From the Institute of Biological Chemistry,
Washington State University, Pullman, Washington 99164-6340 and
the § Faculty of Agriculture, Kagawa University,
Kagawa 761-07, Japan
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Although the heartwood of woody plants represents
the main source of fiber and solid wood products, essentially nothing
is known about how the biological processes leading to its formation are initiated and regulated. Accordingly, a reverse
transcription-polymerase chain reaction-guided cloning strategy was
employed to obtain genes encoding pinoresinol-lariciresinol reductases
from western red cedar (Thuja plicata) as a means to
initiate the study of its heartwood formation.
(+)-Pinoresinol-(+)-lariciresinol reductase from Forsythia
intermedia was used as a template for primer construction for
reverse transcription-polymerase chain reaction amplifications, which,
when followed by homologous hybridization cloning, resulted in the
isolation of two distinct classes of putative pinoresinol-lariciresinol reductase cDNA clones from western red cedar. A representative of
each class was expressed as a fusion protein with Western red cedar (Thuja plicata) lignans, such as
plicatic acid 1 (Fig. 1),
are deposited in large amount (>20% by dry weight) during its
heartwood formation, thereby helping confer protection against invading
pathogens (1) and contributing significantly to the color, quality, and
durability of its highly valued heartwood. Other lignans, such as
secoisolariciresinol 2 and matairesinol 3, which
are present in certain dietary components (e.g. flax
(Linum usitatissimum) seed), are thought to substantially
reduce the risk in humans of the onset of breast, prostate, and other
hormonally linked cancers, as suggested by epidemiological and
tumor-induction suppression studies (2-4). This so-called
chemoprotection occurs through their metabolism by intestinal flora
into the compounds enterodiol and enterolactone, respectively, both of
which act as phytoestrogens, thereby helping to regulate the hormonal
balance in the body. Additionally, the secoisolariciresinol
2 and matairesinol 3-derived lignan (5),
podophyllotoxin 4 (as its etoposide or teniposide derivatives) from Podophyllum species, is one of only five
or so plant-derived substances used in cancer treatment today (6-8). As shown in Fig. 1, it is proposed that these distinct plant
metabolites are biochemically interrelated.
-galactosidase and
assayed for enzymatic activity. Using both deuterated and radiolabeled
(±)-pinoresinols as substrates, it was established that each
class of cDNA encoded a pinoresinol-lariciresinol reductase of different (opposite) enantiospecificity. Significantly, the protein
from one class converted (+)-pinoresinol into
(-)-secoisolariciresinol, whereas the other utilized the opposite
(-)-enantiomer to give the corresponding (+)-form. This differential
substrate specificity raises important questions about the role of
each of these individual reductases in heartwood formation, such
as whether they are expressed in different cells/tissues or at
different stages during heartwood development.
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results & Discussion
References
View larger version (28K):
[in a new window]
Fig. 1.
Proposed biosynthetic pathways to plicatic
acid 1, a major component of western red cedar (T. plicata) heartwood, the anticancer lignan
podophyllotoxin 4 in Podophyllum peltatum, and
the heartwood metabolite -conidendrin 8 in western hemlock
(Tsuga heterophylla).
The entry point into each of the above 8,8'-linked lignans, a branch of the general phenylpropanoid pathway, occurs via stereoselective coupling of two molecules of E-coniferyl alcohol 5 to give pinoresinol 6 (9, 10).1 In Forsythia sp., an ~78-kDa protein confers the regio- and stereoselectivity of coupling to give only the (+)-enantiomeric form. This first case of control of bimolecular phenoxy radical coupling is considered to involve a unique biochemical mechanism of radical capture (9), and the term "dirigent protein" was introduced to describe this phenomenon. The corresponding gene encoding the protein has been cloned, and the functional recombinant protein was obtained using a Spodoptera/baculovirus expression system.1 Additionally, several cDNAs in western red cedar that are homologous to the dirigent protein (11) have been identified. The regio- and enantioselective control of coupling conferred by these homologous proteins, as well as their temporal and tissue-specific expression, are under current investigation.
In Forsythia intermedia, (+)-pinoresinol 6a can undergo enantiospecific reduction to first give (+)-lariciresinol 7a and then (-)-secoisolariciresinol 2a (see Fig. 2A). This reductive sequence is catalyzed by the enantiospecific, bifunctional, NADPH-dependent (+)-pinoresinol-(+)-lariciresinol reductase (PLR-Fi1)2 (12), which has considerable homology (~ 50% identity, ~65% similarity) to isoflavone reductases (Ref. 13 and see under "Results and Discussion," below) involved in isoflavonoid phytoalexin formation. (-)-Matairesinol 3a biosynthesis then occurs via enantiospecific NADP+-dependent dehydrogenation of (-)-secoisolariciresinol 2a (14).
|
Interestingly, other species can contain the opposite enantiomeric forms of these lignans (e.g. (+)-secoisolariciresinol 2b (~99% enantiomeric excess) in flax seed), suggesting that their formation is determined by genes encoding (-)-pinoresinol dirigent proteins and (-)-pinoresinol-(-)-lariciresinol reductases. As an additional complexity, some other species, such as Wikstroemia sikokiana, have been proposed to contain pinoresinol-lariciresinol reductases, which may not be fully enantioselective, based on assays using crude cell-free extracts rather than purified proteins (15). An alternative explanation, however, is that both (+)- and (-)-pinoresinol-lariciresinol reductases are present in such plants, with each being expressed in differing amounts and tissues.
