106-25111 |
37. | Giuliano, K. A., Khatib, F. A., Hayden, S. M., Daoud, E. W. R., Adams, M. E., Amorese, D. A., Bernstein, B. W., and Bamburg, J. R. (1988) Biochemistry 27, 8931-8938[Medline] [Order article via Infotrieve] |
38. | Mullins, R. D., Kelleher, J. F., and Pollard, T. D. (1996) Trends Cell Biol. 6, 208-212[CrossRef] |
39. |
Kaiser, D.,
Vinson, V.,
Murphy, D.,
and Pollard, T.
(1999)
J. Cell Sci.
112,
3779-3790 |
40. |
Skoble, J.,
Portnoy, D.,
and Welch, M.
(2000)
J. Cell Biol.
150,
527-538 |
41. | Loisel, T. P., Boujemaa, R., Pantaloni, D., and Carlier, M. F. (1999) Nature 401, 613-616[CrossRef][Medline] [Order article via Infotrieve] |
42. | Gordon, D. J., Eisenberg, E., and Korn, E. D. (1976) J. Biol. Chem. 251, 4778-4786[Abstract] |
43. | Pollard, T. D. (1986) J. Cell Biol. 103, 2747-2754[Abstract] |
44. | Mullins, R. D., and Pollard, T. D. (1999) Curr. Biol. 9, 405-415[CrossRef][Medline] [Order article via Infotrieve] |
45. | Kabsch, W., Mannherz, H. G., Suck, D., Pai, E. F., and Holmes, K. C. (1990) Nature 347, 37-44[CrossRef][Medline] [Order article via Infotrieve] |