The Catalytic Mechanism of a Pyrimidine Dimer-specific
Glycosylase (pdg)/Abasic Lyase, chlorella virus-pdg*
John F.
Garvish
§ and
R. Stephen
Lloyd§¶
From
the Department of Microbiology and Immunology
and the § Sealy Center for Molecular Science, University of
Texas Medical Branch, Galveston, Texas 77555-1071
 |
ABSTRACT |
The repair of UV light-induced cyclobutane
pyrimidine dimers can proceed via the base excision repair pathway, in
which the initial step is catalyzed by DNA glycosylase/abasic (AP)
lyases. The prototypical enzyme studied for this pathway is
endonuclease V from the bacteriophage T4 (T4 bacteriophage pyrimidine
dimer glycosylase (T4-pdg)). The first homologue for T4-pdg has been found in a strain of Chlorella virus (strain
Paramecium bursaria Chlorella virus-1), which
contains a gene that predicts an amino acid sequence homology of 41%
with T4-pdg. Because both the structure and critical catalytic residues
are known for T4-pdg, homology modeling of the Chlorella
virus pyrimidine dimer glycosylase (cv-pdg) predicted that a conserved
glutamic acid residue (Glu-23) would be important for catalysis at
pyrimidine dimers and abasic sites. Site-directed mutations were
constructed at Glu-23 to assess the necessity of a negatively charged
residue at that position (Gln-23) and the importance of the length of
the negatively charged side chain (Asp-23). E23Q lost glycosylase
activity completely but retained low levels of AP lyase activity. In
contrast, E23D retained near wild type glycosylase and AP lyase
activities on cis-syn dimers but completely lost its
activity on the trans-syn II dimer, which is very
efficiently cleaved by the wild type cv-pdg. As has been shown for
other glyscosylases, the wild type cv-pdg catalyzes the cleavage at
dimers or AP sites via formation of an imino intermediate, as evidenced
by the ability of the enzyme to be covalently trapped on substrate DNA
when the reactions are carried out in the presence of a strong reducing
agent; in contrast, E23D was very poorly trapped on cis-syn
dimers but was readily trapped on DNA containing AP sites. It is
proposed that Glu-23 protonates the sugar ring, so that the imino
intermediate can be formed.
 |
INTRODUCTION |
UV light damages DNA through the formation of two types of
pyrimidine dimers: cyclobutane pyrimidine dimers and 6-4 photoproducts (1). One mechanism for the repair of the cyclobutane pyrimidine dimer
is the base excision repair pathway, which is initiated by a DNA
glycosylase/abasic (AP)1
lyase. Although many DNA-containing viruses that have sustained UV-induced DNA damage, use host cell enzymes to repair their DNA, the
bacteriophage T4 is unusual in that it encodes an enzyme, endonuclease
V (T4-pdg, pyrimidine dimer glycosylase), that cleaves the N-glycosyl
bond of the 5' thymine of the dimer and then subsequently cleaves the
phosphodiester backbone, producing a ring opened sugar as an
,
unsaturated aldehyde (2-4). T4-pdg has been characterized extensively
since its discovery over 40 years ago, and its structure and mechanism
of catalysis have been recently reviewed (5, 6).
The first eukaryotic homologue of T4-pdg has been found to be encoded
within the genome of an algal virus, Paramecium bursaria Chlorella virus-1. As a prelude to investigating
structure-function relationships in Chlorella virus
pyrimidine dimer glycosylase (cv-pdg), it is advantageous to utilize
molecular modeling tools to direct biochemical analyses. However, in
order to justify molecular modeling studies of a protein of which the
structure has not been determined by x-ray crystallography or NMR
spectroscopy, it is essential that the reference enzyme (T4-pdg): 1) be
highly homologous to the protein of interest (cv-pdg), 2) has had its
crystal structure solved as both the apoenzyme and as a complex with
substrate containing DNA, 3) has had the critical active site residues
established, and 4) recognize the same substrate and catalyze a similar
reaction mechanism. In this study, T4-pdg is ideally characterized to
serve as a homologous reference map for the study of cv-pdg, for the following reasons. First, the gene encoding cv-pdg predicts a protein
that has a 41% identity with T4-pdg (7). Additionally, homologous
genes from over 40 Chlorella virus genomes reveal a very
high degree of sequence
conservation.2 Second, the
crystal structure (9) and the co-crystal structure of T4-pdg with
cyclobutane pyrimidine dimer-containing DNA (10) have been solved at
high resolution. Third, two key residues have been identified in T4-pdg
to catalyze the combined glycosylase/AP lyase activity, in which the
-amino group of Thr-2 and Glu-23 act in concert to catalyze the
nucleophilic displacement reaction (11-17). Fourth, as originally
hypothesized for T4-pdg, cv-pdg has been hypothesized to initiate
repair by protonation on the damaged base followed by glycosidic bond
destabilization. This is followed by a nucleophilic attack at the C1'
of the deoxyribose sugar via a primary amine present in the protein
(18). Similar reaction mechanisms have been described for other enzymes
in the base excision repair pathway: formaminopyrimidine DNA
glycosylase (19, 20), MutY (21), and the human homologue of
endonuclease III (NTH1) (22).
Additionally, the initial characterization of the properties of cv-pdg
revealed that despite its high degree of sequence similarity with
T4-pdg, there were significant differences in the activities on
different isomers of the cyclobutane pyrimidine dimer (23). In contrast
to T4-pdg, cv-pdg was able to efficiently cleave the trans-syn II photoisomer, possibly suggesting a subtly
different active site or binding pocket.
Thus, with all of these available data, modeling studies and
electrostatic potential mapping have been carried out to predict the
structural similarities between T4-pdg and cv-pdg (23). In this study,
we investigated the catalytic mechanism of cv-pdg by using homology
modeling to design site-directed mutations to test the role of Glu-23
in both the glycosylase and AP lyase reactions on thymine dimers and AP sites.
 |
EXPERIMENTAL PROCEDURES |
Cloning of Chlorella Virus Pyrimidine Dimer Glycosylase--
The
cv-pdg gene (A50L) was PCR-amplified from the pUC19 vector
(7) to generate an NdeI site on the 5'-end and a
HindIII site on the 3' side. The PCR primers were
5'-CATATGACACGTGTGAATCTCGTACCGG-3' and
5'-AAGCTTAATTATTGCTGGTTTTAGCTTTCGTG-3'. This fragment was subcloned into the pET-lla vector (Stratagene) by the NIEHS Molecular Biology Core at the University of Texas Medical Branch under the supervision of Dr. Thomas G. Wood. PCR conditions can be obtained upon request.
