From the Institut für Biochemie, Fachbereich Biologie, Justus-Liebig Universität, Heinrich-Buff-Ring 58, D-35392 Giessen, Germany
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The extracellular endonucleases from
Serratia marcescens and Anabaena sp. are
members of a family of nonspecific endonucleases. In contrast to the
monomeric Anabaena nuclease, the Serratia
nuclease is a dimer of two identical subunits. To find out whether the two active sites of the Serratia nuclease function
independently of each other and what the advantage of being a dimer for
this enzyme might be, we produced (i) dimers in which the two subunits were cross-linked, (ii) heterodimers consisting of a wild type and an
inactive mutant subunit which were also cross-linked, and (iii)
monomeric variants which are unable to dimerize. The monomeric H184R
variant and the cross-linked S140C variant exhibit the same activity as
the wild type enzyme, while the cross-linked heterodimer with one
inactive subunit shows only half of the activity of the wild type
enzyme, demonstrating functional independence of the two subunits of
the Serratia nuclease. On the other hand at low enzyme and
substrate concentrations dimeric forms of the Serratia nuclease are relatively more active than monomeric forms or the monomeric Anabaena nuclease in cleaving polynucleotides,
not, however, oligonucleotides, which is correlated with the ability of
dimeric forms of the Serratia nuclease to form large
enzyme-substrate networks with high molecular weight DNA and to cleave
polynucleotides in a processive manner. We conclude that in the natural
habitat of Serratia marcescens where the supply of
nutrients may become growth limiting the dimeric nuclease can fulfil
its nutritive function more efficiently than a monomeric enzyme.
Many enzymes are dimers of identical subunits each of which
harbors one active site. Only in a few cases is it obvious that the
dimeric state is essential for enzymatic activity, the paradigm being
type II restriction endonucleases. These are usually dimers of
identical subunits which together form one DNA-binding site, and have
two catalytic centers, one per subunit, which cleave the two strands of
the DNA in a concerted fashion (1, 2).
In contrast, it is not at all clear what the role of the quaternary
structure of a family of sugar nonspecific nucleases is, some of which
are homodimers and others monomers. Representatives of this growing
group of related enzymes are Serratia nuclease which is a
homodimer (3-5) and Anabaena nuclease (Anabaena
sp. strain PCC 7120) which is a monomer (6). Other members of this group have been found in various other prokaryotic but also in eukaryotic organisms, viz. Streptococcus pneumoniae (7-9),
cyanobacteria (10, 11), Saccharomyces cerevisiae (12, 13),
Schizosaccharomyces pombe (14), Syncephalostrum
racemosum (15), and Bos taurus (16). In addition, open
reading frames for homologous proteins have been identified in
Trypanosoma
brucei,1
Caenorhabditis elegans (accession number AF003740),
Mus musculus (Ref. 17, accession number X99395), and
Homo sapiens (Ref. 18, accession number X79444). Recently,
the homologous nuclease from Borrelia burgdorferi was
identified through a genome sequencing project (19).
Although the nucleases of this family occur ubiquitously their cellular
roles are often unknown or poorly understood. The bovine EndoG nuclease
is known to be involved in generating primers for the mitochondrial DNA
replication by cleaving GC-rich sequences in the displacement loop of
mitochondrial DNA and in the region upstream of the mitochondrial
tRNAPhe gene (16), and has been discussed to be involved in
the maintenance of mitochondrial DNA by eliminating defective genomes
from the multicopy pool (20). NUC1 from S. cerevisiae seems
to be involved in DNA recombination and DNA repair. However, null
mutants which lack the NUC1 gene show the wild type phenotype (21). The
secreted nucleases from prokaryotic organisms, namely
Serratia nuclease, Anabaena nuclease, and EndA
from S. pneumoniae most likely fulfil a nutritive function
by providing the bacterial cell in its natural habitat with precursors
for nucleic acid synthesis. They also may act as bactericides to
inhibit the growth of competing organisms. This was shown to be
important for efficient transformation of S. pneumonia (9).
