©1996 by The American Society for Biochemistry and Molecular Biology, Inc.
A Novel Ca-binding Protein, p22, Is Required for Constitutive Membrane Traffic (*)

(Received for publication, December 8, 1995; and in revised form, February 13, 1996)

Margarida R. Barroso (§) Karen K. Bernd Natalie D. DeWitt Andrea Chang Ken Mills Elizabeth S. Sztul

From the Department of Cell Biology, University of Alabama Medical Center, Birmingham, Alabama 35294

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

We have identified a novel protein, p22, required for ``constitutive'' exocytic membrane traffic. p22 belongs to the EF-hand superfamily of Ca-binding proteins and shows extensive similarity to the regulatory subunit of protein phosphatase 2B, calcineurin B. p22 is a cytosolic N-myristoylated protein that undergoes conformational changes upon binding of Ca. Antibodies against a p22 peptide block the targeting/fusion of transcytotic vesicles with the apical plasma membrane, but recombinant wild-type p22 overcomes that inhibition. Nonmyristoylated p22, or p22 incapable of undergoing Ca-induced conformational changes, cannot reverse the antibody-mediated inhibition. The data suggest that p22 may act by transducing cellular Ca signals to downstream effectors. p22 is ubiquitously expressed, and we propose that its function is required for membrane trafficking events common to many cells.


INTRODUCTION

The processes of vesicle formation and fusion occur by conserved mechanisms acting at various steps of exocytic and endocytic pathways (1) . Transport vesicles bind to their cognate target membranes via a specific interaction mediated by the formation of v-SNAREbullett-SNARE complexes(2) . Subsequent membrane fusion requires the assembly of the alpha-SNAPbulletNSFbullet SNAREs complex and the ATPase activity of NSF(^1)(3) . Superimposed on this basic paradigm is the regulation by Ca, by GTP-binding proteins, and the involvement of various SEC products, the function of which are still unresolved. Here we report the identification of a novel p22 EF-hand Ca-binding protein required for ``constitutive'' membrane traffic.


EXPERIMENTAL PROCEDURES

Cloning and Sequencing

A rat liver GT11 cDNA expression library (kindly provided by Dr. J. Schwarzbauer) was screened with a polyspecific rabbit serum raised against rat transcytotic vesicles (TCVs). A partial cDNA clone was isolated and sequenced. A 170-base pair PCR amplified and gel-purified fragment of the 5` end coding sequence of this partial cDNA was used to screen a random-primed rat liver cDNA in pUEX (kindly provided by Dr. G. Banting). Several overlapping cDNA clones were isolated, cloned into pBluescript, and sequenced using standard techniques(4) . A mutation which disrupts the third EF-hand calcium binding loop of p22 was introduced by PCR site-directed mutagenesis. A PCR primer that spans p22's termination codon and has an 3` added XbaI restriction site was paired with primer E134A (5`GACAAGATCTCCCGCGATGCGCTG3`) in PCR reactions using p22 cDNA as a template. p22-E134A was gel-purified and digested with BglII and XbaI. The DNA fragments were then subcloned into the appropriate sites in the p22 cDNA clone resulting in the construct p22-E134A. The mutation was confirmed by DNA sequencing (4) .

Northern Blot

Tissues were dissected from freshly killed rats. Total RNA was extracted as described previously(5) . RNA samples (20 µg) were loaded on a formaldehyde-1% agarose gel, electrophoresed, and transferred to nylon membranes (GeneScreen Plus, DuPont NEN) as described previously(4) . The p22 and rpL32 cDNAs were gel-purified and P-labeled using a random prime labeling kit (Boehringer Mannheim).

Anti-p22 Antibodies

Anti-p22 antibodies were raised in rabbits to a synthetic peptide (CQLGSAIDRTIQEADQDGDS; residues 151-170 in p22 amino acid sequence) coupled to keyhole limpet hemocyanin (Pierce). Immune serum was affinity-purified (APpep1) using the peptide immobilized on Sulfolink coupling gel (Pierce)(6) .

Preparation of Recombinant p22

p22 cDNA was cloned as a NdeI-KpnI PCR fragment into pMON2670 (7) (kindly provided by Dr. J. I. Gordon) under the recA promoter and transformed into Escherichia coli JM101. Transformant cultures were grown in LB in the presence of ampicillin (100 µg/ml) and induced at an A = 0.8-1.0 with 50 µg/ml nalidixic acid. After 90 min, cells were collected and pelleted. Cell lysates were prepared by sonication and precipitated with 40% ammonium sulfate for 1 h at 4 °C. Precipitates were resuspended in 20 mM Tris, pH 8.0, 0.5 mM EDTA, and 0.5 mM dithiothreitol (TDE), dialyzed against the same buffer, and applied to an DEAE-Sepharose column equilibrated with TDE containing 50 mM KCl. The column was eluted with a 50-500 mM KCl gradient. Fractions were analyzed by immunoblotting with APpep1. The fractions containing p22 were collected, dialyzed against TDE, and applied to a Q-Sepharose Fast Flow column equilibrated with TDE containing 50 mM KCl, and fractions containing p22 were eluted with a 50-500 mM KCl gradient. The protein fraction containing p22 was dialyzed and applied to a gel filtration column (Superdex 75, Pharmacia). The fractions were analyzed by SDS-PAGE Coomassie Blue staining and immunoblotting with APpep1 and the fractions containing p22 were collected.

