From the Department of Pediatrics, Ste-Justine
Hospital Research Center, Montreal, Quebec H3T 1C5, Canada and the
§ Department of Pediatrics, Montreal Children's Hospital,
McGill University, Montreal, Quebec H3H 1P3, Canada
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The minisatellite DNA polymorphism consisting of a variable number of tandem repeats (VNTR) at the human INS (insulin gene) 5'-flanking region has demonstrated allelic effects on insulin gene transcription in vitro and has been associated with the level of insulin gene expression in vivo. We now show that this VNTR also has effects on the nearby insulin-like growth factor II gene (IGF2) in human placenta in vivo and in the HepG2 hepatoma cell line in vitro. We show that higher steady-state IGF2 mRNA levels are associated with shorter alleles (class I) than the longer class III alleles in term placentae. In vitro, reporter gene activity was greater from reporter gene constructs with IGF2 promoter 3 in the presence of class I alleles than from those with class III. Taken together with the documented transcriptional effects on the insulin gene, we propose that the VNTR may act as a long range control element affecting the expression of both INS and IGF2. The localization of a type 1 diabetes susceptibility locus (IDDM2) to the VNTR itself suggests that either or both of these genes may be involved in the biologic effects of IDDM2.
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Hypervariable minisatellite DNA is one of the different types of polymorphisms of the human genome. Although found mostly in non-coding regions, minisatellite polymorphisms of the variable number of tandem repeat (VNTR)1 type are associated with human disorders and with differences in the levels of gene transcription (1-11). The expression of the human HRAS1 gene which encodes the Ha-ras oncogene has been found to be under the allelic effects of a VNTR polymorphism that lies downstream of the gene (1, 4, 5). Furthermore, alleles that are associated with an increased risk for cancer modulate higher reporter gene activity in vitro (4, 5). Recently, a similar phenomenon was observed for a VNTR minisatellite that is found upstream of the insulin gene promoter (2, 3). The alleles of this minisatellite fall into three broad categories with the following size range: class I, 0.4-0.9 kb; class II, 1.2 kb; and class III, >2 kb. In human fetal and adult pancreas, class I alleles are associated with higher INS mRNA levels than class III (2, 12). In vitro, allelic effects are less clear as two studies showed higher reporter gene activity in the presence of class I alleles (13, 14), whereas another study showed lower reporter gene activity in the presence of class I alleles in pancreatic cells (15). The discrepancy between these studies may have been due to the choice of particular class I subtype used in the constructs or to the absence of genomic context required for the effects seen in vitro.
The VNTR lies 4.1 kb upstream of the first promoter of the human insulin-like growth factor II gene (16) (IGF2) on the short arm of chromosome 11 (11p15.5), and this physical proximity may allow the minisatellite to influence the expression of IGF2 as well as that of INS. IGF2 encodes an important fetal mitogen that is ubiquitously expressed; the placenta and the adrenal gland contain the highest levels of IGF2 transcripts among all fetal tissues (17-19). Besides its role as a growth factor, IGF-II promotes cell survival by preventing apoptosis (20) and has demonstrated immunomodulatory activity in a number of models (21). It is expressed by T-lymphocytes (22), and it has mitogenic and anti-apoptotic actions on these cells (21). The expression of IGF2 is regulated during development, and DNA sequence variants at or near the gene could conceivably affect its transcription. Primarily because of the close physical proximity of IGF2 to the VNTR and the allelic effects of the minisatellite on the expression of the adjacent insulin gene, we have begun an investigation into the association between the VNTR and IGF2 gene expression in vivo and in vitro.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
This study was approved by the Institutional Review Board of the Ste-Justine Hospital, and informed consent was obtained for all tissues used.
Tissue Preparation and Nucleic Acid Purification-- Human term placenta for DNA and RNA purification was obtained at the time of vaginal delivery or elective Cesaerian section. A 1 cm thick layer of placenta was first trimmed from the maternal side to ensure the removal of all the maternal decidual tissue. A narrow 0.5-1-g piece was then removed from the fetal side of the placenta, thoroughly washed in sterile phosphate-buffered saline, and immediately frozen on dry ice. Peripheral blood was collected in EDTA-containing Vacutainer collection tubes. The blood was aliquoted, and the aliquots were centrifuged in a bench-top centrifuge for 10 min at 800 rpm; the cell pellet was immediately frozen.
