HOX proteins are dependent upon cofactors of the
PBX family for specificity of DNA binding. Two regions that have been
implicated in HOX/PBX cooperative interactions are the YPWM motif,
found N-terminal to the HOX homeodomain, and the GKFQ domain (also
known as the Hox cooperativity motif) immediately C-terminal to the PBX
homeodomain. Using derivatives of the E2A-PBX oncoprotein, we find that
the GKFQ domain is not essential for cooperative interaction with HOXA1
but contributes to the stability of the complex. By contrast, the YPWM
motif is strictly required for cooperative interactions in
vitro and in vivo, even with mutants of E2A-PBX
lacking the GKFQ domain. Using truncated PBX proteins, we show that the
YPWM motif contacts the PBX homeodomain. The presence of the GKFQ
domain increases monomer binding by the PBX homeodomain 5-fold, and the
stability of the HOXA1·E2A-PBX complex 2-fold. These data suggest
that the GKFQ domain acts mainly to increase DNA binding by PBX, rather
than providing a primary contact site for the YPWM motif of HOXA1. We
have identified 2 residues, Glu-301 and Tyr-305, required for GKFQ
function and suggest that this is dependent on
-helical
character.
 |
INTRODUCTION |
Hox genes are widely conserved regulators of
anteroposterior patterning during animal development (1). The 39 mammalian Hox genes are expressed in overlapping domains and
confer positional identity along the body axes (1, 2). The
Hox genes encode homeodomain-containing transcription
factors that bind a degenerate site with a TAAT core (3). Whereas
modest binding-site preferences exist, these appear insufficient to
account for specificity of action in vivo. The PBC (PBX and
CEH-20) subfamily of homeodomain proteins (4), including PBX
(pre-B-cell transformation-related gene) (5) and EXD (extradenticle)
(6), are cofactors that greatly increase the specificity of HOX
proteins. PBX is the mammalian homolog of Drosophila
exd. The latter was first identified in a genetic screen for
patterning defects in the fly (6, 7). The homeodomain proteins encoded
by PBC genes cooperatively interact with HOX proteins to
bind an extended site on DNA and regulate transcription in
vivo (8-17). PBC proteins improve HOX specificity due to the
increased size of the cooperative binding site and the strength of DNA
binding and by modulating recognition of cooperative binding sites by
different groups of HOX proteins (15, 16, 18-24).
The human PBX family comprises three genes, PBX1,
PBX2, and PBX3 (25). PBX1 was
initially discovered through the study of the t(1:19) chromosomal
translocation causing 25% of all acute pre-B cell leukemia (26, 27).
This translocation fuses the powerful transcriptional activation
domains of E2A to the homeodomain and C terminus of PBX1, creating the
novel transcription factor, E2A-PBX. The oncogenicity of E2A-PBX has
been demonstrated in focus-forming assays, myeloid differentiation
assays, and in mice (5, 28, 29). Studies done to uncover the regions of
E2A-PBX required for transformation have identified the transcriptional activation domains as essential (30, 31). However, the homeodomain was
found to be dispensable for oncogenic transformation in focus-forming assays and transgenic mice (30, 31), although it is required to block
myeloid differentiation (31). This raised the question of how E2A-PBX
could alter target gene expression without a DNA-binding domain.
HOX proteins could interact with homeodomain-containing E2A-PBX and
localize it to regulatory sites on DNA. This supposes that E2A-PBX
would cause transformation by the misregulation of Hox gene
targets. There are a number of arguments supporting this model. The
leukemia induced by E2A-PBX is characterized by a block in
differentiation and Hox genes are known to regulate
hematopoietic differentiation (32). Misexpression of Hox
genes is known to cause leukemia (33-36). There is also evidence that
the combined misexpression of Hox genes and the PBX-related
gene Meis1 causes leukemia in BXH-2 mice (37).
It is therefore of interest to examine closely the interactions between
HOX proteins and E2A-PBX to better understand how PBX contributes to
HOX specificity and to assess the above model of E2A-PBX
transformation. Two regions outside the homeodomains have been
implicated in HOX/PBX interactions. The YPWM motif (and variants
thereof) is found in many HOX proteins N-terminal to the homeodomain
(38). This motif is required for any significant interaction with PBX
or EXD (11, 14, 17, 20, 24, 39-42). In PBX, a conserved region
immediately following the C terminus of the homeodomain has also been
shown to influence cooperative interactions (40, 43-45) and has been
designated the Hox cooperativity motif (HCM) (44). The HCM, referred to
as the GKFQ domain in this paper, has been proposed as a possible
contact site for the YPWM motif (21, 40, 44).
