From the Diabetes Unit, Centre Médical
Universitaire, 1211 Genève 4, Switzerland and the
¶ Laboratoire de Differentiation Cellulaire et Moléculaire,
CNRS EP56, Institut Pasteur, 59019 Lille Cedex, France
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() |
---|
The promoter element G1,
critical for The glucagon gene is expressed in the We report here that the factor that interacts with Cdx-2/3 to form the
B3 complex is Pax-6, a member of the pax family
of vertebrate genes that contain conserved paired and homeo boxes encoding DNA-binding domains (9). Pax-6 has previously been reported to
be expressed in the endocrine pancreas (10), to be critical for
Cell Culture and DNA Transfection--
The glucagon-producing
hamster InRIG9 (13) and the non-islet Syrian baby hamster kidney
(BHK-21) cell lines were grown in RPMI 1640 (Seromed, Basel,
Switzerland) supplemented with 5% heat-inactivated fetal calf serum
and 5% heat-inactivated newborn calf serum, 2 mM
glutamine, 100 units/ml of penicillin, and 100 µg/ml of streptomycin. InR1G9 cells were generously provided by Dr. R. Takaki (Medical College
of Oita, Oita, Japan). BHK-21 cells were transfected by the calcium
phosphate precipitation technique (14) using 10-12 µg of total
plasmid DNA/10-cm Petri dish. 1 µg of pSV2A pap, a plasmid containing
the human placental alkaline phosphatase gene, driven by the SV40 long
terminal repeat was added to monitor transfection efficiency (15).
Transfection of glucagon-producing InR1G9 cells was done using the
DEAE-dextran method as described previously (16). Expression vectors
consisted of the hamster Cdx-2/3 cDNA, kindly provided
by Dr. M. German (University of California, San Francisco, CA), and the
quail pax-6 cDNA (17), both cloned in pSG5 (Stratagene).
Reporter plasmids consisted of 1) wild-type and mutated (at nucleotides
CAT and Protein Assays--
Cell extracts were prepared 36-48 h
after transfection and analyzed for CAT and alkaline phosphatase
activities as described previously (6). Quantification of acetylated
and nonacetylated forms was done with a PhosphorImager (Molecular
Dynamics). A minimum of three independent transfections were performed,
each of them carried out in duplicate. Protein concentrations were
determined with a Bio-Rad protein assay kit.
EMSAs--
EMSAs were performed as described previously (12)
using nuclear extracts prepared according to Schreiber et
al. (19) or 0.1 µg of GST fusion proteins. Oligonucleotides
containing the wild-type or mutated G1 (G1-56, G1-33,
G1-33r3, and G1-33r5; see Fig. 1) or G3 (G3; see Fig. 1)
sequences have previously been described (5, 6). Anti-Cdx-2/3 and
anti-Isl-l antibodies were generously provided by Drs. M. German
(University of California) and D. Drucker (Toronto University, Toronto,
ON, Canada), respectively; anti-Pax-6 antibodies were raised against
the paired domain or the homeodomain of the quail protein (serum 11 and
13, respectively, in Ref. 17).
GST Fusion Proteins and Protein-Protein Interaction in
Vitro--
For construction of GST fusion proteins, pax-6
paired, homeo, and paired linker homeo boxes were generated from
InR1G9 cells by reverse transcription-polymerase chain reaction using
the primers Pax-6 PD5', actggatcc-cagcttggtggtgtctttg; Pax-6 PD3',
actaagcttgctagccaggttgcgaagaac; Pax-6 HD5',
actggatccggctgccagcaacaggaag; and Pax-6 HD3',
actaagcttgtgttgctggcctgtcttc and inserted into the
BamHI/HindIII sites of pGEX-4T3 (Amersham Pharmacia Biotech). GST fusion proteins were expressed in
Escherichia coli and purified according to the
manufacturers' recommendations. L-[35S]Methionine-labeled Cdx-2/3 was
generated in vitro using the TNT wheat germ extract system
(Promega). For protein-protein interaction, 10 µg of GST or GST
fusion proteins were bound to 25 µl of glutathione-Sepharose beads in
a total volume of 50 µl of incubation buffer containing 12 mM Hepes, pH 7.9, 4 mM Tris/HCl, pH 7.9, 50 mM NaCl, 10 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride for 20 min at room temperature. Beads were washed three times,
resuspended in 20 µl of incubation buffer, and incubated with 10 µl
of L-[35S]methionine-labeled Cdx-2/3 for 40 min on ice. Beads were then washed five times at room temperature with
200 µl of washing buffer (20 mM Tris/HCl, pH 8, 100 mM NaCl, 1 mM EDTA, 0.5% Nonidet P-40), recovered in SDS-polyacrylamide gel electrophoresis loading buffer, and
bound proteins were analyzed by SDS-polyacrylamide gel electrophoresis followed by autoradiography.
