(Received for publication, March 3, 1997, and in revised form, April 23, 1997)
From the Cold Spring Harbor Laboratory, Cold Spring
Harbor, New York 11724, the § Genetics Program, State
University of New York at Stony Brook, Stony Brook, New York 11794, and
the ¶ Howard Hughes Medical Institute,
Cold Spring Harbor, New York 11724
The human small nuclear (sn) RNA promoters contain a proximal sequence element (PSE), which recruits the basal transcription factor SNAPc, and a distal sequence element characterized by an octamer sequence, which recruits the POU domain transcription factor Oct-1. The Oct-1 POU domain and SNAPc bind cooperatively to probes containing a PSE and an octamer sequence, and this effect contributes to efficient transcription in vitro. In vivo, however, Oct-1 regions outside of the POU domain can activate snRNA gene transcription. Here, we have examined whether the role of these regions is to contribute to cooperative binding with SNAPc. We find that they indeed improve cooperative binding, but most of the effect is nevertheless mediated by just the POU domain. This suggests that Oct-1 activates transcription of snRNA genes in at least two steps, recruitment of SNAPc mediated primarily by the POU domain, and a later step mediated by regions outside of the POU domain. We also show that a PSE-binding complex observed in nuclear extracts consists of Oct-1 and SNAPc. Although Oct-1 cannot bind effectively to the PSE probe on its own, in the complex it contacts DNA. Thus, in a nuclear extract, SNAPc can recruit Oct-1 to a probe to which Oct-1 cannot bind on its own.
Transcriptional activators are key regulators of RNA polymerase II transcription, but their mode of action is still poorly understood. Activators often consist of a DNA-binding domain, whose role is to target the activator to the correct promoter, and of activation domains, whose role is to enhance transcription (1). The activation domains may help recruit members of the basal transcription machinery to the promoter, enhance transcription elongation, or perhaps trigger modifications of the basal machinery that result in enhanced transcription initiation (2-6) (see Refs. 7 and 8, for reviews).
The RNA polymerase II and III snRNA1 gene promoters both contain an essential proximal sequence element (PSE), which recruits the basal transcription factor SNAPc (also called PTF) (9-11), and a distal sequence element, which serves as a transcriptional enhancer and is characterized by the presence of an octamer sequence. The octamer constitutes a binding site for both the Oct-1 and Oct-2 POU domain transcription factors, but the distal sequence element is thought to recruit Oct-1. Indeed, like snRNA genes, Oct-1 is broadly expressed, whereas Oct-2 is a B cell-specific factor (see Ref. 12, for a review). Moreover, in vivo, the Oct-1 and Oct-2 activation domains display promoter specific activities; the Oct-1 activation domains preferentially activate snRNA promoters, whereas the Oct-2 activation domains preferentially activate transcription from mRNA promoters (13, 14). This differential activation results from differences in the mRNA and snRNA basal promoter elements, suggesting that the Oct-1 and Oct-2 activation domains interact differentially with promoter-specific basal transcription factors (13).
Both the Oct-1 and Oct-2 POU domains bind cooperatively with SNAPc/PTF to a probe containing a PSE and an octamer sequence, and at least in the case of the Oct-1 POU domain, this cooperative binding promotes increased levels of transcription in vitro (9, 15). The observation that in vivo, Oct-1 regions outside of the POU domain activate snRNA gene transcription, and do so much more efficiently than Oct-2 regions outside of the POU domain, suggests that the POU domain is not sufficient for transcription activation in vivo (16). How do Oct-1 regions outside of the POU domain contribute, then, to transcription activation?
Here we have tested whether Oct-1 regions outside of the POU DNA-binding domain play any role in cooperative binding with SNAPc to probes containing a PSE and an octamer sequence. We find that they do contribute to cooperative binding but most of the effect is mediated by the POU domain, suggesting that the Oct-1 activation domains play their primary role at a later step in the activation process. We also show that in crude nuclear extracts, a complex consisting of Oct-1 and SNAPc forms on a probe containing a PSE-binding site but lacking an octamer site. Formation of the complex is dependent on the ability of Oct-1 to bind DNA, and indeed Oct-1 contacts DNA in the complex. Thus, in the very complex mixture of proteins that constitutes a nuclear extract, SNAPc can recruit Oct-1 to a probe to which Oct-1 cannot bind on its own.
