From the Howard Hughes Medical Institute, the
§ Department of Biochemistry, and the
Departments of
Pediatrics and Genetics, Emory University School of Medicine, Atlanta,
Georgia 30322
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Fragile X syndrome is caused by the
transcriptional silencing of the FMR1 gene due to a
trinucleotide repeat expansion. The encoded protein, Fmrp, has been
found to be a nucleocytoplasmic RNA-binding protein containing both KH
domains and RGG boxes that associates with polyribosomes as a
ribonucleoprotein particle. RNA binding has previously been
demonstrated with in vitro-translated Fmrp; however, it
remained uncertain whether the selective RNA binding observed was an
intrinsic property of Fmrp or required an associated protein(s). Here,
baculovirus-expressed and affinity-purified FLAG-tagged murine Fmrp was
shown to bind directly to both ribonucleotide homopolymers and human
brain mRNA. FLAG-Fmrp exhibited selectivity for binding poly(G) > poly(U) poly(C) or poly(A). Moreover, purified FLAG-Fmrp bound to
only a subset of brain mRNA, including the 3' untranslated regions
of myelin basic protein message and its own message. Recombinant
isoform 4, lacking the RGG boxes but maintaining both KH domains, was
also purified and was found to only weakly interact with RNA.
FLAG-purified I304N Fmrp, harboring the mutation of severe fragile X
syndrome, demonstrated RNA binding, in contrast to previous
suggestions. These data demonstrate the intrinsic property of Fmrp to
selectively bind RNA and show FLAG-Fmrp as a suitable reagent for
structural characterization and identification of cognate RNA
ligands.
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Fragile X syndrome, a common mental retardation syndrome, results from an unstable CGG repeat expansion in the 5'-untranslated region of the FMR1 gene, leading to transcriptional silencing and the absence of Fmrp protein (1-4). Characterization of in vitro-translated Fmrp has shown it to be an RNA-associated protein with selectivity for homopolymer RNA and some human brain transcripts (5, 6). Fmrp contains nuclear localization and export sequences (7), as well as RGG box and KH domain motifs found in many RNA-binding proteins. The RGG box has been found in hnRNP1 U, hnRNP A1, nucleolin, and fibrillarin and has been shown to autonomously bind homopolymeric RNA (8). However, the amino acid context surrounding the RGG box may influence the specificity and avidity of the RNA-nucleic acid interaction (8, 9). The KH domain is highly conserved in hnRNP K, yeast MER-1 splicing regulator, Sam68, and chicken vigillin, among other RNA-binding proteins (10).
Fmrp expression is widespread but not ubiquitous. The majority of Fmrp is associated with polyribosomes and has been found to form an mRNP, which can be stripped from ribosomes by EDTA or RNase treatment (11-14). A prevailing model suggests that Fmrp directly binds specific mRNAs in the nucleus as part of a hnRNP particle and then mediates its transport to the cytoplasm and delivery of the mRNP to the ribosome (4, 7).
Homopolymer binding assays performed with in vitro-translated Fmrp and carboxyl-terminal truncated Fmrp proteins suggested a role for both the KH domain and RGG box in RNA binding (15). However, whether the observed RNA binding by Fmrp is mediated directly by the KH domain or through a KH-associated protein present in the translation mixture is unknown (5, 6, 12, 15). Prior to this work, all RNA binding studies with Fmrp were performed in cell lysates. Because these in vitro systems contain concentrated quantities of ribosomes and other translation factors and because Fmrp has been shown to associate with mRNP particles and polyribosomes, direct binding of the Fmrp and RNA could not be verified. Because Fmrp associates with large protein complexes, we could not disregard the possibility that another protein in the translation mix was actually binding the RNA and that Fmrp was associating tightly yet peripherally with an RNA-binding protein in the RNP complex (5, 6, 11-14). Furthermore, if the Fmrp was truly making direct contact with the RNA, the specificity of the interaction might be modulated by other proteins bound to Fmrp. Similar situations exist for other RNA-binding proteins, such as the mammalian erythropoietin RNA-binding protein ERBP (16) and the Drosophila SR splicing proteins (17).
