From the Eccles Program in Human Molecular Biology and Genetics, The formation of prostaglandins requires the
catalytic activity of cyclooxygenase (COX) which converts arachidonic
acid to the prostaglandin endoperoxide PGH2, from
which all other prostaglandins are formed. COX-2 is the highly
inducible isozyme of COX which is responsible for much of the
prostaglandin production in inflammation and is a key factor in colon
carcinogenesis. Because COX-2 activity can be rate-limiting in
prostaglandin formation, COX-2 expression must be regulated tightly.
Numerous factors, including mitogens, tumor promoters, and cytokines
have been found to stimulate the transcription of COX-2. We show that
fatty acids, prostaglandins, and non-steroidal anti-inflammatory drugs,
compounds that are substrates, products, and inhibitors, respectively,
of COX enzymatic activity, also increase its expression. These
compounds are members of a heterogeneous group of compounds known as
peroxisome proliferators, and the prototypical peroxisome proliferator,
WY-14,643, also enhanced COX-2 expression. We demonstrate that these
compounds increase COX-2 transcription, and we identify a region of the COX-2 promoter containing a peroxisome proliferator response
element that is responsible for the enhancement of COX-2 expression
seen with these compounds.
Arachidonic acid and its oxidized derivatives, the prostaglandins
(PGs),1 are important
mediators of many physiological and pathophysiological processes.
Physiologically, prostaglandins regulate vascular homeostasis, kidney
function, ovulation, and parturition. These compounds are equally
important as mediators of inflammation, thrombosis, and pain (1).
Prostaglandins are formed by the action of cyclooxygenase, a
bifunctional enzyme catalyzing both the oxidation of arachidonic acid
to the prostaglandin endoperoxide PGG2 (hence the name
cyclooxygenase) and its subsequent reduction to PGH2. This
prostaglandin intermediate is the precursor to all biologically active
prostaglandins and thromboxanes, the ultimate prostaglandin product
being formed in a cell-specific manner. There are two isoforms of
cyclooxygenase, COX-1 and COX-2. COX-1 expression is consistent
throughout the cell cycle (2, 3) and is relatively unaffected by
treatment of cells with mitogenic or inflammatory compounds, but it has been demonstrated to be developmentally regulated (4). COX-1 is thought
to be responsible for "housekeeping" prostaglandin production.
COX-2, on the other hand, is highly inducible; its expression is
elevated by a variety of stimuli, including mitogens, tumor promoters,
and cytokines (1), and, as described below, it is involved in carcinogenesis.
Dietary fat is an important risk factor for certain epithelial cancers,
particularly colon cancer (5), but the molecular basis for this risk is
unknown. The initiation and progression of other forms of cancer,
including breast cancer, may also be regulated by dietary fat. Studies
by Bandyopadhyay et al. (6) demonstrated that linoleic acid
(LA), the major fatty acid in a normal Western diet, enhances the
growth of murine mammary epithelial cells (6). Carter et al. (7)
demonstrated that a diet high in fat increased the incidence of tumor
formation in rats treated with the carcinogen
dimethylbenz(a)anthracene. Treatment with a COX inhibitor attenuated
the effects of the high fat diet, suggesting that a COX was essential
to the carcinogenic process. More recent studies in colon cancer have
identified induction of the COX-2 isoform as a rate-limiting step
(8-10).
Work in the last few years has shown that fatty acids and
prostaglandins are able to regulate gene expression through peroxisome proliferator-activated receptors (PPARs) (11-15). PPARs are members of
the steroid hormone receptor superfamily which act by altering the
transcription of genes with which they associate by means of a
recognition sequence known as a peroxisome proliferator response element (PPRE) (16). Although nuclear localization of the receptors is
independent of ligand, PPARs modulate gene expression only when ligand
is bound (17). Compounds that activate PPARs are known as peroxisome
proliferators and comprise a heterogeneous group that includes fatty
acids and prostaglandins, plasticizers, and anti-diabetic drugs (18 and
references therein).
Numerous clinical studies have demonstrated that non-steroidal
anti-inflammatory drugs (NSAIDs) prevent colon cancer (19-23). In
patients with familial adenomatous polyposis, sulindac reduces both the
size and number of polyps, which are precursors of colon cancer (22).