Constructs
Constructs for PCR ProbesThe plasmids containing the H2B
octamer site and human U6 PSE were previously described (15). The
plasmid containing the H2B octamer site was described previously (17).
The plasmids AD (also referred to in the text as mouse U6 PSE probe)
and the mouse U6 PSE probe with the ABC mutation were generated by
annealing two oligos, filling in with the Klenow fragment of DNA
polymerase, cutting with BamHI and HindIII, and
inserting into pUC118. This resulted in plasmids containing
inserts with the sequences
GGATCCGAAACTCACCCTAACTGTAAAGTAATTGTGTTTCTTGGCTTCTCGAGCCTTGTGGAAGCTTAAG and
GGATCCGAAACTCCCACTACCGGTCCAGTAATTGTGTTTCTTGGCTTCTCGAGCCTT-GTGGAAGCTTAAG for the AD plasmid and the plasmid containing the mouse U6 PSE with the
ABC mutation, respectively. The N7 plasmid has been previously described (18). Probes were generated by PCR amplification of these
constructs using the universal sequencing primer end-labeled with
[-32P]ATP and T4 polynucleotide kinase and the reverse
sequencing primer. The probes AD-mutHD and AD-short were generated by
PCR with the plasmid AD as a template and primers with the sequences TCACACAGGAAACAGCTATGACCATGACCACGAATTCG and AGCTCGGTACCCGGGGATCC, respectively, substituted for the reverse sequencing primer. All the probes were generated with the same radiolabeled primer and had,
therefore, the same specific activity.
The pET11c.G.POU-1 and pET11c.G.Pit-1 POU constructs, which contain the Oct-1 POU and Pit-1 POU domains fused to the glutathione S-transferase (GST) gene, were previously described (19, 20). The constructs pET11c.H.Oct-1 and pET11c.H.1.P.1 were generated by PCR amplification of a plasmid containing the Oct-1 coding sequence and pBSoct-1(H)P(Pf)1 (20), respectively, using oligonucleotides with the sequences GGGAATTCCATATGCATCACCATCACCATCACAACAATCCGTCAGAAACCAG and ACGCGGATCCTCACTGTGCCTTGGAGGC. The PCR products were cleaved with NdeI and BamHI and ligated into pET11c cleaved with NdeI and BamHI.
Sources of Proteins
SNAPcThe SNAPc used in these experiments was derived from a Mono Q peak fraction, which corresponds to the fourth step in the purification of SNAPc and is purified approximately 2,500-fold (10). The total protein concentration in the fraction is approximately 0.3 mg/ml.
Expression and Purification of Oct Proteins in Escherichia coliAll proteins were expressed in E. coli BL21 (DE3) cells using the T7 expression system (21) as described previously (20). The Oct-1 POU, Oct-1 POU R49A, and Pit-1 POU domains were expressed as GST fusion proteins and were purified with glutathione-agarose beads (Sigma). In some cases the GST moiety was removed by cleavage with thrombin and dialyzed against buffer D (20 mM HEPES, pH 7.9, 100 mM KCl, 0.5 mM EDTA, 20% glycerol, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride). Proteins were analyzed by SDS-polyacrylamide gel electrophoresis and visualized by Coomassie Blue staining. In all cases the proteins appeared to be greater than 90% pure. Protein concentrations were measured by the Bio-Rad protein assay (Bio-Rad).
