From the Institute of Molecular Medicine, School of Medicine, National Taiwan University, 7 Chung Shan South Rd., Taipei, Taiwan, Republic of China
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() |
---|
ADP-ribosylation factors (ARFs) are highly
conserved, ~20-kDa guanine nucleotide-binding proteins that enhance
the ADP-ribosyltransferase activity of cholera toxin and have an
important role in vesicular transport. Several cDNAs for ARF-like
proteins (ARLs) have been cloned from human, Drosophila,
rat, and yeast, although the biological function(s) of ARLs is unknown.
We have identified a yeast gene (yARL3) encoding a protein
that is structurally related (>43% identical) to the mammalian
ARF-like protein ARP. Biochemical studies of purified recombinant yARL3
protein revealed properties similar to those of ARF and ARL proteins,
including the ability to bind and hydrolyze GTP. Like other ARLs,
recombinant yARL3 did not stimulate cholera toxin-catalyzed
auto-ADP-ribosylation. Anti-yARL3 antibodies did not cross-react with
yARFs or yARL1. yARL3 was not essential for cell viability,
but disruption of yARL3 resulted in cold-sensitive cell
growth. At the nonpermissive temperature, processing of alkaline
phosphatase and carboxypeptidase Y in arl3 mutant was
slowed. yARL3 might be required for protein transport from endoplasmic
reticulum to Golgi or from Golgi to vacuole at nonpermissive
temperatures. On subcellular fractionation, unlike its mammalian
homologue ARP, yARL3 was detected in the soluble fraction but not in
the plasma membrane. Indirect immunofluorescence analysis revealed that
yARL3 when overexpressed was associated in part with the endoplasmic
reticulum-nuclear envelope. Thus, the structural and functional
characteristics of yARL3 indicate that it may have a unique role(s) in
vesicular trafficking.
ADP-ribosylation factors
(ARFs)1 are a family of
~20-kDa GTP-binding proteins (or GTPases) that includes both ARFs and
ARF-like proteins (ARLs) (for recent reviews, see Refs. 1 and 2). ARFs
were originally identified and purified on the basis of their ability
to increase the ADP-ribosyltransferase activity of cholera toxin (3,
4). Members of the ARF family have been identified in every eukaryotic
cell examined; at least six ARFs have been identified in mammalian
tissues. They share 65-96% overall amino acid identity and include
identical consensus sequences involved in guanine nucleotide binding
and GTP hydrolysis.
The physiological roles of at least some ARF proteins involve the
regulation of vesicular transport in the endoplasmic reticulum, Golgi,
endosomes, or nuclear membranes. The best characterized is ARF1, which
is required for the assembly of coat proteins on Golgi membranes (5, 6)
and of AP-1 adaptor particles on the trans-Golgi network (7, 8). In
in vitro assays, ARFs 1, 3, and 5 differed in their binding
to Golgi (9), as well as in their dependence on accessory proteins for
interaction with Golgi and, perhaps, other cellular membranes (10). In
addition, recombinant human ARF6 was localized to the plasma membrane
(11) and might, like the Rho-related GTPases, regulate plasma membrane architecture and participate in endocytosis by mediating cytoskeletal reorganization (12).
ARF function depends on its alternation between inactive GDP-bound and
active GTP-bound conformations. As ARF has no detectable GTPase
activity and exchanges bound nucleotide very slowly at physiological
concentrations of Mg2+, its cycling between active and
inactive forms is controlled by GTPase-activating proteins and guanine
nucleotide-exchange proteins. In in vitro assays, ARFs also
have been shown to stimulate the activity of phospholipase D, an enzyme
found in Golgi membranes (13, 14), raising the speculation that
phospholipase D may mediate ARF signals to initiate coated vesicle
formation (15, 16).
cDNAs encoding proteins with similarity to the ARF isoforms,
designated ARF-like or ARL, have been cloned from several species, including human, rat, mouse,2
Drosophila, and yeast (17-22). The products of these genes
appear to lack ADP-ribosyltransferase-enhancing activity, and they
differ in GTP-binding requirements and GTPase activity from ARF
isoforms. Although some of these proteins exhibit tissue- and/or
differentiation-specific expression, the biological functions of ARLs
are unknown.
ARP, a mammalian ARF-like protein, was identified and characterized by
cDNA cloning (23). It is 33-39% identical to members of the ARF
family and contains the characteristic sequence motifs involved in
nucleotide binding (DVGG, NKQD, and CAT sequences) and GTP hydrolysis
(GLDXAGK) (1). ARP differs, however, from other ARF family proteins by
the absence of a myristoylation site, an insertion of eight amino acids
between the GLDXAGK and DVGG consensus sequences, and the capacity to
hydrolyze bound GTP in the absence of other proteins. Most of the ARP
protein, unlike ARFs, is associated with plasma membrane instead of the cytosol.
Four members of the ARF family have been reported in yeast
Saccharomyces cerevisiae. Those include three ARFs (yARF1
(24), yARF2 (25), and yARF3 (26)) and an ARF-like protein (yARL1 (22)).
yARF1 and yARF2 are thought to act in ER-to-Golgi secretory protein
sorting; yARF3 is most similar in amino acid sequence to human ARF6,
which has been implicated in the regulation of early endocytic
transport. yARL1 is a recently characterized ~20-kDa GTPase, which
may in part reside in the Golgi and which has a function distinct from
those of yARF1 and yARF2.
Sequence analysis of the S. cerevisiae genome identified a
ARF-like gene, yARL3, the product of which is homologous to
mammalian ARP (23). This report describes the genetic, molecular, and biochemical characterization of yARL3. Like yARL1 and yARF3, yARL3 is
not essential for cell viability; however, arl3 mutants
appear to be cold-sensitive. yARL3 is required for vacuolar protein
transport at nonpermissive temperatures. Unlike mammalian ARP, which
was exclusively detected on the plasma membrane, yARL3 was found in the
soluble fraction and associated in part with the ER-nuclear envelope
structures. Thus, yARL3 may function in a novel ER-associated vesicular
trafficking pathway.
