From the Institute of Biochemistry, National Taiwan
University, College of Medicine, Taipei, Taiwan, Republic of China and
¶ Department of Microbiology and Immunology, Chang Gung
University, Tao-Yuan, Taiwan, Republic of China
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
It has been reported that the polypeptide of
thymidine kinase type 1 (TK1) from human and mouse cells can be
modified by phosphorylation. Our laboratory has further shown that the
level of human TK phosphorylation increases during mitotic arrest in
different cell types (Chang, Z.-F., Huang, D.-Y., and Hsue, N.-C.
(1994) J. Biol. Chem. 269:21249-21254). In the
present study, we demonstrated that a mutation converting Ser13 to Ala abolished the mitotic phosphorylation of
native TK1 expressed in Ltk cells. Furthermore, we
expressed recombinant proteins of wild-type and mutated human TK1 with
fused FLAG epitope in HeLa cells, and confirmed the occurrence of
mitotic phosphorylation on Ser13 of hTK1. By using an
in vitro phosphorylation assay, it was shown that wild-type
hTK1, but not mutant TK1Ala13, could serve as a good
substrate for Cdc2 or Cdk2 kinase. Coexpression of
p21waf1/cip1, which is a universal inhibitor of Cdk kinases, in
Ltk
fibroblasts also suppressed mitotic phosphorylation
of hTK1 expressed in this cell line. Thus, Cdc2 or related kinase(s) is
probably involved in mitotic phosphorylation on Ser13 of
the hTK1 polypeptide. We also found that mutation on Ser13
did not affect the functional activity of hTK1. As the sequences around
Ser13 are highly conserved in vertebrate TK1s, we speculate
that phosphorylation of Ser13 may play a role in the
regulation of TK1 expression in the cell cycle.
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Thymidine kinase (TK)1 is an enzyme that catalyzes the transfer of the terminal phosphate of ATP to the 5'-hydroxyl group of thymidine to form dTMP, which is the salvage pathway for dTTP synthesis. In eukaryotic cells, there are two TK isoenzymes: TK1 and TK2, also called cytosolic and mitochondrial TK, respectively. The amount of cytosolic TK1 is increased significantly in cells during transition from G1 to S phase (1, 2), whereas the expression level of TK2 is low and is controlled in a cell cycle-independent manner (3, 4). TK1 is highly expressed in dividing or malignant cells, but is absent in quiescent cells (5-8), and its expression is stringently regulated in normal cells, but not in malignant cells (9, 10).
Studies on TK1 regulation have provided a good model for understanding the molecular events that coordinate progression through the cell cycle. It is well documented that the transcriptional and translational activation of TK1 gene expression leads to elevation of its activity in the G1/S phase (11-18). In addition, other lines of evidence have shown that the C-terminal region of the TK1 polypeptide may determine its stability in cells in different growth states, indicating that cell cycle-dependent degradation is also involved in the regulation of TK1 expression (19-21). Thus, it is clear that multiple levels of control regulate TK1 expression in eukaryotic cells.
Our laboratory has previously reported that TK1 can be phosphorylated
in human promyeloleukemia cells in response to growth stimulation (22).
The phosphorylated form of TK1 was also detetected by isoelectric
focusing gel analysis of TK1 purified from mouse Ehrlich ascites tumor
cells (23). The regulation of TK1 phosphorylation was investigated
further during the cell cycle. When cells were M phase-arrested by
treatment with nocodazole, a microtubule-depolymerizing drug, TK1
became hyperphosphorylated in HL-60, K562, and HeLa cells (24).
