From The Menkes protein (MNK or ATP7A) is a
transmembrane, copper-transporting CPX-type ATPase, a
subgroup of the extensive family of P-type ATPases. A striking feature
of the protein is the presence of six metal binding sites (MBSs) in the
N-terminal region with the highly conserved consensus sequence
GMXCXXC. MNK is normally located in the
trans-Golgi network (TGN) but has been shown to relocalize
to the plasma membrane when cells are cultured in media containing high
concentrations of copper. The experiments described in this report test
the hypothesis that the six MBSs are required for this copper-induced
trafficking of MNK. Site-directed mutagenesis was used to convert both
cysteine residues in the conserved MBS motifs to serines. Mutation of
MBS 1, MBS 6, and MBSs 1-3 resulted in a molecule that appeared to
relocalize normally with copper, but when MBSs 4-6 or MBSs 1-6 were
mutated, MNK remained in the TGN, even when cells were exposed to 300 µM copper. Furthermore, the ability of the MNK variants
to relocalize corresponded well with their ability to confer copper
resistance. To further define the critical motifs, MBS 5 and MBS 6 were
mutated, and these changes abolished the response to copper. The region
from amino acid 8 to amino acid 485 was deleted, resulting in mutant
MNK that lacked 478 amino acids from the N-terminal region, including
the first four MBSs. This truncated molecule responded normally to
copper. Moreover, when either one of the remaining MBS 5 and MBS 6 was mutated to GMXSXXS, the resulting proteins were
localized to the TGN in low copper and relocalized in response to
elevated copper. These experiments demonstrated that the deleted
N-terminal region from amino acid 8 to amino acid 485 was not essential
for copper-induced trafficking and that one MBS close to the membrane
channel of MNK was necessary and sufficient for the
copper-induced redistribution.
Copper is an essential element required for enzymes such as
cytochrome c oxidase, lysyl oxidase, and
dopamine- Elucidating the function of the N-terminal
GMXCXXC motifs of both WND and MNK has been the
subject of several studies (13-16). These studies suggest a binding
stoichiometry of one copper atom per metal binding site for both MNK
and WND N termini and a capacity to bind Zn, Ni, and Co (13, 14). Thus
far, the biochemical function of the MNK and WND N termini has only
been studied in a In CHO-K1 cells, human fibroblasts, and HeLa cells, MNK is localized to
the trans-Golgi network (TGN) (17-19).
Copper-dependent redistribution of MNK from the TGN to the
plasma membrane was demonstrated in copper-resistant CHO-K1 cells that
overexpressed the endogenous hamster MNK homologue (17). Recently, this
observation was supported by experiments with stable CHO-K1 cells
expressing human MNK from a cDNA construct (20). Copper-induced
movement of WND from the TGN to an as yet unidentified intracellular
compartment has also been observed (21-23). Despite these data, little
is known about the structural domains involved in the exocytic and
endocytic trafficking of these copper-transporting proteins. An obvious candidate region that may be involved in the
copper-dependent trafficking of MNK is the N-terminal
region containing the six copper-binding GMXCXXC motifs.
The objective of this study was to clarify the role of the N-terminal
MBSs of MNK in copper-induced redistribution. We report here that not
all of the MBSs are essential for the relocalization of MNK and for
conferring a copper-resistant phenotype. Furthermore, the presence of
only one MBS within a region of ~170 amino acids adjacent to the
proposed transduction channel is necessary and sufficient for the
copper-induced exocytic trafficking of the Menkes protein. In addition,
the data indicate that protein-protein interactions that may be
required for the translocation of MNK from the TGN to the plasma
membrane do not involve amino acids 8-485 of the MNK N terminus.
Antibody Production--
The production of the affinity-purified
antibody directed against the first 590 amino acids of the MNK N
terminus was described previously (20). To detect MNK truncated at the
N terminus, rabbit antibodies directed against the C-terminal peptide
with the amino acid sequence RNSPRLGLLDRIVNYSRASIC were produced. The MNK IgG fraction was prepared by sodium sulfate precipitation as
described previously (24).
