The Saccharomyces cerevisiae YOR163w Gene Encodes a Diadenosine 5',5'''-P1,P6-Hexaphosphate (Ap6A) Hydrolase Member of the MutT Motif (Nudix Hydrolase) Family*

Jared L. Cartwright and Alexander G. McLennanDagger

From the School of Biological Sciences, Life Sciences Building, University of Liverpool, P. O. Box 147, Liverpool L69 7ZB, United Kingdom

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The YOR163w open reading frame on chromosome XV of the Saccharomyces cerevisiae genome encodes a member of the MutT motif (nudix hydrolase) family of enzymes of Mr 21,443. By cloning and expressing this gene in Escherichia coli and S. cerevisiae, we have shown the product to be a (di)adenosine polyphosphate hydrolase with a previously undescribed substrate specificity. Diadenosine 5',5'''-P1,P6-hexaphosphate is the preferred substrate, and hydrolysis in H218O shows that ADP and adenosine 5'-tetraphosphate are produced by attack at Pbeta and AMP and adenosine 5'-pentaphosphate are produced by attack at Palpha with a Km of 56 µM and kcat of 0.4 s-1. Diadenosine 5',5'''-P1,P5-pentaphosphate, adenosine 5'-pentaphosphate, and adenosine 5'-tetraphosphate are also substrates, but not diadenosine 5',5'''-P1,P4-tetraphosphate or other dinucleotides, mononucleotides, nucleotide sugars, or nucleotide alcohols. The enzyme, which was shown to be expressed in log phase yeast cells by immunoblotting, displays optimal activity at pH 6.9, 50 °C, and 4-10 mM Mg2+ (or 200 µM Mn2+). It has an absolute requirement for a reducing agent, such as dithiothreitol (1 mM), and is inhibited by Ca2+ with an IC50 of 3.3 mM and F- (noncompetitively) with a Ki of 80 µM. Its function may be to eliminate potentially toxic dinucleoside polyphosphates during sporulation.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Recent interest in the diadenosine polyphosphates (ApnA)1 has focused on their possible roles as regulators of cell proliferation. Ap3A has been proposed as a component of the interferon-induced antiproliferative response in mammalian cells (1), whereas Ap4A, the intracellular level of which has long been known to be associated with proliferation (2, 3), may be an antagonist of this pathway. A key factor in this response in humans is the fragile histidine triad (FHIT) protein, an Ap3A hydrolase that is absent or defective in many common cancers (4, 5). Precisely how this protein and its substrate, Ap3A, contribute to antiproliferation is not clear, but there is little doubt that the regulation of the intracellular levels of specific diadenosine polyphosphates is of great importance.

Eukaryotic Ap3A hydrolases exhibit an approximately 10-fold preference for Ap3A over Ap4A as substrates2 (6). They are members of the histidine triad (HIT) family of proteins and possess the catalytic sequence motif HXHXHX in which the central histidine residue forms a covalent enzyme-AMP reaction intermediate (4). Animals and higher plants also possess an asymmetrically cleaving Ap4A hydrolase that prefers Ap4A but is also active toward higher homologues, such as Ap5A and Ap6A, but inactive toward Ap3A (6). This enzyme belongs to the MutT motif (or nucleoside diphosphate linked to x (nudix)) family of nucleotide hydrolases (7, 8). Together, these two enzymes are probably crucial for regulating the Ap3A/Ap4A ratio.

Many lower eukaryotes appear unusual in possessing one or more Ap4A phosphorylases in place of Ap4A hydrolase. For example, Saccharomyces cerevisiae has two Ap4A phosphorylases, Apa1 and Apa2, in addition to an Ap3A hydrolase (6, 9-11). Like the Ap4A hydrolases, the yeast phosphorylases can also degrade Ap5A but not Ap3A (6, 11). The phosphorylases appear to be distantly related to the HIT proteins, having an HXHXQ motif in place of the HXHXH histidine triad (10, 12). Although S. cerevisiae does not have an Ap4A hydrolase, genes for five potential MutT motif proteins can be discerned in the genomic sequence. Here, we report that one of these, YOR163w (GenBankTM accession no. Z75071) from chromosome XV, encodes an Ap6A hydrolase that is also active against Ap5A and the adenosine 5'-polyphosphates p5A and p4A, but not Ap4A or Ap3A. This is the first time that an enzyme with this substrate specificity has been described. A preliminary report of this work has appeared (13).

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials

Ap6A was synthesized by carbodiimide condensation of ATP (14). p5A was synthesized using the recombinant LysU lysyl-tRNA synthetase and tetrapolyphosphate (15, 16). The plasmid pXLys5 was a gift from P. Plateau, and the LysU protein was purified as described (16). All other nucleotides were from Sigma. The cosmid clone pUOA1258, which carries the complete YOR163w open reading frame from yeast chromosome XV, was a gift from B. Dujon. The vector pPGY1 was a gift from L. D. Barnes. Calf intestinal alkaline phosphatase (2000 units/mg) and yeast inorganic pyrophosphatase (200 units/mg) were from Boehringer Mannheim. Pfu DNA polymerase was from Stratagene. H218O (97.66 atom %) was from Amersham Pharmacia Biotech.