As shown by Thun et al. (23), aspirin consumption decreases
the risk of fatal colon cancer by as much as 50%. Work by Oshima
et al. (10) further supported the involvement of COX-2 in
colon carcinogenesis. This group examined polyp formation in mice with
a mutation in the APC gene, the gene responsible for familial
adenomatous polyposis. When these mice were crossed with COX-2 knockout
mice, the offspring had only a small fraction of the intestinal polyps
found in their COX-2-expressing peers. Mice that were heterozygous for
expression of COX-2 had intermediate levels of colon polyps. Given the
correlation between increased COX-2 expression and colon cancer, the
effect of NSAIDs is most certainly mediated, at least in part, by COX
inhibition. Interestingly, some NSAIDs have recently been demonstrated
to act as peroxisome proliferators (24), suggesting that they may also
regulate gene expression as part of their chemopreventative mechanism.
In the experiments described below, we examined the ability of fatty
acids, prostaglandins, and NSAIDs to regulate COX-2 expression. We
demonstrate that these compounds enhance COX-2 expression and that the
regulation occurs transcriptionally. Further, we define a region of the
promoter responsible for at least part of the regulation of COX-2
expression by these compounds.
Materials--
Fatty acids, prostaglandins, NS-398, and several
other NSAIDs were purchased from Cayman Chemical Company. WY-14,643,
sulindac sulfide, and sulindac sulfone were purchased from BioMol.
Other NSAIDs and common reagents were purchased from Sigma. Fatty acids and prostaglandins were diluted in ethanol, WY-14,643 and NSAIDs in
dimethyl sulfoxide. Medium for the culture of human mammary epithelial
cells was prepared in house, media for culture of colon cell lines were
obtained from Life Technologies, Inc. Mouse anti-human monoclonal
antibodies to COX-1 and COX-2 were the kind gift of J. Maclouf (INSERM,
Paris). Mouse anti-human Clones for Human PPARs and RXR Isolation and Subcloning the 7-Kilobase COX-2
Promoter--
Previous work in this laboratory isolated a 1.8-kb human
COX-2 promoter clone (9). Because many PPREs are located further upstream from the translational start site (29), we felt it was
necessary to obtain a larger promoter clone. We designed polymerase chain reaction primers corresponding to the 5'-most end of the COX-2
promoter, which were used to isolate a P1 clone (Genome Systems). We
performed a series of restriction digestions and Southern blots to
identify regions of the clone corresponding to further 5'-regions of
the COX-2 promoter. We chose pieces from two restriction digestions,
KpnI (5,710 bases) and SacI (2,971 bases), which
were subcloned into pBluescript (Stratagene) for sequencing and then
into pGL3-basic (see below) attached to our existing COX-2 promoter to
allow us to search for potential PPREs in this larger promoter. The
result of the subcloning gave us a total of approximately 7,270 bases
of promoter for the KpnI construct and 3,920 bases of
promoter for the SacI construct. The 7,270-base pair COX-2
promoter has been deposited with GenBank, Accession Number
AF044206.
Reporter Constructs--
Regions of the 7-kb COX-2 promoter were
cloned into pGL3-basic (Promega). The putative PPRE in the COX-2
promoter (located at Epithelial Cell Culture--
184B5 mammary epithelial cells
(obtained from Martha Stampfer) (32) were grown in modified MCDB 170, a
serum-free defined medium. Before treatment with fatty acids,
prostaglandins, or NSAIDs, the cells were made quiescent by treating
for 48 h with an antibody to the epidermal growth factor (EGF)
receptor (monoclonal antibody 225) at 10 µg/ml (33). HCT-116, DLD-1,
CaCo-2, and HT-29 colonic epithelial cells were obtained from ATCC and
grown according to recommended procedures. HCT-116 and HT-29 were
cultured in McCoy's 5A with 10% fetal bovine serum, DLD-1 were grown
in RPMI 1640 with 10% fetal bovine serum, and CaCo-2 were grown in minimal essential medium with Earle's salts, supplemented with sodium
pyruvate and 20% fetal bovine serum. For 24 h before treatment with NSAIDs, the colonocytes were serum starved by replacing the normal
growth medium with serum-free medium. To examine COX-2 expression in
both mammary epithelial cells and colonocytes, the medium was changed
to fresh serum-free medium containing fatty acid, prostaglandin,
WY-14,643, or NSAID. For 184B5 cells, the medium also contained the EGF
receptor antibody. Cells were incubated with agonist for 4-8 h for
mRNA expression or for 10-12 h for protein expression before
harvest. For time-course experiments, samples were harvested at the
times indicated in the figures. For experiments utilizing actinomycin
D, it was added at 5 µg/ml simultaneously with agonist. For each
fatty acid, prostaglandin, and NSAID used, a dose-response curve was
performed. Only the maximally effective concentration of each fatty
acid, prostaglandin, or NSAID is shown in the figures. Fatty acids
including arachidonic acid, eicosapentaenoic acid, eicosatetraynoic
acid, linoelaidic acid, and docosahexaenoic acid were used at 0.3-18
µM. Prostaglandins, HETEs, and HODEs were used at the
following concentrations: PGD2, PGE2, and
PGF2 Transfection Experiments--
Quiescent 50% confluent 184B5
cells were transfected using 2.5 µl/P35 dish LipofectAMINE (Life
Technologies, Inc.) and 0.25 µg/P35 dish each of luciferase reporter
plasmid, PPAR Western Blot Analysis--
Cells were washed with ice-cold
phosphate-buffered saline and then lysed with buffer consisting of 20 mM Tris, pH 7.5, 16 mM CHAPS, 0.5 mM dithiothreitol, 1 mM EDTA, 1 mM
benzamidine hydrochloride, 1 µg/ml leupeptin, and 10 µg/ml soybean
trypsin inhibitor. Cells were scraped and placed on ice for 30 min.
