(Received for publication, December 11, 1996, and in revised form, January 16, 1997)
From the McGill Cancer Centre, and Departments of
§ Medicine (Division of Experimental Medicine) and
Oncology, McGill University,
Montréal, Québec H3G 1Y6, Canada
Dimerization with extradenticle or PBX
homeoproteins dramatically improves DNA binding by HOX transcription
factors, indicating that recognition by such complexes is important for
HOX specificity. For HOX monomeric binding, a major determinant of
specificity is the flexible N-terminal arm. It makes base-specific
contacts via the minor groove, including one to the 1st position of a
5-TNAT-3
core by a conserved arginine (Arg-5). Here we show that
Arg-5 also contributes to the stability of HOX·PBX complexes,
apparently by forming the same DNA contact. We further show that
heterodimers of PBX with HOXA1 or HOXD4 proteins have different
specificities at another position recognized by the N-terminal arm (the
2nd position in the TNAT core). Importantly, N-terminal arm residues 2 and 3, which distinguish the binding of HOXA1 and HOXD4 monomers, play
no role in the specificity of their complexes with PBX. In addition,
HOXD9 and HOXD10, which are capable of binding both TTAT and TAAT sites
as monomers, can cooperate with PBX1A only on a TTAT site. These data
suggest that some DNA contacts made by the N-terminal arm are altered
by interaction with PBX.
Many developmental events are under the control of homeobox genes, whose products regulate the transcription of effector genes by binding to specific DNA sequences. The classic example involves proteins encoded by the homeotic selector complex (Hom-C) of the fruit fly Drosophila melanogaster, which determine the identity of body segments along the anteroposterior axis. A similar function is performed in mammals by the homologous Hox genes. These genes specify the identity of mesodermal and ectodermal derivatives such as vertebrae and rhombomeres (reviewed in Ref. 1), as well as contributing to limb patterning. Homologous genes are expected to be found in all organisms with an anteroposterior axis. The 39 Hox genes of mice and humans are located in four clusters, termed HOXA to HOXD, homologous to the Hom-C of insects. Genes that encode similar products occupy the same position in each cluster, and this permits the functional partitioning of the Hox family into 13 paralog groups based on the relative position of a particular gene. The expression boundaries of the Hox genes during embryogenesis, which are critical for patterning, are colinear with genomic position (2, 3). With few exceptions, the smaller the paralog group number, the earlier and more anteriorly the genes of that group are expressed.
Despite a wealth of genetic and biochemical data on the in
vivo and in vitro activities of Hox gene
products, relatively little is known about how Hox genes
from different paralog groups produce the discrete regulatory effects
required at particular axial positions. HOX proteins have a single DNA
binding domain, the homeodomain, that consists of a flexible N-terminal
arm and three -helices. When bound to DNA the third helix, or
recognition helix, makes a number of DNA contacts in the major groove.
The N-terminal arm extends from the packed helical structure and lies
along the minor groove. The consensus HOX binding site consists of a
5
-TAAT-3
core followed by a selection against C at the next two
3
-positions. Sequences 5
and 3
to the midpoint of the TAAT are
recognized by the N-terminal arm in the minor groove and helix three in
the major groove, respectively. There are clear deficiencies in the monomer binding activity of HOX proteins. The HOX consensus site is
short and somewhat degenerate and so statistically far too common to
direct a given HOX protein to select the promoters it is intended to
regulate. Furthermore, by comparison to the crystal structure of the
related engrailed (EN) homeodomain-DNA complex (4), the TAAT core is
specified by residues of which all but one, residue three in the
N-terminal arm, are completely conserved across the HOX family. As a
result, there are predominantly only three variations of HOX monomer
binding. Proteins from paralog groups 2-8, as well as EN, have an
arginine at position 3 and exhibit a preference for TAAT-containing
sites. HOX proteins from the large ABDOMINAL-B (ABD-B) subfamily
(paralog groups 9-13), which have Lys-3, recognize both TTAT and TAAT.
HOX proteins from paralog group one are not conserved at residue three
and, as demonstrated for HOXA1 (5) and HOXB1 (6), exhibit weak
DNA-binding activity. While weaker preferences for flanking sequences
have been observed in vitro (7-9), this specificity has not
been shown to account for differences in regulatory ability.
Paradoxically, chimeric studies in Drosophila demonstrate
that the homeodomain and immediate flanking regions are major
determinants of functional specificity (10-14). The flexible
N-terminal arm, for which several functions have been described
(15-18), is implicated in a number of these studies (12, 19, 20). Many
of the implicated residues are not predicted to contact DNA in
monomeric binding, suggesting they contribute to specificity by
contacting other proteins, including cofactors (17, 21-23).
Alternatively, the DNA binding conformation may be altered in these
higher order complexes, thereby allowing these residues to contact
DNA.
