Biosynthesis of Osteogenic Growth Peptide via Alternative
Translational Initiation at AUG85 of Histone H4
mRNA*
Itai
Bab
,
Elisheva
Smith§,
Hanna
Gavish
,
Malka
Attar-Namdar
,
Michael
Chorev¶,
Yu-Chen
Chen
,
Andrash
Muhlrad
,
Mark J.
Birnbaum
,
Gary
Stein**, and
Baruch
Frenkel§
From the
Bone Laboratory, Faculty of Dental Medicine,
Hebrew University of Jerusalem, Jerusalem 91120, Israel, the
§ Departments of Orthopaedic Surgery and Biochemistry and
Molecular Biology and the Institute for Genetic Medicine, University of
Southern California School of Medicine, Los Angeles, California 90033, the ¶ Division of Bone and Mineral Metabolism, Department of
Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School,
Boston, Massachusetts 02215, the
Department of Biology,
Merrimack College, North Andover, Massachusetts 01845, and the
** Department of Cell Biology, University of Massachusetts Medical
Center, Worcester, Massachusetts 01655
 |
ABSTRACT |
The osteogenic growth peptide (OGP) is an
extracellular mitogen identical to the histone H4 (H4) COOH-terminal
residues 90-103, which regulates osteogenesis and hematopoiesis. By
Northern analysis, OGP mRNA is indistinguishable from H4 mRNA.
Indeed, cells transfected with a construct encoding
[His102]H4 secreted the corresponding
[His13]OGP. These results suggest production of OGP from
H4 genes. Cells transfected with H4-chloramphenicol acetyltransferase
(CAT) fusion genes expressed both "long" and "short" CAT
proteins. The short CAT was retained following an ATG
TTG mutation
of the H4 ATG initiation codon, but not following mutation of the
in-frame internal ATG85 codon, which, unlike
ATG1, resides within a perfect context for translational
initiation. These results suggest that a PreOGP is translated starting
at AUG85. The translational initiation at AUG85
could be inhibited by optimizing the nucleotide sequence surrounding
ATG1 to maximally support upstream translational
initiation, thus implicating leaky ribosomal scanning in usage of the
internal AUG. Conversion of the predicted PreOGP to OGP was shown in a cell lysate system using synthetic [His102]H4-(85-103)
as substrate. Together, our results demonstrate that H4 gene expression
diverges at the translational level into the simultaneous parallel
production of both H4, a nuclear structural protein, and OGP, an
extracellular regulatory peptide.
 |
INTRODUCTION |
Histone genes serve as templates for the synthesis of histones
that package DNA during the S phase of the cell cycle, and exhibit
remarkable evolutionary conservation. Each of the main five histone
proteins in mammalian cells, H1, H2A, H2B, H3, and H4, is encoded by a
family of genes, most of which are arranged in clusters and expressed
predominantly in dividing cells (reviewed in Ref. 1). Fewer histone
genes have been described (1), including one Drosophila H4
gene (2), which are replication-independent. Recently, some
extranuclear functions have been proposed for histones, including
microtubule stabilization by histone H1 (3), regulation of cell
proliferation by histones H1 (see Ref. 4, and references therein) and
H2A.X (5), repression of microbial growth by a histone H2A fragment
(6), and stimulation of glucose uptake into adipocytes and myocytes by
histone H4 (7).
The osteogenic growth peptide (OGP), initially isolated from
regenerating bone marrow, is identical to the carboxyl-terminal residues 90-103 of histone H4 (ref. 8 and Fig. 1C). OGP is present in micromolar concentrations in the serum of mammals, including
humans (8, 9), and is secreted by cultured cells such as NIH3T3
fibroblasts, MC3T3-E1 osteoblastic cells (10), and ROS 17/2.8
osteosarcoma cells (Fig. 1A). In cell culture models, OGP
regulates cell proliferation and activity (8, 11). In in
vivo rodent models, OGP increases bone mass (8), stimulates blood
and bone marrow cellularity, and enhances engraftment of bone marrow
transplants (12). The amino acid sequence identity between OGP and the
carboxyl-terminal region of histone H4 prompted us to test the
hypothesis that OGP is derived from histone H4 gene(s). Indeed, we
demonstrate that histone H4 genes do encode OGP, and that OGP synthesis
is supported by leaky ribosomal scanning through the suboptimal AUG
initiator of histone H4 mRNA.
 |
MATERIALS AND METHODS |
Constructs--
pCMVH4His102 (Fig. 1C) is
a glycine 102 to histidine mutant histone H4 (H4) gene driven by the
CMV promoter. The [His102]H4 fragment was prepared by
polymerase chain reaction (PCR) using as template the plasmid pJA5
carrying a rat somatic H4 genomic sequence (Ref. 13; accession no.
X13554). The forward primer, 5'-TCTTCTTGCTCCATTACTGC, started 30 nucleotides downstream of the TATA box (37 nucleotides upstream of the
ATG initiator). The reverse primer,
5'-GAGggatCCGGCTCAGCCGtgGAAGCC, contained a CC
tg
mutation at codon 102 and a BamHI site (substituted nucleotides are in lowercase) starting 4 base pairs downstream of the
stop codon (bold). The PCR product was digested with BamHI and cloned between the PvuII and BamHI sites of
the mammalian expression vector pCEP4 (Invitrogen, San Diego, CA).
Plasmids containing H4-CAT fusion genes were constructed via an
intermediate construct, pSVdCAT, derived from pSV2CAT (14). In pSVdCAT,
a fragment between the unique SfiI site (juxtaposed the
first transcription start site) and the CAT ATG initiation codon, is
replaced by 17 base pairs containing two unique restriction sites, for
EcoRV and XbaI. The sequence of pSVdCAT in the
fusion area downstream of the SV40 promoter is
CGAGGCCGGATATCTAAGGAAGCTAATCTAGAGAAA (original pSV2CAT sequences in italics, newly introduced restriction sites underlined, CAT gene codons 2 and 3 in bold). The SV40-H4-CAT plasmids (Figs. 2A and 3A) were then constructed
by inserting H4-derived coding sequences between the EcoRV
and XbaI sites of pSVdCAT. In each case the insert was
obtained by PCR with reverse primers (containing XbaI sites)
and forward primers as depicted below, using as templates genomic
clones of either a rat somatic H4 (13) or the human H4FO108 (15)
histone gene. The PCR products were digested with XbaI and
inserted into pSVdCAT.