The deposition of the lignans plicatic acid 1 and its congeners occurs during western red cedar heartwood formation; this formation is proposed to result from the metabolism of secoisolariciresinol 2 and matairesinol 3 as shown (Fig. 1) (1). It has been hypothesized that these metabolites are formed in the transition zone between the living sapwood and the dead heartwood, being deposited into the pre-lignified tissue from the neighboring ray cells via an infusion process (see Ref. 1 and references therein). This process of metabolite deposition, therefore, leads to what is known as heartwood, which constitutes some 80-90% of all woody stem tissues. Despite the tremendous importance of this process of metabolite deposition to heartwood formation and its importance to industries that use heartwood as their main resource, particularly the finished wood products and pulp/paper industries, no enzymes or genes have yet been identified that are involved. This can be partly explained by the difficulties in working with heartwoods, especially in extracting proteins from their tissues that are high in phenolic materials. The goal of this study, therefore, was to establish whether the genes encoding pinoresinol-lariciresinol reductase(s) were present in T. plicata stem tissue, as a first step toward gaining insight into the biochemical processes accompanying heartwood (lignan) formation.
We report herein the identification of two classes of
pinoresinol-lariciresinol reductases from T. plicata: the
first type reduces (+)-pinoresinol 6a to give
(-)-secoisolariciresinol 2a (Fig. 2A), whereas
the second reduces (-)-pinoresinol 6b to produce
(+)-secoisolariciresinol 2b (Fig. 2B). As
discussed below, the identification of these two classes of proteins
from its stem tissue further illustrates the inherent biochemical
complexity involved in control of phenolic coupling and metabolism in
higher plants.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plant Materials-- Western red cedar (T. plicata) trees were maintained in Washington State University greenhouse facilities.
Materials--
All solvents and chemicals used were reagent or
HPLC grade. Taq thermostable DNA polymerase and restriction
enzymes (SacI and XbaI) were obtained from
Promega. pT7Blue T-vector and competent NovaBlue cells were purchased
from Novagen and radiolabeled nucleotide ([-32P]dCTP)
was from NEN Life Science Products. Oligonucleotide primers for
polymerase chain reaction (PCR) and sequencing were synthesized by Life
Technologies, Inc. Geneclean II® kits (Bio 101, Inc.) were
used for purification of PCR fragments, with the gel-purified DNA
concentrations determined by comparison to a low DNA mass ladder (Life
Technologies, Inc.) in 1.3% agarose gels.
Sequence Analysis-- DNA and amino acid sequence analyses were performed using the Unix-based GCG Wisconsin Package (16, 17) and the ExPASy World Wide Web molecular biology server (Geneva University Hospital and University of Geneva, Geneva, Switzerland).
Instrumentation--
Ultraviolet spectra (including RNA and DNA
determinations at 260 nm) were recorded on a Lambda 6 UV/VIS
spectrophotometer (Perkin-Elmer). A Temptronic II thermocycler
(Thermolyne) was used for all PCR amplifications. Purification of
plasmid DNA for sequencing employed a QIAwell Plus plasmid purification
system (Qiagen) followed by polyethylene glycol precipitation (18) or
Wizard® Plus SV Minipreps DNA Purification System
(Promega), with DNA sequences determined using an Applied Biosystems
model 373A automated sequencer. High performance liquid chromatography
was carried out as described previously (12). Briefly, reversed-phase
column chromatography employed a Nova-pak C18 column (3.5 mm × 150 mm) (Waters) with an isocratic solvent system consisting
of methanol:3% acetic acid in H2O (3:7) at a flow rate of
0.4 ml min1. Separations of (+)- and
(-)-secoisolariciresinols 2a and 2b, and (+)-
and (-)-pinoresinols 6a and 6b were achieved
using a Chiralcel OD column (4.6 mm × 250 mm; Chiral Technology)
eluted with ethanol/hexanes 3:7 (flow rate, 0.5 ml min
1)
and 1:1 (flow rate, 0.8 ml min
1), respectively.
Separations of (+)- and (-)-lariciresinols 7a and
7b were achieved using a Chiralcel OC column (4.6 mm × 250 mm) (Chiral Technology) eluted with ethanol/hexanes 4:1 (flow rate,
0.5 ml min
1). Liquid chromatography-mass spectrometry was
carried out on a Waters Integrity system.
T. plicata cDNA Library Synthesis-- Total RNA (6.7 µg/g fresh weight) was obtained from young green stems (with leaves attached) of a single greenhouse-grown western red cedar tree (T. plicata) according to the method of Lewinsohn et al. (19). An initial T. plicata cDNA library (library A) was constructed using 3 µg of purified poly(A)+ mRNA (Oligotex-dTTM Suspension, Qiagen) with the ZAP-cDNA® synthesis kit, the Uni ZAPTM XR vector, and the Gigapack® II Gold packaging extract (Stratagene), with a titer of 1.2 × 105 pfu for the primary library. The amplified library (7.1 × 108 pfu/ml; 28 ml total) was used for initial screening (12). A second T. plicata cDNA library with a much higher titer (8.8 × 105 pfu for the primary library; 1.34 × 1011 pfu/ml, 180 ml total, for the amplified library) was later constructed (library B) and screened in the same manner as library A to obtain the full-length clones, as described below.
Pinoresinol-Lariciresinol Reductase DNA Probe Synthesis--
The
F. intermedia (+)-pinoresinol-(+)-lariciresinol reductase
cDNA (12) was used to synthesize a probe for screening T. plicata cDNA library A. Purified plasmid (10 ng) containing
cDNA of F. intermedia (+)-pinoresinol-(+)-lariciresinol
reductase was used as the template in 100-µl PCR reactions (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.1% Triton
X-100, 2.5 mM MgCl2, 0.1 mM each dNTP, and 1.25 units of Taq DNA polymerase) with the
N-terminal primer PLRN5 (100 pmol) and the internal primer PLRI5R (20 pmol) as described previously (12). PCRs were carried out in a
thermocycler as follows: 35 cycles of 1 min at 94 °C, 2 min at
42 °C, and 3 min at 72 °C, with 5 min at 72 °C and an
indefinite hold at 4 °C after the final cycle. PCR products were
resolved in a preparative 1.3% agarose gel where a DNA band
corresponding to ~400 base pairs (called PLRN5-PLRI5R) was isolated.