Preparation of Recombinant N-Myristoylated p22

p22-myr and p22-E134A were produced in a coupled bacterial system, where p22 or p22-E134A (cloned into pMON2670 as described above) and NMT (pBB131(8, 9) , kindly provided by Dr. J. I. Gordon and Monsanto, Corp.) were co-transformed into E. coli JM101. Double transformants bacterial cultures were shaken at 37 °C till A = 0.4-0.5 in LB with 100 µg/ml ampicillin and kanamycin. Isopropyl-1-thio-beta-D-galactopyranoside was then added to a final concentration of 0.5 mM to induce NMT production. Cultures were shaken at 37 °C for another 20 min, and then myristic acid (5 µg/ml) and nalidixic acid (50 µg/ml), to induce p22 production, were added to the cultures. After 1.5-2 h of induction, cells were harvested and p22-purified using standard chromatographic techniques as described under Preparation of Recombinant p22.

Cell-free Transcytotic Targeting/Fusion Assay

In vivo radiolabeled donor fraction and unlabeled target fractions and cytosol were prepared from rat livers as described(10) . Targeting/fusion assays and analysis of pIgA-R were performed as described(10) . Fusion is scored as the amount of proteolytic cleavage of pIgA-R which occurs when TCVs containing pIgA-R fuse with apical PM containing a serine ecto-protease. The cleavage results in a shift in mobility of pIgA-R from 120 kDa to 90 kDa (arrowhead) and is detected by fluorographs of SDS-PAGE gels. In some experiments, reaction mixtures were centrifuged and supernatant and pellets were separated. To quantitate p22 wild-type and mutant proteins for addition to the fusion reactions, increasing amounts (0.1-1 µl) of cytosol (12 mg/ml) were compared to that of recombinant p22s (p22-rec, p22-myr, and p22-E134A) by immunoblotting. An amount of each of the recombinant p22s corresponding to the amount of p22 present in 10 µl of cytosol was added to fusion reactions.

SDS-PAGE, Immunoblotting, and in Vitro Transcription/Translation

Samples were processed for SDS-PAGE and immunoblotting as described(11) . Immunoblots were processed by chemiluminescence (Renaissance, DuPont NEN) and nitrocellulose filters were exposed to x-ray film. p22 cDNA was in vitro transcribed using ``mCAP'' mRNA capping kit (Stratagene Cloning Systems). The mRNA transcript was translated in the presence of [S]methionine using an In Vitro Express rabbit reticulocyte translation kit (Stratagene Cloning Systems).


RESULTS AND DISCUSSION

To identify novel proteins involved in membrane traffic, we generated a polyspecific rabbit serum against proteins present in a homogeneous population of specialized exocytic vesicles(12) , TCVs, isolated from polarized epithelial cells. This serum recognizes predominantly a 108-kDa protein named TAP/p115(10, 12, 13) , but also interacts with other proteins of smaller molecular mass (data not shown). We used this antibody to screen a rat liver gt11 cDNA expression library. A 5` end PCR-amplified fragment from a positive clone was then used to screen a rat liver cDNA library. Several overlapping cDNA clones were identified revealing a single open reading frame (ORF). The ORF contains 585 nucleotides encoding a novel 195-amino acid polypeptide with a calculated molecular mass of 22.4 kDa (p22) (GenBank accession number U39875). Subsequent work showed that the ORF encodes a protein with an apparent molecular mass of 27 kDa. p22 is predicted to be acidic with a pI of 4.82. Analysis of the predicted amino acid sequence revealed an N-myristoylation consensus site (14) (Fig. 1A, double underlined) and four regions (residues 30-58, 62-90, 114-142, and 155-183; Fig. 1A, boxed) that conform to the consensus sequence of the EF-hand motif (15, 16) (Fig. 1B). The helix-loop-helix domain of the EF-hand includes a 12-residue loop, involved in the coordination of the Ca ion, flanked by two alpha-helices(16) . Although all four EF-hands of p22 show homology to the consensus EF-hand motif, p22EF-2 contains a Phe residue in position 10 (the X position is required for the coordination of the Ca ion and can be only Glu, Gln, Asp, Ser, or Thr) and is predicted not to bind Ca. The other three EF-hands conform to the required consensus for Ca binding but show several amino acid variations. p22EF-1 and p22EF-2 contain an Asp and a Gly residue, respectively, at position 21 (-Z) of the EF-hand, instead of the more conserved Glu residue present in p22EF-3 and p22EF-4. Another variation occurs at position 15 in which the conserved Gly residue is present only in p22EF-1, while an Asp residue is present in p22EF-3 and a Ser residue is present in p22EF-4 (Fig. 1B). These variations, shown to occur in other members of the EF-hand superfamily, are likely to play functional roles since selectivity for residues in coordinating positions of the EF-hand correlates with the Ca ion affinity of the EF-hand (17) .