Methods

Cloning in Escherichia coli-- The YOR163w gene was amplified from the cosmid clone pUOA1258 (GenBankTM accession no. U55021) using the polymerase chain reaction. The 29-mer oligonucleotide primers d(AACACACCATGGGCAAAACCGCGGATAAT) and d(AGGAATGGATCCATATGTTTGCGGTGGCT) were synthesized to provide an NcoI restriction site at the start of the amplified gene and a BamHI site at the end. After amplification with Pfu DNA polymerase, the DNA was recovered by phenol/chloroform extraction and digested with NcoI and BamHI, and the gel-purified restriction fragment was ligated into the NcoI and BamHI sites of the pET15b vector (Novagen), thus regenerating the ATG initiator in the NcoI site and eliminating the His tag sequence from the vector. The resulting plasmid, pET163W, was used to transform E. coli XL1-Blue cells for propagation.

Cloning in Yeast-- The YOR163w gene was amplified as above using the primers d(GTGGGGGAATTCAAAATGGGCAAAACCGC) and d(GAATAGCTCGAGATGTTTGC GGTGGCTTG). These primers provided an EcoRI restriction site at the start of the amplified gene and a XhoI site at the end. After amplification, the recovered DNA was digested with EcoRI and XhoI, and the gel-purified restriction fragment was ligated into the EcoRI and XhoI sites of the yeast centromere vector, pPGY1. The resulting construct, pPGY163W, generated the ATG initiator downstream of GAL1p, a galactose-inducible promoter. The plasmid was used to transform E. coli XL1-Blue cells for propagation.

Protein Expression in E. coli and Purification-- E. coli strain BL21(DE3) was transformed with pET163W. A single colony was picked from an LB agar plate containing 20 µg/ml ampicillin and inoculated into 10 ml of LB medium containing 60 µg/ml ampicillin. After overnight growth, the cells were transferred to 1 liter of LB medium containing 60 µg/ml ampicillin and grown to an A600 of 0.9. Isopropyl-1-thio-beta -D-galactopyranoside was added to 0.4 mM, and the cells were induced for 4 h. The induced cells (5.1 g) were harvested, washed, and resuspended in 50 ml of breakage buffer (50 mM Tris-HCl, pH 8.0, 2 mM EDTA, 0.1 M NaCl). The cell suspension was sonicated, and the inclusion bodies were recovered by centrifugation at 10,000 × g for 20 min. After washing by resuspension in breakage buffer containing 2.5 M urea, the inclusion bodies were dispersed in 6 ml of 6 M guanidinium-HCl, 10 mM DTT, and the extract was centrifuged at 100,000 × g for 1 h. The supernatant was applied in 1-ml aliquots to a Bio-Rad Hi-Pore RP-304 reversed phase column (250 × 4.6 mm), and the protein was eluted with a nonlinear gradient from 0.15% (v/v) trifluoroacetic acid to 0.1% (v/v) trifluoroacetic acid, 80% (v/v) CH3CN. Homogeneous YOR163w gene product eluted at 50% (v/v) CH3CN.

Protein Expression in Yeast and Purification-- S cerevisiae strain INVScI was transformed with pPGY163W. A single colony was picked from an SC-Ura (Synthetic Complete medium without uracil) agar plate and inoculated into 100 ml of SC-Ura medium supplemented with 5% glucose. After 36 h, the cells were harvested by centrifugation, resuspended in 1 liter of SC-Ura (5% glucose), and further grown for 24 h. The cells (4.27 g) were again recovered by centrifugation, resuspended in 1 liter of SC-Ura (2% galactose, 1% raffinose), and grown for 16 h to fully induce expression of YOR163w. The induced cells (8.1 g) were harvested, washed, and resuspended in 8 ml of breakage buffer (50 mM Tris acetate, pH 7.5, 0.3 M NaCl, 10 mM 2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, 5 µM trans-epoxysuccinyl-L-leucylamido-(4-guanidino)butane, and 1 mM benzamidine). An equal volume of 0.5-mm glass beads was added, and the cells were disrupted by shaking at 1600 rpm for 10 min at 4 °C in a Mikro-Dismembrator U (B. Braun Biotech). The homogenate was decanted, and a cytosolic extract was recovered by centrifugation at 100,000 × g at 4 °C for 1 h. Crude extract (13.5 ml) was applied at 0.5 ml/min to a 50 × 15-mm column of Ni2+-nitrilotriacetic acid-agarose (Sigma) equilibrated with 50 mM Tris acetate, pH 7.5, 0.3 M NaCl, and 10 mM 2-mercaptoethanol. After eluting the unbound protein, a linear gradient of 0-30 mM histidine in equilibration buffer was applied at 1 ml/min. Fractions (4 ml) were assayed for Ap6A hydrolytic activity, pooled, and dialyzed against 10 mM sodium phosphate, pH 6.8, 0.01 mM CaCl2. The dialysate (20 ml) was applied at 1 ml/min to a 100 × 7.8-mm Bio-Gel HPHT column (Bio-Rad), and the protein eluted with a linear gradient from 10 mM sodium phosphate, pH 6.8, 0.01 mM CaCl2 to 350 mM sodium phosphate, pH 6.8, 0.01 mM CaCl2. Homogeneous YOR163w gene product eluted at 180 mM sodium phosphate.

