From the Medical Genetics Centre Department of Cell Biology and Genetics, Erasmus University Rotterdam, P.O. Box 1738, 3000 DR, Rotterdam, The Netherlands
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cockayne syndrome (CS) is a nucleotide excision repair disorder characterized by sun (UV) sensitivity and severe developmental problems. Two genes have been shown to be involved: CSA and CSB. Both proteins play an essential role in preferential repair of transcription-blocking lesions from active genes. In this study we report the purification and characterization of baculovirus-produced HA-His6-tagged CSB protein (dtCSB), using a highly efficient three-step purification protocol. Microinjection of dtCSB protein in CS-B fibroblasts shows that it is biologically functional in vivo. dtCSB exhibits DNA-dependent ATPase activity, stimulated by naked as well as nucleosomal DNA. Using structurally defined DNA oligonucleotides, we show that double-stranded DNA and double-stranded DNA with partial single-stranded character but not true single-stranded DNA act as efficient cofactors for CSB ATPase activity. Using a variety of substrates, no overt DNA unwinding by dtCSB could be detected, as found with other SNF2/SWI2 family proteins. By site-directed mutagenesis the invariant lysine residue in the NTP-binding motif of CSB was substituted with a physicochemically related arginine. As expected, this mutation abolished ATPase activity. Surprisingly, the mutant protein was nevertheless able to partially rescue the defect in recovery of RNA synthesis after UV upon microinjection in CS-B fibroblasts. These results indicate that integrity of the conserved nucleotide-binding domain is important for the in vivo function of CSB but that also other properties independent from ATP hydrolysis may contribute to CSB biological functions.
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Nucleotide excision repair (NER)1 is an evolutionary strongly conserved pathway responsible for the removal of a wide variety of lesions from the DNA, including the major types of UV-induced DNA injuries: cyclobutane pyrimidine dimers and (6-4) photo products. Removal of these lesions proceeds via a multi-step reaction; lesion recognition is followed by local opening of the DNA helix, dual incision in the damaged strand on each side of the lesion, release of the damage-containing fragment, gap-filling DNA synthesis, and ligation. A large number of gene products is involved in this repair reaction (reviewed in Refs. 1-3). The dramatic consequences of impaired NER are illustrated by several hereditary human diseases including xeroderma pigmentosum (XP) and Cockayne syndrome (CS). Patients with XP manifest a high sun (UV) skin sensitivity associated with a strong predisposition to skin cancer and frequently progressive neurodegeneration. Besides these common features, a significant clinical and genetic heterogeneity is observed among XP patients. Seven excision-deficient complementation groups (XP-A to XP-G) have been identified so far on the basis of cell fusion experiments (4). Patients with CS show, like XP, increased sensitivity to UV light. In addition, they suffer from severe developmental problems, which include growth retardation, skeletal and retinal abnormalities, and severe neurological deficiencies due to dysmyelination of neurons (4-6). Unlike XP patients and unlike a recently generated mouse model for CSB (7), no significant skin cancer predisposition has been noted for CS so far.
Several observations have revealed functional connections between DNA repair and basal transcription. Firstly, at least three subunits of the basal transcription factor TFIIH (XPB, XPD, and TTDA) are also required for NER (8-10). Secondly, lesions in the transcribed strand of active genes hamper or block the vital process of transcription. For some lesions such as cyclobutane pyrimidine dimers the normal (global genome) NER pathway is very slow. Therefore, a special subpathway of NER has evolved that accomplishes rapid and efficient removal of these types of damage from the transcribed strand of active genes (11, 12). This process, called transcription-coupled repair is highly conserved in evolution, because it has been described in Escherichia coli, yeast and mammalian cells (7, 13-16). In humans, two genes have been shown to be specifically required for transcription-coupled repair: CSA and CSB, defective in CS complementation groups A and B, respectively (17, 18). CS cells exhibit an elevated UV sensitivity correlated with a specific defect in transcription-coupled repair. Consequently, unlike normal cells, they are unable to recover RNA synthesis after UV irradiation (19, 20).