Figure 1: Sequence homology and distribution of p22. A, alignment of rat p22 sequence with sequences of calcineurin B from Naegleria and rat. The p22 cDNA contains a single open reading frame (ORF) of 585 nucleotides, encoding 195 amino acids. The N-myristoylation site is double underlined (residues 2-7), and the four EF-hands are boxed (p22EF-1, residues 30-58; p22EF-2, 62-90; p22EF-3, 114-142; and p22EF-4, 155-183). The peptide used for polyclonal antibody production is underlined (residues 151-170). The amino acid sequences of calcineurin B (CLNB) from rat (GenBank accession number L03554) and N. gruberi (GenBank accession number U04380) are aligned with the rat p22 sequence (top line; GenBank accession number U39875) for maximal homology using the PILEUP routine from the GCG package. Amino acids identical between p22 and rat CLNB or Naegleria CLNB are shaded. The 5 Ca-coordinating residues (X, Y, Z, -X, and -Z) are indicated above the p22 sequence. Numbers refer to the p22 amino acid sequence. B, the EF-hand domains of p22. The canonical EF-hand domain consists of a 12-amino acid Ca binding loop flanked on both sides by 8-9-amino acid stretches predicted to form alpha-helices. Residues 1-11 comprise the first helix, 11-20 the Ca-binding loop, and 19-29 the second alpha-helix. The consensus sequence includes: E, Glu; n, any hydrophobic residue; *, variable; G, Gly; I, Ile, Leu, or Val; X, Y, Z, -X, and -Z (bold) are five of the six Ca-coordinating residues and can be: Glu, Gln, Asp, Ser, Thr; # can be any amino acid and coordinates the Ca ion through its carbonyl oxygen. The four EF-hand domains of p22 are shown beneath the consensus sequence. The nonconserved amino acid in position X of the p22EF-2 is underlined. C, relationship alignments. Dendogram illustrating the relationship between rat p22 and other members of the EF-hand superfamily. These clustering relationships are based on the PILEUP program which compares a group of related sequences with each other using progressive pairwise alignments. Distance along the horizontal axis is proportional to the difference between sequences. Entire protein sequences were used for these comparisons. D, tissue distribution of p22 mRNA. Northern blot analysis of total RNA from various rat tissues (B, brain; L, lung; T, testes; K, kidney; S, spleen; and H, heart). The p22 panel shows hybridization of a p22 cDNA P-labeled probe. The blot was stripped and hybridized to a control probe (kindly provided by J. Saam and Dr. S. Tilghman) corresponding to the ribosomal protein gene, rpL32 (18) (rpl 32 panel).



BLAST searches of data bases revealed that p22 shares extensive amino acid sequence similarity with the regulatory subunit of protein phosphatase 2B (also known as calcineurin B, CLNB) from various organisms (Fig. 1A, shaded residues). The highest sequence similarity was observed with a CLNB from the protozoan Naegleria gruberi (51.4% identity; 72.3% similarity), slightly less with CLNB from mammalian sources (43.5% identity; 65.9% similarity with rat CLNB), and with CLNB from Drosophila melanogaster and yeast Saccharomyces cerevisiae (40-44% identity; 63-65.8% similarity). p22 shows lower but significant similarity (25-30% identity; 50-60% similarity) with other members of the EF-hand superfamily, such as recoverins, visinins, frequenin, centrins, and calmodulins. The primary sequence of p22 is completely congruent with those of CLNBs from various species, i.e. p22EF-1 is more closely related to the EF-1 domain of all the CLNB subfamily members than to the other EF-hands in p22. This suggests that p22 and CLNB evolved from a precursor four-domain protein in an ancestral organism. However, congruency is not sufficient for inclusion into a subfamily(16) . Two characteristics of p22's primary structure appear to place it in a separate subfamily: 1) p22EF-2 is inferred not to bind Ca while the second EF-hand domain of CLNB does bind Ca; 2) p22 contains a 23-residue linker domain localized between p22EF-2 and p22EF-3 (RPI . . . RSN) while the linker between domains 2 and 3 of CLNB is only eight residues long (KEQ . . . KLR). Therefore, relationships based on sequence similarities between p22 and other members of the EF-hand superfamily suggest that p22 belongs to a separate subfamily that is closely related to the CLNB subfamily (Fig. 1C).

p22 mRNA (2.2-2.4 kilobases) was specifically detected in all tissues that contained detectable amounts of the control mRNA, rpL32 (18) (Fig. 1D), using high stringency Northern blot analysis. p22 Northern blot analysis was consistent with immunoblotting analysis of p22 protein levels in the same tissues (data not shown).