We report here that the RNA binding activity and specificity of Fmrp is an intrinsic property of the protein. The purified FLAG-Fmrp binds in a salt-resistant manner to ribonucleic homopolymers with a high affinity for poly(G) and poly(U) but with weak affinity for poly(C) and poly(A). Purified Fmrp also binds specifically to the 3'-untranslated region of its own message and a subset of human brain transcripts. In addition, an isoform 4 of Fmrp, lacking RGG boxes, was shown to only weakly bind RNA, whereas the I304N mutation of the second KH domain was found to retain RNA binding ability. These studies show that purified recombinant Fmrp is suitable for further biochemical and structural studies and will be a useful reagent to identify cognate mRNAs.
![]() |
EXPERIMENTAL PROCEDURES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Materials-- Baculovirus transfer vector pVL1393 and Sf9 cells were obtained from Invitrogen Corp. BaculoGold wild type baculovirus was purchased from Pharmingen, and Grace's medium, pluronic F-68, and antibiotic/antimycotic were purchased from Life Technologies, Inc. M2 matrix, FLAG peptide, and anti-M2 monoclonal antibody were from Kodak Scientific Imaging Systems. Secondary antibodies and ECL reagents were from Amersham Pharmacia Biotech. CNBr-activated Sepharose 4B (Amersham Pharmacia Biotech) was conjugated with polyadenylic, polyguanylic, polycytidylic, or polyuridylic acid (Sigma). Bacterial vector pQE31 and Ni-NTA resin were obtained from Qiagen. Anti-Fmrp primary antibody was a generous gift from Jean-Louis Mandel.
Fmrp Constructs-- The baculoviral constructs used in wild type Fmrp production were constructed by inserting the sequence GACTACAAGGACGACGATGACAAG encoding the FLAG epitope into full-length fmr1 cDNA between the second and third amino acids. The fmr1 Mc2.17 cDNA (18) includes 123 bases upstream of the translational start codon, all 17 exons and 2288 bases of 3' untranslated region, including a terminal poly(A)17 tail. Briefly, polymerase chain reaction was performed using an upstream primer (5'ACCTCCCGGAGGATGGAGGACTACAAGGACGACGATGACAAGGAGC TGGTGGTGGAAGTGC-3') containing at its 5'-terminus an EcoN1 restriction site (underlined), a methionine and glutamate codon followed by sequence encoding the FLAG epitope, and a downstream primer (5'-ATGAAATCTTGAGGCAAGCTGCC-3'). The fragment was digested with EcoN1 and BstB1. The purified oligo was then cloned into Mc2.17 in pBS KS+ previously restricted with EcoN1 and BstB1, deleting the endogenous sequence between the 5' EcoN1 site and the initiating ATG of fmr1. The cloning junctions were sequenced to verify the correct protein reading frame. For the I304N point mutant Fmrp construct, a SacII/SnaBI fragment carrying the FLAG epitope was removed from the wild type cDNA and ligated into the Mc2.17 point mutant cDNA that was previously restricted with SacII and SnaBI and that carried the A to T missense at nucleotide 1034 (19). For the wild type and I304N constructs, a 3.9-kb EcoRI fragment containing the full, tagged cDNA without the 3'-terminal 256 bases of the 3'-UTR was cloned into the nonfusion baculovirus pVL1393 vector downstream of the AcMNPV enhancer-promoter. These constructs were co-transformed into Sf9 cells with BaculoGold AcMNPV DNA using a cationic liposome method as recommended (Invitrogen). Sf9 cells were cultured in 1× Grace's medium with 10% FBS, 0.1% pluronic F-68, and 1 × antibiotic/antimycotic (Life Technologies, Inc.). Occlusion body-negative recombinant plaques on an Sf9 cell lawn were visually identified, isolated, and purified by screening crude cell lysates for recombinant protein production via Western blotting using anti-FLAG M2 and/or anti-Fmrp primary antibody. Viral DNA was extracted from high titer stocks and sequenced to confirm the amino acid codon at position 304.