Here we report that the GKFQ domain of PBX is not essential to form a
cooperative complex with HOXA1 but does contribute to complex
stability. We have mapped important residues of the GKFQ domain and
shown that its function is likely to depend on an
-helical structure. We further demonstrate that the primary YPWM contact site is
located in the PBX homeodomain and not in the GKFQ domain. The GKFQ
domain does, however, increase monomer PBX binding. We therefore
conclude that the GKFQ domain contributes to many HOX/PBX interactions
by stabilizing contacts with DNA. A secondary role in interprotein
interactions is not excluded and may be more important for interaction
with a subset of HOX proteins including HOXB7.
 |
EXPERIMENTAL PROCEDURES |
Plasmid Construction--
The E2A-PBX mutants were constructed
by two different approaches. EP
GKFQ was generated by polymerase
chain reaction mutagenesis so as to create two new restriction sites:
an EcoRI site at base pair 863 (GAATCC to GAATTC) of the
PBX1A open reading frame, resulting in a single silent change, and a
HindIII site at base pair 926 (CAGCTG to AAGCTT). The latter
introduced two codon changes: T309K and V311F. The E2A-PBX mutants
A302P, F298P, and N303A/I304A/Y305A were generated by introducing a
68-mer double-stranded oligonucleotide into these new restriction
sites. EP pswt,1 which
reintroduced wild-type E2A-PBX sequence while retaining the new
restriction sites, was also produced in this manner. All other mutants
were subsequently generated by site-directed mutagenesis (Sculptor
Mutagenesis System, Amersham Pharmacia Biotech) in M13. All E2A-PBX
derivatives were cloned in the pSG5 expression vector (46) (Stratagene)
allowing both in vitro transcription/translation and
expression in mammalian cells. PBX 233-319 and 233-294 were constructed by polymerase chain reaction amplification using primers that incorporated start and stop codons and NdeI and
BamHI sites to clone into pET16b (Novagen). All constructs
were verified prior to use. The primers used were:
5'GGGAATTCCATATGGCGCGGCGGAAGAGAC3', 5'CCCAAGCTTGGATCCTCAATGGGCTGACACATTGG3', and
5'CGGGATCCTCAGTTCTTCTTGTACCG3'.
Protein Expression and Purification--
The truncated HOXA1
proteins used in these experiments (amino acids 185 to the C terminus)
were expressed as His-tagged fusion proteins and batch-purified from
Escherichia coli MC1061 using an imidazole elution protocol
as described previously (20). They were stored at
80 °C in 200 mM Na2PO4 (pH 7.4), 500 mM NaCl, 10 mM
-mercaptoethanol, 0.01%
Triton X-100, 300 mM imidazole, and 20% glycerol.
His-tagged PBX constructs were expressed in E. coli
BL21(DE3)pLysS. Cultures were grown at 37 °C to an
A600 of 0.9, induced with
isopropyl-1-thio-
-D-galactopyranoside to 1 mM and grown at 30 °C for 3 h. Cells were pelleted
by centrifugation at 5,000 × g for 20 min, resuspended
in binding buffer (5 mM imidazole, 0.5 M NaCl,
20 mM Tris-HCl, pH 7.9, supplemented with urea to 6 M), and sonicated. The extract was clarified by
centrifugation at 12,000 × g for 20 min followed by
filtration through a 0.45-µm filter. Protein was batch-purified by
incubating the clarified extract with nickel-charged chelating
Sepharose beads (Amersham Pharmacia Biotech) for 1 h at 4 °C
followed by washing twice with 10 ml of binding buffer and three times
with 10 ml of 1× washing buffer (60 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9, supplemented with urea to 6 M). Protein was refolded by stepwise 1 M decreases in the urea concentration in the washing buffer
with a 20-min equilibration period between each buffer change. Protein
was eluted with 1× elution buffer (1 M imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) and stored at
80 °C in 20% glycerol. Protein concentrations were determined by
the Bradford assay (47).