To facilitate further studies, anti-p22 antibodies were raised in rabbits against a 20-residue peptide (pep1) (residues 151-170; Fig. 1A, underlined), selected using the GCG Peptide Structure program from the GCG package, for high antigenicity and surface exposure. The antibodies were affinity-purified (AP) on a pep1 column. The APpep1 antibodies immunoprecipitate S-labeled p22 generated by in vitro transcription/translation of the p22 ORF cloned into pBluescript (Fig. 2A, lane APpep1). Recombinant p22 (p22-rec) was expressed in E. coli JM101 under a recA promoter and purified to homogeneity from bacterial lysates using standard chromatographic techniques (Fig. 2B, lane p22-rec). APpep1 antibodies recognize the recombinant p22 (Fig. 2C, lane p22-rec) by immunoblotting but not cell lysate of E. coli not expressing p22 (Fig. 2C, lane -p22). Significantly, the APpep1 antibodies also recognize a protein of the same molecular weight in rat liver cytosol (Fig. 2C, lane cyt).


Figure 2: Characterization of anti-p22 APpep1 antibody. A, APpep1 recognizes in vitro translated p22. In vitro transcribed and translated p22 was subjected to immunoprecipitation using APpep1 anti-p22 antibodies (lane APpep1), or preimmune serum (lane PI). Immunoprecipitated proteins were analyzed by SDS-PAGE and fluorography. The molecular masses in kDa are indicated on the left. B, p22 expression in bacteria. p22 was expressed in E. coli JM101 and purified from bacterial lysates using standard chromatographic techniques. A Coomassie Blue-stained SDS-PAGE of the purified material (lane p22-rec) is shown. The molecular masses in kDa are on the left. C, APpep1 recognizes recombinant and endogenous p22. Purified bacterially expressed p22 (lane p22-rec), cell lysate of bacteria not expressing p22 (lane -p22) and rat liver cytosol (lane cyt) were subjected to SDS-PAGE and transferred to nitrocellulose. Nitrocellulose was immunoblotted with APpep1 antibodies. A chemiluminescence image is shown. The molecular masses in kDa are indicated on the right.



Since another protein, TAP/p115, identified using the polyspecific anti-TCV serum has been shown to be required for membrane traffic(13, 19) , we examined whether p22 is required in a cell-free assay that reconstitutes the targeting/fusion of TCVs with the apical plasma membrane (PM)(10) . We have shown previously that NSF and TAP/p115 are required for transcytotic targeting/fusion(10, 13) . Membrane fusion in this assay is measured as the proteolytic cleavage of the 120-kDa polymeric IgA receptor (pIgA-R) to a 90-kDa fragment, which occurs when TCVs containing pIgA-R fuse with the apical PM, which contains a serine ecto-protease. When donor TCVs and acceptor PM fractions are mixed with 10 µl of cytosol and an ATP-regenerating system and incubated at 37 °C for 1 h, fusion proceeds normally as evidenced by the conversion of 80% of the 120-kDa pIgA-R to the 90-kDa fragment (Fig. 3A, lane 1). Addition of 0.05 µg/ml or 0.1 µg/ml APpep1 to the fusion reaction has no apparent effect on fusion efficiency (lanes 2 and 3). However, a dramatic reduction in fusion is observed when APpep1 is added to the fusion reaction at a concentration of 0.25 or 0.5 µg/ml (lanes 4 and 5).


Figure 3: p22 is required for transcytotic targeting/fusion. A, APpep1 inhibits transcytotic targeting/fusion. Fusion reaction mixtures containing untreated cytosol (lane 1) or cytosol treated with increasing amounts of APpep1 (lanes 2-5) were incubated for 1 h at 37 °C. Fusion was terminated and pIgA-R was immunoprecipitated and analyzed by SDS-PAGE. A fluorograph is shown. The uncleaved 120-kDa form of pIgA-R and its 90-kDa proteolytic fragment (arrowhead) are visible. B, p22 is required for transcytotic targeting/fusion. The following fusion reactions were incubated for 1 h at 37 °C. Lane 1, reaction mixture containing donor, acceptor, ATP-regenerating system, and 10 µl of cytosol; lane 2, as in lane 1 but supplemented with 0.25 µg/ml APpep1 antibodies; lane 3, as in lane 2 but supplemented with additional 10 µl of fresh cytosol; lane 4, as in lane 2 but supplemented with purified recombinant N-myristoylated p22, p22-myr (amount corresponding to the amount of p22 present in 10 µl of cytosol). Fusion was terminated and pIgA-R was immunoprecipitated and analyzed by SDS-PAGE. A fluorograph is shown. The uncleaved 120-kDa form of pIgA-R and its proteolytic fragment (arrowhead) are visible.