They may also constitute virulence factors.
Among this family of nucleases the Serratia (for review, see
Ref. 22) and the Anabaena nuclease are by far the best
studied enzymes. Both enzymes, Serratia nuclease secreted by
the Gram-negative bacterium Serratia marcescens (23-25) and
Anabaena nuclease produced by members of the cyanobacterial
genus Anabaena (10) are largely nonspecific endonucleases
which cleave double- and single-stranded DNA and RNA and produce
5'-phosphorylated oligonucleotides. For the Serratia
nuclease the three-dimensional structure is known (5, 26, 27), and due
to a detailed mutational (28, 29) as well as a kinetic analysis using
natural and synthetic, in part chemically modified, substrates (30-32)
its mechanism of action is well understood. Anabaena
nuclease recently has been cloned, sequenced, and expressed in
Escherichia coli (10, 33) and biochemically
characterized in detail (6). It is the only representative of this
group whose intracellular activity is regulated by the polypeptide
inhibitor NuiA which is specific for the Anabaena nuclease,
as it does not inhibit the activity of the related Serratia nuclease (6, 33). Serratia nuclease is not active
intracellularly because two disulfide bonds are essential for its
nucleolytic function (34), which are not formed prior to secretion into the oxidizing milieu of the periplasma.
The active site of these nucleases is characterized by the DRGH motif
typical for this family of nucleases. It contains the essential
histidine, His89 in Serratia nuclease, which
presumably acts as the general base to generate the active nucleophile
for phosphodiester bond cleavage. The nucleolytic activity requires
divalent metal ions like Mg2+ or Mn2+ which in
Serratia nuclease are bound by
Asn119.2 The
metal ion cofactor could be involved in polarization of the P-O bond to
make the phosphorus more accessible for a nucleophilic attack and
together with Arg57 stabilize the phosphorane intermediate
in the transition state. Glu127 seems to be involved in
protonation of the leaving group. These residues are conserved in the
Serratia family of nucleases and their essential function
has been demonstrated for Serratia nuclease (29, 31, 32) as
well as for Anabaena
nuclease.3
While it appears from a comparison of the properties of these two
nucleases that they have a similar mechanism of action (6), they differ
as mentioned above in their quaternary structure. The question, of
course, arises, whether the dimeric structure of Serratia
nuclease leads to a functional dependence of the two active sites, a
question that cannot easily be resolved by kinetic studies, as the
enzyme is subjected to a monomer/dimer equilibrium and attacks nucleic
acids at many sites with different rates which obscures any analysis
regarding cooperative effects (31). We have, therefore, taken another
approach, namely to produce monomeric and cross-linked homo- and
heterodimeric variants of the Serratia nuclease and to
compare their nucleolytic activity and mechanism of action toward
different nucleic acid substrates. Our results demonstrate that the
subunits of Serratia nuclease are functionally independent,
but that the dimeric state of this enzyme is of advantage at very low
enzyme and substrate concentration, because it allows the
Serratia nuclease to stay associated with high molecular
weight nucleic acids and to cleave them in a processive manner.
Strains and Vectors--
For the cloning and expression of the
wild type and the mutant genes of Serratia nuclease the
vector pHisNuc (4) was used. Anabaena nuclease was cloned
and overexpressed using the pBBINucA expression vector (6). Cloning of
pHisNuc and pBBINucA was performed in E. coli K12 LK111(
E. coli DH5 In Vitro Mutagenesis and Sequencing--
The double mutant
H89A,S140C variant of Serratia nuclease was generated by
ligating the BamHI/ClaI fragment of the gene of the H89A variant (28) into pHisNuc (S140C) (41) which had been digested
with the same restriction endonucleases.
The double mutant S140C,H184R and H89A,H184R variants were generated
applying an inverse polymerase chain reaction strategy (6). Mutations
were verified by sequencing the whole gene using the ABI PRISM Dye
Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA
Polymerase FS, on an ABI 373A DNA sequencer (Applied Biosystems)
according to the supplier's protocol.