For isoform 4 Fmrp production, the coding region of Mc2.14 (18) was modified by polymerase chain reaction to add SacI and SalI sites to the ends of the coding fragment. The fragment was subsequently ligated in frame to the SacI/SalI digested vector pQE31 (Qiagen). This construct places the His6 tag 5' to the polylinker. The pQE expression construct was then transformed into the M15[pREP4] E. coli host strain (Qiagen), which carries the pPREP4 repressor plasmid. Transformants were selected on plates containing both ampicillin and kanamycin and were screened for the insert.Recombinant FLAG-Fmrp-- In Sf9 cells, virus was amplified to high titer by serial infections with plaque-purified, protein-producing virus as recommended (Invitrogen). Large scale purification of recombinant protein was performed as follows: 4 × 108 cells were infected with high titer virus for 72 h at a multiplicity of infection = 5 in spinning culture. Cells were harvested and resuspended in PBS, pH 7.2-7.4, containing 1 M NaCl and protease inhibitors: 1 µg/ml pepstatin, 2 µg/ml leupeptin and aprotinin, 10 mM N-ethylameleimide, 2 mM iodoacetamide and diisopropyl fluorophosphate, and 100 µg/ml phenylmethylsulfonyl fluoride. Cells were disrupted by nitrogen cavitation for 10 min at 450 psi and subjected to centrifugation at 14,500 × g for 20 min, followed by shearing the supernatant through an 18-gauge needle before centrifugation at 60,000 × g for 1 h. Soluble protein was loaded onto an anti-FLAG M2 affinity column, washed with 1 × PBS, 1 M NaCl, protease inhibitors, and eluted with 150 µg/ml FLAG peptide. Fractions were analyzed via Coomassie Blue-stained SDS-PAGE gel, Western blotting, and Bradford protein concentration assay (Bio-Rad). Fractions containing FLAG-Fmrp were dialyzed against 1× PBS, 0.75 M NaCl, 10% glycerol for 2 h; against 1× PBS, 0.5 M NaCl, 10% glycerol for 2 h; and against 1× PBS, 0.3 M NaCl, 10% glycerol overnight. Buffer to sample ratio was 1000:1 for each dialysis.
Recombinant His6 Isoform 4 Fmrp--
Briefly,
bacteria containing the His6 isoform 4 construct were grown
at 37 °C in Luria broth containing 50 µg/ml carbenicillin and 25 µg/ml kanamycin until the A600 reached 0.8. We
used carbenicillin, a less labile, semisynthetic form of ampicillin,
for selection to ensure plasmid maintenance (QIAexpressionist, Qiagen).
Recombinant protein production was then induced by the addition of
isopropyl-1-thio--D-galactopyranoside to a final
concentration of 2 mM for 5 h, and the cells were
harvested at 4000 × g for 10 min. For purification,
the cells were lysed for 1 h in Buffer A (6 M GuHCl,
0.1 M sodium phosphate, 0.01 M Tris-HCl, pH
8.0), followed by centrifugation at 10,000 × g for 15 min at 4 °C. The supernatant was subjected to a Ni-NTA column that
was previously equilibrated with Buffer A. The column was then washed
with 10 column volumes of Buffer B (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl, pH 8.0)
followed by 5 column volumes of Buffer C (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl, pH 6.3)
until the A280 was less than 0.01. Recombinant His6 isoform 4 Fmrp was eluted with 18 ml of Buffer D (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl, pH 5.9), followed by 18 ml of Buffer E (8 M urea, 0.1 M sodium phosphate, 0.01 M Tris-HCl, pH 4.5). 3-ml fractions were collected and
analyzed by SDS-PAGE.
