(Received for publication, February 10, 1997, and in revised form, May 8, 1997)
From the Department of Biochemistry, Medical
Institute of Bioregulation, Kyushu University, Fukuoka 812-82, Japan and the § Department of Biology, Fukuoka Dental
College, Fukuoka 814-01, Japan
The enzyme 8-oxo-7,8-dihydrodeoxyguanosine
triphosphatase (8-oxo-dGTPase) hydrolyzes 8-oxo-dGTP
to 8-oxo-dGMP, thereby preventing misincorporation of
8-oxo-dGTP into DNA. We investigated expression of MTH1
gene encoding 8-oxo-dGTPase. Large amounts of
MTH1 mRNA were present in thymus and testis, embryonic
tissues, and certain cell lines. In peripheral blood lymphocytes, the
level of MTH1 mRNA was significantly increased after
concomitant treatment with phytohemagglutinin and interleukin-2.
Analyses of the 5 regions of the MTH1 transcripts revealed
that 7 types of MTH1 mRNAs, which may be produced by
transcription initiation at different sites and/or alternative
splicing. The MTH1 gene consists of 5 major exons, some of
which are composed of differentially processed segments. All types of
MTH1 mRNAs carry the entire coding region, and may be
functional. Three ATG initiation codons in-frame were found in the 5
regions of some of the MTH1 mRNAs. There is a polymorphic alteration at the 5
splicing site (GT to GC) located in
exon 2, an event which affects splicing patterns of the MTH1 transcript. Allele frequency of this polymorphism is about 20% among healthy volunteers.
Oxygen radicals produced during normal cellular metabolism damage chromosomal DNA. An oxidized form of guanine, 8-oxoguanine1 (8-oxoG; 8-oxo-7,8-dihydroguanine), seems to be pertinent in terms of mutagenesis as well as carcinogenesis (1-4). 8-Oxoguanine nucleotide can pair with cytosine and adenine nucleotides with an almost equal efficiency during DNA replication and, high frequency of mutation is induced (5, 6).
Spontaneous mutagenesis caused by the oxidation of guanine nucleotides can be separated into two pathways, one initiating from oxidation of guanine in DNA and the other from oxidation of guanine nucleotide in the nucleotide pool. The oxidation of guanine residues in DNA results in formation of the 8-oxoG:C pair, which can lead to a G:C to T:A transversion, unless repair is made (7, 8). Studies on Escherichia coli mutator mutants revealed that 8-oxoguanine generated in DNA is removed by DNA glycosylase/AP endonuclease, coded by the mutM gene (9-12), and that adenine paired with 8-oxoguanine is excised by a specific adenine-DNA glycosylase, coded by the mutY gene (13-15). Oxidation of guanine also proceeds in the form of free nucleotides, and an oxidized form of dGTP, 8-oxo-dGTP, is a potent mutagenic substrate for DNA synthesis (16). The MutT protein of E. coli hydrolyzes 8-oxo-dGTP to the corresponding nucleoside monophosphate, and lack of the mutT gene increases the occurrence of A:T to C:G transversion a thousand-fold over the wild type level (16-19).
Enzymes similar to those of the MutM, MutY, and MutT proteins were
found in mammalian cells (20-22). Among them, the MutT-related protein
has been studied most extensively (23). Based on the partial amino acid
sequence determined with the purified human 8-oxo-dGTPase protein,
cDNA for the human enzyme and the genomic sequence were isolated
(24, 25). The human gene for 8-oxo-dGTPase was named MTH1
for human mutT homologue and was found to be located on
chromosome 7 at p22. With expression of cDNA for human MTH1 protein
in the mutT cells the elevated frequency of
spontaneous mutation reverted to normal (24, 25). This means that the
human protein may have the same antimutagenic capacity as the E. coli MutT protein. cDNAs for mouse and rat enzymes have also
been isolated (26, 27).
To examine roles of mammalian 8-oxo-dGTPase in the control of
spontaneous mutagenesis as well as carcinogenesis, it is important to
examine expression of the gene in various tissues, at different stages
of development and under different physiological conditions, and to
elucidate molecular mechanisms involved in the regulation of gene
expression. We isolated various types of MTH1 transcripts, each of which has a unique structure at its 5-terminal region, and
their relations to the genomic sequence were elucidated. The existence
of a polymorphic alteration which affects splicing of some of the
transcripts is also given attention.
