From the Departments of Physiology and Biophysics and
§ Anatomy and Neurobiology, College of Medicine,
University of California, Irvine, California 92697
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In eukaryotes, two isozymes (I and II) of
methionine aminopeptidase (MetAP) catalyze the removal of the initiator
methionine if the penultimate residue has a small radius of gyration
(glycine, alanine, serine, threonine, proline, valine, and cysteine).
Using site-directed mutagenesis, recombinant yeast MetAP I derivatives that are able to cleave N-terminal methionine from substrates that have
larger penultimate residues have been expressed. A Met to Ala change at
329 (Met206 in Escherichia coli enzyme)
produces an average catalytic efficiency 1.5-fold higher than the
native enzyme on normal substrates and cleaves substrates containing
penultimate asparagine, glutamine, isoleucine, leucine, methionine, and
phenylalanine. Interestingly, the native enzyme also has significant
activity with the asparagine peptide not previously identified as a
substrate. Mutation of Gln356 (Gln233 in
E. coli MetAP) to alanine results in a catalytic efficiency about one-third that of native with normal substrates but which can
cleave methionine from substrates with penultimate histidine, asparagine, glutamine, leucine, methionine, phenylalanine, and tryptophan. Mutation of Ser195 to alanine had no effect on
substrate specificity. None of the altered enzymes produced cleaved
substrates with a fully charged residue (lysine, arginine, aspartic
acid, or glutamic acid) or tyrosine in the penultimate position.
Proteins synthesized in eukaryotic cells undergo two common types
of co-/post-translational modifications at their N termini: initiator
methionine cleavage and N There are two major types of MetAPs that have been identified with this
substrate cleavage pattern and both are expressed in eukaryotes. In
addition, the type I enzymes are found in Eubacteria, while the type II
enzymes are found in Archaea (8). Comparison of the Escherichia
coli structure (9) with that of Pyrococcus furiosis
(10) reveals that despite their low overall sequence similarity, the
type I and type II enzymes possess a very similar fold in the catalytic
domain. The most significant difference between these enzymes is a
large helical domain insertion on the surface of the protein
characteristic of the type II isozymes. The eukaryotic MetAP isozymes
are differentiated from their prokaryotic counterparts by an additional
N-terminal domain. The eukaryotic type I MetAP has two putative zinc
finger motifs in this ~12-kDa region (11, 12), and the eukaryotic
type II enzyme has a highly charged N terminus with alternating
polyacidic and polybasic stretches in a similarly sized segment (8).
Although it has not yet been demonstrated, these N-terminal extensions
may be involved in the association of eukaryotic MetAP isozymes with
intracellular structures/organelles such as the ribosome.
Historically, it has been reported that both types of MetAP are
Co2+-dependent metalloproteases, having two
metal ions per catalytic unit (13-15). However, recent experiments
have determined that Saccharomyces cerevisiae MetAP I
containing Zn2+ in place of Co2+ has
substantially higher activity under in vivo conditions than the Co2+-substituted enzyme, albeit zinc ions are
inhibitory at higher (nonphysiological) concentrations (16).
Furthermore, unlike the Zn2+ enzyme, the Co2+
enzyme is inactivated by glutathione, which is present in high concentrations in the cytosol, further supporting the view that yeast
MetAP I is a Zn2+-metalloprotease in situ.
However, in reconstituted preparations, the Zn2+ and
Co2+-MetAP I preparations act essentially identically.
Deletion of the MetAP gene in prokaryotes is a lethal event (17); in
yeast, both the type I and type II genes must be disrupted for
lethality, indicating some redundancy in function, at least in that
simple eukaryote (18). However, the specific inactivation of MetAP II
by the antiangiogenic compounds, fumagillin and ovalicin, indicates
some uniqueness in function (19, 20). The selectivity of fumagillin for
the type II enzymes appears to be a matter of dose-response, since it
has recently been shown that E. coli and yeast MetAP I can
be inactivated by these reagents (21). Since antiangiogenic compounds
have excellent potential in the treatment of cancer, the ability of
fumagillin and ovalicin to differentiate between the type I and type II
isozymes is of major interest currently.