Homology Model of cv-pdg Based on the Endonuclease V
Structure--
The amino acid sequence of T4-pdg was aligned with the
predicted amino acid sequence of the cv-pdg protein using the Look computer modeling package SegMod (Molecular Applications Group, Palo
Alto, CA). The SegMod algorithm can be briefly described as follows.
The cv-pdg sequence was divided into short segments, and these segments
were matched to fragments in the Brookhaven Protein Data Bank
structural data base. The fragments were combined into a framework
based on a template structure, in this case, the known structure of
T4-pdg (10). Multiple structures of the model were built and averaged
into a final structure, which was then stereochemically refined using
500 rounds of energy minimization. The RMS deviation of backbone atoms
relative to the T4-pdg structure was 1.6 Å.
The coordinates of the modeled cv-pdg structure were used to calculate
a relative electrostatic potential map using GRASP (24). The GRASP
Poisson-Boltzmann calculation used the following parameters: interior
dielectric constant, 2.0; exterior dielectric constant, 80; water probe
radius, 2.0; and salt concentration, 0.0. The relative potential values
were mapped onto the Connolly surface of the model. The same procedure
was followed with the T4-pdg structure for comparison with the modeled
cv-pdg protein.
Oligonucleotide Site-directed Mutagenesis of
cv-pdg--
Site-directed mutagenesis was carried out on the pET-11a
vector containing the cv-pdg gene using the Quikchange
mutagenesis kit (Stratagene). The sequence of the primers used to carry
out the mutagenesis of the cv-pdg gene were as follows:
5'-GCTTCGGAATCATCTTAAGGTCACGAAATTCTGCCATGAG-3' (E23D
cv-pdg), 5'-CTCATGGCAGAATTTCGTGACCTTAAGATGATTCCGAAGGC-3' (E23D cv-pdg),
5'-CTTCGGAATCATCTTAAGTTGACGAAATTCTGCCATGAGAT-3'(E23Q cv-pdg), and
5'-ATCTCATGGCAGAATTTCGTCAACTTAAGATGATTCCGAAG-3' (E23Q cv-pdg), where the mismatched nucleotides are underlined. PCR conditions are available upon request. Following the PCRs, the templates were digested with DpnI, and the PCR product was
visualized following separation on a 0.8% agarose gel and staining
with ethidium bromide. An aliquot of the PCR (4 µl) was used for
transformation into Supercompetent XL1 Blue bacterial cells
(Stratagene). After 1 h at 0 °C, the transformation reaction
was heat-shocked for 1 min at 42 °C. The cells were allowed to
recover for 1 h at 37 °C in 2X-YT medium (pH 7.0) (16 g of
bacto-tryptone, 10 g of bacto-yeast extract, 5 g of NaCl per
liter of deionized water). Cells were then plated out on LB plates that
contained 100 µg/ml ampicillin (amp). Plasmid preparations were
prepared from amp resistant colonies and analyzed by automated
sequencing (NIEHS Molecular Biology Core Facility) to confirm each mutation.
Purification of Chlorella Virus Pyrimidine Dimer Glycosylase
Mutants E23D and E23Q--
The purification scheme for the mutant
enzymes differed slightly from that previously described for the wild
type enzyme (7). After sequencing each mutated gene to ensure that the
only mutation generated was the mutation of interest, the plasmid was
introduced into E. coli BL21DE3, which is used for
expression from this plasmid. This cell is a DE3 lysogen in which the
gene for the T7 RNA polymerase has been inserted in the
int gene,
such that the lysogen remains stable. The T7 RNA polymerase gene is
induced by induction with isopropyl-1-thio-
-D-galactopyranoside. Cultures (2 liters) were grown in LB medium containing 100 µg/ml amp at 30 °C
for 6 h. Cells were pelleted by centrifugation at 4000 × g for 15 min at 4 °C and resuspended in Buffer A (50 mM Tris-HCl (pH 7.5), 2 mM EDTA, 5% glycerol,
5 mM dithiothreitol, 100 mM NaCl, and 0.6 M sucrose). The cells were broken using a French press at a
constant pressure of 9000 p.s.i. The lysates were cleared of
cellular debris by centrifugation at 8000 × g for 30 min at 4 °C. The cleared lysates were loaded onto two 60-ml tandem
Q-Sepharose-SP-Sepharose columns that had been previously equilibrated
with Buffer B (25 mM sodium phosphate (pH 7.5), 1 mM EDTA, 0.5 mM dithiothreitol, and 100 mM NaCl). The mutant cv-pdg proteins flowed through the Q-Sepharose but bound to the SP-Sepharose matrix and were eluted with a
linear gradient of Buffer B from 0.1 M to 1.0 M
NaCl (200 ml total volume). Fractions were collected and monitored by
Western blot analysis and Coomassie Brilliant Blue R-250 staining of
15% polyacrylamide-SDS gels. The fractions that contained the mutant cv-pdg proteins were pooled, dialyzed, and loaded onto a 25-ml single-stranded DNA cellulose column that had been equilibrated with
Buffer B. A linear gradient was run over the column of Buffer B from
0.1 M to 1.0 M NaCl (150 ml total volume).
Several fractions appeared to contain pure cv-pdg by Coomassie
Brilliant Blue staining and were subsequently analyzed via silver staining.
Qualitative in Vivo Assay of Mutant Enzyme
Activity--
E. coli strain AB2480 (uvrA,
recA
) containing the pET-11a vector with
either wild type cv-pdg, E23D cv-pdg, or E23Q cv-pdg was grown
overnight at 37 °C in LB medium containing 100 µg/ml amp. Aliquots
of these cultures were streaked onto an LB agar plate that also
contained 100 µg/ml amp. The liquid bacterial medium was allowed to
dry, and areas on the plate were irradiated with 254-nm light at 1.0 µW/cm2 for increasing amounts of time. Following
irradiation, the plates were incubated in the dark at 37 °C for
12 h.