Unlysed cells and debris were removed by centrifugation, and protein
assays were performed (BCA protein assay, Pierce) to ensure equal
loading on SDS-polyacrylamide gel electrophoresis. Proteins were
separated through 10% denaturing polyacrylamide gels and transferred
to polyvinylidene difluoride membranes. COX-2 and COX-1 monoclonal
antibodies were used according to the procedures of Habib et
al. (34). Monoclonal anti-human RNase Protection Assay--
RNA was isolated using TRIzol
reagent (Life Technologies, Inc.) and processed according to the
manufacturer's instructions. Samples were resuspended in RNase-free
water and concentrations determined spectrophotometrically. 10 µg of
each sample was used for RNase protection assay with probes for COX-2
and GAPDH. The COX-2 probe corresponds to the region spanning Nuclear Run-on Assays--
Nuclear run-on assays were used to
assess absolute levels of transcription of COX-2 after treatment with
EGF, phorbol 12-myristate 13-acetate, or LA. Assays were performed
essentially as described by DeWitt and Meade (3). For nuclear
isolation, 1 × 107 cells were treated with vehicle,
EGF (100 ng/ml), phorbol 12-myristate 13-acetate (60 ng/ml), or LA (18 µM) until the time when the maximal change in
transcription was expected based on changes in mRNA levels (30 min
for EGF, 1 h for phorbol 12-myristate 13-acetate, and 2 h for
LA and vehicle). Cells were scraped into cold phosphate-buffered saline, centrifuged and rinsed, and placed in buffer (50 mM
Tris, pH 8.3, 40% glycerol, 5 mM MgCl2, and
0.1 mM EDTA) for storage in liquid nitrogen until assayed.
mRNA and protein were harvested from identical plates at later time
points to ensure that both COX-2 protein and mRNA expression were
altered as expected by these treatments. For nuclear run-on assays, the
following plasmids were used as probes: a cDNA fragment for COX-2
which corresponded to the entire open reading frame but did not contain
the 3'-untranslated region and a full-length cDNA for COX-1.
(Previous work demonstrated that COX-1 levels are unaltered by the
treatments used in these experiments and that it could serve as a
control in these experiments.) Both plasmids were in the same base
vector, eliminating the need for a vector control. Plasmids were
linearized, denatured, and applied to Hybond N membrane using a
Minifold II Slot Blotter (Schleicher & Schuell). To begin run-on
assays, nuclei were thawed and combined with a buffered nucleotide
mixture containing [ Gel Shift Assay--
Nuclear extracts were prepared from COS-7
cells transfected with PPAR Polyunsaturated fatty acids, including LA, have diverse effects on
cells, and we asked whether one component of the response was to alter
COX-2 expression. We exposed mammary epithelial cells to LA and found
that it strongly enhanced COX-2 expression (Fig. 1A). Many fatty acids are able
to stimulate cell responses, so we next tested other fatty acids for
their effect on COX-2 expression. We found that all of the unsaturated
fatty acids that we tested enhanced COX-2 expression, including
arachidonic acid, the normal substrate for COX-2, as well as fatty
acids that are abundant in fish oils, eicosapentaenoic acid and
docosahexaenoic acid. To determine whether metabolism of the fatty acid
was necessary for stimulation of COX-2 expression, we exposed cells to
linoelaidic acid, an analog of LA which has only trans-double bonds,
and eicosatetraynoic acid, an analog of arachidonic acid with triple
bonds, neither of which is a substrate for oxidases such as COX. These
compounds also increased the level of COX-2, demonstrating that
metabolism of fatty acid is not required for this effect.
