(Received for publication, April 7, 1997, and in revised form, May 28, 1997)
From the Faculty of Bioscience and Biotechnology,
Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama
226, Japan, ¶ Takeda Chemical Industries Ltd., Juso,
Osaka 532, Japan,
Banyu Tsukuba Research Institute (Merck), Tsukuba
300-26, Japan, ** Department of Microbiology and Immunology, University
of Tennessee Memphis, Memphis, Tennessee 38163, and Departments of
Medicinal Chemistry and
§§ Biochemistry, University of Utah,
Salt Lake City, Utah 84112
Archaeosine is a novel derivative of 7-deazaguanosine found in transfer RNAs of most organisms exclusively in the archaeal phylogenetic lineage and is present in the D-loop at position 15. We show that this modification is formed by a posttranscriptional base replacement reaction, catalyzed by a new tRNA-guanine transglycosylase (TGT), which has been isolated from Haloferax volcanii and purified nearly to homogeneity. The molecular weight of the enzyme was estimated to be 78 kDa by SDS-gel electrophoresis. The enzyme can insert free 7-cyano-7-deazaguanine (preQ0 base) in vitro at position 15 of an H. volcanii tRNA T7 transcript, replacing the guanine originally located at that position without breakage of the phosphodiester backbone. Since archaeosine base and 7-aminomethyl-7-deazaguanine (preQ1 base) were not incorporated into tRNA by this enzyme, preQ0 base appears to be the actual substrate for the TGT of H. volcanii, a conclusion supported by characterization of preQ0 base in an acid-soluble extract of H. volcanii cells. Thus, this novel TGT in H. volcanii is a key enzyme for the biosynthetic pathway leading to archaeosine in archaeal tRNAs.
A variety of modified nucleosides has been found in tRNA (1, 2),
but their functions and, in particular, their biosynthetic pathways are
still largely unknown (3). Many modified nucleosides are highly
conserved with respect to their sequence locations in tRNA (4), and
some are characteristic of the evolutionary origin (2, 5), namely,
archaea, bacteria, or eukarya (6). Perhaps the most phylogenetically
specific nucleoside in tRNA is archaeosine, which occurs only in
archaeal tRNA at position 15, a site that is not modified in tRNAs from
the other two primary domains (7). Archaeosine was first discovered by
Kilpatrick and Walker (8) during sequencing of tRNA from
Thermoplasma acidophilum, and it was subsequently shown to
be present in many archaeal species (9); in the most extensively
studied archaeal tRNA, from Haloferax volcanii, archaeosine
occurs in tRNAs specifying more than 15 amino acids (10). Subsequently,
the structure of archaeosine was determined to be the non-purine,
non-pyrimidine nucleoside 7-formamidino-7-deazaguanosine (Fig.
1A) (11).
The only other known examples of tRNA nucleosides with 7-deazaguanosine structures are the members of the Q1 nucleoside (12) (Fig. 1E) family (13), which includes precursors in its biosynthesis, such as 7-cyano-7-deazaguanine (preQ0; Fig. 1D) (14), 7-aminomethyl-7-deazaguanine (preQ1; Fig. 1C) (15), and oQ (16) from bacterial tRNAs, and mannosyl and galactosyl derivatives of Q (17, 18) from mammalian tRNAs. In contrast to archaeosine, members of the Q nucleoside family are located at the first position of the anticodon (position 34) in bacterial and eukaryotic tRNAs that are specific for only four amino acids (Tyr, His, Asp, and Asn) (19). The key enzyme in the biosynthesis of the Q nucleoside in tRNA is tRNA-guanine transglycosylase (TGT; EC 2.4.2.29), which catalyzes a base-exchange reaction by cleavage of the N-C glycosidic bond at position 34 (20). In bacteria, TGT catalyzes the exchange of guanine at position 34 in tRNA with either guanine base, preQ1 base, or preQ0 base (20, 21). preQ1 base is presumed to be synthesized de novo from GTP (1) and was identified as the physiological substrate of Escherichia coli TGT (21). After incorporation of preQ1 into tRNA, it is further modified to oQ by transfer of the ribosyl moiety from S-adenosylmethionine (22), then finally to yield Q in the polynucleotide chain (23). In contrast, in eukarya, TGT can incorporate fully modified Q base into the first position of the anticodon by a base-replacement reaction (24, 25). Animals cannot synthesize Q-related compounds de novo and must obtain Q base as a nutrient from their diet or gut flora (26, 27).