Histidine-tagged proteins were produced by growing 1-liter cultures of E. coli BL21 (DE3) cells expressing histidine-tagged Oct-1 (H.Oct-1) or histidine tagged Oct-1.P.1 (H.Oct-1.P.1) as described above. The cells were lysed by sonication in OctQ buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 0.1% Tween 20, 5% glycerol, 5 mM 2-mercaptoethanol, 0.5 mM phenylmethylsulfonyl fluoride, 1 µg/ml pepstatin A, 1 mM benzamidine, 2 µg/ml aprotonin, 1 µg/ml leupeptin). Cell lysate was centrifuged at 40,000 × g for 30 min. Supernatant was collected and passed over a Mono Q 10/10 column (Pharmacia). The flow-through fractions were kept and dialyzed against OctQ buffer containing 1 M NaCl. Protein was applied to a 1.5-ml Ni-NTA column (Qiagen) and eluted with a gradient from 0 to 40 mM imidazole. Fractions containing octamer binding activity were then dialyzed against OctQ buffer containing 100 mM NaCl and applied to a Mono S 5/5 column (Pharmacia) and eluted with a salt gradient from 0.1 to 1 M NaCl. Fractions containing octamer binding activity were pooled and dialyzed against buffer D. Protein purity and concentration were assessed by the same method as with the POU domains above except that the protein gels were stained with silver. For both Oct-1 and Oct-1.P.1, a number of truncated proteins were visible below the full-length products. Oct-2 and the Oct-2 POU domain were a generous gift of Dr. Masafumi Tanaka (Cold Spring Harbor Laboratory).
Nuclear ExtractsHeLa cell nuclear extracts were prepared as described (22).
EMSA
The binding reactions were performed in a total volume of 20 µl containing final concentrations of 100 mM KCl, 20 mM HEPES, pH 7.9, 5 mM MgCl2, 0.2 mM EDTA, 10% glycerol, 20 µg of fetal calf serum as a protein carrier, 2 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 0.4 µg each of poly(dI-dC) and pUC118. The amounts of SNAPc and Oct proteins added are indicated in the figure legends. The reactions were incubated at room temperature for 20 min before addition of 25,000 cpm (50-100 pg) of radiolabeled DNA probe followed by a 30-min incubation at room temperature. The reactions were electrophoresed through 5% nondenaturing polyacrylamide gels (acrylamide/bisacrylamide ratio, 39:1) in 1 × TGE running buffer (50 mM Tris base, 380 mM glycine, 2 mM EDTA) at 150 V for 4.5 h at room temperature. The gels were dried and autoradiographed. The intensities of the signals were measured with a Fuji BAS1000 PhosphorImager.
OP-Cu Footprinting
EMSA reactions containing 16 µl of SNAPc, O.4 µg of His-Oct-1, and 100,000 cpm of DNA probe in a total volume of 80 µl were performed as described above. In-gel footprinting reactions were performed essentially as described (23, 24) except that the reactions were performed at 4 °C. The gel was washed with 600 ml of 50 mM Tris, pH 8.0. The wash solution was removed and the gel was immersed in 400 ml of 50 mM Tris, pH 8.0, 40 ml of solution A (2 mM 1,10-phenanthroline, 0.45 mM CuSO4), and 40 ml of solution B (58 mM 3-mercaptopropionic acid). The cleavage reaction was allowed to proceed for 13 min and stopped by the addition of 40 ml of 28 mM 2,9-dimethyl-1,10-phenanthroline. The gel was incubated for an additional 15 min at 4 °C and 10 min at room temperature. The gel was subject to autoradiography and the bands corresponding to specific protein-DNA complexes, as well as free probe, were excised. Gel slices were eluted overnight in 0.4 ml of 0.1% SDS, 5 mM EDTA, 20 mM Tris, pH 8.0. Eluted DNA was extracted with phenol:chloroform (1:1), precipitated with ethanol, and analyzed on a 6% polyacrylamide (19:1), 8 M urea, 0.5 × TBE sequencing gel. The gel was dried and autoradiographed.
The Oct-1 and Oct-2 POU domains can recruit the SNAP complex
to the PSE in vitro (9, 15). To determine (i) whether
regions outside of the POU domain contribute to such recruitment of
SNAPc to the PSE, and (ii) whether the Oct-1 regions
outside of the POU domain are more active in this process than the
Oct-2 regions outside of the POU domain, we compared the abilities of
Oct-1, the Oct-1 POU domain (POU-1), Oct-2, and the Oct-2 POU domain (POU-2) to recruit SNAPc to a PSE in an EMSA. We used a DNA
probe containing the H2B octamer sequence, a high affinity binding site for Oct-1 and Oct-2, and the human U6 PSE, a low affinity binding site
for SNAPc. With this combination of sites, Oct proteins can substantially increase the binding of SNAPc to the low
affinity PSE, and the effect is therefore easily visualized (15). As shown in Fig. 1A, when SNAPc was
added to the probe alone, a weak protein-DNA complex was formed
(lane 2). However, when SNAPc and increasing
amounts of full-length Oct-1 (lanes 3-11), Oct-1 POU (lanes 12-20), full-length Oct-2 (lanes 21-29),
or Oct-2 POU (lanes 30-38) were added together to the
probe, a slower migrating complex was formed, whose intensity increased
with increasing amounts of Oct proteins to levels much higher than
those observed in the absence of Oct proteins. The slower migration
indicated that SNAPc and the respective Oct proteins occupy
the same probe, and the enhanced binding shows that the Oct proteins
recruit SNAPc to the PSE, as observed previously for the
Oct-1 and Oct-2 POU domains (15).