The pattern of fatty acids that enhanced COX-2 expression is consistent
with fatty acids that have been identified recently (14, 15) to act
through PPARs. Although their physiological ligands remain uncertain,
it has been demonstrated that prostaglandins and fatty acids can act as
ligands. We next tested the ability of a panel of potential COX-2
products to enhance its expression. We found that many of them enhanced
COX-2 expression, particularly the cyclopentanone prostaglandins
PGA2 and 15 Nora Eccles
Harrison Cardiovascular Training and Research Institute, the University
of Utah, Salt Lake City, Utah 84112
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
REFERENCES
EXPERIMENTAL PROCEDURES
-actin was purchased from ICN. Goat
anti-mouse secondary antibody was from BIOSOURCE.
--
We screened a human
skeletal muscle 5'-STRETCH PLUS cDNA library
(CLONTECH) to isolate clones for the known human
isoforms of PPAR and for RXR
. PPAR
(25),
(26), and RXR
(27) were obtained by screening with 30-mer oligonucleotides
corresponding to the region surrounding the translational start site,
according to established procedures. PPAR
(28) was obtained by
screening with a random prime-labeled cDNA probe (Cayman).
Full-length cDNA clones were obtained for each. The clones were
sequenced to ensure correctness and subcloned into pcDNAI/Amp
(Invitrogen) for mammalian expression.
3900) as well as a consensus PPRE for the rat
acyl-CoA oxidase gene (ACO) (30, 31) were cloned into pGL3 promoter.
Oligonucleotide sequences for ACO PPRE were: F, 5'-CGCGT
TCCTTTCCGAACGTGACCTTTGTCCTGGTCCCCTTTTGCT- 3'; ACO PPRE R,
5'-GATCTAGCAAAAGGGGACCAGGACAAAGGTCACGTTCGGAAAGGA-3'; and for the
COX-2
3900 PPRE: COX-2
3900 PPRE F, 5'-
CGCGTGGTCTGTCTTTCAAATTTTTTAAGTAGGGTTATGACCTGTCGCCTCACTTCTCTGACAGTTCTA-3', COX-2
3900 PPRE R, 5'-
GATCTAGAACTGTCAGAGAAGTGAGGCGACAGGTCATAACCCTACTTAAAAAATTTGAAAGACAGACCA-3'. A pGL3 promoter vector with no insert was used as a negative
control in transfection experiments. PPAR
cloned into pcDNAI/Amp
was used for cotransfection to ensure that the cells' native PPAR would not be limiting in detection of transcriptional effects.
-Galactosidase cloned into pHOOK-2 (Invitrogen) was used as a control for normalization of transfections.
at 0.4-74 µM; PGA2,
15-deoxy-
12,14-PGJ2, 8(R)-HETE,
8(S)-HETE, 15-HETE, 9-HODE, and 13-HODE at 0.3-18 µM. The following NSAIDs were tested from 10 to 250 µM: meclofenamate, mefenamic acid, NS-398, indomethacin,
sulindac sulfone, piroxicam, resveratrol, naproxen, flurbiprofen, and
ketorolac. Sulindac sulfide was tested from 1 to 250 µM.
Ibuprofen and aspirin were tested from 50 to 1,000 µM.
(or
, or
, or vector only), and
-galactosidase and were performed in the presence of monoclonal
antibody 225. At 24 h after transfection, the medium was changed
to fresh MCDB 170 containing monoclonal antibody 225 with or without
100 µM WY-14,643. The cells were harvested 72 h
later, and luciferase and
-galactosidase assays were performed.
Luciferase activity was measured using the Promega kit, and
-galactosidase was measured using Galactolight (Tropix). Triplicate
wells were assayed in duplicate for each sample.
-actin was also used in some
experiments as a control for protein integrity. The secondary antibody
was horseradish peroxidase-labeled goat anti-mouse
(BIOSOURCE), and ECL (Amersham) was used as a detection method. Quantitation of Western blots was performed by
scanning the blots into Photoshop and performing densitometry with NIH Image.