The CSB gene encodes a protein of 1493 amino acids containing a 500-amino acid region highly homologous to members of the SWI2/SNF2 subfamily of DNA-dependent ATPases (18, 21). Interestingly, SNF2-related proteins are involved in a wide variety of cellular functions, notably transcription regulation, chromatin remodelling, and all known multi-step DNA repair pathways, such as nucleotide excision repair of both transcribed and nontranscribed regions of the genome, post replication repair, and recombination repair (22, 23). Importantly, we found recently that the CSB protein resides in a large molecular weight complex that includes RNA polymerase II but no transcription initiation factors (24).
The mechanism by which CSB protein mediates transcription-coupled repair is still largely unknown. Availability of a recombinant CSB protein is essential for studying CSB activity in in vitro assays. Here we present the generation, purification, and functional characterization of a double-tagged wt and ATPase-deficient mutant CSB protein. Surprisingly, the DNA-dependent ATPase activity was found to be partially dispensable for the in vivo CSB function in RNA synthesis recovery.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cell Culture-- The immortalized human cell lines used in this study were: HeLa, C5RO (wt), GM2965 (CS-A), CS1AN (CS-B), and XPCS1BA(XP-B). The fibroblasts were cultured in Ham's F-10 medium, supplemented with antibiotics and 12% fetal calf serum. Cell-free extract from HeLa cells was prepared as described previously (25, 26).
An insect cell line, Spodoptera frugiperda Sf21, was cultured at 27 °C in Hanks' medium supplemented with antibiotics and 10% fetal calf serum. Hanks' medium was prepared from Grace's insect cell culture medium (Life Technologies, Inc.) supplemented with 0.33% tissue culture yeastolate (Difco), 0.33% tissue culture lactalbumin hydrolysate (Difco), and 0.55% bovine serum albumin.Plasmid Constructs-- Previously we have generated a CSB cDNA construct (2tpSLME6) encoding a N-terminal hemagglutinin antigen (HA) epitope as well as a C-terminal histidine (His6) tag (24). For overexpression of the HA-CSB-His6 in the BAC to BAC Baculovirus Overexpression System (Life Technologies, Inc.), the N-terminal SacI fragment and the C-terminal SacI-XbaI fragment were cloned together in the pFASTBAC vector (Life Technologies, Inc.), giving rise to construct 2tpFBACE6. Construct 2tpFBACE6-K538R, containing a mutation changing the Lys-538 codon to Arg, was generated as described below.
Site-directed Mutagenesis-- The K538R mutation in the CSB cDNA was introduced using the PCR-mediated site-directed mutagenesis method (27). For this purpose, two fragments of the CSB cDNA containing the helicase domain (1330-base pair KpnI-SmaI fragment and 1914-base pair KpnI-KpnI fragment) were independently subcloned into pBluescript KS and pTZ18 vector, respectively. The primers used in the PCR reactions are: the mutagenic primer (5' GGATTGGGCAGGACCATCCAG 3') and the universal primers SK and M13 universal. The final PCR product was cloned into the pBluescript vector, and the internal AsuII fragment was used to replace the wild-type fragment in 2tpFASTBACE6. Sequencing of the entire PCR fragment ruled out PCR-derived errors and confirmed the presence of the desired mutation.
