(Received for publication, February 21, 1996, and in revised form, December 20, 1996)
From the Departments of Immunology and
¶¶ Pathology, National Institute of Health, 1-23-1 Toyama,
Shinjuku-ku, Tokyo 162, Japan, ¶ Mitsubishi Chemical Corporation,
1000 Kamoshida, Aobaku, Yokohama 227, Japan,
Mitsubishi-Kasei
Institute of Life Sciences, Minami-ooya 11, Machida-shi, Tokyo 194, Japan, ** Division of Hematology and Oncology, Oregon Health Sciences
University and the Portland Veterans Affairs Medical Center, Portland,
Oregon 97207,
Department of Molecular and
Cellular Biology, Harvard University, Cambridge, Massachusetts 02138, and §§ The First Department of Internal
Medicine, School of Medicine, University of Tokyo, Bunkyo-ku,
Tokyo 113, Japan
We previously showed that consensus sequences exist at the chromosomal breakpoints in lymphoid malignancies and that these sequences are specifically recognized by a novel DNA binding protein, Translin. In the present study, the native form of Translin was established to be a ring-shaped structure by electron microscopy and crystallographic studies. It was also determined that this multimeric Translin formed by the subunits is responsible for its binding to target sequences situated only at single-stranded DNA ends. Furthermore, DNA-damaging reagents were found to initiate a signaling pathway for the active nuclear transport of Translin. The results support the hypothesis that staggered breaks occur at recombination hot spots and Translin has a pivotal function in recognition of the generated single-stranded DNA ends.
The significance of chromosomal translocations in many hematological tumors has recently become very clear (1). A number of studies have shown that chromosomal translocations either result in the activation of proto-oncogenes by joining them to immunoglobulin (Ig) or T-cell receptor genes or lead to the creation of tumor-specific fusion proteins. In man, such translocations consistently occur at particular sites in the genome. Despite their significance to tumor etiology, the molecular basis for the existence of these "recombination hot spots" has been poorly understood.
Virtually identical sequences at the chromosomal breakpoint junctions
in T-cell leukemias bearing the t(8;14)(q24;q11) and t(1;14)(p32;q11)
rearrangements led us to suspect that a novel enzymatic mechanism might
be operating on chromosomes 1p32 and 8q24 (2, 3). Similar sequences
were also found within the clustered breakpoint region of the Bcl-2
oncogene in follicular lymphoma patients carrying the t(14;18)(q32;q21)
translocations, which is one of the most common chromosomal
abnormalities in human lymphoid neoplasms (4). Further extensive search
of the nucleotide sequences at the breakpoint junctions of many
chromosomal abnormalities in human lymphoid neoplasms involving 1p32,
3q27, 5q31, 8q24, 9q34, 9q34.3, 10q24, 11p13, 11q13, 14q11, 14q32,
14q32.1, 17q22, 18q21, 19p13, and 22q11 revealed the consensus sequence
motifs, ATGCAG and GCCC(A/T)(G/C)(G/C)(A/T), with gaps or a few
nucleotides intervening (5). In most cases, these sequences were found at the 5-flanking site of the breakpoint junctions, with genes encoding physiologically important proteins located in their vicinity. Subsequent analysis identified a protein, Translin, that exhibits general binding activity to the above consensus sequences. Molecular gene cloning experiments revealed the protein to be a previously undescribed type with no significant homology to known proteins (5). In
addition to our original observations indicating that Translin is
expressed predominantly in the nuclei of lymphoid lineage cell lines in
which the Ig or T-cell receptor loci are not in a germline DNA
configuration, confocal laser-scanning microscopic analysis revealed
that nuclear localization of Translin is limited to lymphoid lineage
cells despite being present in the cytoplasm of cell lines of various
lineage. These observations support the view that the nuclear
localization of Translin is associated with its physiological role and
that its nuclear importation is selectively controlled in lymphoid
cells with an Ig or T-cell receptor gene rearrangement.
In the present investigation, to provide further insight into Translin function, the native form of multimeric Translin and its mode of binding to the target DNA sequences were determined by electron microscopic studies. It was further suggested that a signaling pathway for the active nuclear transport of Translin may be initiated by exposure to DNA-damaging reagents.