Oligonucleotides--
The sequences of the mutagenic primers and
the selection oligonucleotides that were used in site-directed
mutagenesis are listed (5' to 3'), and the introduced restriction sites
or the metal binding site (MBS) that was mutated from
GMXCXXC to GMXSXXS is
indicated in parentheses: (i) IVM20 (MBS 1),
GGTCCAAACAGAGGAATTCGAAGTCATACCC; (ii) IVM21 (MBS 2),
AATAGTGCTAGTCGATGAATGGGAGGTCATCC; (iii) IVM22 (MBS 3),
ATTTGACACAGATGATTTAGAATGCATCCCATCAATG; (iv) IVM23 (MBS 4),
ATAGACTGCACAGAGGAATTCGAAGTCATGC; (v) IVM24 (MBS 5),
GTTTGCTACACTCGAAGCGCTAGTCATGC; (vi) IVM25 (MBS 6),
TATGTACGCTGGAGGCACTAGTCATTCCCC; and (vii) IVM26
(XhoI/SacI/AvaI),
GAAGAGATGAGCTCGAGGGAGAGTTTG. For site-directed mutagenesis of the
truncated MNK, the selection oligonucleotide was IVM40
(CTAGAGTCGACCCGCGGCCCAAGCTTG). For mutagenesis of the full-length MNK,
amp-repair/tet-knockout and
tet-repair/amp-knockout primer pairs for use with
the vector pALTER-1 were used according to the manufacturer's
recommendations (Promega).
In Vitro Mutagenesis of the N-terminal Metal Binding Sites in
Full-length MNK--
A 1.8-kb SacII fragment encoding the N
terminus of MNK was isolated from the previously described construct
pCMB19 (25) and subcloned into pBluescriptII-KS(+) (Stratagene). A
1.8-kb SacI/SalI fragment from this construct was
further subcloned into pALTER-1 (Promega). By site-directed mutagenesis
using the mutagenic primer IVM26, a
XhoI/SacI/AvaI restriction site was
introduced between MBS 3 and MBS 4, generating plasmid pCMB99.
Site-directed mutagenesis of pCMB99 was carried out using either one
primer (IVM20) or three primers (IVM20/IVM21/IVM22) to create Cys to Ser mutations in MBS 1 and MBSs 1-3, respectively. To generate Cys to
Ser mutations in MBS 6, MBS 5 and MBS 6, and MBSs 4-6, pCMB99 was
mutated using the oligonucleotides IVM25, IVM24/IVM25, and
IVM23/IVM24/IVM25, respectively. Mutagenesis procedures were essentially performed according to the manufacturer's description using the Altered Sites II in vitro mutagenesis kit
(Promega). Mutations were initially verified by restriction analysis
and subsequently confirmed by manual and automated DNA sequencing using
the ThermoSequenase cycle sequencing kit and the dideoxy chain
termination kit, respectively (both from Amersham). To generate MNK
mutated in all six MBSs, a 0.9-kb SacI fragment containing mutations in MBSs 4-6 was isolated and ligated with the 6.6-kb SacI fragment of pCMB99 containing mutations within MBSs
1-3. Subsequently, all of the mutated 1.8-kb MNK fragments were
excised from pCMB99 with SacII and subcloned into pCMB19,
replacing the original 1.8-kb SacII fragment. The final
plasmid constructs were obtained by subcloning the full-length mutated
MNK cDNAs as XbaI/SalI fragments
into the NheI/SalI sites of the eukaryotic
expression vector pCMB77 (26).
N-terminal Deletion and in Vitro Mutagenesis of the Truncated
MNK--
The 1.8-kb fragment encoding the N terminus of MNK was PCR
amplified and cloned as a BamHI/SacII fragment
into pBluescriptII-KS(+) to generate the plasmid pCMB6. Digestion of
this clone with EcoRI and re-ligation created a clone with
an in-frame deletion of a 1.4-kb fragment containing MBSs 1-4 but
maintained the MNK start site and MBS 5 and MBS 6 within a 0.4-kb
fragment. This fragment was re-cloned into the
BamHI/SacI site of vector pSP64 (Promega) and
designated pCMB142. The 0.4-kb insert from this clone was isolated as a
XbaI/SacII fragment and ligated to the 2.9-kb
SacII/XhoI fragment of pCMB19, and the ligated
product was ligated to XbaI/XhoI-digested pWSK29
(27) to generate pCMB144. The truncated MNK cDNA from this clone
was isolated as a XbaI/SalI fragment and cloned
into the NheI/SalI site of expression vector
pCMB77 to create plasmid pCMB146. This construct encodes a protein
lacking 478 amino acids from amino acid 8 to amino acid 485, thus
eliminating the first four MBSs.