Baculovirus Infection and Purification of Recombinant
Proteins--
Suspension cultures of Sf21 cells at 1.5 × 106 cells/ml were infected with the recombinant
baculoviruses at 27 °C for 1 h at a multiplicity of infection
of 5-10. At 3 days post-infection, cells were collected and washed
twice with ice-cold phosphate-buffered saline. For fractionation, the
cell pellet was resuspended into 8 (packed cell) volumes of ice-cold NP
lysis buffer (25 mM Tris-HCl, pH 9.0, 1 mM
EDTA, 10% glycerol, 1% Nonidet P-40, 0.3 M KCl, 1 mM dithiothreitol, 0,1 mM phenylmethylsulfonyl
fluoride, 0,2 µM chemostatin, leupeptin, antipain, and
pepstatin A). After incubation on ice for 30 min with occasional
agitation, the suspension was centrifuged at 12,000 × g for 15 min to obtain the supernatant fraction and the
precipitate fraction. To examine the protein remaining in the
precipitate fraction, the pellets were homogenized in NP buffer by
sonication. For purification, the supernatant fraction was diluted with
NP buffer at pH 6,8 in a 1:1 ratio and loaded on a heparin-Sepharose
(CL-6B; Amersham Pharmacia Biotech) column equilibrated with buffer A
(25 mM HEPES-KOH, pH 7, 9, 0,01% Nonidet P-40, 10%
glycerol, 1 mM -mercaptoethanol, 0, 1 mM
phenylmethylsulfonyl fluoride) containing 0.3 M KCl. The
column was washed with the same buffer, and the adsorbed proteins were
eluted with buffer A containing 0.8 M KCl. The eluate was
directly loaded on a Ni2+-nitrilotriacetic acid-agarose
column equilibrated with buffer A containing 0.8 M KCl and
5 mM imidazole. After washing the column with 20 mM Imidazole, bound proteins were eluted with buffer A containing 0.3 M KCl and 60 mM/250
mM imidazole.
ATPase Assay--
Standard reactions (10 µl) were carried out
in buffer B (20 mM Tris-HCl, pH 7.5, 4 mM
MgCl2, 40 µg/ml bovine serum albumin, 1 mM
dithiothreitol), 1 µCi of [-32P]ATP (5000 Ci/mmol;
Amersham Pharmacia Biotech) and the specified amounts of CSB protein.
When indicated, reactions were carried out in the same buffer B
supplemented with 50 µM cold ATP and 0.25 µCi of
[
-32P]ATP. 150 ng of DNA cofactor/reaction was added.
After 1 h at 30 °C the reactions were stopped with 5 µl of
0.5 M EDTA, and a 1-µl sample was analyzed on
polyethylenimine-cellulose thin layer chromatography plates developed
in 0.75 M KH2PO4. The extent of ATP
hydrolysis was determined by image analysis and quantification on a
PhosphorImager (Molecular Dynamics).
Helicase Assay-- The partial duplex DNA substrates were constructed by hybridizing a 5' 32P-labeled complementary fragment to the viral (+)-strand of M13 DNA: (i) 18-base oligonucleotide; (ii) 36-base oligonucleotide; (iii) 50-base oligonucleotide with a 5' 15-base noncomplementary overhang; and (iv) 50-base oligonucleotide with a 3' 15-base noncomplementary overhang. Helicase substrates with a 5'-3' and a 3'-5' polarity were made by hybridizing a 5'-32P-labeled complementary fragment to a 36-base oligonucleotide (F36), respectively: (i) 19-base oligonucleotide (F19) and (ii) 17-base oligonucleotide (F17) (see Table I). Also, a double-stranded 75-base DNA fragment was used. Free oligonucleotides were removed by gel filtration on a Sephadex G50 (Amersham Pharmacia Biotech) column. The substrates, 5 ng each, were incubated with the indicated amount of CSB protein in buffer B containing 1 mM ATP (total volume 25 µl). After incubation at 37 °C for 45 min, reactions were stopped and subjected to electrophoresis on 12% polyacrylamide gel and autoradiography as described (8).
Microneedle Injection of Recombinant Proteins and Analysis of Repair and Transcription Levels-- Microneedle injection into cultured fibroblasts was performed as described previously (10, 28). Comparable amounts of purified recombinant CSB, wild type, and K538R mutant dissolved at 20 ng/µl were injected into the cytoplasm of CS1AN (CS-B) homopolykaryons (obtained after cell fusion of CS1AN (CS-B) fibroblasts with each other), multinucleated cells of GM2965 (CS-A), or XPCS1BA (XP-B) homopolykaryons. The recovery of RNA synthesis post-UV was measured. Cells were UV-irradiated with 10 or 15 J/m2 (UV-C 254 nm) and allowed to recover for 16-20 h. RNA synthesis was measured after pulse-labeling with [3H]uridine (10 µCi/ml; specific activity, 50 Ci/mmol), fixation, and autoradiography. Grains above the nuclei of injected cells (polykaryons) and noninjected neighboring cells (monokaryons) were counted and represent a quantitative measure for RNA synthesis.
