Identification of a Novel DNA Binding Site for Nuclear Orphan
Receptor OR1*
Dorothee
Feltkamp
,
Franziska F.
Wiebel§,
Siegfried
Alberti, and
Jan-Åke
Gustafsson¶
From the Department of Biosciences at Novum, Karolinska Institute,
Hälsovägen 7, S-14157 Huddinge and the ¶ Department
of Medical Nutrition, Karolinska Institute, F 60 Novum,
S-14186 Huddinge, Sweden
 |
ABSTRACT |
The nuclear orphan receptor OR1 has been shown to
bind as a heterodimer with retinoid X receptor (RXR) to direct repeat 4 (DR4) response elements. It remained unclear, however, whether this
represents the only or the optimal binding site for this receptor.
Therefore, we performed a DNA binding site selection assay that allows
the identification of novel DNA binding sites for OR1 in an unbiased
manner. While OR1 alone was not able to select a specific sequence from
the pool of oligonucleotides, the OR1/RXR heterodimer selected a highly
conserved DR1 element, termed DR1s, with two AGGTCA motifs spaced by
one adenosine. The functional activity of the consensus binding site
was verified in transient transfection assays and corroborated by
in vitro studies. Based on the sequence of the consensus
DR1s, we located putative natural binding sites in the 5'-promoter
flanking regions of the rat S14 gene and the rat cholecystokinin type A
receptor gene. Furthermore, we could show that although the OR1/RXR
heterodimer has a distinct binding orientation on a DR4 element, it is
able to bind in both orientations to the DR1s element. The OR1 paralog LXR
does not bind as a heterodimer with RXR to the DR1s element, indicating that these receptors, despite their homology, are involved in the regulation of different sets of genes.
 |
INTRODUCTION |
Nuclear receptors constitute a superfamily of ligand-activated
transcription factors that link extracellular signals directly to
transcriptional responses and are involved in the regulation of many
diverse processes, including development, homeostasis, differentiation,
and oncogenesis (reviewed in Refs. 1-4). Important members of this
family are the steroid hormone receptors, the thyroid hormone receptor
(TR),1 the retinoic acid
receptor (RAR), the retinoid X receptor (RXR), the vitamin D receptor
(VDR), and an increasing number of orphan receptors for which a ligand
has not yet been identified. All members of this family share a common
modular structure consisting of four domains (5). A highly conserved
DNA binding domain (DBD) forms a two zinc finger structure, which is
involved in specific DNA binding and protein-protein interactions (6,
7). The C-terminal ligand binding domain, which is moderately conserved among the members of the family, is involved in ligand binding and
receptor dimerization and contains transactivation and/or repression
functions (8-10). The N-terminal parts of these proteins vary highly
both in length and sequence and often contain a transactivation domain (11, 12). The function of the hinge region that separates the DNA binding and the ligand binding domain is not yet fully understood but might involve interactions with regulatory proteins (13).
Nuclear receptors control transcription of their target genes by
interacting with specific DNA sequences termed hormone response elements (6, 14). All nuclear receptors recognize a minimal 6-base pair
sequence (AGGTCA or AGAACA) referred to as a consensus half site motif.
The primary determinant to discriminate between these two motifs is the
P-box (15), a 6-amino acid sequence at the C-terminal base of the first
zinc finger. To achieve high affinity binding and specificity for
target genes, most receptors bind as dimers to DNA. The steroid hormone
receptors interact as homodimers with their cognate DNA binding sites,
usually palindromic repeats spaced by 3 nucleotides. In contrast,
members of the thyroid/retinoid receptor subgroup bind most efficiently
as heterodimers with RXR to direct or inverted repeat elements of the
AGGTCA type. Both spacing of the half sites and surrounding nucleotides
are crucial determinants for the specificity of binding. Thus, elements
spaced by 1-5 nucleotides are bound by different subsets of
heterodimers (16-18). Since direct repeats are asymmetric elements,
binding of RXR heterodimers occurs in an asymmetric arrangement in
which RXR usually occupies the 5'-half site (19, 20). Interestingly, this polarity of binding is reversed in heterodimers binding to DR1
elements (21, 22).
Some receptors that bind as monomers to DNA display an increased
binding affinity for a single half site caused by an C-terminal extension, also referred to as A-box, at the end of the second conserved zinc finger. This motif contacts base pairs 5' of the upstream half site, usually an A/T rich sequence, which thus can form
part of the recognition sequence (23, 24). Another subgroup of
receptors is able to bind as homodimers to direct or inverted repeats
(25-27). RXR binds to direct repeats spaced by 1 base pair utilizing a
third helix, also known as the T-box, that is located immediately
downstream of the second zinc finger (28). Several receptors are able
to bind to more than one DNA binding site and in variable
configurations, often displaying differential activation properties
with the differential binding behavior (18, 20, 26, 29, 30).
The orphan receptor OR1 (also referred to as LXR
, RIP15, UR, and NER
(31-34)) and its paralog LXR
(also referred to as RLD-1 (35, 36))
have been isolated on the basis of their homology to sequences in the
DNA binding domain of known receptors. In situ hybridization
on fetal and adult rat tissues revealed an almost ubiquitous but
differentially regulated expression of OR1 (31, 37) indicative of a
general role for this receptor. In contrast, LXR
shows a more
restricted expression pattern, with the highest expression levels in
metabolically active organs, such as liver, intestine, and adrenals
(35, 36). An important step toward the understanding of the
physiological functions of OR1 and LXR
was the observation that both
receptors are activated by various oxysterols (38, 39). These compounds
have important functions in cholesterol homeostasis and constitute
precursors in the biosynthesis of steroid hormones and bile acids
(40-42). These findings led to the suggestion that at least LXR
acts as a sensor for cholesterol derivatives and directly connects
cholesterol homeostasis and gene regulation (38, 39). This hypothesis has recently been corroborated in a study on LXR
-deficient mice, which were no longer able to dispose excess cholesterol from the diet
via bile acid excretion (43). The rationale given for these results was
the failure of LXR
mediated induction of the 7
hydroxylase (CYP7A) gene, which encodes the enzyme responsible for the
rate-limiting step in the conversion of cholesterol to bile acids (39,
43).
The P-box sequence of both OR1 and LXR
identifies them as members of
the TR/RAR subgroup of nuclear receptors. The receptors have been shown
to form heterodimers with RXR on AGGTCA half sites spaced by 4 nucleotides, but also by 2 or 5 nucleotides, in gel shift analysis
(31-34, 44). Interestingly, both OR1/RXR and LXR
/RXR heterodimers
confer not only constitutive activation on a DR4 element but are also
inducible by the respective ligands, oxysterols, and 9-cis-retinoic
acid, the ligand for RXR, enabling these receptors to simultaneously
respond to a whole subset of different signals (31, 32, 44, 45).
In an effort to identify new target genes for OR1, we decided to
determine the optimal DNA binding site for OR1 without the bias
introduced by known or consensus elements. Therefore we used a
selection and amplification technique that allows identification of
high affinity binding sites from a pool of random oligonucleotides. Interestingly, we found that the OR1/RXR heterodimer preferentially binds to a DR1 type element, termed DR1s, and provide evidence that the
selected consensus sequence is able to mediate transactivation of a
reporter gene upon coexpression of the respective receptors. A data
base search based on the selected DNA sequence located putative
response elements in the 5'-promoter flanking regions of several genes.