Homopolymer Assays-- Assays were performed according to previously established procedures (15, 21). Briefly, homopolymer RNA was conjugated to CNBr-activated beads previously washed with 1 mM HCl and then conjugated with RNA either in carbonate buffer, pH 8.0, for primary amine linkage (Amersham Pharmacia Biotech; as recommended), MES buffer, pH 6.0, for aromatic amine linkage (22), or potassium phosphate buffer, pH 8.5, for 5' phosphate linkage (23), 8-72 h at 4 °C. Beads were washed with three volumes of conjugation buffer and then twice with 100 mM Tris-HCl, pH 8.0, and blocked for at least 4 h in 100 mM Tris-HCl, pH 8.0. After blocking, the beads were washed in alternating high/low pH buffers (Amersham Pharmacia Biotech; as recommended), and conjugation efficiency was determined via alkaline hydrolysis of an aliquot overnight at room temperature. The amount of nucleic acids released was determined by measuring absorbance at 258 nm. Samples of identically prepared, mock conjugated naked beads were alkaline hydrolyzed and analyzed to exclude background absorbance. The absorbance values and extinction coefficients were used to equalize input of immobilized homopolymer RNA for each binding reaction. Experiments shown were performed with beads prepared in the carbonate buffers. Indicated amounts of FLAG-Fmrp and approximately 5 µg of homopolymer RNA beads were at 30 °C in 0.5 ml of binding buffer (100 mM NaCl, 10 mM Tris-HCl, pH 7.5, 2.5 mM MgCl2, 2.5% Triton X-100) or the buffer indicated. After incubation, the beads were washed 5 times for 10 min each at 4 °C in 0.5 ml of binding buffer. The second wash contained 1 mg/ml heparin. Beads were pelleted at 12,000 rpm in a microcentrifuge, resuspended in SDS sample buffer, boiled for 20 min, and pelleted. Supernatants were transferred to fresh tubes and pelleted, and 50% of the volume was loaded on a 12% SDS-PAGE minigel for electrophoresis (Bio-Rad). This procedure was used to equalize the amount loaded for each reaction and to avoid loading agarose matrix onto the gel. Fmrp eluted from the beads was detected by Western blotting using enhanced chemiluminesence (Amersham Pharmacia Biotech).
Ultraviolet Cross-linking Assays-- Full-length (4.2 kb) fmr1 message containing all 17 exons was transcribed and 32P-labeled in vitro with T3 polymerase (Stratagene) using 44 µCi of 32P-UTP. One microgram of 4.2-kb Mc2.17 sequence (19) in pBS SK+ vector restricted with XhoI served as template. Fmr1 message (500 ng, ~4.7 × 106 counts) was mixed with protein in 30-µl reactions in 1× ERBB binding buffer. The mix was incubated at 30 °C for 30 min and uv cross-linked on ice 11 times for 30 s (120 mJ) each (24). RNase A (Sigma) was added, and the mix was incubated at 37 °C for 10 min. SDS sample buffer was added, and the sample was boiled for 3-5 min and then loaded on 7.5% SDS-PAGE minigels (Bio-Rad). Gels were silver-stained, and autoradiography was performed overnight.
Filter Binding Assays-- Recombinant Fmrp and 32P-labeled full-length fmr1 message as described above were mixed in 50-µl reaction volumes of 1× ERBB buffer for 30 min at 30 °C. Nitrocellulose filters (Millipore, HAWP 025 00) were pretreated with 0.4 M potassium hydroxide for 40 min, 0.1 M Tris-HCl, pH 7.0-7.9, for 30 min, and binding buffer for 5 min prior to use. The reaction mix was filtered (~10 s), and the filters were washed with 2.5 ml of IPP150 (150 mM NaCl, 10 mM Tris-HCl, pH 8.0, 0.1% Nonidet P-40, 0.1% NaN3) (25). Specific activity for the fmr1 probe was 1.5 × 104 counts/fmol (see Fig. 5A) and 7.28 × 103 counts/fmol (see Fig. 5C). Filters were dried, and the nucleic acids retained on the filter were dried and quantitated via scintillation counting (Beckman).