The H4-CAT coding sequences inserted in pSVdCAT either contained
full-length H4 sequences (pSVrH4CAT and pSVFO108CAT; Fig. 2A) or were truncated downstream of H4 codon 86 (constructs
of the pSVrH4
87-103CAT type). In the former case, the in-frame H4-CAT fusion is via a CTA leucine codon, which replaces the
H4 stop codon and is followed by the GAG codon encoding glutamate 2 of
CAT. In the latter case, a CTA leucine codon is introduced between the
H4 GAT codon encoding aspartate 86 and the CAT gene GAG codon encoding
glutamate 2. Forward primers used to generate the H4 inserts started 34 base pairs downstream of the H4 TATA box. They were
5'-aTCTTCTTGCTCCATTACTGC for pSVrH4CAT; 5'-AtCTGTCTATCGGGCTCCAGC for
pSVFO108CAT; 5'-TCTTCTTGCTCCATTACTGC for
pSVrH4
87-103CAT and
pSVrH4
87-103CAT(A/T);
5'-aTCTTCTTGCTCCATTACTGCTCTACTAGGtTGTCTGG for
pSVrH4
87-103CAT(T/A) and
pSVrH4
87-103CAT(T/T); and
5'-aTCTTCTTGCTCCATTACTGCTCTgCcgccaccATGgCTGGACGAGGG for
pSVrH4
87-103CAT(A!/A); lowercase fonts
indicate deviations from the wild type sequence, introduced to either
restore an EcoRV site at the fusion point with pSVdCAT, to
mutate the ATG1 initiator to tTG, or to optimize the
sequence around ATG1 for efficient translation initiation. Reverse primers were 5'-ACACCGtCTagaCCGCCGAAGCCATAGAGCG for
pSVrH4CAT; 5'-AGCGGCtCtagaCCTCCGAAGCCGTAGAGGG for pSVFO108CAT;
5'-GAGCGCGTACtCtAgaTCCATAGCCGTG for pSVrH4
87-103CAT,
pSVrH4
87-103CAT (T/A), and
pSVrH4
87-103CAT (A!/A); and
5'-GAGCGCGTACtCtAgaTCCAaAGCCGTG for
pSVrH4
87-103CAT(A/T) and
pSVrH4
87-103CAT(T/T); lowercase fonts
indicate mutations introduced to generate XbaI sites, or to
mutate ATG85 to tTG (CAa on the bottom strand). Finally, pSVrH4CAT(A!/A) and pSVrH4CAT(T/A) (Fig. 5) were
constructed by replacing an AvaI/BamHI fragment
of pSVrH4CAT, containing a portion of the H4 gene and the CAT gene,
with the respective fragment of either
pSVrH4
87-103CAT(A!/A) or
pSVrH4
87-103CAT(T/A).
Cell Culture and Transfections--
ROS 17/2.8 rat osteosarcoma
cells (16) were maintained in Ham's F-12 medium supplemented with 5%
fetal bovine serum (FBS). NMuMG normal mouse mammary gland cells (17)
were maintained in DMEM containing 10% FBS and 10 µg/ml insulin. DU
145 human prostatic carcinoma cells (18) were maintained in DMEM/RPMI 1640 (1:1) and 10% FBS. BALB/3T3 mouse embryonic cells (19) were
maintained in DMEM supplemented with 10% calf serum, 4 mM L-glutamine, 4.5 g/liter glucose, and 1 mM
sodium pyruvate. CV-1 African green monkey kidney cells (20) were
maintained in DMEM supplemented with 10% FBS. Media were purchased
from Life Technologies, Inc., and serum was from Omega Scientific Inc.,
Tarzana, CA. All transfections were performed with 20 µg of DNA in
100-mm culture dishes. Stable and transient transfection of ROS 17/2.8
cells employed the calcium phosphate (21) or the DEAE-dextran methods, respectively, exactly as in Ref. 22. In some experiments, ROS 17/2.8
cells were also transiently transfected using the
LipofectAMINETM reagent (Life Technologies, Inc.) according
to the manufacturer's recommendations, yielding essentially the same
results. The LipofectAMINETM reagent was also used for
transient transfection of all the other cell lines.
Northern Blot Analysis--
Total RNA was extracted from
proliferating ROS 17/2.8 cell cultures with guanidinium
thiocyanate-phenol-chloroform (23) using the Trizol reagent from Life
Technologies, Inc. Samples (25 µg) were electrophoresed in 1%
agarose gels and blotted onto a Nylon-N+ membrane (Amersham Pharmacia
Biotech). Oligonucleotide probes corresponded to the OGP amino acid
sequence (8), and the codons were selected based on either a
cloned H4 gene (Ref. 13; 5'-GCGCTCAAGCGCCAGGGCCGCACGCTCTATGGCTTCGGC)
or codon usage frequency (Ref. 24; 5'-
GCCGCCAAAGCCATACAGGGTCCGGCCCTGCCGCTTCAGGGC). The oligonucleotides were
labeled by tailing with [
-32P]dATP using terminal
deoxytransferase (Roche Molecular Biochemicals) according to the
manufacturer's protocol. Prehybridization (6 h, 50 °C) and
hybridization (12 h, 50 °C) were in 1× SSC solution containing 2%
SDS, 2× Denhardt's solution, 1% nonfat dry milk, and 200 µg/ml
salmon sperm DNA. The final wash was carried out at 50 °C with 0.1×
SCC and 0.2% SDS.
Western Blot Analysis--
Cells were harvested in ice-cold
phosphate-buffered saline, pelleted, and lysed in 60 mM
Tris-HCl buffer containing 2% SDS. Protein concentration in cell
lysates was determined using a micro-BCA protein assay kit 23235 (Pierce), and samples supplemented with 2-mercaptoethanol (2%, v/v)
were subjected to SDS-polyacrylamide gel electrophoresis (12% gel).
The resolved proteins were transferred to Hybond ECL nitrocellulose
membrane (Amersham Pharmacia Biotech) and CAT-immunoreactive proteins
visualized with anti-CAT antibodies (5Prime
3Prime, Boulder, CO;
1:300 dilution) and anti-rabbit IgG-conjugated horse radish peroxidase
(Santa Cruz Biotechnology, Santa Cruz, CA) using the ECL
immunodetection kit (Amersham Pharmacia Biotech).
Peptide Synthesis and Purification--
Synthetic peptides were
prepared by the standard solid phase methodology (25). Peptides in
conditioned medium or in cell lysate were purified by boiling, size
exclusion, and reverse phase HPLC as described previously (9).
ELISA--
The presence of OGP, [His13]OGP, and
immunoreactive products was determined in HPLC fractions by ELISA (10)
using corresponding polyclonal antibodies generated in rabbits
challenged with maleimido-modified keyhole limpet hemocyanin conjugated
with either synthetic peptide (8).