The
Translin gene encoding 228 amino acids was amplified by
PCR1 and cloned into a bacterial expression
vector, pQE-9 (Qiagen Inc.). The resulting expression construct was
transformed into the Escherichia coli host strain
M15[pREP4], and production of recombinant Translin protein was
induced by treatment with 2 mM isopropyl
-D-thiogalactopyranoside for 4 h. The Translin was purified from the bacterial lysate using a Ni2+-agarose
column, and a sample was prepared on a thin carbon film supported by a
mesh copper grid and negatively stained with potassium phosphotungstate
adjusted to pH 7.0. To analyze the mode of Translin/DNA interactions,
heat-denatured ss DNA was incubated with the recombinant Translin in 50 mM phosphate buffer (pH 8.0) with 300 mM NaCl
for 30 min at 20 °C. Samples were spread onto 5-µl droplets of
redistilled water and then absorbed on carbon-coated grids. Micrographs
of rotary-shadowed samples were taken in a Hitachi H-7000 electron microscope.
Crystals of
the recombinant Translin were grown by the hanging drop method at
5 °C. The reservoir solution contained 15% (w/w) polyethylene
glycol 4000 in 0.1 M MES buffer at pH 6.2. The protein solution contained 3.4 mg/ml protein in 50 mM phosphate
buffer (pH 8.0) with 300 mM NaCl. Initial drops were formed
with 4.5 µl of reservoir solution and 6.0 µl of protein solution.
Bipyramidal crystals grew to 0.3 × 0.15 × 0.15 mm after
several weeks. X-ray diffraction data were collected with a Weissenberg
camera for macromolecules (13) at the photon factory (beam line 6A2) of the National Laboratory for High Energy Physics, Tsukuba, Japan. The
crystals were found to belong to a tetragonal space group, either
P41212 or P43212, with
cell parameters of a = 97.2 and c = 283.6 Å. The ratio of the volume to the molecular mass was estimated
to be 3.2 Å3/dalton assuming four molecules in an
asymmetric unit. The intensity data were processed using the DENZO
program (14). The Rmerge was 13% for 17,357 independent reflections with |I| > 1 (|I|) within the
3.5-Å resolution, and the completeness was 95%. The heavy atom
derivative search for multiple isomorphous replacement is now under
way.
DNA fragments in the mbr were synthesized by PCR using the Bcl-2 genomic fragment (4.3-kilobase HindIII) of chromosome 18q21 (8). PCR primers for each DNA fragment were as follows: Bcl-1048, B1960 (TTCTTAAGACATGTATCACT) and B3007M (TAAAGCAACTCTCTAAAGGT); Bcl-1103, B1960 and Bcl-24M (4); Bcl-142, B2920 (CCATGAGATTCATTCAGTTAA) and Bcl-24M. Parameters for PCR amplification were 1 min each at 94, 60, and 72 °C for 40 cycles, followed by a final extension period of 15 min at 72 °C. Single-stranded forms of each DNA were prepared by heating at 100 °C for 5 min followed by cooling on ice.
DNA-damaging Reagents and Detection of TranslinHeLa cells
were grown on 9-cm Petri dishes treated with mitomycin C (1 µg
ml1) or etoposide (5 mM) for 6 or 18 h,
and then the cells were lysed and nuclear extracts prepared as
described previously (3, 4). Nuclear extracts (20 µg of total
protein) were run on 12.5% acrylamide SDS-polyacrylamide gel
electrophoresis, transferred to Hybond-polyvinylidene difluoride
membrane (Amersham Life Science), and probed with rabbit anti-Translin
antibody followed by horseradish peroxidase-conjugated goat anti-rabbit
IgG. Antibody binding was detected by enhanced chemiluminescence
according to the manufacturer's instructions (Amersham Corp.). Nuclear
extracts of HeLa cells treated with mitomycin C were also assayed for
binding to 32P-labeled V
3-23P (3) by gel shift
assay.
The Translin cDNA encodes a protein of 228 amino
acids with a predicted molecular size of 26 kDa. SDS-polyacrylamide gel
electrophoresis analysis showed the recombinant Translin migrated as a
single band of approximately 27 kDa under reducing conditions and 54 kDa under nonreducing conditions, indicating that Translin polypeptides form a dimer (5). In the native form, Translin dimers generate a
multimeric structure whose molecular size is approximately 220 kDa, and
this form is responsible for its DNA binding activity. Since Translin
has the leucine zipper motif at the COOH terminus (Fig.
1), we hypothesized that polymerization of Translin
dimers could be facilitated by the heptad repeat of hydrophobic amino acids (five leucines and one valine) to form a multimeric subunit structure, possibly an octamer. Therefore, the top view of native Translin would be expected to give a circular structure connected by
disulfide bonds and leucine zipper motifs. Confirming this hypothesis,
our electron microscopic study indicated that the complex formed by
Translin subunits is ring-shaped (Fig. 2).