[-32P]dCTP and
[
-32P]ATP were purchased from Amersham International
plc (Buckinghamshire, United Kingdom). Recombinant Taq DNA polymerase, restriction enzymes, T4 DNA polymerase, T4 DNA ligase, and
T4 polynucleotide kinase were obtained from Takara Shuzo (Kyoto, Japan)
and Toyobo Co. (Osaka, Japan). T4 RNA ligase and calf intestinal alkaline phosphatase were purchased from New England Biolabs, Inc.
(Beverly, MA) and Boehringer Mannheim (Mannheim, Germany), respectively. DNA labeling kits were obtained from Nippon Gene (Toyama,
Japan). 1 Kb DNA Ladder and 0.24-9.5 Kb RNA Ladder as size standards,
10 × RPMI medium, cesium chloride, and formamide were purchased
from Life Technologies, Inc. (Gaithersburg, MD). Other chemicals were
obtained from Wako Pure Chemical Industries Ltd. (Osaka, Japan).
Sources of other materials are given in the text.
Lymphoblastoid cell lines established from healthy volunteers were kindly provided by Drs. T. Tana and T. Sasazuki. These cell lines and a Jurkat line, a human T cell leukemia cell line, were cultured in RPMI 1640 medium containing 10% fetal calf serum. HeLa S3 cells were grown in Dulbecco's modified Eagle's medium supplemented with 5% fetal calf serum and 5% horse serum at 37 °C in a humidified atmosphere with 5% CO2. Peripheral blood mononuclear cells were isolated using Ficoll-Paque (Pharmacia Biotech, Uppsala, Sweden). Peripheral blood lymphocytes (PBL) were obtained from peripheral blood mononuclear cells by removing monocytes adhering to the flask wall. PBL were cultured in RPMI 1640 medium containing 10% fetal calf serum, with or without 50 IU/ml interleukin-2 (Shionogi Co., Ltd., Japan) and 10 µg/ml phytohemagglutinin-P (Difco) for 72 h.
Preparation of RNATotal cellular RNA was prepared by the procedure of Chirgwin et al. (28). Briefly, cells in midlog growing phase were harvested, washed with ice-cold phosphate-buffered saline, and lysed with 4 M guanidine thiocyanate (Fluka Chemie AG, Buchs, Switzerland), 25 mM sodium citrate, 7% 2-mercaptoethanol, 0.5% sodium N-lauroyl sarcosinate (pH 7.0). The RNA was precipitated on a 5.7 M cesium chloride cushion by centrifugation at 32,000 rpm for 40 h in a Beckman SW40Ti rotor at 15 °C. The RNA was dissolved in 4 M guanidine thiocyanate, 25 mM sodium citrate, 7% 2-mercaptoethanol, extracted with phenol and chloroform, precipitated with ethanol, then dissolved in diethylpyrocarbonate-treated water. To obtain poly(A)+ RNA, an oligo(dT)-cellulose spun column (Pharmacia Biotech Inc.) was used, according to the manufacturer's manual. Purified poly(A)+ RNA was dissolved in 10 mM Tris-HCl (pH 7.6), 1 mM EDTA. RNAs prepared from various human tissues were purchased from CLONTECH Laboratories, Inc. (Palo Alto, CA).
Northern Blot AnalysisNorthern blotting was done as
described (29). RNA (12 to 15 µg) was dissolved in 24 µl of sample
buffer (50% formamide, 6.5% formaldehyde, 20 mM MOPS, pH
7.0), denatured at 65 °C for 5 min, and electrophoresed on a 1.2%
agarose containing 6.5% formaldehyde. RNA was transferred onto
nitrocellulose membrane (BA-85, Schreicher & Schuell Inc., Dassel,
Germany) by capillary transfer (30) and the membrane was baked at
80 °C for 2 h in vacuo. After prehybridization in
5 × SSPE (1 × SSPE: 0.15 M NaCl, 10 mM sodium phosphate, pH 7.0, 1 mM EDTA), 5 × Denhardt's solution, 0.1% sodium dodecyl sulfate (SDS), 200 µg
of sonicated salmon sperm DNA/ml, overnight at 42 °C, the membrane
was hybridized with 32P-labeled 461-bp
NcoI-AspI fragment of MTH1 cDNA as
a probe (1.25 ng/ml: specific radioactivity = 4.0 × 109 cpm/µg) in 50% formamide, 5 × SSPE, 5 × Denhardt's solution, 0.1% SDS, 200 µg of sonicated salmon sperm DNA
per ml, for 16 h at 42 °C. The membrane was washed twice in
2 × SSC (1 × SSC: 0.15 M NaCl, 0.015 M sodium citrate), 0.2% SDS at room temperature for 15 min, and then twice in 0.1 × SSC, 0.2% SDS for 15 min at 37 °C. Radioactivity on the membrane was measured in BAS 2000 Bio-image analyzer (Fuji Photo Film Co. Ltd., Tokyo, Japan). To confirm
amounts of RNA loaded, each blot was reprobed with a 1.0-kilobase EcoRI-BamHI fragment of 18S rRNA gene
prepared from pRcHE (31) (10 ng/ml: specific radioactivity = 8.0 × 106 cpm/µg), obtained from the Japanese
Cancer Research Resources Bank (JCRB).