[His18]PreOGP Proteolysis--
ROS 17/2.8 cells
were rinsed and harvested in phosphate-buffered saline. Whole cell
extract was prepared by resuspending the cell pellet (~2 × 106 cells) in 0.5 ml of 25 mM Tris-HCl buffer
containing 0.25% Triton X-100, followed by homogenization (20 strokes
with a tight fitting pestle) and sonication (four intervals of 10 s). Synthetic [His18]PreOGP was incubated with ROS 17/2.8
cell extracts for 1 h at 37 °C. Peptides were isolated from the
reaction mixture by boiling, size exclusion, and reverse phase HPLC and
the eluted fractions subjected to ELISA using
anti-[His13]OGP antibodies.
 |
RESULTS |
Histone H4 Gene Expresses OGP--
Although OGP, present
abundantly in the serum and in cell culture media, is identical to the
H4 carboxyl terminus, it was not known whether the two polypeptides, H4
and OGP, could be synthesized from the same template. The possible
occurrence of a non-H4 mRNA that encodes OGP was addressed by
Northern analysis of ROS 17/2.8 cells, which we had confirmed secrete
OGP (Fig. 1A). The probe was a
radiolabeled oligonucleotide complementary to the codons that most
likely encode the reported OGP amino acid sequence (8) based on codon
usage frequency (24). A parallel RNA blot was probed with a
radiolabeled oligonucleotide complementary to the OGP-respective
sequence of a known rat somatic H4 gene (Ref. 13; accession no.
X13554). As shown in Fig. 1B, the "common usage" OGP
probe hybridized with a single-size short transcript(s), which co-migrated with H4 mRNA. Thus, OGP is likely encoded exclusively by H4 mRNA(s), although the possibility of OGP translation from a
transcript similar in size to, yet distinct from, H4 mRNA cannot be
excluded.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
OGP is a product of histone H4 gene(s).
A, accumulation of immunoreactive OGP
(irOGP) in culture medium of ROS 17/2.8 cells. Cells
were cultured and irOGP determined as reported (10). Data
represent mean ± S.D. obtained in triplicate culture wells at
each time point. B, Northern blot analysis of ROS 17/2.8
cells with an OGP common usage codon probe. Total RNA was extracted
from proliferating ROS 17/2.8 cells and two identical samples subjected
to Northern blot analysis. Lane 1, the membrane
was probed with an oligonucleotide complementary to a hypothetical OGP
mRNA predicted from codon usage frequency (24); lane
2, a parallel membrane was probed with an oligonucleotide
corresponding to the OGP domain of a rat somatic H4 gene (13).
Bars represent location of the 28 and 18 S ribosomal RNA.
C, schematic illustration of H4 gene and
pCMVH4His102. Histone H4 gene is shown at the
top with OGP represented by a shaded box and
transcription start site indicated by horizontal
arrow. Codons encoding H4 and OGP NH2 and COOH
termini are numbered (arrowheads). pCMVH4His102 contains histidine 102-tagged
(italic) histone H4 coding sequence, flanked by CMV promoter
(hatched box) and SV40 intron and polyadenylation
signal sequences (stippled box).
Shaded box with black bar
represents [His13]OGP coding sequence. OGP and
[His13]OGP amino acid sequences are
underlined. Arrows indicate chymotrypsin-like
cleavage sites. pCMVH4His102 was constructed using pCEP4
(Invitrogen), thus providing resistance to hygromycin B. D
and E, secretion of [His13]OGP by ROS 17/2.8
cells carrying pCMVH4His102. Cells were transfected with
pCMVH4His102 and selected with hygromycin B. Forty-eight-hour conditioned medium was collected from the stable
transfectants cultured in serum-free, bovine serum albumin-supplemented
medium (8). Chromatographic fractions eluted at 17-22% acetonitrile
were screened for the presence of [His13]OGP by ELISA.
Peak region of ir[His13]OGP was subjected to a second
reverse phase cycle using the same conditions and screened with
anti-[His13]OGP antibodies (D). Control
reverse phase profiles of synthetic OGP (i.e. H4-(90-103))
and [His13]OGP (i.e.
[His102]H4-(90-103)) are shown in (E).
------, immunoreactivity; - - -, light absorbance. A similar
[His13]OGP peak was observed in two independent
experiments, but not in conditioned medium from nontransfected
cells.
|
|
To directly demonstrate the synthesis of OGP from an H4 mRNA, we
introduced a histidine 102-tagged H4 gene into cells and assayed medium
conditioned by these cells for the corresponding tagged OGP. ROS 17/2.8
cells were stably transfected with pCMVH4His102 (Fig.
1C), containing a CMV-driven rat somatic H4 gene (13), in
which the GGC glycine 102 codon was replaced by CAC, encoding histidine. If OGP is produced from this H4 gene, then the transfected cells may secrete an OGP molecule with a glycine to histidine mutation
at position 13 ([His13]OGP). Secretion of
[His13]OGP by the transfected cells was assayed by
reversed-phase HPLC fractionation of conditioned medium and ELISA with
anti-[His13]OGP antibodies. As shown in Fig.
1D, [His13]OGP was readily detectable in
medium conditioned by the transfected cells. The secreted
immunoreactive [His13]OGP was eluted at 19.8%
acetonitrile (Fig. 1D), identical to the elution profile of
synthetic [His13]OGP, and distinct from the synthetic
wild type OGP, which was eluted at 20.8% acetonitrile (Fig.
1E). Identity of the immunoreactive [His13]OGP
was confirmed by amino acid sequencing. No [His13]OGP was
detected in medium conditioned by nontransfected ROS 17/2.8 cells (data
not shown). Thus, a histidine-tagged H4 coding sequence gave rise to a
secreted histidine-containing OGP mutant in transfected ROS 17/2.8
cells, suggesting that this and perhaps other H4 genes encode both H4,
a component of the eukaryotic DNA packaging apparatus, and OGP, a
secreted regulatory polypeptide.
Production of Long and Short CAT Proteins from H4-CAT Fusion
Genes--
To further investigate the production of both H4 and OGP
from H4 genes we constructed two CAT-tagged H4 genes (Fig.
2A), in which the CAT
sequence, starting at its second codon, was fused in frame to the H4
coding sequence of either the rat somatic H4 gene used in Fig. 1, or to
the coding sequence of a human H4 gene, H4FO108 (Ref. 15; accession no.
M16707). Each of these constructs, pSVrH4CAT and pSVH4FO108CAT, encodes
an H4-CAT fusion protein of ~35 kDa, comprising ~10-kDa and
~25-kDa H4 and CAT moieties, respectively. However, if the mechanism
of OGP synthesis from H4 genes (Fig. 1) is not interfered with by the
CAT tag, then an additional, shorter CAT derivative of ~26 kDa should
be produced from each of these constructs. The two plasmids were each
transiently transfected into ROS17/2.8 cells and whole cell extracts
subjected to Western analysis using anti-CAT antibodies. As shown in
Fig. 2B for both of these constructs (lanes
3 and 4), the 35-kDa band representing the
full-length fusion protein (double arrowhead) is
accompanied by a lower molecular mass CAT-immunoreactive doublet with
apparent molecular masses of 25.7 kDa (arrowhead) and 24.8 kDa (small arrow). The 25.7-kDa band is
consistent with the production of an OGP-CAT fusion protein from the
H4-CAT genes. The 24.8-kDa CAT species, which co-migrates with a CAT
protein expressed from pSV2CAT (lane 1), may
represent a proteolytic product of the 35- and/or 25.7-kDa protein (see
below). These results are consistent with the conclusion from Fig. 1,
that the rat somatic X13554 H4 gene encodes both H4 and OGP, and
suggest that this may be shared by other H4 genes.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 2.