90 to
+332 relative to the COX-2 translational start
site.2 The GAPDH probe is
commercially available (Ambion). Radioactive transcripts were prepared
using [
-32P]UTP and the Ambion MAXIscript in
vitro transcription kit. 80,000 cpm/sample of the COX-2 probe and
8,000 cpm/sample of the GAPDH probe were used in the RNase protection
assay (RPA II, Ambion). RNA and probes were co-precipitated,
resuspended in hybridization buffer, and incubated overnight at
43 °C. The following day, unbound RNA was digested with RNase, and
the remaining radiolabeled RNA was precipitated, resuspended in loading
buffer, and separated on a 6% polyacrylamide gel. Gels were dried and
exposed to BioMax MS film at
80 °C for up to 48 h. After
autoradiography, the protection assay was quantitated by densitometry
as above.
-32P]UTP to label transcripts
radioactively. Transcription was allowed to proceed for 30 min at
30 °C, and then RNase-free DNase (200 units) was added and the
incubation continued a further 10 min. Next, proteins were digested by
the addition of proteinase K (400 µg/ml) for 45 min at 37 °C. The
samples were extracted with phenol-chloroform and precipitated with
NH4OAc and EtOH at
80 °C. After repeating the DNase
and proteinase K digestions, the samples were precipitated overnight at
80 °C. The following day, the samples were centrifuged, and the
RNA was resuspended in TE and denatured with NaOH for 10 min on ice.
The samples were precipitated a third time and resuspended in TE.
Incorporation of radiolabel into the nuclei was ascertained by
scintillation counting, and an equal amount of radioactivity was added
to individual slot blots for each sample. The slot blots that contained
COX-1 and COX-2 probes had been prehybridized for 2 h before the
addition of radiolabeled nuclei. After the addition of the nuclei, the
blots were hybridized at 42 °C for 48 h. The blots were then
washed as described and exposed to BioMax MS at
80 °C for up to
48 h. After autoradiography, blots were quantitated as described above.
(or
, or
, or vector only) and
with RXR
(35). Oligonucleotide cassettes corresponding to the ACO
PPRE (30, 31) and the COX-2
3900 PPRE were either radiolabeled using [
-32P]ATP and T4 kinase or used unlabeled for
competition experiments. The following oligonucleotides were used: ACO
PPRE F, ACO PPRE R, COX-2
3900 PPRE F, COX-2
3900 PPRE R, whose
sequences were defined earlier, and AP2 F,
5'-GATCGAACTGACCGCCCGCGGCCCGT-3'; and AP2 R,
5'-ACGGGCCGCGGGCGGTCAGTTCGATC- 3'. Binding reactions were performed by
preincubating 20 µg of nuclear lysate in binding buffer with or
without competitor oligonucleotide (50-fold excess compared with
radiolabeled oligonucleotide) in a volume of 18 µl for 10 min at room
temperature. Binding buffer consisted of 10% glycerol, 20 mM Tris, pH 8.0, 80 mM KCl, 10 mM
MgCl2, 2 mM dithiothreitol, and 5 µg of
poly(dI·dC). 2 µl of radiolabeled oligonucleotide cassette was then
added, and the reactions were incubated 20 min at room temperature. The
products were separated by loading on a prerun 4% non-denaturing
polyacrylamide gel containing 2.5% glycerol and separated in 1 × TBE buffer at 150 volts at room temperature until the bromphenol blue
marker dye was approximately two-thirds of the way down the gel.
Controls, including AP2 oligonucleotides, were from the Promega gel
shift assay system. Gels were dried and exposed to BioMax MR
autoradiography film at
80 °C for up to 48 h.
RESULTS
View larger version (23K):
[in a new window]
Fig. 1.
Fatty acids enhance the expression of COX-2
in 184B5 mammary epithelial cells. 184B5 cells were grown until
they were approximately 70% confluent and then made quiescent as
described under "Experimental Procedures." The cells then were
treated with various fatty acids for 10 h, at which time extracts
were prepared and examined by immunoblotting using a monoclonal
antibody specific for COX-2 (see "Experimental Procedures").
Panel A, LA enhances the expression of COX-2. Cells were
exposed to the indicated concentrations of LA. The experiment shown is
representative of five. Panel B, a panel of fatty acids was
tested for their ability to enhance COX-2 expression. A dose-response
curve was performed for each fatty acid; the concentration shown is
that which was maximally effective: 18 µM LA, linoelaidic
acid (LEA), arachidonic acid (AA),
eicosapentaenoic acid (EPA), and eicosatetraynoic acid
(ETYA); 10.7 µM docosahexaenoic acid
(DHA). This result was obtained in two independent
experiments.
PGJ2, which are most potent in
other PPAR-mediated responses (14, 36, 37) (Fig.