Enzyme Assays and Product Identification-- Potential substrates were screened by measuring the Pi released by co-incubation of substrate with YOR163w protein and either inorganic pyrophosphatase or alkaline phosphatase. The standard assay (200 µl) with phosphomonoester substrates was incubated for 30 min at 37 °C and contained 50 mM Bis-Tris Propane buffer, pH 6.9, 5 mM MgCl2, 1 mM DTT, 0.35 mM substrate, 1 µg (1 milliunit) YOR163w protein and 0.5 µg (100 milliunit) inorganic pyrophosphatase. Assays with phosphodiester substrates contained 1 µg (2 units) alkaline phosphatase instead of the pyrophosphatase. The Pi released in each case was measured colorimetrically (17). Chromatographic fractions were screened for activity with 100 µM Ap6A using a rapid luminometric assay supplemented with 1 mM DTT (18). The reaction products were identified by high performance ion-exchange chromatography. Assay mixtures (100 µl) containing 50 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 1 mM DTT, 0.16 mM substrate and 1 µg of YOR163w protein were incubated for up to 10 min at 37 °C and applied to a 1-ml Resource-Q column (Amersham Pharmacia Biotech) at 2 ml/min in 35 mM NH4HCO3, pH 9.6. The elution system comprised Buffer A (H2O) and Buffer B (0.7 M NH4HCO3, pH 9.6, with a gradient of 5-100% Buffer B over 10 min. Peaks were identified with the aid of standards and quantified by area integration.

Kinetic parameters for p5A and p4A were calculated by measuring the initial rate of product formation by high performance liquid chromatography as described above. Because some of the products of Ap6A and Ap5A breakdown are also substrates for the enzyme, parameters for the dinucleotides were calculated from the initial rate of adenosine production upon co-incubation of the substrates with YOR163w protein and alkaline phosphatase. Assays containing 50 mM Bis-Tris Propane buffer, pH 6.9, 5 mM MgCl2, 1 mM DTT, substrate (various concentrations), 0.2 µg (0.2 milliunit) of YOR163w protein, and 0.4 µg (0.8 unit) of alkaline phosphatase were incubated for 5-10 min at 37 °C and then applied at 1 ml/min to a 250 × 4.6-mm Phenomenex Jupiter C18 column in 4 mM potassium phosphate, pH 6.1, 8% (v/v) methanol. The adenosine peak was integrated.

Determination of Site of Nucleophilic Substitution by Mass Spectrometry-- A reaction mixture containing 100 mM Bis-Tris Propane buffer, pH 6.9, 10 mM MgCl2, 2 mM DTT, and 6 µg of YOR163w protein was prepared in a final volume of 50 µl. After freezing at -70 °C, 50 µl of ice-cold 2.0 mM Ap6A was added, and the mixture was immediately returned to -70 °C and then lyophilized. The reaction was initiated by reconstitution in 100 µl of H218O, and Ap6A was hydrolyzed completely to yield the major reaction products by incubation at 37 °C for 20 min. Products were separated by high performance anion-exchange chromatography on a 1-ml Resource-Q column as described above. Peaks, monitored by their absorbance at 259 nm, were collected manually and lyophilized, and the distribution of the 18O between AMP, ADP, and p4A was determined by positive ion electrospray mass spectrometry. Masses were also determined for the products of a control assay reconstituted in H216O. Samples for electrospray mass spectrometry were reconstituted in 20 µl of 50% (v/v) acetonitrile, 0.1% (v/v) formic acid and injected at 10 µl/min in to a VG-Quattro quadrupole mass spectrometer (Micromass U.K., Ltd.). Analysis was performed at a source temperature of 60 °C, capillary voltage of 3.1 kV, and cone voltage of 45 V and with the skimmer offset to 5 V. A scan time of 1 s was employed, and the mass ranges of m/z 330-365 Da, m/z 420-455 Da, m/z 570-630 Da were scanned for AMP, ADP, and p4A, respectively.

Immunoblotting-- Protein extracts were analyzed on a 90 × 50 × 0.75-mm 15% SDS-polyacrylamide gel. The gel was equilibrated immediately after electrophoresis in transfer buffer (10 mM CAPS-NaOH, pH 11.0, 10% (v/v) methanol) for 10 min before electrophoretic transfer of the separated polypeptides to a nitrocellulose membrane at 150 mA and 4 °C for 2 h. The membrane was blocked for 2 h at room temperature with phosphate-buffered saline containing 3% fat-free powdered milk and 0.2% Tween-20 and then probed with a 1:5000 dilution of whole rabbit anti-YOR163w antiserum (raised by standard procedures) followed by a 1:5000 dilution of horseradish peroxidase-conjugated goat anti-rabbit second antibody. After washing, the membrane was developed by enhanced chemiluminescence using the Amersham Pharmacia Biotech ECL kit.