Production of long and short CAT proteins
from histone H4-CAT fusion genes. A, schematic
illustration of SV-H4-CAT constructs derived from pSV2CAT (14) by
introducing full-length histone H4 coding sequences upstream of and in
frame with the CAT gene. Both the H4 stop codon and the CAT initiation
codon are missing in these constructs. H4 sequences are either from a
rat somatic H4 (pSVrH4CAT) or the human H4FO108 (pSVH4FO108CAT) gene.
Striped box, SV40 promoter and enhancer;
clear boxes, sequences of either the rat or the
human H4 gene; shaded boxes, OGP-respective
sequence; meshed box, CAT gene and SV40 intron
and polyadenylation signals. B, Western analysis of
CAT-immunoreactive proteins. ROS 17/2.8 osteosarcoma cells were
transiently transfected with pSV2CAT (14) (lane
1), an unrelated plasmid (lane 2),
pSVH4FO108CAT (lane 3), or pSVrH4CAT
(lane 4), and whole cell extract subjected to
Western analysis using anti-CAT antibodies. Double
arrowhead indicates the 35-kDa H4-CAT fusion protein.
Arrowhead and small arrow indicate a
25.7- and a 24.8-kDa CAT-immunoreactive doublet. The 25.7-kDa band
marked by arrowhead is likely OGP-CAT. Note three
nonspecific bands demonstrated by cells transfected with an unrelated
plasmid (lane 2). A similar ratio between the
intensities of the 35- and the 25.7-kDa bands was observed in four
independent experiments. The 24.8-kDa band exhibited varying degrees of
relative intensity, either similar or higher than that shown
here.
|
|
Production of Short CAT from H4-CAT Fusion Gene Does Not Require
Proteolytic Sites at the H4 COOH Terminus--
Production of both OGP
(Fig. 1D) and the short CAT proteins (Fig. 2) could occur
via a chymotrypsin-like cleavage of H4 at the
Tyr89-Ala90 site (Fig. 1C). To
examine this possibility, we prepared a pSVrH4CAT internal deletion
construct, pSVrH4
87-103CAT (abbreviated A/A;
Fig. 3A), in which the histone
codons 87-103, containing this proteolytic site, are missing. The
deleted sequence included an additional chymotrypsin-like cleavage
site, between Tyr99 and Gly100 (Fig.
1A), which could have also contributed to production of the
short CAT forms (Fig. 2B), but it did not include the
ATG85 codon (see below). Western analysis of ROS 17/2.8
cells transfected with the A/A construct (Fig.
3B, lane 3) clearly indicates
expression of two CAT species (~35 and ~25 kDa), similar to those
observed with constructs containing full-length H4 sequences (Fig.
2B). This result suggests that the generation of alternative
CAT products observed in cells transfected with H4-CAT fusion genes
does not require proteolytic cleavage anywhere between residues 87 and 103 of the H4-CAT fusion protein.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 3.
Production of short CAT protein from H4-CAT
fusion gene is dependent on intact ATG85, does not require
the ATG1 initiator, and inhibited by optimizing the
sequence around ATG1 to better support translational
initiation. A, pSVrH4 87-103CAT is
schematically illustrated in relation to H4 gene. The sequence encoding
H4 residues 87-103 is deleted, and the H4 GAT86 codon is
fused in-frame to the CAT gene GAG2 codon. In the three
constructs illustrated below pSVrH4 87-103CAT
(abbreviated A/A), either ATG85,
ATG1, or both (indicated by A) are mutated to
TTG (indicated by T). These three constructs are abbreviated
as A/T, T/A and T/T, respectively. In
pSVrH4 87-103CAT(A!/A), the nucleotide
sequence surrounding ATG1 was altered to optimize
translational initiation. Box designation is as in Fig. 2A.
B, Western analysis of ROS 17/2.8 cells transiently
transfected with an unrelated plasmid (lane 1),
pSV2CAT (14) (lane 2), A/A
(lane 3), A/T (lane
4), T/A (lane 5), or
T/T (lane 6). CAT immunodetection was
performed as in Fig. 2B. C, same as B,
with A!/A (lane 1), A/A
(lane 2), and an unrelated plasmid
(lane 3). Single and double
arrowheads indicate CAT-immunoreactive proteins of ~25 and
~35 kDa, respectively.
|
|
De Novo Production of Short CAT from H4-CAT Fusion
Gene--
Production of OGP from H4 genes could occur de
novo by translational initiation at the AUG85 codon
(Fig. 1C), followed by removal of five amino-terminal
residues. The feasibility of such de novo
synthesis was examined by constructing
pSVrH4
87-103CAT(T/A), which differs from
pSVrH4
87-103CAT in that the H4 ATG initiator is mutated
to TTG (Fig. 3A). As expected, cells transfected with this
construct (abbreviated T/A) do not express the ~35-kDa H4-CAT fusion protein (Fig. 3B, lane
5). However, the ~25-kDa CAT form is fully retained,
indicating its production in the absence of the long CAT form, likely
via translational initiation at AUG85. Enhanced expression
of the short CAT from the T/A as compared with the
A/A construct (Fig. 3B), confirmed with three
independent pairs of plasmid preparations, may be explained by more
rapid ribosomal scanning through the otherwise translated H4 codons 1-84.
ATG85 Is Required for Production of Short CAT from
H4-CAT Fusion Gene--
To directly address involvement of the
ATG85 codon in synthesis of the short CAT form, ROS 17/2.8
cells were transfected with pSVrH4
87-103CAT(A/T), which differs from
pSVrH4
87-103CAT in that ATG85 is
substituted by TTG. As shown in Fig. 3B (lane 4), this mutation specifically abrogated synthesis of the
short CAT form, suggesting that alternative translation is indeed
involved in the production of the ~25-kDa protein. Finally, neither
the long nor the short CAT forms were detected in cells transfected with pSVrH4
87-103CAT(T/T) (Fig.
3B, lane 6), in which both
ATG1 and ATG85 had been replaced by TTG.
Together, these results demonstrate that the ATG85 codon of
the rat somatic H4 gene functions as an alternative translational initiator.
Translational Initiation at AUG85 Is Supported by
Suboptimal Nucleotide Sequence around AUG1--
As in most
other higher eukaryotic H4 genes (Table
I), the initiation codon of the rat
somatic X13554 H4 gene used in this study is followed by a thymidine.
Because guanine in this position is the optimal nucleotide for high
fidelity translational initiation (26, 27), we hypothesized that
translational initiation at AUG85 occurs when ribosomal
scanning fails to recognize the AUG1 codon as a translation
start site (26, 27). To test this hypothesis, we constructed
pSVrH4
87-103CAT(A!/A) (abbreviated A!/A) in which nucleotides flanking the ATG1
codon are substituted from ACTAGGAAGATGT to
GCCGCCACCATGG. The latter sequence provides the most optimal
environment for translational initiation (27). As shown in Fig.