To ensure that the inhibitory activity of the APpep1 antibody was due to its specific binding to p22 and not general inactivation of the reaction, we tested whether addition of fresh cytosol or recombinant N-myristoylated p22 (p22-myr) to the APpep1-inhibited fusion reaction could restore fusion. As shown in Fig. 3B, lane 1, in the absence of APpep1, fusion proceeds normally, while the addition of 0.25 µg/ml APpep1 drastically inhibits fusion (lane 2). Addition of 10 µl of fresh cytosol reverses that inhibition (lane 3) to the level of fusion observed in the absence of APpep1. To show that p22 was responsible for the reversal of inhibition, p22-myr was produced in E. coli JM101 using a coupled bacterial expression system where yeast myristoyl-CoA:protein N-myristoyltransferase (NMT) and p22 were co-induced from distinct promoters in the presence of myristic acid(8, 9, 20) . p22-myr was purified by standard chromatographic techniques to homogeneity as described for p22-rec. Addition of purified p22-myr (in an amount corresponding to the amount of p22 present in 10 µl of cytosol, data not shown) reversed the APpep1 inhibition (Fig. 3B, lane 4) to the same extent as addition of 10 µl of fresh cytosol. These results indicate that p22 is required for the exocytic targeting/fusion of TCVs with the PM.

The role of Ca in constitutive exocytosis is disputed (21, 22) , although it has been suggested that Ca might be required for exocytic secretion in all cell types(23, 24, 25) . p22 contains four EF-hands, three of which (p22EF-1, p22EF-3, and p22EF-4) are predicted to bind Ca (Fig. 1B). To test directly whether p22 binds Ca, the protein was expressed in E. coli using 6 times His-tagged QIAexpress expression vector (Qiagen Inc., Chatsworth, CA), purified by passing it through a nickel affinity column, and assayed for Ca binding by the Ca overlay technique(26) . As shown in Fig. 4A, p22 binds Ca. The majority of Ca-binding regulatory proteins undergo Ca-dependent conformational changes (27) that modulate their function or influence the activity of their effectors. To examine whether p22 undergoes Ca-mediated conformational changes, we assayed p22's electrophoretic migration on native acrylamide gel (28) under a range of Ca concentrations. At 0.4-0.5 µM Ca concentration, native p22 undergoes an electrophoretic mobility shift (Fig. 4B, panel p22), indicating a conformational change. To examine the functional significance of p22's Ca-mediated conformational changes, we constructed a p22EF-3 mutant in which a Glu residue (-Z), involved in the coordination of the Ca ion, was replaced by an Ala residue (p22-E134A) and tested its ability to undergo an electrophoretic mobility shift and to support targeting/fusion. As shown in Fig. 4B, panel p22-E134A, the p22-E134A mutant does not show altered electrophoretic mobility when Ca concentrations reach 0.4-0.5 µM, suggesting that p22EF-3 needs to bind Ca for p22 to undergo Ca-mediated conformational changes. Addition of bacterially produced, purified N-myristoylated p22-E134A to the APpep1-treated transcytotic fusion reaction (in an amount corresponding to the amount of p22 present in 10 µl of cytosol, data not shown), was not able to restore transcytotic targeting/fusion to normal levels (Fig. 4C, lane 6). These results indicate that p22's ability to undergo Ca-mediated conformational changes is required for exocytic traffic.