We previously reported that G1 is a large, 50-bp-long
proximal upstream promoter element critical for -cell-specific expression of the glucagon gene,
contains two AT-rich sequences important for transcriptional activity.
Pax-6, a paired homeodomain protein previously shown to be required for
normal
-cell development and to interact with the enhancer element
G3 of the glucagon gene, binds as a monomer to the distal
AT-rich site of G1. However, although the paired domain of
Pax-6 is sufficient for interaction with the G3 element,
the paired domain and the homeodomain are required for high affinity
binding to G1. In addition to monomer formation, Pax-6
interacts with Cdx-2/3, a caudal-related homeodomain protein binding to the proximal AT-rich site, to form a heterodimer on
G1. Both proteins are capable of directly interacting in
the absence of DNA. In BHK-21 cells, Pax-6 activates glucagon gene transcription both through G3 and G1, and
heterodimerization with Cdx-2/3 on G1 leads to more than
additive transcriptional activation. In glucagon-producing cells, both
G1 and G3 are critical for basal transcription,
and the Pax-6 and Cdx-2/3 binding sites are required for activation. We
conclude that Pax-6 is not only critical for
-cell development but
also for glucagon gene transcription by its independent interaction
with the two DNA control elements, G1 and
G3.
INTRODUCTION
Top
Abstract
Introduction
References
-cells of the pancreatic
islets, the L cells of the intestine, and specific areas of the brain
(1). The factors controlling glucagon gene expression are still poorly
understood. Pancreas-specific expression of the glucagon gene is
conferred by the islet-specific enhancer elements G2,
G3, and G4 (2-5), and the
-cell-specific
proximal promoter element G1 (2, 3, 5-7). G1
contains two nearly identical 7-bp1 AT-rich sequences
forming a direct repeat that are candidate binding sites for
homeodomain transcription factors. At least three protein complexes
(B1, B2, and B3) interact with
G1, and the integrity of the AT-rich direct repeat is
critical for their binding and for transcriptional activity (2, 6, 7).
We and others have recently characterized the transcription factor that
binds to the proximal 7-bp site as Cdx-2/3, which is encoded by a
caudal-related gene expressed in the endocrine pancreas and the intestine (7, 8). Cdx-2/3 is able to bind with high affinity to the
7-bp proximal AT-rich site of G1 when isolated but binds
intact G1 in glucagon-producing cells preferentially as a
multiprotein complex, B3 (6, 7), when both AT-rich sites
are present.
-cell development (11, 12), and to bind to the enhancer element
G3 of the glucagon gene (11). Our results indicate that the
paired domain of Pax-6 is sufficient for interaction with the
G3 element, whereas both paired domain and homeodomain are
important for interaction with the G1 element. Furthermore, Pax-6 binds to the promoter element G1 preferentially as a
monomer but also as a heterodimer with Cdx-2/3. When both Pax-6 and
Cdx-2/3 are overexpressed in BHK-21 cells, we observe more than
additive effects on transcriptional activation of glucagon gene
expression, suggesting that Pax-6-Cdx-2/3 interactions have functional
consequences on transcription. We conclude that Pax-6 not only is a key
regulator of
-cell development but is also critical for glucagon
gene expression through its independent interaction with the promoter
and enhancer elements, G1 and G3, respectively.
EXPERIMENTAL PROCEDURES
90/
91 or
71/
72) 408-bp fragments (nucleotides
350 to +58)
(
350 CAT, G1M1-350 CAT, and G1M11-350 CAT, respectively); 2) a 196-bp
fragment (nucleotides
138 to +58) linked to oligonucleotides
containing the wild-type or mutated (nucleotides
254 to
258)
G3 sequence (nucleotides
274 to
234 relative to the
transcriptional start site) (G3-138 CAT and G3M6-138 CAT); 3) a
128-bp fragment (nucleotides
75 to + 58) of the 5'-flanking sequence
of the rat glucagon gene linked to the wild-type oligonucleotide G3 (G3-75 CAT) (Refs. 2, 5, and 6; see Fig. 1). These fragments were subcloned into pBLCAT3 (6). RSVCAT (18) served as
positive control.
RESULTS
-cell-specific
expression that binds at least three protein complexes, B1,
B2, and B3 (Ref. 6 and Fig.