The product of another Drosophila homeobox gene,
extradenticle (exd), has been shown to cooperate
with several HOM proteins for binding to specific DNA elements (24, 25)
and regulation of target genes in vivo (26). This is
consistent with genetic evidence that exd mutations affect
the ability of HOM genes to specify segment identity (27).
The three exd homologues in humans comprise the
PBX family (28). Mammalian HOX and PBX proteins have also
been shown to be able to cooperatively bind DNA (29-32). A critical
HOX determinant for interaction is the pentapeptide, found N-terminal
to the homeodomain of many HOX proteins (29, 30, 33-35). It has the
consensus (Y/F)PWM(K/R). As well, a diverged tryptophan-containing
sequence found in a number of ABD-B subfamily members has been shown to
permit cooperative interactions with PBX (36). On its own, the
pentapeptide is capable of increasing PBX DNA-binding activity (33),
which suggests that it may stabilize or induce a particular
conformation of PBX. In PBX, regions within and immediately C-terminal
to the homeodomain are important for cooperativity (29, 37). Although
the homeodomains of the HOX·PBX heterodimer are not predicted to
contact one another, they appear to act as protein interfaces (25, 34,
37, 38). Most of the in vitro studies to date have used an
experimentally derived heterodimer binding site (39, 40) containing a
5-TGATTGAT-3
core. Such heterodimer sites are functional in
vivo, as the Hoxb1 autoregulatory enhancer
(ARE)1 contains three related sequences
that are required to direct Hoxb1-like expression of a
lacZ transgene in the hindbrain (6). This sequence is
recognized as adjacent TGAT half-sites, with the PBX and HOX partners
binding the 5
and 3
half-sites, respectively, in a head-to-tail
arrangement (37, 41). The close proximity of the two homeodomains in
the HOX·PBX heterodimer raises the possibility of an overlap in
base-specific and DNA backbone contacts. Overlaps have been suggested
to contribute to the DNA binding cooperativity of Oct-1 POU subdomains
(42, 43) and may even dictate specificity.
Interaction with PBX molecules dramatically increases the strength and
selectivity of DNA binding by HOX proteins (24, 25, 29, 30, 33), both
of which are likely to contribute to HOX functionality. However, the
ability of these interactions to produce functional specificity between
HOX proteins is poorly understood. In this paper, we further
characterize the HOX·PBX complex on DNA in an attempt to elucidate
mechanisms by which this specificity may arise. As an initial step, the
importance of the diverged HOXA1 pentapeptide was confirmed. We also
show that different HOX·PBX complexes exhibit differences in
stability based on sequence variations at the 2nd position in the 3
half-site. This position is predicted to be contacted by the HOX
N-terminal arm via the minor groove. The same relative position
distinguishes the three major HOX monomer binding types. Although we
provide evidence that the HOX N-terminal arm remains in the minor
groove in the cooperative complex, the residues responsible for
differences in the binding characteristics of HOXA1 and HOXD4 monomers
are not responsible for heterodimer specificity. This is consistent with the observation that monomer and heterodimer preferences at this
position are not the same. These results suggest that conformational
changes in the N-terminal arm of the HOX partner result from the
HOX-PBX interaction. The ability of different residues to confer
N-terminal arm DNA binding specificity in different contexts adds an
important dimension to the functional versatility of the homeodomain
N-terminal arm.
An initial step in generating all the
Hoxa1-containing plasmids used in this study was the
generation of pPGK-Hoxa1(HD+), a eukaryotic expression vector encoding
only the homeodomain-containing product of Hoxa1 (44). This
was made by inserting the BamHI/HincII fragment
of pHoxa1(HD+) (30) into pCEV-1 (5). pPGK-Hoxa1-vp16 was created by
first introducing an XbaI site at the 3 end of the open
reading frame by inserting a double-stranded oligonucleotide, O-220
(CTACCTCAGACTCTAGA, top strand only), into an AccI site. Then an XbaI fragment from pPGK-Hoxd4-vp16 (30) encoding the activation domain of VP16 was ligated into this site. This replaced the
last six codons of Hoxa1 with codons 412-490 of
vp16. The vector for bacterial expression of His-tagged
HOXA1, pTrcB-Hoxa1, was generated by subcloning the HindIII
fragment of pPGK-Hoxa1(HD+) into pTrcB (Invitrogen). The product of
this vector contains HOXA1 sequences from 16 amino acids N-terminal to
the pentapeptide to the C terminus. The two amino acid substitution in
the pentapeptide (WM to AA) was created by site-directed mutagenesis
using oligonucleotide O-176
(AGGGTTTCTTTTAACTTTCGCCGCGTCAAAGGTCTGCG). The N-terminal arm R5A
substitution was created by polymerase chain reaction amplification of
pPGK-Hoxa1(HD+) using the oligonucleotides O-245 (GTGGGTCAACCCAACGCAGTGGCCACCAATTTC) and 1.6-2
(AAGAAGTCTAGATCAGTGGGAGGTAGTCAG). The N-terminal arm N2K,A3R
substitution is described elsewhere (5). These mutant Hoxa1
sequences were subcloned into both pPGK-Hoxa1(HD+)-vp16 and pTrcB-Hoxa1
using convenient restriction sites. pTrcA-Hoxd4 was created by
subcloning a PstI/HindIII fragment from p4.2 (45)
directly into pTrcA. The product of this construct contained HOXD4
sequences from 22 amino acids N-terminal to the homeodomain to the C
terminus. All constructs were confirmed by sequencing.