The gel-purified PLRN5-PLRI5R fragment (50 ng) was used with the
Amersham Pharmacia Biotech T7 Quick Prime® kit and 5 µl
(50 µCi) [-32P]dCTP (3000 Ci·mmol
1),
according to kit instructions, to produce a radiolabeled probe (in 50 µl), which was purified over BioSpin 6 columns (Bio-Rad) and added to
carrier DNA (0.5 mg/ml sheared salmon sperm DNA (Sigma), 0.85 ml).
Library Screening--
150,000 pfu of T. plicata
cDNA library A were plated for primary screening, as described
previously (12). Plaques were blotted onto Magna Nylon membrane circles
(Micron Separations Inc.), which were then allowed to air dry. The
membranes were placed between two layers of Whatman® 3MM
Chr paper. cDNA library phage DNA was fixed to the membranes and
denatured in one step by autoclaving for 4 min at 100 °C with fast
exhaust. The membranes were washed for 30 min with gentle shaking at
37 °C in 6× standard saline citrate and 0.1% SDS and prehybridized
for 5 h with gentle shaking at 57 °C in preheated 6× standard
saline citrate, 0.5% SDS, and 5× Denhardt's reagent (hybridization
solution, 220 ml) in a crystallization dish (190 × 75 mm). The
32P-radiolabeled probe (see above) was denatured (98 °C
for 10 min), quickly cooled (on ice for 15 min), and added to a
preheated fresh hybridization solution (50 ml at 57 °C) in a
crystallization dish (150 × 75 mm). The prehybridized membranes
were next added to this dish, which was then covered with plastic wrap.
Hybridization was performed for 17 h at 57 °C with gentle
shaking. The membranes were washed in 4× standard saline citrate and
0.5% SDS (250 ml) for 5 min at room temperature, transferred to
preheated 2× standard saline citrate and 0.5% SDS (250 ml), and
incubated at 57 °C for 20 min with gentle shaking. After the
membranes were removed from the dish and wrapped with plastic wrap to
prevent drying, they were finally exposed to Kodak X-OMAT AR film for
24 h at 80 °C between intensifying screens. Ten positive
plaques were purified through two more rounds of screening with
hybridization conditions as above.
In Vivo Excision and Sequencing of Screened Phagemids-- Ten purified cDNA clones were rescued from the phage following Stratagene's in vivo excision protocol. The cDNAs rescued in pBluescript SK(-) were sequenced using overlapping sequencing primers.
T. plicata Pinoresinol-Lariciresinol Reductase cDNA Synthesis via RT-PCR-- Full-length T. plicata pinoresinol-lariciresinol reductase cDNA was obtained from T. plicata mRNA by a reverse transcription-polymerase chain reaction (RT-PCR) strategy. Briefly, first-strand DNA was synthesized from the purified mRNA previously used for the synthesis of T. plicata cDNA library. Purified mRNA (150 ng) was mixed with linker-primer (1.4 µg) from ZAP-cDNA® synthesis kit (Stratagene), heated to 70 °C for 10 min, and quickly chilled on ice. The mixture of denatured mRNA template and linker-primer was then mixed with First Strand Buffer (Life Technologies), 10 mM dithiothreitol, 0.5 mM each dNTP, and 200 units of SuperScriptTM II (Life Technologies) in a final volume of 20 µl. The reaction was carried out at 42 °C for 50 min and then stopped by heating (70 °C, 15 min). Escherichia coli RNase H (1.5 units, 1 µl) was added to the solution and incubated at 37 °C for 20 min. The first-strand reaction (2 µl) was next used as the template in 100-µl PCR reactions (10 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.1% Triton X-100, 1.5 mM MgCl2, 0.2 mM each dNTP, and 5 units of Taq DNA polymerase) with primer CR6-NT (5'GCACATAAGAGTATGGATAAG3') (10 pmol) and primer XhoI-poly(dT) (5'GTCTCGAGTTTTTTTTTTTTTTTTTT3') (10 pmol). The sequence of primer CR6-NT was based on the 5'-end of the truncated cDNAs obtained in the first round of screening (see above). PCR amplification was carried out in a thermocycler as described previously (12) except for the annealing temperature at 52 °C. PCR products were resolved in 1.3% agarose gels, where at least two bands possessing the expected length (about 1200 base pairs) were observed. The bands were extracted from the gel. The gel-purified PCR products (56 ng) were then ligated into the pT7Blue T-vector (50 ng) and transformed into competent NovaBlue cells, according to Novagen's instructions. The size and orientation of the inserted cDNA were determined using the rapid boiling lysis and PCR technique (with the following primer combinations: R20-mer + U19-mer, R20-mer + CR6-NT, and U19-mer + CR6-NT primers) according to Novagen's instructions. The CR6-NT primer site of the inserted DNAs was located on the side of U19-mer primer site of the T-vector. The T-vectors containing the inserted cDNAs were purified with Wizard® Plus SV Minipreps DNA purification system, and the inserted cDNAs were completely sequenced using overlapping sequencing primers, revealing five individual cDNA inserts that were identical except for different sites of polyadenylation. The longest cDNA, called PLR-Tp1, was used to screen, as described above, 300,000 pfu of T. plicata cDNA library B. 19 cDNAs were isolated and completely sequenced. See under "Results and Discussion" for a description of these cDNA clones.
Expression in E. coli--
The open reading frame of one of the
clones encoding PLR-Tp2 was found to be in frame with the
-galactosidase gene
-complementation particle in pBluescript
SK(-), allowing for expression of the pinoresinol-lariciresinol
reductase as a fusion protein (12). In order for the open reading frame
of PLR-Tp1 to be in frame with the
-galactosidase gene
-complementation particle, PLR-Tp1 was excised from the pT7Blue
T-vector with SacI and XbaI, gel-purified, and
then ligated into pBluescript SK(-) digested with these same enzymes.