Here we report the isolation of a new type of TGT from H. volcanii; it catalyzes the incorporation of preQ0 base into position 15 of tRNA, replacing guanine originally located at that site. Further, we have demonstrated that free preQ0 base is present in H. volcanii cells, implying that TGT utilizes preQ0 as a substrate leading to the biosynthesis of archaeosine in archaeal tRNAs.
H. volcanii (ATCC 29605) was grown aerobically at 37 °C on a 500-liter scale in Gupta's medium (10), until the absorbance at 600 nm reached 0.8-1.0. About 1.0 kg of cells was collected.
Assay of Guanine Exchange ReactionExchange between guanine and various 7-deazaguanine analogues, catalyzed by TGT, was assayed as described previously (20) except that the final ionic condition of the reaction mixture was 1.5 M KCl and 1.5 M NaCl. The 7-deazaguanines were synthesized as described previously: preQ0 (28), preQ1 (29), and archaeosine base (30).
Purification of H. volcanii tRNA-Guanine TransglycosylaseFrozen H. volcanii cells (100 g) were suspended in 200 ml of buffer A (50 mM Hepes (pH 7.5), 10% glycerol, 1.0 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride) plus DNase I (2.5 µg/ml), and were broken by sonication. The S-100 fraction was obtained by centrifugation at 105,000 × g for 1 h, dialyzed against buffer A, and then adsorbed onto a DEAE-Sepharose FF column (2.5 × 20 cm) (Pharmacia Biotech Inc.), which was eluted by a linear gradient of NaCl from 0.02 to 0.5 M in buffer A. The eluate containing the active fraction was brought to 40% ammonium sulfate and then applied to a Butyl-Sepharose FF column (2.5 × 20 cm) (Pharmacia), which was eluted with a linear gradient of ammonium sulfate from 40 to 0% in buffer A. The active fraction was next applied to a Butyl-Sepharose 4B column (1.5 × 15 cm) (Pharmacia) and eluted as described above for the Butyl-Sepharose FF column. The active fraction was then applied to a Superdex 200 column (1.6 cm × 60 cm) (Pharmacia), and then eluted with buffer A containing 300 mM NaCl. Finally, the TGT fraction was applied to a Mono Q column (0.50 × 5 cm) (Pharmacia) and eluted with a linear gradient of NaCl from 300 mM to 1 M. This TGT fraction was stable for at least 1 month when stored at 4 °C. The activity of the enzyme was monitored by incorporation of [8-14C]guanine into unfractionated E. coli tRNA (20). Amino acid sequences of peptide fragments generated by digestion with lysylpeptidase were determined as described previously (31).
Construction of a Plasmid Clone Containing the Gene for H. volcanii tRNALys(CUU) and Preparation of its T7 TranscriptTwo synthetic DNA oligomers, namely Lys-FOR (5-
TAATACGACTCACTATAGGGCCGGTAGCTCAGTTAGGCAGAGCGTCTGACTCTT-3
) and Lys-REV
(5
-TGGTGGGCCGGACGCGATTTGAACACGCGACCGTCTGATTAAGAGTCAGACGCTCTGCCTA-3
) were annealed via the complementary region, and both of the 3
ends were extended by Tth DNA polymerase (Toyobo). After extension, two
synthetic DNA primers, namely T7 (5
-TAATACGACTCACTATA-3
) and
Halo-Lys3
(5
-CCTGGTGGGCCGGACGCGATTT-3
) were added, and a polymerase
chain reaction was performed to yield the gene for H. volcanii tRNALys(CUU) containing the promoter sequence
for T7 RNA polymerase (Takara). We cloned the product of a polymerase
chain reaction in pUC19; digestion of plasmid DNA with MvaI
generated a CCA end for the tRNA gene, which was transcribed in
vitro using T7 RNA polymerase (32).