Truncated MNK constructs containing only MBS 5 and MBS 6 with each MBS
separately mutated at the Cys residues were generated. Site-directed
mutagenesis was carried out on pCMB142, using the mutagenic primer
IVM24 to mutate the MBS 5 Cys residues to Ser. The 0.4-kb mutated
fragment from the resulting plasmid, pCMB143, was isolated as a
SacII fragment and cloned into SacII-digested pCMB19 to replace the 1.8-kb MBS-encoding fragment. The truncated MNK
construct with a mutated MBS 5 was isolated from this plasmid (pCMB145)
as a XbaI/SalI fragment and cloned into pCMB77 to
generate the final construct, pCMB147.
Plasmid pCMB109 contained the 1.8-kb N terminus encoding the MNK
fragment in which MBS 6 was mutated at the Cys residues. The 1.8-kb
fragment was isolated from this plasmid as a
SacII/NotI fragment and cloned into vector
pGEM-5Zf(+) (Promega) to generate pCMB148. MBSs 1-4 were deleted from
this plasmid by digestion with EcoRI and re-ligation to
generate pCMB158. The resulting 0.4-kb insert was isolated as a
SacII/SacI fragment and cloned into pCMB19 to
replace the 1.8-kb SacII/SacI MNK fragment. The truncated MNK construct from this plasmid (pCMB159) was cloned as a
XbaI/SalI fragment into the
NheI/SalI site of pCMB77 to generate the final
construct, pCMB160.
Cell Culture and Transient Transfection Experiments--
Cell
culture conditions were as described previously (28). Approximately
3 × 105 CHO-K1 cells were seeded onto coverslips on
the day before the experiment. For each transfection, 0.5-1 µg of
supercoiled plasmid DNA and 3 µl of LipofectAMINE (Life Technologies,
Inc.) was used in serum-free BME. Transfection procedures and culturing
conditions were as described by the manufacturer. At approximately
18 h after transfection, CuCl2 was added to a final
concentration of 200 µM, and cells were incubated for
3 h at 37 °C. Cells were then fixed in acetone and
processed for immunofluorescence analysis as described previously
(17).
Stable Transfections--
Purified plasmid DNA was linearized
with NruI. Cells were grown to ~50% confluence, and
transfections were carried out as described for transient transfections
in a total volume of 5 ml of serum-free BME. Cells were allowed to
recover overnight in BME containing 10% fetal calf serum, detached,
and seeded into 24-well plates. Selection in 400 µg/ml G418 (Life
Technologies, Inc.) was initiated and continued for 12 days.
G418-resistant clones were screened for MNK expression by
immunofluorescence analysis, and MNK-positive colonies were clonally purified.
Immunofluorescence Microscopy--
Fixed cells were blocked and
immunolabeled as described previously (17). Primary antibodies
consisted of either affinity-purified anti-MNK N terminus antibodies or
sulfate-precipitated anti-MNK C terminus antibodies. The secondary
antibody was fluorescein isothiocyanate-conjugated anti-rabbit IgG
(Silenus, Australia). Cells were analyzed using a × 100 objective
on a Zeiss microscope (Figs. 2, 4, and 5) or a × 60 objective on
a confocal scanning microscope (Optiscan F900) (Fig.
3B).
Western Blotting--
Approximately 30 µg of whole cell
protein extract were fractionated by SDS-polyacrylamide gel
electrophoresis and transferred to nitrocellulose (Schleicher and
Schuell, Northeim, Germany). MNK was detected by using the
affinity-purified anti-MNK N terminus antibody, followed by horseradish
peroxidase-conjugated sheep anti-rabbit IgG (AMRAD Biotech, Victoria,
Australia) as the secondary antibody. Protein detection was carried out
using chemiluminescence blotting substrate (Boehringer Mannheim). All
the protocols were performed essentially as described previously
(20).
Colony Survival Assay--
80 cells/3-cm Petri dish were seeded
in triplicate and allowed to attach overnight. The cells were incubated
in BME and 10% fetal calf serum containing 0-105 µM
CuCl2 for the next 7 days. After this period, the cells
were fixed in 90% methanol and 10% formaldehyde and stained with 10%
Giemsa's stain (improved R66 solution; Gurr; Merck), and the number of
colonies in each Petri dish was counted.