These two plasmids, pBSPLR-Tp2 and pBSPLR-Tp1, were each transformed
into NovaBlue cells according to Novagen's instructions. The
transformed cells for each clone (5-ml cultures) were grown at 37 °C
in LB medium supplemented with 50 µg ml
1 carbenicillin
with shaking (225 rpm) to mid-log phase (A600 = 0.5-0.7). The cells were next collected by centrifugation (1000 × g for 10 min) and resuspended to an absorbance of 0.6 (at
600 nm) in fresh LB medium supplemented with 10 mM
isopropyl-
-D-thiogalactopyranoside and 50 µg
ml
1 carbenicillin. The cells were allowed to grow
overnight at 37 °C and then were collected by centrifugation and
resuspended in 500-700 µl (per 5-ml culture tube) of buffer (50 mM Tris-HCl, pH 7.5, 2 mM EDTA, and 5 mM dithiothreitol). Next, the cells were lysed by
sonication (five periods of 45 s each). After centrifugation (17,500 × g at 4 °C for 10 min) to pellet cellular
debris, the supernatant for each clone was removed and assayed for
pinoresinol-lariciresinol reductase activity as described below.
Pinoresinol-Lariciresinol Reductase Enzyme Assay
Controls--
Both positive and negative assay controls were performed
in assays containing equivalent protein amounts from cell-free extracts from induced E. coli cells containing either the parental
plasmid (pBluescript SK(-)) without insert DNA (negative control),
where no conversion of (±)-pinoresinols was observed with assays
incubated for as long as 24 h, or containing the plasmid
pBSPLR-Fi1, where the cDNA of authentic F. intermedia
(+)-pinoresinol-(+)-lariciresinol reductase was in frame with the
-galactosidase gene
-complementation particle in pBluescript
SK(-) (positive control).
14C-Labeled Enzyme
Assays--
Pinoresinol-lariciresinol reductase activity was assayed
by monitoring the formation of (+)-7a and (-)-7b
[3,3'-O14CH3]lariciresinols and
(-)-2a and (+)-2b
[3,3'-O14CH3]secoisolariciresinols (12,
20). Briefly, each of triplicate assays consisted of
(±)-[3,3'-O14CH3]pinoresinols
6a/6b (21) (5 mM in methanol, 33 MBq·mmol1, 20 µl) and the enzyme preparation
(i.e. total soluble protein extract from E. coli,
210 µl). The enzymatic reaction was initiated by addition of NADPH
(10 mM, in deionized and distilled H2O, 20 µl). Incubations were carried out at 30 °C with shaking for
several different times (0, 10, 20, 30, 40, 50, 60, 120, 180, and 240 min), after which the assay mixture was extracted with ethyl acetate (500 µl) containing (±)-lariciresinols 7a/7b
(20 µg) and (±)-secoisolariciresinols 2a/2b
(20 µg) as radiochemical carriers. After centrifugation (13,800 × g for 5 min), the ethyl acetate solubles were removed and
the extraction procedure was repeated, but without addition of
radiochemical carriers. For each assay, the ethyl acetate solubles were
combined with an aliquot (100 µl) removed for determination of its
radioactivity using liquid scintillation counting. The remainder of the
combined ethyl acetate solubles was evaporated to dryness in
vacuo, reconstituted in methanol/H2O (3:7, 100 µl)
and subjected to reversed-phase and chiral column HPLC. Fractions were
collected from the chiral column HPLC separation and analyzed for
radioactivity by scintillation counting.
Assays with (±)-[9,9'-2H2,
OC2H3]Pinoresinols 6a/6b--
Assays
were conducted as described above but using
(±)-[9,9'-2H2,
OC2H3]pinoresinols
6a/6b as substrates and NADPH as cofactor. After
incubation at 30 °C for 24 h, the assay mixture was extracted
with ethyl acetate (2 × 500 µl). The ethyl acetate solubles
were combined, evaporated to dryness, reconstituted in methanol/H2O (1:1, 100 µl), and subjected to
reversed-phase HPLC. Fractions corresponding to secoisolariciresinol
2 and pinoresinol 6 were individually collected,
freeze-dried, redissolved in methanol (100 µl), and subjected to
chiral column analysis with detection at 280 nm and mass spectral
analysis in the electrostatic ionization mode (Integrity System,
Waters, Inc.).
![]() |
RESULTS AND DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Formation of western red cedar (T. plicata) heartwood occurs through the massive deposition of the lignans plicatic acid 1 and its higher molecular weight congeners into pre-lignified sapwood. Surprisingly, little is known about what induces and ultimately forms both developed heartwood and its forerunner, lignified secondary xylem, in woody plants. This is a curious fact given not only its general biological significance, but also its importance to lumber and pulp/paper operations, which essentially only use secondary xylem containing 80-90% heartwood.
From a phenomenological perspective, heartwood formation is initiated in the stem pith, and once initiated continues to expand in diameter across the pre-lignified zone as the plant ages. Depending on the species involved, its formation involves deposition of various metabolites (lignans, flavonoids, tannins, and other substances) into pre-lignified secondary xylem, and these can often account for >20% of the dry weight of the tissue (22-30). The composition and amounts of these metabolites can vary from plant to plant, and these determine, to a large extent, the properties of the different woods encountered in the plant kingdom.
The general process of metabolite deposition leading to heartwood
appears to be well conserved in the plant kingdom and was first
described almost 50 years ago by Chattaway (31, 32) and then further
demonstrated years later by H. Hergert (33-35). As heartwood formation
progresses, it is accompanied by the death of neighboring axial and ray
parenchyma cells, where a small transition or intermediate zone (1 cm
thick) is formed, separating the heartwood from the sapwood. This zone
is suspected to be involved in the biosynthesis of heartwood
metabolites, such as the lignans in western red cedar. Interestingly,
presumed peroxidase activity levels are also highest in this zone,
suggesting that specific oxidative transformations occur there prior to
heartwood metabolite deposition (see Ref. 1 and references therein).