Phosphoaminoacid analysis of immunoprecipitated human TK1 polypeptide
indicated that serine is the residue involved in mitotic
phosphorylation (22, 24). Amino acid sequence analysis reveals that
several potential phosphorylation sites exist for a variety of
serine/threonine protein kinases, including cAMP-dependent protein kinase at serine 194, cyclin-dependent kinase(s) at
serine 13 and serine 231, and protein kinase C at serine 30. In this study, we examined the specific phosphorylated site for human TK1 in
mitotically arrested TK-deficient mouse Ltk fibroblasts
and human carcinoma HeLa cells, and we identified the kinase
responsible for the mitotic phosphorylation of hTK1. The physiologic
role of the mitotic phosphorylation of hTK1 was also investigated.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cell Cultures and M-phase Arrest--
TK-deficient mouse
Ltk connective fibroblasts and HeLa cells were maintained
in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10%
fetal bovine serum. For M-phase arrest, nocodazole (NOC) was added to
subconfluent Ltk
cells at a final concentration of 0.5 µg/ml for 17 h.
Site-directed Mutagenesis--
The
ScaI-BamHI restriction fragment containing
cDNA of the human TK1 (hTK1) gene (25) was treated with Klenow
enzyme and cloned into the EcoRV site of pBluescript SK()
(Stratagene), yielding pBsTK. pBsTK was used as a template for
site-directed mutagenesis as described by Deng and Nickoloff
(26). The following primers were synthesized: primer 1, CTGCCCGGCGCCCCCAGCAAGACCCGGGGG; and primer 2, CAAGAAGGCACCAGGCCAGCC. The primers were designed with the
underlined nucleotides being changed to convert Ser13 to
Ala and Ser194 to Pro, respectively. One primer
(5'-TAGAACTAATGGAACCCCCG-3') that
contains a mutation in the BamHI site unique to pBluescript SK(
) was also synthesized and was included in the process of site-directed mutagenesis for the selection of the mutated plasmids. The DNA sequence of each mutated plasmid used for this study was confirmed by dideoxynucleotide sequencing.
Construction of Expression Plasmids--
For transient
transfection of expression plasmids into Ltk mouse
fibroblasts, cDNAs encoding hTK1 and some of its mutants were
cloned into the XhoI site of an expression vector, pCDM8, in
a sense orientation. These hTK1 expression plasmids were constructed by
inserting the EcoRI/ClaI restriction fragment
containing cDNA of the hTK1 from pBsTK without or with a desired
site-specific mutation downstream of the cytomegalovirus (CMV)
immediate-early promoter. For stable expression in HeLa cells, human
TK1 cDNA and its mutant, TK1Ala13, were each cloned
into the pCMV-2 expression plasmid (Eastman Kodak Co.) at a blunt-ended
XbaI/SmaI site, resulting in fusion of a sequence
encoding FLAG epitope (MDTKDDDDK) plus 40 residues from the polylinker
to the 5'end of the hTK1 coding sequence, by which pFLAG-TK1 and
pFLAG-TK1Ala13 were generated.
Transient Transfection of Ltk
Fibroblasts--
Ltk
cells (2 × 105)
were seeded and transfected with a mixture of 18 µg of LipofectAMINE
(Life Technologies, Inc.) and 3 µg of plasmid DNA per 6-cm dish. On
the day after transfection, cells were washed and then treated with or
without NOC for 17 h. Next, cells were then pulse-labeled for
2 h at 37 °C with [32P]orthophosphate (500 µCi/ml, Amersham Corp.) in phosphate-free medium. Cells were lysed in
a lysis buffer containing 50 mM Tris-HCl buffer (pH 7.5),
1% Nonidet P-40, 150 mM NaCl, 50 mM NaF, 1 mM
-mercaptoethanol, 10 µg/ml leupeptin, 5 µg/ml
aprotinin, and 1 mM phenylmethylsulfonyl fluoride (PMSF).
Two microliters of each lysate was precipitated by 10% trichloracetic
acid, and the amount of radioactivity present in the trichloracetic
acid-insoluble portion was determined with a liquid scintillation
counter. Lysates containing equal trichloracetic acid-insoluble counts
were then incubated with antiserum against GST-TK1 for 2 h.
Immunocomplexes were adsorbed onto protein A-Sepharose (Pharmacia
Biotech Inc.) and washed five times with lysis buffer containing 0.1%
deoxycholate and 0.2% SDS. Samples were analyzed by SDS-PAGE and
transferred to polyvinylidene fluoride (PVDF) membranes (Millipore) for
autoradiography, followed by immunodetection using the antiserum
against GST-TK1.