For preparation of the T7 transcript into which preQ0 base was incorporated, 200 µl of a reaction mixture containing 300 pmol of T7 transcript, 20 µl of TGT (15 units) (20), and 5 nmol of preQ0 base (under ionic conditions of the guanine exchange reaction; see above) were incubated at 37 °C for 1.5 h. The sequence of the RNA was determined as described elsewhere (33, 34).
Characterization of Modified Nucleotides by Post-labelingA
reaction mixture containing T7 transcript and TGT in the presence of
preQ0 base or an aliquot of acid-soluble extract of H. volcanii was incubated at 37 °C for 1.5 h. After
digestion of the T7 transcript by RNase T2, the preQ0
nucleotide was analyzed by post-labeling using T4 polynucleotide kinase
and [-32P]ATP (21, 35). The enzymes used (RNase T2, T4
polynucleotide kinase, and yeast hexokinase) were inactivated by phenol
extraction instead of boiling. After incubation with nuclease P1, the
digestion product was applied to a cellulose thin layer plate (20 × 20 cm) and was subjected to two-dimensional chromatography (15).
H. volcanii cells were suspended in a solution of 0.2 M formic acid and shaken for 2 h at 4 °C. After centrifugation, the supernatant was filtered through a Millipore filter. After neutralization with NaOH, soluble substances were extracted with tetrahydrofuran. The organic phase was evaporated, and the material was used for the identification of preQ0 base.
E. coli TGT can be assayed by its ability to incorporate [8-14C]guanine into Q-unmodified tRNAs (typically unfractionated yeast tRNA, which constitutively lacks Q, is used) by replacing the guanine base located at the first position of the anticodon (20). By analogy with E. coli TGT, we searched for such an enzymatic activity in a crude extract of H. volcanii using E. coli tRNA as a substrate (see below). H. volcanii TGT was purified to near homogeneity following successive column chromatographies. Table I shows the recovery and the purification factor at each step, and Fig. 2 shows the pattern of SDS-polyacrylamide gel electrophoresis at each step. The molecular mass of the enzyme was deduced to be 78 kDa from a profile of the gel (Fig. 2, lane 6). Like E. coli and eukaryotic TGT, H. volcanii TGT does not require ATP for the base replacement reaction. High salt concentration (approximately 2.4 M) is necessary for maximum activity. Magnesium ion is required for activity with the T7 transcript as a substrate, but activity with unfractionated E. coli tRNA does not require magnesium ion. These results suggest that magnesium ion may be responsible for conformational rigidity of the tRNA, but not for the enzymatic activity itself. Optimum activity occurs near pH 7.5. Purified TGT was digested with lysylpeptidase, and the sequences of several resultant peptide fragments were determined (see below).
|
Unfractionated E. coli tRNAs and a T7 Transcript of H. volcanii tRNALys(CUU) Are Substrates for H. volcanii tRNA-Guanine Transglycosylase
To examine the specificity for tRNA substrate,
we constructed a plasmid clone containing the sequence of H. volcanii tRNALys(CUU) and that of T7 promoter upstream
of the gene. Its T7 transcript (Fig.