The role of the six MBSs in MNK trafficking was investigated using
site-directed and deletion mutagenesis of the MNK N terminus. Constructs encoding MNK mutated in MBS 1 alone (MNKm1), MBS 6 alone
(MNKm6), MBSs 1-3 (MNKm1-3), MBSs 4-6 (MNKm4-6), and MBS 5 and MBS 6 (MNKm5+6) were generated. Amino acids 8-485 at the N terminus of MNK
were deleted to create MNK All of the mutated MNK cDNA constructs were initially transiently
transfected into CHO-K1 cells, and the intracellular distribution of
the mutated MNK molecules was assessed by indirect immunofluorescence using polyclonal antibodies directed against the MNK N or C terminus. Stable cell lines were established for constructs containing
MNKm1-3, MNKm4-6 and MNKm1-6. In basal
copper concentrations, fluorescent staining was observed within the
perinuclear region of all of the transfected cells (Figs.
2-6; The Murdoch Institute for Research into Birth
Defects,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-hydroxylase that employ its fundamental redox
properties in the respiratory chain, connective tissue biosynthesis,
and catecholamine production, respectively. Nevertheless, these
biochemically useful redox properties can also lead to serious cellular
damage through the formation of highly reactive free radicals. Thus,
intracellular copper concentrations must be tightly regulated. Various
molecules are involved in the maintenance of cellular copper
homeostasis, many of which have been recently identified and
characterized (for a review, see Ref. 1). Among these are copper efflux
proteins whose essential role is demonstrated in the genetically
inherited Menkes and Wilson diseases. The genes affected in these
diseases were identified by several independent groups (2-6) and
designated MNK (ATP7A) and WND
(ATP7B). MNK and WND encode highly
homologous membrane proteins of 178 and 165 kDa, respectively. They
belong to the family of P-type ATPases classically represented by the
human Ca2+-ATPases and the ubiquitous
Na+/K+-ATPases (7). Together with
Cd2+-ATPases, Cu+/2+-ATPases form a subfamily
of CPX-type ATPases (X = Cys, His, or Ser)
characterized by a conserved Cys-Pro-X motif in the proposed ion transduction channel and a variable number of
GMXCXXC putative heavy metal binding sites
(MBS)1 at the N terminus (8).
Bacterial copper transporters contain a single MBS (9), yeast possess
two MBSs (10), nematodes have three MBSs (11), and the human MNK and
WND have six metal binding sites (8). The same motifs are also present
in cadmium transporters and in mercury-binding proteins (12),
underscoring the role of these motifs in specifically complexing heavy
metal ions.
ccc2 mutant yeast strain in which human MNK and
WND fully restored copper delivery to the high affinity iron uptake
system (15, 16). The third MBS was found to be most critical for
catalytic activity of MNK and was suggested to be involved in
protein-protein interaction (15). A further study demonstrated that the
deletion of a region comprising MBS 6 rendered WND inactive (16).
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1-4, and in this construct, mutations were
separately introduced within MBS 5 (MNK
1-4m5) and MBS 6 (MNK
1-4m6) to generate constructs with only one functional MBS (Fig.
1).
View larger version (36K):
[in a new window]
Fig. 1.
Schematic representation of mutations and
deletions introduced into MNK. MBSs of MNK were mutated from
GMXCXXC to GMXSXXS by
site-directed mutagenesis as described under "Experimental
Procedures." white box, wt MBS; gray box,
mutated MBS; X/A/S,
XhoI/AvaI/SacI restriction sites
introduced between MBS 3 and MBS 4; E, EcoRI
restriction sites used to delete the first 478 amino acids of
MNK.
Cu), consistent with
location at the TGN and with previous results obtained with CHO-K1
cells (17, 20). Thus, the overexpressed, mutated MNKs were not
mislocalized under basal conditions. Furthermore, the mutations did not
affect MNK epitope recognition by the polyclonal antibody, suggesting that even multiple point mutations within the N terminus did not induce
significant antigenic changes in the molecule.
View larger version (88K):
[in a new window]
Fig. 2.
Effect of copper on MNK localization in
transiently transfected CHO-K1 cells expressing wt MNK and MNK mutated
in MBS 1 and MBS 6. Cells transiently transfected with cDNA
encoding MNK mutated in MBS 1 or MBS 6 were cultured for 3 h in
normal media ( Cu) or in media containing 200 µM CuCl2 (+ Cu). Cells were then
fixed, blocked, and immunolabeled using an affinity-purified N-terminal
anti-MNK antibody. wt, wild-type MNK; MNKm1, MNK
mutated in MBS 1; MNKm6, MNK mutated in MBS 6. Some
untransfected cells are visible, showing the level of background
staining.