The E2A-PBX proteins were produced using a TnT in vitro
coupled transcription/translation kit (Promega). The amount of
translated protein was quantified by [35S]Met
labeling.
Transient Transfection--
Transient transfections were done in
human embryonic kidney 293 cells as described previously for P19 cells
(20). Human embryonic kidney 293 cells were cultured in
-minimal
essential medium supplemented with 10% fetal calf serum (Life
Technologies, Inc.) and antibiotics (penicillin and streptomycin)
(Sigma).
Electrophoretic Mobility Shift Assay (EMSA), HOX Titrations, and
Dissociation Rate Experiments--
EMSA was done as described
previously (11) with the following modifications: 8 ng of His-tagged
HOXA1 and 2.0 µl of in vitro translated E2A-PBX
derivatives or 16 ng of His-tagged PBX protein were used per 10 µl of
reaction. Final buffer conditions were 10 mM Tris (pH 7.5),
75 mM NaCl, 30 mM imidazole, 1 mM
dithiothreitol, 1 mM EDTA, 5.4 µg of bovine serum
albumin, 12.7% glycerol, and 80 ng of poly(dI-dC)/10 µl. The
following 32P-labeled DNA probe was used (one strand
shown): 5' TCACCATGATTGATGGGCGACTGCTCGG 3'. This contains the "G6"
cooperative binding site 5'-TGATTGATGG-3'. Quantification of
steady-state bands was determined using a Fuji Bas2000 Imager.
A range of HOX protein concentrations (0-200 nM) was
incubated as described above either alone or with 30 ng of PBX
233-294. Quantification of bands was determined using a Fuji Bas2000
Imager. Titration data was plotted using the GraFit program (48) and fitted to the equation describing cooperative binding:
y = ([L]n *
capacity)/(Kd + [L])n where
[L] is the concentration of ligand and n is the
cooperativity factor.
Dissociation rate experiments were performed by adding 450 ng/µl of
unlabeled double-stranded competitor DNA (identical to the labeled DNA
binding site) at time 0 following a 50 min preincubation period at room
temperature of proteins with labeled DNA. Samples (7 µl) were loaded
at 3, 10, 15, 20, 25, and 40 min. The fraction of labeled DNA bound at
each time point was determined using a Fuji Bas2000 Imager. The log of
this value was plotted against time to get a line of best fit where the
slope is equivalent to the negative Kd, the
dissociation rate constant. Half-lives were determined using the
equation t1/2 =
log(0.5)/Kd.
 |
RESULTS |
The GKFQ Domain Is Not Essential for Cooperative Interactions
between HOXA1 and E2A-PBX Nor Is It the Primary Contact Site for the
YPWM Motif--
Thirteen residues immediately following the PBX
homeodomain are highly conserved across species (Fig.
1B). We call this the GKFQ
domain, after the first 4 residues. The GKFQ domain has been reported
to be important for cooperative interactions between HOX and PBX (40,
43, 44, 49) and, based on comparison to MATA1/MAT
2, has been
predicted to adopt an
-helical structure (50-52). A deletion of the
13 conserved amino acids in this region was made to study its
importance (Fig. 1A). In addition, we have conducted an
alanine/proline scan through the GKFQ domain (Fig. 1C).
Whereas most residues were mutated to alanine, those that are already
alanine or that are alanine in one or more of the known homologs of
PBX1, were instead mutated to proline. Proline was chosen since it
should disrupt the putative
-helical structure (53). Two other
mutations outside the GKFQ region were introduced in wild-type E2A-PBX
to facilitate the creation of these mutants by the introduction of new
restriction sites (see "Experimental Procedures"). This variant of
wild-type, called EP pswt, contains the changes T309K and V311F. The
change T309K is found naturally between PBX1 and EXD, whereas residue
311 lies outside of the most conserved region (Fig. 1B).
There was no difference between the activity of EP pswt and wild-type
E2A-PBX as measured by the dissociation rates of cooperative complexes
(data not shown). In transfection experiments, transcriptional
activation by EP pswt was approximately twice that of wild-type E2A-PBX
(Fig. 3).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 1.
A description of proteins used in this study
and the degree of GKFQ domain conservation among homologs.