Oligonucleotides containing these potential targets efficiently compete
with binding of the OR1/RXR heterodimer to the selected DR1s. Moreover,
we report the first example of an RXR-containing heterodimer that is
able to bind in both orientations to a direct repeat. These results
suggest that OR1 might play a central role in multiple hormonal
signaling pathways by responding to various signals and binding to
different subsets of genes.
 |
EXPERIMENTAL PROCEDURES |
Plasmids
Plasmids for Overexpression in Escherichia coli and in Vitro
Translation--
His6-tagged proteins were expressed in
the pET3a vector (Novagen) modified as follows: pET3a-OR1 expresses
full-length OR1 fused to the amino acid sequence MHHHHHHIEGR, including
6 histidines and a factor Xa cleavage site. The vector pET3a-
NOR1 is
an analogous construct that lacks codons 7-74 of OR1. Full-length RXR
(pET3a-RXR) is preceded by the same sequence as in pET3a-OR1, and the
analogous construct pET3a-
NRXR was obtained by deleting codons
11-111 of RXR. Vector sequences obtained by PCR were confirmed by DNA
sequencing or replaced by template material. The same plasmids were
used for in vitro transcription/translation from the T7
promoter in the pET3a-vector.
Vectors for Transfection Studies--
2DR1s-thymidine kinase
(TK)-LUC contains two copies of the sequence TAAAGGTCAAAGGTCAAGT spaced
by 5 nucleotides in front of the TK-LUC vector. This reporter vector is
a derivative of pGL3-Basic (Promega) in which a
BglII/HindIII fragment of the TK promoter has
been inserted. For expression of the receptors in CHO-K1 cells, cDNA fragments encoding full-length proteins were subcloned in the
pCMX-vector (kindly provided by D. Mangelsdorf) under control of the
CMV promoter. The empty vector was used as a control. pCMV5-SRC1 was
derived from a gift of B. W. O'Malley and as described by Onate
et al. (46) but in vector pCMV5.
Protein Expression and Purification
E. coli strain BL21(DE3)pLysS, freshly transformed
with one of the expression vectors, was grown at 30 °C in M9 minimal
medium supplemented with 1% casamino acids, 0.002% thiamin B1, 300 µg/ml ampicillin and 72 µg/ml chloramphenicol to an
A600 of approximately 0.6, induced with 1 mM IPTG and harvested after 2-3 h. Cell pellets were
resuspended in Buffer A (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM phenylmethylsulfonyl fluoride)
and broken in a French press. Cell debris was sedimented by
centrifugation at 16.000 × g for 15 min and the
supernatant applied on a TALON affinity column (CLONTECH) that was run on a Biologic
Chromatography System (Bio-Rad). The column was washed with 5-10
mM imidazole in Buffer A, and the proteins were eluted
either in a linear or in a step gradient with a final concentration of
500 mM imidazole in Buffer A. Fractions were analyzed by
SDS-polyacrylamide gel electrophoresis; pure fractions were combined,
and the protein was precipitated with ammonium sulfate, dialyzed
against 20 mM Tris-HCl, pH 8.0, 100 mM KCl,
50% glycerol, 1 mM phenylmethylsulfonyl fluoride, and stored at
80 °C.
In vitro transcription and translation was performed with
the TNT-T7 rabbit reticulocyte lysate kit (Promega, Madison, WI) as
recommended by the manufacturer. The integrity of all proteins was
analyzed by SDS-polyacrylamide gel electrophoresis using
[35S]methionine in the protocol.
Binding Site Selection Assay
The amplification and binding selection method was modified as
described by Alex et al. (Ref. 47 and references therein).
The oligonucleotide pools N20 or 2N10 consist of the following
sequences:
GGCTCAGCGAATTCCGTTGACC(N)20GGTCTACGGGATCCGAGTGACC or
GGCTCAGCGAATTCCGTTGACC(N)10AGGTCA(N)10GGTCTACGGGATCCGAGTGACC. The flanking sequences contain an EcoRI and
BamHI restriction site used for subcloning and primer
binding sites for PCR amplification. Single stranded oligonucleotides
were made double strand by PCR. 2 ng of either pool of oligonucleotides
was incubated with 200 ng of total protein in a binding reaction mix
containing 20 mM Tris-HCl, pH 8.0, 100 mM KCl,
5% glycerol, 100 ng poly(dI-dC)-poly(dI-dC), 1 mM
phenylmethylsulfonyl fluoride, and 1 mM dithiothreitol.
After 20 min of incubation at room temperature, the reaction volume was
increased to 100 µl, and the mixture was filtered through cellulose
nitrate filters (0.45-µm pore size, Schleicher & Schuell). Filters
were washed five times with 200 µl of binding buffer, dried, and
boiled in 300 µl of water to elute bound oligonucleotides. 30 µl of
this solution was used as a template for PCR amplification and
approximately 2 ng of the amplified product was used for the next round
of selection. After six rounds of filter binding and PCR amplification
the selected oligonucleotides were labeled in a standard PCR containing
5 ng of template and [
-32P]dCTP and subsequently used
as a probe in electrophoretic mobility shift assays (EMSAs). The
observed retarded DNA-protein complexes were cut out of the dried gel,
and the DNA was eluted overnight in elution buffer (300 mM
NaCl, 30 mM Tris-HCl, pH 8.0, 3 mM EDTA, pH
8.0). The eluted DNA was reamplified by PCR and either subcloned directly in a T-vector (pCRTM 2.1, Invitrogen) or cut with
EcoRI/BamHI prior to subcloning in pBluescript SK
(Stratagene). The subcloned oligonucleotides were then sequenced with
the dideoxy chain termination method using the T7 sequencing kit from
Amersham Pharmacia Biotech.
Electrophoretic Mobility Shift Assay (EMSA)
Synthetic oligonucleotide probes for EMSAs were end-labeled with
[
-32P]dCTP by Klenow enzyme and purified from a 10%
nondenaturing polyacrylamide gel. Approximately 0.5 ng (10-20.000 cpm)
of the probe was used in a binding reaction with 2-5 µl of
programmed reticulocyte lysate in a buffer containing 20 mM
Tris-HCl, pH 8.0, 100 mM KCl, 10% glycerol, 100 ng
poly(dI-dC)-poly(dI-dC) and 100 ng of single strand DNA as unspecific
competitor, 1 mM dithiothreitol, 0.1% bovine serum
albumin, and specific competitor or antibodies as indicated. The
reactions were incubated for 20 min at room temperature and
subsequently run on a 4.5% nondenaturing polyacrylamide gel in 1× TBE
(Tris-borate-EDTA) at 4 °C.