Placental DNA was recovered from phenol/chloroform/isoamyl alcohol extractions following proteinase K and RNase A digestion of the tissue. Genomic DNA was obtained from blood cell pellets and from purified mononuclear blood cells with phenol extraction at neutral pH as described (23). Total RNA from placenta was isolated by acid guanidinium isothiocyanate followed by phenol/chloroform extraction (24).Genotyping--
In all PCR reactions, 0.5 µg of genomic DNA
was used. The reactions were, for the greater part and unless otherwise
indicated, carried out in the presence of 1 µCi of
[-32P]dATP, 75-150 pmol of PCR primer (sense and
antisense), 0.1 mM each dNTP, and commercially available
buffers supplied with the thermostable DNA polymerase were used. The
PCR can only amplify VNTR alleles whose products will be less than 1.5 kb, chiefly because of the large size of class II and class III alleles
(greater than 1.2 kb) and the consequent increase in the GC content.
All reagents were purchased from ID Labs (London, Ontario, Canada). An
ammonium sulfate buffer was used in the PCR with 1 mM
MgCl2 and 10% Me2SO with each dNTP at a final
concentration of 1.5 mM and the supplier's Taq
polymerase. Following a heat denaturation step of 5 min at 94 °C,
the PCR was performed for 30 cycles consisting of 1 min at 94 °C and
5 min at 72 °C (2, 12). Sense primer, 5'
TCAGGCTGGACCTCCAGGTGCCTGTTCTG 3'; antisense, 5'
TCGTCAGCACCTCTTCCTCAGGACCAGC 3'.
cDNA Synthesis and Competitive RT-PCR-- One µg of total RNA in diethyl pyrocarbonate-treated water was heated for 3 min at 80 °C and quickly cooled on ice. A mix of either 75 pmol of antisense polymerase chain reaction (PCR) primer or oligo(dT), 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, 1.3 mM dNTP mix, 6 units of human placental RNase inhibitor (Promega), and 400 units of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.) was added to the RNA. Incubation was at 37 °C for 1 h followed by heating at 80 °C for 10 min.
The internal competitor standard was generated using PCR-based in vitro mutagenesis as indicated (25). The standard is 190 bp and consists of the identical sequence as that of the exon 9-derived IGF2 cDNA PCR product with an internal deletion of 46 bp. The competitor PCR product was subcloned into a T-Vector (Promega) using the supplier's recommendations. Following bacterial transformation and purification using the QIAamp kit (Qiagen, Mississauga, Ontario, Canada), the competitor plasmid was aliquoted in fractions of 0.01-1 × 10Generation of VNTR-INS-IGF2 Reporter Gene Constructs-- For a schematic diagram of all the constructs refer to Fig. 4A. A P1 bacteriophage clone from a primary human fibroblast cell line genomic DNA library, selected by PCR primers for a segment in intron 1 of the tyrosine hydroxylase gene (MapPairs-Research Genetics Inc.), was purchased from Genome Systems Inc. (St. Louis, MO). The presence of IGF2 exon 3 as revealed by PCR indicated the presence of the first promoter (P1) of IGF2 in this bacteriophage clone.
A BamHI-XbaI fragment derived from purified bacteriophage cloned insert was found to contain human genomic DNA that included sequence from 5' of a class III VNTR to the untranslated exonic DNA of the first promoter of IGF2. By restriction enzyme analysis, the class III allele was found to be approximately 3 kb. The entire genomic fragment from upstream of the VNTR to 97 bp downstream of the first IGF2 promoter was subcloned into pBluescript II KS (Stratagene). This construct was termed pBL. Digestion of pBL with SalI and XbaI allowed the subcloning of this construct into pCAT-Basic (Promega), with IGF2 P1 directly upstream of the CAT (chloramphenicol acetyltransferase) reporter gene. Since P1 is primarily a post-natal liver promoter and thus less likely relevant to the pathophysiology of type 1 diabetes, we also included P3, a major fetal promoter, which generates abundant 6.0-kb transcripts in placenta and in other fetal organs including lymphoid tissues. To obtain P3, a HindIII fragment of 8.0 kb from a lambda phage clone termedTransient Transfection Assays--
To assess the in
vitro effects of the VNTR on IGF2 P3-based
transcription of CAT, the P3-based constructs were introduced into the
HepG2 hepatoma cell line (ATCC HB-8065, Rockville, MD) which expresses
endogenous IGF2 primarily from P3 (29). 8 × 105 cells in 35-cm2 multiwell dishes in
serum-free medium (Opti-MEM, Life Technologies, Inc.) were
cotransfected with 3 µg of each CAT construct and with 1 µg of
pSV (a plasmid encoding
-galactosidase, Promega) using a cationic
liposome formulation (Lipofectin, Life Technologies, Inc.) according to
the manufacturer's protocol. Following a 5-h incubation, the cells
were refed with minimum Eagle's medium supplemented with 0.1 mM non-essential amino acids, 1 mM sodium
pyruvate (Life Technologies, Inc.), and 10% fetal bovine serum and
incubated for 48 h at 37 °C. Following this incubation, the
cells were washed in PBS, and a lysate was prepared for CAT and
-galactosidase assays described below, using a commercial kit
(Promega).