2A). Of all the compounds that
we tested, 15
PGJ2 was the most potent, strongly
enhancing COX-2 expression at levels as low as 0.4 µM
(Fig. 2B). We also found that 15-HETE (Fig. 2A), 8-HETE, and 9- and 13-HODE stimulated COX-2 expression (not shown). PGE2, which is produced at relatively high levels by
mammary epithelial cells, did not alter COX-2 expression in these
cells. This pattern of COX-2 expression in response to prostaglandins
and HETEs supported the hypothesis that it occurred via a PPAR. As an
additional test of this, we treated cells with the PPAR agonist
WY-14,643 and found that it strongly stimulated COX-2 expression (Fig.
2C).
View larger version (24K):
[in a new window]
Fig. 2.
Peroxisome proliferators enhance COX-2
protein expression in mammary and colonic epithelial cells.
Quiescent 184B5 cells were treated with various peroxisomal
proliferators for 10 h, at which time extracts were prepared and
examined by immunoblotting using a monoclonal antibody specific for
COX-2 (see "Experimental Procedures"). Panel A, products
of COX-2 enhance its expression. A dose-response curve was performed
for each compound, and the concentration shown is that which was
maximally effective: 18 µM LA, 18 µM
PGA2, 74 µM PGD2, 3.6 µM 15 PGJ2, 74 µM
PGF2
, and 18 µM 15-HETE. The results shown
are representative of those obtained in two experiments. Panel
B, COX-2 expression is elevated by low levels of
15
PGJ2. Western blot analysis of COX-2 expression in
response to LA or increasing concentrations of 15
PGJ2 is
shown. The results are representative of those obtained in two
experiments. Panel C, the prototypical peroxisome
proliferator WY-14,643 enhances COX-2 expression. Western blot analysis
of COX-2 expression in response to 18 µM LA, 3.6 µM 15
PGJ2, and WY-14,643 is shown. The results are
representative of those obtained in six experiments.
NSAIDs function by inhibiting COX-1 and COX-2 and recently have been identified as peroxisome proliferators (24). We asked if inhibitors of COX would also induce its expression. We tested a panel of NSAIDs on both mammary epithelial cells and colonic epithelial cells and found that many of them strongly enhanced COX-2 expression in both cell types (Fig. 3). Particularly potent were the members of the fenamate family, meclofenamate and mefenamic acid. Ibuprofen, a commonly used NSAID, enhanced COX-2 expression as did NS-398, the first well characterized inhibitor that is highly selective for COX-2. Sulindac sulfide, which has been used in the prevention of colon cancer, strongly enhanced COX-2 expression in mammary epithelial cells, with much lesser effects in colonic epithelial cells. Although only CaCo-2 cells are shown, similar results were obtained in all four colonic epithelial cell lines that we examined. COX-1 expression was unaffected by NSAID treatment. Treatment with NSAIDs at these concentrations did not alter cell viability (n = 2, data not shown).
|
Peroxisome proliferators act by increasing the transcription of the genes that they regulate. If fatty acids, prostaglandins, and NSAIDs alter COX-2 expression through a PPAR, changes in COX-2 mRNA levels should correspond with changes in COX-2 protein levels. We examined the COX-2 mRNA over time in 184B5 cells treated with LA (Fig. 4A) and found that the levels rose markedly, reaching a maximum by 4 h after treatment. We also measured the change in COX-2 mRNA in CaCo-2 cells that had been treated with the panel of NSAIDs used for Western blot analysis (Fig. 4B). The same pattern of NSAIDs was found to enhance COX-2 mRNA expression as had increased protein levels, suggesting that the mechanism responsible for the increased expression was transcriptional. Actinomycin D inhibited COX-2 expression when used in combination with fatty acids, prostaglandins, and NSAIDs (Fig. 5, A and B), providing further evidence that their effects are transcriptional. Nuclear run-on assays validated this conclusion; in two separate experiments 18 µM LA enhanced COX-2 transcription in 184B5 cells 2.1- and 1.5-fold (COX-2/COX-1), whereas phorbol 12-myristate 13-acetate, which strongly stimulates COX-2 expression in these cells, enhanced transcription 4.9- and 2.1-fold.
|
|
We took two approaches to identify the portion of the COX-2 promoter
responsive to peroxisome proliferators. First, we isolated new, longer
regions of the COX-2 promoter than previously published, and we
sequenced approximately 7 kb. These clones contained a PPAR consensus
site (PPRE) at approximately 3900 bases upstream of the translational
start site (3900). We made reporter constructs that contained between
7 kb and 200 base pairs of the COX-2 promoter, the
3900 PPRE, or with
a reporter that contained the rat fatty ACO PPRE sequence (30, 31).