Oct-1 is more active than Oct-1 POU in
recruiting SNAPc to the PSE. A, EMSA with a
probe containing the H2B octamer motif and a human U6 PSE in the
absence of proteins (lane 1) or with 5 µl of a
SNAPc fraction (Mono Q fraction (10)) alone (lane 2) or 5 µl of the SNAPc fraction with increasing amounts of His-Oct-1 (0.05, 0.1, 0.2, 0.4, 0.8, 1.6, 3.2, 6.4, and 12.8 ng in lanes 3-11), Oct-1
POU (0.01, 0.02, 0.04, 0.08, 0.16, 0.32, 0.64, 1.28, and 2.56 ng in
lanes 12-20), Oct-2 (1.25, 2.5, 5, 10, 20, 40, 80, 160, and
320 pg in lanes 21-29), and Oct-2 POU (0.1, 0.2, 0.4, 0.8, 1.6, 3.2, 6.4, 12.8, and 25.6 pg in lanes 30-38). The positions of the free probe and of the complexes containing the Oct-1
or Oct-2 POU domains (POU), Oct-2, His-Oct-1, SNAPc
together with Oct-1 or Oct-2 POU (SNAPc/POU), or
SNAPc together with His-Oct-1 or Oct-2
(SNAPc/Oct) are indicated. B, EMSA performed
with a probe containing the H2B octamer motif and a human PSE in the
absence of proteins (lane 1) or with increasing amounts of
the various Oct proteins indicated above the lanes (lanes
2-37). The amounts of each Oct protein in the titrations were
identical to those used in A. The positions of the complexes
containing Oct-1 or Oct-2 POU (POU), Oct-2, and His-Oct-1 are
indicated. C, graph showing the fold enhancement of
SNAPc binding by the different Oct proteins. The
y axis corresponds to the fold enhancement of SNAPc recruitment by the various Oct proteins as determined
by dividing the amounts of SNAPc·Oct-1 (),
SNAPc·Oct-2 (
), SNAPc·Oct-1 POU (
),
and SNAPc·Oct-2 POU (
) complexes obtained in
panel A by the amounts of complexes formed with
SNAPc alone (lane 2). The x axis
corresponds to the amount of complexes formed by the different Oct
proteins in the absence of SNAPc in panel B. The quantitations were performed with a PhosphorImager.
To quantitate the enhancement of SNAPc binding by the different Oct proteins, we first determined the amounts of DNA binding activity in the different Oct protein preparations by performing an EMSA identical to that shown in Fig. 1A except that SNAPc was omitted from the binding reactions. The results, shown in Fig. 1B, were quantitated with a PhosphorImager. When shorter than full-length products were present, as in the case of Oct-1 (lanes 2-10), they were included in the quantitation as detailed in the figure legend. The resulting values were used to normalize the amounts of SNAPc-DNA complexes formed in the presence of the different Oct proteins in Fig. 1A. The resulting data are graphed in Fig. 1C and show that at equal amounts of DNA binding activity, Oct-1 recruited SNAPc about 2-fold better than Oct-2 and 4-fold better than the Oct-1 and Oct-2 POU domains. In the case of Oct-1, this value may be an underestimate, since a fraction of the Oct-1 protein was not full-length and may have, therefore, been missing a domain required for efficient SNAPc recruitment. Nevertheless, most of the effect (about a 10-fold enhancement of SNAPc binding) was directed by the Oct-1 or Oct-2 POU domain.