Stable Transfection of HeLa Cells-- HeLa cells were maintained in DMEM supplemented with 10% fetal bovine serum (Life Technologies, Inc.) Cells were cotransfected with 5 µg of the expression plasmid, pFLAG-TK1 or pFLAG-TK1Ala13, with 0.25 µg of pRSVneo by the LipofectAMINE method. Two days after transfection, cells were trypsinized and plated in the medium containing 0.6 mg/ml G418. The medium was replaced every 4 days. G418-resistant clones were selected after approximately 14 days and analyzed for the expression of FLAG-TK of a molecular size of 30 kDa by Western blotting with M2 monoclonal antibody (Kodak), which is specific against the FLAG epitope.
Mitotic Arrest and Flow Cytometry of Stable Cell Lines--
For
mitotic arrest of stably transfected cell lines, 1 × 106 cells/10-cm dish were treated with thymidine (2 mM) in DMEM containing 10% fetal bovine serum for 20 h, then released for 8 h, and followed by addition of 2 mM thymidine for another 20 h. After this double thymidine block, cells were washed and treated with NOC (50 ng/ml) for
16 h. For release from mitotic arrest, after NOC treatment cells
were washed with PBS twice and refreshed with DMEM containing 10%
fetal bovine serum. Immediately after harvesting, cells were frozen in
70% ethanol and stored at 20 °C until analysis. At this time, the
cells were thawed and stained with propidium iodide as described
elsewhere (27). Flow analysis was performed on a Becton Dickinson
FACScan flow cytometer, and the data were interpreted by use of the
ModiFit cell cycle analysis program (version 2.0). At least 10,000 cells were analyzed for each sample.
Immunoblotting-- Twenty micrograms of cytosolic protein were resolved on 12% SDS-PAGE, followed by electrophoretic transfer to PVDF membrane (28). After blocking with 5% powdered milk, the membrane was incubated with antiserum against GST-TK1 (1:1500) for 2 h, and treated for 1 h with alkaline phosphatase-conjugated goat anti-rabbit IgG antibody (Promega) or with horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Amersham). The alkaline phosphatase color development or ECL detection for the horseradish peroxidase reaction was performed according to the vendor's instructions. Antibodies against p21waf1/cip1, Cdc2, and Cdk2 were obtained from Santa Cruz Corp. and diluted at 1:2000 for immunodetection of p21waf1/cip1, Cdc2, and Cdk2, respectively.
Preparation of Recombinant Proteins-- The construction of pGex-hTK1 and preparation of GST-TK1 fusion protein were described previously (24). pET-TK1 was constructed by ligation of a 1.5-kilobase pair EcoRI/BamHI fragment from pGexTK1 into pET-28c (Invitrogen). pET-TK1 expresses hTK containing an N-terminal 44 residues of His-tagged/T7 tag fusion, producing a 30-kDa protein. pET-TKAla13 was generated by subcloning of an EcoRI/SalI fragment, liberated from pBsTKAla13, into the SalI site of pET-28c. His-tagged TK1 and His-tagged TK1Ala13 were produced in Escherichia coli strain BL21(DE3) and purified by binding to a Ni-NTA (QIAGEN) column. The His-tagged protein was eluted by a buffer containing 50 mM sodium phosphate, pH 8.0, 250 mM imidazole, 300 mM NaCl, 10% glycerol, and 1 mM PMSF. The proteins were then dialyzed against 100 mM Tris-HCl, pH 7.9, 150 mM NaCl, 0.5 mM dithiothreitol, 1 mM PMSF, and 10% glycerol. The proteins were stored in the presence of 1% bovine serum albumin for enzymatic activity assay and storage. The Km values of His-tagged TK1 and His-tagged TK1Ala13 were approximately 4.8 and 4 µM of thymidine, respectively. Vmax was 40 pmol/min/µg for His-tagged TK1 and 60 pmol/min/µg for His-tagged TK1Ala13. We carried out the kinetic analysis by using 10 ng of purified His-tagged TK1 or His-tagged TK1Ala13 in each TK assay reaction.