HOXA1
and HOXD4 used in these experiments were expressed as His-tagged fusion
proteins and batch-purified from MC1061 bacteria using an imidizole
elution protocol (Invitrogen). These were stored at 80 °C in 200 mM Na2PO4 (pH 7.4), 500 mM NaCl, 10 mM
-mercaptoethanol, 0.01% Triton X-100, 300 mM imidizole, and 20% glycerol. Amounts of the partially
purified proteins were estimated by Coomassie staining and the Bradford
assay. PBX1A, HOXD9, and HOXD10 were produced as described previously
(30) using a TnT in vitro transcription/translation kit
(Promega). Transient transfections into retinoic acid-differentiating P19 embryonal carcinoma cells were as described previously (30).
EMSA was conducted as described previously (30) with
the following modifications. Approximately 1.5-2.5 ng of His-tagged HOX protein and 1.7 µl of reticulocyte lysate expressing full-length PBX1A or a mock translation were used per 10-µl reaction. Final buffer conditions were 10 mM Tris (pH 7.5), 75 mM NaCl, 30 mM imidizole, 1 mM
dithiothreitol, 1 mM EDTA, 540 ng/ml bovine serum albumin,
12% glycerol, and 80 (Figs. 2A, 3, and 5) or 320 (Figs. 5
and 6) ng of poly(dI-dC)/10 µl. The DNA probes used were as follows:
O-160, CGAAATTGATTGATTGATGCTTTAATTGAC; O-209, GCGGTGATGGATGGGCGCTG; O-262, CCCATGATTNATGGCCCCCCCC.
O-160 was subcloned into the SmaI site of pBSe, whereas
O-209 and O-262 were subcloned into the SrfI site of
pCR-Script (Stratagene). This facilitated verification of the probe
sequence and the isolation of all four variations of O-262. The
resulting plasmids were digested with BamHI/KpnI,
BamHI/NotI, and BamHI/SmaI,
respectively, and labeled with [-32P]dATP by Klenow.
The labeled fragment was purified using the Crush and Soak protocol
(46).
For dissociation rate experiments, 400 ng/µl unlabeled
double-stranded competitor DNA (O-160) was added at time 0 following preincubation of proteins with labeled DNA. 5-µl samples were loaded
at the indicated time points. The fraction of labeled DNA bound at each
time was determined using a Fuji Bas2000 Imager. The log of this value
was plotted against time to get a line of best fit where the slope is
equivalent to the negative of Kd, the dissociation
rate constant. Half-lives were determined from the equation
t1/2 = log(0.5)/Kd.
The figures showing EMSA data were produced electronically in Freehand 5.0 for Macintosh. Autoradiographs were scanned as reflective gray scale images using a Umax UC1260 scanner and the Autodensity function. The resulting images were saved as PICT files in Adobe Photoshop 3.0 for Macintosh and then placed into Freehand for labeling. Other than uniform size changes, the images were unmodified.
We have previously shown
that both HOXD4 and HOXA1 can cooperatively bind DNA with PBX1A and
that for HOXD4 this ability is dependent on an intact pentapeptide
motif (5). Specifically, mutation of the HOXD4 pentapeptide from YPWMK
to YPAAK is sufficient to abrogate interaction with PBX1A. HOXA1 also
contains a pentapeptide; however, the motifs of HOXA1 and HOXD4 share
only the sequence WMK and have no flanking homology (Fig.
1B). To determine the importance of the HOXA1
pentapeptide for interaction with PBX, we tested the effect of the same
WM to AA pentapeptide conversion, HOXA1(WM to AA), on the formation of
the HOXA1·PBX complex in vitro. To assess whether the weak
DNA-binding activity of HOXA1 monomers was affected by substitutions in
the pentapeptide, we used conditions that revealed monomer binding
activity (see "Experimental Procedures") and a DNA probe containing
binding sites for both heterodimeric and HOX monomeric complexes.
Although the WM to AA substitution in the HOXA1 pentapeptide had no
apparent effect on the level of monomer binding (Fig.