Transient Transfections
CHO K1 cells were plated in 6-well dishes containing Ham's F-12
medium supplemented with L-glutamine, 10% fetal calf
serum, 100 units/ml penicillin, and 100 µg/ml streptomycin at
37 °C in 5% CO2. After approximately 24 h, cells
were transfected with a total of 500 ng of expression vector DNA and 1 µg of reporter plasmid DNA using DOTAP reagent (Boehringer Mannheim)
according to the instructions of the manufacturer. After 4-5 h, medium
was exchanged, and inducer was added as indicated (9-cis-retinoic acid
was used at a final concentration of 1 µM,
22(R)-hydroxycholesterol at a final concentration of 5 µM). Cells were harvested 24 h after transfection
and assayed for luciferase activity. Each experiment was done in
duplicates and was performed at least three times.
 |
RESULTS |
Selection of OR1 Binding Sites--
To select specific binding
sites for the nuclear receptor OR1 in an unbiased way, we chose a
strategy that combined several rounds of selection via filter binding
and subsequent amplification via PCR with a final selection step using
EMSA (Fig. 1 and see under
"Experimental Procedures"). It had already been established that
OR1 binds as a heterodimer with RXR to DR4, like response elements that
contain the consensus core motif AGGTCA. On this basis, we screened a
mixture of oligonucleotides that contained one AGGTCA core motif
flanked by 10 random nucleotides on each side (2N10), as well as a pool
of oligonucleotides containing 20 random nucleotides (N20), giving room
for two half sites spaced by, at most, 6 nucleotides.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
Binding site selection. A,
strategy. N20 and 2N10 (N10 AGGTCA N10) are the starting pools of
oligonucleotides from which binding sites were selected by using a
combination of filter binding, PCR, and EMSA (see under "Experimental
Procedures" for details). B, schematic structure of the
full-length fusion proteins His6-OR1 and
His6-RXR expressed from the pET3a vector and the derived
deletion constructs N-His6-OR1 (internal deletion of
amino acids 7-74) and N-His6-RXR (internal deletion of
amino acids 11-111) used in this study.
|
|
For the selection, we used modified proteins for the following reasons:
full-length RXR expressed in E. coli is unstable and often
results in specific degradation products due to degradation signals in
the amino terminus of the protein (48). Similar problems arose when we
expressed full-length OR1 in E. coli. Therefore, we
constructed expression vectors for both proteins that lack the
corresponding sequences in the N terminus, resulting in more stable and
soluble products (
NOR1 and
NRXR, Fig. 1B).
In EMSAs, we could detect a specific complex already after two rounds
of subsequent filter binding and PCR amplification using the pool of
2N10 oligonucleotides that contain one AGGTCA motif (Fig.
2, lanes 4-6). This complex
increased in strength in the following selection cycles, whereas a
second, unspecific complex diminished with every round of selection. A
similar specific complex was also observed using the pool of N20
oligonucleotides bearing a random sequence, although its appearance was
delayed by two rounds of selection (data not shown). After six rounds
of selection, a strong complex was formed in EMSAs (Fig. 2, lanes
7-9) from which the DNA was recovered by elution and then
subcloned and sequenced as described under "Experimental
Procedures."

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 2.
Gel shift analysis of selected binding
sites. Oligonucleotides (2N10) obtained after 0, 2, or 6 rounds of
selection were labeled by PCR and bound to in vitro
translated His6-OR1 and His6-RXR protein in the
presence or absence of unspecific competitor. The number of selection
cycles is indicated above the lanes.
|
|
OR1 Does Not Bind as a Homodimer or Monomer to DNA--
As it
has not been established whether or not OR1 might bind as a monomer or
homodimer to DNA, the same approach as described above was also
performed with OR1 protein alone. After six rounds of selection, no
specific complex was obtained in EMSAs, indicating that OR1 is not able
to bind to DNA on its own under the conditions employed,
i.e. without a ligand present in the binding reaction (data
not shown).
Sequence Analysis of Selected Sites--
We sequenced 50 and 30 subcloned binding sites derived from the pool of AGGTCA-containing and
random oligonucleotides, respectively. Only independent, unique clones,
as judged by the unselected and thus random sequences surrounding the
binding site, were further analyzed. About 20% of the sequenced 2N10
oligonucleotides did not contain any recognizable binding site, three
contained a DR4-like element, and two contained three half sites spaced
by 1 and 2 base pairs, respectively. The majority of these sequences,
however, contained a well conserved direct repeat spaced by one
nucleotide. Alignment of the DR1 like binding sites allowed us to
derive a consensus OR1/RXR binding element, from the frequency of A, C, G, and T at each position (Fig. 3).
Variation from the consensus occurred basically only in the first
nucleotide of the 5' binding site, where adenosine was replaced by
guanosine in about 30% of the cases. The 1-nucleotide spacer is almost
exclusively an adenosine, indicating the functional importance of this
nucleotide. The surrounding sequences are less well conserved but
predominantly characterized by a high A/T content. Basically the same
result was obtained with the pool of N20 oligonucleotides, in which
approximately 50% of the sequenced oligonucleotides contained
recognizable binding sites. The same consensus was derived from these
sequences, although with slightly higher variation in some positions
(data not shown).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 3.
Alignment of the sequences of 25 subcloned
binding sites from the pool of 2N10 oligonucleotides after 6 rounds of
selection. Only unique clones are listed. A, each
sequence was aligned with respect to the core sequence. The selected
consensus sequence DR1s is shown at the top. Individual
nucleotides that do not match the consensus are boxed.
B, frequency of each nucleotide at each of the positions
analyzed.
|
|
The DR1 Elements Are Binding Sites for the OR1/RXR
Heterodimer--
As the selected binding site resembles the DR1 type
response element of RXR homodimers, we examined whether the sequence
was in fact selected by the OR1/RXR heterodimer and not by RXR
homodimers. For that purpose, we used different size receptor
constructs that allowed us to discriminate between the different
dimers. As shown in Fig. 4, OR1 and RXR
formed a strong complex with the selected oligonucleotides regardless
of which protein combination was used: full-length (lane 2),
N constructs (lane 5), or a mixture of both types of
proteins (lanes 3 and 4). Whereas OR1 alone was unable to bind to the selected sequences (lanes 6 and
8), both RXR and
NRXR were able to form homodimers with
these elements (lanes 7 and 9). Both complexes
show a different migration behavior in the gel, distinguishing them
unequivocally from the heterodimeric complexes. However, weak
homodimeric complexes are also visible above and below the respective
heterodimer complexes (lanes 2 and 4).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
Evidence for a heterodimeric
complex formed on the pool of selected binding sites and the
derived consensus sequence. A, the presence of both OR1
and RXR in the observed complex was confirmed by using constructs that
yield complexes of different size in EMSAs. All combinations of OR1 and
RXR (lane 2, full-length proteins; lanes 3 and
4, a mixture of full-length and N-proteins; lane
5, N-proteins) formed a complex with the labeled pool of
selected oligonucleotides. Neither of the OR1 proteins was able to bind
on its own (lane 6 and 8), whereas both RXR
proteins formed a weak homodimeric complex (lanes 7 and
9). B, OR1 and RXR formed a strong complex on the
labeled DR1s consensus sequence (lane 1) that was upshifted
by an antibody specific for OR1 (lane 2) or an antibody
specific for RXR (lane 3), but not by an unrelated
antibody directed against the glucocorticoid receptor (lane
4).
|
|
OR1 Efficiently Inhibits RXR Homodimer Formation on the
DR1s--
Based on the sequence analysis, we synthesized the consensus
DR1s element TAAAGGTCAAAGGTCAACG and analyzed its binding to the
OR1/RXR heterodimer in EMSAs. As expected, the heterodimer formed a
strong complex with the synthesized oligonucleotide (Fig. 4B,
lane 1), but RXR no longer formed a homodimeric complex in the
presence of OR1. The presence of both proteins in the complex was
verified by supershifts using a polyclonal antibody directed against
OR1 and a monoclonal antibody directed against RXR. A third antibody,
directed against the glucocorticoid receptor, was used as an unspecific
control and did not affect migration of the complex.