Oligonucleotide primers;
MTH-Pr (TAGAGCCTGGAGGCGCCCATGGTCCCTGGG), MTH-P
(CGGCCCCGAAGCCTCGCTTTTTCAT), MTH1-17 (TTCATGCCCAGGAGAAC), MTH2-17
(CCAGCACCAGGGTATAG), BML
(GCACTTGACTATGACTGACTGAATTCTTTAGTGAGGGTTAATTGCC), BM-1
(CAATTAACCCTCACTAAAG), BM-2 (CTAAAGAATTCAGTCAGTC), T1
(AGCGGCGGTGCAGAACC), T2 (AAGCGGCGGTGCAGGTTT), T3 (AAGCGCGCGCGGGGATT),
T4 (GGGCTTTCTGTATCCCTAG), and Ex531 (GCTCTGCGCCACTCAAT) were
obtained from Kurabo (Osaka, Japan). The 5 end of BML was
phosphorylated while its 3
-hydroxyl end was blocked by adding an amino
group. Primers for genomic PCR of MTH1 exon 2, 668-5 (CCCTGCCTTATCGCAAGG) and 491-3 (GGCCATCAACTGATGGAAC), and primers for
direct sequencing of the PCR products, GT-GC1 (TGCCTTATCGCAAGGAC) and
GT-GC2 (GGCGGTCAGAGGAGAGC), were obtained from Takara Shuzo.
The 5 end of oligonucleotide MTH-Pr was
labeled using [
-32P]ATP and T4 polynucleotide kinase.
The labeled oligonucleotide (1 × 106 cpm) was
annealed with poly(A)+ RNA derived from Jurkat or HeLa S3
cells or yeast tRNA at 60 °C for 60 min. Hybridization was done in
10 mM Tris-HCl (pH 8.3), 0.25 M KCl, 1 mM EDTA by incubating at 65 °C for 1 h. The
material (20 µl) was mixed with 44.2 µl of a reaction mixture
containing 68.5 mM Tris-HCl (pH 8.3), 15 mM
dithiothreitol, 6.4 mM MgCl2, 75 µg/ml
actinomycin D, 0.36 mM unlabeled dNTP, and 60 units of rRNasin (Promega, Madison, WI). Primer extension reaction was initiated
by adding Moloney murine leukemia virus reverse transcriptase (500 units, Life Technologies, Inc.). The reaction mixture was incubated at
37 or 42 °C for 90 min, followed by precipitation with ethanol. The
precipitate was dissolved in 8 µl of formamide/loading dye and boiled
for 3 min. The product (4 µl) was applied by electrophoresis to a 6%
denaturing polyacrylamide gel with HinfI-digested pBR322 markers, labeled with 32P at the 5
end. Radioactivity of
the gel was analyzed using a BAS 2000 Bio-image analyzer.
Single-strand ligation to ss-cDNA(SLIC)-PCR
was performed as described by Baptiste et al. (32), with the
following modifications. Single strand (ss)-cDNA was synthesized
from 1 µg of total RNA primed with 6 pmol of MTH-P primer in 33 µl
of reaction mixture, using a first strand cDNA synthesis kit
(Pharmacia Biotech). The synthesized ss-cDNA was purified using a
NICK column (Pharmacia Biotech), and the remaining MTH-P primer was
removed using PrimeErase Quik Push Column (Stratagene, La Jolla, CA).