Cloning of pStrepIINuc--
pStrepIINuc is a derivative of
pHisNuc in which the codons for the N-terminal His6-tag
were replaced by codons for the Strep-tag II. Proteins with the
Strep-tag II bind to StrepTactin, a mutant of streptavidine (42, 43).
In contrast to the original Strep-tag the Strep-tag II can be employed
not only as a C-terminal fusion peptide but also as a linker between
protein domains or as an N-terminal fusion peptide. The original
sequence, CATCATCATCACCATCAC, coding for the His6-tag was
excised as a HindIII/BamHI fragment from pHisNuc
and replaced by a cassette containing the coding sequence,
TCTGCTTGGTCTCACCCGCAGTTCGAAAAA, for the Strep-tag II (Ser-Ala-Trp-Ser-His-Pro-Gln-Phe-Glu-Lys). Codons most frequently used
in E. coli were employed. Positive clones were identified by
polymerase chain reaction screening using a forward primer specific for
the codons of the Strep-tag II and a reverse primer binding to the
3'-region of the Serratia nuclease gene. Positive clones
were verified by sequencing as described above. The newly generated
expression vector containing the gene of Serratia nuclease was named pStrepIINuc.
Overexpression and Purification of Serratia Nuclease
Variants--
As in E. coli all overexpressed variants of
Serratia and Anabaena nuclease are produced as
inclusion bodies, in all cases a denaturing-renaturing purification
procedure was used (28). Anabaena nuclease was overexpressed
as the His6-tagged protein and purified as described
previously (6). These highly active nucleases can be expressed in
E. coli, as they are inactive intracellularly, either
because they require for activity disulfide bonds to be formed
(Serratia nuclease) or because they are kept in an inactive state due to the presence of a specific polypeptide inhibitor (Anabaena nuclease). Wild type Serratia nuclease
and the variant enzymes H89A, S140C, H184R, H89A,S140C, and H89A,H184R
were produced as His6-tagged proteins and purified as
described (4, 29).
In a modification of the previously described purification procedure we
employed for some enzyme preparations an additional gel filtration
purification step using a Beckmann Biosys 2000 HPLC system and a Merck
Superformance 600-16 Fractogel EMD BioSEC (S) which removes inactive
aggregates from the preparation of the His6-tagged
proteins. With this extra step the specific activity of the nuclease
increases from 1 × 106 units mg
The S140C variant was also produced with the Strep-tag II as an
N-terminal affinity peptide. Overexpression of the nuclease was carried
out in the same way as described for the His6-tagged variants (4). The inclusion bodies formed after induction of a 1-liter
culture were first solubilized using 6 M urea and then dialyzed against 10 mM Tris-HCl, allowing the nuclease to
refold. The solution containing the native nuclease was then applied to a StrepTactin column with 1-ml bed volume which binds specifically to
the Strep-tag II (44). After washing the column with 3 ml of 10 mM Tris-HCl, pH 8.2, the protein was eluted with 10 mM Tris-HCl, pH 8.2, 2.5 mM desthiobiotin in
six fractions of 0.5 ml. After dialysis against 10 mM
Tris-HCl, pH 8.2, the protein was stored at 4 °C.
Production of Obligatory Dimers and Obligatory Monomers of the
Serratia Nuclease--
Obligatory dimers of Serratia
nuclease were generated by chemical cross-linking of the S140C variant
(and other variants carrying the Ser140 Analysis of the Quaternary Structure of Serratia and Anabaena
Nuclease--
The quaternary structure analysis of Serratia
nuclease variants and of Anabaena nuclease was carried out
using gel filtration and analytical ultracentrifugation (6, 28,
45).
Analytical gel filtration experiments were performed at 25 °C on a
Beckmann Biosys 2000 HPLC system using a Pharmacia Superdex 75 HR 10/30
column. The protein concentration of the 100-µl sample applied to the
column was 40 µM.