Calculations/Statistics-- Differences in IGF2 expression among placentae (in the competitive RT-PCR assay) were determined as the ratio (in arbitrary units) of the intensity of the specific 236-bp IGF2 PCR product to the intensity of the internal competitor standard (30), normalized to the intensity of the GAPDH PCR product. Statistical significance of the results was evaluated by the Mann-Whitney U test for the in vivo studies in placentae and by a two-way analysis of variance for the transient transfection studies, followed by multiple comparisons using Fisher's Protected Least Significant Difference.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The Association between the VNTR and IGF2 Expression in Human Term Placenta-- The approach used to quantitate insulin gene expression in vivo from class I and class III chromosomes in previous studies, in which the transcribed diallelic PstI RFLP is in linkage disequilibrium with VNTR alleles (2, 3), was impossible for IGF2 in human placenta because of monoallelic expression (31, 32). We therefore used a competitive RT-PCR assay with internal competitor instead. We assessed IGF2 gene expression in normal human term placenta, where only the paternally transmitted gene copy is transcribed (31, 32) thereby allowing us to measure the expression associated with only one VNTR allele in each tissue sample. In heterozygotes, the paternal allele can be easily determined by genotyping the parents. Steady-state IGF2 mRNA levels among placentae were determined using a competitive reverse transcription-PCR (RT-PCR) assay that was reproducible and linear with negligible interassay variability. The cDNA and the competitor were coamplified in the same reaction. The competitor sequence was identical to that of the target minus an internal deletion of 46 bp to distinguish it from the target PCR product in a polyacrylamide gel. It is important to note that the PCR primers flank a sequence in exon 9 which is present in all of the IGF2 transcripts, irrespective of which promoter was used (20).
Following pilot experiments to determine a suitable amount that would titrate the specific IGF2 PCR product in a series of term placentae (data not shown), we coamplified the oligo(dT)-primed cDNA of all placentae with the same amount of internal standard (1 × 10
|
|
|
Effects of the VNTR on IGF2 P1 and P3 Promoters in Vitro-- We next examined the effects of the VNTR on reporter gene activity in vitro. Exploiting the genomic sequence from upstream of the VNTR to just downstream of the transcriptional start site of the first IGF2 promoter (P1) with the addition of the P3 promoter elements, we designed INS-IGF2 reporter gene constructs. The rationale for using these constructs was to test the in vitro effects of the VNTR on CAT expression in the natural genomic context, should secondary structure in the region be important.
In these constructs, the first and third IGF2 promoters (P1 and P3) were placed upstream of the chloramphenicol acetyltransferase (CAT) reporter gene. To these constructs (shown in Fig. 4A), we fused either a class I VNTR (of the 683 subclass) or a class III allele upstream of the INS promoter without altering any defined minimal INS promoter region sequence (33). Transfection efficiency was monitored by cotransfection with a plasmid containing the
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Our results demonstrate that VNTR alleles are associated with differences in IGF2 mRNA levels in human placenta, similar to those already demonstrated for INS in fetal and adult pancreas (2, 12). Previous in vivo studies in fetal thymus showed that the VNTR effect on INS transcription is tissue-specific and opposite to that in fetal pancreas (3), the effect being much more subtle in the pancreas compared with that in the thymus. More recent in vivo studies in fetal pancreas and thymus (34) did not reveal a transcriptional effect of the VNTR on IGF2 such as we saw in placenta; however, whether this reflects a tissue or developmental stage specificity of VNTR action is not known. Our in vitro data suggest hepatocytes as another transcriptional environment in which VNTR alleles modulate IGF2 expression. Additionally, the effects, if any, of the VNTR on the postnatal expression of IGF2 as well as its association with human disease in addition to type 1 diabetes remain open for future investigation. It is interesting to note, however, that there appears to be a significant genetic contribution to the interindividual variability of circulating IGF-II levels in humans (35).