To eliminate the possibility that the Oct-1 POU domain was masking the
contributions of regions outside of the POU domain to recruitment of
SNAPc to the PSE, we also tested a chimeric Oct-1 protein
referred to as 1.P.1 in which the Oct-1 POU domain was swapped with the
POU domain of the pituitary transcription factor Pit-1 (20). The Pit-1
POU domain, which is 50% identical to the Oct-1 POU domain, binds to
the H2B octamer motif (20) but does not efficiently recruit
SNAPc to the PSE (15). Any effect of Oct-1 regions outside
of the POU domain on recruitment of SNAPc to the PSE
should, therefore, be easily visualized with the 1.P.1 protein. The
effects of 1.P.1. and the Pit-1 POU domain on SNAPc binding
to the PSE are shown in Fig. 2A. The amounts of octamer binding activity in the different protein preparations in
the absence of SNAPc were determined as described above for the Oct-1 and Oct-2 proteins (data not shown), and the quantitated data
are shown in Fig. 2B. SNAPc on its own bound
poorly to the probe (Fig. 2A, lane 2), but SNAPc
together with increasing amounts of Oct-1 bound up to 40-fold more
efficiently to the PSE (Fig. 2, A, lanes 2-11, and
B). When Oct-1 was replaced by 1.P.1, a greatly reduced but
clearly detectable enhancement of SNAPc binding was
observed (3.5-fold at a 1.P.1 concentration equivalent to the highest
concentration of Oct-1: see Fig. 2, A, lanes 12-20, and
B). This enhancement was larger than that observed with just the Pit-1 POU domain (a maximum of less than 2-fold, see Fig. 2,
A, lanes 21-29, and B). As with the Oct-1
protein in Fig. 1, the enhancement of SNAPc binding by the
1.P.1 protein may be larger than that shown in Fig. 2B,
because a significant fraction of the 1.P.1 protein was not full-length
and may have been missing a domain important for efficient
SNAPc recruitment. Together, these results indicate that
although the Oct-1 POU domain is primarily responsible for the
recruitment of SNAPc to the PSE, Oct-1 regions outside of
the POU domain also contribute to the effect in this assay.
A PSE-binding Complex Present in Crude Nuclear Extracts Contains SNAPc and Oct-1
To search for any putative
PSE-binding factors other than SNAPc, we performed EMSAs
with a probe carrying the mouse U6 PSE alone, a high affinity binding
site for SNAPc, and nuclear extracts. As a control, we used
a probe carrying six point mutations in the PSE that debilitate U6
snRNA transcription both in vivo and in vitro
(Ref. 18, and data not shown). As shown in Fig. 3, lane 5, we observed, in addition to the
SNAPc·DNA complex, a second complex of slower mobility
that did not form with the mutant probe (lane 12). The
migration of both complexes was retarded after incubation with
polyclonal antibodies directed against the SNAP43 (10) or the SNAP45
(25) subunits of SNAPc (lanes 6 and
7) but not after incubation with preimmune antibodies
(lane 10), suggesting that both complexes contain
SNAPc. In addition, the migration of the upper complex was
retarded after incubation with two different anti-Oct-1 monoclonal
antibodies (26) (lanes 8 and 9), but not with an
irrelevant monoclonal antibody (12CA5) directed against an epitope in
the influenza hemagglutinin protein (27) (lane 11). This
suggested that the upper complex consists of SNAPc and
Oct-1 bound to the probe, even though the probe lacks an octamer
sequence and is not bound by Oct-1 alone (lane 2). Indeed, a
complex of nearly identical mobility was obtained when purified
SNAPc and recombinant Oct-1 protein were incubated with the
probe (lane 4). Thus, incubation of a probe containing a
high affinity PSE but no independent Oct-1-binding site with a crude nuclear extract, where the relative concentrations of different factors
have not been manipulated, results in the formation of a complex
containing both SNAPc and Oct-1. This suggests that this
complex is physiologically relevant, and that SNAPc can
recruit Oct-1 to a probe devoid of octamer site.