Analytical ultracentrifugation experiments were carried out at 20 °C
and 45,000 min Generation of an Obligatory Heterodimer of Serratia
Nuclease--
An obligatory heterodimer of Serratia
nuclease consisting of a wild type subunit and one subunit with an
active site mutation was generated using the His6-tagged
H89A,S140C variant which is catalytically inactive and the
StrepII-tagged variant S140C which has wild type activity (Fig. 2).
Both variants were overexpressed and purified separately. A
stoichometric mixture of both variants was then dialyzed against 10 mM Tris-HCl, pH 8.2, 6 M urea to denature the
protein. The refolding and stochastic formation of His6-tagged/His6-tagged (denoting: subunit
1/subunit 2), His6-tagged/StrepII-tagged and
StrepII-tagged/StrepII-tagged dimers were achieved by dialysis against
10 mM Tris-HCl, pH 8.2. The dimers obtained were
cross-linked using the same procedure that was used to generate the
cross-linked S140C homodimer (41). To separate the heterodimer from the
two homodimeric forms the solution containing the mixture of dimers was
first applied to a Ni2+-NTA column which binds only the
His6-tagged homodimers and the heterodimer. After the
StrepII-tagged homodimer was removed by washing the column with 10 mM Tris-HCl, pH 8.2, the protein was eluted with 10 mM Tris-HCl, pH 8.2, 200 mM imidazole and after dialysis against 10 mM Tris-HCl, pH 8.2, applied to a
StrepTactin column. The His6-tagged homodimers appeared in
the flow-through and in the wash with 10 mM Tris-HCl, pH
8.2. The heterodimer was eluted with 10 mM Tris-HCl, pH
8.2, 2.5 mM desthiobiotin.
As the His6-tagged and the StrepII-tagged variant have
almost the same molecular weight, they cannot be distinguished by
SDS-polyacrylamide gel electrophoresis. To ensure that we indeed
purified the heterodimer described above we applied a
His6-tagged variant to a StrepTactin column and a
StrepII-tagged variant to a Ni2+-NTA column. After washing
with the same amount of buffer that was used in the procedure to
prepare the heterodimer, all nucleolytic activity appeared in the
flow-through and the wash.
Circular Dichroism (CD)--
CD spectra were recorded with a
Jasco J-710 circular dichrograph in 0.05-cm cells at protein
concentrations of 5 µM as described previously (28).
Hyperchromicity Assay--
The DNase activity of
Anabaena nuclease and the different variants of
Serratia nuclease were determined using a hyperchromicity assay (47) with high molecular weight DNA from herring sperm as
described previously (31).
Plasmid Cleavage Assay--
Plasmid cleavage assays were
performed at 37 °C (steady state experiments) or 25 °C
(pre-steady state experiments which were carried out in a quenched-flow
apparatus (Biologic)) in 50 mM Tris-HCl, pH 8.2, 5 mM MgCl2 with Serratia nuclease
variants and in 50 mM Tris-HCl, pH 7.5, 5 mM
MnCl2, 0.01% (w/v) Lubrol with Anabaena
nuclease. Protein concentrations varied between 5 × 101 and 2.5 × 106 units
liter Precipitation Assay--
For the coprecipitation of the
Serratia nuclease in the presence of DNA due to the
formation of enzyme-DNA networks the nuclease was incubated at a
concentration of 10 µM with 0.05 mg ml It has been the aim of this study to compare the properties and
activities of obligatory monomeric and obligatory dimeric variants of
Serratia nuclease and for reference, of Anabaena
nuclease which is a monomer. For this purpose we had prepared
obligatory monomeric variants of Serratia nuclease by
substituting His184 by other amino acid residues that
interfere with subunit-subunit interaction, e.g. H184R (Fig.
1 (45)). We also had produced obligatory
dimers by substituting Ser140 by Cys and cross-linking the
two subunits of this Serratia nuclease variant via the Cys
residues by specifically designed bismaleimides, e.g.