Although the transition zone is putatively involved in heartwood deposition/forming processes, very little is understood about the specific metabolic events that take place there, i.e. at either the gene (transcriptional) or enzyme level (1). One of our overall goals is, therefore, to establish the temporally and spatially controlled biochemical and molecular processes involved in heartwood formation, using lignan biosynthesis in western red cedar (T. plicata) as a means to achieve this objective.
Cloning and Characterization of Pinoresinol-Lariciresinol Reductases from Western Red Cedar-- As summarized above, several genes from western red cedar woody stem tissue were identified (11) that have very significant homology (~85% similarity and ~75% identity) to the dirigent protein from F. intermedia responsible for (+)-pinoresinol 6a formation in that species. These western red cedar dirigent protein genes are of interest because one or more must be associated with the initiation of its heartwood lignan formation. Moreover, based on the chemical structure of its heartwood lignans (e.g. plicatic acid 1, see Fig. 1), a second proposed step of the biosynthetic pathway utilizing pinoresinol-lariciresinol reductase, was rationalized as being involved in its formation. To investigate this possibility, messenger RNA (mRNA) was first isolated from western red cedar stems and used to construct a cDNA library (library A). Using the F. intermedia (+)-pinoresinol-(+)-lariciresinol reductase cDNA as a probe, 10 cDNAs were isolated. Three of the 10 were identical, but encoded only the first half (5'-end) of the putative pinoresinol-lariciresinol reductase sequence, including the complete N-terminal sequence, as determined by comparison to the F. intermedia (+)-pinoresinol-(+)-lariciresinol reductase cDNA; the second half of these same cDNA sequences were replaced by unknown sequences, apparently by some recombination event in cDNA library construction. The seven other clones encoded cDNAs homologous to other genes. Thus, although this strategy was unsuccessful in producing a full-length clone, it provided the 5'-end sequence of a putative T. plicata pinoresinol-lariciresinol reductase. This sequence was used to construct a new gene-specific primer (CR6-NT, 5'GCACATAAGAGTATGGATAAG3', see under "Experimental Procedures"), which could then be used in an alternative approach to obtain a full-length cDNA.
A full-length T. plicata pinoresinol-lariciresinol reductase cDNA (PLR-Tp1) was obtained from mRNA by an RT-PCR strategy (18, 36). Briefly, first strand cDNA synthesis utilized reverse transcriptase and the linker-primer from the ZAP-cDNA® synthesis kit (see under "Experimental Procedures"). PCR was subsequently performed for 35 cycles (see under "Experimental Procedures") using two additional primers: XhoI-poly(dT), for hybridization to the poly(A) tail of the mRNAs, and CR6-NT, synthesized based on the 5'-end of the partial cDNA clones obtained (as fusions to other genes) from the first T. plicata cDNA library (see under "Experimental Procedures"). The PCR products were then ligated into a T-vector and sequenced completely on both strands. Five cDNAs were identified from these PCR products, but they only differed in position of polyadenlyation initiation sites, having otherwise identical sequences. All contained open reading frames beginning with methionine, corresponding to 313 amino acid residues, and showing significant homology (see below) to the previously reported pinoresinol-lariciresinol reductase cDNA isolated from F. intermedia (312 amino acid residues in length). The longest of these, PLR-Tp1, was then used to screen a second, higher titer T. plicata cDNA library (see under "Experimental Procedures"). From this second library, 19 cDNAs were isolated that showed homology to the F. intermedia (+)-pinoresinol-(+)-lariciresinol reductase. Sequence comparisons revealed that the cDNAs fit into two classes: the first class included six cDNAs, five of which were identical to each other (PLR-Tp2) and one of which was unique (PLR-Tp4); the second class included 13 cDNAs, 11 of which were identical to PLR-Tp1, and 2 of which were identical to each other (PLR-Tp3). These two classes of T. plicata reductases are defined by the high levels of homology between the members of each: PLR-Tp3 is 80% identical and 86% similar to PLR-Tp1, whereas PLR-Tp4 is 94% identical and 97% similar to PLR-Tp2 (see Table I). The amino acid sequences of the putative enzymes encoded by these four different cDNAs are shown in Fig. 3, as compared with the F. intermedia pinoresinol-lariciresinol reductase (PLR-Fi1) and a homolog from Lupinus albus (PLRH-La1), which we believe may also encode a pinoresinol-lariciresinol reductase (see Ref. 13 and references therein). As can readily be seen in Table I, both classes of T. plicata reductases have high levels of homology to PLR-Fi1 (~58% identity and ~70% similarity) and even higher degrees of homology when compared with each other (~70% identity and ~80% similarity between classes). These cDNAs have lower homology to the related isoflavone reductase protein, IFR-Ps1 (~44% identity and ~55% similarity), and a homolog, PLRH-Pt1 (~52% identity and ~63% similarity), indicating that they belong to the class of proteins known as pinoresinol-lariciresinol reductases.
|
|
Attention was next turned to the functional expression of a
representative member of each of these two classes of T. plicata putative pinoresinol-lariciresinol reductases. Because the
open reading frame of PLR-Tp2 was in frame with the -galactosidase
-complementation particle present in the cloning plasmid
(pBluescript SK(-)) (called pBSPLR-Tp2) and under the control of the
lacZ promoter, the corresponding recombinant protein could
be produced as a fusion protein in E. coli (12). In an
analogous manner, in order for the open reading frame of PLR-Tp1 to be
in frame with the
-galactosidase gene
-complementation particle,
PLR-Tp1 was excised from its cloning plasmid and ligated into
pBluescript SK (-) (called pBSPLR-Tp1) as described under
"Experimental Procedures."