Other Methods-- Protein concentrations were measured by the Coomassie Blue dye binding method (19), using a mixture containing equal weights of bovine serum albumin, conalbumin, cytochrome c, and myoglobin as a standard.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning and Expression of the YOR163w Gene Product

Open reading frame YOR163w potentially encodes a 188-amino acid protein with a molecular mass of 21,575 Da. The intronless gene was polymerase chain reaction-amplified from the cosmid clone pUOA1258 using 29-base forward and reverse primers that included NcoI and BamHI sites, respectively, and the polymerase chain reaction product was inserted into the pET-15b expression vector. E. coli strain BL21(DE3) was transfected with the recombinant plasmid, and exponentially growing cells were induced for up to 3 h with isopropyl-1-thio-beta -D-galactopyranoside. SDS-polyacrylamide gel electrophoresis of cell extracts revealed the presence in both the soluble fraction (10-20%) and inclusion bodies (80-90%) of a major band migrating with an apparent molecular mass of 24 kDa, which increased with induction time and so was presumed to be the required product (Fig. 1). Inclusion bodies were then isolated after 4 h of induction and solubilized, and the protein was purified in a single step to homogeneity by reversed phase chromatography (Fig. 2). The N-terminal sequence of the purified recombinant protein was determined to be GKTADNHGPVRS by Edman degradation, and its mass was measured as 21,443 Da by electrospray mass spectrometry. These correspond exactly to the predicted sequence and mass (21,443.6 Da) for the 187-amino acid polypeptide lacking the N-terminal methionine. These data confirm the accuracy of the cloning procedure and the identity of the protein.


View larger version (79K):
[in this window]
[in a new window]
 
Fig. 1.   Expression of YOR163w gene in E. coli BL21(DE3). Cells were transformed with pET163W as described under "Experimental Procedures" and induced with 0.4 mM isopropyl-1-thio-beta -D-galactopyranoside for up to 3 h. Samples were taken at hourly intervals, boiled in sample buffer, and analyzed by SDS-polyacrylamide gel electrophoresis in a 15% gel. The gel was stained with Coomassie Blue. Lane 1, 0 h; lane 2, 1 h; lane 3, 2 h; lane 4, 3 h. Protein standards: bovine serum albumin (66 kDa), ovalbumin (45 kDa), glyceraldehyde-3-phosphate dehydrogenase (36 kDa), carbonic anhydrase (29 kDa), trypsinogen (24 kDa), soybean trypsin inhibitor (20 kDa), alpha -lactalbumin (14.2 kDa). The presumed YOR163w gene product is indicated with an arrow.


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2.   Purification of YOR163w gene product. YOR163w gene product was purified in a single step from solubilized inclusion bodies as described under "Experimental Procedures." - - - - -, acetonitrile gradient. Inset, a sample of the pooled peak was analyzed by SDS-polyacrylamide gel electrophoresis in a 15% gel. Lane 1, protein standards as in Fig. 1; lane 2, 1 µg of YOR163w gene product.

In order to confirm that the observed properties of the enzyme were not due to an alternative folding of the protein after reversed phase chromatography, the enzyme was also overexpressed in a soluble form in a yeast host system and purified conventionally by chromatography on a nickel affinity resin and hydroxyapatite. The enzyme binds tightly to the nickel column even though it was not expressed with a histidine tag. Both procedures yielded enzyme with very similar properties. The data presented here were obtained with the bacterially expressed protein.

Properties of the Protein

Substrates-- Almost all MutT motif proteins studied so far are nucleotide pyrophosphatases that hydrolyze compounds containing an NDP linked to another moiety, hence the alternative name of nudix hydrolase (8). A wide range of nucleotides was assayed to determine the substrate(s) of the YOR163w protein. Of these, only Ap6A, p5A, Ap5A, and p4A yielded significant activity (Table I). ATP was very slowly degraded to ADP + Pi, whereas no activity was detectable with the following compounds in the presence of Mg2+ or Mn2+ ions: Ap4A, Ap3A, Ap2A, NAD+, NADH, NADP+, NADPH, desamino-NAD+, FAD, coenzyme A, (deoxy)nucleoside 5'-triphosphates (GTP, CTP, UTP, ITP, dATP, dGTP, dCTP, and TTP), nucleoside 5'-diphosphates (ADP, GDP, CDP, and UDP), nucleoside 5'-monophosphates (AMP, GMP, CMP, and UMP), nucleotide sugars (ADP-ribose, IDP-ribose, ADP-glucose, GDP-glucose, GDP-mannose, CDP-glucose, UDP-glucose, UDP-galactose, and UDP-N-acetylgalactosamine), or nucleotide alcohols (CDP-glycerol, CDP-choline, and CDP-ethanolamine). Diguanosine polyphosphates were not tested as substrates. Table I shows the kinetic constants obtained with the active substrates. Km values were all within the range 30-70 µM and had apparent catalytic constants (kcat) below 1 s-1. According to the calculated catalytic efficiencies (kcat/Km), Ap6A is an 8-fold better substrate than Ap5A, the overall preference being Ap6A > p5A >> p4A > Ap5A. Kinetic parameters for p5A were calculated using subsaturating substrate concentrations only because substrate inhibition by this compound was observed above 50 µM. Given the preference for Ap6A, we propose that this protein should be described as a diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Products and kinetic constants
Products were determined as described under "Experimental Procedures." Kinetic parameters were determined by hyperbolic regression analysis from duplicate determinations of enzyme activity over the substrate concentration range 5-90 µM. One unit hydrolyzes 1 µmol of substrate/min.

Reaction Requirements-- With 160 µM Ap6A as substrate, the enzyme displayed optimal activity at pH 6.9, 50 °C, and 4-10 mM Mg2+. Mn2+ at 200 µM also sustained optimal activity, but Ca2+ inhibited with an IC50 of 3.3 mM. F- was also inhibitory (noncompetitive), with a Ki of 80 µM. In this respect, the yeast Ap6A hydrolase is similar to but less sensitive than the plant and animal Ap4A hydrolases, which have Ki values for F- in the ranges 2-3 and 20-30 µM, respectively (20). The enzyme had an absolute requirement for a reducing agent, such as DTT (optimal at 1 mM).