Antibodies-- Anti-CSB antibodies used in this study were raised against the C-terminal 158 amino acids of CSB. Characterization of affinity-purified anti-CSB and immunoblotting procedures were performed as described (24).
DNA Substrates-- DNA cofactors used in the ATPase assay are described in Table I and kindly provided by Wouter de Laat (29). HeLa polynucleosomes were a generous gift of Robert Kingston and Gavin Schnitzler.
|
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Overexpression and Purification of Recombinant wt and Mutant CSB Proteins-- To facilitate purification of CSB and to allow isolation of a full-length protein, we generated a double-tagged CSB (dtCSB) construct (24) in a baculovirus expression system. A 9-amino acid HA epitope was introduced at the N terminus of the cDNA sequence, and a hexameric histidine stretch (His6) was introduced at the C terminus. It was important to verify whether the addition of tags per se did not interfere with the biological function of CSB. Therefore, we established by cDNA transfection a CS-B cell line stably expressing dtCSB in a mammalian expression vector. The level of expression of dtCSB protein was similar to the endogenous CSB level in normal cells. We found that the tagged protein conferred wild-type UV resistance to the CS-B cells and was incorporated into a large complex including RNA polymerase II (see Ref. 24). Thus, these findings confirm that dtCSB was biologically active in vivo and functionally indistinguishable from the untagged wt protein.
To investigate the importance of the ATPase activity for the various CSB functions we introduced by site-directed mutagenesis a strategic amino acid substitution in the Walker-type A motif (30) by replacing the invariant lysine residue (Lys-538) in the GXGKT sequence by the physicochemically related arginine, yielding dtCSB (K538R). It has been shown for other ATPases that such an alteration does prevent ATP hydrolysis but still permits ATP binding (31-33). Importantly, this conservative amino acid change is not expected to drastically modify the overall protein conformation. Both the wild-type and the mutant CSB protein were overproduced using the baculovirus/Sf21 insect cell system. Infected Sf21 cells were extracted with hypertonic buffer containing 0.3 M KCl, and the dtCSB protein was isolated from the soluble fraction. The purification was monitored by immunoblot analysis using polyclonal anti-CSB antibodies and by silver staining of SDS-PAGE. After two chromatographic steps, a heparin-Sepharose and a Ni2+-nitrilotriacetic acid-agarose column that selects for the C-terminal His6 stretch, we obtained a protein fraction consisting of a major band of about 170 kDa, corresponding to the predicted molecular weight of dtCSB (Fig. 1, A and B, lanes 1-3). Some degradation products were visible after immunoblot analysis using antibodies raised against the C terminus of CSB (data not shown; similar findings made by Selby and Sancar (34)). The presence of an HA epitope at the N terminus of dtCSB allowed us to select only for full-length protein during the last highly specific monoclonal affinity purification step. When the final fraction was analyzed by SDS-PAGE and silver staining, no protein species other than dtCSB were detected, indicating that the protein was purified to near homogeneity (Fig. 1B, lane 4). The same purification procedure was used for both wild-type dtCSB and dtCSB (K538R) mutant, obtaining both proteins at comparable high levels of purity, intactness, concentration, and yield (Fig. 1C). The three-step purification scheme described above yielded about 22 µg of protein from 108 infected cells. Immunoblot analysis of purified wt and mutant dtCSB and HeLa WCE using antibodies against CSB confirms the identity of the purified proteins (Fig. 1D, note the slight increase in size of the dtCSB as compared with the nontagged wt CSB in HeLa whole cell extract; for characterization of the antiserum, see Ref. 24).
|
Functionality of the Purified Recombinant dtCSB Protein in Vivo-- Prior to the biochemical characterization of the recombinant dtCSB protein, it was important to verify whether overproduction in the heterologous Baculo system and/or the purification procedure had not inactivated the biological function of the protein, e.g. by improper folding or lack of post-translational modification.