Fmr1 and Human Brain Transcript Binding Assays--
Fmr1
cDNA (Mc2.17 cloned into pBS KS+)18 message containing
all 17 exons was linearized with either XhoI (+3'-UTR) or
NsiI (3'-UTR) and then transcribed, as described above,
and biotinylated in vitro (6). For human brain transcript
assays, plasmid DNA from each randomly chosen clone in a
pCMV-SPORTTM human brain cDNA library (Life
Technologies, Inc.) was linearized by NotI restriction,
transcribed, and biotinylated in vitro using Sp6 polymerase
(Stratagene). Each message (80 ng) was mixed with 250 ng of FLAG-Fmrp
in 1× ERBB buffer and incubated in a 10-µl reaction volume at
30 °C for 30 min. The RNA was captured with streptavidin-linked
magnetic beads (Dynal) and washed three times for 10 min each with 0.7 ml of IPP150 buffer at room temperature. Protein was eluted by boiling
the beads in SDS-sample buffer, and visualized via SDS-PAGE and Western
blotting. Alternatively, the messages were mixed with 2 µl of
TnTR transcription/translation mix (Promega) containing
either 35S-labeled wild type Fmrp or
35S-labeled isoform 4 Fmrp. Neither of the
35S-labeled proteins had the FLAG epitope. Reactions were
performed as above, and the protein was eluted by boiling the beads in
protein sample buffer, separated by 12% SDS-PAGE, visualized via
phosphorimage, and quantitated by MacBas, version 2.0, software.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Expression and Purification-- The mouse cDNA Mc2.17 encodes the Fmrp with 97% amino acid identity and greater than 98% predicted amino acid similarity to human FMRP (18). We have inserted an eight-amino acid FLAG peptide epitope tag between the second and third amino acids of Fmrp and cloned the full-length construct into the pVL1393 baculovirus transfer vector. Cotransfecting Sf9 insect cells with pVL1393-FLAG-fmr1 and linear BaculoGold DNA yielded recombinant baculovirus expressing FLAG-Fmrp using its natural ATG start codon controlled by the polyhedrin promoter. Cell lysates analyzed by SDS-PAGE gels stained for protein show that cells infected with the recombinant baculovirus produce an extra ~85-kDa protein band (Fig. 1, A and C). Western analysis using the anti-FLAG M2 primary antibody detected the FLAG-tagged protein in infected cell lysates only, and showed no cross-reactivity to insect proteins (Fig. 1B). Western analysis using monoclonal anti-Fmrp primary antibody detects the same protein band, with no cross-reactivity to insect cell proteins, confirming its identity as FLAG-Fmrp (data not shown). Similar to Fmrp-translated in vitro and endogenous full-length FMRP in human lymphoblastoid cells, the recombinant protein migrates with an anomalously high apparent molecular weight, larger than predicted from primary amino acid sequence (26). After lysing the cells, FLAG-Fmrp was purified by affinity chromatography using anti-FLAG M2 antibody matrix and analyzed by Coomassie Blue-stained SDS-PAGE and Western blotting (Fig. 1, C and B, respectively). One hundred ml of Sf9 cell suspension culture at 1 × 106 to 3 × 106 cells per ml produced approximately 1 mg of purified FLAG-Fmrp protein.
|
Homopolymer Binding-- We next asked whether the purified recombinant Fmrp displayed the biochemical properties previously observed for Fmrp that had been translated and assayed within wheat germ extract or rabbit reticulocyte lysate (5, 15). The importance of this question may not be intuitive; our first assumption was that if the protein had not become denatured during purification, then it would behave identically to the unpurified in vitro-translated Fmrp. However, upon careful examination of previous work and considering that Fmrp is one component of multiprotein mRNPs or translation machinery, we could not be certain that Fmrp was the component of the translation lysate that directly bound the mRNA (11-14). We performed RNA binding assays with the purified protein, using homopolymer RNAs conjugated to Sepharose beads (21). The purified FLAG-Fmrp preferentially bound poly(G) much stronger than poly(U) and barely bound poly(C) or poly(A). This specificity is identical to that previously observed with in vitro-translated Fmrp (5) (Fig. 2A).