1). The more distal enhancer element
G3 can be separated into an A and a B domain; G3 binds four
complexes, C1A and C1B (A domain), which are
islet-specific, and C2 and C3 (B domain), representing ubiquitous proteins (Refs. 5 and 20 and Fig. 1). From our
previous studies, we concluded that the protein complexes B1 and C1A interacting with the G1
and G3 elements, respectively, were similar or identical
inasmuch as they displayed closely related binding affinities for both
G1 and G3 and migration characteristics in
EMSAs (5, 6). Recently, Sander et al. (12) provided evidence
that the paired homeodomain transcription factor Pax-6 interacts with
the A domain of G3 and is critical for
-cell
development. We thus investigated the nature of C1A and
C1B and their relationship with B1. We first
performed EMSAs with nuclear extracts from the glucagon-producing
hamster cell line InRlG9 and 32P-labeled oligonucleotides
containing either G1 (G1-56) or G3 (G3). As
shown in Fig. 2A, three
specific complexes are detected with G1-56, B1,
B2, and B3; additional complexes are also
observed (indicated by asterisks) but have been shown
previously to be nonspecific (6). Two major complexes interact with the
G3 oligonucleotide, C1A and C1B
(Fig. 2B); the ubiquitous complexes C2 and
C3 are of lower intensity and visible only on longer
expositions (5). To more precisely define the relationship between the
complexes that bind G1 and G3, we added as
competitor cold oligonucleotides containing different portions of the
wild-type or mutated element G1 or the wild-type element
G3. Like G1-56, G1-33 representing the AT-rich repeat of
G1 competed for complexes B1, B2,
and B3 formed on G1-56 (Fig. 2A). Mutant
G1-33r5 characterized by a mutation of the 5' AT-rich site of
G1 only competed for B3, whereas the 3' AT-rich
site mutant (G1-33r3) displayed the same competition characteristics
as G1-33. Furthermore, oligonucleotide G1-54 containing the 5'
AT-rich site of G1 competed for complexes B2
and B3. These results indicate that B1 and
B2 interact on overlapping sites within the distal part of
G1-33 as previously reported (Ref. 6 and Fig. 1); however,
B2 may interact on a more restricted site compared with
B1 inasmuch as G1-54 efficiently competes for
B2 but not for B1. Formation of B3,
in contrast, involves both the distal and proximal parts of the core
element oligonucleotide G1-33. Of note, oligonucleotide G3 competes
for both B1 and B3 (Ref. 5 and Fig.
2A). We then applied the same competitor oligonucleotides as
in Fig. 2A on the complexes formed with InR1G9 nuclear
extracts and the 32P-labeled oligonucleotide G3 (Fig.
2B). Neither formation of the islet-specific complex
C1B nor formation of the ubiquitous complexes C2 and C3 are significantly affected by
addition of the competing oligonucleotides (Fig. 2B and data
not shown). In contrast, all oligonucleotides competing for complex
B1 on G1-56 (G1-56, G1-33, G1-33r3, and G3), do also
compete for C1A formed on G3, and oligonucleotides that do
not interfere with B1 (G1-33r5 and G1-54) do not affect C1A. These data show that C1A exhibits similar
binding characteristics as B1 and suggest that
C1A is capable of binding efficiently to the G1
element.
View larger version (20K):
[in a new window]
Fig. 1.
Protein complexes binding to the
G1 promoter and G3 enhancer elements of the rat
glucagon gene 5'-flanking sequence. Schematic representation of
oligonucleotides used in EMSAs that correspond to the wild-type or
mutated DNA control elements. Two 7-bp AT-rich sequences within
G1 forming an imperfect direct repeat are
underlined. In the G3 sequence, subdomains A and
B are underlined.
View larger version (41K):
[in a new window]
Fig. 2.
Protein complexes from glucagon-producing
cells interacting with G1 and G3. EMSAs
were performed with 8 µg of nuclear extract from glucagon-producing
InR1G9 cells and 32P-labeled G1-56 (A) and
G3 (B) oligonucleotides (see Fig. 1).
Competition was performed with 20 and 50 ng of unlabeled wild-type or
mutated oligonucleotides as indicated. Specific complexes are indicated
on the side with a bold arrowhead, and asterisks
correspond to nonspecific complexes.