In Vitro Kinase Reaction--
GST-TK1 and GST bound to
glutathione-agarose (Sigma) were washed three times in the kinase
buffer. HeLa cells without or with NOC overnight treatment were lysed
and extracted with a buffer containing 50 mM Tris-HCl, 150 mM NaCl, 15 mM MgCl2, 2 mM KCl, 5 mM NaF, 0.5 mM PMSF, 0.5 mM dithiothreitol, 5 mM EGTA, leupeptin, aprotinin, pepstatin (10 µg/ml each), and 0.2% Nonidet P-40. After centrifugation at 10,000 × g, the supernatant at a
concentration of 2 mg/ml was used for the kinase reaction. Each
reaction contained 100 µg of protein from cell extracts, 0.2 µg of
GST-TK1 or GST that was coupled to glutathione-agarose, and 30 µCi of
[-32P]ATP at a final concentration of 50 µM of ATP in a total reaction volume of 100 µl. After
incubation at 30 °C for 30 min, GST-TK1 or GST on
glutathione-agarose beads was washed several times in lysis buffer and
eluted by addition of 20 µl of 10 mM reduced gluathione.
The eluted protein was resolved on 10% SDS-PAGE, followed by
autoradiography.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Mouse TK-deficient Ltk cells were transfected with
expression vectors encoding human wild-type or mutant types of TK1. Two mutants each contain a single amino acid substitution
(Ser13
Ala or Ser194
Pro) that
generates catalytically active TK1 with similar levels of TK activity
when expressed in proliferating Ltk
cells. After
transfection, cells were either maintained in the proliferating state
or treated overnight with NOC for mitotic blocking. Cells were labeled
with [32P]orthophosphate for immunoprecipitation by hTK1
antiserum (24). In proliferating Ltk
cells,
phosphorylation of ectopically expressed TK1 was weakly detectable for
the wild type as well as the two mutants (Fig. 1A). In NOC-treated
Ltk
cells, the phosphorylation level of wild-type hTK1
was greatly enhanced (Fig. 1B). However, the intensity of
phosphorylation for ectopically expressed mutant hTK1
(Ser13
Ala) was reduced significantly, even though a
greater amount of hTK1 was immunoprecipitated in this cell lysate (Fig.
1B). The phosphorylation intensity of another mutant hTK1
(Ser194
Pro) in NOC-treated L-cells was essentially
similar to that of the wild-type hTK1. Thus, serine 13 appears to be an
important site contributing to an increased phosphorylation level of
hTK1 expressed in NOC-treated Ltk
cells.
|
To learn whether mitotic phosphorylation on Ser13 of hTK1 also occurs in human cells, we established HeLa cell lines stably expressing FLAG-tagged wild-type TK1 or mutated TK1Ala13. For this purpose, HeLa cells were cotransfected with pCMV-FLAG-TK1 or pCMV-FLAG-TK1Ala13, separately, with pRSV-neo as a selection marker. FT and FN cell lines, which stably expressed FLAG-TK1 and FLAG-TK1Ala13, respectively, were established by G418 selection. The expression of FLAG-TK1 in proliferating and mitotically arrested FT cells was measured by immunoprecipitation with monoclonal antibody M2 against the FLAG epitope, followed by Western blotting with antiserum against hTK1. Isoforms of FLAG-TK1, displaying a mobility shift, were detected in mitotically arrested cells (Fig. 2A). Alkaline phosphatase treatment of immunoprecipitated FLAG-TK1 from the cell lysate of mitotically arrested HeLa (FT) cells abolished the up-shifted band, indicating that phosphorylation of FLAG-TK1 decreases its electrophoretic mobility during separation on SDS-PAGE (Fig. 2A). Clearly, alterations in the phosphorylation state of FLAG-TK1 were detectable by immunoblot analysis with antibody to TK1. Because hTK1 can be present as homodimer or homotetramer (29, 30), in FT cells endogenous TK1 of a molecular size of 24 kDa could also be detected by hTK1 antiserum in the FLAG-TK1 immunoprecitates recognized by the M2 antibody. We noted that detection of a mobility shift of endogenous TK1 during mitotic arrest was rather unclear. The presence of mobility shift for FLAG-TK1, but not TK1, expressed in mitotically blocked cells might be due to the introduction of several negative charges of residues in the FLAG and fusion region, which somehow allowed a clear separation of the phosphorylated isoform of FLAG-TK1 in SDS-PAGE.