To determine the three-dimensional structure of Translin, a
crystallographic investigation was started. For the preliminary study,
the self-rotation function (6) was calculated with the program POLARRFN
of the CCP4 package (7). The reflection data between 20- and 3.5-Å
resolution were used, but the program limits the resolution to 13.7 Å for the integration radius of 80 Å. The highest peaks at = 0 and
= 90 and 180 correspond to the crystallographic 41 or
43 screw axis, and those at
= 90,
= 180, and
= 0, 45, 135, and 180 correspond to the crystallographic 2-fold rotation and 21 screw axes. There were no other peaks with
significant height except in the region
= 0. Fig. 3
shows the self-rotation function versus
at
= 0. The
maximum background level at
0 was 15. The fact that there is
only one axis that gives a high score for the self-rotation function is
quite consistent with the ring-shaped structure observed in the
electron micrography. The figure shows that the axis normal to the ring
lies parallel to the c axis of the crystal. Thus, there are
four layers of the ring along the c axis in a unit cell, and
the crystallographic 2-fold axis must be within the plane of the ring.
The 2-fold axis implies the ring consists of even numbers of subunits,
i.e. 6, 8, or 10. The low resolution rotation function peaks
at
= 45 and 135 together with the assembly molecular weight suggest
that the Translin is an assembly of eight subunits.
Translin Is a Single-stranded DNA End-binding Protein
The
multimeric structure of Translin and its DNA binding activity raises
the question of how DNA binding is achieved with its ring-shaped
structure. It is conceivable that the DNA binding domain is created in
the cylindrical structure of native Translin protein by combination
with its basic regions. To confirm this, the mode of Translin/DNA
interactions was analyzed using the target sequence of a recombination
hot spot region on chromosome 18q21 (4). The chromosomal breakpoints of
follicular lymphomas carrying the t(14;18)(q32;q21) are known to be
clustered within a 150-base pair region in the mbr of the Bcl-2
oncogene on chromosome 18q21 (8-10). We synthesized an
oligonucleotide, Bcl-CL1, that included the consensus sequence found
within the 150-base pair region and confirmed by gel shift assay that
Translin strongly binds to the end-labeled Bcl-CL1 (Fig.
4). Bcl-CL1·Translin complex formation was
competitively blocked by increasing amounts of nonradioactive Bcl-CL1.
The oligonucleotides Bcl-CL1a and Bcl-CL1c, with an additional 6 nucleotides ((ATT)2 at the 3 and 5
ends), demonstrated
similar competitive activities. However, Bcl-CL1b and Bcl-CL1d, with 12 additional nucleotides ((ATT)4 at the 3
and 5
ends),
competed less efficiently. Interestingly, Bcl-CL1e with 12 additional
nucleotides at both ends failed to inhibit the complex formation. These
results clearly indicate that the target sequence of Translin has to be situated at DNA ends for efficient binding to occur.
To further confirm that Translin specifically binds to target sequences
at DNA ends, two different double-stranded (ds) DNA fragments (Bcl-1103
and Bcl-1048) from the mbr of the Bcl-2 oncogene were prepared (Fig.
5A), and their binding to Translin was
analyzed by electron microscopy. Although both ds DNA fragments failed to bind (data not shown), Translin bound to ss Bcl-1103 with the target
sequence (Bcl-CL1) at the DNA end (Fig. 5, E-G) but not to
ss Bcl-1048 without the target sequence (Fig. 5, C and
D). To ascertain whether Translin is an ss DNA binding
protein, a ds DNA fragment, Bcl-142 (142 base pairs) bearing the
Bcl-CL1 at its end was prepared (Fig. 5A), and its binding
to Translin was tested by gel shift assay. As shown in Fig.
5H, the end-labeled ds Bcl-142 failed to bind to Translin
despite binding to ss Bcl-142.
Induction of Active Nuclear Transport of Translin
In the
small number of examples tested so far, the native form of Translin was
shown to be present in the cytoplasm of cell lines of various lineages,
whereas a nuclear location was limited to the case of hematopoietic
cell lines, especially lymphoid cell lines with rearranged Ig or T-cell
receptor loci. To determine whether or not Translin may have any
physiological significance in the cytoplasm of nonhematopoietic cells,
we hypothesized that Translin may be involved in both DNA repair and
apoptosis. Therefore, a nonhematopoietic cell line (HeLa) was treated
with the DNA-damaging agents, mitomycin C and etoposide, and then
homogenized for preparation of nuclear extracts. The presence or
absence of Translin in the nucleus was tested by immunoblotting with
anti-Translin antibody. As shown in Fig. 6A,
nuclear transport of Translin was greatly induced by mitomycin C and
etoposide within 6 h. Further incubation, however, resulted in a
decrease in Translin protein levels. It was confirmed by gel shift
assay that mitomycin C induced nuclear transport of Translin present in
the native form (Fig. 6B). These experiments indicate that
DNA damage initiates a signaling pathway, resulting in active nuclear
transport of Translin.