Strains, Media, and Microbiological Techniques--
The S. cerevisiae strains used in this study are listed in Table
I. Yeast culture media were prepared as
described by Sherman et al. (27). YPD and YPGal contained
1% Bacto-yeast extract, 2% Bacto-peptone, and 2% glucose or 2%
galactose, respectively; SD contained 0.7% Difco yeast nitrogen base
(without amino acids) and 2% glucose. Nutrients essential for
auxotrophic strains were supplied at specified concentrations (27).
Sporulation, growth, and mating were carried out as described (28).
Yeast strains were transformed by the lithium acetate method (29).
Plasmids were constructed by standard protocols (30).
Polymerase Chain Reaction--
Unless otherwise specified, the
protocol used for PCR amplification was 35 cycles of 1 min at 95 °C,
1 min at 52 °C, 1 min at 72 °C, followed by extension at 72 °C
for 10 min, in a solution containing 50 mM KCl, 10 mM Tris-Cl (pH 8.3), 1.5 mM MgCl2,
0.01% gelatin, 20 mM each dNTP, 0.1% Tween, 25 pmol of
each amplification primer, and 2.5 units of Taq polymerase
(total volume, 100 µl). Samples of reaction mixtures were subjected
to electrophoresis in a 1.2% agarose gel. All PCR products were
purified, subcloned, and sequenced by the dideoxy chain-termination
method (31).
Isolation of Yeast ARL3 DNA--
Yeast ARL3 gene was
cloned by PCR using a yeast genomic DNA as template and primers
complementary to sequences upstream or downstream of the Lpe21p gene
(Yeast Genome Project, accession number U39205). The nucleotide
sequence of yARL3 has GenBank accession number U89332. DNA
sequences were analyzed and multiple protein alignments were prepared
using a GeneWorks software package (IntelliGenetics, Inc., Mountain
View, CA).
yARL3 Gene Disruption--
yARL3 DNA generated by PCR
was subcloned into pGEM-7Zf plasmid resulting in pGyL3. The yeast
URA3 gene was inserted at the single EcoNI site
in the yARL3 gene as follows: The 3.8-kb DNA fragment
containing the yeast URA3 gene and two hisG
repeat sequences was excised from the plasmid pNKY51 (32) by digestion
with BglII and BamHI; the 5' overhangs were
filled in with Klenow fragment. Plasmid pGyL3, containing the
yARL3 gene, was linearized at the internal EcoNI
site; the overhang ends were filled in with Klenow fragment and the
cDNA was ligated to the 3.8-kb hisG-URA3-hisG fragment,
resulting in pGyL3U.
Gene disruption mutants were constructed by a one-step gene replacement
method (33). Briefly, the ~4.8-kb DNA fragment excised from pGyL3U by
digestion with XhoI and BamHI was used to
transform various Ura Expression and Purification of Recombinant Proteins--
The
open reading frame of yeast ARL3 was obtained by PCR, using primers
that incorporated unique NdeI and BamHI sites at
the initiating methionine and 6 base pairs 3' of the stop codon,
respectively. For the His-tag-yARL3 fusion protein, a DNA fragment
containing the yARL3 coding region was generated by
amplifying yeast genomic DNA with sequence-specific primers. The PCR
product was purified and annealed to the expression vector pET15b
(Novagen), yielding pET15byL3. For the nonfusion protein, PCR products
were digested with NdeI and BamHI, purified, and
annealed to expression vector pT7 (34), yielding pT7yARL3. BL21 (DE3)
cells containing expression plasmids were grown to a density of
A600 = 1.0 at which time the inducer,
isopropyl-1-thio- Polyclonal Antibody Production--
The recombinant N-terminal
His-tagged fusion protein yARL3 was synthesized in Escherichia
coli using pET15-b expression plasmid (Novagen), isolated on
Ni2+-NTA resin, and further purified by SDS-PAGE. Denatured
purified proteins from SDS-PAGE gel were used as antigens to raise
polyclonal antibodies in rabbits essentially as described (35).
Yeast Cell Extracts and Immunoblotting--
Whole cell extracts
were prepared by harvesting three optical density units
(A600)/ml of cells. Yeast cell concentration was assessed by absorbance at 600 nm. Cells were suspended in radioimmune precipitation buffer (50 mM Tris-HCl (pH 8.0), 0.1% SDS,
0.5% deoxycholic acid, 150 mM NaCl, and 1% Nonidet P-40)
to a final A600 of 30. Whole cell extracts were
then prepared by vortexing with glass beads for 2 min at 4 °C and
clarified by brief centrifugation. Proteins separated by SDS-PAGE were
transferred electrophoretically to Immobilon-P membranes (Millipore
Corp.). Incubation with antibodies was carried out in
phosphate-buffered saline (pH 7.4) containing 0.1% Tween 20 and 5%
dried skim milk at room temperature for 60 min. The anti-HA monoclonal
antibody (HA.11, Berkeley Antibody Co., Richmond, CA) and horseradish
peroxidase-conjugated goat anti-mouse IgG + IgM (H + L) were each
diluted 1:5000. Bound antibodies were detected with the ECL system
(Amersham Pharmacia Biotech) according to the manufacturer's
instructions. Primary and secondary antibodies and luminol substrate
were removed from the blot using the blot-stripping protocol (Amersham
Pharmacia Biotech).
Construction of HA Epitope-tagged yARL3 and yARL(Q78L)
Mutant--
The 3'-end of the yARL3 cDNA was altered so that the
encoded protein contained the sequence
199YPYDVPDYA*207 at its extreme C
terminus. The sequence of the HA epitope is underlined; the asterisk
indicates stop codon. The Q78L replacement was introduced using a
two-step recombinant PCR technique. In the primary PCR, overlapping 5'-
and 3'-DNA fragments were generated. The 5'-oligonucleotide primer
(gcacatatgtttcatttagtcaagg) and 5'-Q78L oligonucleotide primer
(ctcagtgattctagaccacctacatccc; the point mutation is
underlined), served as primers for amplification of the 5'-fragment.