Figure 4: p22 calcium binding and N-myristoylation are required for transcytotic targeting/fusion. A, p22 binds calcium. p22 was expressed in E. coli using the 6 times His-tagged QIAexpress expression vector (Qiagen Inc.) and the soluble fraction either analyzed directly (lane Lysate) or after purification over Ni-NTA columns (Qiagen Inc.) prior to SDS-PAGE (lane Ni-NTA). The gel was transferred to nitrocellulose and either immunoblotted with APpep1 antibodies or incubated with Ca(25) . A chemiluminescence image (panel APpep1) and an autoradiograph (panelCa) are shown. B, p22 undergoes Ca-dependent conformational changes. In vitro transcribed and translated p22 (panel p22) or a mutant containing a Glu to Ala substitution in the -Z position (amino acid 134) of p22EF3 (panel p22-E134A) were incubated with increasing concentrations of free Ca (0.005-5.0 µM) for 10 min at 25 °C prior to electrophoresis on a native acrylamide gel(28) . Ca/EGTA buffers were prepared according to (49) . A fluorograph is shown. C, N-myristoylation and Ca-mediated conformational shifts of p22 are required for transcytotic targeting/fusion. The following fusion reactions were incubated for 1 h at 37 °C. Lane 1, reaction mixture containing donor, acceptor, ATP-regenerating system, and 10 µl of cytosol; lane 2, as in lane 1 but supplemented with 0.25 µg/ml APpep1 antibodies; lane 3, as in lane 2 but supplemented with an additional 10 µl of fresh cytosol; lane 4, as in lane 2 but supplemented with purified recombinant N-myristoylated p22, p22-myr (amount corresponding to the amount of p22 present in 10 µl of cytosol); lane 5, as in lane 2 but supplemented with recombinant nonmyristoylated p22, p22-rec (amount corresponding to the amount of p22 present in 10 µl of cytosol); lane 6, as in lane 2 but supplemented with recombinant N-myristoylated EF-hand mutant, p22-E134A (amount corresponding to the amount of p22 present in 10 µl of cytosol). Fusion was terminated and pIgA-R was immunoprecipitated and analyzed by SDS-PAGE. A fluorograph is shown. The uncleaved 120-kDa form of pIgA-R and its proteolytic fragment (arrowhead) are visible. D, p22 is N-myristoylated in vivo. Cell lysates of E. coli JM101 co-expressing p22 and NMT (lane NMT+p22) in the presence of [^3H]myristic acid were analyzed by SDS-PAGE and fluorography. Control bacteria expressing only p22 (lane p22) or NMT (lane NMT) in the presence of [^3H]myristic acid are also shown.



CLNB(29) , members of the recoverin family(20, 30, 31, 32, 33) , and some annexins (34) are N-myristoylated, and this modification appears functionally relevant, as shown for the interaction between the alpha and beta subunits of trimeric G(o)(35) and for the membrane association of p60(36) . p22 contains an N-myristoylation consensus sequence and to assay directly whether p22 is N-myristoylated, we co-expressed p22 and NMT in E. coli JM101 in the presence of [^3H]myristic acid(8, 9, 20) . When p22 and NMT are co-expressed, a 27-kDa protein is specifically labeled by [^3H]myristic acid (Fig. 4D, lane NMT+p22). However, if p22 (lane p22) or NMT (lane NMT) is expressed alone, no myristoylated p22 is produced. Immunoblot analysis of these samples showed that p22 is detected in all the samples expressing p22 (data not shown). The functional significance of the N-myristoylation was determined by adding purified nonmyristoylated p22 (p22-rec) produced in bacteria to the APpep1-inhibited fusion reaction to determine whether p22-rec could restore transcytotic targeting/fusion to normal levels. As shown in Fig. 4C, lane 5, addition of p22-rec (in amounts corresponding to the amount of p22 present in 10 µl of cytosol, data not shown) to the APpep1-treated transcytotic fusion reaction does not restore fusion to normal levels. These results strongly suggest that both N-myristoylation and Ca-mediated conformational changes are essential for the function of p22 in exocytic traffic.

Recently, it has been shown that Ca-dependent neurotransmitter release shares a common SNAP/SNARE-mediated mechanism with constitutive membrane fusion(2, 37, 38) . Synaptotagmin has been proposed to be the Ca sensor at the synapse, but whether synaptotagmin functions as a Ca sensor promoting vesicle fusion or as a Ca-dependent negative regulator of exocytosis is not yet resolved(39, 40, 41, 42) . Ca is also required for several constitutive membrane fusion events (ER to Golgi(43) , endosomal fusion(44) , ER to Golgi in yeast(45) , constitutive exocytosis in yeast(46) , nuclear fusion(47) , transcytotic traffic, data not shown), and we propose that p22 is part of the molecular mechanism that mediates the Ca regulation of constitutive exocytic membrane traffic. Recently, it was shown that the endosomal recycling pathway can be up-regulated by elevating the Ca concentration(42) . Evidence presented here suggests that p22 might act as a general Ca sensor for constitutive exocytosis: p22 is widely expressed, it is required for transcytotic targeting/fusion cell-free assay, it undergoes conformational changes upon binding of concentrations of Ca within the range of those shown for other constitutive fusion events (42, 43, 44, 47) (0.1-1 µM), and specific mutations render it unable to function in transcytotic targeting/fusion. Thus, it is possible that, as with the rab superfamily of GTP-binding proteins, proteins belonging to the EF-hand superfamily of Ca-binding proteins might have an important role in regulating membrane traffic. Recently, frequenin, a Drosophila member of the recoverin family of EF-hand Ca-binding proteins, was shown to facilitate neurotransmitter release in neuromuscular junctions(48) . The molecular mechanism of p22's action is unknown. However, we speculate that, like other members of the EF-hand superfamily, it uses conformational changes to transduce cellular Ca signals to other protein(s) involved in membrane trafficking. p22 might act directly in membrane traffic or alternatively, by indirectly modulating an essential component of the membrane traffic machinery.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Biology, Gilmer Hall, University of Virginia, Charlottesville, VA 22903. Tel.: 804-243-7616: Fax: 804-982-5626; mmb8n{at}virginia.edu.