3C, pSVrH4
87-103CAT(A!/A) transfected into ROS17/2.8 cells gave rise to an increased level of the
~35-kDa CAT protein, accompanied by a decrease in the ~25-kDa CAT
form. Thus, optimization of the rat somatic H4 sequence around ATG1 to enhance translational initiation inhibited
utilization of the alternative AUG85 initiator, suggesting
that translational initiation at AUG85 is attributable
primarily to leaky ribosomal scanning through AUG1.
View this table:
[in this window]
[in a new window]
|
Table I
Context of ATG1 and ATG85 of representative H4 genes
The nucleotide sequence flanking the first and 85th codons of
representative histone H4 genes are shown for some higher and lower
eukaryotic organisms. Horizontal arrows indicate the two genes used in
the present study. ATG1 and ATG85 are in bold, as are
nucleotides at positions 3 and +4 relative to each ATG (the A being
+1). Nucleotides at these positions that do not comply with the
(A/G) NNATGG consensus for translational
initiation (26, 27) are in lowercase.
|
|
Conversion of PreOGP (H4-(85-103)) to OGP
(H4-(90-103))--
Translational initiation at AUG85 of
H4 genes predicts the synthesis of a 19-amino acid peptide,
H4-(85-103), hereby designated PreOGP, which may be converted to OGP
by removal of its five amino-terminal residues. To experimentally
address this post-translational modification, we followed the fate of
synthetic [His18]PreOGP upon incubation with ROS 17/2.8
whole cell lysate. The synthetic PreOGP was tagged with histidine 18 in
order to eliminate possible misinterpretation of the results due to the
presence of endogenous wild type OGP. HPLC fractions of peptides
isolated from the reaction mixture after 1 h of incubation at
37 °C were screened by ELISA with anti-[His13]OGP
antibodies. In addition to the [His18]PreOGP substrate
eluted at 40 min, two [His13]OGP-immunoreactive peaks
were observed (Fig. 4A). The
major peak had a retention time of 25 min, identical to that of
[His13]OGP, and was confirmed as such by amino acid
sequencing. Sequencing of a second, smaller peak, with a retention time
of 8.3 min, revealed it was identical to the five carboxyl-terminal
residues (positions 15-19) of [His18]PreOGP
(i.e. [His102]H4-(99-103)), and this was
corroborated by the identical retention time of a synthetic
[His102]H4-(99-103) peptide (Fig. 4B).
Interestingly, this pentapeptide, known as historphin, has opiate-like
and chronotropic effects in heart muscle and intestine (28). Thus, ROS
17/2.8 cells exhibit proteolytic activities capable of converting
PreOGP mainly to OGP, and, to a lesser extent, to historphin
(OGP-(10-14)).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
Conversion of PreOGP to OGP. Nine
nanomoles of synthetic [His18]PreOGP (i.e.
[His102]H4-(85-103)) were incubated with ROS 17/2.8 cell
extract (3.4 mg of protein) at 37 °C for 1 h. Peptides were
isolated from the reaction mixture and subjected to reverse phase HPLC,
followed by ELISA with anti-[His13]OGP antibodies.
A, chromatographic fractions eluted at 14-37% acetonitrile
were screened for the presence of [His13]OGP and
immunoreactive peptides. Similar results were reproduced in four
independent experiments. ------, cell extract incubated with
[His18]PreOGP; - - -, control extract without
exogenously added peptide. B, control reverse phase profile
of synthetic [His18]PreOGP (i.e.
[His102]H4-(85-103)), [His13]OGP
(i.e. [His102]H4-(90-103)) and
[His13]OGP-(10-14) (i.e.
[His102]H4-(99-103)).
|
|
Leaky Ribosomal Scanning of H4-CAT mRNA and Proteolysis of
H4-CAT Protein Give Rise to Different Short CAT Products--
Deletion
of the PreOGP sequence from the H4-CAT fusion gene did not
significantly lessen the amount of the short CAT product relative to
the full-length H4-CAT fusion protein (compare the 25.7-kDa product of
pSVrH4CAT in Fig. 2B to the short CAT product of
pSVrH4
87-103CAT in Fig. 3B). This
observation suggests that in the context of full-length H4, the
proteolytic site involved in the conversion of PreOGP to OGP (Fig. 4)
is inaccessible to proteolytic cleavage. If the site was accessible,
then the PreOGP-containing construct, pSVrH4CAT (Fig. 2B),
would have yielded a higher short/long CAT ratio, because generation of
the short CAT from this construct would have been the consequence of
both leaky ribosomal scanning (same as in
pSVrH4
87-103CAT) and proteolytic processing of the long
CAT. To further test this hypothesis, we constructed pSVrH4CAT(A!/A) (Fig.
5A), containing a full-length
H4-CAT gene, in which the nucleotide sequence surrounding
ATG1 was altered as in
pSVrH4
87-103CAT(A!/A) (Fig. 3) to minimize
leaky ribosomal scanning. As shown in Fig. 5B, the
optimization of ATG1 resulted in obliteration of the
25.7-kDa CAT-immunoreactive band (single
arrowhead) in transfected ROS 17/2.8 cells, suggesting that
this protein (probably OGP-CAT) is synthesized primarily via leaky
ribosomal scanning, and not by proteolysis of full-length H4-CAT. Thus,
the CAT-tagged H4 protein apparently escaped the proteolytic activity
demonstrated in Fig. 4 using PreOGP as substrate.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 5.
Peptides corresponding to the H4 carboxyl
terminus are produced by either leaky ribosomal scanning, proteolysis,
or both. A, schematic illustration of (i)
pSVrH4CAT(A!/A), which differs from pSVrH4CAT (Fig.
2A) in that the nucleotide sequence flanking
ATG1 is modified to increase its fidelity as a
translational initiator; and (ii) pSVrH4CAT(T/A), an
additional derivative of pSVrH4CAT, in which the ATG1 codon
is mutated to TTG. The parent pSVrH4CAT construct is shown at the top.
Box designations as in Fig. 2A. B, Western blot
analysis showing CAT-immunoreactive proteins in ROS 17/2.8 cells
transfected with either pSVrH4CAT (lane 1),
pSVrH4CAT(A!/A) (lane 2),
pSVrH4CAT(T/A) (lane 3), or an
unrelated plasmid (lane 4). Double
arrowhead indicates the 35-kDa H4-CAT fusion protein.