3A) was found to be a good
substrate for the enzyme (Fig. 3B). The labeled T7
transcript was isolated, and the site at which [8-14C]guanine had been incorporated was determined by
RNA sequencing to be position
15,2 the exclusive location
of archaeosine nucleotide in archaeal tRNA. This result suggested that
the enzymatic activity is involved in the biosynthesis of archaeosine
nucleotide in tRNA. Unfractionated tRNA from E. coli was
also found to be a good TGT substrate, whereas unfractionated H. volcanii, yeast, and bovine tRNAs were not (Fig. 3B),
although we did not quantitatively measure the efficiency of
unfractionated E. coli tRNA and of the T7Lys
transcript as substrates. These results further suggest that position
15 of H. volcanii tRNAs is fully modified to archaeosine nucleotide.
preQ0 Base May Be the Physiological Substrate for H. volcanii tRNA-Guanine Transglycosylase
The ability of various
bases to serve as substrates for incorporation into tRNA by H. volcanii TGT was examined using the procedure of Okada et
al. (21). First, the T7 transcript was labeled with
[8-14C]guanine by incubation with TGT. To a reaction
mixture that contained this 8-14C-labeled tRNA and the TGT
enzyme, we added various 7-deazaguanine bases and monitored the
decrease in acid-insoluble radioactivity of the tRNA due to release of
[8-14C]guanine by replacement with the added base (Fig.
4). Unexpectedly, neither archaeosine
base itself (Fig. 1B), nor preQ1 base (Fig. 1C), which is the physiological substrate for E. coli TGT (21), were incorporated into the tRNA transcript. Among
7-deazaguanine derivatives, only preQ0 base (Fig.
1D) was efficiently incorporated. We attribute the small
amount of apparent archaeosine base incorporation into tRNA to be due
to preQ0 base, and not archaeosine base, since approximately 20% of archaeosine base is chemically converted to
preQ0 base after incubation of the reaction mixture under
the conditions used. Furthermore, the nucleotide at position 15 of the
tRNA product after incubation with archaeosine base was found to be
preQ0 nucleotide by RNA sequencing2 (see
"Discussion").
preQ0 Base Is Incorporated at Position 15 of tRNA
To investigate whether preQ0 base is directly
incorporated into tRNA, as well as whether incorporation occurs at
position 15 in the D-loop, the sequence of the D-loop region in the T7 transcript after incubation with preQ0 base was determined
by the post-labeling method (33, 34). The RNA was subjected to partial
digestion with alkali and the 5 ends of resultant RNA fragments were
labeled by using polynucleotide kinase and [
-32P]ATP,
followed by separation by electrophoresis in a polyacrylamide gel (Fig.
5A). RNA was extracted from
each band in the gel and digested with nuclease P1. The resultant
32P-labeled nucleotide 5
-monophosphate was analyzed by
thin-layer chromatography. Fig. 5B shows clearly that
preQ0 base was incorporated at position 15 of the tRNA, and
also shows that more than 90% of the nucleotide at position 15 is a
preQ0 nucleotide, indicating that the base-replacement
reaction by H. volcanii TGT was efficient under the present
conditions.
Evidence for the Occurrence of Free preQ0 Base in H. volcanii Cells
If preQ0 base is the physiological
substrate for H. volcanii TGT, free preQ0 base
could be present in H. volcanii cells. To test this
hypothesis, we prepared an acid-soluble extract of H. volcanii and incubated an aliquot of the extract with the T7
transcript of H. volcanii tRNALys(CUU) and
H. volcanii TGT under the same conditions described in Fig.
4. After the reaction, we analyzed modified nucleotides in the treated
tRNA using the post-labeling method (21, 35). As shown in Fig.
6, preQ0 5-monophosphate was
detected in the tRNA transcript following incubation in the presence of
the acid-soluble extract (Fig. 6B), but it was not detected
following incubation with the enzyme alone (Fig. 6C).
Further, similar acid treatment of isolated H. volcanii tRNA
did not release preQ0 by the criterion of failure of the T7
transcript to incorporate preQ0 when incubated with the
extract and TGT.2 Although archaeosine base is unstable
under conditions of high temperature and high salt (see above),
archaeosine appears stable when present as a nucleotide in intact tRNA
(10). These results suggest that free preQ0 base is present
in H. volcanii cells and that it may serve as the
physiological substrate for H. volcanii TGT (see
"Discussion"; Fig.