A, derivatives of E2A-PBX1A and PBX1. E2A-PBX1A pseudo wild
type (EP pswt, see "Experimental Procedures") was used as the
parent for the alanine scan of the GKFQ domain (black box).
The E2A and PBX1A halves of the oncoprotein are marked. HD designates
the PBX homeodomain. EP GKFQ is a deletion mutant of EP pswt lacking
amino acids 296 through 308 (PBX1A numbering system is used throughout)
(25). Two other truncated PBX proteins were constructed containing the
isolated PBX homeodomain (PBX 233-294) or the PBX homeodomain with a
short C-terminal extension including the GKFQ domain (PBX 233-319).
B, the GKFQ domain of human PBX1 and its homologs including
human PBX2 and PBX3 (25), Drosophila EXD (7), and the
Caenorhabditis elegans CEH-20 (57). The residues in each
homolog and EP pswt that differ from PBX1 are indicated in
lowercase characters. A consensus is provided below where
residues in uppercase are 80% identical and those in
lowercase are at least 50% identical to PBX1. The
shaded area contains those residues that were subjected to
an alanine scan. C, residues of the GKFQ domain were
generally mutated to alanine. However, those that were already alanine
or were alanine in one of the homologs of PBX1, were mutated to
proline. A deletion of the entire 13 amino acids from 296 through 308 (EP GKFQ) was also constructed. All proteins shown in C
are derived from EP pswt. PBX 233-319 and 233-294 are derived from
wild-type PBX1.
|
|
Initially, we wished to assess the overall importance of the GKFQ
domain to HOX/E2A-PBX steady-state cooperative DNA binding and to
assess the possibility that the GKFQ domain serves as the primary
contact site for the YPWM motif (Fig. 2).
The mutant EP
GKFQ (Fig. 1A) lacks the GKFQ domain due to
an internal deletion of residues 296 through 308. Nonetheless, EP
GKFQ is still able to form a heterodimeric complex with HOXA1 (Fig.
2, compare lanes 5 and 7). The GKFQ domain is
therefore not essential for HOXA1/E2A-PBX interactions. By contrast,
mutation of the key tryptophan and methionine residues of the YPWM
motif of HOXA1 (HOXA1 WM
AA) abolishes interactions with EP pswt and
EP
GKFQ (Fig. 2, compare lanes 6 and 8).
Together, these results strongly suggest that the GKFQ domain of PBX is
not the primary site of contact of the HOX YPWM motif. Mutation of the
PBX GKFQ domain or the HOX YPWM motif does not have equivalent
consequences, as would be the case if these two domains were mutual
primary contact sites.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 2.
The GKFQ domain contributes, but is not
essential to HOX/PBX interactions in vitro. Mutations
of the GKFQ domain (EP GKFQ) and the YPWM motif of HOXA1 (HOXA1
WM AA) were tested for cooperative interaction by EMSA. The HOXA1
proteins were bacterially expressed and purified, whereas the E2A-PBX
proteins were in vitro translated. A nonspecific band
derived from the reticulocyte lysate is indicated. This and all
subsequent experiments were performed with a double-stranded
radiolabeled probe having a G6 cooperative binding site
(5'-TGATTGATGG-3') (20).
|
|
Transient transfection experiments confirmed these results in
vivo. Expression vectors for either EP pswt or the mutant EP
GKFQ were cotransfected with a luciferase reporter bearing a minimal
promoter driven by cooperative binding sites for HOX·PBX complexes
(pML(5XHOX/PBX)) (11). Comparable to our results in EMSA, deletion of
the GKFQ domain from EP pswt reduced but did not abolish
transcriptional activation (Fig. 3,
compare bars 3 and 4). The EP
GKFQ mutant
retains 18% of the activity of EP pswt and 40% of true E2A-PBX wild
type, which was less active in this assay.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
The GKFQ motif contributes, but is not
essential to HOX/PBX interactions in vivo. The
histogram summarizes the results of transient transfection assays
comparing the effect of deletion of the GKFQ domain (EP GKFQ) of
E2A-PBX and the alanine-proline scan on transcriptional activation. 1 µg of expression plasmid for the indicated proteins was transfected
into HEK 293 cells along with carrier DNA, a luciferase reporter
plasmid carrying five copies of a HOX·PBX cooperative binding site
(pML(5XHOX/PBX)) and an internal lacZ control. Standard
error of the mean is shown, n = 3.
|
|
The Binding Site for the YPWM Motif Is in the PBX
Homeodomain--
Since the YPWM motif does not primarily interact with
the GKFQ domain, the possibility that its major binding site resides in
the PBX homeodomain was addressed using truncated recombinant proteins.