After incubation in 200 µM copper for 3 h, transiently expressed human MNK that was mutated in either MBS 1 (MNKm1) or MBS 6 (MNKm6) was redistributed and was clearly present within the cytoplasm and at the plasma membrane (Fig. 2). There were no obvious differences in the staining pattern of cells expressing mutated or wt proteins as observed after incubation in different copper concentrations (data not shown). Thus, a single GMXCXXC to GMXSXXS mutation within the MNK N terminus did not influence the copper-inducible relocation of MNK.
Proteins transiently expressed in cells differ significantly in their levels of expression. Therefore, the interpretation of results obtained with transiently transfected cells can be complicated by artifacts resulting from overexpression of the target protein. To allow a clearer analysis of the effects of mutations, stable cell lines were generated from CHO-K1 cells that expressed the mutant MNK forms MNKm1-3, MNKm4-6, and MNKm1-6. These cell lines were designated 114, 115, and 116, respectively.
To confirm that the expressed mutant proteins were of the expected
sizes and to determine the level of MNK expression, Western blots on
whole cell lysates of the stable cell lines were carried out (Fig.
3A). A protein of the expected
size of ~178 kDa was detected in each of cell lines 114, 115, and
116, also demonstrating the capacity of the anti-MNK antibody to
recognize the mutated proteins. Compared with the endogenous CHO-K1
Menkes protein homologue, significantly more MNK was expressed in the
transfected cell lines. This level of expression corresponded well with
the intensity of the fluorescent signal observed in the whole cell
fluorescence experiments described below.
|
The intracellular location of MNKm1-3, MNKm4-6, and MNKm1-6 was assessed by confocal immunofluorescence microscopy. All of these mutated proteins localized to the TGN in cells cultured in basal medium (Fig. 3B). When cells were incubated for 3 h in 80 µM copper, some redistribution to the plasma membrane was noticeable in the wt cells and in cell line 114 (MNKm1-3). In high copper concentrations, the labeling of the plasma membrane of these cells intensified and was the predominant signal at 300 µM copper (Fig. 3B). When the 114 and the wt cell lines were incubated for 10, 20, 40, 60, and 120 min in media containing 100 µM copper, there were no noticeable differences in the kinetics of the translocation observed for the two MNK forms (data not shown). In contrast to wt MNK and MNKm1-3, MNKm4-6 and MNKm1-6 remained at the TGN after incubation in high copper concentrations (300 µM). These data demonstrated that the first three MBSs were not essential for the copper-dependent redistribution of MNK, whereas the three MBSs closest to the transport channel were critical.
To further localize the regions critical for relocalization, a
construct with MNK mutated in MBS 5 and MBS 6 was created (MNKm5+6). CHO-K1 cells transiently transfected with this construct showed clear
perinuclear staining that indicated TGN localization of MNKm5+6. In the
presence of elevated copper, MNKm5+6 remained at the TGN, whereas wt
MNK relocated to the plasma membrane (Fig. 4). This result showed that MBSs 1-4
were not sufficient for the copper-dependent redistribution
of MNK.
|
To determine whether amino acids other than the MBSs in the N-terminal
region play a role in copper-induced trafficking and whether both MBS 5 and MBS 6 or just one of the two were essential, a construct encoding
MNK that lacked MBSs 1-4 was generated (MNK1-4) and mutated
individually at MBS 5 (MNK
1-4m5) and MBS 6 (MNK
1-4m6). Immunofluorescence microscopy using an antibody directed against the
MNK C terminus showed that in basal media, all three mutant proteins
were located at the TGN of transiently transfected CHO-K1 cells.
However, when cells were incubated in 200 µM copper for 3 h, an elevated, dispersed fluorescence was evident throughout the cytoplasm and at the plasma membrane (Fig.