7A).
The normal growth medium for H. volcanii (10) contains Tryptone, which, as a whole meat extract, is a source of Q nucleoside and, therefore, a potential source of preQ0. To rule out the possibility that H. volcanii may not synthesize archaeosine de novo, tRNA was isolated from cells grown in a chemically defined (Q-free) medium (36) and analyzed for archaeosine; archaeosine content in tRNA from cells grown in the normal growth medium and in chemically defined growth medium was identical.2
H. volcanii and E. coli tRNA-Guanine Transglycosylases Are Evolutionarily RelatedRecently, the complete genome sequence of
the methanogenic archaeon, Methanococcus jannaschii, has
been reported (37). Among 1738 protein-coding genes predicted is a
putative M. jannaschii TGT gene (MJ#0436) that exhibits 30%
identity to E. coli TGT (38). We determined the amino acid
sequences of three peptide fragments, generated from purified H. volcanii TGT by digestion with lysylpeptidase, and compared them
with the sequence of the putative M. jannaschii TGT. As
shown in Fig. 8, fragments 1 and 2 from H. volcanii TGT appear to be closely
related to the M. jannaschii sequence, with identities of
53.5 and 38.5%, respectively, although the C-terminal portion of
fragment 3 diverges from that in M. jannaschii.
These results suggest that the H. volcanii tRNA-guanine
transglycosylase characterized here is the counterpart of the putative
TGT whose sequence is present in M. jannaschii (37).
It is well established that TGT is involved in biosynthesis of Q nucleotide in E. coli (Fig. 1E) by exchange of guanine at position 34 by preQ1 base in tRNAs specific for Tyr, Asp, Asn, and His ((20, 21); see Introduction). The resultant preQ1 nucleotide in tRNA is then modified to the epoxide oQ by the S-adenosylmethionine-requiring enzyme QueA (22), and finally, oQ is converted to Q by an unknown vitamin B12-dependent enzyme (23). These processes are schematically represented in Fig. 7B. In the present study, we provide evidence that, in contrast with the primary substrate of bacterial TGT (preQ1), preQ0 base is the normal substrate for H. volcanii TGT. Presumably, the incorporated preQ0 base then is further converted to archaeosine by (net) addition of ammonia, at the polynucleotide level (Fig. 7A). Therefore, both E. coli and H. volcanii TGTs catalyze a very similar reaction, namely, the exchange of guanine base in a polynucleotide chain with a free 7-deazaguanine derivative; however, their actual substrates (in terms of base, tRNAs, and the site of replacement in tRNA) are different.
Functional Implications of 7-Deazaguanosine NucleosidesArchaeosine is present at position 15 (D-loop) in most archaeal tRNAs (7), whereas Q and its derivatives are present at position 34 (first position of the anticodon) of four specific tRNAs in bacteria and eukarya (19) (see Introduction). Accordingly, these conserved differences in structure and sequence location suggest differences in function. Q has been proposed to be involved in codon recognition (39) and has been shown to prevent stop codon readthrough in tobacco mosaic virus RNA in a codon context-dependent manner (40). A correlation between the presence of Q-undermodified tRNAs and frameshifts of some retroviruses including human immunodeficiency virus was proposed (41). Other functional implications of Q, such as in virulence of Shigella (42), signal transduction (43), ubiquitin-dependent proteolytic pathway (44), and tumor differentiation (45-48), have also been suggested.
The functional role of archaeosine has not been established, but has been proposed to involve enhanced stabilization of tRNA tertiary structure as a consequence of the unique charged imidino side chain (11). Earlier work has demonstrated that hydrogen bonding interactions between G-15 in the D-loop and C-48 in the T-loop, stabilized by stacking with purine-59, constitute a generally conserved mechanism for stabilization of the universal folded L-shape of tRNA (49, 50). These structural features (G-15, C-48, purine-59) are basically met by nearly all reported archaeosine-containing tRNA sequences (7), to which would be added the strong potential for electrostatic interactions between phosphate and the "arginine fork" imidino side chain of archaeosine.