Gel Mobility Shift Binding Assay--
The cis-syn
49-mer, trans-syn II 49-mer, reduced AP 49-mer, pyrrolidine
(P) 25-mer (5'-GGATAGTGTCCAPGTTACTCGAAGC-3'), and tetrahydrofuran (F)
25-mer (5'-GGATAGTGTCCAFGTTACTCGAAGC-3') were 5'-end-labeled with
[
-32P]ATP and annealed to the appropriate
complementary oligonucleotide with an adenine opposite the damaged
nucleotide. The reduced AP 49-mer was generated by the same method as
the AP 49-mer substrate except that subsequent to treatment with UDG,
the DNA was treated with 100 mM NaBH4 for 10 min at 25 °C. Binding of the E23D cv-pdg or E23Q cv-pdg was assessed
by gel mobility shift analysis. The reactions were conducted in a
20-µl total volume with the appropriate dilutions of the enzymes, and
20 pM substrate DNA duplexes in 25 mM
NaH2PO4 (pH 6.8), 100 mM NaCl, and
100 µg/ml bovine serum albumin and a 1000-fold weight excess of poly
dI:dC over the specific target DNA duplex. The reactions were incubated
for 30 min at 25 °C, followed by the addition of a one-half volume
of loading buffer (50% glycerol and 0.05% (w/v) bromphenol blue). The
free DNA was separated from the enzyme-bound DNA duplex by
electrophoresis through an 8% native polyacrylamide gel in 45 mM Tris borate (pH 7.5) 1 mM EDTA for 3 h
at 120 V. Free DNA and enzyme-bound DNA complexes were visualized by
autoradiography of the wet gels using Hyperfilm (Amersham Pharmacia
Biotech) x-ray film. The binding data was quantitated using a Molecular
Dynamics PhosphorImager and ImageQuant software (Sunnyvale, CA). The
data were plotted and fit to a hyperbolic curve function using
Kaleidagraph (Synergy Software, Reading, PA). The KD
values were determined to be the enzyme concentration at which 50% of
the substrate was shifted.
Dimer-specific Nicking Activities--
Oligonucleotides
(49-mers) containing either a site-specific cis-syn,
trans-syn I, or trans-syn II thymine dimer were
provided generously by Colin Smith and John-Stephen Taylor (Washington University, St. Louis, MO) with the sequence
5'-AGCTACCATGCCTGCACGAATTAAGCAATTCGTAATCATGGTCATAGCT3' (23, 25). The underlining shows the position of the dimer. These
DNAs were 32P-labeled on the 5'-end with T4 polynucleotide
kinase and annealed to an unlabeled complementary oligonucleotide. The
double stranded thymine dimer-containing 49-mer was diluted with
reaction buffer (25 mM NaH2PO4 (pH
6.8), 1 mM EDTA, 100 mM NaCl, and 100 µg/ml bovine serum albumin), and the appropriate concentrations of the T4-pdg, cv-pdg, E23D cv-pdg, or E23Q cv-pdg were added to the reactions
for 30 min at 37 °C. Incision reactions were terminated by the
addition of the loading buffer (95% (v/v) formamide, 20 mM
EDTA, 0.02% (w/v) bromphenol blue, and 0.02% (w/v) xylene cyanol). The reactions were subsequently treated with 1 M piperidine
and heated to boiling for 10 min. The purpose of the piperidine
treatment was to convert any abasic sites into single strand breaks.
The substrate DNAs were separated from the incision product DNAs by electrophoresis through a 15% denaturing polyacrylamide gel containing 8 M urea. The DNA bands were visualized by autoradiography
of the wet gels using Hyperfilm-MP x-ray film (Amersham Pharmacia Biotech).
AP Site-specific Nicking Activity--
A 49-mer oligonucleotide
containing a site-specific uracil was synthesized (Midland Research)
with the sequence
5'-AGCTACCATGCCTGCACGAAUTAAGCAATTCGTAATCATGGTCATAGCT-3'. The underlining shows the position of the uracil. This
uracil-containing 49-mer was 32P-labeled on the 5'-end with
T4 polynucleotide kinase and annealed to its complementary
oligonucleotide. The double stranded uracil-containing 49-mer was
incubated with uracil DNA glycosylase (Epicentre Technologies) for 10 min at 37 °C, generating an AP site. This oligonucleotide was then
diluted with reaction buffer (25 mM
NaH2PO4 (pH 6.8), 1 mM EDTA, 100 mM NaCl, and 100 µg/ml bovine serum albumin), and the
appropriate concentrations of the T4-pdg, cv-pdg, E23D cv-pdg, or E23Q
cv-pdg were added to the AP-containing DNA (30 min at 37 °C). The
reactions were analyzed as described above.
Covalent Trapping of Imino Intermediate Using Sodium
Borohydride--
Oligonucleotides containing either a
cis-syn thymine dimer or the abasic site were diluted to
obtain a final substrate concentration of 0.5 nM in the
reaction buffer described above. Reactions were initiated by the
simultaneous addition of 100 mM NaBH4 or 100 mM NaCl with 115 nM T4-pdg, cv-pdg, E23D
cv-pdg, or E23Q cv-pdg. In control experiments, the substrates were
preincubated with 100 mM NaBH4 or 100 mM NaCl for 5 min prior to addition of the enzymes. All
reactions were incubated for 30 min at 25 °C. Reactions were
terminated as described above, and the trapped complexes were separated
from free DNAs by electrophoresis through a 15% polyacrylamide 8 M urea denaturing gel.
 |
RESULTS |
Generation of Mutations at Glu-23 in cv-pdg and Protein
Purification--
Site-directed mutagenesis was carried out on the
pET-11a vector containing the cv-pdg gene using the
Quikchange mutagenesis kit (Stratagene) to introduce a codon change at
Glu-23 to create either a glutamine (E23Q) or an aspartic acid (E23D).
The cv-pdg genes were completely sequenced to verify the
identity at each nucleotide. These DNAs were transformed into E. coli BL21DE3 for expression. The mutant proteins were expressed
and purified as described under "Experimental Procedures." The
purity of the protein preparations was assessed by silver staining of a
15% polyacrylamide gel. E23Q cv-pdg (Fig.
1, lane 1), E23D cv-pdg
(lane 2), and wild type cv-pdg (lane 3) were
visible without any discernable contaminants.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 1.
SDS-polyacrylamide gel electrophoresis
analysis of cv-pdg, E23D cv-pdg, and E23Q cv-pdg after silver
staining. The left lane shows low range molecular mass
markers (Low MW marker). Lanes 1-3 show the pure
fractions of E23Q cv-pdg, E23D cv-pdg, and cv-pdg, respectively.
|
|
Relative UV Survival--
The ability of cv-pdg and the E23D and
E23Q mutants to enhance the survival of an E. coli strain
that is recombination and nucleotide excision repair-deficient
(uvrA
, recA
) was
determined by challenge with increasing doses of UV irradiation (Fig.