To analyze whether RXR was still able to bind to the derived consensus
oligonucleotide as a homodimer, we performed an EMSA with RXR alone and
with increasing amounts of OR1. Fig. 5
shows that RXR formed a weak complex in the absence of OR1 (lane
1). However, RXR homodimerization was abolished in the presence of only small amounts of OR1, and heterodimers were formed instead. In the
presence of equimolar amounts of protein (Fig. 5, lane 4)
RXR homodimers were no longer visible. This observation was in contrast
to the results obtained with the originally selected oligonucleotides,
indicating that those might contain a mixture of binding sites selected
by both the heterodimer and the RXR homodimer.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
OR1 inhibits homodimerization of RXR on the
DR1s. Gel shift analysis with His6-OR1 and
His6-RXR bound to the labeled DR1s oligonucleotide. Each
lane contained the same amount of total protein. Lane 1 contained 100% RXR, and lanes 2-6 contained increasing
amounts of OR1 protein and decreasing amounts of RXR protein, with
equal amounts of both proteins in lane 4. Lane 7 contained 100% OR1. RXR was able to form a homodimeric complex on the
DR1s, but the presence of even small amounts of OR1 inhibited homodimer
formation.
|
|
Mutational Analysis and Native DR1s Elements--
To define more
precisely the requirements for high affinity binding, we asked the
question of whether an exchange of the spacer nucleotide would be
tolerated, considering that the main characteristic of the selected
binding site is its high conservation of a consensus DR1. For that
purpose, we synthesized DR1 elements with the spacer nucleotide
consisting of any one of all four nucleotides and tested their ability
to compete with the selected binding site for binding to the OR1/RXR
heterodimer (Fig. 6, lanes
1-5).Using equal amounts of competitor in each lane, it is
evident that by exchanging the spacer nucleotide the ability of these
oligonucleotides to compete with the DR1s was greatly diminished. Thus,
the A as a spacer is important for high affinity binding.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6.
Competition of binding to DR1s. Binding
of the OR1/RXR heterodimer to labeled DR1s was competed by 50-fold
excess of various oligonucleotides. The oligonucleotides used as
competitors are listed in the box at the right.
A, C, G, and T are oligonucleotides derived from DR1s differing only in
the spacer (lanes 2-5). cck, S14, cte, and aox are
naturally occurring DR1-like sites with differing deviations from the
selected consensus. DR4 is a consensus direct repeat spaced by four
nucleotides that has been described as a binding site for the OR1/RXR
heterodimer.
|
|
Competition experiments with naturally occurring DR1 elements that
serve as binding sites for e.g. RXR homodimers or PPAR/RXR heterodimers and often are composed of less well conserved half sites
indicated that exchanges in the half sites reduce the ability to
compete for OR1/RXR binding (data not shown). Therefore, we performed a
data base search to identify natural promoter elements that match the
consensus precisely and found several candidates. We chose two
interesting examples: one was found in the 5'-upstream region of the
rat cholecystokinin type A receptor gene (cckar) in the
vicinity of additional hormone regulatory elements, and the other one
was present in the 5'-upstream region of the rat S14 protein gene. The
putative binding sites were synthesized and analyzed for OR1/RXR
binding in EMSA. As shown in Fig. 6, the cckar and S14 oligonucleotides
could compete with binding to the labeled DR1s almost as well as the
unlabeled DR1s itself (lanes 6 and 7 versus lane
2), identifying them as putative natural binding sites for the
OR1/RXR heterodimer. Natural elements that carried exchanges in one
(aox, lane 9) or both (cte, lane 8) half sites of
the element were not or only moderately able to compete. A DR4 element
previously described as a binding site for OR1/RXR was used as
competitor in EMSAs as well. As shown in Fig. 6 (lane 10),
this element was able to compete with the DR1s for binding to the
OR1/RXR heterodimer although with lower affinity. This result is in
agreement with the low frequency of DR4 elements selected by the
binding site selection assay.
The DR1s Is a Functional Element in Transfection Assays--
To
analyze whether the selected DR1s element represents not only the most
effective binding site for the OR1/RXR heterodimer but also a
functional element that confers transactivation, we subcloned two
copies of the element in front of a luciferase reporter construct
driven by the TK promoter (2DR1s-TK-LUC). The reporter gene and
receptor expression vectors were cotransfected into CHO K1 cells and
assayed for luciferase activity (Fig. 7).
No increase in reporter gene activity was measured due to insertion of
the DR1s elements alone when compared with the TK-LUC reporter gene (Fig. 7A). Cotransfection of OR1, however, led to a
significant induction (7-8-fold) of luciferase activity, possibly due
to the presence of endogenous RXR, that was even exceeded when
exogenous RXR was added: cotransfection of both OR1 and RXR expression
vectors led to a 17-fold induction of luciferase activity in the
absence of ligand (Fig. 7A). Cotransfection of RXR alone
likewise resulted in an induction of the reporter gene activity
(5-fold). In contrast, the peroxisome proliferator-activated receptor
PPAR was not able to mediate activation of the reporter through the
DR1s elements in the absence of ligand (Fig. 7A). In
addition, OR1 was not able to induce activation of a reporter gene
containing a PPAR-responsive element (aox, see Fig. 6) instead of the
DR1s (data not shown).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 7.
DR1s mediates transcriptional activation by
OR1/RXR. CHO K1 cells were cotransfected with a reporter
containing two copies of the DR1s element in front of a TK-luciferase
construct (2DR1s-TK-LUC) and CMX-expression vectors encoding OR1, RXR,
or PPAR as indicated. Luciferase activity was measured 24 h after
transfection. The values are means of at least three independent
experiments; each experiment was carried out with double values.
Bars indicate S.E. A, the results are given as
fold induction of the value obtained for cotransfection of 2DR1s-TK-LUC
with an empty vector control. The DR1s elements do not confer activity
on the reporter when compared with the original TK-LUC construct.