The substrate specificity of the MetAP isozymes suggests a high degree
of selectivity for methionine in the S1
site2 with an S1'
site that primarily limits the side chain length of the substrate to
<3.68 Å (6). Although the S'1 pocket is not yet defined
in molecular terms, the structure of the E. coli MetAP (9)
is a useful guide to predict the catalytic site residues that define
the cavity. Fig. 1 depicts the residues
that presumably form the penultimate residue-binding site, of which
Gln356 and Met329 are two such candidates.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-acetylation. These
reactions are catalyzed by two classes of enzymes, the methionine
aminopeptidases (MetAP)1 and
N
-acetyltransferases (1). In combination,
they produce four distinct types of N termini: those with and without
initiator methionine, and those with and without
N
-acetylation. The penultimate residue
adjacent to the initiator methionine is the principal factor that
determines enzyme specificity and hence which of these four types of N
termini the mature protein will possess. Proteins that have signal
peptides removed during translocation steps do not retain these
modifications. As predicted from mutant cytochrome sequences (2), the
seven penultimate amino acid residues with the smallest side chain
radii of gyration (glycine, alanine, serine, threonine, proline,
valine, and cysteine) direct MetAP to cleave the initiator methionine.
In addition, N-terminal glycine, alanine, serine, and threonine
residues are usually N
-acetylated. This
modification also occurs on the retained methionine of proteins with
penultimate aspartic acid, glutamic acid, and asparagine (3-5).
Prokaryotes have an initiator methionine cleavage pattern identical to
that of the eukaryotes (5, 6); however, they
N
-acetylate very few proteins and apparently
have individual acetyltransferases for each substrate (1).
View larger version (26K):
[in a new window]
Fig. 1.
Stereo representation of the E. coli MetAP I proposed binding pocket for the penultimate
residue. S. cerevisiae MetAP I residue numbers are
shown with the E. coli MetAP locations in
parenthesis. The two active site metal ions are represented
as cyan spheres (Co1 and
Co2). The residues mutated to alanine in this study include
serine 72, methionine 329, and glutamine 356 based on Ref. 9. This
figure was generated using MOLSCRIPT (42).
In this study, data are presented for mutant forms of S. cerevisiae MetAP I, in which these two residues individually and together have been converted to alanine. A third site,
Ser195, that is conserved in all of the MetAP isozymes was
also mutated to alanine to determine if it has a significant catalytic
function. Detailed kinetic analysis has established that the methionine and glutamine-substituted enzymes have an expanded substrate profile, while the serine substitution was without effect on specificity. In
addition, evidence is presented that the current MetAP specificity profile, as determined from in situ measurements, although
generally correct, should be modified to indicate that the midsized
penultimate residues, such as threonine and valine, may not always
allow initiator methionine processing and that asparagine in a limited
number of cases may direct processing.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cloning of Yeast MetAP I-- MetAP I was cloned from S. cerevisiae total genomic DNA, based on the sequence of Chang et al. (11), using polymerase chain reaction with the following oligonucleotides: ACAGAATTCAGCACTGCAACTACAACAGTT and ACAGAATTCCTATTTAATTCTCTGTCTTGG (Genset, San Diego, CA). Polymerase chain reaction products were restricted with EcoRI, purified on a 1.2% agarose gel, and subcloned into pBluescript II (Stratagene, La Jolla, CA). Several clones were then sequenced using the Sequenase 2.0 protocol (Amersham Pharmacia Biotech). Polymerase chain reaction-generated errors were removed by exchanging restriction fragments among the sequenced clones. The final product was resequenced to verify the accuracy of the corrections and subcloned into the pGEX-5X-1 expression vector (Amersham Pharmacia Biotech) using the EcoRI restriction site.