2). Plasmids containing the wild type and
mutant cv-pdg genes were transformed into E. coli
AB2480. Overnight cultures of these cells were streaked onto an agar
plate and either completely shielded from UV irradiation (Fig. 2,
lanes 1-4) or irradiated (lanes 5-8) for
increasing times. Cells that expressed cv-pdg (lane 5)
exhibited increased survival, whereas cells expressing the two mutants,
E23D and E23Q (lanes 6 and 7, respectively), had
survivals that were indistinguishable from cells that contained the
pET11a vector alone (lane 8). These results demonstrate that cv-pdg led to increased survival of UV challenged bacteria, whereas the
bacteria expressing cv-pdg mutants at Glu-23 resulted in no increased
survival following UV challenge.

View larger version (73K):
[in this window]
[in a new window]
|
Fig. 2.
In vivo complementation of
UV-irradiated repair-deficient E. coli by cv-pdg, E23D
cv-pdg, and E23Q cv-pdg. E. coli AB2480
(uvrA , recA ) cells containing
the pET-lla vector with cv-pdg (lanes 1 and 5),
E23D cv-pdg (lanes 2 and 6), or E23Q cv-pdg
(lanes 3 and 7) or vector alone (lanes
4 and 8) were grown to stationary phase and applied to
an agar plate containing 100 µg/ml amp. Cells in lanes 5-8 were
UV-irradiated with 254-nm light at 1 µW/cm2 for
increasing amounts of time from 0-35 s. Plates were then incubated for
12 h at 37 °C in the dark.
|
|
KD Determinations--
A possible explanation for the
decreased UV survival of cells expressing mutant forms of cv-pdg was
that these mutations altered pyrimidine dimer-specific binding. In
order to estimate relative binding affinities, dissociation constants
were determined for wild type and mutant enzyme on noncleavable
substrate analogues. For these determinations, gel mobility shift
analyses were chosen because this assay represents the standard method
that is used to estimate KD values for other
glycosylase/AP lyases in the base excision repair pathway,
i.e. endonuclease VIII (26), Fpg (27), endonuclease V (28),
and MutY (29). For these assays, it was necessary to use substrates
that are not catalytic substrates for these enzymes. Although
previously it had been demonstrated that T4-pdg and cv-pdg could not
incise DNAs containing reduced AP sites, tetrahydrofuran residues, or
pyrrolidine sites (23, 28), to ensure a complete lack of activity on
these substrates, cv-pdg, E23D cv-pdg, and E23Q cv-pdg were examined
for residual incision activity. The data in Fig.
3 show no activity for the enzyme
preparations on any of these three substrates.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 3.
Reactions using DNAs with damaged
oligonucleotides a reduced abasic site, pyrrolidine, or
tetrahydrofuran. Oligonucleotides containing centrally located
damage (A, reduced abasic site (49-mer); B,
pyrrolidine (25-mer); C, tetrahydrofuran (25-mer)) were
reacted with no enzyme (lane 1), cv-pdg (lane 2),
E23D cv-pdg (lane 3), or E23Q cv-pdg (lane 4) for
30 min at 37 °C. All enzymes were at 115 nM.
S represents the substrate band, and Sn
represents the nicked substrate (product) band. The reaction products
were separated by electrophoresis on a 15% polyacrylamide denaturing
gel containing 8 M urea.
|
|
Gel shift analyses were performed to determine the relative
dissociation constants for the wild type and mutant enzymes on noncleaveable substrates (Table I).
Labeled DNAs were incubated with increasing concentrations of enzymes
for 30 min at 25 °C and analyzed by native polyacrylamide gel
electrophoresis. The wild type cv-pdg showed comparable dissociation
constants to those determined for the E23D cv-pdg mutant on all of its
noncleavable DNA substrates. These data strongly suggest that the
decreased UV survival cannot be attributed to a loss of specific DNA
binding. However, the E23Q cv-pdg mutant was found to have a reduced
binding of 20-100-fold on all the substrates tested. These data
indicate that reduced affinity for specific substrates may
significantly contribute to reduced UV survival. In comparison, the
T4-pdg mutant E23Q did not exhibit significant loss in binding to these
noncleavable substrates, suggesting significant differences in the
details of the damage recognition site.
Pyrimidine Dimer Substrate Specificity--
To characterize the
dimer substrate specificity, in vitro incision assays were
used to determine the relative nicking activity of the wild type and
mutant cv-pdg enzymes on separate DNAs, each containing one of the
three isomers of the cyclobutane pyrimidine dimer, cis-syn,
trans-syn I, or trans-syn II. Seven
concentrations of T4-pdg, cv-pdg, and E23D cv-pdg were assessed for
activity on the cis-syn thymine dimer 49-mer (Fig.
4). To monitor every glycosylase event
and not only the combined glycosylase and concomitant AP lyase
activities, the reactions were treated with piperidine prior to
electrophoretic separation of substrates and nicked products. The
relative activity between these proteins can be compared by the enzyme
concentration that converted 50% of a 0.5 nM substrate into product in 30 min. These activity comparisons were made relative to the activity of the wild type cv-pdg on the cis-syn
49-mer (Table II). Wild type cv-pdg had a
relative activity of 0.09 nM, T4-pdg was 0.19 nM, and E23D cv-pdg was 0.60 nM. Additionally, when these experiments were carried out without the final piperidine treatment, no decrease in the amount of product DNA generated was
detected, suggesting that all the glycosylase activity was followed by
a concomitant AP lyase activity (data not shown). E23Q cv-pdg was found
to have no detectable activity on the cis-syn 49-mer, even
when the reaction time was increased from 30 min to 6 h (data not
shown). Consistent with this finding, the binding affinity of E23Q for
DNA containing a cis-syn dimer was very weak (400 nM.) (Table I), a value approaching the affinity for
undamaged DNA.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 4.
Cis-syn thymine dimer-specific
nicking. An oligonucleotide containing a cis-syn
thymine dimer (0.5 nM) was reacted with increasing
concentrations of T4-pdg (endonuclease V) (A), cv-pdg
(B), E23D cv-pdg (C), and E23Q cv-pdg
(D) for 30 min at 37 °C. S represents the DNA
substrate band, and Sn represents the nicked substrate
(product) band. Following the 30-min incubation, each reaction was
treated with piperidine to convert any DNAs containing AP sites to the
incised product band. The reaction products were separated by
electrophoresis on a 15% polyacrylamide denaturing gel containing 8 M urea. Lanes 1-7 are at 0, 0.094, 0.19, 0.37, 0.75, 1.5, and 3.0 nM for each enzyme except E23Q cv-pdg
(D), for which lanes 1 and 2 are 0 and
3.0 nM.
|
|
Additionally, five concentrations of T4-pdg, cv-pdg, and E23D cv-pdg
were analyzed for their activity on another isomer of the thymine
dimer, trans-syn II (Fig. 5).