S140C_X4 (Fig. 1 (41)). We
have now prepared also a heterodimer of the Serratia
nuclease consisting of an active subunit (S140C) and an inactive
subunit (H89A,S140C) in which the catalytically essential His89 is substituted by Ala (Fig. 1). For this purpose, two
variants of Serratia nuclease were produced, the S140C
variant carrying at its N terminus the Strep-tag II and the H89A,S140C
variant carrying at its N terminus the His6-tag. Upon
mixing, denaturation and renaturation of the two variants homo- and
heterodimers are formed. To prevent subunit exchange the mixture of
homo- and heterodimers was treated with bismaleimidohexane as described
before for the S140C variant to cross-link the two subunits (41). The
cross-linking reaction had a yield of >95%. Cross-linked dimers were
subjected to a series of two affinity purification steps involving a
Ni2+-NTA and a StrepTactin column, after which a pure
preparation of cross-linked heterodimer was obtained with an overall
yield of 30% (Fig. 2).
INTRODUCTION
Top
Abstract
Introduction
Procedures
Results
Discussion
References
EXPERIMENTAL PROCEDURES
Top
Abstract
Introduction
Procedures
Results
Discussion
References
)
(35). For the overexpression of Serratia nuclease E. coli K12 TGE900 and for Anabaena nuclease E. coli BL21(DE3)LysS (36) were used.
(37) was used for the propagation of the
plasmid pBSK+ (Stratagene) to achieve a maximum yield of supercoiled plasmid DNA. The pBSK+ plasmid was isolated using alkaline lysis (38,
39) followed by differential nucleic acid precipitation using a
modified protocol from (40).
1 to
3-4 × 106 units mg
1.
Cys
substitution) across the dimer interface at Cys140 using
the SH-specific bismaleimidohexane as cross-linking reagent (41).
Obligatory monomers were obtained by replacing His184 which
is located in the dimer interface of Serratia nuclease (5)
by Ala, Thr, Asn, and Arg (45).
1 in a Beckmann Optima XL-A centrifuge
equipped with absorption optics and an An-50 8-place rotor. The protein
concentration was 6 µM. Sedimentation velocity data were
evaluated with the program package AKKUPROG (46).
1. Cleavage products were analyzed using native
0.8% Tris borate-agarose gels. The gels were quantified by
densitometry using a video documentation system (Intas).
1
high molecular weight DNA from herring sperm in 50 mM
Tris-HCl, pH 7.5, 5 mM MnCl2, and 50 mM Tris-HCl, pH 8.2, 5 mM MgCl2,
respectively. Visually apparent precipitation was taken as an indicator
for the formation of very high molecular weight enzyme-DNA complexes. To demonstrate that these complexes consist of DNA and enzyme the
precipitate after centrifugation was analyzed by SDS-polyacrylamide gel
electrophoresis for the presence of nuclease. The supernatant was
analyzed for the decrease in DNA content by measuring the UV absorbance
at 260 nm.
RESULTS
Top
Abstract
Introduction
Procedures
Results
Discussion
References
View larger version (45K):
[in a new window]
Fig. 1.
Ribbon drawing of the three-dimensional
structure of the Serratia endonuclease dimer (5). The
positions of His89, Cys140, and
His184 are indicated. His89 acts as general
base in the cleavage of phosphodiester bonds; its substitution by Ala
inactivates the enzyme. The S140C variant was used to cross-link the
nuclease at the dimer interface with bismaleimidohexane (41).
His184 makes specific contacts to a loop region in the
second subunit. Replacement by Ala, Thr, Asn, and Arg leads to
monomeric proteins (45).
View larger version (38K):
[in a new window]
Fig. 2.
Scheme to illustrate the procedure used for
the generation of cross-linked heterodimeric variants of Serratia
nuclease with two different affinity tags.