B, effect of 9-cis-retinoic acid or
22(R)-hydroxycholesterol on transcriptional activation
mediated by OR1, RXR, or both proteins when cotransfected with
2DR1s-TK-LUC. The results are given as fold induction, as in
A. Black bars correspond to the values obtained
in A. C, recruitment of SRC1 by the OR1/RXR
heterodimer when bound to DR1s. The coactivator SRC1 interacts
constitutively with the heterodimer OR1/RXR (lane 2),
whereas interaction with the RXR homodimer is only weak in the absence
but strongly induced in the presence of 9-cis-retinoic acid
(lanes 5 and 6).
|
|
The constitutive activation property of the OR1/RXR heterodimer has
already been established on a DR4 element and is thus confirmed for the
DR1s. We next asked the question of whether the addition of activators
for OR1 (22(R)-hydroxycholesterol) or RXR (9-cis-retinoic
acid) could increase the observed constitutive activation. When OR1 was
cotransfected alone, no significant increase in reporter gene activity
was observed when either of the activators was added (Fig. 7B,
left). In contrast, expression of RXR alone induced luciferase
activity 5-fold when its cognate ligand 9-cis-retinoic acid was added
but remained unaffected by addition of
22(R)-hydroxycholesterol (Fig. 7B, middle).
However, the high constitutive activation that was observed when both
receptors were contransfected was only moderately affected by either
compound (Fig. 7B, right).
The observed activation pattern was supported by EMSAs, including the
coactivator SRC1, which has been identified as a mediator of
transactivation by both OR1 and RXR (Fig.
7C).2 Whereas the
DR1s bound heterodimer interacted with SRC1 in the absence as well as
in the presence of ligand (Fig. 7C, lanes 1-3), interaction
with the RXR homodimer basically occurred only in the presence of its
ligand 9-cis-retinoic acid (Fig. 7C, lanes 4-6).
Polarity of Binding--
Previous studies have shown that the OR1
paralog LXR
is able to bind to a DR4 element as a heterodimer with
RXR and that in this configuration RXR exclusively occupies the 5'-site
of the response element (44). Therefore, it was of interest to determine whether the polarity of the OR1/RXR heterodimer is similar on
a DR4 element and, moreover, whether it might be different on the DR1s.
To determine the orientation of binding on these elements, we used
site-directed mutagenesis to change the amino acids of the P-box in the
DNA binding domain of OR1 to those of the glucocorticoid receptor P-box
(Fig. 8, upper right box).
Thus, this mutant receptor has gained an altered DNA binding
specificity and will recognize an AGAACA half-site instead.
Corresponding oligonucleotides, designated D4G and G4D (or D1G and G1D,
respectively) were synthesized in which either the 5'- or the 3'-half
site was changed to the binding site of the glucocorticoid receptor
(Fig. 8, lower right box). EMSAs with these oligonucleotides
as labeled probes showed that the mutated OR1 protein as a heterodimer
with wild type RXR was able to bind only to the D4G element on which RXR is allowed to bind to the 5'-position, and OR1 consequently binds
to the 3'-position, but not to the G4D element (Fig. 8, lanes
1 and 2). In contrast, on the binding sites spaced by
one nucleotide, the heterodimer was able to bind in both orientations because a complex was formed with both the D1G and the G1D
oligonucleotide (Fig. 8, lanes 3 and 4). A
somewhat higher affinity for the D1G was observed when nonsaturating
amounts of protein were used (Fig. 8, lanes 5 and
6). Heterodimer formation is a prerequisite for binding to
these artificial elements because we could not detect any complex
formation when using mutated OR1 or wild type RXR individually (data
not shown). To our knowledge, this is the first reported example of a
receptor occupying the 5'-position in a heterodimer with RXR formed on
a DR1 element, in which orientation of binding usually is reversed.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 8.
Polarity of the OR1/RXR heterodimer on
DNA. The orientation of the OR1/RXR heterodimer when bound to a
DR4 or to the DR1s element was assessed with the help of an OR1
construct in which the amino acid sequence of the P-box in the DBD was
mutated to that of a glucocorticoid receptor P-box (upper
box). This altered specificity mutant that recognizes GRE half
sites was incubated together with RXR on labeled binding sites in which
either the 5'- or the 3'-half site was exchanged with a GRE half site
(lower box). On a DR4 element, this heterodimer was only
able to bind with OR1 in the 3'position (lane 1 versus lane
2). On the DR1s element, the heterodimer was able to bind in both
orientations (lanes 3 and 4), with a preference
of OR1 binding to the 3'position, as illustrated in lanes 5 and 6 with less protein.
|
|
 |
DISCUSSION |
In this study, we characterized in an unbiased manner the optimal
consensus binding site for OR1 by an EMSA/PCR based strategy that
selects oligonucleotides with highest affinity for OR1 from a pool of
degenerate oligonucleotides. OR1 alone was not able to select a binding
site with this approach, indicating that the protein is not able to
bind DNA as a monomer or homodimer. Because the selection was carried
out in the absence of cognate ligands, the possibility remains that
ligand-activated receptor might have changed DNA binding properties.
However, none of our data, including EMSAs in the presence of the
activator 22(R)-hydroxycholesterol, provide evidence in
favor of such an assumption (data not shown).
The majority of oligonucleotides selected by the OR1/RXR heterodimer in
this approach contained a direct repeat of the sequence AGGTCA spaced
by one nucleotide. This result was somewhat unexpected, because so far,
mainly DR4 elements have been described for the receptor dimer.
Therefore, we performed competition studies with both binding sites, in
which we demonstrated that a DR4 oligonucleotide was able to compete
with the DR1s for OR1/RXR binding but obviously with lower affinity. A
possible reason why DR1 elements have not been positively identified as
targets for the heterodimer might be the fact that all previous studies
used DR1 elements spaced by C or G but not A (31-34). We could show
that these elements display a significantly lower binding affinity when
compared with the DR1s.
The DR1s selected in this study was preferentially a target site for
OR1/RXR heterodimers and not RXR homodimers, as confirmed by EMSAs
employing differently sized receptor proteins or specific antibodies to
either receptor. In a similar study, performed with RXR
alone,
Castelein et al. (49) found, in addition to DR2 and PALO
elements, several DR1 elements as binding sites for the RXR homodimer.
The consensus sequence selected in that study resembles the DR1s in so
far that it contains an A as a spacer and two rather conserved half
sites. However, the 5'-half site was more often a GGGTCA
sequence and also the first upstream position next to this half site
showed a clear preference for G and not A as in the DR1s, indicating
that the binding specificities of OR1/RXR heterodimers and RXR
homodimers are subtly distinct.
DR1 elements have been described as DNA binding targets not only for
RXR homodimers, but also for RXR heterodimers with RAR, PPAR, COUP-TF,
and TR and homodimers of HNF4 and COUP-TF (25, 30, 50-54). As OR1 also
some of these receptors bind to more than one DNA binding site, thereby
often displaying differential activation properties. Regulation of gene
expression by RXR heterodimers at promoters containing DR1 elements
provides a paradigm for positive and negative transcriptional control
by nuclear receptors. The response to regulating ligands is dependent
upon the RXR partner, the DNA binding site and its context. Therefore,
it is necessary to carefully analyze not only the exact binding
specificities/requirements of each heterodimer and the RXR homodimer
but also the activation properties of the different dimers on the
respective element.