Reaction Products-- The reaction products generated from each of the four active substrates were determined after various incubation times by ion-exchange high performance liquid chromatography (Table I and Fig. 3). From the kinetics of product formation, the following overall conclusions were drawn. Ap6A yielded mainly p4A + ADP (76%) but also p5A + AMP (24%). AMP must be a primary breakdown product because ADP is resistant to further hydrolysis, hence the enzyme displays two alternative modes of attack on the Ap6A substrate. p5A, either alone or as a product of Ap6A breakdown, generated almost exclusively p4A + Pi. The example high performance liquid chromatography profile in Fig. 3 shows only a small amount of p5A; however, assays using shorter incubation times clearly showed the generation of equimolar amounts of p5A and AMP before the p5A itself is degraded to p4A + Pi. ATP was also observed, most likely due to the breakdown of the primary p4A product (see below). Similarly, Ap5A yielded predominantly p4A + AMP (96%), but with a small amount of ATP + ADP (4%), whereas p4A broke down to ATP + Pi. The preferential generation of p4A from both Ap6A and Ap5A suggests a reaction mechanism similar to the plant and animal Ap4A hydrolases, which always generate ATP from ApnA substrates (n >=  4). A binding pocket on these enzymes accommodates a pppA moiety, with the fourth phosphorus distal to the A being subject to nucleophilic attack by water (21, 22). By analogy, the yeast Ap6A hydrolase appears to preferentially accommodate a ppppA moiety in the substrate binding site.


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3.   Example of product determination using Ap6A as substrate. Ap6A (0.16 mM) was incubated for 10 min with 1 µg of YOR163w protein, and the products were separated by high performance ion-exchange chromatography as described under "Experimental Procedures." Products were monitored by their absorbance at 259 nm. A259 of reaction mixture at 10 min; - - - - -, A259 of reaction mixture at 0 min; · · · · ·, NH4HCO3 gradient, Buffer B = 0.7 M NH4HCO3.

Regarding the generation of alternative products, this could occur in one of three ways. Using Ap6A as an example, these are (i) exclusive attack of the nucleophile (presumed to be water) on Pbeta , with elimination of the Pbeta ---O(Pgamma ) bond, yielding p4A + ADP, and elimination of the Pbeta ---O(Palpha ) bond, yielding p5A + AMP; (ii) attack on Pgamma and elimination of the Pgamma ---O(Pbeta ) bond, yielding p4A + ADP, and attack on Pbeta and elimination of the Pbeta ---O(Palpha ) bond, yielding p5A + AMP; (iii) attack on Pbeta and elimination of the Pbeta ---O(Pgamma ) bond, yielding p4A + ADP, and attack on Palpha and elimination of the Palpha ---O(Pbeta ) bond, yielding p5A + AMP. These possibilities can be distinguished by carrying out the reaction in the presence of H218O and following the fate of the 18O by mass spectrometry (23) (Fig. 4). When Ap6A was hydrolyzed in the presence of H216O, the AMP and ADP products had masses of 348 and 428 Da, respectively (Fig. 5, A and C), whereas hydrolysis in the presence of H218O resulted in fully 18O-labeled AMP and ADP, with masses of 350 and 430 Da, respectively (Fig. 5, B and D). In both cases, the p4A product was unlabeled, with a mass of 588 Da (Fig. 5, E and F), whereas rapid degradation of the p5A prevented an assessment of its labeling pattern. Because only mechanism iii leads to labeling of both AMP and ADP and lack of labeling of p4A (Fig. 4), this must be the normal mode of attack and is, therefore, identical to that previously established for the Artemia and lupin Ap4A hydrolases (22-24).


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4.   Possible mechanisms for the generation of alternative products from Ap6A. Three possible mechanisms for the hydrolysis of Ap6A by the YOR163w protein involving water as the attacking nucleophile to generate alternative sets of products, and the expected labeling pattern of the products of hydrolysis if the reaction is carried out in H218O.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5.   Mass spectrometric analysis of reaction products generated in H216O and H218O. Assays were performed and products were analyzed as described under "Experimental Procedures." Spectra are shown for AMP isolated from a reaction carried out in H216O (A) and H218O (B), for ADP isolated from a reaction carried out in H216O (C) and H218O (D), and for p4A isolated from a reaction carried out in H216O (E) and H218O (F).

Presence in Yeast-- A rabbit polyclonal antibody was raised against the recombinant YOR163w protein in order to confirm that this protein is normally expressed in yeast. Fig. 6 shows that exponentially growing yeast cells express a protein that co-migrates on SDS-polyacrylamide gel electrophoresis with YOR163w. The native protein also migrates with an anomalously high mass of 24 kDa. This phenomenon has also been observed with the 16.7-kDa human Ap4A hydrolase, which usually migrates as 19-21 kDa (7).


View larger version (67K):
[in this window]
[in a new window]
 
Fig. 6.   Western blot analysis of yeast extract. Lane 1, 10 ng of purified recombinant YOR163w protein; lane 2, 5 µl of total yeast cell extract; lane 3, mixture of 10 ng of purified recombinant YOR163w protein and 5 µl of total yeast cell extract prepared as follows: the cells from 200 µl of an overnight culture of strain S288C in YPD (yeast extract/peptone/dextrose) medium were collected at 16,000 × g for 1 min and then resuspended in 100 µl of SDS sample buffer and boiled for 5 min. After centrifugation, the supernatant was used. Immunoblotting was carried out as described under "Experimental Procedures."