PBX 233-319 contains the homeodomain plus 24 residues spanning the
C-terminal GKFQ domain, whereas PBX 233-294 is the isolated
homeodomain (Fig. 1A). The GKFQ domain was not essential to
form a DNA-bound heterodimer with HOXA1 (Fig.
4A, compare lanes 5 and 8). Rather, the PBX homeodomain alone was able to
interact with HOXA1 to form a heterodimeric complex bound to DNA.
Moreover, this interaction was highly YPWM dependent (Fig.
4A, compare lanes 8 and 9),
demonstrating that the primary binding site for the YPWM motif of HOXA1
is in the PBX homeodomain rather than the GKFQ domain.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
A, the binding site for the YPWM motif
is in the PBX homeodomain. The EMSA compares the relative abilities of
the isolated PBX homeodomain, PBX233-294, and the PBX homeodomain plus
the GKFQ domain, PBX233-319, to bind as heterodimers with HOXA1 and
HOXA1(WM AA). B, HOXA1 and PBX233-294 form cooperative
complexes. Symbols used: , HOXA1; HOXA1/PBX233-294. The
x scale shows the log concentration of the HOX partner used
in the titration.
|
|
Based on the percentage of probe bound, the HOXA1·PBX 233-294
heterodimeric complex is 90-fold more abundant than would be predicted
by chance association of the monomeric constituents on the same
fragment of DNA. This is strongly suggestive of cooperative DNA
binding. To prove that the interaction between HOXA1 and PBX 233-294
was indeed cooperative, we first established a linear range of HOXA1
monomer binding spanning three orders of magnitude. The HOXA1 prepared
for this experiment displayed a lower amount of monomeric DNA binding
activity than the preparation used in Fig. 4A. In general,
HOXA1 displays poor DNA binding activity as a monomer (54), but
variation in the extent of binding does occur between preparations. We
then measured the amount of probe bound by the heterodimeric complex in
the presence of a fixed amount of PBX 233-294. A plot of the fraction
of probe bound versus the concentration of HOXA1 (log scale)
revealed a strongly sigmoidal curve (Fig. 4B), the signature
of cooperative interactions (55). The use of HOXA1 mutated in the YPWM
motif failed to yield detectable levels of heterodimeric complex
formation with PBX 233-294 (data not shown.) This experiment firmly
establishes the cooperative nature of the interaction between HOXA1 and
the PBX homeodomain and makes clear that this is dependent on the YPWM
motif in the HOX partner. We conclude that the YPWM directly contacts
the PBX homeodomain to promote cooperative DNA binding.
The GKFQ Domain Is Dependent on
-Helical Character and Requires
Conserved Residues--
We wished to determine the importance of
specific residues of the GKFQ domain to HOX/PBX interactions in the
context of full-length E2A-PBX. The effects of GKFQ domain mutations
(Fig. 1C) on the stability of the HOXA1/E2A-PBX complexes
were assessed in dissociation rate experiments (Fig.
5). Deletion of the entire GKFQ domain (EP
GKFQ) decreased complex stability by 49% (24.1 min from 46.6 min, Fig. 5, compare lanes 1 and 2). This was
consistent with the transient transfection data wherein the deletion of
the GKFQ domain caused 82% loss of transcriptional activation (Fig. 3, compare lanes 3 and 4). Two types of mutation,
those predicted to disrupt
-helical character (alanine to proline)
and those predicted to reveal functional residues (mutations to
alanine) were then tested.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 5.