Arrowhead and small arrow mark
25.7-kDa (likely OGP-CAT) and 24.8-kDa (possibly H4-(99-103)CAT)
CAT-immunoreactive products, respectively. C, model for
biosynthesis of H4 carboxyl-terminal peptides. PreOGP is produced by
alternative translational initiation at AUG85, then
proteolyzed to yield OGP. OGP is slowly converted to OGP-(10-14)
(i.e. H4-(99-103)), which, in addition, can be produced
from full-length H4 by proteolytic cleavage. The question
marks (?) denote that precise identity of the
NH2 termini of the 25.7- and 24.8-kDa proteins have not
been established. The CAT derivatives are illustrated to directly
reflect the actual data. A and M represent AUG
codon and methionine residue, respectively. The H4 and OGP-based
synonyms for H4 carboxyl-terminal peptides are presented in the
box at the lower left
corner.
|
|
Unlike the 25.7-kDa OGP-CAT protein, the 24.8-kDa CAT species (Fig.
2B, small arrow) was resistant to
sealing of the leaky ATG1. Its retention in cells
transfected with pSVrH4CAT(A!/A) (Fig. 5, lane
2) suggests a biosynthetic pathway distinct from that of the
25.7-kDa OGP-CAT, perhaps proteolysis of full-length H4-CAT. To test
this possibility, we constructed and transfected cells with
pSVrH4CAT(T/A), containing a full-length H4-CAT gene in
which ATG1 had been mutated to TTG. As shown in Fig. 5
(lane 3), the expected absence of full-length H4-CAT in
these cells is accompanied by specific loss of most, although clearly
not all, of the 24.8-kDa CAT form, suggesting that it was indeed
generated primarily from H4-CAT by proteolysis. The residual 24.8-kDa
CAT form suggests that it may also be produced, to a limited extent, by
proteolysis of the 25.7-kDa CAT form. The pathways contributing to
production of the 25.7-kDa (OGP-CAT?) and the 24.8-kDa
(OGP-(10-14)-CAT?) proteins are schematically illustrated in Fig.
5C.
Cell Type-dependent Ratio between "Long CAT" and
"Short CAT" Produced from H4-CAT Fusion Gene--
Because H4 is
expressed ubiquitously, it was of interest to assess whether
translational initiation at AUG85 would occur in any cell
versus the exclusive utilization of the AUG1
codon by selected cell types. pSVrH4
87-103CAT (Fig. 2)
was transfected into five randomly selected cell lines, and the ratio
between the long and the short CAT forms evaluated by Western blot
analysis using anti-CAT antibodies. As shown in Fig.
6, all the cells tested expressed both
the long and the short CAT species. ROS 17/2.8 and two other cell
lines, DU 145 human prostatic carcinoma cells and CV-1 monkey kidney
cells, expressed the full-length H4-CAT protein at levels that are
severalfold higher than the expression of the short CAT protein. The
short CAT was expressed at levels equal to or higher than the long CAT
in NMuNG mouse mammary gland cells and BALB/3T3 mouse embryonic cells,
respectively. These results suggest that the dual function of H4
mRNA leading to the biosynthesis of distinct products, is shared by
many cells, but the ratio between the two products, H4 and PreOGP,
depends significantly on the cell type. The mechanisms responsible for
this cell type-specific regulation remain to be explored.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 6.
Alternative utilization of H4 mRNA as a
function of cell type. Five cell lines were each transfected with
pSVrH4 87-103CAT (Fig. 3A), and
CAT-immunoreactive proteins visualized by Western analysis of cell
extracts using anti-CAT antibodies. Double and
single arrowheads represent the 35- and 25-kDa
CAT-immunoreactive proteins, respectively. Lane
1, purified CAT; lane 2, ROS 17/2.8
osteosarcoma cells; lane 3, NMuMG normal mouse
mammary gland cells; lane 4, DU145 prostate
cancer cells; lane 5, BALB/3T3 embryonic cells;
lane 6, CV1 monkey kidney cells. Similar results
were obtained in three independent transfections.
|
|
 |
DISCUSSION |
OGP is a regulator of cell growth and activity identical to the
carboxyl terminus of H4 (H4-(90-103)). Similar to all other histone
genes, the H4 genes are present in higher eukaryotes in multiple copies
and they typically lack introns (1, 29). All mammalian H4 genes encode
the same polypeptide. Significant diversity observed in the third
position of most codons as well as outside the protein-coding sequence
is assumed to ensure expression in a variety of cells under broad
physiological conditions. OGP could be a de novo
translational product of any of the multiple H4 gene copies or a
post-translational cleavage product of H4 protein. It could also be a
product of an H4-related gene or an H4-fragmented gene. The Northern
blot analysis carried out herein demonstrated that OGP mRNA(s) is
indistinguishable from H4 mRNA(s) (Fig. 1). Furthermore, we altered
a rat somatic H4 gene (X13554) at codon 102, and showed that this
bona fide H4 gene gave rise to the anticipated
OGP mutant in transfected cells (Fig. 1). Since selection of the rat
somatic H4 gene, as well as the human H4FO108 gene (see below) was
random, our results suggest that OGP is produced from these and
probably other H4 genes.
H4-derived constructs, based on either the rat somatic (X13554) or the
human H4 FO108 (M16707) genes, in which the H4 coding sequences were
fused in frame to the bacterial CAT gene lacking its ATG initiation
codon, gave rise to both long and short CAT-containing proteins (Fig.
2), consistent with the production of OGP from H4 genes. By deletion
and point mutations of the rat H4-CAT fusion gene, it was demonstrated
that production of the long and short proteins depends on
ATG1 and ATG85, respectively, suggesting that
translation can start at either of these methionine codons (Fig. 3). In
addition, we showed that the predicted translation product of the
downstream initiation (H4-(85-103)), which we have designated PreOGP,
is processed to OGP by a ROS 17/2.8 cell extract (Fig. 4). It therefore
appears that the H4 mRNA is translated simultaneously to both H4
protein and PreOGP. The latter is then converted to OGP.
The PreOGP-to-OGP pathway may be mediated by either limited
exopeptidase activity or a specific endopeptidase. Either way, a
CAT-tagged H4 protein did not serve as a substrate for this activity in
transfected cells (Fig. 5), possibly reflecting sequestration of the
proteolytic site when residing within a full-length H4 protein
sequence. As opposed to H4 proteolysis, de novo synthesis of
OGP via alternative translation of H4 mRNA, as suggested by the
present study, facilitates the production and secretion of OGP
independently of H4 protein synthesis. Furthermore, OGP synthesis by
alternative translation avoids production of a truncated H4 protein
(amino acids 1-89), which may be undesirable to the cell. Although
irrelevant to OGP biosynthesis, our experiments with CAT-tagged H4
genes also disclosed proteolysis of the H4 peptide sequence at a site
within the OGP domain (Fig. 5). This activity may be related to the
limited production of OGP-(10-14) from PreOGP and/or OGP (Fig. 4).
This proteolytic activity seems to favor the full-length H4 over PreOGP
or OGP as substrate (Fig. 5). Thus, we propose three previously
unidentified processes in H4 gene expression: (i) alternative
translational initiation at AUG85, giving rise to PreOGP;
(ii) proteolysis between Tyr5 and Ala6 of the
PreOGP, thus yielding OGP; and (iii) proteolysis at a further
COOH-terminal site, with full-length H4 as the preferred substrate.