Relative to the activities observed on the DNA containing the
cis-syn dimer, the activity on this substrate was reduced
for T4-pdg (6.0 nM) and cv-pdg (1.5 nM) (Table
I). However, the most significant differential effect was evident when
comparing the activities of the E23D cv-pdg enzyme on the
trans-syn II and cis-syn isomers, in which the
E23D cv-pdg lost all detectable activity on the trans-syn II
isomer (Fig. 5D). The E23Q cv-pdg showed no activity on the
trans-syn II dimers, data that are consistent with its lack
of activity on the cis-syn dimer (Fig. 4D).
Because cv-pdg mutants E23D and E23Q did not incise DNA containing the
trans-syn II dimer, relative binding affinities were
determined using this DNA as a substrate (Table I). The E23D mutant
bound with a 1.5 nM affinity (Fig.
6) and yet was unable to cleave this
substrate. The E23Q mutant displayed a significantly weaker affinity at
130 nM (Table I).

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 5.
Trans-syn II thymine
dimer-specific nicking activity. An oligonucleotide containing a
trans-syn II thymine dimer (0.5 nM) was reacted
with increasing concentrations of T4-pdg (B), cv-pdg
(C), and E23D cv-pdg (D) for 30 min at 37 °C.
A shows control trans-syn II dimer DNA without
the addition of any enzyme. B-D (lanes 1-5)
show reactions at 0.37, 0.75, 3.0, 12.0, and 48.0 nM,
respectively, for each enzyme. S represents the substrate
band, and Sn represents the nicked substrate (product) band.
The reaction products were separated by electrophoresis on a 15%
polyacrylamide denaturing gel containing 8 M urea.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 6.
Gel Shift of E23D cv-pdg on trans-syn
II 49-mer. A, oligonucleotides containing a
trans-syn II thymine dimer (20 pM) were
incubated with increasing concentrations of E23D cv-pdg for 30 min at
25 °C. The products were separated by electrophoresis through an 8%
native polyacrylamide gel. The wet gels were visualized on x-ray film,
and the substrate and product bands were quantitated using a Molecular
Dynamics PhosphorImager and ImageQuant software. B, the data
were plotted using Kaleidgraph software, and the KD
was determined by fitting the data to a hyperbolic function, plotting
percentage shifted versus enzyme concentration, and
determining the enzyme concentration that resulted in a 50% substrate
shift.
|
|
T4-pdg, cv-pdg, E23D cv-pdg, and E23Q cv-pdg were also examined for
activity on a third thymine dimer isomer, trans-syn I. Because it had been previously reported that this preparation of
trans-syn I dimer was contaminated with 1-2%
cis-syn dimer (23), when each of the enzymes were reacted
with this substrate, approximately 5% of the DNAs were incised (Fig.
7A). These data were
consistent with incision at the cis-syn contaminant and not the trans-syn I substrate. However, to confirm this
interpretation, kinetic experiments were carried out at a very high
enzyme concentration (175 nM) (Fig. 7B). These
results demonstrated no increase in product DNAs beyond that observed
in Fig. 7A. Taken together, these data suggest that T4-pdg,
cv-pdg, and E23D cv-pdg do not have substantial activity on DNA
containing the trans-syn I isomer.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 7.
Trans-syn I thymine dimer-specific
nicking activity. An oligonucleotide containing a trans-syn
I thymine dimer (0.5 nM) was reacted with increasing
concentrations of T4-pdg, cv-pdg, and E23D cv-pdg for 30 min at
37 °C. A, lane 1, control trans-syn I dimer
with no added enzyme; lanes 2-4, T4-pdg; lanes
5-7, cv-pdg; lanes 8-10, E23D cv-pdg; each at 12, 48, and 192 nM, respectively. B shows a kinetic
analysis of incision of DNA containing trans-syn I dimer
(0.5 nM) with T4-pdg (115 nM) (lanes
2-5) and cv-pdg (115 nM) (lanes 6-9).
Time points were taken at 0, 1, 2, 4, and 6 h, for T4-pdg and
cv-pdg (lanes 2-5 and 6-9, respectively).
S represents the substrate DNA band, and Sn
represents the nicked substrate (product) band. The reaction products
were separated by electrophoresis on a 15% polyacrylamide denaturing
gel containing 8 M urea.
|
|
AP Site-specific Nicking Activity on Synthetic
Oligonucleotides--
In order to determine the ability of T4-pdg,
cv-pdg, E23D cv-pdg, and E23Q cv-pdg to incise DNA at AP sites, an
AP-containing oligonucleotide was prepared as described under
"Experimental Procedures." This 32P-labeled duplex
AP-containing 49-mer (0.5 nM) was incubated with seven
concentrations of the pure enzymes for 30 min at 25 °C (Fig. 8). The relative activities of T4-pdg
(0.15 nM), cv-pdg (0.17 nM), and E23D cv-pdg
(0.18 nM) on the AP-containing 49-mer were very consistent,
whereas the E23Q cv-pdg mutant, which had no activity on DNA containing
cyclobutane dimers (Fig. 4D), had very low activity (>115
nM) (Table II and Fig.
9A). This approximately 1000-fold decreased activity of the E23Q cv-pdg mutant, relative to
either of the two wild type enzymes, was confirmed by kinetic experiments (Fig. 9B).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 8.
AP site-specific nicking. An
oligonucleotide containing an abasic site (0.5 nM) was
reacted with increasing concentrations of T4-pdg (A), cv-pdg
(B), E23D cv-pdg (C), and E23Q cv-pdg
(D) for 30 min at 25 °C. The concentrations of T4-pdg and
cv-pdg were 0, 0.023, 0.047, 0.094, 0.19, 0.37, and 0.75 nM
for lanes 1-7, respectively; concentrations of E23D cv-pdg
were 0, 0.047, 0.094, 0.19, 0.37, 0.75, and 1.5 nM for
lanes 1-7, respectively; and concentrations of E23Q cv-pdg
were 0 and 1.5 nM, for lanes 1 and 2, respectively. S represents the substrate DNA band, and
Sn represents the nicked substrate (product) band. The
reaction products were separated by electrophoresis on a 15%
polyacrylamide denaturing gel containing 8 M urea.
|
|

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 9.
E23Q cv-pdg incision of a synthetic
oligonucleotide containing an abasic site. An oligonucleotide
containing an abasic site (0.5 nM) was reacted with
increasing concentrations of E23Q cv-pdg for 30 min at 25 °C.