To assess the nature of complexes B1 and C1A, we added in the EMSA incubation reactions antisera raised against the paired or homeodomain of Pax-6 (Fig. 3A). Anti-paired domain antibodies displaced B1 and B3 (G1-56), as well as C1A and C1B (G3). Complexes B1 and C1A are also supershifted by antibodies raised against the homeodomain of Pax-6. Of note, addition of both anti-Pax-6 antibodies did not completely displace B1. The residual complex was, however, of variable intensity in different nuclear extracts of InR1G9 cells and also detected with nuclear extracts from insulin-producing cell lines. Whereas this complex was specifically competed for by G-56, it was less efficiently displaced by competition with G1-33 comprising the core element of G1, and not at all with unrelated oligonucleotides (data not shown); it thus may represent a protein present in insulin- and glucagon-producing cells that might play a role in glucagon gene expression via its interaction with G1. Incubation of oligonucleotide G3 with extracts from BHK-21 cells transfected with the avian pax-6 cDNA results in a complex that migrates similarly to C1A. This complex is supershifted with Pax-6 anti-paired and anti-homeodomain antibodies and absent from nuclear extracts from BHK-21 transfected with the vector alone; our data thus indicate that B1 and C1A represent Pax-6.
|
Complex C1B, which displays binding characteristics that are different compared with B1 and C1A (Ref. 5 and Fig. 2), is supershifted with anti-paired domain but not with anti-homeodomain Pax-6 antibodies (Fig. 3A) and may thus represent a protein antigenically related to Pax-6 or a Pax-6 isoform with a deletion or modification in the homeodomain. Complex B3 formed on G1-56 has previously been shown by immunological criteria to consist of a protein complex containing Cdx-2/3 (7); its competition by oligonucleotide G3 and its interaction with both anti-Pax-6 antibodies now suggest that B3 may represent a Pax-6-Cdx-2/3 heterodimer.
To further characterize complexes B1 and B3, we transfected the avian pax-6 or hamster cdx-2/3 cDNA in BHK-21 cells, a cell line that does not express Pax-6 nor Cdx-2/3. As shown in Fig. 3B, incubation of oligonucleotide G1-56 with extracts from BHK-21 cells overexpressing Pax-6 results in a complex that migrates similarly to B1 and that is absent from nuclear extracts from BHK-21 transfected with the vector alone. Of note, a nonspecific complex with similar migration mobility as Pax-6 and Cdx-2/3 can be observed in vector-transfected BHK-21 cells; this complex does not react with anti-Pax-6 or anti-Cdx-2/3 antibodies (data not shown). When extracts from BHK-21 cells overexpressing Cdx-2/3 are incubated with G1-56, a complex with a slightly lower electrophoretic mobility than B1 and corresponding to Cdx-2/3 appears (Fig. 3B) as previously reported (7). To test our hypothesis that B3 represents a Pax-6-Cdx-2/3 heterodimer, we incubated the labeled oligonucleotide G1-56 with a constant concentration of BHK-21 nuclear extracts overexpressing Pax-6 together with increasing amounts of Cdx-2/3 containing extracts or increasing amounts of Pax-6 containing extracts at two different concentrations of Cdx-2/3 containing extracts; in these conditions, an additional complex is observed that migrates like B3 and supershifted by anti-Pax-6 and anti-Cdx-2/3 antibodies (Fig. 3B). Of note, the intensity of the reconstituted complex did not increase linearly; relatively high concentrations of either Pax-6 or Cdx-2/3 may be necessary for heterodimer versus homodimer formation in this in vitro system. In nuclear extracts from glucagon-producing cells, Cdx-2/3 appears to be present in much lower concentration than Pax-6 because it binds only as the heterodimer B3, whereas Pax-6 binds both as a monomer (B1) and a heterodimer (B3). Indeed, when anti-Pax-6 and anti-Cdx-2/3 antibodies were added to InRlG9 nuclear extracts incubated with labeled G1-56, anti-Pax-6 antibodies displace B1 and B3, whereas anti-Cdx-2/3 antibodies displace only B3 (Fig. 4). To test whether the residual complex of low intensity after displacement of B1 by anti-Pax-6 antibodies corresponds to a Cdx-2/3 monomer, we added both anti-Pax-6 and anti-Cdx-2/3 antibodies to the reaction. However, no further displacement was seen, indicating that in InR1G9 cells, Cdx-2/3 binds G1 only as the heterodimer B3. By contrast to anti-Pax-6 and anti-Cdx-2/3 antibodies, anti-Isl-1 antisera (21) did not affect any of the complexes binding to G1-56.
|
To analyze the binding characteristics of Pax-6 on the G1 and G3 elements, we expressed the Pax-6 paired, homeo, and paired and homeodomains as GST fusion proteins (Fig. 5A). Whereas the Pax-6 homeodomain was unable to bind to G1 or G3, the paired domain interacted with both elements (Fig. 5B); however, the binding of the paired domain to G1-56 was very weak, and the resulting complex was readily competed for by unlabeled G3 oligonucleotides. In contrast, a fusion protein comprising both domains exhibited a high affinity for G1 and a relatively lower affinity for G3; the complex formed on G3 was highly competed for by unlabeled G1-56. We therefore conclude that although both the paired and homeodomains of Pax-6 are necessary for maximal interaction with the G1 and G3 elements of the glucagon gene, the paired domain alone is sufficient for about half-maximal binding to G3, whereas it displays very low affinity for G1.