2A, lanes 2 and 4), it completely abolished detectable HOX·PBX complex formation (compare lanes 3 and 5).
To confirm this result, we used a luciferase reporter assay to look at the ability of transfected HOXA1 and PBX1A to cooperatively bind DNA in vivo. Because unmodified HOX and PBX proteins are poor transcriptional regulators, versions of HOXA1 and PBX1A proteins containing strong activation domains were used. These were the E2A-PBX1A oncoprotein and a HOXA1 protein to which the transcriptional activation domain of VP16 was fused (HOXA1-VP16). Endogenous HOX and PBX proteins are broadly expressed in differentiated cell types and are thus available to cooperate with proteins expressed from transfected vectors in the experiments reported below. As seen previously, HOXA1 has intrinsically weak DNA-binding activity (5). It was therefore not surprising to find that the HOXA1-VP16 fusion protein was completely unable to affect the activity of either a minimal promoter or a promoter containing five copies of the consensus HOX monomer binding site of Fig. 1 (data not shown). In contrast, HOXA1-VP16 produced a 1650-fold activation of a reporter that contained five copies of a PBX/HOX cooperative binding site, pML(5xHOX/PBX) (Fig. 2B). The activity of the E2A-PBX1A oncoprotein was likewise dependent on the presence of these heterodimer binding sites and produced a 700-fold activation. When transfected together, HOXA1-VP16 and E2A-PBX1A were able to generate a 4000-fold increase in luciferase activity. Thus, HOX and PBX proteins appear to participate in the cooperative DNA binding interaction seen in the in vitro binding assay to achieve synergistic transcriptional activation in vivo. If this is the case, this activity also should be dependent on an intact pentapeptide. Introduction of the WM to AA pentapeptide mutation into the HOXA1-VP16 construct abolished its ability to cooperate with E2A-PBX1A, thus confirming this hypothesis (Fig. 2B). Additionally, the observation that point mutations in the pentapeptide reduced the activity of HOXA1-VP16 alone from 1650- to 37-fold suggests that it is no longer recruited to the cooperative binding sites by endogenous PBX proteins.
Collectively these data demonstrate that, as seen previously for HOXD4, HOXA1 requires an intact pentapeptide for its ability to interact with PBX partners.
The Relative Stability of a Given HOX·PBX Complex Cannot Be Predicted by the Ability of the HOX Partner to Bind DNA as a MonomerGiven the cooperativity between HOX and PBX partners in binding DNA (24, 25, 29, 30, 33), it is reasonable to expect that differences in the activity of HOX·PBX heterodimers are exploited for HOX functional specificity in vivo.
To determine whether HOXA1 and HOXD4 differentially interact with PBX, we compared the binding kinetics of HOX·PBX1A heterodimers containing either HOXD4 or HOXA1. The relative stabilities of these complexes can be estimated by comparing the rates of dissociation of the proteins from a labeled DNA probe upon addition of a vast excess of unlabeled competitor. The complex containing HOXA1 was more stable than its HOXD4-containing counterpart (Fig. 3C, Table I). The measured half-life of the HOXD4·PBX1A complex at 23 °C was 15 min, while the half-life of the HOXA1·PBX1A complex was 25 min. In comparison, HOXD4 as a monomer dissociates completely from a consensus HOX site in less than 2 min (data not shown). This demonstrates that interaction with PBX partners can dramatically increase the stability of interactions with DNA of different HOX proteins. However, this increase is not necessarily uniform.
|
Since the HOXA1 homeodomain has been shown to bind DNA much more poorly than HOXD4, the greater stability of the heterodimer containing HOXA1 is somewhat surprising. The difference in monomeric binding activity has been shown to result from the lack of conservation in HOXA1 of N-terminal arm residues that contribute to HOXD4 DNA binding via the minor groove (5). Specifically, the HOXD4 residues Lys-2 and Arg-3 are substituted by Asn-2 and Ala-3 in HOXA1, greatly reducing HOXA1 monomeric DNA-binding activity. The greater stability of HOXA1·PBX over HOXD4·PBX complexes suggests that other factors control the level of heterodimer activity. While the N-terminal arms of distantly related homeodomains can be similarly oriented in monomeric DNA binding complexes (47), this region is inherently unstructured (48). Thus, it cannot be assumed to adopt the same conformation in higher order complexes as in monomer binding. As a result, several models can be proposed for how HOXA1 manages to form more stable HOX·PBX heterodimers. These are based on three conceivable conformations of the HOX N-terminal arm. In the first model, the same contacts between the N-terminal arm and DNA that are formed in the monomer are maintained in the heterodimer. In this case, HOXA1 must compensate through interactions with either PBX1A or DNA via sequences outside the N-terminal arm. In a second model, the N-terminal arm remains in the minor groove but adopts new DNA contacts that are favorable for HOXA1. The third model proposes that the interaction of the adjacent pentapeptide with PBX may displace the HOX N-terminal arm from the minor groove.