Mutagenesis of Yeast MetAP I-- Mutations in S. cerevisiae MetAP I were made using the Transformer site-directed mutagenesis system (CLONTECH Laboratories, Palo Alto, CA) and the following oligonucleotides: selection primer, CCGGGTCGACTTAAGCGGCCGCATC; S195A primer, CTAAATCGCTTTGTACCGCTGTCAATGAAGTTATTTG; M329A primer, GTTTTCACCATCGAACCTGCGATTAATGAAGGTACTTG; and Q356A primer, GGTAAACTGAGTGCTGCATTTGAACATACACTG. All mutations were verified by DNA sequencing using the Sequenase 2.0 protocol and an ABI 377 automated DNA sequencer (Applied Biosystems Inc., Foster City, CA).
Expression and Purification of Yeast MetAP I--
S.
cerevisiae MetAP I fused in frame to glutathione
S-transferase was expressed in E. coli BL21 cells
(Novagen Inc., Madison, WI) as described previously (22). Briefly,
E. coli cells harboring the glutathione
S-transferase-MetAP I plasmid was cultured in expression
media (Luria-Bertani medium, 2% glucose, 50 µg/ml ampicillin) and
induced using 0.1 mM isopropyl
thio--D-galactoside (Fisher). Cells were harvested and
resuspended in phosphate-buffered saline (140 mM NaCl, 10 mM Na2HPO4, 1.8 mM
KH2PO4, 2.7 mM KCl) and ruptured using a French press. The lysate was then absorbed onto GSH-Sepharose (Amersham Pharmacia Biotech) and then cleaved with factor Xa (Amersham Pharmacia Biotech) to release the glutathione S-transferase
domain. The liberated MetAP I was eluted and purified on a Source S
FPLC column (Amersham Pharmacia Biotech). Fractions were then flash frozen in liquid nitrogen and stored at
70 °C until needed. The molecular weight of the product was verified using matrix-assisted laser desorption/ionization mass spectroscopy (data not shown).
Determination of MetAP I Initial Velocities and Kinetic
Constants--
Twenty peptides based on the sequence
MXSHRWDW (where X represents each of the 20 normally coded amino acids) were purchased from Quality Controlled
Biochemicals (Hopkinton, MA) and purified on a 10-mm Vydac
C4 column (The Separations Group, Hesperia, CA) using an
acetonitrile/water gradient with 0.1% trifluoroacetic acid. The
purified peptides were assessed using mass spectroscopy and reverse
phase high pressure liquid chromatography on a 4.6-mm Vydac
C18 column. Initial velocities were determined as described previously (16), except that assays used 50 µM substrate,
50 nM enzyme, and various time intervals (15 s to 30 min),
as required by the individual substrates. Kinetic constants were also
determined as described previously (16), except various time scales
were used as required for each peptide substrate. Due to an interfering reaction of Co2+ and the MCSHRWDW peptide, kinetic
constants for this peptide could not be determined using the
Co2+-substituted enzyme. However, the
Zn2+-substituted enzyme prepared as described previously
(16) was able to cleave this peptide (data not shown).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The evaluation of the kinetic behavior of the native and mutant forms of recombinant S. cerevisiae MetAP I can be divided into two major sections based on normal and nonnormal MetAP substrates, defined as follows. Normal substrates are those that possess penultimate residues reported to specify N-terminal methionine cleavage (glycine, alanine, serine, threonine, proline, valine, and cysteine), and nonnormal substrates are those that possess penultimate residues generally considered to prevent methionine removal (aspartic acid, glutamic acid, phenylalanine, histidine, isoleucine, lysine, leucine, methionine, asparagine, glutamine, arginine, tryptophan, and tyrosine) (2-5).