The heterodimer and its "parent" homodimers, whose dimeric state was verified by gel filtration and/or analytical ultracentrifugation (data not shown) have the same circular dichroism (CD) spectrum as the wild type Serratia nuclease (Fig. 3). It had been demonstrated before that the H89A, the H184A, N, T, or R, and the cross-linked S140C variants all have the same CD spectrum as the wild type enzyme indicating that the secondary structure composition and presumably also the tertiary structure is unaltered by the amino acid substitution(s) and the cross-linking (41, 45).
|
The suggestion that the tertiary structure is unaffected by the amino
acid substitution and the cross-linking is supported by functional
assays. The specific activities of the monomeric variants H184A, N, T,
or R, the cross-linked S140C, and the wild type enzyme toward high
molecular weight DNA as determined by the Kunitz assay are very similar
(Table I). This finding demonstrates that
the subunits of Serratia nuclease are functionally
independent; they can be irreversibly joined or irreversibly separated
without effect on their activity. It is not unexpected, therefore, that the cross-linked heterodimeric variant with one active and one inactive
subunit (H89A,S140C/S140C_X) has approximately half of the specific
activity of the wild type enzyme (for this comparison enzyme
preparations were used that had not been passed over a gel filtration
column, cf. Table I). The steady state kinetic analysis of
the cleavage of herring sperm DNA by cross-linked S140C and the
cross-linked H89A,S140C/S140C heterodimer shows that the difference in
activity is mainly due to a difference in kcat
(S140C_X: kcat = 245 s1,
Km = 39 µM(nucleotide)
1,
kcat/Km = 6 µM
1 s
1; H89A,S140C/S140C:
kcat = 135 s
1,
Km = 51 µM(nucleotide)
1,
kcat/Km = 3 µM
1 s
1), demonstrating that
in the heterodimer only one active site is present which is unaffected
by the presence of the inactive subunit.
|
The Kunitz assay allows determination of specific activities, but gives little information regarding the course of the reaction, in particular whether the nuclease stays associated with a macromolecular substrate after cleavage and cleaves adjacent phosphodiester bonds in a concerted manner or whether it dissociates after each cleavage event and cleaves phosphodiester bonds in a sequential manner. To distinguish between these possibilities we have carried out cleavage assays with sc plasmid DNA. An enzyme which works in a processive manner will leave more sc plasmid DNA unattacked in the initial phase of the reaction than an enzyme of the same specific activity, that follows a distributive mechanism. As shown in Fig. 4 there is a clear difference in the time course of sc plasmid DNA cleavage between the monomeric and the dimeric variants of Serratia nuclease: the monomeric H184R variant works in a more distributive manner, as the sc plasmid DNA is degraded rapidly, while the obligatory dimer S140C_X follows a more processive mechanism which leaves the sc plasmid DNA intact for a longer period of time and preferentially produces fragments of the linear DNA (which appear as an unresolved "smear" on the gel). The heterodimer produces an intermediate pattern. It is important to note that the monomeric H184R when forced into a dimer structure by cross-linking produces a cleavage pattern typical of the dimer. This clearly demonstrates that the mode of cleavage (more processive or more distributive) is a consequence of the quaternary structure.
|
It is noteworthy that with Mg2+ as cofactor all Serratia nuclease variants cleave sc plasmid DNA without accumulation of the oc intermediate, indicating that both strands of the double-stranded DNA are cleaved in a correlated manner at sites in close proximity. This mode of cleavage was termed diplotomic and is characteristic of many deoxyribonucleases, e.g. spleen acid DNase (for review, see Ref. 48). Only in the pre-steady state phase of the reaction, i.e. in a quenched-flow experiment, can one observe under these conditions the formation of the oc intermediate. Its rate of appearance is very similar for the monomeric H184R and the dimeric S140C_X variant, demonstrating again the independence of the two subunits (Fig. 5).