100 µl of the purified ss-cDNA solution was mixed with 75 µl of
2 N NaOH for RNA hydrolysis and ss-cDNA was
precipitated with ethanol. The 5 end of BML primer was ligated to the
3
end of synthesized ss-cDNA using T4 RNA ligase. PCR was
performed in a reaction mixture containing an appropriate amount of
ss-cDNA, 10 pmol each of MTH1-17 and BM1 primer, 10 nmol each of 4 types of deoxyribonucleoside triphosphates, 10 mM Tris-HCl
(pH 8.3), 50 mM KCl, 1.5 mM MgCl2,
0.001% gelatin, and 2.5 units of rTaq DNA polymerase in a
final volume of 50 µl. The initial denaturation was done at 94 °C
for 1 min, then amplification was performed by 40 cycles of
denaturation at 94 °C for 1 min, annealing at 55 °C for 2 min,
and extension at 72 °C for 1 min, using a DNA thermal cycler
(Perkin-Elmer). Following the first PCR, 1 µl of the reaction mixture
was added to the second PCR reaction mixture. Cycles of the second PCR
were run in the same manner except that MTH2-17 and BM2 primers were
used. The PCR products were analyzed in 6% PAGE and cloned into
pT7Blue T-vector (Novagen, Madison, WI).
Total RNA (1 µg) was reverse-transcribed into
ss-cDNA with MTH-P as a specific primer, using First Strand
cDNA Synthesis Kit (Pharmacia Biotech). To amplify a specific 5
region for each type of MTH1 mRNA, PCR was done in 50 µl of a reaction mixture containing the first strand cDNA, 2.5 units of rTaq DNA polymerase, 10 µM sense
primer for each type of MTH1 mRNA (T1 to T4), 10 µM antisense primer MTH2-17, and 200 µM
dNTP. The initial denaturation was done at 94 °C for 1 min, then
amplification was performed by 35 cycles of denaturation at 94 °C
for 30 s, annealing at 60 °C for 1 min, and extension at
72 °C for 2 min, followed by extension at 72 °C for 2 min. The
PCR product (10 µl) was digested with NcoI, and analyzed
by 8% PAGE. To amplify full-length MTH1 mRNA, oligo(dT)18 was used as a primer for synthesis of the
first-strand cDNA. PCR was performed as described above, except
that Ex531 was used as an antisense primer. PCR products (10 µl) were
separated on 3% agarose gel electrophoresis (NuSieve 3:1 Agarose, FMC
BioProducts, Rockland, ME). DNA was transferred onto nylon membrane
(Hybond N+, Amersham), and the filter was processed for
hybridization with 32P-labeled 461-bp
NcoI-AspI fragment of MTH1 cDNA as
a probe. Radioactivity on the membrane was measured in BAS 2000 Bio-image analyzer.
Nucleotide sequence was determined using Dye Terminator or Dye Primer Cycle Sequencing FS Ready Reaction Kits and model 373A automated DNA sequencer (Perkin Elmer), according to the manufacturer's instructions.
Genomic PCR and Direct SequencingGenomic DNA was extracted from various types of human cell lines using ISOGEN kits (Nippon Gene). To amplify the entire region for MTH1 exon 2, PCR was done in 100 µl of reaction mixture containing 100 ng of genomic DNA, 10 µM each sense (668-5) or antisense primer (491-3), 200 µM dNTP, and 2.5 units of rTaq DNA polymerase. The initial denaturation was performed at 95 °C for 1 min, then amplification was done by 35 cycles of denaturation at 95 °C for 45 s, annealing at 65 °C for 45 s, and extension at 72 °C for 45 s, followed by extension at 72 °C for 3 min. The PCR product (254 bp) was purified using Microcon 100 (Amicon Inc., Beverly, MA) and subjected to direct sequencing using Dye Terminator Cycle Sequencing FS Ready Reaction Kits and oligonucleotides GT-GC1 and GT-GC2 as primers.
Northern blot analysis was performed to determine levels
of MTH1 mRNA in various tissues and cultured cell lines.
As shown in Fig. 1, a band corresponding to 0.8-kilobase
MTH1 mRNA was detected in almost all of the samples
examined, although intensities of the bands varied considerably.