Cells were co-transfected with an expression plasmid for one of the
PPARs. The transfected cells then were stimulated with WY-14,643 or
vehicle for 72 h. Luciferase activity was measured and normalized
to co-transfected
-galactosidase. In cells containing the
3900
PPRE construct, luciferase activity increased 1.4-fold on treatment
with WY-14,643 (n = 6) (Fig.
6A). This response depended on
co-transfection with a PPAR, and, although modest, was highly
consistent between experiments. The experiments shown used an
expression plasmid for PPAR
, but essentially equivalent results were
obtained with either
or
(data not shown). In the second
approach, we performed gel shift experiments using nuclear lysate
obtained from COS-7 cells transfected with a PPAR and RXR
(Fig.
6B). As a positive control we used an oligonucleotide cassette for the ACO PPRE. Both the COX-2
3900 PPRE and the ACO PPRE
produced bands on gel shift. The ACO PPRE could be competed with cold
ACO PPRE but not with cold AP2. The COX-2
3900 PPRE could be competed
with cold COX-2 PPRE or ACO PPRE but not cold AP2, supporting the
hypothesis that this region of the COX-2 promoter is responsible for
binding PPAR/RXR heterodimers and therefore is responsible for
peroxisome proliferator-stimulated transcription of COX-2. To provide
further support that the shifted band was truly a PPAR·COX-2 PPRE
complex, we performed supershift experiments using both commercially
available antibodies as well as an anti-PPAR
antibody that we
prepared in house especially for this purpose. Although these
antibodies recognized the corresponding PPAR when used for
immunoblotting, none would supershift the PPAR·ACO PPRE complex used
as a positive control, and none was therefore useful for characterizing
the interaction between PPARs and the COX-2 PPRE.
|
![]() |
DISCUSSION |
---|
Much debate has surrounded the role of dietary fat as a risk factor for the development of cancer. Although diet is a relatively well established risk for colon cancer (5), the mechanism behind this risk has remained undefined. Further, studies examining the impact of dietary fat on breast cancer have been inconclusive. The studies described in this manuscript may help guide future studies addressing this long running debate by identifying a potential mechanism for the increased risk of cancer development due to dietary fat. Our studies show that components of dietary fat induce the expression of COX-2, a protein that has been closely tied to colon cancer (8-10), in mammary epithelial cells. The induction of the COX-2 gene by lipids was quite vigorous and occurred in response to a variety of fatty acids, many of which are found in a typical Western diet.
The regulation of COX-2 expression not only by fatty acids, but also by
its enzymatic products, demonstrates a rare feed-forward mechanism that
may be key in the pathogenesis of cancer. Dietary fat may act through a
PPAR to enhance COX-2 expression in one cell type, resulting in the
release of prostaglandins to the intercellular milieu. There, the
prostaglandins affect neighboring cells, resulting in enhanced COX-2
expression in these cells. Support for such a feed-forward mechanism is
found in the work of Oshima et al. (10) who examined
expression of COX-2 in the interstitial cells of mice
harboring a mutant APC (APC716). These mice develop
large numbers of intestinal polyps. They found COX-2, surprisingly, to
be localized in the interstitial cells of the murine intestine rather
than in the polyp epithelium where it is expressed in human colon.
Thus, expression measured in the polyp epithelium may actually
represent a second wave of COX-2 expression due to the
paracrine effect of prostaglandins released by the interstitial cells.
NSAIDs are among the most prescribed drugs in the United States. Although these drugs have many well known, longstanding uses, one of the more recent uses is as a colon cancer prophylactic. As demonstrated in this manuscript, NSAIDS have the dual role of inhibiting COX-2 activity while increasing its expression. No in vivo role has currently been defined for this increased COX-2 expression stimulated by NSAIDS. It is likely that NSAIDS would block the activity of the induced COX-2 enzyme as long as the treatment continued, and in such a case, there presumably would be no net effect. However, if NSAID treatment were discontinued, or were intermittent, the effect might be deleterious. For example, if the level of the COX-2 enzyme had been increased markedly by the drug and then it was discontinued, the result might be the exact opposite of the intended therapeutic effect. However, estimating the likelihood of this unfavorable outcome is complex because it depends on the rate at which the NSAID dissociates from COX-2, the t1/2 of the protein, and probably other variables. In vivo experiments will be necessary to assess whether the induction of COX-2 by NSAIDS can result in increased prostaglandin synthetic capacity under some circumstances.