|
Our suggestion that the dimeric state of Serratia nuclease is the prerequisite for the processive action of this enzyme on macromolecular substrates is supported by a comparison with the related monomeric Anabaena nuclease. Its preferred divalent metal ion cofactor is Mn2+, which is also accepted by the Serratia nuclease. As can be seen in Fig. 6 the time course of sc plasmid DNA cleavage by Anabaena nuclease is very similar to that observed for the monomeric H184R variant and differs from that measured for the cross-linked dimeric S140C variant at the same specific activity and in the presence of Mn2+. Fig. 6 also shows that in the presence of Mn2+ the monomeric and dimeric variants of Serratia nuclease accumulate more oc DNA than in the presence of Mg2+. This suggests that with Mn2+ as the cofactor monomeric and dimeric variants of Serratia nuclease prefer to nick DNA and do not cleave the two strands in a correlated manner, i.e. to follow a haplotomic mode of action. Nevertheless, the dimeric variants cleave DNA processively also in the presence of Mn2+ as can be deduced from the relatively slow decline of sc plasmid DNA.
|
The finding that dimeric forms of Serratia nuclease cleave high molecular weight DNA in a more processive manner than monomeric forms can be explained by the simultaneous binding of the substrate to two binding sites on the enzyme and thus critically depends on the affinity of the enzyme for the substrate. If binding is weak or dissociation fast compared with cleavage, the advantage of the dimer for a processive action will be diminished. This is indeed observed, when the binding of the nucleic acid to the nuclease is weakened by the addition of salt. Fig. 7 shows that with 125 mM NaCl in the reaction buffer the time course of cleavage of sc plasmid DNA by the cross-linked dimeric S140C variant is similar to that of the monomeric H184R variant. Furthermore, under these conditions both follow a haplotomic mode of cleavage.
|
The Kunitz assay had shown that wild type Serratia nuclease, the cross-linked S140C variant and H184A, T, N, or R variants have the same specific activity, despite the fact that they are in a monomer/dimer equilibrium (wild type enzyme), are obligatory dimers (S140C_X) or obligatory monomers (H184A, T, N, or R), respectively. On the other hand the course of the reaction is different with these variants, dimeric forms working more processively, monomeric forms more distributively on plasmid substrates. It must be expected, therefore, that at very low concentrations of enzyme and high molecular weight DNA (much lower than used in the Kunitz assay), where substrate binding becomes rate-limiting, dimeric variants that tend to stay associated with their substrate after cleavage should appear to be more active than monomeric variants which dissociate from the DNA after cleavage. This should only be the case with high molecular weight DNA, not, however, with oligonucleotides which cannot bind to two subunits simultaneously. Fig. 8 shows that the specific activity of dimeric S140C_X increases with decreasing protein concentration, but only when the substrate is high molecular weight DNA, not when it is an oligonucleotide. The monomeric H184R variant and Anabaena nuclease do not show this effect. The specific activity of the heterodimer displays an intermediate concentration dependence, presumably, because the H89A subunit of the heterodimer has a lower affinity to DNA than the wild type subunit.
|
The fact that the increase in specific activity is only observed with
high molecular weight DNA but not with an oligonucleotide substrate
demonstrates that this effect is not a consequence of a greater
stability of the dimer compared with the monomer at low protein
concentration but rather an effect mediated by the size of the
substrate. The simultaneous binding of a high molecular weight DNA to
the two subunits of Serratia nuclease should lead to a
"network" of enzyme and DNA, which in the absence of cleavage, i.e. when an inactive variant like the H89A variant is used,
should lead to precipitation of these aggregates. This is observed with the dimeric H89A and the H89A,S140C variants, not, however, with the
monomeric H89A,H184R and the inactive H124A variant of monomeric Anabaena nuclease (data not shown). The aggregates are
"dissolved" by addition of catalytic amounts of active
Serratia or Anabaena nuclease, demonstrating that
the aggregation is mediated by high molecular weight DNA. Serratia
nuclease-DNA aggregates are formed at low and high concentration, but
only at low concentrations, when association become rate-limiting, does