Radioactivities hybridized to MTH1 cDNA were quantified
using an image analyzer, and standardized for radioactivities
hybridized to 18 S ribosomal RNA, as shown in Table I.
Relatively large amounts of mRNA were found in thymus and testis.
Fetal tissues (brain and liver) also contained large amounts of
MTH1 mRNA.
|
The content of MTH1 mRNA in Jurkat cells, a human T cell leukemia cell line, was exceedingly high, as compared with findings in adult and fetal human tissues, evidence in accord with the observation that Jurkat cells contain a large amount of MTH1 protein with 8-oxo-dGTPase activity (20). HeLa cells, which also have a high proliferating capacity, had a lower but significantly large amount of MTH1 mRNA.
Induction of MTH1 mRNA SynthesisTo assess the
correlation between the cellular content of MTH1 mRNA
and the proliferating capacity of cells, we measured mRNA levels in
resting and actively proliferating cells. Lymphocytes in peripheral
blood are mostly in the G0 state, and when stimulated with
phytohemagglutinin and interleukin-2, they enter the proliferating cell
cycles within 72 h, as evidenced by flow-cytometric analysis (data
not shown). Total RNAs were prepared from the two phases of cells and
levels of MTH1 mRNA determined by Northern blot
analysis. As shown in Fig. 2, a large amount of
MTH1 mRNA was found in the RNA sample from the
proliferating cells while a much lesser amount of mRNA was seen in
the sample from the resting cells. About 7 times a larger amount of
mRNA were found in the proliferating phase, as compared with
findings in the resting one. Thus, expression of the MTH1
gene is regulated so as to reflect the proliferative state of cell.
Primer Extension Analysis of Transcription Products
To
determine the transcription initiation site(s) for the MTH1
gene, a primer extension experiment was done, the result of which is
shown in Fig. 3. Poly(A)+ RNA was prepared
from Jurkat cells, which exhibit an extremely high level of expression
of the gene, and used for the analysis. Major extension products were
detected around the 70-base region, and multiple extension products
larger than 100 bases were also seen, at a relatively lower level. We
obtained an essentially similar result with poly(A)+ RNA
prepared from HeLa S3 cells, which produce about a quarter of the
amount of mRNA, compared with Jurkat cells. Almost the same band
patterns were obtained when the reaction was performed at either 37 or
42 °C (lanes 4 and 6 in Fig. 3), suggesting
that these bands represent authentic transcription products, not
artificially terminated ones. These results indicate that there are
multiple 5 ends of the MTH1 transcripts.
Sequence Analysis of the Multiple Transcription Products
To
determine the nucleotide sequences of multiple 5 ends of the
MTH1 transcripts, SLIC-PCR was applied to amplify 5
parts of the MTH1 cDNA species (Fig.
4A). If the MTH1 transcript has a
N-base extended sequence beyond the MTH-Pr primer, a SLIC-PCR product
of (75 + N) bp length, which is longer than the corresponding primer-extension product by 45 bases should be amplified. Indeed, various lengths of amplified products as seen in the primer extension were obtained. These products were subcloned and their sequences determined.
All of 24 clones carrying MTH1 cDNAs less than 100 bp
exhibited the same sequence corresponding to the 5 part of
MTH1 cDNA originally isolated from Jurkat cells (24),
and this type of cDNA was named type 1. Among various sizes of PCR
products obtained, a 35-base length sequence extending beyond the
second exon was found as the longest 5
part of the type 1 cDNA
(Fig. 5). It is likely that the major extended product
in the primer extension of MTH1 mRNA is 67 bases in
length and represents the longest type 1 MTH1 mRNA (see
Fig. 3). In SLIC-PCR, the longest type 1 mRNA is expected to be 112 bp in length, although there were two additional PCR products shorter
than the 112-bp length product (Fig. 4B). This discrepancy
between the results of primer extension and SLIC-PCR would be due to a
preferential amplification of the shorter extended products from type 1 MTH1 mRNA.
By subcloning of SLIC-PCR products longer than 100 bp, we found various
types of 5 sequences composed of different segments. These cDNAs
were designated type 2, 3, and 4 MTH1 cDNAs according to
their composition of the segments. Type 2 cDNA has an insertion between the first and the second exon of type 1 cDNA (Fig. 5). In
type 2 cDNA, there are two types of insertions and, according to
types of insertion, it can be divided into 2A and 2B. Type 2A carries a
51-bp insertion while type 2B a 124-bp insertion, the latter being
composed of the 51-bp sequence and an additional 73-bp sequence. The
51-bp and the 73-bp sequences were designated exon 2b and 2c,
respectively, since they were found to exist contiguously in the
genomic sequence (see Fig. 6).