The 3'-fragment was generated using 3'-Q78L oligonucleotide
(gatgtaggtggtctagaatcactgagatc) primer in combination with
the 3'-end antisense oligonucleotide primer
(ctttggatccttctttatcatttataaatcg). In the second fusogenic PCR, the
appropriate pairs of overlapping fragments were combined with the 5'-
and 3'-end primers to generate the full-length Q78L mutant sequence.
The full-length Q78L mutant DNA was then purified, subcloned, and
sequenced. The yARL3-HA and yARL3(Q78L) DNAs were subcloned into the
pVT101U plasmid, an expression plasmid containing the ADH1 promoter
(36), as a XhoI-XbaI fragment into
XhoI-XbaI sites to yield pVT101yL3HA and
pVT101yL3(Q78L), respectively.
Protein Labeling and Immunoprecipitation--
Yeast was grown at
30 °C overnight in selective minimal medium containing 200 mM (NH4)2SO4 to an
A600 of 0.5. After 30 min at 37 °C or at
15 °C, cells were transferred to sulfate-free, selective minimal
medium (final A600 = 5), and incubated for 15 min at 37 °C or for 30 min at 15 °C, before addition of 30 µCi of Pro-mix L-35S label (blend of
[35S]methionine and [35S]cysteine,
14.3mCi/ml) per A600 unit. After 5 min (at
37 °C) or 20 min (at 15 °C), labeling was terminated by addition
of 5% (v/v) of chase solution (0.3% cysteine (w/v), 0.4% methionine (w/v), and 100 mM
(NH4)2SO4). Samples (1 ml) were
removed at the indicated time (at 37 or 15 °C) thereafter and added
to equal volumes of ice-cold 20 mM NaN3 in
double-distilled H2O. Cells were collected and washed with
10 mM NaN3 in double-distilled H2O.
Glass beads (300 µl) and 300 µl of lysis buffer (50 mM
Tris-Cl (pH 7.5), 1% SDS, 1 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride) were added, and the mixture was agitated
vigorously for 90 s at room temperature before immersion in a
boiling water bath for 6 min. Immunoprecipitation, electrophoresis, and
autoradiography were done essentially as described (37), using
anti-yARL3, anti-carboxypeptidase Y (anti-CPY), or anti-alkaline
phosphatase (anti-ALP) antiserum.
Endocytosis of Lucifer Yellow CH--
Endocytosis of Lucifer
Yellow CH was performed as described.(38) Briefly, one
A600 unit/ml of mid-log phase cells (1 ml) was
collected, suspended in 90 µl of fresh medium, and added to 10 µl
of Lucifer Yellow CH (40 mg/ml). Cells were incubated at 30 °C for
30-90 min or at 15 °C for 2-4 h, harvested, washed three times in
endocytosis wash buffer (50 mM succinate, 2 mM
NaN3, pH 5.0), and suspended in 10 µl of the same buffer.
Samples (2.5 µl) of cells were mixed with an equal volume of 1.6%
low melting agarose (at 45 °C) and mounted on microscope slides
before visualization by fluorescence microscopy using fluorescein
isothiocyanate optics.
Cholera Toxin A-catalyzed ADP-ribosylation Assay--
Samples (5 µg) of purified His-tagged -yARL3 or -yARF1 fusion protein were
tested for their ability to stimulate cholera toxin-catalyzed auto-ADP-ribosylation in reaction mixtures (total volume, 100 µl)
containing 50 mM potassium phosphate (pH 7.5), 5 mM MgCl2, 20 mM thymidine, 0.1 mM GTP, 0.003% SDS, 10 µM
[32P]NAD (2 mCi), and 1 µg of activated cholera toxin
A. After incubation at 30 °C for 1 h, reactions were terminated
by the addition of 1.0 ml of ice-cold 7.5% trichloroacetic acid. After
precipitation overnight at 4 °C and centrifugation, proteins were
dissolved in 60 mM Tris (pH 6.8), 10% glycerol, 5%
2-mercaptoethanol, 3% SDS, and 0.006% bromphenol blue (10 min at
65 °C); separated by SDS-PAGE in 12% gels; and transferred to
nitrocellulose membranes, which were exposed to x-ray film for 24 h.
Nucleotide Binding and Hydrolysis--
Binding of GTP
GTP hydrolysis was determined by binding[ Subcellular Fractionation by Velocity Sedimentation on Sucrose
Density Gradients--
Cells were harvested by centrifugation from
cultures (50 ml), grown in YPD to mid-exponential phase
(A600 = 1). Cells (~0.5 g) were washed by
repeated suspension in ice-cold NaN3 (10 mM in
double-distilled H2O) and centrifugation, incubated with
Lyticase to form spheroplasts, suspended in 0.2 ml of ice-cold lysis
buffer (20 mM triethanolamine (pH 7.2), 1 mM
EDTA, 0.8 M sorbitol) containing protease inhibitors
(aprotinin, leupeptin, and pepstatin, each 1 µg/ml; 1 mM
benzamidine; and 1 mM phenylmethylsulfonyl fluoride), and
disrupted on ice with 20 strokes in a Dounce homogenizer. The cell
lysate was centrifuged (450 × g) twice for 10 min to remove unbroken cells and cellular debris. For gradient fractionation of cell organelles, 0.8 ml of the clarified supernatant was loaded on
top of a manually generated five-step sucrose gradient (0.8 ml each of
60, 50, 40, 30, and 20% sucrose in lysis buffer), which was then
subjected to centrifugation (~170,000 × g) for
3.5 h at 4 °C in a Beckman SW55 rotor. Twelve fractions were
collected manually from the top. Proteins in samples (100 µl) of
fractions were precipitated with 10% trichloroacetic acid, separated
by SDS-PAGE, and analyzed by immunoblotting. Antibodies were kindly provided by Dr. Schroder-Kohne (anti-Emp47p) and Dr. Dieter Gallwitz (anti-ALP).