The HOX N-terminal Arm Contributes to DNA Binding in Heterodimers with PBXThe divergence (Fig. 1A) between the core of
the heterodimer half-site recognized by the HOX partner, 5-TGAT-3
,
and the canonical HOX recognition site, 5
-TAAT-3
, suggests that the first model cannot be correct. By comparison to the crystal structure of the related EN homeodomain (4), Arg-3 of the HOXD4 homeodomain is
predicted to contribute to monomer binding by contacting the second
base pair in the TAAT core. In the heterodimeric half-site recognized
by the HOX homeodomain, the analogous position is occupied by a G:C
base pair. Thus, the combination of predicted HOXD4 N-terminal arm
contacts in the heterodimer is of necessity not the same as in the
HOXD4 monomer. The loss of this contact could at least partly explain
the PBX-dependent convergence of HOXA1 and HOXD4 binding
activities.
This observation does not distinguish between the second and third models. Therefore, we asked whether the HOX N-terminal arm still contributes to DNA binding in the heterodimer. An N-terminal arm-DNA contact seen in numerous homeodomain-DNA crystal (4, 49, 50) and solution (51) structures occurs between Arg-5 and O-2 of the thymine at the 1st position of the TAAT core. Arg-5 is conserved in all HOX proteins (Fig. 1B), whereas the correct A:T base pair is found in both the HOX monomer (position 1) and HOX·PBX heterodimer (position 5) sites (Fig. 1A). If the HOX N-terminal arm retains this minor groove contact in the heterodimer, then mutation of this arginine to alanine (R5A) will result in a decrease in DNA binding stability.
The effect of the R5A mutation on HOXA1 was tested first by EMSA. The
dissociation of the HOXA1·PBX1A and the HOXA1(R5A)·PBX1A heterodimers from this probe is shown in Fig.
4A. Half-lives for the two complexes were
just under 27 and under 5 min, respectively (Table II).
Thus, more than a 5-fold decrease in stability is produced by the R5A
mutation. A similar decrease in stability for the HOXA1·PBX1A complex
is seen when the binding site used contains a G at position 5 rather
than a T (Fig. 4B, lanes 1-6; Table II). To
determine if Arg-5 of HOXA1 contributes to heterodimer complex
stability by recognition of the T at position 5, we tested the effect
of using both the mutated HOXA1 and the DNA probe with G at position 5. The half-life of this complex was not further reduced (Table II), as
would be expected for two independent functions. The most
straightforward conclusion is that the role of Arg-5 in contacting T5
is retained in the heterodimeric complex.
|
In addition, the effect of the R5A mutation was tested in the transfection assay. This mutation reduces activation by HOXA1-VP16 alone from 1650- to 8.5-fold and when cotransfected with E2A-PBX1A from 4000- to 640-fold (Fig. 2B). The latter value is similar to that obtained by transfection of E2A-PBX1A alone. Thus, cooperativity between HOXA1(R5A) and PBX1A is severely attenuated both in vitro and in vivo.
From the above results we conclude that minor groove contacts by the HOXA1 N-terminal arm are important for complex stability. Since Arg-5 is conserved in all HOX homeodomains, these observations can be extended to other PBX-interacting HOX proteins, such as HOXD4. This interpretation is consistent with the second model, in which the N-terminal arm adopts at least a subset of the minor groove contacts formed in the monomer. This subset includes that of a residue which is conserved between HOXA1 and HOXD4 (Arg-5).
HOXA1 and HOXD4-containing Complexes Exhibit DNA Sequence Preferences at Positions Predicted to Be Recognized by the HOX N-terminal ArmWhile the above results indicate that Arg-5 of the HOX N-terminal arm retains its minor groove contact in HOX·PBX heterodimers, the greater stability of HOXA1·PBX over HOXD4·PBX complexes suggests that the roles of residues two and three have been altered. Arg-3 of EN has been shown to contact the A:T base pair at position 2 of the TAAT monomer site (4); however, this corresponds to the G:C base pair at position 6 of the heterodimeric site (Fig. 1A). The presence of G6 in the heterodimeric site used to this point may thus not permit contacts with residues two and three of HOXD4.
To address this hypothesis, we tested the effect of all four bases at
position 6 on the activity of the HOX·PBX complexes. First, steady
state binding was analyzed for both the HOX monomers and the HOX·PBX
heterodimers. As expected, HOXD4 alone has a preference for the A6
probe, since this contains the sequence 5-TAATGG-3
(Fig.