The Complex Containing SNAPc and Oct-1 Does Not Form with a DNA-binding Defective Mutant of Oct-1
The
SNAPc·Oct-1 complex can assemble on a probe to which
Oct-1 alone cannot bind. We therefore asked whether SNAPc
and Oct-1 coexist as a complex in the absence of DNA. Attempts to
co-immunoprecipitate Oct-1 with an anti-SNAPc antibody and
vice versa were unsuccessful, suggesting that this is not the case
(data not shown). In another approach, we asked whether the complex
could form with an Oct-1 POU domain containing a single alanine
substituted for an arginine at position 49 of the POU domain (R49A
(12)). This Oct-1 POU domain mutant does not bind to an octamer site
efficiently but can assemble into a VP16-induced complex with VP16 and
HCF (12). As shown in Fig. 4, addition of either a
histidine-tagged Oct-1 protein or a GST-Oct-1 POU domain fusion protein
retards the migration of the SNAPc·PSE complex
(lanes 3 and 4), suggesting that both proteins
can form a complex with SNAPc on a PSE probe. Indeed, these
complexes can be supershifted with anti-Oct-1 antibodies (lanes
9 and 10). In contrast, addition of a GST-Oct-1 R49A
mutant protein does not retard the complex (lanes 5 and
6) nor render it reactive to anti-Oct-1 antibodies
(lanes 11 and 12). Thus, an Oct-1 mutant
defective for binding DNA cannot assemble with SNAPc on the
PSE probe.
Oct-1 Contacts DNA When Complexed with SNAPc on the PSE Probe
The observation that a mutant Oct-1 defective for binding
DNA could not assemble with SNAPc on the PSE probe raises
the possibility that Oct-1 interacts with DNA in the complex. To
examine this possibility directly, we performed orthophenanthroline-Cu
(OP-Cu) footprinting (23, 24) on protein-DNA complexes fractionated by
EMSA. We used three probes, designated AD, N7, and H2B Octa. As shown
in Fig. 5A, the AD and N7 probes both contain
the mouse U6 PSE, but the flanking sequences are different. The H2B
Octa probe contains the H2B octamer motif, a high affinity site for Oct-1. The three probes were incubated with SNAPc, Oct-1,
or both, and the binding reactions were fractionated by EMSA. The gel
was then exposed to OP-Cu and the DNA fragments corresponding to free probe, or to probe complexed with SNAPc, or to probe
complexed with SNAPc and Oct-1 were eluted from the gel and
fractionated on a sequencing gel. The results are shown in Fig.
5B. DNA from the Oct-1/H2B Octa probe complex displayed a
footprint over the octamer motif, as expected (lane 8). DNA
from the SNAPc/AD probe and SNAPc/N7 probe
complexes showed a clear footprint on the PSE (lanes 2 and
5). Significantly, on both the AD and N7 probes, DNA
from the complexes containing SNAPc and Oct-1 displayed, in addition to the footprint on the PSE, a footprint higher up in the gel
(lanes 3 and 6). As shown in Fig. 5A,
the distance between this additional footprint and the PSE footprint
varies on the two probes, but in each case the same sequence is
protected. The footprint corresponds to an ATT sequence within a
region, ATGATTACGAA, with limited similarity to an octamer motif in
either orientation (see Fig. 5C). These results suggest that
Oct-1 contacts DNA in the complex, and that this point of contact is
remarkably flexible relative to the location of the PSE.
Oct-1 Recognizes a Specific DNA Sequence in the SNAPc·Oct-1 Complex with DNA
The footprinting results above suggested that although Oct-1 can contact DNA at various distances from the PSE in the SNAPc·Oct-1·DNA complex, the sequences recognized by Oct-1 are specific. To confirm this possibility, we tested the ability of Oct-1 to supershift a SNAPc·PSE complex formed on a probe containing a mutation within the ATT sequence contacted by Oct-1 (AD-mutHD probe, see Fig. 5A), or a truncated probe missing this sequence altogether (AD-Short probe, see Fig. 5A). As shown in Fig. 5D, Oct-1 could "supershift" the SNAPc·DNA complex on the AD and N7 probes, as before, but very weak complexes, or no retarded complexes, were observed with the probe mutated within the ATT sequence (lanes 11-15), or the truncated probe (lanes 16-20), respectively. These results show that Oct-1 requires sequence-specific interactions with the DNA to form the SNAPc·Oct-1·DNA complex.