A, lanes 1-6 show increasing concentrations of E23Q cv-pdg
0, 57.5, 115, 172.5, 230, and 287.5 nM, respectively. Due
to the relatively high enzyme concentration necessary to achieve a
small amount of nicked substrate, a kinetic experiment (B)
was carried out in which 0.5 nM DNA was reacted with 115 nM E23Q cv-pdg for increasing amounts of time. Lane
1 shows the reaction at 0 h, and lanes 2-7 show
the DNA products at 0.5, 1, 2, 3, 4, and 5 h, respectively.
S represents the substrate DNA band, and Sn
represents the nicked substrate (product) band. The reaction products
were separated by electrophoresis on a 15% polyacrylamide denaturing
gel containing 8 M urea.
|
|
Covalent Trapping of the Imino Intermediate via
NaBH4--
Previously, it was determined that other
glycosylase/AP lyases that function in the base excision repair pathway
are able to cleave the phosphodiester backbone via a
-elimination
reaction through the formation of an imino intermediate (17, 30). In support of this conclusion was the ability of these enzymes to be
covalently trapped on DNAs containing pyrimidine dimers and abasic
sites when reactions were carried out in the presence of a strong
reducing agent, NaBH4. Thus, the ability to form and trap
this imino intermediate was assessed for all the enzymes on both the
cis-syn- and AP site-containing 49-mers (Fig.
10, A and B,
respectively). The reactions shown in the first lane of each enzyme
grouping (Fig. 10, A, lanes 2, 5, 8, and 12, and
B, lanes 2, 5, 8, and 11) were conducted such
that the NaBH4 and the appropriate enzyme at 115 nM were simultaneously added to the substrate DNA. The
trapped complexes were observed as having reduced mobility due to the
enzyme-DNA covalent linkage upon NaBH4 reduction.
Significant amounts of trapped complexes were evident for T4-pdg and
cv-pdg, whereas a small amount of trapped complex was visible for the
E23D cv-pdg mutant on the cis-syn 49-mer. No trapped complex
was evident for the E23Q cv-pdg mutant. The DNAs shown in the second
lane of each enzyme grouping (Fig. 10, A, lanes 3, 6, 9, and
13, and B, lanes 3, 6, 9, and 12) show
the data from experiments in which the substrates were preincubated with 100 mM NaBH4 for 5 min prior to the
addition of enzyme. This preincubation step did not significantly
affect the amount of pyrimidine dimer trapped complex seen as an
altered mobility in the gel for the T4-pdg and cv-pdg, whereas no
trapped complexes were observed for either the E23D or E23Q cv-pdg
mutant.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 10.
Covalent trapping on cis-syn
dimer and AP site containing DNA. DNAs containing either a
centrally located cis-syn thymine dimer (0.5 nM)
(A) or a centrally located abasic site (0.5 nM)
(B) were incubated with 115 nM of T4-pdg,
cv-pdg, E23D cv-pdg, and E23Q cv-pdg. DNAs were either preincubated
with 100 mM NaBH4 for 5 min prior to addition
of the enzyme or added simultaneously with the enzyme. Reactions were
incubated for 30 min at 25 °C. S represents the substrate
DNA band, Sn represents the nicked substrate (product) band,
and E-S represents the enzyme DNA covalent complex.
|
|
When the abasic site containing 49-mer was used as a substrate, T4-pdg,
cv-pdg, and E23D cv-pdg were all trapped, a result consistent with the
incision data (Fig. 10B). No trapped complex appeared with
the E23Q cv-pdg mutant. Also as expected, preincubation of the
AP-containing DNA with NaBH4 resulted in an inability to trap covalent complexes when the enzymes were added after the 5 min
preincubation. During the initial 5-min incubation, all AP sites were
reduced and thus not subject to covalent trapping by NaBH4.
The remainder of the experiments were controls to show activity on the
cis-syn and AP site containing 49-mers.
 |
DISCUSSION |
In the initial description of cv-pdg, Chlorella cells
that were infected with Paramecium bursaria
Chlorella virus-1 were found to have dimer-specific nicking
activity similar to the activity exhibited by T4-pdg (7, 23). The 41%
amino acid identity between these two enzymes, as well as a basic
similarity in substrate activity, led to the formation of a structural
model for cv-pdg based on the x-ray crystal structures of T4-pdg and
T4-pdg bound to a dimer-containing oligonucleotide. Through analysis of
this structural model, site-directed mutants were designed to examine the catalytic mechanism of cv-pdg. Due to the proximity of Glu-23 to
the dimer in the modeled structure and the mechanistic information available about other glycosylase/AP lyases, this residue was hypothesized to serve as the acidic residue necessary for glycosidic bond destabilization. This allows the C1' of the deoxyribose sugar of
the 5' pyrimidine to become vulnerable to attack from a primary or
secondary amine. Mutations in cv-pdg were designed to assess the
necessity of the acidic charge at this position (E23Q) and the
importance of side chain positioning in the active site (E23D).
Initially, the wild type and mutant cv-pdg enzymes were assessed for
their ability to enhance the survival of recombinational repair and
nucleotide excision repair deficient E. coli. Wild type
cv-pdg enhanced survival over that of the plasmid alone, whereas both
of the mutants resulted in survival levels corresponding to that seen
with the plasmid alone. The inability of either the E23D or E23Q cv-pdg
mutants to enhance survival of repair-deficient E. coli are
consistent with the results obtained when the same mutations were
created in T4-pdg. However, this lack of biological activity is not
completely consistent with the relative in vitro activities
of the E23D mutants of cv-pdg versus T4-pdg, in which the
cv-pdg mutant retained substantial cis-syn dimer-specific nicking activity. An understanding of this difference may lie in the
differential specific activities of the two mutants. Although similar
differences in in vitro versus in vivo
activities have been previously observed for mutants of T4-pdg that
affect nontarget binding, there is no indication that the E23D cv-pdg
mutant has been affected in the mechanism of target site location
(31-33). However, these differential survivals provided the first
evidence that Glu-23 was going to be critical for the activity of this enzyme. This led us to perform a number of more sensitive in
vitro assays to determine the relative binding and activity of the
wild type and mutant proteins on various isomers of thymine dimers and
abasic sites.