Indirect Immunofluorescence--
Cells were grown in 5 ml of
minimal selective medium with 2% glucose to a density of 1-2 × 107 cells/ml and prepared for indirect immunofluorescence
as described (41) with the following modifications. To each culture,
0.6 ml of 37% formaldehyde was added for fixation, and the cultures were gently shaken at 30 °C for 2 h. Cells were collected by
centrifugation (2500 × g for 5 min), washed once in 5 ml of 0.1 M potassium phosphate (pH 6.5) buffer, suspended
in 1 ml of solution P (1.2 M sorbitol, 0.1 M
potassium phosphate, pH 6.5), and incubated at 30 °C for 30 min with
5-10 µl of Lyticase (10,000 units/ml, in solution P) and 1% of
Identification of Yeast ARL3--
To date, four members of the
ARF/ARL family have been characterized in S. cerevisiae:
yARF1, yARF2, yARF3 (also known as yARL2), and yARL1 (3, 22, 25, 26).
Evidence was provided that yARF1 and yARF2 act in ER-to-Golgi protein
sorting. yARF3 is most similar to human ARF6, which has been implicated
in the regulation of early endocytic transport. yARL1 may reside in the
Golgi apparatus and regulate the vesicular traffic from trans-Golgi to
vacuole (22).2 Sequence analysis of the S. cerevisiae genome revealed an additional gene that shares
significant similarity with members of ARF/ARL family (temporarily
named Lpe21 in the Yeast Genome Project). The human and rat
homologues of this gene, ARP, were originally identified as products of
PCR amplification using degenerate primers derived from conserved
sequences in members of the ARL family (23). We propose that the yeast
Lpe21 be renamed ARL3 based on its properties
(see below) and following the nomenclature of Saccharomyces Genome
Database guidelines. The full-length open reading frame of
yARL3 (549 bases) encodes a protein of 198 amino acids.
yARL3 has a calculated molecular mass of ~23 kDa. Alignment of the
deduced amino acid sequence of yARL3 and other related ARFs and ARLs
revealed that yARL3 is more identical (43%) to mammalian ARP than to
ARFs (28-33%) or ARLs (28-33%) (Table
II). Like its mammalian homologues (ARP),
yARL3 does not have a glycine at position 2, the site of
N-myristoylation in ARF/ARL proteins, and has an insertion
of eight amino acids between the GLDXAGK and DVGG consensus sequences.
In addition, yARL3 lacks cysteine residues near the C terminus, which
are sites of isoprenylation in non-ARF members of the Ras superfamily.
Alignment of the yARL3 protein with other ARL and ARF proteins is shown
in Fig. 1. There are 33 amino acids that
are identical in yARL3 and the mammalian ARPs, including two consensus
GTP-binding sequences, WDXGGQ and NKQD, found in the ARF family
proteins (Fig. 1). These are residues and sequences that are thought to
be involved in binding of the guanine moiety and the magnesium ion, or
in protein-protein interactions, and are very highly conserved in the
ARF family. Because of its sequence similarity to ARF/ARL family, we
decided to study the function of yARL3 in more detail.
yARL3 Is Not an Essential Gene, but yarl3 Mutants Are
Cold-sensitive for Growth--
To investigate the function of yARL3,
we prepared strains in which the corresponding open reading frame was
disrupted by URA3 marker gene (see under "Materials and
Methods"). A DNA fragment containing the
yARL3::hisG-URA3-hisG sequence was used to
transform ura3/ura3 diploid yeast (SEY6210.5) (Table I)
(29). Ura+ transformants were isolated and used
to confirm the correct replacement of one of the two genomic copies of
yARL3. The verified heterozygous diploids were then
subjected to sporulation and tetrad dissection. On germination at
30 °C, most diploid cells gave rise to four viable spores.
Ura+ spores, but not
ura
The double deletion of yARF1 and yARF2 is lethal,
but each of the five known human ARF proteins can restore vegetative
growth to this double deletion mutant (42, 43). Cells with double deletions of yARL3 and yARF3 or yARL3
and yARL1 were also viable (data not shown). Proper
disruption of the specific genes was confirmed by PCR on genomic DNA
prepared from colonies of the mutants. This result confirmed that
yARL3, like yARL1 and yARF3, is not
essential for cell viability and that its deletion was not being
complemented by yARL1 or yARF3.
To assess whether yARL3 can affect growth phenotype, growth
rates of wild-type, arl3 mutant, and overexpressed yARL3
strains were determined. We constructed a recombinant yARL3 clone with a nine-amino acid influenza virus HA epitope (44) fused to its C
terminus, placed the HA-tagged allele (yARL3-HA) under control of the
ADH1 promoter, and expressed it in wild-type and arl3 mutant yeast. The arl3 mutants and yeast overexpressing yARL3, had
only ~10% lower specific growth rates than wild-type cells in
glucose synthetic medium (data not shown).
The replacement of Gln by Leu at position 71 in ARF1 is analogous to
the transforming Ha-Ras Q61L mutation in the second highly conserved
guanine nucleotide-binding region, which is essential for the function
of all guanine nucleotide-binding proteins (45). In ras,
this substitution reduces the intrinsic GTP hydrolytic activity
significantly, rendering the protein constitutively active with GTP
bound (46). An identical effect on activity was observed for
ARF1(Q71L), and the effects of the ARF1(Q71L) mutant on vesicular traffic in vitro were similar to those of GTP
Growth of wild-type cells, those overexpressing yARL3(Q78L),
arl3 mutant cells, and those overexpressing yARL3 was also
determined at different temperatures. Wild-type and arl3
mutant yeast cells were transformed with vectors harboring no insert
(pVT101U) or with yARL3(Q78L) or yARL3 expression plasmids,
respectively. At 37 and 30 °C, all of these cells grew nearly as
well as the wild-type strain (Fig. 2). At
15 °C, however, growth of the arl3 mutant was severely
impaired. Expression of yARL3 complemented the growth defect of
arl3 mutant, indicating that the growth defect of the null
mutant was caused by disruption of yARL3. Moreover,
overexpression of yARL3(Q78L) in wild-type yeast can cause growth
defective at 15 °C. It is conceivable that overexpressed
yARL3(Q78L), similar to ARF1(Q71L) (44), might interfere with
yARL3-mediated vesicular transport at 15 °C.