Mapping GKFQ domain residues which are
critical to HOXA1/E2A-PBX complex stability. The histogram is a
summary of dissociation rate experiments in which a vast excess of cold
competitor (see "Experimental Procedures") was added to preformed
HOXA1/E2A-PBX complexes bound to radiolabeled probe and loaded at 6 different time points over the course of 40 min. A half-life was
calculated based on the rate of dissociation of the radiolabeled probe
over time. Average values, n = 2 or 3 are shown.
|
|
Three of four mutations to proline (F298P, A302P, and A306P/A307P) had
similar deleterious effects. In transient transfections, between 91 and
95% of transactivation activity was lost (Fig. 3, compare bar
3 with bars 7, 10, and 13). In
dissociation rate assays, 39-44% of complex stability was lost
compared with EP pswt (Fig. 5, compare bar 1 with bars
5, 8, and 11). These results imply that
-helical character is important in this region. The G296P mutation
had no effect, perhaps because
-helical structure at the start of
the region is not present or not required. Of residues mutated to
alanine, 2 were shown to decrease both transactivational activity and
the stability of E2A-PBX·HOXA1 complexes on DNA. The E301A mutant
decreased E2A-PBX·HOXA1 transactivation by 85%, similar to deletion
of the whole GKFQ region (Fig. 3, compare bars 4 and
9). Dissociation rate assays were consistent with this observation, with complex stability on DNA decreased to 57% of EP pswt
values, similar to the destabilization observed when the whole region
was deleted (Fig. 5, compare bars 2 and 7).
Mutation of Tyr-305 either alone, Y305A, or in the triple mutant,
N303A/I304A/Y305A, reduced transactivation relative to EP pswt values
(Fig. 3, compare bar 3 with bars 11 and
12) by 89 and 74%, respectively, and complex stability to
68% of EP pswt values (Fig. 5, compare bar 1 with bars 9 and 10). Since Tyr-305 is the only
strictly conserved residue in the NIY triplet and both mutations have a
similar effect, Tyr-305 is considered to be the functional residue.
The GKFQ Domain Contributes to PBX Monomer Binding--
Since the
GKFQ domain is not critically involved in protein-protein interactions
through the YPWM motif, it was considered that it may improve the
stability of HOX·E2A-PBX complexes by increasing the affinity of DNA
binding by PBX. The importance of the GKFQ domain for PBX monomer
binding was assessed with truncated proteins (Fig. 1A).
Equal amounts of PBX homeodomain (PBX 233-294) and PBX homeodomain
with the GKFQ domain (PBX 233-319) bind DNA with comparable efficiency
(Fig. 6, lanes 1 and
2). However, when these two proteins must compete with one
another for DNA binding sites, the presence of the GKFQ domain confers
5-fold better binding (Fig. 6, lane 5). This corresponds
well with the 6-fold difference seen between the amount of cooperative
complex formed with HOXA1 and each of these recombinant PBX proteins
(Fig. 6, lanes 3 and 4).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 6.
The GKFQ domain increases PBX monomer
binding. The EMSA compares the monomer binding of PBX 233-319 to
that of the isolated PBX homeodomain, PBX 233-294. Their binding was
compared as monomers in heterodimeric complexes with HOXA1 and in
competition for probe in the same reaction. Twice as much labeled probe
was added in lane 5 to permit better visualization of both
bands. There was an approximately 60-fold molar excess of protein over
probe.
|
|
The loss of the GKFQ domain also caused a similar 6-fold decrease in
the stability of cooperative complexes formed with HOXA1. The complex
of HOXA1 with PBX 233-319 had a half-life of 36 s (average of
three experiments). Removal of the GKFQ (HOXA1·PBX 233-294)
decreased the half-life markedly. It is difficult to measure the amount
of complex remaining at time points earlier than 20 s after
addition of competitor. In one experiment, there was no remaining
HOXA1·PBX 233-294 complex at 20 s. In a second experiment, a
small amount of complex remaining at 20 s allowed us to calculate
a half-life of 6 s, six times shorter than that obtained with the
GKFQ domain.
 |
DISCUSSION |
Two Models Describe the Roles of the YPWM Motif and the GKFQ
Domain--
Although domains important for cooperative interactions
between HOX and PBX proteins have been identified, the manner in which they act remains unclear. We have examined two reported domains of
importance for HOX/PBX interactions: the YPWM motif found N-terminal to
the HOX homeodomain, and the conserved region immediately C-terminal to
the PBX homeodomain, which we have named the GKFQ domain. Previously, two models have been proposed to describe the relative activities of
these elements. In the first, the GKFQ domain is the primary contact
site for the YPWM motif and is required for cooperative interaction
with HOX proteins (44). In the second model, the YPWM motif contacts
the PBX homeodomain, possibly in the loop separating helices 1 and 2 (45, 56) and/or in a hydrophobic pocket formed between helices 1 and 2 (45).