Type 1 diabetes (previously referred to as insulin-dependent diabetes mellitus, or IDDM) is an autoimmune disorder culminating in the destruction of the insulin-producing beta cells of the pancreas. The disorder is of a multifactorial nature with a significant polygenic component in the susceptibility (36). The INS VNTR minisatellite is 1 of 16 mapped type 1 diabetes susceptibility loci and has been designated IDDM2, where the class I alleles are associated with susceptibility and the class III with protection (2, 16). The preferential paternal transmission of susceptibility haplotypes at IDDM2 in some populations studied suggests the involvement of an imprinted gene in the predisposition to type 1 diabetes that could lie at or near the VNTR, which may be under its transcriptional effects (2, 16, 37, 38). An obvious human imprinted gene that could be a candidate for allelic effects of the VNTR is IGF2, because of its imprinted status (expressed from paternal chromosomes in most tissues studied) (31, 32, 38, 39) and its proximity to the VNTR (less than 4.1 kb).
As is the case for pancreatic INS expression, the class I alleles are associated with an increase in the levels of IGF2 mRNA relative to the levels from the protective class III alleles in vivo. The in vitro effects of the VNTR on IGF2 P3-driven CAT expression parallel those demonstrated in the study of Lucassen et al. (13) who report an enhanced transcription of INS in the context of a class I VNTR-based construct, compared with a class III construct in transiently transfected pancreatic cells with an INS reporter gene construct. In fact, the magnitude of the transcriptional effect of the class I allele compared with the class III allele on IGF2, in vitro, is comparable to that shown for INS (1.5-3.1 times higher INS expression from class I VNTR constructs than class III (13); 1.5 times higher CAT activity from IGF2 P3-based constructs with class I VNTR than class III, this report). This difference parallels our in vivo results as well.
Additionally, it must be noted that the magnitude of the effects of class I over class III alleles was not that different from what we report here, in the studies evaluating the allelic effects of the VNTR on INS mRNA levels in human thymus and pancreas (no higher than 3-fold with an average of 2.5-fold along with an intersample and an interassay variability) (2, 3, 40). Whereas transgenic mice deficient for the IGF-II gene display a growth retardation and are 60% the size and weight of their wild-type littermates (41), it is not known how more subtle differences in IGF2 expression will affect normal growth and development. That such small differences in mRNA levels are indeed physiologically relevant comes from the observation that relaxation of normally occurring monoallelic IGF2 expression (i.e. loss of imprinting, leading to a theoretical 2-fold increase in mRNA) is believed to underlie certain cases of fetal macrosomia (42, 43) and many tumors including Wilms' (44, 45), rhabdomyosarcoma (46), choriocarcinoma (47), lung (48), glioma (49), and colorectal carcinoma (50). Finally, Igf2 transgenes introduced into mouse embryonic stem cells leading to a roughly 2-fold increase in Igf2 mRNA produced a parallel increase in the birth weight and organ weights of the chimeric fetuses (51).
The VNTR classes are composed of subclasses of specific alleles, which may in turn be polymorphic (2, 14) and may thus have potentially different allelic effects on the expression of IGF2. This may explain the range of transcript levels of placental IGF2 observed in this study and may also explain the variability observed in the studies on the insulin gene (3, 40). This is not without precedent as Green and Krontiris (5) have previously shown that specific VNTR alleles have different transcriptional effects in vitro in the context of the HRAS1 minisatellite 3' to the gene. The magnitude of the allelic effects in this latter study was variable among different subclasses and not considerably different from the variability and magnitude observed in our study and in those on INS (2, 3, 13, 40). More importantly, our study was performed in the context of physiologically relevant promoters and not on strong viral promoters (Rous sarcoma virus) as was done by Green and Krontiris (5). It should be noted that since we compared mRNA levels across samples, we should also expect a non-VNTR-dependent variability among individuals based on nutritional status and stage in labor of the mother, as well as other unlinked genetic and epigenetic factors.
Our in vitro data reflect the situation observed in most fetal tissues, where IGF2 is expressed predominantly from P2, P3, and P4 but not from P1 (52). A similar pattern of promoter expression is seen in the HepG2 cell line where, as shown by Northern blot analysis (29) and more recently using an RNase protection assay (53), the major transcript is 6.0 kb and originates from P3. To preserve the natural genomic context as much as possible, we used reporter gene constructs containing the genomic sequence around the VNTR including the insulin gene and its promoter up to and including the first IGF2 promoter (P1). Since the insulin gene is not transcribed in the HepG2 cells, there is no competition between its promoter and the IGF2 promoters. We completed the construct with the insertion of a 1.3-kb fragment containing the IGF2 P3 promoter elements, thus omitting an 18-kb intervening sequence because of considerations of plasmid size, transfection efficiency, and promoter usage. No significant CAT activity was detected when constructs containing IGF2 P1 but not P3 were tested; therefore, we cannot answer the question if the VNTR has similar effects on P1-derived transcription of IGF2 in this cell line which does not contain all the transcription factors necessary for P1 usage (data not shown).