One of the characteristic features of CS cells is their inability to recover RNA synthesis after UV exposure (18, 35). To assess the in vivo function of the recombinant wt CSB, the purified protein was microinjected into the cytoplasm of living CS-B (CS1AN) fibroblasts, and its ability to transiently correct the DNA repair defect of CS-B cells was analyzed. The experimental protocol is outlined in Fig. 2A. CS1AN (CS-B) fibroblasts were fused to generate homopolykaryons. After injection of at least 50 multi-nucleated fibroblasts, the cells were irradiated with 15J/m2 UV light and incubated for 16-20 h to allow recovery from UV-induced inhibition of RNA synthesis. Transcription was analyzed by a 1-h pulse labeling with [3H]uridine followed by autoradiography. Transcription levels were quantified by counting silver grains above the nuclei (10, 28). As shown in Table II and Fig. 2B, in injected CS-B polykaryons the recovery of UV-induced inhibition of transcription is resumed to levels observed in wild-type cells assayed in parallel. In contrast, the neighboring noninjected cells (monokaryons in Fig. 2B), exhibit a very low level of transcription, which is typical for UV-exposed CS-B fibroblasts.
|
|
In Vitro Biochemical Characterization of the Purified Recombinant
wt and Mutant dtCSB Proteins--
The presence of a SNF2 domain in the
CSB protein starting with a Walker A-type nucleotide hydrolysis motif
strongly suggested that CSB harbors an ATPase activity (21, 30). The
mutant dtCSB (K538R) protein should serve as an optimal negative
control for this assay. As shown in Fig.
3A, in the absence of nucleic
acids, both proteins exhibited a comparable background level of
activity. However, ATPase activity of wild-type dtCSB was highly
stimulated by the presence of ds DNA in the reaction, in contrast
to the mutant protein (Fig. 3A). The extent of ATP
hydrolysis was proportional to the amount of wt dtCSB added to
reactions in which ATP concentration was kept constant and the DNA
cofactor was in excess (Fig. 3B and 5A).
Quantification of ATP hydrolysis showed that the conservative K538R
substitution resulted in a complete loss of the catalytic ATPase
function of CSB (Fig. 3B). Because wt and mutant proteins (purified in parallel) are at the same level of purity and equally concentrated (Fig. 1C), this result indicates that
DNA-dependent ATPase activity is an intrinsic property of
CSB protein and that the K538R substitution abolishes ATP
hydrolysis.
|
|
|
Inactivation of the ATPase Activity Does Not Completely Impair the in Vivo Function of CSB-- As shown above, the specific K538R substitution in the CSB nucleotide-binding domain abolishes its catalytic ATPase activity in vitro. To investigate the biological consequences of this mutation, purified dtCSB (K538R) protein was microinjected into living CS-B fibroblasts in parallel to injected wild-type dtCSB. The same type of mutation (Lys to Arg) in the ATP hydrolysis domain of the dual functional XPB DNA repair helicase was shown to possess a dominant-negative in vivo effect; this mutant subunit of the TFIIH repair/transcription complex completely paralyzes both repair and basal transcription in a dominant fashion in normal cells (28). Apparently, the mutant XPB protein is incorporated in the TFIIH complex but is unable to exert its function, thereby actively blocking both processes. The CSB protein too is incorporated in a RNA polymerase II complex, and thus substitution by an enzymatically dead molecule could actively disrupt the processes in which it is engaged. However, in striking contrast to the effect of mutant XPB, injection of the recombinant dtCSB (K538R) protein even partially rescued the defect in RNA synthesis recovery after UV irradiation in CS-B fibroblasts (Table II). Although the activity is much lower when compared with wt dtCSB, still a significant (approximately 2-fold) stimulation of resumption of transcription was observed in repeated experiments (Table II). This partial in vivo activity is in sharp contrast with the completely inactive ATP hydrolysis of (K538R) mutant protein.