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The recovery of active YOR163w protein after reversed phase chromatography and its high temperature optimum of 50 °C reflect the high stability of the MutT motif proteins as a family. This purification system has also been found to yield pure and fully active recombinant human Ap4A hydrolase.3 Stability can probably be attributed to the mixed beta -sheet structure shown to be at the core of the E. coli MutT protein itself and other highly stable proteins (25).

So far, Ap6A and Ap5A have only been described in the secretory granules of certain specialized mammalian cells. It is not known whether they are present in the cytosol of eukaryotes in general, including yeast. If so, and if they are synthesized by aminoacyl-tRNA synthetases in a reaction similar to the lower order diadenosine polyphosphates (26, 27), then both p5A and p4A would be required as adenylate acceptors. Neither of these compounds exists at detectable levels in vegetative yeast cells; however, they are both synthesized and excreted during the latter stages of sporulation following ascospore formation, reaching 1.5 and 2% of the concentration of ATP, respectively (28). They are not produced by asporogenous a/a or alpha /alpha strains placed in sporulation medium, and so they have been proposed as signals marking the end of sporulation (28). They may be synthesized by acetyl-CoA synthetase, which is known to generate them in vitro (29). Their presence in yeast cells suggests that Ap6A and Ap5A might also be synthesized at low levels during sporulation. Because Ap5A is a potent inhibitor (active in the nanomolar range) of the essential enzyme adenylate kinase (30), one function of the Ap6A hydrolase may be to eliminate these potentially toxic dinucleotides during sporulation. In this context, it is of interest to note that the region upstream of the YOR163w gene contains a single copy of the stress response element 5'-AGGGG, which is known to contribute to the response to nitrogen starvation (31). The possibility that YOR163w expression is regulated by cellular stress remains to be determined. Alternatively, the accumulation of p5A and p4A during this period may reflect a higher activity of the Ap6A hydrolase during vegetative growth, its function being the removal of the substrates for Ap6A and Ap5A synthesis. Such functions would be in keeping with the "housecleaning" role proposed for the nudix hydrolase family (8).

In generating AMP + p5A from Ap6A, the reaction mechanism of the yeast Ap6A hydrolase is identical to that previously determined for the production of AMP + ATP by the Artemia and lupin Ap4A hydrolases, namely nucleophilic attack of water on Palpha and elimination of the Palpha ---O(Pbeta ) bond (22-24). Interestingly, the Artemia Ap4A hydrolase can be forced to switch attack to Pbeta when presented with substrates containing nonscissile Palpha ---C phosphonate linkages, such as diadenosine 5',5'''-P1,P4-(P1,P2-monofluoromethylene-P3,P4-monofluoromethylene) tetraphosphate (ApCHFppCHFpA) (21), or alpha -thiophosphates, such as (Rp,Sp)-diadenosine 5',5'''-P1,P4-(P1,P4-dithio)-tetraphosphate (ApspppsA) (32). This so-called frameshift mode of attack was attributed to a flexibility in the binding of the polyphosphate substrate to the enzyme, with either Palpha or Pbeta being positioned next to a fixed catalytic center, a situation more commonly encountered with polymeric substrates (21). This flexibility is also demonstrated by the yeast Ap6A hydrolase with the natural substrate Ap6A and, to a lesser extent, Ap5A, with alternative sets of products being generated in each case.

Fig. 7A shows a partial sequence alignment of the YOR163w protein with other known eukaryotic dinucleoside polyphosphate hydrolases, including the YA9E protein from Schizosaccharomyces pombe, which shares 43% sequence identity with YOR163w. The gene encoding YA9E has recently been cloned and expressed,4 and the protein has ApnA hydrolase activity with Ap6A and Ap5A as the preferred substrates, but with some activity toward Ap4A, in contrast to YOR163w, which has no activity with this substrate. Several observations can be made. First, YOR163w has an extra proline residue inserted in the MutT motif, the sequence common to all members of this protein family. This may in part explain the exclusive accommodation of the longer polyphosphate chains compared with the Ap4A hydrolases and the YA9E protein, which do not have this extra residue. Second, the hydrophobic patch in the fungal enzymes located just N-terminal to the MutT motif (YOR163w residues 47-50) is more similar to that in the animal Ap4A hydrolases than the plant enzyme sequences (Fig. 7A). However, further toward the N terminus (YOR163w residues 26-40), both of the fungal proteins, especially YOR163w, share additional sequence similarity with the two plant Ap4A hydrolases. This similarity is absent from the animal hydrolases, which do not align with any significance in this region. The fungal and plant enzymes also share the enzymic property of hydrolyzing both nucleoside and dinucleoside polyphosphates: the lupin Ap4A hydrolase degrades p4A, whereas this compound is a potent inhibitor of the animal Ap4A hydrolases (6, 33). Thus, there may be a closer evolutionary relationship between the plant and fungal ApnA hydrolases. Another activity that may be related is the dinucleoside polyphosphate hydrolase purified from the green alga Scenedesmus obliquus, an organism that, like S. cerevisiae, has an Ap4A phosphorylase (34). This enzyme hydrolyzes ApnA with the preference Ap5A > Ap4A > Ap6A. No significant similarity to the E. coli orf186 gene product, an enzyme that prefers Ap3A as substrate but that also hydrolyzes ADP-ribose and NADH (35), was detected outside the MutT motif.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 7.   Partial sequence alignment of YOR163w protein with other known dinucleoside polyphosphate hydrolases (A) and two possible human homologs (B). A, the YOR163w sequence (GenBankTM accession number Z75071) was aligned with lupin (GenBankTM accession number U89841) and barley (GenBankTM accession number Z99996) Ap4A hydrolases, S. pombe YA9E protein (SwissProt accession number Q09790), and human (SwissProt accession number P50583), pig (SwissProt accession number P50584) and mouse (SwissProt accession number P56380) Ap4A hydrolases using the CLUSTAL W program. B, the YOR163w sequence (GenBankTM accession number U55021) was aligned with the human diphosphoinositol polyphosphate phosphohydrolase DIPP (GenBankTM accession number AF062529) and the related human sequence of unidentified function (GenBankTM accession number AA916467). Amino acid identities with YOR163w are shaded black, amino acid similarities are shaded gray, the MutT motif (GX5EX7REX2EEXG) is underlined, and the hydrophobic patch is overlined. Numbers to the right and left of the sequences represent the positions in the respective complete amino acid sequences.