5). These results showed that amino acids
8-485 of the MNK N terminus were not necessary for the copper-induced
redistribution of the protein; therefore, this region did not contain a
critical copper-sensing or copper-responsive targeting signal. In
addition, these data indicated that a single MBS located within a
maximum distance of 170 amino acids from the membrane channel was
sufficient for MNK trafficking.
|
The ability of the mutated proteins to confer copper resistance was
determined by assessing the survival of 114, 115 and 116 cells
(expressing MNKm1-3, MNKm4-6, and MNKm1-6, respectively) compared with
the parental CHO-K1 cells and CHO-K1 cells expressing wt MNK in
increasing copper concentrations (Fig.
6). The level of copper resistance of
cell lines 115 and 116 was similar to that of the parental CHO-K1 cells
with an estimated LD50 of 60-65 µM
CuCl2 (Fig. 6, B and C). In contrast,
the survival of 114 cells and the wt cell line was still evident up to
105 µM CuCl2, with a LD50 of 75 and 105 µM copper, respectively (Fig. 6A).
However, the difference in copper resistance of 114 cells compared with wt cells may be explained by a ~50% reduction in the level of MNK
expression in 114 cells (Fig. 3A); therefore, MNKm1-3 may be
functionally equivalent to wt MNK.
|
Taken together, these results showed that: (i) point mutations
converting either a single MBS or the first three MBSs from GMXCXXC to GMXSXXS have no
effect on the copper-induced intracellular redistribution of MNK as
shown with MNKm1, MNKm6, and MNKm1-3; (ii) the protein region
encompassing the first four MBSs is not necessary for copper-regulated
trafficking; (iii) one MBS within the region comprising MBS 5 to MBS 6 is necessary and sufficient for copper-dependent MNK
trafficking; and (iv) the ability of MNK to confer resistance to copper
is linked to its ability to undergo copper-induced redistribution.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Petris et al. (17) previously demonstrated a copper-responsive relocalization of MNK from the TGN to the plasma membrane in copper-resistant CHO-K1 cells. Recently, a copper-dependent redistribution to the cell surface was demonstrated in CHO-K1 cells that expressed human MNK (20). To explain the MNK response to elevated copper levels, it was postulated that the N terminus functioned as a copper-sensing domain in which the six MBSs became progressively occupied by copper, causing a conformational change that triggered the redistribution of MNK (17). In this study, we have used an extensive mutagenesis strategy to define the role of the six MBSs in the copper-induced trafficking of MNK.
The mutation of a single MBS did not inhibit the copper-induced relocalization of MNK from the TGN to the plasma membrane, as demonstrated by mutations of MBS 1 and MBS 6 (Fig. 2). The majority of point mutations that have been identified in Menkes patients occur within exons 7-10, which encode MBS 6 and the first four transmembrane helices. All of the point mutations identified within the N terminus were either nonsense mutations or insertion/deletion mutations that are predicted to result in a truncation of the MNK gene product (29). These observations suggest that point mutations that disrupt the function of a single MBS are not likely to cause a disease phenotype and are supported by our findings that six functional MBSs are not necessary for MNK trafficking.
In elevated copper, MNKm1-3 was able to redistribute to the plasma membrane, demonstrating that the first three GMXCXXC repeats are not essential for the copper-induced trafficking of MNK (Fig. 3B). In contrast to MNKm1-3, MNKm1-6, MNKm4-6, and MNKm5+6 remained predominantly within the perinuclear region, even under very high copper concentrations (300 µM) (Figs. 3B and 4). This result suggested that the MBSs close to the membrane channel were more important for the intracellular trafficking of MNK. Further support for this conclusion was obtained with the deletion constructs containing only MBS 5 and MBS 6 that showed that only one functional MBS close to the channel was necessary and sufficient for MNK trafficking (Fig. 5). These experiments demonstrated that 478 amino acids within the MNK N terminus did not contain a critical targeting sequence and were not required for the copper-dependent exocytic trafficking of MNK, effectively negating the hypothesis that the multiple metal binding sites constitute a relocalization domain.
The ability of the mutated MNK molecules to traffic corresponded well with their ability to confer copper resistance. The parental CHO-K1 cells and cell lines 115 and 116 that overexpressed MNK mutated in MBSs 4-6 and MBSs 1-6, respectively, did not survive in copper levels greater than 75 µM for 7 days. In contrast, the cell lines overexpressing MNKm1-3 and wt MNK (114 and wt cells, respectively) were significantly more resistant to copper (Fig. 6, A-C). This experiment demonstrated that the copper-resistant phenotype was caused by the overexpression of MNK. Therefore, MNK molecules mutated in the first three MBSs were able to effectively efflux copper, indicating that MBSs 1-3 were not essential for both MNK trafficking and copper transport.