|
|
uv Cross-linking-- Earlier studies with in vitro-translated Fmrp indicated that it associates with its own message (6). To demonstrate direct binding of Fmrp to its own message, we performed a uv cross-linking assay. As shown by autoradiograph in Fig. 4A, radiolabeled full-length 4.2-kilobase fmr1 message was mixed in a binding reaction with purified recombinant Fmrp. The reaction was then cross-linked by uv irradiation, treated with RNase, and separated by 7.5% SDS-polyacrylamide gel electrophoresis. The gel was silver-stained to visualize Fmrp, and then autoradiography was used to detect message cross-linked to protein. One microgram of bovine serum albumin failed to cross-link to any fmr1 message (Fig. 4A, lane 3), whereas with increasing amounts of Fmrp, there was a concomitant increase in the amount of message cross-linked to the protein (Fig. 4A, lanes 4-8). With increasing Fmrp concentrations, a higher molecular weight band became apparent; at 4.8 µg of Fmrp, it became the predominant labeled band (Fig. 4A, lane 8). Both species were recognized by either anti-Fmrp or anti-FLAG antibodies (data not shown). The basis for the appearance of the higher molecular weight species is unclear at the present time.
|
mRNA Binding-- Filter binding assays were performed as an additional method to assess RNA binding. 32P-labeled fmr1 message alone exhibited a low binding capacity when up to 1 nM quantities were passed through 0.45 µm nitrocellulose filters. However, when premixed with 5.7 nM purified Fmrp, the binding of the labeled fmr1 message increased with increasing RNA levels, as judged by captured radioactivity (Fig. 5A). Saturation appeared evident at approximately 500 pM message. When the binding assay was repeated with 57 nM Fmrp, a 10-fold increase in bound radioactivity was observed at all RNA concentrations tested.
|
|
I304N Fmrp-- The FLAG-tagged version of Fmrp was modified to produce the I304N missense mutation of severe fragile X syndrome (19). It previously been suggested that this amino acid change results in the unfolding of the second KH domain and may abrogate RNA binding (30). This speculation was supported by the reduced binding of in vitro-translated I304N Fmrp to poly(G) RNA and abolished binding of in vitro-translated I304N Fmrp to poly(U) RNA at 250 mM NaCl (15). Here, recombinant I304N Fmrp was purified as described above for wild type Fmrp and subjected to homopolymer binding. As shown in Fig. 7, I304N protein clearly bound selectively to poly(G), although with slightly reduced yield as compared with wild type; this is seen more clearly in the poly(U) experiments.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We have used the baculovirus system to express high levels of
FLAG-Fmrp and purify the protein to apparent homogeneity under relatively nondenaturing conditions. The purified FLAG-Fmrp protein appears biochemically intact and active. It displays the same homopolymer association properties as in vitro-translated
Fmrp, binding poly(G) > poly(U) poly(C) and poly(A). The RNA
binding activity is therefore an intrinsic property of the Fmrp
molecule, independent of Fmrp interaction with other proteins. This
point is of some significance. Because previous studies did not utilize purified preparations, it had remained unclear whether or not the
selectivity and, indeed, RNA binding were functional attributes of Fmrp
alone or required association with other proteins. The selective RNA
binding demonstrated by the purified protein will now allow the capture
and characterization of cognate RNA species by epitope-immobilized
purified Fmrp.
We have also demonstrated that FLAG-Fmrp directly binds to the 3'-untranslated portion of its own transcript. Moreover, of the two RNAs found in this study to bind Fmrp well, one was the 3'-UTR of myelin basic protein. Although it is difficult at the present time to discern any similarity between these RNA sequences that may direct binding, the observation of 3'-UTR interaction is interesting. The 3'-UTRs of mRNA have been found to often be targets for RNA-binding proteins, the interactions of which may regulate translational efficiency and or mRNA stability (31-35). Although it is premature to interpret the Fmrp binding to the 3'-UTRs of both its own message and that of myelin basic protein, one might speculate a functional significance. Additional studies, such as adding either 3'-UTR to a reporter construct and transfecting into normal and Fmrp-deficient cells, are needed.