Kinetic Parameters of Yeast MetAP I with Normal Substrates--
As
seen in Fig. 2A, native yeast
MetAP I has the highest turnover rates on substrates with penultimate
alanine or serine. The S195A mutant has a similar substrate preference
(Fig. 2B), but its average turnover is only about two-thirds
that of the native enzyme (Table I). In
contrast, with the exception of the valine substrate, the M329A
mutation produces turnover rates very similar to those of the native
enzyme (Fig. 2C and Table I). The MetAP derivatives with
Q356A and M329A/Q356A mutations have almost identical substrate
preference patterns (Fig. 2, D and E,
respectively) but with turnover rates that are only about one-third that of the native enzyme (Table I). Additionally, the
kcat values for the threonine and valine
substrates, whose side chains are somewhat larger, are exceptionally
depressed, being less than 12 and 5% of the native enzyme,
respectively.
|
|
For native MetAP I, substrates among the cleaved subset with larger
penultimate residues (threonine, proline, and valine) have higher
Km values than the smaller residues (glycine, alanine, and serine) (Fig.
3A). All mutant enzymes show a
similar Km profile (Fig. 3, B-E) and
have average Km values comparable with the native
enzyme (Table I). However, the enzyme with the M329A/Q356A double
substitution has a low Km for the threonine
substrate (27% of native), mimicking the S195A enzyme (34% of native)
much more than the enzyme with the Q356A substitution (149% of native)
that it otherwise resembles (Fig. 3, E, B, and
D, respectively).
|
All five enzymes have similar substrate specificity profiles with
respect to catalytic efficiency
(kcat/Km); the three smallest
penultimate residues (glycine, alanine, and serine) having the highest
values in every case (Fig. 4,
A-E). This is due to a combination of both higher
kcat and lower Km values for
these substrates. However, as shown in Table I, the S195A and M329A
mutant enzymes have noticeably improved catalytic efficiencies (131 and
150% of native), while the mutant enzymes with Q356A and M329A/Q356A
substitutions have substantially lower catalytic efficiencies (37 and
31% of native, respectively).
|
Velocity of Methionine Hydrolysis with Nonnormal
Substrates--
In agreement with previous reports (2-5), native
MetAP I does not cleave N-terminal methionine from the nonnormal subset of peptides with the notable exception of the asparagine-containing substrate, which was cleaved at a low but significant rate (Fig. 5A). The S195A enzyme behaves
almost identically to the native enzyme on the nonnormal substrates,
including showing a significant activity with the asparagine peptide
(Fig. 5B). The enzymes with M329A, Q356A, and M329A/Q356A
mutations, however, are very effective at cleaving many of these
nonnormal peptides showing significant activity toward all but
substrates with fully charged penultimate residues (aspartic acid,
glutamic acid, lysine, and arginine) and with tyrosine (Fig. 5,
C-E). The M329A enzyme is more effective with the
asparagine, leucine, isoleucine, and phenylalanine substrates than
either of the enzymes with the Q356A or M329A/Q356A mutations, while
the latter are better at cleaving histidine, glutamine, and
tryptophan-containing peptides than the former. Consistent with the
activities on the normal substrates, the enzyme with the Q356A
substitution behaves almost identically to the one with the M329A/Q356A
double mutation. Both of these enzymes cleave the MMSHRWDW substrate
with velocities that are comparable with the wild type enzyme acting on
normal substrates and far exceed the velocity of other nonnormal
substrates with any of the enzymes in this study.
|
Kinetic Constants of MetAP I for Nonnormal Substrates--
As seen
in Fig. 6, A-C, native MetAP
I has measurable activity with the nonnormal asparagine peptide.