|
Distinct from parental HeLa cells, FT and FN stable cell lines, expressing FLAG-TK1 and FLAG-TK1Ala13, respectively, required a double thymidine block followed by NOC treatment for mitotic arrest. To compare the expression patterns of FLAG-TK1 and FLAG-TK1Ala13 in different phases of the cell cycle, we harvested FT and FN cells in proliferating, mitotic arrest, and recovering from mitotic arrest states for fluorescein-activated cell sorting analysis to assure that the two cell lines had a similar cell cycle distribution for each treatment condition. The parallel cell lysates obtained under these conditions were subjected to Western blotting (Fig. 2B). It appeared that the steady-state level of FLAG-TK1 was relatively low in the proliferating FT cells and increased in G2/M arrested cells. After release from mitotic blocking, the intensity of the up-shifted band of FLAG-TK1 detected in mitotically blocked cells decreased. In contrast, the steady-state levels of FLAG-TK1Ala13 expressed in FN cells remained rather constantly elevated, without the detection of an up-shifted band in different phases of the cell cycle. This result not only confirmed the presence of mitotic phosphorylation on Ser13, but also indicated that conversion of Ser13 to Ala affects the fluctuation of hTK1 expression in different phases of the cell cycle.
For a better understanding of the biochemical nature of the mitotic phosphorylation of human TK1, we performed phosphorylation reactions in vitro. Both GST and GST-TK1 produced in E. coli and isolated on glutathione-agarose were used as substrates for the phosphorylation reaction carried out with the cell extracts. The GST-TK1 fusion protein was intensively phosphorylated in the reaction performed in the extracts prepared from mitotically arrested HeLa cells (Fig. 3A). In contrast, phosphorylation of GST-TK1 was not detected in the reaction carried out with the proliferating extract. Because GST was not well phosphorylated in either cell extract, the TK1 moiety of GST-TK1 was specifically phosphorylated in the mitotic extract. The phosphoaminoacid analysis of in vitro phosphorylated GST-TK1 revealed that serine is the only residue that is phosphorylated by the mitotic extract (Fig. 3A). For the phosphorylation reaction of GST-TK1 in the mitotic extract, we also observed a prominent phosphorylated band at a molecular size of 26 kDa. Because this phosphorylated band did not appear in other reactions shown in Fig. 3, A and B, we speculated that a molecule present in the mitotic extract formed complex with GST-TK1 on glutathione-agarose and became phosphorylated in the reaction.
|
Our previous results of in vivo labeling experiments showed that mitotic phosphorylation of TK1 in HeLa cells is reduced significantly by staurosporine treatment at a concentration of 50 nM (24), which is the dosage range for Cdc2 kinase inhibition (31). Staurosporine at a 50 nM concentration could also abolish in vitro phosphorylation of GST-TK1 by extracts of NOC-treated HeLa cells (data not shown). Moreover, the sequence around Ser13 of hTK1 is compatible with a Cdc2 kinase consensus site. These facts prompted us to examine whether hTK polypeptide is a direct substrate for Cdc2 kinase. It has been demonstrated that p13suc1, a fission yeast protein, can bind avidly to active forms of Cdc2 and Cdk2 kinases (32-34). Therefore, Cdc2 and Cdk2 kinases can be specifically immobilized by p13-agarose from the cell extracts of the mitotically blocked HeLa. The p13-agarose after incubation with the mitotic extract of HeLa cells was used for the in vitro kinase reaction of GST-TK1. Sepharose CL-4B was mixed with the same cell extract and used as a control. Both p13-agarose and Sepharose CL-4B were analyzed by Western blotting and detected by monoclonal antibodies against Cdc2 or Cdk2 kinase to show that both kinases were specifically adsorbed on p13-agarose beads (Fig. 3B). The in vitro kinase reactions of GST-TK1 were carried out in the mixtures containing treated p13-agarose or Sepharose CL-4B beads (Fig. 3B). Clearly, the TK1 moiety is phosphorylated in vitro by Cdc2 or Cdk2 kinase that is specifically bound to p13-agarose. We further tested whether the presence of the GST moiety influences the property of GST-TK1 protein as a substrate for phosphorylation. His-tagged TK1 was expressed in E. coli and purified for this in vitro phosphorylation system. Consistently, His-tagged TK1 could also serve as a good substrate for Cdc2 or Cdk2 kinase (Fig. 4). In contrast, the mutant His-tagged TK1Ala13 could not be phosphorylated by Cdc2 or Cdk2 kinase. These results clearly suggested that Ser13 is efficiently phosphorylated by Cdc2 or Cdk2 kinase in vitro.