Competition experiments revealed that the OR1/RXR heterodimer has a
very restricted binding behavior and tolerates only few exchanges in
the consensus DR1s. Since the majority of natural response elements for
nuclear receptors described so far are composed of half sites that
differ from the consensus, we performed a data base search to find
putative natural targets for the OR1/RXR heterodimer. Two candidates
displaying highest homology to the consensus were analyzed in EMSAs and
identified as strong competitors for DR1s binding. One binding site was
derived from the 5'-upstream region of the rat cholecystokinin type A
receptor gene (cckar) (55). The cholecystokinin family of
peptide hormones was originally isolated from the mammalian
gastrointestinal tract and subsequently also discovered in brain. The
cck type A receptor (CCKAR) mediates the physiological
functions of these peptide hormones that, among other functions, play a
significant role in the nervous system control of satiety (56-58). The
presence of an OR1/RXR binding site in this gene and colocalization of
CCKAR and OR1 in many tissues, especially in brain, as well
as its involvement in feeding disorders render this gene a likely
target for OR1 action. In this context, it is also interesting to note
that a putative ligand for OR1, 24(S)-hydroxycholesterol, is
present in high concentrations in brain and has therefore been called
"cerebrosterol" (41).
A second putative target was localized in the 5'-upstream region
of the rat S14 gene in near proximity to several hypersensitive sites
and a thyroid hormone (T3)-responsive element (58). S14 is a nuclear
protein that is mainly expressed in liver and adipose tissue and its
expression is regulated by polyunsaturated fatty acids, hormones and
carbohydrates (59, 60). It is thought to have a significant role in
lipid metabolism in liver based on its tissue distribution and
correlation with lipogenesis. Interestingly, PPAR
is not
involved in the fatty acid regulation of this gene (61). The
presence of both a conserved DR1s element and a thyroid hormone-responsive element, which is a DR4 type element, might render
this gene a dual target for the OR1/RXR heterodimer. Extended studies
on these genes might help to reveal a functional connection between
food intake, lipid metabolism, and cholesterol homeostasis.
On most direct repeat elements studied so far, heterodimerized RXR
occupies the 5'-position of a given binding site. RXR acts either as a
silent, not ligand-induced partner, when heterodimerized with RAR, VDR,
or TR, or as an active, ligand-responsive receptor, as exemplified by
the heterodimer LXR
/RXR (reviewed in Ref. 4). This polarity is
reversed, however, in heterodimers binding to a DR1 element, such as in
the PPAR/RXR heterodimer, in which RXR occupies the 3'-half site of a
DR1 element whereas PPAR binds to the upstream 5'-half site. RXR
remains a ligand-inducible partner in this configuration (21). Another
example is the RAR/RXR heterodimer; in this case, however, the
consequence of the reversed polarity is that RXR is no longer
ligand-responsive, and the heterodimer acts as a repressor by competing
with the ligand-activated RXR homodimer (22).
An analysis of the binding polarity of the OR1 paralog LXR
bound to
a DR4 element with RXR revealed that LXR
bound as expected to the
3'-half site (44). Therefore, we analyzed the polarity of binding of
the OR1/RXR heterodimer both on a DR4 and on the DR1s element because
we suspected that, as with RAR/RXR and PPAR/RXR heterodimers, the
polarity of binding might be reversed on the DR1s. We found that the
heterodimer binds to a DR4 element only when OR1 was allowed to occupy
the 3'-half site similar to other RXR heterodimers. In contrast,
binding to the DR1s was possible in both orientations although with a
slightly higher affinity when OR1 was allowed to bind to the 3'-half
site. RXR is able to occupy both half sites of a DR1 element since it
can form homodimers on this element. Modeling of the dimerization
interface of the RXR homodimer predicted that the molecule occupying
the 5'-half site provides part of the CII finger and the 3'-molecule
the T-box as a dimerization motif in the DBD. The same type of
dimerization interface was also predicted for RXR heterodimers on
narrow spaced elements with RXR in the 5'-position (20). The clear
polarity of binding that was observed in most heterodimers, however, is abolished in the OR1/RXR heterodimer. This mode of binding is reflected
by the symmetry of the consensus sequence in which both half sites are
preceded by the same nucleotides. Since the polarity of binding can
result in different activation properties, it will be interesting to
analyze whether only one or both configurations could be
transcriptionally active and/or inducible.
It has previously been shown that the OR1/RXR heterodimer is able to
transactivate a reporter gene both constitutively and in response to
ligands for both partners. Interaction between the RXR and OR1 ligand
binding domains leads to dimerization induced and thus constitutive
activation for which we proposed a novel mechanism of nuclear receptor
activation (45). We now found that the DR1s element confers
constitutive activation to a reporter gene when OR1 and RXR are
coexpressed in CHO-K1 cells. However, the dimer was no longer
significantly responsive to 9-cis-retinoic acid or
22(R)-hydroxycholesterol in this system. Thus, the mode of
activation of the receptor heterodimer might be response
element-dependent. The presence of OR1 inhibits the
9-cis-retinoic acid inducibility of the RXR homodimer on this element,
although the absolute values of the reporter gene activity remain high.
These results cannot, however, rule out the possibility that the
heterodimer might be responsive to an as yet unidentified ligand for
OR1. As an additional mode of action, a ligand could alter or influence
the binding affinity for different elements or, in the case of the
DR1s, affect the polarity of binding to this element.
In contrast to OR1, LXR
is not able to bind to the DR1s as a
heterodimer with RXR.3 The
DBDs of both proteins share about 76% sequence identity. However,
while the first Zn-fingers, including the P-box, are almost 100%
identical, the second Zn-fingers are much less well conserved (64%).
Since the second Zn-finger provides part of the dimerization interface
of the DBDs, these amino acid exchanges might be decisive for the
different ability of the two receptors to form RXR heterodimeric
complexes on DNA. Additionally, interactions between the ligand binding
domains of the respective partners might contribute to the
stabilization of the complexes with different DNA binding sites (8-10,
62, 63).
The broader DNA binding specificity of OR1 is paralleled by its
ubiquitous expression pattern, indicating a more general role for this
receptor. LXR
, on the other hand, might have a more specific role in
agreement with its restricted expression pattern. Due to their
different ligand and DNA binding specificities, these receptors offer
the possibility of simultaneously regulating a whole subset of genes
both in a ligand-dependent and ligand-independent way. In
conclusion, the identification of the preferred binding site for the
OR1/RXR heterodimer will be helpful in predicting whether nuclear
receptor binding sites in natural promoters can be targets for OR1
action. Additional studies will be necessary to elucidate the precise
DNA binding properties of these receptors and to establish their role
in the complex network of nuclear receptor interactions.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Pierre Chambon and Lotta
Wikström for providing us with RXR and OR1 specific antibodies,
respectively, and Dr. Bert O'Malley for the pBK-CMV-SRC1 expression
vector. We also thank Dr. Stefan Oehler for helpful suggestions and
discussion and Helmi Siltala for help with the Biologic Chromatography System.
 |
FOOTNOTES |
*
This study was supported by grants from the Swedish Cancer
Foundation and the Swedish Medical Research Council (13X-2819).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 46-8-608-9147;
Fax: 46-8-774-5538; E-mail: dorothee.feltkamp{at}cbt.ki.se.