Interaction of Translin with Clustered Chromosomal Break Sites
We have previously shown that Translin could also bind to a
complementary minus strand of Bcl-CL1, Bcl-24M, containing a tandem repeat of the sequence that is similar to one of the consensus sequences, ATGCAG. To further narrow down the target sequence at the
clustered break sites of 18q21 required for binding of Translin, the 3
end of the Bcl-CL1 and the 5
end of the Bcl-24M were deleted, and the
resultant forms were tested for their binding to Translin by gel shift
analysis. Fig. 7A summarizes the results, indicating that the minimal length of the target sequence is about 18 base pairs of both strands. The 3
end of the plus strand coincides with the most frequent break sites defined in the literature. The same
result was also obtained for similar sequences present in that region
of DXP genes (members of the Ig DH gene family) that is most frequently rearranged with the Bcl-2 oncogene in the
t(14;18) translocation (data not shown). These results suggest that
Translin could function by specifically interacting with the target
sequence only when a staggered break occurs at chromosomal translocation hot spots, as shown in Fig. 7B.
Despite the significance of recombination in the human genome, little is known about the molecular events occurring at recombination hot spot regions. Translin, which specifically binds to the consensus sequences ATGCAG and GCCC(A/T)(G/C)(G/C)(A/T) found at the breakpoint junctions in many cases of chromosomal translocations, is a unique DNA binding protein. We have shown by electron microscopic and crystallographic studies that the native form of Translin is a ring-shaped structure. Based on our findings for interaction of Translin with the target sequence in the major breakpoint region of the Bcl-2 oncogene on chromosome 18q21, Translin has to be located at DNA ends for efficient binding to occur. Our electron microscopic studies not only confirmed this but also proved that Translin is a ss DNA binding protein. Moreover, the same results support the view that the DNA binding domain is created in the cylindrical structure of Translin by combination with the relatively short basic regions of the Translin polypeptide (Fig. 1) because Translin could only bind to the end target sequence of the ss Bcl-1103 despite the existence of several identical target sequences in its interior (4). Theoretically, in this case, chromosomal breakage would have to precede recognition of target sequences by the ring-shaped Translin protein in vivo. In this respect, Translin may be a typical DNA end-binding protein, which is in contrast with one of the other DNA binding proteins, the Ku antigen, that initially binds to DNA ends and then moves to internal positions within the DNA molecule (11).
An important conclusion that we can draw from these observations is
that, after chromosomal breakage at recombination hot spots, a single
chain target sequence motif has to be exposed for efficient binding of
Translin to occur in vivo. It is important to determine
whether it is due to deletion of the 5 end by exonuclease or a
staggered cut by unknown restriction endonucleases. Our results also
support the view that the existence of a ss DNA region would increase
the probability of a free DNA end being generated by a nuclease,
facilitating recombination by interaction with DNA binding proteins
(12). Further investigation is required to determine if Translin might
protect single-stranded DNA ends from nuclease cleavage and promote the
initiation of DNA strand exchange. The fact that nuclear transport of
Translin is induced by DNA-damaging reagents also raise the question of
whether or not an identical signal is involved in the active nuclear
transport of Translin in lymphoid cell lines.
The primary amino acid sequences and ring-shaped structure of Translin are highly conserved through evolution, and the consensus target sequences appear to be similar.2 One attractive possibility is that the Translin targets universally exist throughout the eukaryotic genome and influence chromatin structure. The fact that chromosomal translocations recur very consistently in particular chromosomal regions that almost always contain physiologically important genes leads us to suspect that the underlying mechanisms are associated with some fundamental process in eukaryotic cells such as transcription or replication. Further characterization of the Translin actions including identification of interacting proteins should facilitate understanding of its role in the recombination hot spots and of the molecular basis of chromosomal translocations in many hematological diseases.
We express our appreciation to M. Seto for providing the Bcl-2 genomic clone and F. Hirose, H. Maekawa, and T. Higashinakagawa for valuable suggestions. We also thank T. Hasegawa, C. Sasaki, and G. Meng for technical assistance.