(^1)
The abbreviations used are: NSF, N-ethylmaleimide sensitive factor; TCV, transcytotic vesicle; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis; PM, plasma membrane; NMT, myristoyl-CoA:protein N-myristoyltransferase; CLNB, calcineurin B.


ACKNOWLEDGEMENTS

We thank the members of the Sztul laboratory for helpful discussions. We are grateful to Dr. J. Schwarzbauer, Dr. G. Banting, J. Saam, Dr. S. Tilghman, Dr. J. I. Gordon, and the Monsanto Corp. for their generous gifts of cDNA libraries and plasmids. We thank Emily Jackson-Machelski for her help with the N-myristoylation of proteins in E. coli. We appreciate the helpful comments and discussions with Dr. R. Kretsinger and Dr. K. Howell.


REFERENCES

  1. Rothman, J. E., and Warren, G. (1994) Curr. Biol. 4, 220-232 [Medline] [Order article via Infotrieve]
  2. Sollner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., and Rothman, J. E. (1993) Nature 362, 318-324 [CrossRef][Medline] [Order article via Infotrieve]
  3. Whiteheart, S. W., Rossnagel, K., Buhrow, S. A., Brunner, M., Jaenicke, R., and Rothman, J. E. (1994) J. Cell Biol. 126, 945-954 [Abstract]
  4. Sambrook, J., Maniatis, T., and Fritsch, E. F. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  5. Barroso, M., Dargouge, O., and Lechner, M. C. (1988) Eur. J. Biochem. 172, 363-369 [Abstract]
  6. Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  7. Li, E., Locke, B., Yang, N. C., Ong, D. E., and Gordon, J. I. (1987) J. Biol. Chem. 262, 13773-13779 [Abstract/Free Full Text]
  8. Duronio, R. J., Jackson-Machelski, E., Heuckeroth, R. O., Olins, P. O., Devine, C. S., Yonemoto, W., Slice, L. W., Taylor, S. S., and Gordon, J. I. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 1506-1510 [Abstract]
  9. Duronio, R. J., Rudnick, D. A., Johnson, R. L., Linder, M. E., and Gordon, J. I. (1990) Methods 1, 253-263
  10. Sztul, E., Colombo, M., Stahl, P., and Samanta, R. (1993) J. Biol Chem. 268, 1876-1885 [Abstract/Free Full Text]
  11. Sztul, E., Howell, K. E., and Palade, G. E. (1985) J. Cell Biol. 100, 1248-1254 [Abstract]
  12. Sztul, E., Kaplin, A., Saucan, L., and Palade, G. (1991) Cell 64, 81-9 [Medline] [Order article via Infotrieve]
  13. Barroso, M., Nelson, D., and Sztul, E. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 527-531 [Abstract]
  14. Grand, R. G. A. (1989) Biochem. J. 258, 625-638 [Medline] [Order article via Infotrieve]
  15. Heizmann, C. W., and Hunziker, W. (1991) Trends Biochem. Sci. 16, 98-103 [CrossRef][Medline] [Order article via Infotrieve]
  16. Kawasaki, H., and Kretsinger, R. H. (1995) Protein Profile 1, 343-517
  17. Babu, A., Su, H., Ryu, Y., and Gulati, J. (1992) J. Biol. Chem. 267, 15469-15474 [Abstract/Free Full Text]
  18. Dudov, K. P., and Perry, R. P. (1984) Cell 37, 457-468 [Medline] [Order article via Infotrieve]
  19. Sapperstein, S. K., Walter, D. M., Grosvenor, A. R., Heuser, J. E., and Waters, M. G. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 522-526 [Abstract]
  20. Ray, S., Zozulya, S., Niemi, G. A., Flaherty, K. M., Brolley, D., Dizhoor, A. M., McKay, D. B., Hurley, J., and Stryer, L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5705-5709 [Abstract]
  21. de Curtis, I., and Simons, K. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8052-8056 [Abstract]
  22. Miller, S. G., and Moore, H. P. (1991) J. Cell Biol. 112, 39-54 [Abstract]
  23. Popov, S. V., and Poo, M.-M. (1993) Cell 73, 1247-1250 [Medline] [Order article via Infotrieve]