Earlier data suggested that MNK constitutively recycled between the TGN and the plasma membrane in cells cultured in low-copper media (17). Copper-induced relocalization of MNK could involve an increase in the rate of exocytosis of MNK from the TGN to the plasma membrane or a reduction in the rate of endocytosis from the plasma membrane. No published data distinguish between these two possibilities. However, two regions important for its basal location in the TGN have been identified. The first is a 38-amino acid sequence containing transmembrane domain 3, characterized as a candidate region responsible for Golgi retention of MNK (30). In addition, TGN localization has recently been shown to depend on a di-leucine motif, 1487LL1488, within the C-terminal region of MNK (26). Di-leucines are a class of endocytic targeting signals directing plasma membrane proteins into clathrin-coated vesicles, resulting in constitutive internalization of these membrane proteins (31). Based on these observations, one hypothesis to explain the accumulation of MNK at the plasma membrane is that copper retards the internalization of the protein by causing a conformational change that obscures the C-terminal di-leucine motif. This conformational change may occur as a consequence of the binding of copper to MBS 5 or MBS 6. To clarify whether this mechanism is operative, some measurements of the rate of internalization of MNK in the presence and absence of copper will be required.
An alternative model to explain copper-induced relocalization is that conformational changes induced by copper-binding at the N terminus may activate the delivery of copper to the channel and induce the translocation of a copper ion across the cell membrane. Further conformational changes that are coincident with the copper pumping mechanism of MNK may reveal a motif that is recognized by the vesicular sorting machinery, leading to an increase in the number of MNK molecules that are loaded onto vesicles destined for the plasma membrane. In this mechanism, the proximity of the MBS to the transduction channel may be critical either for the direct delivery of copper to the channel or for the acceptance of copper from copper chaperones such as HAH1 (32) that specifically interact with the protein region comprising MBS 5 and MBS 6. This model is supported by several recent experiments from our laboratory that showed different mutations in structurally and functionally distinct regions of MNK, which are predicted to disrupt copper transport activity, inhibited the copper-dependent trafficking of the protein.2 In addition, Payne et al. (22) have reported that a mutation in a region distinct from the metal binding sites in the closely related Cu-ATPases affected in Wilson disease also abolished copper-induced relocalization (22). These observations suggest that mutations in MNK that disrupt copper transport may also prevent copper-induced relocalization to the plasma membrane.
The redundancy of 478 N-terminal amino acids containing four MBSs
implies that as with bacteria and yeast, a Cu-ATPase with only one MBS
or two MBSs at the N terminus may be sufficient to maintain some degree
of copper homeostasis in mammalian cells. The number of MBSs at the N
terminus has increased during evolution: one in bacteria, two in yeast,
three in nematodes, and six in mammals. This observation suggests that
MNK and WND gained the additional MBSs simply by amplification of the
repeated elements. The additional MBSs may have evolved to increase the
efficiency of copper scavenging in the cytoplasm or copper ion delivery
to the transduction channel in the cells of higher organisms. However, to further clarify the role of the six MBSs in the human
copper-transporting ATPases, additional studies involving copper
transport activity measurements of the mutant MNK forms will be required.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Dr. M. J. Petris for helpful scientific discussions, Dr. L. Ackland for help with the confocal microscopy, and Dr. J. Camakaris for critical reading of the manuscript.
![]() |
FOOTNOTES |
---|
* This work was supported by a grant from the International Copper Association and the National Health and Medical Research Council of Australia.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ A recipient of a fellowship from the Roche Research Foundation, Switzerland.
To whom correspondence should be addressed: Centre for
Cellular and Molecular Biology, School of Biological and Chemical
Sciences, Deakin University-Burwood Campus, 221 Burwood Highway,
Burwood, Victoria 3125, Australia. Tel.: 61-3-9251-7329; Fax:
61-3-9251-7328; E-mail: jmercer{at}deakin.edu.au.
2 S. La Fontaine, L. Ambrosini, and D. Strausak, unpublished observations.
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: MBS, metal binding site; MNK, Menkes protein; TGN, trans-Golgi network; CHO, Chinese hamster ovary; kb, kilobase(s); BME, Eagle's basal media; wt, wild-type; WND, Wilson protein.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|