§
Present address: Eberhard-Karls-Universität Tübingen,
Institut für Zellbiologie, Abteilung Molekularbiologie, Auf der
Morgenstelle 15, 72076 Tübingen, Germany.
2
F. F. Wiebel, K. R. Steffensen, E. Treuter, D. Feltkamp, and J.-Å. Gustaffson, submitted for publication.
3
D. Feltkamp, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
TR, thyroid hormone
receptor;
VDR, vitamin D receptor;
LXR, liver X receptor;
RAR, retinoic
acid receptor;
RXR, retinoid X receptor;
OR, orphan receptor;
DR, direct repeat;
DBD, DNA binding domain;
TK, thymidine kinase;
LUC, luciferase;
SRC1, steroid receptor coactivator;
PCR, polymerase chain
reaction;
EMSA, electrophoretic mobility shift assay;
CMV, cytomegalovirus;
PPAR, peroxisome proliferator-activated
receptor.
 |
REFERENCES |
-
Glass, C. K.,
and Rosenfeld, M. G.
(1991)
Molecular Aspects of Cellular Regulation: The Hormonal Control Regulation of Gene Transcription, Elsevier Science Publishers B.V., Amsterdam
-
Mangelsdorf, D. J.,
Thummel, C.,
Beato, M.,
Herrlich, P.,
Schutz, G.,
Umesono, K.,
Blumberg, B.,
Kastner, P.,
Mark, M.,
Chambon, P.,
and Evans, R. M.
(1995)
Cell
83,
835-839[Medline]
[Order article via Infotrieve]
-
Gronemeyer, H.,
and Laudet, V.
(1995)
Protein Profile
2,
1173-1308[Medline]
[Order article via Infotrieve]
-
Mangelsdorf, D. J.,
and Evans, R. M.
(1995)
Cell
83,
841-850[Medline]
[Order article via Infotrieve]
-
Evans, R. M.
(1988)
Science
240,
889-895[Medline]
[Order article via Infotrieve]
-
Glass, C. K.
(1994)
Endocr. Rev.
15,
391-407[Medline]
[Order article via Infotrieve]
-
Freedman, L. P.
(1992)
Endocr. Rev.
13,
129-145[Medline]
[Order article via Infotrieve]
-
Fawell, S. E.,
Lees, J. A.,
White, R.,
and Parker, M. G.
(1990)
Cell
60,
953-962[Medline]
[Order article via Infotrieve]
-
Zhang, X. K.,
Wills, K. N.,
Graupner, G.,
Tzuhman, M.,
Hermann, T.,
and Pfahl, M.
(1991)
New Biol.
3,
169-181[Medline]
[Order article via Infotrieve]
-
Forman, B. M.,
Yang, C. R.,
Casanova, J.,
Ghysdael, J.,
and Samuels, H. H.
(1989)
Mol. Endocrinol.
3,
1610-1626[Abstract]
-
Nagpal, S.,
Saunders, M.,
Kastner, P.,
Durand, B.,
Nakshatri, H.,
and Chambon, P.
(1992)
Cell
70,
1007-1019[Medline]
[Order article via Infotrieve]
-
Ikonen, T.,
Palvimo, J. J.,
and Janne, O. A.
(1997)
J. Biol. Chem.
272,
29821-29828[Abstract/Free Full Text]
-
Hörlein, A. J.,
Näär, A. M.,
Heinzel, T.,
Torchia, J.,
Gloss, B.,
Kurokawa, R.,
Ryan, A.,
Kamei, Y.,
Söderström, M.,
Glass, C. K.,
and Rosenfeld, M. G.
(1995)
Nature
377,
397-404[CrossRef][Medline]
[Order article via Infotrieve]
-
Lucas, P. C.,
and Granner, D. K.
(1992)
Ann. Rev. Biochem.
61,
1131-1173[CrossRef][Medline]
[Order article via Infotrieve]
-
Mader, S.,
Kumar, V.,
de Verneuil, H.,
and Chambon, P.
(1989)
Nature
338,
271-274[CrossRef][Medline]
[Order article via Infotrieve]
-
Umesono, K.,
Murakami, K. K.,
Thompson, C. C.,
and Evans, R. M.
(1991)
Cell
65,
1255-1266[Medline]
[Order article via Infotrieve]
-
Näär, A. M.,
Boutin, J.-M.,
Lipkin, S. M., Yu, V. C.,
Holloway, J. M.,
Glass, C. K.,
and Rosenfeld, M. G.
(1991)
Cell
65,
1267-1279[Medline]
[Order article via Infotrieve]
-
Mader, S.,
Chen, J.-Y.,
Chen, Z.,
White, J.,
Chambon, P.,
and Gronemeyer, H.
(1993)
EMBO J.
12,
5029-5041[Abstract]
-
Perlmann, T.,
Rangarajan, P. N.,
Umesono, K.,
and Evans, R. M.
(1993)
Genes Dev.
7,
1411-1422[Abstract]
-
Zechel, C.,
Shen, X.-Q.,
Chen, J.-Y.,
Chen, Z.-P.,
Chambon, P.,
and Gronemeyer, H.
(1994)
EMBO J.
13,
1425-1433[Abstract]
-
DiRenzo, J.,
Söderström, M.,
Kurokawa, R.,
Ogliastro, M.-H.,
Ricote, M.,
Ingrey, S.,
Hörlein, A.,
Rosenfeld, M. G.,
and Glass, C. K.
(1997)
Mol. Cell. Biol.
17,
2166-2176[Abstract]
-
Kurokawa, R.,
DiRenzo, J.,
Boehm, M.,
Sugarman, J.,
Gloss, B.,
Rosenfeld, M. G.,
Heyman, R. A.,
and Glass, C. K.
(1994)
Nature
371,
528-531[CrossRef][Medline]
[Order article via Infotrieve]
-
Wilson, T. E.,
Paulsen, R. E.,
Padgett, K. A.,
and Milbrandt, J.
(1992)
Science
256,
107-110[Medline]
[Order article via Infotrieve]
-
Wilson, T. E.,
Fahrner, T. J.,
and Milbrandt, J.
(1993)
Mol. Cell. Biol.
13,
5794-5804[Abstract]
-
Cooney, A. J.,
Tsai, S. Y.,
O'Malley, B. W.,
and Tsai, M.-J.
(1992)
Mol. Chem. Biol.
12,
4153-4163
-
Yan, Z. H.,
Medvedev, A.,
Hirose, T.,
Gotoh, H.,
and Jetten, A. M.
(1997)
J. Biol. Chem.
272,
10565-10572[Abstract/Free Full Text]
-
Harding, H. P.,
and Lazar, M. A.
(1995)
Mol. Cell. Biol.
15,
4791-4802[Abstract]
-
Lee, M. S.,
Kliewer, S. A.,
Provencal, J.,
Wright, P. E.,
and Evans, R. M.
(1993)
Science
260,
1117-1121[Medline]
[Order article via Infotrieve]
-
Schräder, M.,
and Carlberg, C.
(1994)
DNA Cell Biol.