|
From our in vitro data, it appeared that hTK1 can be a substrate for Cdc2 or a related kinase in vitro. In order to determine whether hTK1 polypeptide was also phosphorylated by Cdc2 or Cdk2 kinase in intact cells, we examined the mitotic phosphorylation of hTK1 in vivo in the presence of overexpression of p21waf1/cip1, which is a universal inhibitor for cyclin-dependent kinases (35-37). We performed in vivo [32P]orthophosphate labeling in NOC-arrested L-fibroblasts that had been transfected with pCMV-TK1 in the presence of a control vector or pCMV-p21waf1/cip1. As shown in Fig. 5, the phosphorylation level of hTK1 was clearly reduced in the cells cotransfected with pCMV-p21waf1/cip1. Thus, cyclin-dependent kinase(s) is indeed involved in mitotic phosphorylation of hTK1.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Phosphorylation has been considered to play a central role in
regulating the biochemical events that coordinate progression through
the cell cycle. In the present study, we investigated the mitotic
phosphorylation of hTK1. The data presented here illustrate that a
mutation converting Ser13 to Ala decreases the extent of
mitotic phosphorylation of both native TK1 and recombinant FLAG-TK1
expressed in Ltk fibroblasts and HeLa cells,
respectively. We designed an in vitro system to show that
M-phase kinase was responsible for TK phosphorylation on serine
residue(s). We further demonstrated that Cdc2 or Cdk2 kinase could
carry out this in vitro phosphorylation of wild-type TK1,
but not mutant TK1Ala13. Because coexpression of
p21waf1/cip1 in Ltk
fibroblasts could also
suppress the mitotic phosphorylation of hTK1 expressed in this cell
line in a cotransfection experiment, our data suggest that cdc2 or
related kinase(s) is involved in mitotic phosphorylation at
Ser13 of the hTK1 polypeptide.
We have previously demonstrated that TK1 expressed a 10-fold higher
affinity for thymidine in proliferating HeLa cells than in mitotically
blocked cells. Because hyperphosphorylation of TK1 in mitotically
blocked HeLa cells is accompanied by a decrease in its affinity for its
substrate, thymidine, we have proposed that the physiologic function of
specific TK1 phosphorylation by M-phase kinase(s) is to decrease its
catalytic efficiency to prevent unnecessary synthesis of dTTP in
mitotic cells. However, in this study we did not find any significant
difference in the kinetic properties of purified his-tagged TK1 and
phosphorylated his-tagged TK1 by Cdc2 or Cdk2 kinase (data not shown).
Since we did not rule out the possibility that the extent of TK
phosphorylation in vitro was different from that in
vivo, the functional significance of phosphorylation of hTK1
during mitotic arrest remains to be established. Nevertheless, we found
that mutation of Ser13 rendered a constitutively elevated
expression of FLAG-TK1Ala13, independent of the growth
state of the cells. These results raise the possibility that
phosphorylation of Ser13 by Cdc2 or Cdk2 kinase influences
the level of TK1 expression during the cell cycle. The expression of
FLAG-TK1, but not FLAG-TK1Ala13, in HeLa cells was
increased significantly after double thymidine block and NOC treatment.