It was also demonstrated, utilizing both in vitro-translated and purified protein, that a naturally occurring isoform of Fmrp, isoform 4, is severely impaired in RNA binding. This isoform is devoid of exon 14-coded residues and, because of a frameshift at the alternative splice, has a distinct carboxyl terminus (18). The loss of exon 14 results in the absence of the nuclear export signal from Fmrp, leading to nuclear localization (7), whereas the alternative carboxyl terminus no longer contains the RGG box (18, 36). Because isolated KH domains have been considered sufficient to direct RNA binding (37), it is unexpected that isoform 4 interacts only weakly with RNA. It is possible that either the RGG box directs RNA binding or any or all of the absent sequences alter the conformation of the KH domains, limiting their ability to interact with RNA. Whatever the mechanism, these data imply that isoform 4 does not bind RNA as well as the wild type does. It is also confined to the nucleus, thereby having significantly distinct attributes from the full-length Fmrp. Because it is possible that isoform 4 may still interact with at least some of the nuclear proteins that normally constitute the mRNP along with full-length Fmrp (13), isoform 4 may act to sequester these proteins, perhaps limiting the formation of the normal Fmrp mRNP. Although it is possible that the purification and refolding of isoform 4 may have produced a nonnative conformation in the protein, parallel studies with in vitro-translated isoform 4 support the observed impaired RNA binding of this isoform.
In contrast to the diminished RNA binding of isoform 4, we demonstrate that protein bearing the I304N mutation in the second KH domain of Fmrp retains a significant amount of RNA binding ability. This is in contrast to earlier studies that speculated that, based upon NMR-derived structure of an isolated KH domain, the I304N mutation should abolish RNA binding due to complete unfolding of the KH structure (30). Our observation of RNA binding by the purified I304N protein (albeit slightly less than the wild type protein, but with selectivity similar to that of the wild type protein) suggests that the I304N mutation is not destabilizing when incorporated within the full-length protein. The unfolding of the isolated KH domain, apparently caused by this mutation, was supported by work of Siomi et al. (5, 15), which showed that in vitro-translated I304N Fmrp lost poly(U) binding in 250 mM NaCl, whereas wild type protein did not. We also demonstrate that purified I304N protein has a greater salt sensitivity than wild type protein in regard to poly(U) binding (in 100 mM NaCl, the I304N protein was unable to bind poly(U) but retained poly(G) binding). Our observation of a more severe salt sensitivity with the purified mutant protein than the in vitro-translated protein (which could bind poly(U) at 100 mM NaCl (15)) may suggest that interacting proteins within the reticulocyte lysate may partially stabilize the I304N Fmrp. Indeed, this possibility is supported by our recent observation that the human cellular I304N FMRP retains RNA binding in vivo but forms a mRNP of altered mass and density, suggesting that the mutation influences protein-protein interaction more than RNA-protein interaction at physiological salt concentrations (13).
As described above, recombinant epitope-tagged forms of Fmrp can be prepared in mg quantities at near homogeneous levels of purity. The observations that wild type purified Fmrp has autonomous and selective RNA binding, whereas the I304N mutation in the second KH domain exhibits selective RNA binding with a greater salt sensitivity, demonstrate that the functional attributes of the protein were maintained throughout the purification process. The significant reduction in RNA binding by isoform 4 suggests distinctive functional attributes for this alternatively spliced form of Fmrp. Based on the above characterization of the purified proteins, structural studies of Fmrp are now possible, the results of which should shed considerable insight specifically into Fmrp and, more broadly, into KH domain proteins in general.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank David Uhlinger, Fuping Zhang, and Claude Ashley for technical assistance.
![]() |
FOOTNOTES |
---|
* This work was supported in part by Grants R37 HD20521 and P01 HD35576 from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ An associate of the Howard Hughes Medical Institute.
** An investigator of the Howard Hughes Medical Institute. To whom correspondence should be addressed: Howard Hughes Medical Institute, Emory University School of Medicine, 4035 Rollins Research Center, 1510 Clifton Rd., Atlanta, GA 30322. Tel.: 404-727-5979; Fax: 404-727-5408; E-mail: swarren{at}bimcore.emory.edu.
1 The abbreviations used are: hnRNP, human nuclear ribonucleoprotein; mRNP, messenger ribonucleoprotein particle; ERBB, 20 mM HEPES, pH 7.9, 2 mM MgCl2, 10 µM ZnCl2, 0.02% Nonidet P-40, 70 mM NH4Cl; UTR, untranslated region.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|