With both cDNAs under control of the lacZ promoter,
E. coli (NovaBlue) cells containing either pBSPLR-Tp1 or
pBSPLR-Tp2 were grown and induced with
isopropyl--D-thiogalactopyranoside to produce the
respective fusion proteins. For control experiments, plasmids either
contained no inserted DNA (negative control) or were the
PLR-Fi1-producing line (positive control). Cells were allowed to grow
overnight, pelleted to remove growth medium, resuspended in buffer,
lysed, and assayed for pinoresinol-lariciresinol reductase activity.
Assays were performed on crude protein extracts for each of the fusion
proteins and the controls with
(±)-[3,3'-O14CH3]pinoresinols
6a/6b used as substrates (see under "Experimental Procedures"). Triplicate assays were quenched by ethyl acetate extraction (containing 20 µg each of
(±)-lariciresinols 7a/7b and
(±)-secoisolariciresinols 2a/2b as radiochemical
carriers), with the resulting extracts dried, resuspended in
methanol:water (1:1, 100 µl) and purified by C18 reversed-phase HPLC. Formation of
[3,3'-O14CH3]lariciresinol 7 and
[3,3'-O14CH3]secoisolariciresinol
2 was observed for both fusion proteins, PLR-Tp1 and
PLR-Tp2, as well as for the PLR-Fi1 positive control (data not shown).
No conversion of
(±)-[3,3'-O14CH3]pinoresinols
6a/6b into
[3,3'-O14CH3]lariciresinol 7 or
[3,3'-O14CH3]secoisolariciresinol
2 was observed for the parental plasmid negative control
(see under "Experimental Procedures").
A time course was next performed for both the PLR-Tp1 and PLR-Tp2 fusion proteins, with product formation and substrate utilization monitored after 0, 10, 20, 30, 40, 50, 60, 120, 180, and 240 min of incubation, in assays performed in triplicate as above. However, no significant difference in product ratios was observed for either fusion protein over this time range (data not shown). Thus, the two classes of T. plicata reductases present in these crude protein extracts were shown to be pinoresinol-lariciresinol reductases and, as described further below, displayed distinct enantiospecificities toward their substrates.
Determination of Enantiospecificity of Western Red Cedar Reductases-- To determine the enantiospecificity of the reductions catalyzed by these two enzymes, decadeuterated (±)-[9,9'-2H2, OC2H3]pinoresinols 6a/6b (M+ +10) were first prepared as potential substrates. Fig. 4A shows the facile chiral separation of both enantiomeric forms, with mass detection at m/z 368 (M+ +10). Pinoresinol-lariciresinol reductase assays were next carried out using decadeuterated (±)-[9,9'-2H2, OC2H3]pinoresinols 6a/6b as substrate(s), with NADPH as cofactor, at 30 °C for 24 h. Following incubation with the PLR-Tp1 and PLR-Tp2 fusion proteins, assays were quenched by extraction with ethyl acetate, with the resulting extracts dried and resuspended in methanol:water (1:1, 100 µl). The residual pinoresinol 6 substrate and secoisolariciresinol 2 products were next separated by C18 reversed-phase HPLC and then subjected to chiral column HPLC analysis with detection both at 280 nm and by mass spectral analysis in the electrostatic ionization mode. Fig. 4B shows the enantiomeric composition of the remaining pinoresinol 6 substrate after 24-h assays with the PLR-Tp1 fusion protein in which essentially only the (+)-form was detected, due to the nearly complete depletion of (-)-[9,9'-2H2, OC2H3]pinoresinol 6b. In stark contrast, Fig. 4C shows the remaining substrate after 24-h assays with the PLR-Tp2 fusion protein in which the (+)-enantiomer of [9,9'-2H2, OC2H3]pinoresinol 6a had been depleted.
|
Unlabeled natural abundance secoisolariciresinols 2 have an m/z of 362 (M+), and Fig. 4D shows the chiral column HPLC separation of both (+)- and (-)-forms, with mass detection at m/z 362. Additionally, Fig. 4G shows its mass spectral fragmentation pattern, with major peaks obtained at m/z 362 (M+), 344 (M+ -18, loss of H2O), 326 (M+ -36, loss of 2 H2O), and 137 (representing a benzylic cleavage fragment). Thus, under these conditions, the assay mixtures using (±)-[9,9'-2H2, OC2H3]pinoresinol 6a/6b substrates were next examined for [9,9'-2H2, OC2H3]secoisolariciresinol 2 formation. Accordingly, Fig. 4E shows the enantiomeric composition of the secoisolariciresinol 2 obtained (analyzed at m/z 372, M+ +10) following a 24-h assay with the PLR-Tp1 fusion protein, which revealed that only (+)-[9,9'-2H2, OC2H3]secoisolariciresinol 2b had been formed. The authenticity of the product was further confirmed by analysis of its mass spectral fragmentation pattern (Fig. 4H), with major peaks at m/z 372 (M+, +10), 354 (M+ +10, -18 (H2O)), 336 (M+ +10, -36 (H2O ×2)) and 140 (benzylic cleavage fragment, with 3 deuteriums on the -OC2H3 group at position 3 of the phenyl ring). Fig. 4F, in contrast, shows the enantiomeric composition of the secoisolariciresinol 2 (analyzed at m/z 372, M+ +10), following a 24-h assay with the PLR-Tp2 fusion protein, indicating that now only (-)-[9,9'-2H2, OC2H3]secoisolariciresinol 2a had been formed. As before, its mass spectral fragmentation pattern (shown in Fig. 4I), had peaks at m/z 372 (M+, +10), 354 (M+ +10, -18 (H2O)), 336 (M+ +10, -36 (H2O ×2)), and 140 (benzylic cleavage fragment, with 3 deuteriums on the -OC2H3 group at position 3 of the phenyl ring). Thus, PLR-Tp1 and PLR-Tp2 unambiguously catalyzed formation of the opposite enantiomers of secoisolariciresinol 2 from pinoresinol 6 (see Fig. 2).