5, lane 9). Under the same conditions, HOXA1
alone shows little or no binding to any site (Fig. 5, lanes
1-4). To see whether these monomer preferences could be
transferred to the higher order complexes, we also tested HOX·PBX
heterodimers. Very strong binding for HOXA1·PBX1A was seen with the
G6 probe (lane 7), strong binding was seen on A6 (lane
5), and there was weaker binding on T6 (lane 8). The
relative binding to each probe was G6
A6 > T6 > C6. For the HOXD4·PBX1A complex, similar levels of binding were seen for
A6 and G6, whereas binding to T6 was somewhat lower (lanes 13-16) (A6~G6 > T6
C6).
The effect of variations in the heterodimer site at position 6 on complex stability was also studied (Fig. 3). The calculated half-lives are presented in Table I. The stability of both HOX·PBX complexes on A6 is similar, despite the fact that the complex containing HOXD4 shows stronger steady state binding. This discrepancy is most likely due to the ability of HOXD4 monomer binding to accelerate the formation of the heterodimer on this particular sequence (data not shown). Binding to the C6 probe, which was extremely weak, was also similar for the two HOX·PBX complexes. In contrast, the stability of the complexes formed on both G6 and T6 was clearly different (Fig. 3, C-D, Table I). Both HOXA1·PBX1A and HOXD4· PBX1A complexes were very stable on binding sites bearing G6, although the former showed two-thirds greater stability (25 versus 15 min). Substitution of G6 with T6 reduced the stability of HOXA1·PBX1A 5-fold relative to G6, whereas the stability of HOXD4·PBX1A was essentially unchanged.
In conclusion, the two HOX·PBX complexes have distinct preferences at
position 6. Numerous lines of evidence indicate that this corresponds
to the 2nd position in the 3 HOX half-site. For homeodomains binding
DNA as monomers, this position is known to be contacted in the minor
groove by residue three (4).
The above observations prompted us to test whether the same residues that confer monomer preferences between HOXA1 and HOXD4 may also be responsible for conferring the position 6 preferences of the corresponding HOX·PBX complexes. For this, we used a HOXA1 protein in which the Asn-2 and Ala-3 residues were replaced with Lys-2 and Arg-3 found in HOXD4. This chimera, referred to as HOXA1(N2K,A3R) (5), showed a strong preference for the A6 probe (Fig. 5, lane 17). These observations are consistent with our previous results showing that these residues distinguish the ability of HOXD4 versus HOXA1 to recognize sites containing a TAAT core (5) and confirm the prediction that they do so by specifying the 2nd position in the TAAT core.
When HOXA1(N2K,A3R) was incubated with PBX1A, the binding preferences
of the resulting heterodimer (G6 A6~T6 > C6) were much
more similar to the heterodimer containing HOXA1 (Fig. 5, compare
lanes 21-24 with lanes 5-8) than to that
containing HOXD4 (lanes 13-16), despite the fact that this
chimeric HOX protein acts like HOXD4 as a monomer. This is consistent
with the observation that the binding preference of the HOXD4 monomer
(A6) did not determine the preference of the HOXD4·PBX1A heterodimer
(A6, G6, and T6).
We also tested whether the N-terminal arm substitutions responsible for differences in monomer binding between HOXA1 and HOXD4 were involved in differences in the stability of the corresponding HOX·PBX complexes. As seen for the steady state binding, the substitution of Lys-2 and Arg-3 into HOXA1 had little or no effect on complex stability (Fig. 3 and Table I). The half-lives of the HOXA1(N2K,A3R)·PBX1A complex on G6 and T6 were 24 and 6 min, respectively.
Thus, while our results implicate Arg-5 of the HOX N-terminal arm in binding site selection by HOX·PBX heterodimers, here we see that positions 2 and 3 of this structure do not influence this process. This is in striking contrast to the importance of these residues for HOX monomer binding.
ABD-B Subfamily Members Can Interact with PBX1A on a Heterodimeric Site That Contains a TTAT CoreABD-B subfamily members, which lack a recognizable pentapeptide, fail to cooperate on the heterodimeric site shown in Fig. 1A (24, 29, 30). Given the above results, we wished to test HOXD9 and HOXD10 on the probes with variations at position 6.
HOXD10 (Fig. 6A) and HOXD9 (data not shown)
bind both the A6 and T6 heterodimer probes as monomers, which was
expected since the 3 half-sites are TAAT and TTAT, respectively.
Additionally, they heterodimerize with PBX1A on the site containing T6
(Fig. 6A, lane 8). This demonstrates that the previously
reported inability to cooperate with PBX1A (30) is due to the DNA site
tested. The stability of these complexes bound to T6 was tested in the same manner as the complexes in Fig. 3. While most of the bound HOXD10
monomer dissociated within 2 min (Fig. 6B), the
HOXD10·PBX1A heterodimer was considerably more long-lived, with a
calculated half-life of 11.5 min. Under the same conditions,
HOXD9·PBX1A had a half-life of 16.7 min. Thus, for ABD-B subclass
members, the preference for thymine at position 6 is shared by the HOX monomer and the HOX·PBX complex.