  24. Neher, E., and Zucker, R. S. (1993) Neuron 10, 21-30 [Medline] [Order article via Infotrieve]
  25. Turner, M. D., Rennison, M. E., Handel, S. E., Wilde, C. J., and Burgoyne, R. D. (1992) J. Cell Biol. 117, 269-278 [Abstract]
  26. Chakravarti, S., Tam, M. F., and Chung, A. E. (1990) J. Biol. Chem. 265, 10597-10603 [Abstract/Free Full Text]
  27. Strynadka, N. C. J., and James, M. N. G. (1989) Annu. Rev. Biochem. 58, 951-998 [CrossRef][Medline] [Order article via Infotrieve]
  28. Davis, T. N., Urdea, S., Masiarz, F. R., and Thorner, J. (1986) Cell 47, 423-431 [Medline] [Order article via Infotrieve]
  29. Aitken, A., Klee, C. B., and Cohen, P. (1984) Eur. J. Biochem. 139, 663-671 [Abstract]
  30. Dizhoor, A. M., Ericsson, L. H., Johnson, R. S., Kumar, S., Olshevskaya, E., Zozulya, S., Neubert, T. A., Stryer, L., Hurley, J. B., and Walsh, K. A. (1992) J. Biol. Chem. 267, 16033-16036 [Abstract/Free Full Text]
  31. Dizhoor, A. M., Chen, C. K., Olshevskaya, E., Sinelnikova, V. V., Phillipov, P., and Hurley, J. B. (1993) Science 259, 829-832 [Medline] [Order article via Infotrieve]
  32. Kobayashi, M., Takamatsu, K., Saitoh, S., Miura, M., and Noguchi, T. (1992) Biochem. Biophys. Res. Commun. 189, 511-517 [Medline] [Order article via Infotrieve]
  33. Teng, D. H.-F., Chen, C.-K., and Hurley, J. B. (1994) J. Biol. Chem. 269, 31900-31907 [Abstract/Free Full Text]
  34. Wice, B. M., and Gordon, J. I. (1992) J. Cell Biol. 116, 405-422 [Abstract]
  35. Linder, M. E., Pang, I. H., Duronio, R. J., Gordon, J. I., Sternweis, P. C., and Gilman, A. G. (1991) J. Biol. Chem. 266, 2654-4659
  36. Kamps, M. P., Buss, J. E., and Sefton, B. M. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 4625-4628 [Abstract]
  37. DeBello, W. M., O'Connor, V., Dresbach, T., Whiteheart, S. W., Wang, S. S., Schweizer, F. E., Betz, H., Rothman, J. E., and Augustine, G. J. (1995) Nature 373, 626-630 [CrossRef][Medline] [Order article via Infotrieve]
  38. Scheller, R. H. (1995) Neuron 14, 893-897 [Medline] [Order article via Infotrieve]
  39. Popov, S. V., and Poo, M.-M. (1993) Cell 73, 1247-1249 [Medline] [Order article via Infotrieve]
  40. DeBello, W. M., Betz, H., and Augustine, G. J. (1993) Cell 74, 947-950 [Medline] [Order article via Infotrieve]
  41. Schweizer, F. E., Betz, H., and Augustine, G. J. (1995) Neuron 14, 689-696 [Medline] [Order article via Infotrieve]
  42. Morimoto, T., Popov, S., Buckley, K. M., and Poo, M.-M. (1995) Cell 15, 689-696
  43. Beckers, C. J. M., and Balch, W. E. (1989) J. Cell Biol. 108, 1245-1256 [Abstract]
  44. Mayorga, L. S., Beron, W., Sarrouf, M. N., Colombo, M. I., Creutz, C., and Stahl, P. D. (1994) J. Biol. Chem. 269, 30927-30934 [Abstract/Free Full Text]
  45. Rexach, M. F., and Schekman, R. W. (1991) J. Cell Biol. 114, 219-229 [Abstract]
  46. Lew, D. J., and Simon, S. M. (1991) J. Membr. Biol. 123, 261-268 [Medline] [Order article via Infotrieve]
  47. Sullivan, K. M., Buss, W. B., and Wilson, K. L. (1993) Cell 73, 1411-1422 [Medline] [Order article via Infotrieve]
  48. Pongs, O., Lindemeier, J., Zhu, X. R., Theil, T., Engelkamp, D., Krah-Jentgens, I., Lambrecht, H. G., Koch, K. W., Schwemer, J., Rivosecchi, R., Mallart, A., Galceran, J., Canal, I., Barbas, J. A., and Ferrus, A. (1993) Neuron 11, 15-28 [Medline] [Order article via Infotrieve]
  49. Tsien, R., and Pozzan, T. (1989) Methods Enzymol. 172, 230 [Medline] [Order article via Infotrieve]

©1996 by The American Society for Biochemistry and Molecular Biology, Inc.