13,
333-341[Medline]
[Order article via Infotrieve]
-
Perlmann, T.,
and Jansson, L.
(1995)
Gen. Dev.
9,
796-782
-
Teboul, M.,
Enmark, E.,
Wikström, A. C.,
Pelto-Huikko, M.,
and Gustafsson, J.-Å.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
2096-2100[Abstract]
-
Song, C.,
Kokontis, J. M.,
Hiipakka, R. A.,
and Liao, S.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
10809-10813[Abstract/Free Full Text]
-
Seol, W.,
Choi, H.-S.,
and Moore, D. D.
(1995)
Mol. Endocrinol.
9,
72-85[Abstract]
-
Shinar, D. M.,
Endo, N.,
Rutledge, S. J.,
Vogel, R.,
Rodan, G. A.,
and Schmidt, A.
(1994)
Gene
147,
273-276[CrossRef][Medline]
[Order article via Infotrieve]
-
Apfel, R.,
Benbrook, D.,
Lenhardt, E.,
Ortiz, M.-A.,
Salbert, G.,
and Pfahl, M.
(1994)
Mol. Cell. Biol.
14,
7025-7035[Abstract]
-
Willy, P. J.,
Umesono, K.,
Ong, E. S.,
Evans, R. M.,
Heyman, R. A.,
and Mangelsdorf, D. J.
(1995)
Genes Dev.
9,
1033-1045[Abstract]
-
Kainu, T.,
Kohonen, J.,
Enmark, E.,
Gustafsson, J.-Å.,
and Pelto-Huikko, M.
(1996)
J. Mol. Neuroscience
7,
29-39[CrossRef][Medline]
[Order article via Infotrieve]
-
Janowski, B. A.,
Willy, P. J.,
Devi, T. R.,
Falck, J. R.,
and Mangelsdorf, D. J.
(1996)
Nature
383,
728-731[CrossRef][Medline]
[Order article via Infotrieve]
-
Lehmann, J. M.,
Kliewer, S. A.,
Moore, L. B.,
Smith-Oliver, T. A.,
Oliver, B. B.,
Su, J.-L.,
Sundseth, S. S.,
Winegar, D. A.,
Blanchard, D. E.,
Spencer, T. A.,
and Willson, T. M.
(1997)
J. Biol. Chem.
272,
3137-3140[Abstract/Free Full Text]
-
Lund, E.,
and Björkhem, I.
(1995)
Acc. Chem. Res.
28,
241-249
-
Luetjohann, D.,
Breuer, O.,
Ahlborg, G.,
Nennesmo, I.,
Siden, Å.,
Diczfalusy, U.,
and Björkhem, I.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
9799-9804[Abstract/Free Full Text]
-
Spencer, T. A.,
Gayen, A. K.,
Phirwa, S.,
Nelson, J. A.,
Taylor, F. R.,
Kandutsch, A. A.,
and Erickson, S. K.
(1985)
J. Biol. Chem.
260,
13391-13394[Abstract/Free Full Text]
-
Peet, D. J.,
Turley, S. D.,
Ma, W.,
Janowski, B. A.,
Lobaccaro, J.-M. A.,
Hammer, R. E.,
and Mangelsdorf, D. J.
(1998)
Cell
93,
693-704[Medline]
[Order article via Infotrieve]
-
Willy, P. J.,
and Mangelsdorf, D. J.
(1997)
Genes Dev.
11,
289-298[Abstract]
-
Wiebel, F. F.,
and Gustafsson, J.-Å.
(1997)
Mol. Cell. Biol.
17,
3977-3986[Abstract]
-
Onate, S. A.,
Tsai, S. Y.,
Tsai, M.-J.,
and O'Malley, B. W.
(1995)
Science
270,
1354-1357[Abstract]
-
Alex, R.,
Sözeri, O.,
Meyer, S.,
and Dildrop, R.
(1992)
Nucleic Acids Res.
20,
2257-2263[Abstract]
-
Chen, Z.-P.,
Shemshedini, L.,
Durand, B.,
Noy, N.,
Chambon, P.,
and Gronemeyer, H.
(1994)
J. Biol. Chem.
269,
25770-25776[Abstract/Free Full Text]
-
Castelein, H.,
Janssen, A.,
Declercq, P. E.,
and Baes, M.
(1996)
Mol. Cell. Endocrinol.
119,
11-20[CrossRef][Medline]
[Order article via Infotrieve]
-
Zhang, X.-k.,
Lehmann, J.,
Hoffmann, B.,
Dawson, M. I.,
Cameron, J.,
Graupner, G.,
Hermann, T.,
Tran, P.,
and Pfahl, M.
(1992)
Nature
358,
587-591[CrossRef][Medline]
[Order article via Infotrieve]
-
Gearing, K. L.,
Göttlicher, M.,
Teboul, M.,
Widmark, E.,
and Gustafsson, J.-Å.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1440-1444[Abstract]
-
Kliewer, S. A.,
Umesono, K.,
Heyman, R. A.,
Mangelsdorf, D. J.,
Dyck, J. A.,
and Evans, R. M.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
1448-1452[Abstract]
-
Sladek, F. M.,
Zhang, W. M.,
Lai, E.,
and Darnell, J. E., Jr.
(1990)
Genes Dev.
4,
2353-2365[Abstract]
-
Jorpes, E.,
and Mutt, V.
(1966)
Acta Physiol. Scand.
66,
196-200[Medline]
[Order article via Infotrieve]
-
Takata, T.,
Takiguchi, S.,
Funakoshi, A.,
and Kono, A.
(1995)
Biochem. Biophys. Res. Commun.
213,
958-966[CrossRef][Medline]
[Order article via Infotrieve]
-
Vanderhaegen, J. J.,
Signeau, J. C.,
and Gepts, W.
(1975)
Nature
221,
557-559
-
Silver, A. J.,
and Morley, J. E.
(1991)
Prog. Neurobiol.
36,
23-34[CrossRef][Medline]
[Order article via Infotrieve]
-
Crawley, J. N.,
and Corwin, R. L.
(1994)
Peptides
15,
731-755[CrossRef][Medline]
[Order article via Infotrieve]
-
Jump, D. B.,
Bell, A.,
and Santiago, V.
(1990)
J. Biol. Chem.
265,
3474-3478[Abstract/Free Full Text]
-
Ota, Y.,
Mariash, A.,
Wagner, J. L.,
and Mariash, C. N.
(1997)
Mol. Cell. Endocrinol.
126,
75-81[CrossRef][Medline]
[Order article via Infotrieve]
-
Freake, H. C.,
and Oppenheimer, J. H.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
3070-3074[Abstract]
-
Ren, B.,
Thelen, A. P.,
Peters, J. M.,
Gonzales, F. J.,
and Jump, D. B.
(1997)
J. Biol. Chem.
272,
26827-26832[Abstract/Free Full Text]
-
Lee, S. K.,
Na, S. Y.,
Kim, H. J.,
Soh, J.,
Choi, H. S.,
and Lee, J. W.
(1998)
Mol. Endocrinol.
12,
325-332[Abstract/Free Full Text]
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.