Specific Immunoreactivity of Antibody against
yARL3--
Recombinant proteins were purified and antibodies were
prepared as described under "Materials and Methods." Purified
His-tagged fusions with yARL3, yARL1, yARF1, yARF2, and yARF3
(~30-40 ng) were subjected to SDS-PAGE under reducing conditions,
transferred to polyvinylidene difluoride membranes, and visualized by
silver staining. At a dilution of 1:5000, the polyclonal antibody
specific for yARL3 did not cross-react with yARF1, yARF2, yARF3, or
yARL1 (data not shown). In addition, polyclonal antibodies against
yARF1, yARF2, yARF3, and yARL1 failed to react with yARL3 on Western blots analysis (data not shown). Immunoblotting with the yARL3 antiserum allowed detection of 1-2 ng of yARL3, whereas no signal was
detected with recombinant yARF1, yARF2, yARF3, and yARL1 (up to 100 ng)
(data not shown). Thus, yARL3 was immunologically distinguishable from
yARFs and yARL1.
Expression of Endogenous yARL3--
To confirm the presence of
yARL3 protein in yeast, proteins from lysates of wild-type,
arl3 mutant, and wild-type cells overexpressing yARL3 were
separated by SDS-PAGE and stained with Coomassie Blue (Fig.
3A). Although overexpressed
yARL3 was detected by the antibody against yARL3, endogenous yARL3 was
not detected (Fig. 3A).
As a more sensitive means to identify endogenous yARL3 protein, we
prepared lysates from cells that had been incubated with Pro-mix
L-35S label (blend of
[35S]methionine and [35S]cysteine) for
1 h. Immunoprecipitation with yARL3 antibody permitted detection
of 35S-labeled endogenous yARL3 protein from wild-type and
those overexpressing yARL3(Q78L), but not arl3 mutant cells
(Fig. 3B). These results demonstrated the existence of yARL3
in yeast, although in much lesser abundance (less than 0.005%) than
yARF1 and yARF2, which represent approximately 0.03-0.1% of total
yeast protein (25).
Function of yARL3 in Vesicular Transport--
To evaluate the role
of yARL3 in vesicular transport, we examined both endocytotic and
exocytotic pathways. First, we measured the glycosylation and
proteolytic processing of CPY and vacuole ALP, enzymes that are
transported from the ER to Golgi and finally to vacuole by distinct
sorting machineries (48). Pulse-chase labeling with
35S-labeled cysteine and methionine of wild-type,
arl3, and arf1 mutant cells at the permissive
temperature (37 °C) or nonpermissive temperature (15 °C) was
followed by immunoprecipitation of CPY or ALP. The core-glycosylated P1
form of the CPY proenzyme in the ER is converted to the P2 form by
further glycosylation in the Golgi apparatus and finally is
proteolytically processed in the vacuole to the mature form. ALP is a
type II membrane protein that is delivered to the vacuole in proenzyme
form and the sorting of ALP from late Golgi to the vacuole is reported
to differ from that of CPY (48). Upon arrival at the vacuole, precursor
ALP is cleaved at a site near the C terminus to yield a mature
membrane-spanning form of the hydrolase. At the permissive temperature,
similar to the wild-type cells, the arl3 mutant converted
CPY and ALP from the ER to Golgi and vacuole forms.(Fig.
4, A and C). The arf1 mutant, however, accumulated core-glycosylated CPY in
the Pl form and pro-ALP form as expected. At the nonpermissive
temperature, processing of alkaline phosphatase and carboxypeptidase Y
in arl3 mutant was slower than it was at 37 °C (Fig. 4,
B and D). Thus, yARL3 may have a biological
function different from that of yARF1/yARF2, with involvement in a
distinct ER to Golgi or Golgi to vacuole protein transport pathway.
Effect of the arl3 Mutant on Fluid-phase Endocytosis--
Previous
work demonstrated that some ARF proteins participate in endosome fusion
reactions, as well as in traffic through the secretory pathway (47,
49). In addition, the mammalian homologue of yARL3, ARP, was detected
on the plasma membrane and thus might be involved in some plasma
membrane-related events (e.g. endocytosis). To determine
whether yARL3 might function in an endocytic pathway, we investigated
the effect of yARL3 on the uptake of the fluid-phase marker, Lucifer
Yellow (LY). LY is a small fluorescent organic anion that is often used
as a marker for fluid-phase endocytosis (38). The uptake of LY is time- and energy-dependent (50) and requires certain proteins
that are important for endocytosis (Ref. 51 and references therein). Wild-type and arl3 mutant cells were incubated with LY at
either the permissive temperature (30 °C) or the nonpermissive
temperature (15 °C) for various times. Cells were washed, mounted,
and viewed under phase-contrast and fluorescence optics. At the
permissive temperature, arl3 mutant cells appeared defective
in accumulation of LY after incubation for 30 min but not after
incubation for 90 min (data not shown). Throughout this experiment,
vacuolar morphology of both wild-type and arl3 mutants
appeared normal. At the nonpermissive temperature, fluid-phase
endocytosis of LY was found to be impaired in arl3 mutant
compared with wild-type cells after incubation for 2 h (Fig.
5, left column). After
incubation with LY for 4 h at the nonpermissive temperature,
wild-type cells exhibited unambiguous vacuolar staining, whereas most
of the arl3 cells had less clearly stained vacuoles.
Moreover, arl3 mutants were found to contain vacuoles of
aberrant sizes after incubation at the nonpermissive temperature for
4 h (Fig. 5H). Prior study has shown that
overexpression of mutant ARF1 protein inhibited fluid-phase endocytosis
(47). A GTPase-activating protein of yeast ARF1, Gcs1, was also found
to participate in endocytosis at the nonpermissive temperature (52).
More recently, ARF was shown to have a fundamental role in regulating
membrane dynamics, peroxisome biogenesis and was required for
maintenance of yeast Golgi and endosome structure and function (53,
54). Hence, the action of yARL3 may be similar to that of ARF in
regulating membrane dynamics and organelle biogenesis.