The effects of the VNTR on INS expression as well as on
IGF2 suggest that the VNTR may be acting as a locus control
region, whose transcriptional effects act globally on INS
and IGF2. This also suggests possible VNTR effects on the
other IGF2 promoters, which lie within 24 kb, a distance
compatible with enhancer effects. One can argue that the allelic
effects of the VNTR on insulin gene expression are more pronounced (3,
39) than on IGF2 (what we observe in this study) because
INS lies closer to the VNTR (about 500 bp) than the
placental IGF2 promoters (more than 11 kb downstream). It is
remarkable that at this distance the VNTR still has allelic effects,
but it is not without precedent; it should be noted that a VNTR
contained in the sixth intron of the interleukin-1 gene
(approximately 6 kb downstream from its promoter) has also been seen to
influence interleukin-1
expression (11).
Functionally, the VNTR may be part of a nuclear matrix-attachment region and may influence the chromatin structure, modulating the accessibility of transcription factors to the nearby INS and IGF2 genes (54). Our speculation is that the shorter the number of tandem repeats, the greater the potential for the DNA not to be tethered to the nuclear matrix, thereby exposing a large chromatin loop (54) which facilitates transcription of the INS-IGF2 domain. One possibility is that the VNTR may act as a silencer of gene expression, whose effects could be proportional to the number of tandem repeats. Extrapolating from our results with the antisense VNTR construct, correct orientation may also be important for VNTR effects. As discussed above, the effects of the class I and class III alleles on INS gene expression are not the same in all tissues. For example, INS expression is higher from class I alleles in fetal and adult pancreas (2, 12), but in fetal thymus expression is higher from chromosomes with class III alleles (3, 40). Therefore, the regulation of gene expression modulated by alleles of this minisatellite may be more complex than initially thought and could therefore also involve allele-specific trans-acting factors whose effects on INS and IGF2 gene expression are tissue-specific and perhaps age-dependent. Finally, there is evidence that there may even be interactions or "cross-talk" between certain alleles since the preferential paternal transmission of diabetes susceptibility depends not only on the transmitted class I VNTR allele but also on the VNTR subclass of the untransmitted paternal allele (55).
It has been suggested previously (2, 21) that IGF2 may be a functional gene whose expression could be under transcriptional effects of the VNTR at the IDDM2 locus. We have proposed (21) that possible mechanisms by which INS VNTR effects on IGF2 transcription could determine susceptibility to type 1 diabetes include a role of pancreatic IGF-II in islet regeneration, a role of thymic IGF-II in thymocyte selection by apoptosis, or a T-lymphocyte IGF-II autocrine loop amplifying cellular immune response. In view of the absence of any discernible effects of the VNTR on IGF2 in these tissues, these mechanisms appear unlikely. If IGF2 is involved in the IDDM2 effect in addition to (or instead of) INS, is must be doing so through a less direct mechanism, such as through effects on fetal nutrition or size, which have been found in some studies to be correlated with type 1 diabetes risk (56). Regardless of its possible relevance to diabetes, the effect we observe here appears to constitute an important part of the genetic background effects on IGF2 expression levels, with obvious potential for genetic effects on fetal growth and its disturbances as well as risk of specific childhood tumors, noted recently to be linked to higher birth weights (57).
![]() |
ACKNOWLEDGEMENT |
---|
We thank the caseroom staff of Ste-Justine Hospital for their assistance in acquisition of placentae.
![]() |
FOOTNOTES |
---|
* This work was supported by the Medical Research Council of Canada (to C. D. and C. P.) and the Juvenile Diabetes Foundation International (to C. P.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Recipient of a doctoral fellowship from the Fonds pour la Formation de Chercheurs et l'Aide à la Recherche of the province of Quebec, Canada.
To whom correspondence should be addressed: Endocrine Service,
Rm. 1706, Ste-Justine Hospital Research Center, St-Justine Hospital,
3175 Cote-Ste-Catherine, Montreal, Quebec, Canada H3T-1C5. Tel.:
514-345-4735; Fax: 514-345-4988; E-mail: dealc{at}ere.umontreal.ca.
1 The abbreviations used are: VNTR, variable number of tandem repeats; IGF, insulin-like growth factor; kb, kilobase pair(s); RT, reverse transcription; PCR, polymerase chain reaction; bp, base pair(s); CAT, chloramphenicol acetyltransferase.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|