Recently, it has been demonstrated that thymidine treatment can inhibit
the growth arrest-specific degradation of TK1 protein in transfected
Ltk cells (38). Based on this line of evidence, it is
possible that the stability of FLAG-TK1Ala13 expressed in
HeLa cells was relatively unaffected by the treatment of double
thymidine block. Given that the expression of FLAG-TK1 and that of
FLAG-TK1Ala13 both are controlled by the CMV promoter, it
is logical to assume that the difference of their expressed amounts may
result from the effect of Ser13 mutation at the regulatory
level of translational efficiency or degradation.
Analysis of phosphorylation sites for Cdc2 kinase substrates reveals a
consensus that requires a minimum of a serine or threonine followed by
proline. A search of the hTK1 sequence for the presence of this
consensus showed only two potential sites: the serines at positions 13 and 231. We have also carried out a point mutation on
Ser231 located at the C terminus to obtain
TK1Ala231 for an in vivo phosphorylation
experiment. Our results showed that the phosphorylation levels of
TK1Ala231 in mitotically blocked Ltk cells
were not reduced significantly as compared with that of wild-type TK1
(data not shown). We also found that a mobility up-shift was detectable
for FLAG-TK1Ala231, but not for
FLAG-TK1Ala13,Ala231, in stable cell lines after mitotic
arrest (data not shown). However, we cannot be certain whether
Ser231 is definitely excluded from phosphorylation.
According to these results, we concluded that the mitotic
phosphorylation site of hTK1 is primarily on Ser13 by
cyclin-dependent kinase(s) during mitotic arrest. What role phosphorylation on Ser13 of hTK might play during the
G2/M transition is still unclear.
Previously, it has been reported that deletion of the C-terminal 40 amino acids of hTK1 can result in a dramatic stabilization of TK1 polypeptide in HeLa cells that have been released from mitotic blocking (19, 20). The C-terminal 30 residues of murine TK1 have also been found to be responsible for triggering TK1 degradation during serum deprivation in an L-cell line that stably expresses murine TK1. As the vaccinia virus and related viral TK proteins are highly homologous to hTK1, but lack 16 N-terminal and 42 C-terminal amino acids (39), it has been suggested that viral TKs have not retained the C-terminal region of the protein because cell cycle regulation is not necessary for virus multiplication (19). By comparing the amino acid sequence of TK from different species, it was also noted that the sequences around Ser13 are highly conserved in vertebrate TK1s. It has been shown that the truncated form of hTK1 with deletion of the C-terminal 40 amino acids still retains its functional activity (19). We found that Ser13 is also not required for hTK1 activity. Here, we speculate that both the N and C termini of TK1 have evolved to serve as regulatory domains. At present, it is of interest to determine how phosphorylation on Ser13 and the C-terminal region interact to regulate the fluctuation of TK1 expression during the cell cycle.
![]() |
ACKNOWLEDGEMENT |
---|
We thank Dr. Yue Xiong for providing p21waf1/cip1 expression vector. We thank Dr. Su-Ming Hsu for editing the manuscript.
![]() |
FOOTNOTES |
---|
* This work was supported in part by Grants CMRP 436 from the Chang Gung University and NSC87-2314-B-002-165 from the National Science Council, Taiwan, Republic of China.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ To whom correspondence should be addressed: Institute of Biochemistry, National Taiwan University, College of Medicine, No. 1 Jen Ai Road, 1 St. Section, Taipei, Taiwan, Republic of China. Fax: 02-2395-8904.
1
The abbreviations used are: TK, thymidine
kinase; TK1, TK type 1; hTK, human TK; Ltk, TK-deficient
mouse connective fibroblast; NTA, nitriloacetic acid; DMEM, Dulbecco's
modified Eagle's medium; NOC, nocodazole; CMV, cytomegalovirus; PMSF,
phenylmethylsulfonyl fluoride; GST, glutathione
S-transferase; PAGE, polyacrylamide gel electrophoresis; PVDF, polyvinylidene difluoride; PBS, phosphate-buffered saline.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|