|
To investigate the functional role of Pax-6, we performed
cotransfection experiments in BHK-21 cells using fragments of the 5'-flanking sequence of the rat glucagon gene linked to the CAT reporter gene and a SV40-driven expression vector containing the quail
pax-6 cDNA. Using the first 350 bp of the glucagon gene promoter (350 CAT) containing both Pax-6 binding sites
(G1 and G3), we observed a
dose-dependent increase in CAT activity with increasing
amounts of expression plasmids containing the pax-6 cDNA. The transcriptional activation observed was similar to that obtained with the transcription factor interacting with the proximal AT-rich site of G1, Cdx-2/3 (Figs.
6 and
7A). To characterize the
relative functional importance of the proximal (G1) and the distal (G3) Pax-6 binding sites, we investigated the
effects of Pax-6 overexpression on promoter constructs containing
either one or both Pax-6 binding sites (Fig. 7A); we used
the first 138 bp of the glucagon gene promoter either alone (
138 CAT)
or linked to oligonucleotides representing wild-type G3
(G3-138 CAT) or G3 specifically mutated at the
Pax-6 binding site (G3M6-138 CAT). As shown in Fig.
7B, overexpression of Pax-6 resulted in a 98-fold activation
of the basal activity obtained with G3-138 CAT, whereas only half of this activation was observed for either
138 CAT or
G3M6-138 CAT (37- and 38-fold activation, respectively).
These results indicate that both Pax-6 binding sites are necessary for maximal activation of the glucagon gene promoter in BHK-21 cells and
that deletion of the G3 site results in a loss of 50% of
the activation potential. We then assessed the consequences of
deletions or mutations of the proximal G1 binding sites by
using either the first 75 bp of the glucagon gene promoter linked to
wild-type G3 (G3-75 CAT, deletion of the Pax-6
binding site on G1) or the first 350 bp of the promoter
with point mutations at nucleotides
89/
90 resulting in the loss of
Pax-6 binding on G1 (G1M1-350 CAT) (Ref. 6 and
Figs. 1 and 8A). A 40-fold stimulation of transcription by
Pax-6 was observed for G3-75 CAT, which corresponds to half
of the activation obtained with G3-138 CAT (Fig.
7B). With G1M1-350 CAT, transcription increased
by 25-fold, which also corresponded to half of the activation seen with
the respective control,
350 CAT. When point mutations were directed
to the Cdx-2/3 binding site (nucleotides
71/72,
G1M11-350 CAT), Pax-6 induced a 78-fold activation. Our
results thus indicate that in BHK-21 cells, each Pax-6 binding site of
the rat glucagon gene 5'-flanking sequence accounts for about half of
the full activation observed when both sites are present. Of note, we
always obtained significantly lower stimulation by Pax-6 with the
wild-type or mutated 350 first bp of the promoter compared with shorter
promoters.
|
|
We then analyzed the respective activation potential of Pax-6 and
Cdx-2/3 either alone or together on the various promoter mutants
described above in BHK-21 cells. 0.25 µg of the Pax-6 or Cdx-2/3
expression plasmid was used for transfection because this concentration
resulted in submaximal activation and dose-response curves with
increasing amounts (from 0.125 to 1 µg) of the respective plasmids
gave similar activation potentials (Fig. 6). Pax-6 and Cdx-2/3 alone
activated 350 CAT by 21- and 13-fold, respectively; when both
pax-6 and cdx-2/3 cDNAs were transfected, we
observed an activation reaching 58-fold (Fig.
8A). Similar qualitative results were obtained with
138 CAT, G3-138 CAT and
G3M6-138 CAT, which contain both Pax-6 and Cdx-2/3 binding
sites on an intact G1; indeed, when tested individually,
Pax-6 and Cdx-2/3 increased transcriptional activity from these
constructs, but when used together they resulted in a more than
additive activation. The weak synergistic effects on transcription
observed with Pax-6 and Cdx-2/3 may be explained by the fact that Pax-6
interacts with G1 primarily as a monomer, B1,
whereas Cdx-2/3 binds as a heterodimer, B3, with Pax-6
(Ref. 7 and Fig. 4).