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Purification of the dtCSB Protein Using Tags-- Here we describe the successful isolation of double-tagged CSB protein from baculovirus-infected SF21 cells. We have utilized a novel purification procedure that has a number of advantages above classical purification protocols: (i) The use of the HA and His6 tags allows a highly selective, rapid, standardized three-step procedure. This avoids lengthy purification protocols involving a large number of column chromatography steps. In independent experiments we have found that the HA-monoclonal affinity chromatography by itself already can provide an >1000-fold purification when starting from mammalian whole cell extracts (38). The Ni2+-nitrilotriacetic acid agarose column chromatography specific for the hexameric histidine tag has the benefit that it is very versatile because it can be carried out under a wide range of conditions. (ii) The strategy used in this work has also the advantage that it selects only for full-length protein avoiding inclusion of partial degradation products in the final purified protein preparation. (iii) The purification procedure is very efficient: the dtCSB approach used yielded 22 µg of intact CSB protein from 108 infected cells, appearing at least 15-fold more efficient compared with classical protocols in which CSB was successfully purified involving seven chromatographic steps (34). A prerequisite for the use of tags is that one should test whether the addition of tags interferes with the function of the protein. In the case of dtCSB, we demonstrate in vivo and in vitro that the tagged protein was fully functional. Microinjection and DNA transfection experiments showed that the dtCSB protein completely corrected the defect in recovery of UV-induced inhibition of RNA synthesis and UV sensitivity of CS-B cells.
Biochemical Properties of the Purified dtCSB Protein--
Purified
wt dtCSB possesses an in vitro DNA-dependent
ATPase activity, as also reported recently by Selby and Sancar (34). We
investigated the DNA cofactor requirement for CSB ATPase activity using
structurally defined DNA substrates. The highest stimulation of CSB
ATPase activity was observed when dsDNA or structured oligonucleotides with a partial double- and single-stranded character were used as DNA
substrates (Figs. 4B and 5B). Unexpectedly, M13
ssDNA also exerts a strong stimulation. The notion that true dsDNA and
ssDNA are physicochemically very different rendered it unlikely that both should be equally efficient in enhancing CSB-ATPase. However, the
ATPase stimulation by M13 ssDNA was drastically reduced after removing
secondary structure by melting. This indicates that the double-stranded
character in M13 ssDNA was responsible for the stimulation and that
true ssDNA is a poor activator for CSB ATPase. This was confirmed by
the use of poly(dT)>80, which is known to have little
secondary structure and "single-stranded" oligonucleodides with
multiple palindromic sequences. In addition to differences in protein
preparations, the above observation may explain the findings of Selby
and Sancar, who reported a strong stimulation of CSB-ATPase by ssDNA
(34) and the yeast equivalent RAD26, which was reported by Guzder
et al. to be stimulated preferentially by ssDNA (39). In
fact, for any ssDNA-dependent ATPases for which
nonpremelted ssDNA substrates were used, it should be considered a
possibility that the stimulation was not derived from ssDNA but from
double-stranded structures within it. The fact that the CSB ATPase
activity is strongly enhanced by ds/ss DNA substrates such as
Y-structures containing hairpins opens the possibility that a
double-stranded to single-stranded transition is a biological relevant
DNA conformation for CSB. In addition, we find that ATP hydrolysis by
CSB is stimulated equally by naked dsDNA and nucleosomal DNA (Fig.
4C). A similar observation is made for the ySWI·SNF complex (40, 41). Specific activity of dtCSB in the presence of dsDNA
was approximately 160 pmol ADP formed/µg CSB/min
(Kcat = ~27 min 1), which is
within the range of activities measured for other DNA-dependent ATPases of the same family. In particular,
CSB appears to be a stronger ATPase than the recombinant ySNF2 (20 pmol
ADP/µg/min (42)) as well as the Drosophila NURF complex
(Kcat = ~8.5 min
1 in the
presence of nucleosomal DNA) (43).