In support of a direct interaction between the HOX YPWM motif and the
PBX GKFQ domain, two groups have reported that deletion of the GKFQ
domain eliminates nearly all interactions with HOXB7 (40, 45). On the
basis of these results and molecular modeling, it was proposed that
these two regions contact each other in the DNA-bound heterodimer (21,
44). The GKFQ domain was thus designated the Hox cooperativity motif or
HCM (44).
The second model is supported by data showing that HOXA5 can weakly
interact with the isolated homeodomain of PBX and that addition of a
free peptide containing the HOXA5 YPWM motif increases the monomer
binding of the PBX homeodomain (43). Fusion of the YPWM motif to the
PBX homeodomain also caused a similar increase in monomer binding,
whereas the addition of the GKFQ domain to the PBX homeodomain
increased its monomer binding 5-fold. Mutations in the GKFQ domain
generally had a similar effect on monomer binding and cooperative
interactions with HOXA5 (43). It was therefore proposed that the YPWM
motif contacts the PBX homeodomain directly, and that the role of the
GKFQ domain may be restricted to a direct DNA binding function.
The GKFQ Domain Is Not Essential for HOXA1/PBX
Interaction--
Our results are consistent with a primary interaction
of the YPWM motif of HOXA1 with the homeodomain of PBX. In contrast to
the first model, we find that the GKFQ domain is not absolutely required for HOX/PBX interactions. Nonetheless, in the context of
full-length E2A-PBX1A, we find that the GKFQ domain improves HOX·E2A-PBX·DNA complex stability in vitro (Fig. 5) and
increases transactivational activity in vivo (Fig. 3). Our
deletion of positions 296-308 removed the most highly conserved
residues C-terminal to the homeodomain. Although it is possible that
compensatory residues lie in the moderately conserved region that
follows the GKFQ domain, we note that deletion of the entire region
C-terminal to residue 309 of PBX had no effect on cooperativity with
either HOXB7 or ENGRAILED-2 (45). We suggest that there is a
differential requirement for the GKFQ domain, depending on the HOX
partner involved. Thus, the HOXB7 protein (44, 45), unlike HOXA1 (this study), HOXA5 (43), and ENGRAILED-2 (45), is unable to interact substantially with PBX in the absence of the GKFQ. The linker region
separating the YPWM motif of HOXB7 from the homeodomain is shorter than
for any of the HOX proteins that show some independence from the GKFQ
domain. It is possible that the HOXB7 linker length or composition
imposes physical constraints, leading to stronger dependence on GKFQ
domain function. Regardless of the explanation, the more modest
contribution of the GKFQ domain to cooperativity with HOX proteins from
paralog groups 1 and 5 suggests that the term "Hox cooperativity
motif" is not a generally applicable designation for this region of
PBC family proteins.
The YPWM Motif Contacts the PBX Homeodomain--
To resolve
whether the YPWM motif contacted the GKFQ domain or the PBX
homeodomain, we compared the relative importance of the YPWM motif and
the GKFQ domain for cooperativity. If the YPWM motif primarily
contacted the GKFQ, the removal of the GKFQ domain should be as
deleterious to cooperative interactions with HOX proteins as the loss
of YPWM function. Instead, we find that mutation of the YPWM motif is
far more disruptive than the deletion of the GKFQ domain (Fig. 2),
demonstrating that the latter is not the primary contact site for the
YPWM motif. Furthermore, we have shown that the isolated PBX
homeodomain is able to cooperatively interact with HOX proteins in a
YPWM-dependent manner (Fig. 4), establishing that a binding
site for the YPWM motif is found within the PBX homeodomain. It does
remain possible that the GKFQ domain serves a secondary role in
contacting the YPWM motif, perhaps helping to form or stabilize the
primary YPWM contact site in the PBX homeodomain. Our results are
supported by the findings of other groups (43, 45), which implicate the
3 amino acid insertion in the extended loop of the PBX homeodomain and
hydrophobic residues in helix 1 as HOX YPWM motif contact sites.