The snRNA promoters contain an enhancer, the distal sequence element, which is nearly always characterized by the presence of an octamer sequence as well as, in some cases, an Sp1-binding site (28). This contrasts with the enhancers of mRNA promoters, which differ from one promoter to the next and can consist of a wide variety of protein-binding sites. Consistent with the uniformity of the distal sequence element, basal transcription from snRNA promoters is activated by Oct-1 activation domains and a glutamine-rich activation domain derived from Sp1 (13), but not, in general, by activation domains derived from other activators. For example, the VP16 or Oct-2 activation domains do not activate snRNA gene transcription (13, 14, 16, 29). This selectivity suggests that the Oct-1 activation domains exert their action on a snRNA promoter-specific transcription factor, such as SNAPc.
The Oct-1 DNA-binding domain (POU domain) has been shown before to bind cooperatively with SNAPc to a probe containing a PSE and an octamer motif (9, 15). Thus, a possibility is that the role of the Oct-1 activation domains is to reinforce this effect. Indeed, we find that the Oct-1 regions outside of the POU domain contribute to cooperative binding with SNAPc, and the effect is significantly larger than that observed with Oct-2 regions outside of the POU domain. There is, therefore, a correlation between the ability of the Oct-1 and Oct-2 regions outside of the POU domain to recruit SNAPc to the PSE and to enhance snRNA gene transcription in vivo (14). Nevertheless, most of the SNAPc recruitment effect is contributed by the POU domain, suggesting that the main function of the Oct-1 activation domains is different. They may be involved either in recruiting other members of the basal machinery, perhaps other snRNA-promoter specific factors, or, for example, in inducing conformational changes in the basal machinery that result in more efficient transcription.
While characterizing a PSE-binding complex observed in crude nuclear extracts, we found that it consists of SNAPc and Oct-1. This was unexpected, because Oct-1 on its own did not bind effectively to the probe, and our previous results had indicated that cooperative binding of Oct-1 and SNAPc to DNA requires the presence of both a PSE and an octamer motif (15). However, we find that within the complex, Oct-1 contacts DNA in a sequence-specific manner, and that this contact is required for formation of the complex. Thus, as we had observed previously, cooperative binding of SNAPc and Oct-1 to DNA requires Oct-1-DNA contacts. Interestingly, the location of these contacts relative to the location of the PSE is flexible and changes on different probes. This is consistent with the observation that neither the distance between the octamer sequence and the PSE (9) nor the orientation of the octamer (15), are critical for cooperative binding.
The POU domain consists of two helix-turn-helix-containing DNA-binding structures, the POU homeodomain (POUH) and the POU-specific domain (POUS), joined together by a flexible linker (30-34). Cooperative binding of the Oct-1 POU domain and SNAPc can be disrupted by a single amino acid change within the POUS domain, which maps to the surface of helix 1 away from the DNA and has no effect on DNA binding (15). This suggests that the POUS domain is involved in direct protein-protein interactions with SNAPc, and that its position may, therefore, be fixed relative to SNAPc and the PSE. We show here that cooperative binding can also be disrupted by a single amino acid mutation within the POUS domain that maps to the surface of helix 3 pointing toward the DNA and that affects DNA binding (12). This suggests that the POUS domain also contacts the DNA in the complex. How, then, can there be so much flexibility in the spacing between the PSE and the sequences contacted by Oct-1 POU? Perhaps the POUS domain-DNA contact is transient, occurring only during formation of the trimeric complex, whereas the POUH domain remains bound to DNA in the formed complex. Or perhaps the location of the POUS domain-DNA contact is dictated more by protein-protein interactions with SNAPc than by specific DNA sequence. In contrast, the position of the POUH may be much more dependent on local DNA sequences than on the position of SNAPc and the PSE. Indeed, the sequence ATT (or AAT on the other strand) constitutes part of the AAAT sequence recognized by the POUH domain on a histone H2B-octamer site (33). Thus, perhaps on different probes, the relative locations of the Oct-1 POUS and POUH domains changes, the first being dictated mainly by the location of SNAPc, and the second by the local DNA sequence. Alternatively, SNAPc may itself be flexible, allowing different positionings of Oct-1 on the DNA while maintaining protein-protein contacts.
We thank M. A. Cleary, W. Herr, V. Mittal, and M. Tanaka for reagents and discussions. We also thank W. Herr and V. Mittal for comments on the manuscript, and M. Ockler, J. Duffy, and P. Renna for artwork and photography.