With regard to possible mammalian orthologs of YOR163w, a 41-amino acid sequence of this protein encompassing the MutT motif shows 50% identity and 65% similarity with two closely related but distinct sequences that are represented by several human, mouse, and rat clones in the GenBankTM expressed sequence tag data base. The alignment with the two human sequences is shown separately from the other dinucleoside polyphosphate hydrolases in Fig. 7B for clarity. One of these, DIPP, has recently been shown to be a diphosphoinositol polyphosphate phosphohydrolase, the first MutT motif protein with activity toward non-nucleotide substrates (36). Like YOR163w, DIPP shows positional flexibility in its site of attack. It is believed to attack a different pyrophosphoryl group in its two substrates, diphosphoinositol pentakisphosphate and bis(diphosphoinositol) tetrakisphosphate. Given the broad substrate specificity of some MutT motif proteins and the similarity between these proteins, it will be of particular interest to determine whether YOR163w can also hydrolyze diphosphoinositol polyphosphates.

In conclusion, we have characterized a dinucleoside polyphosphate nudix hydrolase from S. cerevisiae with a novel substrate specificity. Given the current power of genetic manipulation in yeast, phenotypic analysis of YOR163w knockouts in appropriate genetic backgrounds (e.g. apa1 and apa2 mutants) should help determine the role(s) of this enzyme and the relative contribution of hydrolases and phosphorylases to ApnA catabolism and function in those organisms in which both types of enzyme exist (34).

    ACKNOWLEDGEMENTS

We are grateful to M. C. Prescott for mass spectrometric determinations. We thank L. D. Barnes for communicating unpublished results and for valuable discussions and P. Plateau, B. Dujon, and L. D. Barnes for providing reagents.

    FOOTNOTES

* Financial support was provided by the Leverhulme Trust and the Royal Society.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 44-151-794-4369; Fax: 44-151-794-4349; E-mail: agmclen{at}liv.ac.uk.

2 All the enzymes mentioned are active toward other dinucleoside polyphosphates in addition to diadenosine polyphosphates.