Possible roles for the latter proteolytic activity include synthesis of
OGP-(10-14) and, perhaps, regulation of H4 stability and availability
for DNA packaging.
Translational initiation at an AUG codon that is not the first
following the transcription start site is uncommon for genes encoding
structural proteins but rather frequently observed in genes encoding
regulatory polypeptides such as cytokines, receptors, protein kinases,
transcription factors, and growth factors (reviewed in Ref. 30). Unlike
viral genes, downstream translational initiation of cellular genes
usually reflects the presence of an mRNA molecule which starts 3'
of the first ATG (reviewed in Ref. 30). However, translational
initiation at a downstream AUG codon can also be mediated by internal
ribosome entry, which has been demonstrated initially in viral and more
recently in cellular genes (see Ref. 31, and references therein).
Finally, when the first AUG is weak due to primary sequence context,
length, or structure of flanking sequences, initiation at such a site
may be "leaky" leading to alternative utilization of a downstream
AUG (reviewed in Ref. 30). Translational initiation at
AUG85 of H4 mRNAs seems to be mediated primarily by
leaky ribosomal scanning through the imperfect sequence context of the
AUG1 codon, as evidenced by the inhibition of downstream
translational initiation observed following optimization of the
suboptimal AUG1 (Figs. 2C and 5). Although
alternative translation via a leaky ribosomal scanning is not
unprecedented (30), the synthesis of H4 protein and OGP from H4
mRNA is striking in that the two products apparently have diverse functions.
Fidelity of ATG initiators is primarily determined by the nucleotides
occupying positions
3 and +4 relative to the A of the ATG, defined as
+1. Optimally, these nucleotides should be a purine and a guanine,
respectively. Indeed, at least one of them is found in most cellular
mRNAs (32). All higher eukaryotic H4 genes known to us, from both
animals and plants, have a purine at position
3. However, position +4
is usually occupied by a thymidine, or more rarely by an adenine, but
never by a guanine (Table I). Although the combination of a purine at
3 and a thymidine at +4 is still rather efficient in supporting
translational initiation, the deviation from the optimal sequence is
sufficient to cause some leaky ribosomal scanning, thereby allowing
alternative translational initiation at a second AUG (26). Thus, based
on sequence analysis, leaky ribosomal scanning through
AUG1, demonstrated in the present study for one randomly
selected H4 gene, may be a common feature of many, if not, all H4 genes
in higher eukaryotes, animals and plants alike. Leaky scanning may be
further enhanced in atypical H4 genes with short leaders (33), such as
the mouse clone 12 H4 gene (Ref. 34; accession no. X13235). In
addition, utilization of the AUG85 codon to initiate
translation from any given H4 mRNA may vary as a function of the
cell type (Fig. 6) and/or the physiological conditions.
Our results suggest that ATG85 of the rat X13554 H4 gene is
utilized as an alternative translational initiator to the suboptimally flanked AUG1 codon. AUG85 itself resides within
an optimal context for translational initiation, not only in this
specific gene, but almost in every eukaryotic H4 gene (Table I). Thus,
the combination of a suboptimal AUG1 and an optimal
ATG85 appears to be a hallmark of higher eukaryotic H4
genes, lending support to the hypothesis that OGP synthesis by
alternative translation of H4 genes occurs in many eukaryotic organisms
and may have an important evolutionary conserved role(s).
Interestingly, the 85th residue of Styela plicata, as well
as most lower eukaryotic H4 genes, is a leucine (Table I),
demonstrating that a methionine in this position is not imposed by
structural requirements for DNA packaging. It is tempting to speculate
that the selection of H4-AUG85 by higher eukaryotes is
related to mechanisms in these organisms, versus others (35) that allow leaky ribosomal scanning through imperfect 5' proximal initiators. That OGP is ubiquitously expressed in higher eukaryotic cells is suggested not only by sequence analysis of H4 genes, but also
by the identification of OGP in conditioned medium of all cell lines
thus far tested: MC3T3-E1 osteoblasts, NIH3T3 fibroblasts (10) and ROS
17/2.8 osteosarcoma cells (this paper). This conclusion is further
supported by the demonstration of long and short CAT forms produced
from an H4-CAT fusion gene in five randomly selected cell types from
different species (Fig. 6). Still, the variation in the long/short CAT
ratio exhibited by these cells may suggest preferential expression of
OGP by certain cell types. In terms of biological activity, however,
OGP production is probably just one component in a complex regulatory
system, where additional factors, such as receptors for OGP and their
connections with intracellular signaling networks, are most likely
involved in determining the OGP target cell selectivity and the nature
of the cellular response.
In summary, as suggested by sequence analysis of eukaryotic H4 genes,
the present study demonstrates some leaky ribosomal scanning through
AUG1 of H4 mRNA, resulting in alternative translational initiation at AUG85.The predicted alternative translation
product, H4-(85-103) has been designated PreOGP, as it is
proteolytically processed to OGP (e.g. H4-(90-103)), a
circulating peptide that regulates cell growth and activity. This
biosynthetic mechanism, apparently operative in many, if not all,
eukaryotic cycling cells, may play a crucial role in the previously
reported positive feedback circuit of OGP, which controls cell
proliferation (10, 12), as well as in the linkage between cell growth
and differentiation.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Janet Stein, Jane Lian, and
especially Dr. Andrè van Wijnen for critical comments, Lian Liang
and Rebecca Redman for technical assistance, and Diane Gegala for
secretarial support.
 |
FOOTNOTES |
*
This work was supported by the Small Grant Program of
University of Massachusetts Medical Center, by Grant IRG-58-007-40 from the American Cancer Society, by a faculty developmental grant from
Merrimack College, and by Grant 6305194 from the Ministry of Science
and The Arts, Government of Israel.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.

To whom correspondence should be addressed: Inst. for Genetic
Medicine, University of Southern California School of Medicine, 2250 Alcazar St., CSC/IGM240, Los Angeles, CA 90033. Tel.: 323-442-1322; Fax: 323-442-2764; E-mail: frenkel{at}hsc.usc.edu.
 |
ABBREVIATIONS |
The abbreviations used are:
OGP, osteogenic
growth peptide;
PreOGP, 19-amino acid peptide, H4-(85-103);
CAT, chloramphenicol acetyltransferase;
FBS, fetal bovine serum;
DMEM, Dulbecco's modified Eagle's medium;
HPLC, high performance liquid
chromatography;
ELISA, enzyme-linked immunosorbent assay;
PCR<, polymerase chain reaction..
 |
REFERENCES |
-
Doenecke, D.,
Albig, W.,
Bode, C.,
Drabent, B.,
Franke, K.,
Gavenis, K.,
and Witt, O.
(1997)
Histochem. Cell Biol.
107,
1-10[CrossRef][Medline]
[Order article via Infotrieve]
-
Akhmanova, A.,
Miedema, K.,
and Hennig, W.
(1996)
FEBS Lett.