The E23Q mutant was inactive on all thymine dimer-containing substrates
tested. This result indicates that the acidic nature at Glu-23 is
critical to thymine dimer-specific nicking activity, although a
confounding factor in this analysis was that dimer-specific DNA binding
was greatly reduced in this mutant. However, the overall fold of E23Q
cv-pdg is probably correct because it did have some very minor activity
on AP site-containing DNA; however, even this activity could be
attributed to the presence of various basic residues on the face of
this DNA binding enzyme in close proximity to the AP site. Similar
observations have been made for DNA ligase on AP-containing DNAs
(8).
The E23D cv-pdg mutant exhibited very similar activity on AP-containing
DNA to both the wild type cv-pdg and the T4-pdg controls. The activity
seen on the cis-syn isomer of the thymine dimer was only
slightly diminished for E23D when compared with native cv-pdg. This is
in stark contrast to the results observed for the E23D T4-pdg mutant,
which has less than 1% of the activity of the wild type T4-pdg (15).
This could possibly be explained by a more flexible active site,
initially hypothesized by McCullough et al. (23), based on
the broader substrate specificity seen for cv-pdg relative to T4-pdg.
An additional interesting feature of the E23D cv-pdg mutant was that it
had no detectable activity on the trans-syn II isomer,
whereas the wild type cv-pdg and T4-pdg had slightly diminished
activity when compared with the cis-syn isomer. The
trans-syn II thymine dimer has the 3' thymine of the dimer
flipped trans, which might alter the positioning of the 5'
thymine due to steric considerations. Taking into consideration that
these enzymes perform their chemistry on the 5' thymine of the dimer,
this could help to explain the activity results obtained for the wild
type and E23D cv-pdg. The relative activity between the
cis-syn dimer and the trans-syn II isomer for
cv-pdg shows approximately a 16-fold decrease. This decrease could
result from a slight alteration in the active site geometry. The lack
of activity of the E23D cv-pdg mutant on the DNA containing
trans-syn II dimers may simply reflect that by shortening
the side chain by one carbon, the carboxyl side chain can no longer
facilitate glycosyl bond scission but is still appropriately positioned
to catalyze the
-elimination reaction. In the case of the
trans-syn I isomer, the 5' thymine is moved into a
trans position. The 5' thymine being in a significantly
different position could account for the lack of activity of any of
these glycosylase/AP lyases, as well as their mutants.
Binding studies were performed to ensure that the mutants that had lost
activity had not lost the ability to bind to the DNA. The E23D cv-pdg
mutant bound to a trans-syn II dimer with a dissociation constant that showed tighter affinity than that observed for cv-pdg bound to a cis-syn thymine dimer or some of the noncleavable
substrates. These data indicate that the inability to incise the DNA at
trans-syn II dimers was not a result of a decreased binding
to the substrate DNA. The E23D cv-pdg enzyme was able to bind to all
noncleavable substrates with approximately equal affinity. These
affinities were significantly tighter than that measured for the E23D
T4-pdg binding to noncleavable substrates, thus supporting the
hypothesis that the active site for cv-pdg may be more flexible.
In the reaction mechanism hypothesized for glycosylase/AP lyases in the
base excision repair pathway, there is a combined action requiring an
acidic residue and a primary amine. It is hypothesized that Glu-23 is
the acidic residue that contributes to glycosidic bond destabilization,
functioning either at the ring oxygen of the deoxyribose sugar or the
C2 of the thymine. Following this destabilization, a primary amine
catalyzes a nucleophilic displacement reaction at the C1' of the
deoxyribose sugar. In this reaction mechanism, the enzyme DNA complex
forms an imino intermediate, which would be reduced to a covalent
complex in the presence of a strong reducing agent. Relevant to these
hypotheses, the E23Q cv-pdg mutant could not be trapped on either a
cis-syn dimer-containing DNA or an abasic site-containing
DNA, suggesting that the acidic character at this position is essential
to facilitate the reaction mechanism. The E23D cv-pdg mutant could be
trapped on the abasic site-containing DNA to levels approximately the same as those of the wild type cv-pdg and T4-pdg. However, the ability
to form a trapped complex for the E23D cv-pdg mutant was significantly
reduced when compared with cv-pdg. This result is somewhat surprising,
but it may be due to the decrease in the activity that is seen between
these two enzymes.
The site-directed mutations that were examined in this study give
significant insight into the mechanism of this glycosylase/AP lyase. It
is evident that the presence of a carboxylate-containing side chain at
the 23rd position is essential to both the glycosylase and the AP lyase
activities of this enzyme. There must be a relatively flexible active
site in this enzyme as the E23D mutant retains activity on a
cis-syn thymine dimer and an abasic site. The ability to
trap the wild type cv-pdg and the E23D cv-pdg mutant onto the DNA
through the formation of a covalent complex using a strong reducing
agent suggests that this glycosylase AP lyase follows the mechanism
hypothesized for T4-pdg (17).
 |
ACKNOWLEDGEMENTS |
We thank Drs. J. S. Taylor and C. Smith
(Washington University, St. Louis, MO) for their generous gift of
synthetic oligonucleotides containing site-specific cis-syn,
trans-syn I, and trans-syn II thymine dimers. We
thank Drs. F. Johnson and A. Grollman (State University of New York,
Stony Brook, NY) for providing the synthetic oligonucleotide containing
tetrahydrofuran. The pyrrolidine-containing oligonucleotide was
provided by Drs. O. Scharer and G. L. Verdine (Harvard
University). The initial amino acid sequence alignment and molecular
modeling studies were carried out by Dr. M. L. Dodson. The DNA
sequencing and oligonucleotide synthesis was performed by the NIEHS,
National Institutes of Health, Molecular Biology Core under the
direction of Dr. T. G. Wood, and the T4-pdg was purified by
J. R. Carmical.
 |
FOOTNOTES |
*
This work supported by NIEHS, National Institutes of Health
Grants T327254, ES04091, and ES06676.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Holder of the Distinguished Chair for Environmental Toxicology
from the Houston Endowment. To whom correspondence should be addressed:
Sealy Center for Molecular Science, University of Texas Medical Branch,
301 University Blvd., Galveston, TX 77555-1071. Tel.: 409-772-2179;
Fax: 409-772-1790; E-mail: rslloyd{at}utmb.edu.
2
J. Van Etten, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
AP, abasic;
T4-pdg, T4 bacteriophage pyrimidine dimer glycosylase;
cv-pdg, Chlorella virus pyrimidine dimer glycosylase;
amp, ampicillin;
PCR, polymerase chain reaction.
 |
REFERENCES |
-
Wang, S. Y.
(ed)
(1976)
Photochemistry and Photobiology of Nucleic Acids, Vol. I, pp. 169-225, Academic Press, New York
-
Kim, J.,
and Linn, S.