3 J. L. Cartwright and A.G. McLennan, unpublished observations.

4 S. W. Ingram, S. A. Stratemann, and L. D. Barnes, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: ApnA, diadenosine 5',5'''-P1,Pn-polyphosphate; Ap2A, diadenosine 5',5'''-P1,P2-diphosphate; Ap3A, diadenosine 5',5'''-P1,P3-triphosphate; Ap4A, diadenosine 5',5'''-P1,P4-tetraphosphate; Ap5A, diadenosine 5',5'''-P1,P5-pentaphosphate; Ap6A, diadenosine 5',5'''-P1,P6-hexaphosphate; p5A, adenosine 5'-pentaphosphate; p4A, adenosine 5'-tetraphosphate; DTT, dithiothreitol; nudix, nucleoside diphosphate linked to x; Bis-Tris propane, 1,3-bis[tris(hydroxyethyl)methylamino]propane; CAPS, 3-(cyclohexylamino)propanesulfonic acid.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
  1. Vartanian, A., Prudovsky, I., Suzuki, H., Dal Pra, I., and Kisselev, L. (1997) FEBS Lett. 415, 160-162[CrossRef][Medline] [Order article via Infotrieve]
  2. Rapaport, E., and Zamecnik, P. C. (1976) Proc. Natl. Acad. Sci. U. S. A. 73, 3984-3988[Abstract]
  3. Baxi, M. D., and Vishwanatha, J. K. (1995) J. Pharmacol. Toxicol. Method 33, 121-128[CrossRef][Medline] [Order article via Infotrieve]
  4. Barnes, L. D., Garrison, P. N., Siprashvili, Z., Guranowski, A., Robinson, A. K., Ingram, S. W., Croce, C. M., Ohta, M., and Huebner, K. (1996) Biochemistry 35, 11529-11535[CrossRef][Medline] [Order article via Infotrieve]
  5. Sozzi, G., Huebner, K., and Croce, C. M. (1998) Adv. Cancer. Res. 74, 141-166[Medline] [Order article via Infotrieve]
  6. Guranowski, A., and Sillero, A. (1992) in Ap4A and Other Dinucleoside Polyphosphates (McLennan, A. G., ed), pp. 81-133, CRC Press, Boca Raton, FL
  7. Thorne, N. M. H., Hankin, S., Wilkinson, M., Nuñez, C., Barraclough, R., and McLennan, A. G. (1995) Biochem. J. 311, 717-721[Medline] [Order article via Infotrieve]
  8. Bessman, M. J., Frick, D. N., and O'Handley, S. F. (1996) J. Biol. Chem. 271, 25059-25062[Free Full Text]
  9. Guranowski, A., and Blanquet, S. (1985) J. Biol. Chem. 260, 3542-3547[Abstract]
  10. Kaushal, V., Avila, D. M., Hardies, S. C., and Barnes, L. D (1990) Gene 95, 79-84[Medline] [Order article via Infotrieve]
  11. Plateau, P., Fromant, M., Schmitter, J. M., and Blanquet, S. (1990) J. Bacteriol. 172, 6892-6899[Medline] [Order article via Infotrieve]
  12. Brenner, C., Garrison, P., Gilmour, J., Peisach, D., Ringe, D., Petsko, G. A., and Lowenstein, J. M. (1997) Nat. Struct. Biol. 4, 231-238[Medline] [Order article via Infotrieve]
  13. Cartwright, J. L., and McLennan, A. G. (1997) Biochem. Soc. Transact. 25, S580[Medline] [Order article via Infotrieve]
  14. Ng, K. E., and Orgel, L. E. (1987) Nucleic Acids Res. 15, 3573-3580[Abstract]
  15. Brevet, A., Chen, J., Leveque, F., Plateau, P., and Blanquet, S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 8275-8279[Abstract]
  16. Theoclitou, M. E., Wittung, E. P. L., Hindley, A. D., Elthaher, T. S. H., and Miller, A. D. (1996) J. Chem. Soc. Perkin Trans. I 16, 2009-2019
  17. Ames, B. N. (1966) Methods Enzymol. 8, 115-118
  18. Prescott, M., Milne, A. D., Thorne, N. M. H., and McLennan, A. G. (1992) Int. J. Biochem. 24, 565-571[Medline] [Order article via Infotrieve]
  19. Peterson, G. L. (1982) Methods Enzymol. 91, 95-119
  20. Guranowski, A. (1990) FEBS Lett. 262, 205-208[CrossRef][Medline] [Order article via Infotrieve]
  21. McLennan, A. G., Taylor, G. E., Prescott, M., and Blackburn, G. M. (1989) Biochemistry 28, 3868-3875[Medline] [Order article via Infotrieve]
  22. Guranowski, A., Brown, P., Ashton, P. A., and Blackburn, G. M. (1994) Biochemistry 33, 235-240[Medline] [Order article via Infotrieve]
  23. McLennan, A. G., Evershed, R., and Prescott, M. (1989) Biomed. Environ. Mass Spectrom. 18, 450-452[Medline] [Order article via Infotrieve]
  24. Dixon, R. M., and Lowe, G. (1989) J. Biol. Chem. 264, 2069-2074[Abstract/Free Full Text]
  25. Weber, D. J., Abeygunawardana, C., Bessman, M. J., and Mildvan, A. S. (1993) Biochemistry 32, 13081-13088[Medline] [Order article via Infotrieve]
  26. Plateau, P., Mayaux, J.-F., and Blanquet, S. (1982) Biochemistry 20, 4654-4662
  27. Goerlich, O., Foeckler, R., and Holler, E. (1982) Eur. J. Biochem. 126, 135-142[Medline] [Order article via Infotrieve]
  28. Jakubowski, H. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 2378-2382[Abstract]
  29. Guranowski, A., Sillero, M. A. G., and Sillero, A. (1994) J. Bacteriol 176, 2986-2990[Abstract]
  30. Lienhard, G. E., and Secemski, I. I. (1973) J. Biol. Chem. 248, 1121-1123[Abstract/Free Full Text]
  31. Moskvina, E., Schüller, C., Maurer, C. T. C., Mager, W. H., and Ruis, H. (1998) Yeast 14, 1041-1050[CrossRef][Medline] [Order article via Infotrieve]
  32. Blackburn, G. M., Taylor, G. E., Thatcher, G. R. J., Prescott, M., and McLennan, A. G. (1987) Nucleic Acids Res. 15, 6991-7004[Abstract]
  33. Jakubowski, H., and Guranowski, A. (1983) J. Biol. Chem. 258, 9982-9989[Abstract/Free Full Text]
  34. McLennan, A. G., Mayers, E., Hankin, S., Thorne, N. M. H., Prescott, M., and Powls, R. (1994) Biochem. J. 300, 183-189[Medline] [Order article via Infotrieve]
  35. O'Handley, S. F., Frick, D. N., Dunn, C. A., and Bessman, M. J. (1998) J. Biol. Chem. 273, 3192-3197[Abstract/Free Full Text]
  36. Safrany, S. T., Caffrey, J. J., Yang, X., Bembenek, M. E., Moyer, M. B., Burkhart, W. A., and Shears, S. B. (1998) EMBO J. 17, 6599-6607[Abstract/Free Full Text]


Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.