The enantiospecificity of each class of T. plicata pinoresinol-lariciresinol reductase was further investigated using assays with (±)-[3,3'-O14CH3]pinoresinols 6a/6b as substrates instead of deuterated pinoresinols 6. Triplicate assays were quenched by ethyl acetate extraction (containing 20 µg each of (±)-lariciresinols 7a/7b and (±)-secoisolariciresinols 2a/2b as radiochemical carriers), with the resulting extracts dried, resuspended in methanol:water, and purified by C18 reversed-phase HPLC as before. The products, corresponding to [3,3'-O14CH3]secoisolariciresinol 2, were collected, freeze-dried, redissolved in methanol (100 µl), and subjected to chiral column HPLC analysis with both UV and radiochemical detection. Chiral column HPLC analysis of the [3,3'-O14CH3]secoisolariciresinol 2 obtained following assays of PLR-Tp1 fusion protein with (±)-[3,3'-O14CH3]pinoresinols 6a/6b is shown in Fig. 5A, in which only conversion into the (+)-enantiomer 2b of secoisolariciresinol is evident. On the other hand, Fig. 5B shows the enantiomeric composition of the [3,3'-O14CH3]secoisolariciresinol 2 product obtained from assays of PLR-Tp2 fusion protein with (±)-[3,3'-O14CH3]pinoresinols 6a/6b, demonstrating only radiochemical incorporation into the (-)-enantiomer 2a. These results, therefore, further established the presence of two distinct classes of pinoresinol-lariciresinol reductases in western red cedar, as illustrated in Fig. 2. Thus, the first class of reductase (PLR-Tp1, Fig. 2B) catalyzes reduction of (-)-pinoresinol 6b into (+)-secoisolariciresinol 2b, whereas the other (PLR-Tp2, Fig. 2A) engenders formation of (-)-secoisolariciresinol 2a, in a reaction analogous to that of the F. intermedia reductase (PLR-Fi1).
|
Lastly, the products corresponding to [3,3'-O14CH3]lariciresinol 7, from the above assays with (±)-[3,3'-O14CH3]pinoresinols 6a/6b, were collected and subjected to chiral column HPLC analysis as before, revealing yet another interesting property of each enzyme. As shown in Fig. 5C, chiral column HPLC analysis of the [3,3'-O14CH3]lariciresinol 7 product obtained from assays of PLR-Tp1 fusion protein with (±)-[3,3'-O14CH3]pinoresinols 6a/6b demonstrated that only the (+)-enantiomer 7a was radiolabeled, i.e. exactly the opposite enantiomer from that expected based on chiral analysis of the final (+)-secoisolariciresinol 2b product formed by this enzyme. That is, none of the (-)-lariciresinol 7b formed by action of PLR-Tp1 during reduction of (-)-pinoresinol 6b was observed as an intermediate, being instead immediately reduced to (+)-secoisolariciresinol 2b. In contrast, Fig. 5D shows the chiral column HPLC analysis of the [3,3'-O14CH3]lariciresinol 7a/7b products obtained from assays of PLR-Tp2 fusion protein with (±)-[3,3'-O14CH3]pinoresinols 6a/6b, which now showed radiochemical incorporation into both (+)-7a and (-)-7b enantiomers of lariciresinol, with the former predominating. Identical results were also obtained from assays with both PLR-Tp1 and PLR-Tp2, respectively, utilizing (±)-[9,9'-2H2, OC2H3]pinoresinol 6a/6b substrates (as described above) and evaluated for [9,9'-2H2, OC2H3]lariciresinol 7 formation (data not shown).
It needs to be emphasized that in assays with PLR-Tp1, if allowed to continue until depletion of the (±)-pinoresinol 6a/6b substrates occurs, the (-)-antipode 6b is fully converted into (+)-secoisolariciresinol 2b, whereas the (+)-antipode 6a is only transformed into (+)-lariciresinol 7a. In these experiments, no accumulation of the (-)-form of lariciresinol 7b was noted. On the other hand, with PLR-Tp2, consumption of the (±)-pinoresinol 6a/6b substrates resulted in accumulation of both (+)-7a and (-)-7b lariciresinols, in which the (+)-antipode 7a was then further converted into (-)-secoisolariciresinol 2a. However, the (-)-lariciresinol 7b was not further transformed into (+)-secoisolariciresinol 2b (data not shown).
These results, therefore, revealed that PLR-Tp1 and PLR-Tp2 displayed enantiospecific conversions with (+)-6a and (-)-6b forms of pinoresinol that were quite distinct from that for PLR-Fi1 from F. intermedia, where the latter utilizes only the (+)-enantiomeric forms of pinoresinol 6a and lariciresinol 7a (Fig. 2A) (12, 20). Thus, western red cedar pinoresinol-lariciresinol reductases can reduce both (+)-6a and (-)-enantiomers 6b of pinoresinol, but they are highly enantiospecific toward (±)-lariciresinols 7a/7b. As described below, this differential enantiospecificity may play a significant role in heartwood metabolite formation.
A Role in Heartwood Metabolite Deposition--
As described in
detail elsewhere (1), formation of heartwood constituents is a highly
regulated process, with metabolites deposited into specific cell types
at specific times and fulfilling distinctive antifungal, antibacterial,
and anti-insect herbivory roles (13). For example, two different yet
metabolically related lignans, matairesinol 3 and
-conidendrin 8, are deposited into separate ray tracheid
cells within the same xylem ray of a single western hemlock
(Tsuga heterophylla) tree (37). Thus, specific lignans may
be deposited into specific regions in the developing heartwood and be
products of related but parallel pathways, involving
differing isoforms or classes of related enzymes. The four different
pinoresinol-lariciresinol reductases described here, as well as the
several different dirigent protein homologs mentioned above, provide
further evidence that such parallel lignan pathways may be expressed in
the heartwood-forming tissues of T. plicata.