|
We then investigated the effects of Pax-6 and Cdx-2/3 on constructs containing point or deletion mutants of G1 on transcription (Fig. 8A). G3-75 CAT, which only contains the distal Pax-6 (G3) and the Cdx-2/3 sites, was activated 26- and 28-fold by Cdx-2/3 and Pax-6, respectively; however, with both Pax-6 and Cdx-2/3, only strictly additive effects were observed. Point mutations of the G1 Pax-6 binding site that prevent Pax-6 monomer and Pax-6-Cdx-2/3 heterodimer binding (G1M1-350 CAT; Ref. 6 and Fig. 8B) decreased the effect of Pax-6 without impairing binding and transactivation by Cdx-2/3; again no synergistic activity was obtained. In contrast, mutation of the major Cdx-2/3 binding site, which decreased Cdx-2/3 monomer binding on G1 and B3 formation (G1M11-350 CAT; Ref. 6 and Fig. 8B), led to a decreased activation potential of Cdx-2/3 but did not suppress the more than additive effects conferred by both Cdx-2/3 and Pax-6. These binding and transactivation data indicate that the intact Pax-6 binding site may allow some heterodimer formation between Pax-6 and Cdx-2/3 despite a mutated Cdx-2/3 binding site. Indeed, as shown in Fig. 8C, both proteins are able to interact in solution and in the absence of DNA; both the Pax-6 paired and homeodomains participate in this interaction and maximal protein-protein contacts are observed when the two domains are present. However, in the complete absence of binding of Pax-6 as a monomer (G1-56M1), Cdx-2/3 is unable to stabilize the heterodimer B3 on G1; therefore, heterodimer formation and maximal transcriptional activation may only be possible when some DNA binding of Pax-6 is still present (Fig. 8, A and B).
To investigate the functional importance of the Pax-6 binding sites on
G3 and G1 and the Cdx-2/3 binding site on
G1 in glucagon-producing cells, we transfected the reporter
gene constructs analyzed in Figs. 7 and 8A, in InR1G9 cells.
Construct G3-138 CAT containing the G3 element
linked directly to the first 138 bp of the glucagon gene promoter
conferred a CAT activity identical to the control plasmid 350 CAT.
Mutation (G3M6-138 CAT) or deletion (
138 CAT) of the
enhancer element decreased this activity by about 80% (Fig. 9). Deletion (G3-75 CAT) or
mutation (G1M1-350 CAT) of the Pax-6 binding site on
G1 resulted in 50-60% loss of activity. Surprisingly, mutation of the Cdx-2/3 binding site on G1
(G1M11-350 CAT), which did not affect the activated
transcription conferred by overexpressed Pax-6 and Cdx-2/3 in BHK-21
cells (Fig. 8A), markedly decreased basal CAT activity in
InR1G9 cells (80% reduction). This discrepancy may be due to the
presence of additional, unidentified factors interacting with Pax-6 and
Cdx-2/3 or with Pax6 alone on G1 in glucagon-producing but
not in heterologous cells; alternatively, interactions of the proteins
binding to the distal enhancer G2 or G3 with
those of G1 that we suggested previously (22) may be
impaired by the decreased Pax-6-Cdx-2/3 heterodimer formation.
|
The same wild-type and mutant reporter gene constructs were transfected
along with Pax-6 and/or Cdx-2/3 expression plasmids in InR1G9 cells to
observe the consequences of their overexpression on intact or mutated
G1 and G3 elements; however, we found either no
effect or, at the highest amounts of either cDNA transfected, an
inhibition of basal activity (data not shown), compatible with a
squelching phenomenon. We hypothesize from these results that proteins
interacting with Pax-6, Cdx-2/3, or both may be rate-limiting for
transcriptional activity and that overexpression of Pax-6 and Cdx-2/3
may decrease the availability of these proteins for transcription.
![]() |
DISCUSSION |
---|
This study presents evidence that Pax-6 interacts with at least
two DNA control elements of the rat glucagon gene promoter, G3 and G1. G1 is a critical element
that confers -cell specificity to the expression of the glucagon
gene. Pax-6 is able to bind G1 either as a monomer or as a
heterodimer with Cdx-2/3. When both proteins are overexpressed in
BHK-21 cells, they bind preferentially as monomers; formation of
heterodimer B3 is favored by increasing either Pax-6 or
Cdx-2/3 concentration but in a nonlinear fashion (Fig. 3B).
Binding assays with nuclear extracts from InR1G9 cells suggest that
most of Pax-6 binds G1 as a monomer, as evidenced by the
ratio of complexes B1/B3. However, most if not
all of Cdx-2/3 is contained within the heterodimer Pax-6-Cdx-2/3
because we have not been able to detect Cdx-2/3 monomer binding to
intact G1 using InR1G9 nuclear extracts (Ref. 7 and Fig.