There are three major conclusions from the work presented here. First, we show that the highly conserved Arg-5 residue in the HOXA1 N-terminal arm retains a minor groove contact in a heterodimeric complex with PBX. Thus, the HOX N-terminal arm remains in close proximity to the minor groove in both monomeric and cooperative complexes. Second, this raises the possibility that, as for HOX monomer binding, this region can contribute to the binding site preferences of various HOX·PBX complexes. We confirm this by showing that binding preferences at one of the positions predicted to be contacted by the HOX N-terminal arm varies depending on the HOX protein in the complex. Finally, the N-terminal arm residues responsible for this specificity are not the same as those which distinguish HOXA1 and HOXD4 monomer activities.
The Pentapeptide of HOXA1 Is Required for Cooperative Interaction with PBX1AThe first observation reported here is the requirement of the HOXA1 pentapeptide for cooperative interaction with PBX. It has been shown recently that the divergent pentapeptide of labial (LAB), the Drosophila HOXA1 homologue, appears to block DNA binding by a bacterially purified LAB protein and that this can be abrogated by the presence of EXD or mutation of the LAB pentapeptide (52). Although HOXA1 monomer binding is weak, it is not improved by mutation of the pentapeptide or by the presence of PBX1A (Fig. 2A). Additionally, the low transcriptional activity of HOXA1-VP16 on a promoter containing HOX monomer sites was not increased by mutation of the pentapeptide or by cotransfection of a vector expressing E2A-PBX1A (data not shown). These data argue against the use of such a mechanism by all LAB homologues. Rather, the lack of basic residues at homeodomain positions 2 and 3 appears to be sufficient to explain HOXA1 dependence on cofactors (5). HOXB1, another LAB subfamily member, is likewise dependent on EXD-PBX cooperativity for strong DNA binding (6), but the effect of its pentapeptide on monomeric and cooperative binding has not been reported. Interestingly, negative effects of N-terminal sequences on monomeric binding have been reported for exd and EN (52, 53).
A Conserved Residue in the HOX N-terminal Arm, Arg-5, Makes a Base-specific Contact in the Heterodimeric Binding SiteSeveral structural studies have shown that Arg-5, a residue found in all HOX proteins, performs a conserved function for diverged homeodomains by forming a stable, specific interaction with a thymine in the minor groove upon monomeric binding (4, 42, 49-51). Our results show that this DNA binding function is conserved upon interaction with PBX. We note that two of the three heterodimer sites in the murine Hoxb1 autoregulatory enhancer (ARE) contain a guanine at position 5 (one of three sites in chicken and pufferfish), and yet this enhancer is responsive to HOXB1 in mice (6) and LAB in flies (6, 52) in what appears to be an EXD-PBX-dependent fashion. As well, a transgenic Hoxb1-lacZ reporter construct containing the ARE is responsive to ectopically expressed HOXA1 (54). How might this relatively poor site be functional in vivo? One possibility is that multiple degenerate sites act synergistically to achieve effective transcriptional regulation. Synergy has been demonstrated in vivo for both the Hoxb1 ARE (6) and for EXD-dependent dpp enhancer elements (55-57). However, transfection studies with the Hoxb1 ARE show it responds poorly to HOXA1-VP16 and E2A-PBX1A.2 This discrepancy may be due to a requirement for additional spatial and temporal cues, including post-translational modifications and the presence of other transcription factors (57). Consistent with such a requirement, the Hoxb1 ARE is responsive to ectopically expressed HOXB1 only in restricted domains, and it generates an incomplete lab-like expression pattern in Drosophila (6), despite the fact that exd and PBX genes are widely expressed (28, 58, 59).
HOX Proteins Confer Specific Binding Preferences at a Position Predicted to be Recognized by the N-terminal ArmThe apparent
proximity of the HOX N-terminal arm to the minor groove in the
heterodimer prompted us to test the effect of base substitutions at
position 6 on the stability of the HOX·PBX complexes. Four HOX
proteins suitably representative of the three monomer subclasses (see
Introduction) were used and displayed distinct preferences in complexes
with PBX. These data suggest that variations at position 6 alone could
sufficiently discriminate between different HOX·PBX complexes. This
could be combined with subtle preferences for positions 3 to the TNAT
core (8, 9, 36, 60) and magnified by the ability of clustered
heterodimeric sites to act cooperatively in vivo (6, 25).