However, its kcat is 37-fold lower than the
slowest normal substrate (valine); combined with a 2.8-fold lower
Km, its catalytic efficiency is over 13-fold lower
than for the valine peptide. The enzyme with the S195A mutation behaves
almost identically to the native enzyme having similar kinetic
constants for the asparagine peptide. However, the enzymes with the
M329A, Q356A, and M329A/Q356A mutations are much more effective than
either the native or the S195A mutant enzymes on the asparagine
substrate, having kcat values that are 8-20-fold higher. The improvement in catalytic efficiency on this substrate (7-12-fold) is principally manifested through higher kcat constants, since the Km
values do not vary much between the enzymes.
|
As expected, native MetAP I has no measurable activity toward the
nonnormal substrate MMSHRWDW, and the enzyme with the S195A mutation
has only very low activity (Fig. 7). In
contrast, enzymes with M329A, Q356A, and M329A/Q356A mutations display
substantial activity, with kcat values (400-525
min1) as good as or better than three of the six normal
MetAP substrates measured with the native enzyme (Fig. 4E).
Importantly, these represent minimal kcat
values, since the enzyme produced two products during the reaction
(MSHRWDW and SHRWDW). These mutants have Km values
ranging from 25 to 65 µM that are comparable with those of the native enzyme with normal substrates (23-254 µM)
(Fig. 3A). The combination of these constants yields
catalytic efficiencies ranging from 8.5 to 15.7 µM
1 min
1, which is superior
to the native enzyme with the normal substrates (1.3-7.6
µM
1 min
1) with the larger
threonine, proline, and valine residues in the penultimate
position.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
An octapeptide substrate family with all 20 possible penultimate residues was used to detail the in vitro specificity of yeast recombinant MetAP I. Consistent with previous in situ studies of initiator methionine cleavage patterns, yeast MetAP I is capable of cleaving N-terminal methionine from substrates that have penultimate residues with small side chain radii of gyration (glycine, alanine, serine, threonine, proline, valine, and cysteine) in vitro (2-5). The enzyme cleaves methionine from substrates with penultimate serine and alanine much more efficiently than the other permissive substrates, due to a combination of higher kcat values and lower Km values for the smaller substrates. It is perhaps not surprising, therefore, that Met-Ala and Met-Ser N termini dominate the sequences found in the yeast genome, particularly among the metabolic or "housekeeping" enzymes that characterize the cytoplasmic protein population. Removal of initiator methionines from these proteins would return a significant amount of energetically expensive, free methionine to the amino acid pool, allowing other functions dependent on methionine, including new protein synthesis, to occur.
Although the kcat values measured are comparable with previous studies, the Km values determined for normal substrates range from 23 to 253 µM, which is orders of magnitude lower than previous studies (2680-6560 µM) (12, 23). This may be due to the use of longer, octapeptide substrates, compared with the three- and four-residue substrates used by others, possibly indicating that residues well downstream of the penultimate residue may contribute to substrate binding to the enzyme. This may primarily operate through backbone interactions on the substrate and thus be largely sequence-independent.
It was also found that MetAP I can cleave substrates with penultimate asparagine, indicating that the established specificity pattern for co-/post-translational modification may have a greater degree of flexibility than originally detected (2, 7). Analysis of cytosolic proteins for whom the N terminus has been directly sequenced has shown that, although proteins with penultimate glycine, alanine, serine, cysteine, and proline are completely processed, threonine and valine result in retention of the initiator methionine residue 15 and 60% of the time, respectively (24). An additional study using recombinant methionyl-tRNA synthetase with 20 different penultimate residues, has shown that midsized penultimate residues such as asparagine, aspartic acid, leucine, and isoleucine are partially processed in E. coli (25). Taken together, this may indicate that midsize penultimate residues such as threonine, valine, and asparagine may only specify methionine removal part of the time, possibly dependent on other downstream determinants.