388,
219-222[CrossRef][Medline]
[Order article via Infotrieve]
-
Multigner, L.,
Gagnon, J.,
Van-Dorselaer, A.,
and Job, D.
(1992)
Nature
360,
33-39[CrossRef][Medline]
[Order article via Infotrieve]
-
Class, R.,
Lindman, S.,
Fassbender, C.,
Leinenbach, H., P.,
Rawer, S.,
Enrich, J., G.,
Brady, L. W.,
and Zeppezauer, M.
(1996)
Am. J. Clin. Oncol.
19,
522-531[CrossRef][Medline]
[Order article via Infotrieve]
-
Watabe, Y.,
Kuramochi, H.,
Furuya, Y.,
Inagaki, N.,
Seino, S.,
Kimura, S.,
and Shimazaki, J.
(1996)
J. Biol. Chem.
271,
25126-25130[Abstract/Free Full Text]
-
Kim, H. S.,
Park, C. B.,
Kim, M. S.,
and Kim, S. C.
(1996)
Biochem. Biophys. Res. Commun.
229,
381-387[CrossRef][Medline]
[Order article via Infotrieve]
-
Louters, L. L.,
Michele, D. E.,
and Pearson, J. D.
(1996)
Biochimie
78,
39-45[CrossRef][Medline]
[Order article via Infotrieve]
-
Bab, I.,
Gazit, D.,
Chorev, M.,
Muhlrad, A.,
Shteyer, A.,
Greenberg, Z.,
Namdar, M.,
and Kahn, A.
(1992)
EMBO J.
11,
1867-1873[Abstract]
-
Greenberg, Z.,
Chorev, M.,
Muhlrad, A.,
Shteyer, A.,
Namdar-Attar, M.,
Casap, N.,
Tartakovsky, A.,
Vidson, M.,
and Bab, I.
(1995)
J. Clin. Endocrinol. Metab.
80,
2330-2335[Abstract]
-
Greenberg, Z.,
Gavish, H.,
Muhlrad, A.,
Chorev, M.,
Shteyer, A,
AttarNamdar, M.,
Tartakovsky, A.,
and Bab, I.
(1997)
J. Cell. Biochem.
65,
359-367[CrossRef][Medline]
[Order article via Infotrieve]
-
Robinson, D.,
Bab, I.,
and Nevo, Z.
(1995)
J. Bone Miner. Res.
10,
690-696[Medline]
[Order article via Infotrieve]
-
Gurevitch, O.,
Slavin, S.,
Muhlrad, A.,
Shteyer, A.,
Gazit, D.,
Chorev, M.,
Vidson, M.,
Namdar-Attar, M.,
Berger, E.,
Bleiberg, I.,
and Bab, I.
(1996)
Blood
88,
4719-4724[Abstract/Free Full Text]
-
Wolfe, S. A.,
Anderson, J. V.,
Grimes, S. R.,
Stein, G. S.,
and Stein, J. S.
(1989)
Biochim. Biophys. Acta
1007,
140-150[Medline]
[Order article via Infotrieve]
-
Gorman, C. M.,
Moffat, L. F.,
and Howard, B. H.
(1982)
Mol. Cell. Biol.
2,
1044-1051[Medline]
[Order article via Infotrieve]
-
Pauli, U.,
Chrysogelos, S.,
Stein, G.,
Stein, J.,
and Nick, H.
(1987)
Science
236,
1308-1311[Medline]
[Order article via Infotrieve]
-
Majeska, R. J.,
Rodan, S. B.,
and Rodan, G. A.
(1980)
Endocrinology
107,
1494-1503[Abstract]
-
Maiyar, A. C.,
Huang, A. J.,
Phu, P. T.,
Cha, H. H.,
and Firestone, G. L.
(1996)
J. Biol. Chem.
271,
12414-12422[Abstract/Free Full Text]
-
Schuur, E. R.,
Henderson, G. A.,
Kmetec, L. A.,
Miller, J. D.,
Lamparski, H. G.,
and Henderson, D. R.
(1996)
J. Biol. Chem.
271,
7043-7051[Abstract/Free Full Text]
-
Kogerman, P.,
Sy, M. S.,
and Culp, L. A.
(1998)
Clin. Exp. Metastasis
16,
83-93[CrossRef][Medline]
[Order article via Infotrieve]
-
Brinkmeier, M. L.,
Gordon, D. F.,
Dowding, J. M.,
Saunders, T. L.,
Kendall, S. K.,
Sarapura, V. D.,
Wood, W. M.,
Ridgway, E. C.,
and Camper, S. A.
(1998)
Mol. Endocrinol.
12,
622-63321[Abstract/Free Full Text]
-
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell. Biol.
7,
2745-2752[Medline]
[Order article via Infotrieve]
-
Frenkel, B.,
Montecino, M.,
Green, J.,
Aslam, F.,
Desai, R.,
Banerjee, C.,
Stein, J. L.,
Lian, J. B.,
and Stein, G. S.
(1996)
Endocrinology
137,
1080-1088[Abstract]
-
Chomezynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159[CrossRef][Medline]
[Order article via Infotrieve]
-
Lathe, R.
(1985)
J. Mol. Biol.
183,
1-12[Medline]
[Order article via Infotrieve]
-
Barany, G.,
and Merrifield, R. B.
(1979)
in
The Peptides/1 (Gross, E., and Meienhofer, J., eds), pp. 1-284, Academic Press, New York
-
Kozak, M.
(1986)
Cell
44,
283-292[Medline]
[Order article via Infotrieve]
-
Kozak, M.
(1989)
Mol. Cell. Biol.
9,
5073-5080[Medline]
[Order article via Infotrieve]
-
Kharchenko, E. P.,
Bagrov, A. I.,
and Sokolova, T. V
(1987)
Biulleten Eksperimentalnoi Biologii i Meditsiny
103,
418-20[Medline]
[Order article via Infotrieve]
-
Wells, D.,
and McBride, C.
(1989)
Nucleic Acids Res.
17 (suppl.),
311-346[Medline]
[Order article via Infotrieve]
-
Kozak, M.
(1991)
J. Cell Biol.
115,
887-903[Abstract]
-
Gan, W.,
La Celle, M.,
and Rhoads, R. E.
(1998)
J. Biol. Chem.
273,
5006-5012[Abstract/Free Full Text]
-
Kozak, M.
(1987)
Nucleic Acids Res.
15,
8125-8148[Abstract]
-
Kozak, M.
(1991)
Gene Exp.
1,
111-115
-
Meier, V. S.,
Bohni, R.,
and Schumperli, D.
(1989)
Nucleic Acids Res.
17,
795[Medline]
[Order article via Infotrieve]
-
Merrick, W. C.,
and Hershey, J. W. B.
(1996)
in
Translational Control (Hershey, J. W. B., Mathews, M., and Sonenberg, N., eds), pp. 31-69, Cold Spring Harbor Press, Cold Spring Harbor, NY
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.