The GKFQ Domain Contributes to PBX Monomer Binding--
The
presence of the GKFQ domain increased by 5-fold the ability of the PBX
homeodomain to bind DNA as a monomer when competing against the PBX
homeodomain alone (Fig. 6, lane 5). The enhanced monomer
binding of PBX233-319 was mirrored in the 5-fold abundance of
PBX233-319·HOXA1 over PBX233-294·HOXA1 complex observed in steady-state binding conditions (Fig. 6, lanes 3 and
4) and in the 6-fold increase in the stability of the
cooperative complex in dissociation rate experiments. Thus, the
increase in monomer PBX binding is sufficient to explain the increased
stability seen in E2A-PBX·HOXA1 cooperative complexes.
The GKFQ Domain Contributes to E2A-PBX·HOXA1 Complex
Stability--
It was thought, based on comparison to MATa1/MAT
2
proteins, that the GKFQ domain of PBX might form an
-helix (50-52).
Our mutational analysis supports this hypothesis since three mutations to proline (F298P, A302P, and A306P/A307P) destabilize E2A-PBX·HOXA1 complexes by 39-49% (Fig. 5) and result in 91-95% decreases in transactivation of a reporter gene (Fig. 3). The disruption of
-helical structure in this region would result in the mispositioning of functional GKFQ domain residues. It is possible that some of the
residues mutated to proline are actually functional rather than
structural residues. This is unlikely to be the case for the A302P and
A306P/A307P mutants since the alanine residues could only provide a few
hydrophobic interactions, and the loss of these contacts would be
unlikely to cause the large effects observed. Phe-298 is the only
residue mutated to proline that may also be functional, even though it
is not strictly conserved in the PBC family (Fig. 1B). Lu
and Kamps (43) have shown that an F298A mutation, a natural
substitution occurring in EXD and CEH-20 (Fig. 1B), does
decrease PBX233-326·HOXA5 steady-state binding and PBX233-326 monomer binding, indicating that Phe-298 may also play a role in GKFQ
domain function.
In this study, Glu-301 and Tyr-305 were shown to be the 2 main
functional residues in the GKFQ domain. The E301A mutation decreased
complex stability to 57% (26.4 versus 46.6 min) and transactivation to 15% of the EP pswt value. Glu-301 is an acidic residue that could participate in hydrogen bonds or in an ion pair with
either lysine or arginine. Glu-301 has been mutated by Lu and Kamps
(43) to arginine. They observed a large decrease in steady-state
monomer binding of a PBX233-326 and a corresponding decrease in
cooperative complex formation with HOXA5, consistent with the effects
we observe. The highly polar nature of Glu-301 argues against it
participating in hydrophobic contacts to the YPWM motif of HOXA1 or
HOXA5.
The Y305A mutation decreased cooperative complex stability by 32% and
transactivation by 89%. Tyr-305 could participate in a hydrogen bond
or in hydrophobic interactions but could also stack with other aromatic
residues. Mutation of Tyr-305 by Lu and Kamps (43) to phenylalanine
showed no effect in their assays, suggesting that Tyr-305 does not form
a hydrogen bond. Coupled with the results presented here, we suggest
that Tyr-305 participates in important hydrophobic interactions or in a
stacking interaction with another aromatic amino acid in the PBX
homeodomain, thus stabilizing conformation and promoting contacts to
DNA.
An
-helical wheel projection (Fig. 7)
predicts that Glu-301, Tyr-305, and Phe-298 would lie on the same face
of an
-helix, suggesting that they interact with PBX homeodomain
residues that are close together in space. Further structural studies
will be required to address the specific contacts made by Glu-301 and Tyr-305 to the PBX homeodomain.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 7.
An -helical wheel representation of the
GKFQ domain. The boxed amino acids are those that
decreased stability and transactivation when mutated to alanine in this
study (Glu-301 (E301), Tyr-305 (Y305)) or
decreased monomer PBX 233-326 binding in the study by Lu and Kamps
(43) (Phe-298 (F298)).
|
|
We thank Dr. Michael Phelan for recombinant
HOXA1 protein and Peter Pawelek for help with the GraFit computer
program.