In this study, the E. coli MetAP structure (9) was instrumental in developing a mutagenesis strategy for the S. cerevisiae MetAP I enzyme although their catalytic domains are only 39% identical. However, sequence alignments with 12 other type I MetAPs also aided in developing the mutagenesis strategy. Residues in the active site cavity that were highly conserved and appeared to define cavity perimeters were considered good candidates for site-directed mutagenesis to alter the substrate specificity of the enzyme. Since the M329A and Q356A mutations allow yeast MetAP I to cleave six and seven of the 13 nonnormal substrates, respectively, it is clear that these residues have a significant role in determining if a substrate has the correct size penultimate residue. However, Met329 does not appear to have any other significant role in catalysis, since the M329A enzyme is at least as effective as the native enzyme in catalyzing N-terminal methionine removal from normal substrates. In contrast, Gln356 may serve a dual role with respect to substrate specificity and involvement in the normal catalytic reaction, since conversion of this residue to alanine results in a loss of about two-thirds of the turnover rate. This may be due to an involvement of Gln356 in positioning of the substrate in the active site for optimum catalytic efficiency.
There are several features that distinguish the M329A and Q356A
mutants. The Q356A mutant is able to cleave substrates with the very
large tryptophan residues, while the M329A enzyme cannot. Although
M329A and Q356A are positioned side by side in the enzyme, forming a
common wall (Fig. 1), the replacement of Gln356 with the
smaller side chain allows a large tryptophan to fit into the
penultimate residue-binding site. In addition, the Q356A mutant cleaves
histidine-containing substrates 30-fold more efficiently than the M329A
mutant. It is possible that histidine also fits into the pocket formed
by the missing glutamine, allowing reformation of the glutamine
hydrogen bonding network. Consistent with this hypothesis, the M329A
enzyme is much more efficient with phenylalanine and isoleucine
substrates than is the Q356A mutant. These hydrophobic residues, which
are about the same size as the missing methionine, may fill the cavity
created by the M329A mutation. Gln356 has an important role
in this hydrophobic interaction, since the M329A/Q356A mutant is not
nearly as effective at cleaving the phenylalanine and isoleucine
peptides as the M329A single mutant. This effect may be due to a
hydrophobic interaction between the adjacent Met329 side
chain (or the hydrophobic substrate in the M329A mutant) and the -
and
-carbons of Gln356. Not surprisingly,
Met329 does not play a significant role in the
Gln356 hydrogen bonding network, since the double mutant is
as effective as the Gln356 single mutant at cleaving the
histidine substrate.
It is clear from these studies that size of the penultimate residue is not the only determinant of N-terminal methionine cleavage, since all enzymes tested are highly selective against residues expected to be fully charged at the pH of the reaction mixture. None of the five MetAP I enzymes tested has significant activity toward aspartic acid, glutamic acid, lysine, and arginine although aspartic acid and glutamic acid are not exceptionally large residues. Although the reason for this is uncertain, it may simply be due to charge repulsion. The shorter aspartic acid and glutamic acid residues may be repulsed by Glu327 on the wall of the pocket, and the longer lysine and arginine side chains may be repelled by His308 at the bottom of the pocket. Although mutation of Glu327 would likely be very detrimental to the enzyme due to its involvement in metal coordination, conversion of His308 to alanine could prove instructive in this regard.