Type 3 cDNA carries, in place of exon 1a, exon 1b sequence that locates downstream of the exon 1a sequence in the genomic DNA. This type of cDNA also carries two types of insertions corresponding to those of type 2A and 2B, and they were named type 3A and 3B, accordingly. Type 4 cDNA, which carries exon 2a in place of exon 1a or 1b, is classified into 4A and 4B. They carry insertions also corresponding to those of 2A and 2B, respectively. Constitutions of these various types of cDNAs are shown in Fig. 5.
Seven Types of MTH1 mRNAsTo show that these various
types of MTH1 mRNAs are indeed present in cell, RT-PCR
analysis was performed using total RNA prepared from Jurkat cells. Four
types of PCR primers specific for the 5 end of each MTH1
mRNA species (T1 to T4, shown in Fig. 5) were prepared, and in
combinations with the common 3
-primer (MTH2-17), specific regions of
the mRNA were amplified as cDNA fragments. Fig.
7 shows patterns of PAGE analysis. Except for the case
of type 1 MTH1 mRNA that exists as a single form, two
types each of cDNA fragments, corresponding to those having 51- and
124-bp insertions, were detected. When the amplified fragments were
digested by NcoI restriction enzyme, which recognizes the
CCATGG sequence present at the site for the MTH1 initiation codon,
expected sizes of smaller fragments were produced. An additional small
band present in lane 4 was not affected by NcoI
digestion, and was disregarded.
To determine if all of the multitypes of MTH1 mRNAs
carry the coding sequence for MTH1 protein, we set up an experiment to amplify the entire coding region for MTH1 protein with the use of 5
primers specific for each type of MTH1 mRNA. Total RNA
was prepared from the human thymus, and the first strand cDNA was reverse-transcribed using an oligo(dT)18 primer to select
functional poly(A)+ mRNAs. As shown in Fig.
8, expected sizes of PCR products for 7 types of
MTH1 mRNA were obtained. Since there are some additional bands beside those with expected sizes, the PCR products were subjected
to Southern hybridization with 32P-labeled MTH1
cDNA as a probe. Only bands with expected sizes for the
MTH1 mRNA species were detected (Fig. 8, lower
panel). Thus, it seems clear that human cells contain functional
multiforms of MTH1 mRNAs with various 5
configurations.
Formation of 7 Types of MTH1 mRNAs by Alternative Splicing
We reported earlier that the human MTH1 gene
is composed of four exons (25). The present study has revealed that an
additional exon must exist between the previously characterized first
and second exons and, moreover, these exons are composed of more than two segments, which are transcribed together but spliced in a different
manner. Based on alignment of the cDNA sequences and the genomic
sequence, a new feature of the MTH1 gene, composed of 5 exons, now appears, for which exons are renamed according to their
arrangements. The overall structure of the gene thus defined is shown
in the upper part of Fig. 9.
Various patterns of splicing, which would produce different forms of mRNAs, are shown in the lower part of Fig. 9. Alternative splicing of a single primary transcript would produce all types of mRNAs, although there remains the possibility that three types of primary transcripts, one for type 1 and 2, and the others for types 3 and 4, might be transcribed from different initiation sites. It should be noted that sequences that fit the GT/AG rule exist around each of exon-intron junctions.
Polymorphic Alteration Affecting Splicing PatternWhen total
RNA prepared from human thymus was subjected to RT-PCR using
type-specific 5 primers, cDNA fragments corresponding to 7 different types of MTH1 mRNAs were detected, as expected from the foregoing experiments. However, a quite different pattern was
obtained with RNA prepared from PBL, provided by a healthy volunteer.
In this case, only four types of RNAs, corresponding to type 1, 2B, 3B,
and 4B, were found (Fig. 10). Sequence analysis of the
cDNA and the genomic DNA obtained from the same person revealed
that it has a homozygous T to C base substitution at the beginning of
exon 2c segment (see Fig. 5). This site serves as the 5
splicing site
during maturation of type 1, 2A, 3A, and 4A mRNA and, thus, the
base change should abolish proper splicing at this site, leaving
segments 2b and 2c connected.