Similar results implicating position 6 in distinguishing different HOX·PBX complexes have been reported recently (36). However, there are a number of distinctions. Although HOXD4 showed stable binding to T6 in our hands (Table I), poor T6 binding was reported for its paralog, HOXB4. Our conclusions are based primarily on dissociation rates, which showed similar half-lives on T6 and G6, whereas the HOXB4 result is based on steady state binding. It is reasonable to expect that stability of binding is a critical determinant for the ability of a HOX protein to compete with family members for a particular site and thus that HOXD4 will be active on at least a subset of T6 sites in vivo. Additionally, for both steady state and dissociation experiments, we see poor cooperative binding by both HOXD9 and HOXD10 with PBX1A on any probe other than T6, whereas HOXB9 showed much stronger steady state binding on A6 and G6 relative to HOXA10 (36). This may represent real differences between highly related paralogs or may be the result of variations in experimental protocol.
Binding Preferences of the HOX Protein, and the N-terminal Arm Residues That Confer These Preferences, Differ Between the Monomer and the HeterodimerAlthough HOXA1 and HOXD4 dictated the specificity of HOX·PBX heterodimers at position 6, these preferences did not reflect the DNA binding characteristics of the HOX monomers (Fig. 5). While Arg-3 is common to ANTP, EN, even-skipped (EVE), and paired homeodomains, it forms different DNA contacts in each structure (49, 50) despite the conservation of the Arg-5-DNA contact (see above). It was thus possible that these N-terminal arm residues were reconfigured to form different contacts between monomeric and heterodimeric DNA binding. However, our results demonstrate that the position 6 preferences conferred by the HOX partner do not reside in the same residues that distinguish HOX monomer binding. Consistent with this observation, LAB subfamily members are not conserved at homeodomain residues two and three, and yet HOXA1 (our results) and HOXB1 (36) both heterodimerize with PBX1A most effectively on the G6 probe. Similar differences in HOX monomer versus heterodimeric binding have been noted by others who have also implicated the N-terminal arm in the specificity of monomeric and heterodimeric complexes (36, 41).
Between HOX paralog groups, N-terminal arm sequences are more variable than the remainder of the homeodomain. These differences are well-conserved within paralog groups, however, suggesting a functional role confirmed by studies in vivo (12, 20). Nonetheless, these N-terminal arm differences have moderate, if any, effect on monomeric DNA-binding activity in vitro (8). Results presented here provide an explanation for this discrepancy in that interaction with PBX (or EXD) significantly alters the interaction of the HOX N-terminal arm with DNA.
What induces the N-terminal arm to alter its DNA contacts? Presumably,
this is the result of a PBX-mediated change in the conformation of the
N-terminal arm and/or the minor groove (Fig. 7). In one
scenario, interaction of the pentapeptide with PBX may impart a
structure on the adjacent N-terminal arm. The sequence N-terminal to
the HOX homeodomain, including the pentapeptide or its equivalent in
ABD-B subfamily members, has been shown to influence the recognition of
position 6 by the N-terminal arm in some instances (36). Alternatively,
changes in N-terminal arm-minor groove interaction may result from the
distortion of DNA topography. Interaction with DNA has already been
shown to induce N-terminal arm conformation in monomeric complexes (61, 62).
ABD-B Class Proteins Share a Subset of Their Monomeric Binding Activity with the Heterodimer
HOXD9 and HOXD10 appear to cooperate with PBX via a motif immediately N-terminal to the homeodomain which, other than having a tryptophan, is diverged from the pentapeptide consensus (36). Unlike HOXA1 and HOXD4, complexes of HOXD9 and HOXD10 with PBX1A bind a subset of their monomeric binding site preferences. Both proteins are active on TTAT and TAAT sites as monomers and on TTAT during heterodimeric binding. The source of the TTAT preference exclusive to the ABD-B subfamily monomers has been mapped to N-terminal arm residues Lys-3, Lys-6, and Pro-7 (9). In contrast, most HOX monomers can bind TAAT, including HOXA1(N2K,A3R), suggesting that position 6 and 7 identity is usually unimportant for monomeric recognition. Thus, the positioning of the N-terminal arm of ABD-B subfamily members in the context of a TTAT monomeric site may be distinct from recognition of TAAT and may be more similar to the N-terminal arm conformation occurring in HOX·PBX heterodimers. Alternatively, T6 may be specified by different N-terminal arm residues in monomeric versus heterodimeric complexes. We note that HOXA1 and HOXD4 also differ in the N-terminal arm at positions 4, 7, and 8, in addition to positions 2 and 3 (Fig. 1B). One or more of these residues may therefore be brought into play in complexes with PBX.
We thank Florence W.-H. Ng for advice on purification of His-tagged proteins, Kandavel Shanmugam for bacterially purified HOXD4, and members of the laboratory for discussions and reading of the manuscript. We are grateful to Richard S. Mann for sharing data prior to publication.