Interestingly, precursor bases used as substrates for both bacterial and archaeal TGTs participate in analogous biosynthetic pathways. Free preQ1 base has been isolated from E. coli (21), and here we provide evidence for the presence of free preQ0 base in H. volcanii. We believe that this free preQ0 base is likely to be the precursor exchanged into tRNA in the normal biosynthetic pathway leading to archaeosine, although, at present, we cannot strictly exclude the possibility that free preQ0 base detected is instead derived from archaeosine in tRNA. In E. coli, preQ1 base is synthesized from GTP (13), possibly via preQ0 (51), although there is presently no direct evidence for any precursor-product relationship between these two 7-deazaguanine bases. Presumably a similar pathway is present in H. volcanii for biosynthesis of preQ0 base from GTP. The key substrates following base replacement at the tRNA level, then, are preQ1 nucleotide (leading to queuosine in E. coli) and preQ0 nucleotide (leading to archaeosine in H. volcanii). It is noted that preQ0 nucleoside is present in tRNA of certain mutants of E. coli (51), the meaning of which has not yet been rationalized (14, 21). The occurrence of these 7-deazaguanine precursor bases in both primary phylogenetic domains, archaea and bacteria, prompts us to speculate a more general role for them in cellular functions. In this respect, more detailed characterization of free preQ0 base (and possibly free preQ1 base) in H. volcanii cells is required.
Structural Requirements of Bacterial and Archaeal TGT Enzymes for tRNA Substrates and Their Evolutionary ImplicationstRNA structural requirements for enzyme recognition remain to be identified. Preliminary experiments2 showed that an 18 nucleotide minihelix containing the D-loop and D-stem of H. volcanii tRNALys(CUU) does not serve as a substrate for H. volcanii TGT, implying the existence of higher order recognition elements for the archaeal TGT. By contrast, bacterial TGT recognizes the anticodon loop sequence U33-G34-U35, which is the minimum requirement for recognition by the enzyme, and minihelices containing this triplet sequence are good substrates for the enzyme (52, 53).
By x-ray crystallography, the tRNA-guanine transglycosylase from
Zymomonas mobilis has been determined to be an irregular (/
)8 barrel with a tightly attached C-terminal
zinc-containing subdomain (54). Further, the structure of Z. mobilis TGT in complex with preQ1 suggests a binding
mode for tRNA where the phosphate backbone interacts with the zinc
subdomain and the U33-G34-U35
sequence is recognized by the barrel. The zinc binding motif (CXCX2CX25H)
is highly conserved in prokaryotic TGTs known so far (52), and the
homologous region in M. jannaschii is
(CXCX2CX22H). These results demonstrate a structural and functional conservation of
the archaeal and bacterial/eukaryotic TGT binding mode with tRNA,
despite archaeal modification of the D-loop and bacterial/eukaryotic modification of the anticodon loop. The utilization of 7-deazaguanine derivatives for tRNA processing by interrelated TGT enzymes suggests an
evolutionarily fundamental role for 7-deazaguanine.
In contrast to bacterial TGT (52, 55), productive recognition of tRNA by eukaryotic TGT requires not only the U33-G34-U35 sequence of the anticodon loop but also a correctly folded tRNA architecture (56). In addition, eukaryotic TGT is believed to be a heterodimer, although this is not conclusive at present (44, 57). More detailed examination of the substrate recognition properties of TGTs from archaea, bacteria, and eukaryotes will elucidate the domain structures of these proteins for the tRNA binding site, as well as further define their evolutionary relationship.
We thank Dr. Yoshihiro Fukumori and Takemoto Fujiwara of the Tokyo Institute of Technology for help with the culture of H. volcanii and Dr. Kunio Ihara of Nagoya University for useful discussions.