4). This is most likely due to the relatively low amounts of Cdx-2/3,
as compared with Pax-6, present in InR1G9 cells. Cdx-2/3 monomer
binding to its recognition site is only observed when a mutation of the
distal AT-rich site on G1 prevents formation of
B1 (Pax-6), B2, and B3 (Pax-6-Cdx-2/3); the intensity of the monomer complex corresponds to
that of the heterodimer in the presence of intact G1 (7). Despite the relatively low abundance of the heterodimer Pax-6-Cdx-2/3 as compared with the Pax-6 monomer, interactions of Pax-6 with Cdx-2/3
may be functionally important because our results demonstrate that
together Pax-6 and Cdx-2/3 activate transcription in a more than
additive manner in BHK-21 cells. This effect is entirely lost when
Pax-6 binding to G1 is impaired, such as on the mutant promoters G1M1-350 and G3-75. In this
heterologous system, however, integrity of the Cdx-2/3 site is not
required for interactive activation by Pax-6 and Cdx-2/3. Indeed,
mutant promoter G1M11-350 (6, 7), which decreases
Cdx-2/3 binding, does not affect activation by Pax-6 and Cdx-2/3
together in BHK-21 cells. In contrast, mutation of either the Pax-6 or
the Cdx-2/3 binding site on G1 markedly decrease
transactivation of the glucagon gene promoter in glucagon-producing
cells. This phenomenon may be explained by additional contacts with the
proximal AT-rich motif necessary for optimal conformation of the
Pax-6-Cdx-2/3 heterodimer and its interaction with yet unidentified
proteins in InR1G9 but not in BHK-21 cells. Different expression levels
of Cdx-2/3 leading to a variable ratio of Pax-6 monomer/heterodimer
formation may serve to modulate transcriptional activity of the
glucagon gene during development or in response to physiological stimuli.
Pax-6 has previously been shown to interact with other homeodomain proteins such as Engrailed (En-1); heterodimer formation with En-1, however, depends only on the Pax-6 paired domain and down-regulates the DNA binding and transactivation properties of Pax-6 (23). This is in contrast to the Pax-6-Cdx-2/3 heterodimer, whose formation implicates the Pax-6 paired and homeodomains resulting in a transactivation potential that is more than additive compared with both factors taken alone.
The role of Pax-6 in endocrine pancreatic development is well
established (11, 12). Pax-6 is detected in glucagon-producing cells of
the mouse embryonic pancreas at day 9.5 and in all pancreatic endocrine
cells at later stages of development. In mice homozygous for a targeted
null mutation in the Pax-6 gene, few if any -cells are detected
(12); similar findings are reported in the SeyNeu mice,
which are characterized by a homozygous mutation of the Pax-6 gene
(11). In the latter mice, insulin, somatostatin, and pancreatic
polypeptide-producing cells are also markedly decreased, indicating a
role for Pax-6 in the development of all islet cells. Mouse genetics
has provided direct evidence for the developmental role of
tissue-specific transcription factors. Pax-6 interacts with
G1, a critical determinant of
-cell-specific expression of the glucagon gene, and may thus have a key role in its restricted cell-type expression. It has been proposed that Pax-4 and Pax-6 determine the islet cell fate of the pancreas during development; the
onset of pax gene expression may then define the lineage of the different endocrine cells (11, 12). Cells expressing both Pax-4 and
Pax-6 would differentiate into mature
,
, and
cells, whereas
absence of Pax-4 would divert cells to the
-cell lineage. It is thus
possible that the simultaneous presence of Pax-6 and Cdx-2/3 and the
absence of Pax-4 or other
cell-specific factors are the critical
determinants for
-cell-specific expression of the glucagon gene.
Several transcription factors present in
cells or other
non-
-islet cells have been identified (PDX-1 (24), Pax-4 (25), and a
recently characterized
cell factor, IB1 (26)), whereas no
-cell-specific factor has been identified so far. Interestingly,
PDX-1 has recently been shown to directly interact with Cdx-2/3 and to
impair its transcriptional activation of the sucrase-isomaltase
promoter (27).
-cell-specific expression of the glucagon gene might
thus occur through a default mechanism whereby
cell-specific
factors like Pax-4 or PDX-1 suppress the glucagon promoter in
non-
-islet cells through direct protein-protein interactions with
Pax-6-Cdx-2/3, for example.
Pax-6 has previously been shown to interact with the G3 control element of the rat glucagon gene and to activate transcription (12). We confirm and extend these findings to the G1 promoter element. Although the G3 and G1 Pax-6 binding sites are clearly homologous in their sequence, they only share 8 of 16 nucleotides (5), implicating functional differences in the DNA-protein interaction. It has indeed been shown that DNA binding induces conformational changes in the Pax-6 protein (28) and that different target sites might have allosteric effects on transcription factors (29). On the glucagon gene 5'-flanking sequence, the Pax-6 paired domain alone is sufficient for about half-maximal binding to G3, whereas it shows only weak affinity for G1. In contrast, a protein comprising the Pax-6 paired and homeodomains exhibits a higher affinity for G1 than for G3 (Fig. 5B). These different binding properties might then affect transcriptional potencies and interactions with additional proteins, e.g. Cdx-2/3.