Biological Consequences of ATPase Deficiency on the Functioning of CSB-- By site-directed mutagenesis the invariant lysine 538 residue in CSB ATP binding motif was replaced with the physicochemically related arginine. The conservative K538R mutation leads to a (virtual) complete loss of dtCSB ATPase activity in vitro (Fig. 3, A and B), as also has been shown for a variety of other ATPases (31, 42, 52). Surprisingly, we found that the ATPase-dead CSB protein still exerts a partial function in vivo, as shown by microinjection experiments in CS-B fibroblasts (Table II). Interestingly, the in vivo results suggest that this specific mutation can partially uncouple ATP hydrolysis from other biological activities of CSB, implying that other properties of CSB are also important for its function. In this respect is relevant to note that CS-B cell line (CS1AN) used in this study carries two alleles, each leading to a severely truncated CSB protein product (18). In fact, systematic mutation analysis of a large number of CSB patients has revealed that most patients produce severe CSB truncations. Our microinjection experiments suggest that having an enzymatically dead but physically intact CSB molecule is still better than having no protein at all. We suggest that the partial activity observed may be due to the fact that the enzymatically inactive CSB mutant protein may help stabilize a CSB-containing complex or otherwise permits this complex to function better when CSB is physically present. In fact, this is very similar to findings made with a comparable Lys to Arg substitution in the XPD helicase of TFIIH.3 For the transcription function of the TFIIH complex, this protein must be physically present to permit complex formation or stability, but it does not have to be enzymatically functioning. For the NER function of the TFIIH complex, the XPD helicase activity is at least in part required. Also for other protein complexes it has been shown that absence of one subunits leads to instability of the complex (e.g. Ref. 53). Consistent with the above interpretations for the partial activity of mutant CSB is the notion that the conservative Lys to Arg amino acid substitution is not expected to dramatically alter the overall structure of the CSB protein. Because we observe a biological effect, the dtCSB (K538R) mutant protein probably still fits into the RNA polymerase II complex. Our finding that the same type of amino acid substitution in the XPB and XPD helicase subunits of TFIIH exerts at least some biological effects strongly suggests that also these mutant proteins are still capable of complex formation. The intriguing finding that an enzymatically inactive CSB protein still exert some function in vivo supports the idea that interaction of CSB with other transcription/repair proteins per se contributes to its function(s).
![]() |
ACKNOWLEDGEMENTS |
---|
We are grateful to Robert Kingston and Gavin Schnitzler for providing the purified HeLa polynucleosomes. Wouter de Laat is acknowledged for providing the oligonucleotides substrates and for useful discussion. We thank Roland Kanaar, Bas Winkler, and André Eker for helpful suggestions. Sigrid Swagemakers and Cécile Visser are acknowledged for technical assistance, and Mirko Kuit is acknowledged for photography.
![]() |
FOOTNOTES |
---|
* This work was supported by European Community Training and Mobility Research Network Project Number CHRX-CT94-0443, Dutch Cancer Society Grant EUR 94-763, Human Frontiers Science Program Grant RG 373, and funds from the Louis Jeantet Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Present address: ICRF Clare Hall Laboratories, South Mimms, Herts
EN6 3LD, UK.
§ To whom correspondence should be addressed. Tel.: 31-10-4087199; Fax: 31-10-4360225; E-mail: hoeijmakers{at}gen.fgg.eur.nl.
1 The abbreviation used are: NER, nucleotide excision repair; CS, Cockayne syndrome; XP, xeroderma pigmentosum; HA, hemagglutinin; ssDNA, single-stranded DNA; dsDNA, double-stranded DNA; wt, wild type; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis.
2 E. Citterio and J. H. J. Hoeijmakers, unpublished observations.
3 G. S. Winkler, manuscript in preparation.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|