To examine distribution of this particular base change among the human population, genomic DNAs were prepared from tumor cell lines (Jurkat and HeLa S3) and lymphoblastoid cell lines established from 10 healthy Japanese volunteers, and the corresponding region was amplified and sequenced. In most cases, including DNAs from the two tumor cell lines, this site is homozygous for GT, in two cases it is heterozygous as GT/GC and only one case shows homozygocity for GC. Thus, this site is polymorphic in the human population.
To understand regulatory mechanisms of expression of the
MTH1 gene, determination of the transcription initiation
site is essential, to be followed by identification of the promoter
region and characterization of cis-regulatory sequences. In the process of this approach, we found 7 types of MTH1 mRNA with
different 5 sequences in vivo. Comparisons of the sequences
for these mRNAs and the MTH1 genomic sequence revealed
that the MTH1 gene consists of 5 major exons, some of which
consist of two or three segments differentially processed.
In most or all of human cells and tissues, type 1 mRNA which lacks the exon 2 sequence is present as a major form, as judged from primer extension analysis and the frequency of isolated clones as SLIC-PCR products. The other 6 forms of MTH1 mRNAs carry at least one segment of exon 2, implying the existence of some regulation for exon selection in the course of processing of pre-MTH1 mRNAs. It is of interest to note that for type 1 mRNA, the major transcript lacks any segment of exon 2. On the other hand, type 4A and 4B mRNA, which lack the exon 1 sequence, carry the exon 2a sequence, which is not found in other types of mRNAs.
For efficient splicing reactions of pre-mRNA in mammalian cells, it
has been pointed out that at least four types of cis-elements present
within intron segments, are required (33). A 5 splice site which
directs the beginning of an intron has a consensus sequence of
(C/A)AG:GU(A/G)AGU, and GU is the 5
end of the intron. On the other
hand, a 3
splice site which determines the 3
end of an intron has a
much poorer consensus sequence, (N(C/U)AG:(G/A)), in which AG is its 3
end. In addition, two sequences present near the 3
splice site within
an intron are important and are called a branch point sequence
(UNCURAC) and a polypyrimidine-rich region. The former is necessary for
a lariat formation with the 5
splice site and is located in 18 to 38 nucleotides upstream of the 3
splice site, while the latter is found
between the former and the 3
splice site. At each exon-intron junction
of the MTH1 gene, the consensus sequences for the 5
splice
sites are well conserved, as follows: exon 1a (CAG:GUAcGa), exon 1b
(guG:GUGAcc), 2b (Aga:GUGAGU), and 2c (AAG:GUGAuU). The 3
splice site
preceding exon 3 has a well conserved feature for the consensus
sequence, namely, it has a 23-nucleotide length polypyrimidine tract
and a plausible branch point sequence (gGCUGAC). On the other hand, in
the 3
splice site preceeding exon 2b, a much shorter polypyrimidine tract with a poorly conserved branch point sequence (cAagGAC) was
found. These features of the cis-elements for splicing may explain why
exon 1a is more efficiently joined with exon 3 rather than with exon
2b, thus resulting in a predominant formation of type 1 MTH1
mRNA in cell.
Type 4A and 4B mRNAs lack a sequence corresponding to exon 1 and
the most 5 region of these mRNAs corresponds to 2a segment. No 2a
segment was found in other mRNA species that carry one of the exon
1 segments. It should be noted that no sequence similar to the 3
splice site is present around the 5
end of 2a segment, thus it is
likely that 2a segment serves as part of the first exon for type 4A and
4B MTH1 mRNAs.
In MTH1 transcripts, there are alternative selections of one
or more of three exon 2 segments. A polymorphic alteration,
Aga:GUGAGU to Aga:GcGAGU, was found in the 5
splice site sequence, located at the beginning of the exon 2c segment.
In peripheral blood lymphocytes prepared from an individual who is
homozygous for this polymorphic alteration, type 2A, 3A, and 4A
MTH1 transcripts were not detected. Frequency of this type
of polymorphic alteration in the MTH1 allele is about 20%,
implying that about 4 out of 100 individuals may have the homozygous
alterations regarding this particular site. Such a homozygote was found
in a group of young healthy volunteers, but to date there is no
apparent phenotype. Such variants might provide a useful means to
examine molecular mechanisms of alternative splicing as well as for
estimation of the biological significance of various forms of MTH1
protein, as discussed below.