the formation of aggregates lead to an increase in specific activity.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We have been concerned in the present paper with the importance of the dimeric state for the activity of the Serratia nuclease, the prototypic member of a family of nonspecific nucleases, some of which are dimers of identical subunits and others monomers. We have for this purpose analyzed the DNA cleavage activity of obligatory monomeric and dimeric variants of the Serratia nuclease and for comparison of Anabaena nuclease, a monomeric enzyme related to Serratia nuclease. Our results demonstrate that the two subunits of Serratia nuclease function independently of each other. Nevertheless, the dimeric state has several consequences for the activity of the enzyme, due to the fact that the two subunits can bind simultaneously to one nucleic acid molecule if it is macromolecular and, therefore, provides many binding sites for the nuclease. In the absence of cleavage, as shown here for an inactive dimeric variant of Serratia nuclease, huge networks are formed between the enzyme and the macromolecular substrate that lead to precipitation, similarly as observed with antibodies and multivalent antigens (immunoprecipitation). With active dimeric variants such networks are not formed as substrate binding is immediately followed by cleavage. However, nucleic acids cleaved at one site are likely to stay associated with the enzyme after cleavage if the nucleic acid is bound also by the other subunit which then may cleave the nucleic acid at another site. This leads to a processive degradation of the nucleic acid substrate. At low concentrations of enzyme a dimer following a processive mechanism will be more effective than a monomer following a distributive mechanism in degrading nucleic acids, because finding a new site for cleavage under these conditions is not rate-limiting for the dimeric enzyme. It is conceivable that S. marcescens which secretes several enzymes, among them several proteases (49, 50), lipases (51-53), and chitinases (54, 55) to make available nutrients from the environment, has evolved to produce such a dimeric nuclease to make efficient use also of nucleic acids. This evolutionary achievement is not unique to Serratia nuclease, as other members of the Serratia family of nucleases, for example, EndoG (16), are dimeric. However, it seems, as if S. marcescens has found an independent solution, because amino acid residues forming the dimer interface are not conserved among the dimeric nucleases, in contrast to amino acid residues that make up the catalytic core.
Another feature of the mode of cleavage observed with Serratia nuclease, namely like several other nonspecific deoxyribonucleases to cleave double-stranded DNA in a diplotomic fashion (for review, see Ref. 48), i.e. in both strands "simultaneously," is not dependent on the dimer state but also may help to efficiently degrade high molecular weight DNA to small oligodeoxynucleotides.
In conclusion, we have analyzed the role of the dimer state for the Serratia nuclease and shown that it is of importance for the processive and, therefore, efficient degradation of nucleic acids, even at low concentrations. The approach we have taken, namely to compare the enzymatic activity of obligatory monomeric and dimeric variants is sufficiently general to be of use also for other systems.
It remains to be explained why the Serratia nuclease is a
dimer and the Anabaena nuclease a monomer, despite the fact
that they apparently perform the same function. One could argue that nature just has not gotten around to dimerizing the Anabaena
enzyme, because the evolutionary pressure on Anabaena sp.,
an organism capable of making use of light energy, has not been as
strong as on S. marcescens which is absolutely dependent on
nutrients from the environment to cover its energy requirements.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Dr. T. Schmidt and Dr. A. Skerra for valuable discussions concerning the Strep-tag II peptide and the kind gift of StrepTactin prior to its commercial availability, Dr. C. Urbanke and Dr. F. Mayer for the analysis of Serratia nuclease-DNA complexes by analytical ultracentrifugation and electron microscopy, respectively. We are grateful to Dr. K. L. Krause for communicating unpublished results, Dr. P. Friedhoff for valuable discussions, and S. Hund as well as U. Steindorf for expert technical assistance.
![]() |
FOOTNOTES |
---|
* This work was supported by Deutsche Forschungsgemeinschaft Grant Pi 122/9-2, the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie, and the Fonds der Chemischen Industrie.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 49-641-9935400;
Fax: 49-641-9935409; E-mail:
alfred.m.pingoud{at}chemie.bio.uni-giessen.de.
1 T. Nozaki and G. A. M. Cross, unpublished results.
2 K. Krause, personal communication.
3 G. Meiss, O. Gimadutdinow, and A. Pingoud, manuscript in preparation.
4 S140C_X denotes the cross-linked S140C dimer. An analogous abbreviation is used for the other cross-linked Serratia nuclease variants.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|