Subcellular Localization of yARL3--
As the cellular
localization of yARL3 could provide clues to its function, a cell
lysate was subjected to velocity sedimentation on a sucrose density
gradient. The presence of yARL3, yARF1, Emp47p (Golgi marker protein)
(41), and ALP (vacuole marker protein), in fractions was assessed by
Western blot analysis (Fig. 6). Most of
the yARL3, apparently a soluble cytoplasmic form, was at the top of the
gradient. Although yARF1 is known to function in Golgi transport,
>90% of it was also in the soluble fraction as found previously
(22).
Because yARL3 and yARF1 appeared to dissociate from membranes upon cell
lysis, we investigated the intracellular localization of yARL3 by
indirect immunofluorescence. Fixed, permeabilized wild-type cells were
incubated with anti-yARL3 antibody and then with fluorescein
isothiocyanate-conjugated goat anti-rabbit antibodies. Nuclei were
labeled with the DNA-binding dye H33258. No specific signal was
observed (data not shown), presumably due to the low abundance of yARL3
in wild-type yeast. When yARL3-HA was overexpressed in wild-type cells,
most of the immunoreactive yARL3 appeared concentrated in a continuous
circum-nuclear distribution typical of ER (Fig.
7). This is reminiscent of what has been
seen by others with antibodies directed against perinuclear staining
typical for ER proteins, such as Kar2p (55), Sce62p (56), or Sec63p (57). In parallel experiments, we observed similar staining patterns
with both antibody 12CA5 directed against the HA-epitope of yARL3-HA,
and anti-Kar2p (55). In both cases, neither punctate staining typical
for Golgi localization nor staining of the vacuole was evident. Because
yARL3 was overexpressed using a muticopy-plasmid, large variations from
cell to cell in levels of HA-yARL3 expression were seen and more
cytosolic yARL3 was detected as diffuse than as reticular staining.
From the combined results of subcellular fractionation and indirect
immunofluorescence, we conclude that yARL3 is probably associated in
part with ER membranes, which differs from the recently reported plasma
membrane localization of mammalian ARP (23).
Biochemical Properties of Recombinant yARL3 Protein--
To
determine whether the yARL3 gene product has ARF activity,
recombinant yARL3 synthesized in and purified from E. coli
was assayed as described under "Materials and Methods." The
His-tagged yARL3 fusion protein did not stimulate auto-ADP-ribosylation
of cholera toxin A1 protein, in the presence of 100 µM
GTP
GTP
At least four small GTPases (ARF1, ARF2, SAR1, and YPT1) are known to
be involved in ER-to-Golgi vesicular transport in yeast. Sar1 is an essential gene, the product of which is required
for vesicle budding from the ER (58, 59). The Ytp1 gene
product is involved in either ER-to-Golgi or early Golgi transport and is required for cell viability (60, 61). Like yARL1 and yARF3, yARL3,
at its normal level of expression, clearly cannot replace yARF1 and
yARF2, as their double deletion is lethal. Recently, mammalian and
yeast ARL1 were reported to be localized to Golgi membranes (22, 62).
Although several ARL proteins have been identified, little is known
about their cellular function. We report here the identification and
characterization of yeast ARL3 with structural similarity to mammalian
ARP. yARL3 was not essential for cell viability, but disruption of the
yARL3 gene resulted in cold-sensitive cell growth. With the
temperature-sensitive arl3 mutant, we can isolate
suppressors that complement the cold-sensitive growth phenotype of the
arl3 null mutant. Although ER-to-Golgi vesicular traffic did
not appear affected in the arl3 mutant at permissive
temperature (37 °C), retardation in the maturation of vacuolar
proteins (ALP and CPY) and an impairment in fluid phase endocytosis at
the nonpermissive temperature (15 °C) were observed. ARF is widely
believed to play a critical role in recruiting coatomer (COPI) to Golgi
membranes to initiate vesicle budding. Newer observations indicate,
however, that organelle morphology is significantly more affected than
transport in the arf mutants, suggesting a fundamental role
for ARF in regulating membrane dynamics (53, 54). The newly identified
yARL3, which is, in part, associated with ER-nuclear envelope, may
participate in another kind of vesicular transport. Although the
involvement of yARL1 and yARL3 in the vesicular transport pathway has
been demonstrated, their specific cellular functions and molecular
mechanisms of action remain subjects for investigation.
INTRODUCTION
Top
Abstract
Introduction
References
MATERIALS AND METHODS
Yeast strains
strains (see Table I),
and uracil prototrophs were selected. DNA blot analysis of the
URA+ cells confirmed that the yARL3 gene
contained an additional 3.8-kb, corresponding to the
hisG-URA3-hisG gene. Elimination of the URA3 and
one hisG repeat was carried out as described previously
(28). Double deletions of yARL3 and yARL1 or of
yARL3 and yARF3 were performed in yeast
arl3 mutants (arl3::hisG, ura3),
arl1 mutants (arl1::hisG, ura3), and
arf3 mutants (arf3::hisG, ura3) that
are listed in Table I.
-D-galactopyranoside, was added to a
final concentration of 1 mM. After 3 h, cells were
harvested by centrifugation, washed once in 20 mM Tris, pH
7.4/1 mM EDTA, and stored at
80 °C until used. For
large scale production of recombinant proteins, 5 ml of overnight
culture were used to inoculate 1 liter of LB broth containing
ampicillin (100 µg/ml), followed by shaking at 37 °C. When
A600 reached 0.6-0.8, protein production was
induced with 0.5 mM
isopropyl-1-thio-
-D-galactopyranoside for 3 h,
and bacteria were collected by centrifugation and stored at
20 °C.
Cell pellets were suspended in 10 ml of phosphate-buffered saline (pH
7.4) containing lysozyme, 0.5 mg/ml, and disrupted by sonification. The
lysate was centrifuged after addition of Triton X-100 to 1%, and
His-tagged fusion protein was isolated on Ni2+-NTA resin
(Qiagen, Chatsworth, CA) by standard methods. Purity was assessed by
SDS-PAGE and staining with Coomassie Blue. Protein was quantified by
Coomassie Blue or silver stain assays (Bio-Rad).