The differential enantiospecificity observed between these two classes of reductases raises important questions about their metabolic roles in planta, especially because all four reductases, belonging to the two reductase classes, were isolated from a cDNA library made from mRNA from stems of a single tree. That is, at least four distinct pinoresinol-lariciresinol reductase genes were expressed in its stems at the time that the RNA was isolated, suggesting that all of these reductases are produced in active form. It is, therefore, probable that both reductase classes are involved in parallel lignan biosynthetic pathways in western red cedar stems, leading to the production of different heartwood constituents in different cell types. Although this question will be the subject of future work, it underscores the control of heartwood metabolite deposition and composition that is being exercised in vivo.
Sequence Homology Comparisons-- With the two classes of pinoresinol-lariciresinol reductase from western red cedar in hand, together with PLR-Fi1 present in F. intermedia, it was instructive to evaluate the sequence homology of these proteins with other similar reductases (13). This ultimately resulted in a dendogram based on the amino acid sequence similarity of pinoresinol-lariciresinol reductases, isoflavone reductases and a family of supposed homologs of unknown catalytic function (Fig. 6). As can be seen, the pinoresinol-lariciresinol reductases form a single cluster (Cluster 1), even with inclusion of PLRH-La1, a homolog from L. albus, which may also encode a pinoresinol-lariciresinol reductase. Despite their different enantiospecificities, both classes of western red cedar pinoresinol-lariciresinol reductases (e.g. PLR-Tp1 and PLR-Tp2), are more similar to each other than to either F. intermedia pinoresinol-lariciresinol reductase (PLR-Fi1) or PLRH-La1. The clustering of the western red cedar reductases may be due to the facts that these enzymes are from the same species and that most of the differences in the sequences between the various pinoresinol-lariciresinol reductases listed in Fig. 6 are not important for substrate enantiospecificity. It is also possible that the higher similarity between the western red cedar reductases may have some significance regarding their ability to reduce both enantiomers of pinoresinol 6, given that they are less enantiospecific than the F. intermedia reductase.
|
The isoflavone reductases also form a cluster (Cluster 2), including the recently reported IFR homolog from Glycine max (IFRH-Gm1) (see Fig. 6). On the other hand, with the exception of the homolog from grapefruit (Citrus paridisi), the so-called PLR and IFR homologs form another distinct cluster (Cluster 3; see Fig. 6), perhaps suggesting that these proteins may also catalyze some common transformation. In this respect, results of assays using PLRH-Pt1, a homolog cloned from Pinus taeda, revealed that this protein converted dehydrodiconiferyl alcohol 11 into 7-O-4'-(iso)dihydrodehydrodiconiferyl alcohol 12.3
Thus, Fig. 7 illustrates the overall
reductions catalyzed by pinoresinol-lariciresinol reductases (Fig.
7A), isoflavone reductases (one example is shown in Fig.
7B), and the P. taeda homolog (a dehydrodiconiferyl alcohol 11 benzylic ether reductase) (Fig. 7C). As can be seen in Fig. 7, all three reductive
processes are very similar, in terms of both substrate structure and
the possible catalytic intermediatea conjugated enone (1, 12, 13). It
is also perhaps significant that many of these distinct metabolites
occur as part of oligomeric/polymeric deposits in the heartwoods of
many tree species (e.g. pterocarpanoid isoflavonoids in
tropical legumes (38), dehydrodiconiferyl alcohol 11-derived metabolites in loblolly pine (1, 39), and plicatic acid 1 and related lignans in western red cedar (33-35)). Accordingly, a more
detailed understanding of the role of these reductases in terms of
their developmental, temporal, and tissue-specific expression, as well
as their substrate specificity, is required before an understanding of
the processes accompanying heartwood formation can be fully
delineated.
|
Concluding Remarks--
Heartwood formation is one of the most
important biological processes defining the distinctive properties of
various woody species. Until now, this process has been difficult to
study from a biochemical perspective due to the nature and complexity
of the heartwood tissue. Accordingly, an RT-PCR-guided cloning strategy afforded genes involved in the formation of metabolites deposited into
western red cedar heartwood. The recombinant proteins encoded by these
genes displayed quite unexpected and interesting properties, especially
in terms of their enantiospecificities toward their substrates. Thus,
we are now poised to begin to understand how heartwood formation is
initiated, regulated, and controlled, using western red cedar as a model.
![]() |
FOOTNOTES |
---|
* This research was supported in part by United States Department of Agriculture Grant 9603622, United States Department of Energy Grant DE-FG03-97ER20259, the Organisation for Economic Co-operation and Development (to M. F.), and the United States Department of Agriculture McIntire-Stennis Program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed. Tel.: 509-335-2682; Fax: 509-335-7643; E-mail: lewisn{at}wsu.edu.
The abbreviations used are: PLR, pinoresinol-lariciresinol reductase; HPLC, high performance liquid chromatography; PCR, polymerase chain reaction; RT-PCR, reverse transcription-PCR; pfu, plaque-forming unit; IFR, isoflavone reductase.
1 D. R. Gang, M. A. Costa, M. Fujita, A. T. Dinkova-Kostova, H.-B. Wang, W. Martin, V. Burlat, S. Sarkanen, L. B. Davin, and N. G. Lewis, submitted for publication.
3 D. R. Gang, H. Kasahara, Z.-Q. Xia, K. Vander Mijnsbrugge, G. Bauw, W. Boerjan, M. Van Montagu, L. B. Davin, and N. G. Lewis, submitted for publication.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|