In our heterologous assay system using BHK-21 cells, both Pax-6 binding sites, G1 and G3, appear to be of equivalent functional importance inasmuch as deletions or mutations of either site result in a 50% loss of transcriptional activity. The respective importance of G1 and G3 in this heterologous assay does not, however, reflect the basal transcriptional activity of the glucagon gene in glucagon-producing cells. In these cells, deletion of G3 results in only mild decreases in transcriptional activity when the more proximal enhancer element G2 is present (2, 6), whereas a point mutation (G1M1) of the Pax-6 binding site within G1 leads to a 60% loss of activity (Fig. 9), indicating that the latter site is crucial for basal transcription. A second difference in the consequences of G1 mutations is observed between BHK-21 cells overexpressing Pax-6 and Cdx-2/3 and the glucagon-producing InR1G9 cells with a reporter gene construct containing a point mutation in the Cdx-2/3 binding site within G1 (G1M11). Whereas this mutation does not interfere with the more than additive transcriptional activation conferred by Pax-6 and Cdx-2/3, it decreases basal activation in InR1G9 cells by 80% (Figs. 8A and 9). The only change induced by mutation G1M11 in the complexes formed with InR1G9 nuclear extracts in EMSA is a reduction of B3, and a similar decrease is noted in BHK-21 nuclear extracts containing Pax-6 and Cdx-2/3 (Fig. 8B). Thus, despite the capacity of Pax-6 and Cdx-2/3 to directly interact in the absence of DNA, both binding sites may be important for optimal heterodimer conformation and transcriptional activation in glucagon-producing cells; mutation G1M11 may attenuate the formation and change the conformation of the Pax-6-Cdx-2/3 heterodimer and thus impair its interaction with additional factors present in InR1G9 but not in BHK-21 cells. We cannot exclude, however, that the discrepancies in the consequences of G1 mutations observed between BHK-21 and InR1G9 cells are due to unidentified proteins interacting with Pax-6 and binding to the Cdx-2/3 site.
Pax-6 binds G3 as a monomer; our results suggest, however, that besides Pax-6, a related protein interacts with G3. Indeed, two complexes were previously shown to bind domain A of G3, C1A (Pax-6) and C1B (5); both complexes share very similar binding characteristics but display differences inasmuch as interference of methylation assays suggest that Pax-6 and C1B interact with different nucleotides of domain A (5); furthermore, competition for Pax-6 and C1B by the G1 binding site in EMSAs affects only Pax-6 interaction (Ref. 5 and Fig. 2B). C1B, which is recognized by Pax-6 anti-paired but not anti-homeodomain antibodies, displays slightly slower migration than Pax-6. Several isoforms of Pax-6 have been identified in the nervous system and the endocrine pancreas (10, 17, 30); however, functional tests on DNA binding and transactivation with these isoforms suggest that they do not interact with G3.2 Thus, C1B may represent either an as yet unidentified Pax-6 isoform or a related paired protein. Interestingly, the Pax-6 binding site on G3 corresponds to the insulin-response element of the glucagon gene and mutations impairing Pax-6 binding and C1B formation, result in a loss of regulation by insulin (3, 5). Formal characterization of C1B should lead to a better definition of the respective functional role of this Pax-6 related protein and Pax-6 on the insulin regulation of the glucagon gene.
We conclude from our studies that Pax-6 binds independently to at least
two DNA control elements of the glucagon gene, G1 and
G3. Pax-6 appears functionally important in both -cell
development and glucagon gene transcription; it may mediate
-cell-specific expression of the glucagon gene as the major
transcription factor binding to G1 and by its interaction
with Cdx-2/3 as well as by mediating the inhibitory effects of insulin
on glucagon gene transcription by binding to G3. Further
work will be necessary to appreciate the functional roles of Pax-6 in
glucagon gene regulation.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank F. Kaempfen and C. Robert-Tissot for typing the manuscript and I. Grigorescu for experimental assistance.
![]() |
FOOTNOTES |
---|
* This work was supported by the Swiss National Fund, the Institute for Human Genetics and Biochemistry, the Berger Foundation, the Carlos and Elsie de Reuters Foundation, and the Horten Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ To whom correspondence should be addressed. Tel.: 41-22-702-55-67; Fax: 41-22-702-55-43; E-mail: Laser{at}cmu.unige.ch.
The abbreviations used are: bp, base pair(s); CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; GST, glutathione S-transferase.
2 B. Ritz-Laser, manuscript in preparation.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() |
---|