It is interesting that COX-1 levels are not altered by treatment with NSAIDS, suggesting that the increase in COX-2 expression seen on treatment with NSAIDs is not a feedback mechanism designed to return prostaglandin production to a base-line level. Further, the different NSAIDS did not enhance COX-2 expression equally, although all were tested at concentrations sufficient to abolish prostaglandin formation. This result supports the hypothesis that enhanced COX-2 expression on treatment with NSAIDS is a direct effect mediated through a PPAR.
While this manuscript was in preparation, Staels et al. (38)
reported that activators of PPAR can inhibit the expression of a
variety of genes involved in the inflammatory response, including COX-2, in smooth muscle cells. These experiments used a
protocol in which the cells were treated with PPAR
activators and
then with interleukin-1; the PPAR activators had no effects by
themselves. One likely explanation for some of the differences between
our results and theirs is that our studies used epithelial cells, mammary and colon, whereas theirs were on vascular smooth muscle cells.
Moreover, their studies used our previously described 1.8-kb COX-2
promoter/reporter construct (9), which does not have a PPRE and which
we found to be unresponsive to the agonists described here. Staels
et al. (38) concluded that their results reflected a novel
mechanism in which PPAR
activation interfered with transcription mediated by nuclear factor-
B and not through a typical PPRE; our
work shows that the fatty acid, prostaglandin, and NSAID effects are
through a traditional PPAR/PPRE mechanism. It is feasible that both
mechanisms are involved in the regulation of COX-2
expression in response to peroxisome proliferators, and the predominant
response may be tissue-specific. Several studies examining the role of PPAR
in colon cancer were published at the time that this manuscript was submitted (39-41). In two of them, it was shown that selective activators of PPAR
increased the number and size of colon, but not
small intestinal, polyps in Min mice, which have a mutation in one allele of the APC gene (39, 40). The other study
reported the opposite effect of PPAR
on the growth of human colon
cancer cells transplanted into mice (41). In addition to measuring the
size and number of tumors, Lefebvre et al. (39) examined molecular events including whether COX-2 was induced in the
mouse adenomas. They also tested the effect of a PPAR
agonist on
COX-2 expression in HT-29 cells, a human colon carcinoma
cell line that we also examined. The activation of PPAR
did not
increase COX-2 expression in their experiments, either in mouse
adenomas in vivo or the human cells in culture. In contrast,
we found that COX-2 was induced in HT-29 and other colon
carcinoma cells in response to NSAIDS, which can activate PPAR
.
Taken together, we interpret these studies as showing two results:
activators of PPAR
can alter colon epithelial cell function in a
COX-2-independent manner, and activators of PPAR
(or
) induce
transcription of COX-2 in epithelial cells, which may be
relevant to carcinogenesis pathways in several organs. We found that
the promoter constructs of COX-2 which contained a presumed
PPRE were stimulated when a plasmid encoding any of the three human
isoforms was cotransfected. Thus, our studies do not establish whether
all of them mediate this action in vivo or whether it is a
more restricted response. The work of others (as above) suggests that
PPAR
is unlikely to serve as a trans-activator of the
COX-2 gene in the colonic epithelium.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Drs. Dan Dixon, Chris Maloney, and Bill Kutchera for helpful discussions.
![]() |
FOOTNOTES |
---|
* This work was supported by Department of Defense Grant DAMD 17-94-J-4259. The core facilities at the University of Utah are supported by Grant CA 42014 from the NCI, National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
This paper is dedicated to the memory of Jacques Maclouf, who made many contributions in this field. His generous nature was always evident in his willingness to share key reagents, such as the monoclonal antibodies used in these experiments.
§ To whom correspondence should be addressed: Huntsman Cancer Institute at the University of Utah, 15 N. 2030 East, Rm. 4220, Salt Lake City, UT 84112. Tel.: 801-585-3773; Fax: 801-585-6345; E-mail: stephen.prescott{at}hci.utah.edu.
2 Dixon, D. A., and Prescott, S. M. (1998) BioTechniques 24, 732-734.
![]() |
ABBREVIATIONS |
---|
The abbreviations used are: PG(s), prostaglandins; COX, cyclooxygenase; LA, linoleic acid; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; NSAIDs, non-steroidal anti-inflammatory drugs; RXR, retinoid X receptor; kb, kilobase(s); ACO, acyl-CoA oxidase; EGF, epidermal growth factor; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HETE, hydroxyeicosatetraenoic acid; HODE, hydroxyoctadecadienoic acid.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() |
---|