(1988)
Nucleic Acids Res.
16,
1135-1141[Abstract]
-
Manaharan, M.,
Mazumder, A.,
Ransom, S. C.,
and Gerlt, J. A.
(1988)
J. Am. Chem. Soc.
110,
2690-2691
-
Bailey, V.,
Sente, B.,
and Verly, W. G.
(1989)
Biochem. J.
259,
751-759[Medline]
[Order article via Infotrieve]
-
Lloyd, R. S.
(1998)
Mutat. Res.
408,
159-170[Medline]
[Order article via Infotrieve]
-
Lloyd, R. S.
(1999)
Prog. Nucleic Acid Res. Mol. Biol.
62,
155-175[Medline]
[Order article via Infotrieve]
-
Furuta, M.,
Schrader, J. O.,
Schrader, H. S.,
Kokjohn, T. A.,
Nyaga, S.,
McCullough, A. K.,
Lloyd, R. S.,
Burbank, D. E.,
Landstein, D.,
Lane, L.,
and Van Etten, J. L.
(1997)
Appl. Environ. Microbiol.
63,
1551-1556[Abstract]
-
Bogenhagen, D. F.,
and Pinz, K. G.
(1998)
J. Biol. Chem.
273,
7888-7893[Abstract/Free Full Text]
-
Morikawa, K.,
Matsumoto, O.,
Tsujimoto, M.,
Katayanagi, K.,
Ariyoshi, M.,
Doi, T.,
Ikehara, M.,
Inaoka, T.,
and Ohtsuka, E.
(1992)
Science
256,
523-526[Medline]
[Order article via Infotrieve]
-
Morikawa, K.,
Ariyoshi, M.,
Vassylyev, D. G.,
Matsumoto, O.,
Katayanagi, K.,
and Ohtsuka, E.
(1995)
J. Mol. Biol.
249,
360-375[CrossRef][Medline]
[Order article via Infotrieve]
-
Schrock, R. D., III,
and Lloyd, R. S.
(1991)
J. Biol. Chem.
266,
17631-17639[Abstract/Free Full Text]
-
Schrock, R. D., III,
and Lloyd, R. S.
(1993)
J. Biol. Chem.
268,
880-886[Abstract/Free Full Text]
-
Doi, T.,
Recktenwald, A.,
Karaki, Y.,
Kikuchi, M.,
Morikawa, K.,
Ikehara, M.,
Inaoka, T.,
Hori, N.,
and Ohtsuka, E.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
9420-9424[Abstract]
-
Hori, N.,
Doi, T.,
Karaki, Y.,
Kikuchi, M.,
Ikehara, M.,
and Ohtsuka, E.
(1992)
Nucleic Acids Res.
20,
4761-4764[Abstract]
-
Manuel, R. C.,
Latham, K. A.,
Dodson, M. L.,
and Lloyd, R. S.
(1995)
J. Biol. Chem.
270,
2652-2661[Abstract/Free Full Text]
-
Dodson, M. L.,
Schrock, R. D., III,
and Lloyd, R. S.
(1993)
Biochemistry
32,
8284-8290[Medline]
[Order article via Infotrieve]
-
Dodson, M. L.,
Michaels, M. L.,
and Lloyd, R. S.
(1994)
J. Biol. Chem.
269,
32709-32712[Free Full Text]
-
McCullough, A. K.,
Dodson, M. L.,
Scharer, O. D.,
and Lloyd, R. S.
(1997)
J. Biol. Chem.
272,
27210-27217[Abstract/Free Full Text]
-
Zharkov, D. O.,
Rieger, R. A.,
Iden, C. R.,
and Grollman, A. P.
(1997)
J. Biol. Chem.
272,
5335-5341[Abstract/Free Full Text]
-
Tchou, J.,
and Grollman, A. P.
(1995)
J. Biol. Chem.
270,
11671-11677[Abstract/Free Full Text]
-
Zharkov, D. O.,
and Grollman, A. P.
(1998)
Biochemistry
37,
12384-12394[CrossRef][Medline]
[Order article via Infotrieve]
-
Ikeda, S.,
Biswas, T.,
Roy, R.,
Izumi, T.,
Boldogh, I.,
Kurosky, A.,
Sarker, A. H.,
Seki, S.,
and Mitra, S.
(1998)
J. Biol. Chem.
273,
21585-21593[Abstract/Free Full Text]
-
McCullough, A. K.,
Romberg, M. T.,
Nyaga, S.,
Wei, Y.,
Wood, T. G.,
Taylor, J. S.,
Van Etten, J. L.,
Dodson, M. L.,
and Lloyd, R. S.
(1998)
J. Biol. Chem.
273,
13136-13142[Abstract/Free Full Text]
-
Nicholls, A.,
Sharp, K.,
and Honig, B.
(1991)
Proteins Struct. Funct. Genet.
11,
281-296[Medline]
[Order article via Infotrieve]
-
Smith, C. A.,
and Taylor, J.-S.
(1993)
J. Biol. Chem.
268,
11143-11151[Abstract/Free Full Text]
-
Jiang, D.,
Hatahet, Z.,
Melamede, R. J.,
Kow, Y. W.,
and Wallace, S. S.
(1997)
J. Biol. Chem.
272,
32230-32239[Abstract/Free Full Text]
-
Castaing, B.,
Boiteux, S.,
and Zelwer, C.
(1992)
Nucleic Acids Res.
20,
389-394[Abstract]
-
McCullough, A. K.,
Scharer, O.,
Verdine, G. L.,
and Lloyd, R. S.
(1996)
J. Biol. Chem.
271,
32147-32152[Abstract/Free Full Text]
-
Manuel, R. C.,
and Lloyd, R. S.
(1997)
Biochemistry
36,
11140-11152[CrossRef][Medline]
[Order article via Infotrieve]
-
Scharer, O. D.,
Deng, L.,
and Verdine, G. L.
(1997)
Curr. Opin. Chem. Biol.
1,
526-531[CrossRef][Medline]
[Order article via Infotrieve]
-
Dowd, D. R.,
and Lloyd, R. S.
(1989)
Biochemistry
28,
8699-8705[Medline]
[Order article via Infotrieve]
-
Dowd, D. R.,
and Lloyd, R. S.
(1990)
J. Biol. Chem.
265,
3424-3431[Abstract/Free Full Text]
-
Dowd, D. R.,
and Lloyd, R. S.
(1990)
J. Mol. Biol.
208,
701-707
Copyright © 1999 by The American Society for Biochemistry and Molecular Biology, Inc.