The information gained from these site-directed mutagenesis studies has allowed a reexamination of the structure of E. coli MetAP I to identify other residues that may be involved in defining the substrate specificity of the enzyme. A cavity exists in the enzyme that is bordered by Met329 (Met206), Q356 (Gln233), Tyr291 (Tyr168), His308 (His185), Glu327 (Glu204), Gly293 (Gly170), and the backbones of Cys292 (Cys169) and Pro328 (Pro205) (Fig. 1) (Table II). Tyr291 forms a wall in this cavity and is conserved as tyrosine or phenylalanine in all 13 type I MetAP sequences known; all type II MetAPs have a conservative substitution of leucine in this position. His308 is at the bottom of this pocket and may define the maximum length of the penultimate residue that can be bound and, therefore, may be the residue responsible for discrimination between phenylalanine and tyrosine in the M329A mutant. His308 is conserved as either asparagine or histidine in all type I enzymes and as asparagine in all type II MetAPs. Glu327 serves a dual function as one of the metal coordinating residues as well as forming a wall in the putative penultimate residue binding pocket; Glu327 is completely conserved in all MetAPs. An absolutely conserved Gly293 is also part of the wall of this pocket. The absence of a side chain on Gly293 may be required to keep the cavity open, making it an excellent candidate for creating a MetAP mutant with a more limited specificity. The backbone of two residues, Cys292 and Pro328, also complete this pocket. The Pro328 residue is completely conserved in the type I enzymes and as proline or threonine in five and three of the type II enzymes, respectively. The Cys292 is less conserved, with 7 of 13 residues being cysteine in the type I enzymes with no particular pattern for this residue in the type II enzymes. Since the side chain of Cys292 is solvent-accessible, absolute conservation of this residue is not critical for maintaining the cavity shape. Alignment of the type I E. coli and type II P. furiosis enzymes reveals that all of these putative penultimate binding site residues occupy the same spatial geometry maintaining a similar cavity shape although these enzymes are highly divergent (16% identity) (data not shown).
|
The use of sequence alignments in conjunction with an enzyme crystal structure has proven to be a powerful tool in determining enzyme structure-function relationships. Two out of the three point mutants studied produced novel activities for the enzyme. One of the substrates, not normally cleaved by the native enzyme, was hydrolyzed with kinetic constants superior to three of the six normal substrates for MetAP I. Furthermore, one of these mutants (M329A) retained at least as much activity for the normal substrates as the native enzyme.
MetAP has also been studied for its role in the production of
recombinant proteins, since incorrect processing of the N terminus can
produce proteins that are inactive or immunogenic (40, 41). Overexpression of recombinant proteins can overload the ability of the
host cell to process initiator methionine residues, resulting in a
product that has a mixture of different N termini (7). In addition,
cytosolic expression of a secreted protein can result in the presence
of an initiator methionine that would not normally be found in the
mature product. The mutant forms of MetAP presented here may prove
useful as reagents for the in vitro or in vivo processing of recombinant proteins. The mature forms of enzymes with
cleavable signal sequences often have N-terminal residues with large
side chains. For cytoplasmic expression systems, the signal sequence
can be removed during the cloning process, but all protein synthesis
must be initiated with methionine (or N-formyl methionine); therefore,
if the recombinant protein has a large penultimate residue, the
methionine will be retained. The expanded specificity mutants of MetAP
I could be used in these cases to remove these artificially retained
initiator methionines. It may also be possible to create host cells
that have MetAPs with contracted substrate specificity to allow
protection of N termini from unwanted post-translational modifications.
The initiator methionine could be retained in this system to prevent
N-terminal post-translational modifications, and later in
vivo treatment with the native MetAP could remove this protective methionine.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Steve Disper for performing the mass spectroscopic analyses of the peptide substrates and Brian Matthews and Todd Lowther for rendering Fig. 1 and for the matrix-assisted laser desorption/ionization mass spectroscopic analysis of the yeast recombinant MetAP I. We would also like to thank Todd Lowther, Irwin Rose, and Roseann Cappel for constructive comments on the manuscript.
![]() |
FOOTNOTES |
---|
* This work was supported by National Institutes of Health (NIH) Grant DK32465, a research contract with Baxter-Hyland Division, and NIH postdoctoral fellowship GM18940 (to K. W. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ To whom correspondence should be addressed. Tel.: 949-824-6236; Fax: 949-824-8036; E-mail: rablab{at}uci.edu.
2 S1 is the binding site on the enzyme that accommodates the substrate amino acid immediately to the N-terminal side of the cleavage site; S1' denotes the enzyme binding site for the substrate amino acid adjacent to the C-terminal side of the cleavage site.
![]() |
ABBREVIATIONS |
---|
The abbreviation used is: MetAP, methionine aminopeptidase.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|