S to
purified recombinant yARL3 was determined by a filter trapping method
(39). Unless otherwise specified, 1 µg of His-tagged yARL3 fusion
protein was incubated at 30 °C in 20 mM HEPES (pH 7.5),
100 mM NaCl, 1 mM dithiothreitol, 1 mM EDTA, 0.5 mM MgCl2, bovine serum
albumin, 20 µg/ml, 10 µM [35S]GTP
S
(Amersham Pharmacia Biotech, >1000Ci/mmol) without or with 3 mM sonified
DL-
-dimyristoylphosphatidylcholine, and 2.5 mM (0.1%) sodium cholate, in a final volume of 50 µl.
Duplicate or triplicate samples were transferred to 2 ml of ice-cold 20 mM Tris-Cl (pH 7.4), 100 mM NaCl, 10 mM MgCl2, and 1 mM dithiothreitol before rapid filtration on 0.45 µm HA filters (Millipore, Bedford). The amount of nucleotide bound to the fusion protein was quantified by
scintillation counting. Data were fitted to a first-order rate equation.
-32P]GTP to
5.0 µM recombinant yARL3 protein, as described by
Randazzo and Kahn (40) followed by its dilution (1:9) into 25 mM HEPES (pH 7.4), 100 mM NaCl, 2.5 mM MgCl2, 0.1% Triton X-100, 1 mM
dithiothreitol, 1 mM GTP with bovine brain
phosphoinositides (1 mg/ml), and incubation at 30 °C. Every 5 min,
samples were transferred to 2 ml of ice-cold 20 mM Tris-Cl,
pH 7.4, 100 mM NaCl, 10 mM MgCl2, 1 mM dithiothreitol. The conversion of GTP to GDP was
determined by thin-layer chromatography as described (39). A blank
without protein was used to determine background, which was subtracted
from samples containing protein.
-mercaptoethanol. The cells were collected by centrifugation (3000 × g for 5 min), washed with solution P, and
suspended in 100-200 µl of solution P. Samples (30 µl) of cells
were placed in each well of a multiwell slide that had been coated with
0.1% polylysine. Following aspiration of nonadherent excess cells, the
slides were washed once with a washing buffer containing 100 mM Tris-HCl (pH 9.0) and 150 mM NaCl and then
incubated for 1 h with antibody blocking buffer (100 mM Tris-HCl, pH 9.0, 150 mM NaCl, 5% nonfat
milk, 0.1% Tween 20), followed by a 2-h incubation with the primary
antibody in antibody blocking buffer. The slides were then washed twice
with the washing buffer. After 2 h of incubation with secondary
antibody, cells were washed extensively with the washing buffer again.
Mouse monoclonal anti-HA antibody 12CA5, and fluorescein
isothiocyanate-conjugated secondary antibodies (Cappel) were diluted
1:1000 and 1:300 for use, respectively. Texas Red-conjugated goat
anti-rabbit IgG antibody (Amersham Pharmacia Biotech) was used to
detect rabbit polyclonal antibodies. Nuclei were visualized by staining
with H33258 (2 µg/ml), which was included in mounting solution.
Polyclonal anti-Kar2 antibody was kindly provided by Dr. Mark Rose.
Fluorescence microscopy was performed with a Nikon Microphot SA
microscope. Cells were viewed at a magnification of × 1000. Exposure times for immunofluorescence photographs were 15 or 30 s.
RESULTS AND DISCUSSION
Comparison of deduced amino acid sequences of yeast ARL3 and those of
ARFs and other ARLs
View larger version (54K):
[in a new window]
Fig. 1.
Alignment of deduced amino acid sequences of
ARL3, ARLs, and ARFs from yeast and other eukaryotes. Sources of
sequences are as follows: yARF1, Ref. 24; yARF2, Ref. 25; yARF3, Ref.
26; yARL1, Ref. 22; yARL3, this study; hARP, Ref. 23; rARP, Ref. 23;
hARL1, Ref. 21; hARF1 (recombinant human ARF1), Ref. 1; hARF4, Ref. 1;
and hARL6, Ref. 1. Amino acids that are identical in at least 6 of the
11 sequences compose the consensus sequence shown at the
top. Underlines indicate the consensus sequence
for GTP binding and hydrolysis. Boxes indicate amino acids
identical in yARL3 and two mammalian homologue ARP sequences.
spores, contained the replacement of yARL3
(data not shown) and lacked yARL3 protein as judged by
immunoprecipitation (see below). As each of the strains (haploid)
containing the arl3 disruption (hisG-URA3-hisG)
was viable, yARL3 is not an essential gene under optimal
growth conditions at 30 °C. yARL3 is a single copy gene and is located on chromosome XVI (Yeast Genome Data Bank). Total RNA
from yeast (wild-type or arl3 mutant) during mid-log growth in either glucose- or galactose-containing medium was subjected to
electrophoresis, transferred to GeneScreen Plus, hybridized with the
yARL3 DNA probe, and after stripping, with a yeast
-tubulin probe. The ~0.8-kb yARL3 RNA, similar to that
of yARF1, was not repressed by growth in glucose and was not
detected in the arl3 mutant (data not shown).
S on ER to
Golgi and intra-Golgi transport (47). We also constructed recombinant yARL3 with Leu replacing Gln at amino acid 78 position, yARL3(Q78L). Although overexpression of yARF1 or yARF1(Q71L) in yeast was believed to interfere with normal cellular functions and hence affect cell growth, we did not observe a similar growth defect when wild-type yARL3
or yARL3(Q78L) was overexpressed under optimal growth conditions at
30 °C (data not shown).
View larger version (124K):
[in a new window]
Fig. 2.
Deletion of yARL3 results in cold
sensitivity. Wild-type (WT) and arl3 mutant
cells were transformed with vectors harboring no insert (pVT101U);
wild-type and arl3 mutant were transformed with yARL3(Q78L)
and yARL3, respectively, in a high copy number plasmid. Cells were
grown on selective medium plates incubated for 3 days at 30 and
37 °C or for 5 days at 15 °C, as indicated.