The sequence of type 1 MTH1 mRNA is essentially the same
as that of the originally isolated cDNA (24), which directs
formation of a 18-kDa MTH1 protein. Type 2A, 3A, and 4A mRNAs would
code for the same polypeptide as a sole product, although they have different 5-untranslated regions, which may serve as elements for
modulating their translation efficiencies (34). It is noteworthy that
individuals with the homozygous alterations at the beginning of exon
2c, do not produce type 2A, 3A, and 4A mRNAs. The finding that
these mRNA species encode the same 18-kDa MTH1 polypeptide may
provide an explanation.
In three other types of MTH1 mRNAs with connected exon
2b-2c segments (type 2B, 3B, and 4B mRNA), there are three
additional in-frame initiation codons (ATG1, ATG2, and ATG3) in their
5-region (see Fig. 5). Interestingly, translation from ATG1 is
interrupted by a stop codon, TGA, located at the beginning of exon 2c.
In individuals in whom T at this site is substituted by C, the open reading frame from the ATG1 can get read-through into that for the
18-kDa MTH1 polypeptide, forming a larger polypeptide MTH1 with a
molecular mass of 22,505. If translation is initiated from ATG2 and
ATG3, polypeptides with molecular masses of 20,282 and 19,454 would be
produced. Thus, the polymorphic alteration in exon 2c must affect
expression patterns for various forms of MTH1 protein. Physiological
effects of such variation might be small, but attention to long-term
effects on spontaneous mutagenesis is needed. The sequence around ATG4
codon (ACCATGGGC) fits well the consensus sequence for the
translation initiation site, but others not so well, suggesting that
the frequency of initiation from these sites, if any, may be low. By
using an in vitro transcription/translation system, we
detected multiple forms of translation products derived from 2B, 3B,
and 4B cDNA. We also detected multiple polypeptides that
specifically react with anti-hMTH1 antibody, in crude extracts from
various human cell lines.2 One must take
into account that about 5% of MTH1 protein exists in the mitochondrial
matrix while the remaining MTH1 protein is present in the cytoplasm
(35). There is the possibility that the MTH1 polypeptides with extended
N-terminal sequences might be preferentially translocated to the
mitochondria. Alternatively, the N terminally extended portion of the
MTH1 polypeptide may modulate its stability and/or function in
vivo.
Around the 5 ends of exon 1a, 1b, and 2a no consensus sequence for the
3
splice site was found, further strengthening the idea that
transcription of the MTH1 gene may be initiated from just
upstream from these exons. We found that the sequence TCACTTCC, located
right upstream of exon 1a, is identical to the sequence for the
initiator of murine TdT gene (36). In addition, a stretch of
13-bp sequence just upstream of exon 1a is well conserved in the
promoter region for the mouse MTH1 (37). Assuming that the adenine residue located 6 nucleotides upstream of the 5
end of exon 1a
is the putative transcription initiation site for human MTH1
mRNA, the 13-bp sequence is located
17 to
29 in the human MTH1 gene (
25 to
37 in the mouse genome). This 13-bp
sequence contains a potential binding site for Ets family proteins, and two additional potential binding sites for Ets family proteins were
found near the putative initiation site and within exon 1a. Ets family
proteins are known to regulate transcription in response to multiple
developmental and mitogenic signals (38-41), and especially, expression of Ets-1 is regulated during both thymocyte development and
T-cell activation (42, 43). These sites may be involved in the
induction of MTH1 gene expression by phytohemagglutinin and
interleukin-2. There is no TATA and CCAAT-like sequence in the 5
upstream region of the human MTH1 gene, but potential
Sp1-binding sites are located 50 and 160 bases upstream of the
initiator sequence. This region is highly GC-rich, consistent with the
notion that the MTH1 gene is a housekeeping genes.
The nucleotide sequences reported in this paper have been submitted to DDBJ (DNA Data Bank of Japan) under accession numbers D38591 and D38592.
We extend special thanks to Drs. T. Tana and T. Sasazuki for providing lymphoblastoid cell lines, Drs. S. Oda and S. Mizuno for pertinent advice, and M. Ohara for comments on the manuscript.