View larger version (68K):
[in a new window]
Fig. 3.
Detection of yARL3 by Western blot and
immunoprecipitation analysis. A, samples (~30-40
µg) of proteins from wild-type cells expressing HA-tagged yARL3,
arl3 mutant, or ARL3 wild-type were separated by SDS-PAGE
and stained with Coomassie Blue (upper panel). After
transfer to polyvinylidene difluoride filter, yARL3 was detected with
antibodies against yARL3 using the ECL system and a 10-min exposure of
Hyper-film-MP (lower panel, arrow). Positions of protein
standards (kDa) are shown at the left. B,
[35S]yARL3 was immunoprecipitated from cells labeled at
mid-log growth with [35S]methionine for 1 h.
Wild-type cells were grown in galactose (Gal) or glucose
(Glu) medium as indicated, and lysates from ARL3 wild-type,
arl3 mutant, or wild-type expressing yARL3(Q/L) were
prepared as described under "Materials and Methods." Proteins
immunoprecipitated with anti-yARL3 antibodies were separated by
SDS-PAGE in 12% gel before autoradiography with intensifying screen at
80 °C for 14 days. Positions of protein standards are shown at the
left.
View larger version (29K):
[in a new window]
Fig. 4.
Immunoprecipitation of labeled CPY and
ALP. Wild-type (ARF1/ARL3), arl3 mutant, and
arf1 mutant cells were grown and radiolabeled with
35S-labeled methionine and cysteine at the permissive
(37 °C) or nonpermissive (15 °C) temperature. Immunoprecipitates
were prepared as described under "Materials and Methods." P1 CPY is
the core-glycosylated form found in the ER, P2 is the outer
chain-glycosylated Golgi form, and the mature form (M)
results from proteolytic processing in the vacuole. pro-ALP
is proenzyme form, and mALP is the mature form in the
vacuole. Chase time (min) is indicated. A, CPY at the
permissive temperature; B, CPY at the nonpermissive
temperature; C, ALP at the permissive temperature;
D, ALP at the nonpermissive temperature.
View larger version (79K):
[in a new window]
Fig. 5.
Accumulation of LY in vacuole. The LY
assays were performed on the wild-type and arl3 mutant as
described under "Materials and Methods." Wild-type (A, B,
E, and F) or arl3 mutant (C, D,
G, and H) was grown at 15 °C and transferred to
fresh YPD before addition of LY for 2 h (A-D) or
4 h (E-H) and then viewed by phase-contrast
(right) and fluorescence (left) microscopy.
View larger version (73K):
[in a new window]
Fig. 6.
Subcellular fractionation to localize yARL3
protein. Lysate of spheroplasts from wild-type cells
overexpressing yARL3 was fractionated by sucrose gradient
centrifugation. Samples of fractions were subjected to SDS-PAGE, and
proteins were transferred to polyvinylidene difluoride filters; yARL3,
yARF1, a Golgi marker (Emp47p), and a vacuole marker
(ALP) were identified with specific antibodies and detected
using the ECL system with exposure to Hyper-film-MP. Lane W
contains yeast total lysate; lane M indicates positions of
protein standards (from top: 105, 98, 53, 33, and 24 kDa).
Gradient fractions are numbered from the top.
View larger version (37K):
[in a new window]
Fig. 7.
yARL3 protein localization. Wild-type
yeast transformed with plasmid encoding HA-tagged yARL3 were fixed with
formaldehyde. Spheroplasts were prepared and treated with polyclonal
anti-Kar2 antibody, polyclonal anti-yARL3, or monoclonal 12CA5 antibody
against the HA-epitope. Nuclei were visualized by staining with H33258,
which was included in mounting solution. Phase-contrast and indirect
immunofluorescence images are indicated.
S, and detergent (SDS) (data not shown).
S binding to yARL3, which was assessed by the nitrocellulose
filter trapping method, was concentration dependent and was maximal in
60 min at 30 °C. With and without
dimyristoylphosphatidylcholine/cholate, recombinant yARL3
bound, respectively, 3.2 ± 0.3 and 1.5 ± 0.2 pmol of
GTP
S/µg protein. Therefore, GTP
S binding to yARL3, like that to
ARF, was modified by the added phospholipid/detergent (data not shown)
(17). In contrast, binding of GTP
S to hARL2 and hARL3 was affected
very little by added lipid or detergent (18, 20). Purified mammalian
ARF1 and ARF3 lack detectable of GTPase activity (below 0.0015 min
1) (40). Maximal rates of GTP hydrolysis by hARL2 and
hARL3 were 0.0074 and 0.005 min
1, respectively (18, 20).
Recombinant yARL3 had a rate of ~0.01 min
1,
considerably less than that of the mammalian homologue ARP, which was
0.093 min
1(23).
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Drs. Schroder-Kohne, Mark Rose, and Dieter Gallwitz for providing us with antibodies and Dr. Mingyuan Cheng for helping with tetrad dissection. We also thank Drs. Martha Vaughan and Joel Moss for critical review of the manuscript.
![]() |
FOOTNOTES |
---|
* This work was supported by Grant NSC-87-2314-B-002-262 from the National Science Council, Republic of China (to F.-J. S. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) AF017142.
To whom correspondence should be addressed. Tel.: 886-2-2397-0800, ext. 5730; Fax: 886-2-2395-7801; E-mail: fangjen{at}ha.mc.ntu.edu.tw.
The abbreviations used are:
ARF, ADP-ribosylation factor; yARF, recombinant ARF from Saccharomyces
cerevisae; dARF, recombinant ARF from Drosophila
melanogaster, ARL, ARF-like protein; ER, endoplasmic reticulum; PCR, polymerase chain reaction; kb, kilobase(s); PAGE, polyacrylamide
gel electrophoresis; LY, Lucifer Yellow; ALP, alkaline phosphatase; CPY, carboxypeptidase Y; GTPS, guanosine
5'-O-(thiotriphosphate).
2 F.-J. S. Lee, C.-Y. Lin, C.-F. Huang, and L.-M. Buu, unpublished data.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() |
---|