©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Molecular Cloning and Expression of Two Types of Rabbit -Galactoside 1,2-Fucosyltransferase (*)

Seiji Hitoshi (1) (2), Susumu Kusunoki (2), Ichiro Kanazawa (2), Shuichi Tsuji (1)(§)

From the (1) Molecular Glycobiology, Frontier Research Program, The Institute of Physical and Chemical Research (RIKEN), Wako-shi, Saitama 351-01, Japan and the (2) Department of Neurology, Institute for Brain Research, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Two DNA clones encoding rabbit -galactoside 1,2-fucosyltransferase (RFT-I and RFT-II) have been isolated from a rabbit genomic DNA library. The DNA sequences revealed open reading frames coding for 373 (RFT-I) and 354 (RFT-II) amino acids, respectively. The deduced amino acid sequences of RFT-I and RFT-II showed 56% identity with each other, and that of RFT-I showed 80% identity with that of human H blood type 1,2-fucosyltransferase. Northern blot analysis of embryo and adult rabbit tissues revealed that the RFT-I gene was expressed in adult brain, and that the RFT-II gene was expressed in salivary and lactating mammary glands. The identities of these enzymes were confirmed by constructing recombinant fucosyltransferases in which the N-terminal part including the cytoplasmic tail and signal anchor domain was replaced with the immunoglobulin signal peptide sequence. RFT-I expressed in COS-7 cells exhibited similar transferase activity to that of human H blood type 1,2-fucosyltransferase. RFT-II expressed in COS-7 cells showed higher affinity for type 1 (Gal1,3GlcNAc) and type 3 (Gal1,3GalNAc) acceptors than type 2 (Gal1,4GlcNAc) ones, which suggested that RFT-II was a putative secretor-type 1,2-fucosyltransferase.


INTRODUCTION

The H antigen, the fucosylated structure of the terminal - D-Gal residue, is synthesized by GDP- L-fucose:- D-galactoside 2-- L-fucosyltransferase (1,2-FT)()(reviewed in Ref. 1). The expression of H determinants is strictly regulated temporally and spatially during vertebrate development (2, 3, 4) . We previously reported histochemical investigation of glycoconjugates containing a terminal Fuc1,2Gal residue in the human and rabbit nervous systems, using polyclonal and monoclonal anti-fucosyl Gantibodies, and UEA-1 lectin (5, 6, 7, 8) . The anti-fucosyl Gantibodies and UEA-1 lectin recognized a subpopulation of neurons in the dorsal root ganglia (DRG) and dorsal horn of the spinal cord. The anti-fucosyl Gantibodies also bound to the satellite cells surrounding the fucosyl G-positive neurons (5, 7) . In addition, in rabbits, the anti-fucosyl Gantibodies bound to the axons and the myelin of the small myelinated fibers in the dorsal root, and the large neurons in the ventral horn (8) .

Since these fucosylated glycoconjugates showed developmental changes, especially during the perinatal period (7) , they may function as important molecules in the development of the nervous system, such as axon elongation or myelination. Some fucosylated glycoconjugates are known to play an important role in cell adhesion (9, 10, 11) . However, the significance of glycoconjugates bearing a Fuc1,2Gal residue remains to be clarified. To elucidate the mechanisms underlying the regulation of fucosylation and the possible functional roles of the glycoconjugates with a Fuc1,2Gal residue, molecular analysis of the 1,2-FT gene is indispensable.

Recent genetic and biochemical studies indicated that human H blood-type 1,2-FT and Se-type 1,2-FT are encoded by distinct but closely linked structural genes, the H and Se genes (12, 13) . Enzymatic characterization of the two 1,2-FTs revealed differences in the Kvalues for various oligosaccharide acceptors (14, 15) . Further analysis of the structures and in their regulation of the 1,2-FT genes requires molecular cloning, and one 1,2-FT gene for an H blood-type determinant has been cloned so far (16) . We have tried to clone rabbit 1,2-FTs in order to reveal the role of the Fuc1,2Gal epitope in the development of the nervous system. A rabbit genomic DNA library was screened, because the entire open reading frame of human H blood-type 1,2-FT is encoded by one exon (17) . Here we report the molecular cloning of two types of rabbit 1,2-FTs, one of which is a counterpart of human H blood-type 1,2-FT and the other a putative Se-type 1,2-FT as judged on kinetic analysis.


EXPERIMENTAL PROCEDURES

Materials

GDP-Fuc, phenyl-- D-Gal, p-nitrophenyl-- D-Gal, p-nitrophenyl-- D-Gal, p-nitrophenyl-- D-GalNAc, galactose 1,3- N-acetyl-glucosaminide (Gal1,3GlcNAc), Gal1,4GlcNAc, Gal1,3GalNAc, lactose, Fuc1,2lactose, lacto- N-tetraose, lacto- N-neotetraose, asialofetuin, 1-acid glycoprotein, bovine submaxillary mucin, and FITC-labeled UEA-1 lectin were from Sigma. Asialo-1-acid glycoprotein and bovine submaxillary asialomucin were obtained by mild acid treatment of the respective glycoproteins. GDP-[C]Fuc (10.5 GBq/mmol) was from DuPont Corp. (France). Gwas from Biosynth AG (Switzerland). Paragloboside was from Dia-Iatron (Tokyo, Japan). Monoclonal antibodies to blood groups A and B were from Biomeda (Foster City, CA). FITC-labeled anti-mouse Ig(G and M) was from Tago (Burlingame, CA). Restriction endonucleases were from Takara (Kyoto, Japan).

Construction of a Genomic DNA Library

The standard molecular cloning techniques described by Maniatis and co-workers were used (18) . DNA was prepared from rabbit brain and then partially digested with Sau3AI. Size-fractionated DNA (10-15 kb) was ligated to -EMBL3 (Stratagene) and then packaged in vitro with the Gigapack II Gold packaging extract (Stratagene). The resulting genomic DNA library was plated using Escherichia coli strain MRA as a host for screening.

Polymerase Chain Reaction (PCR)

The PCR fragments used as probes for screening of the rabbit genomic DNA library were amplified using primers as to the deduced catalytic region of human H blood-type 1,2-FT. Sense primer FT12, TCGTGGTCACCAGCAACGGCATG, and antisense primer FT14, TCAGAGTCTGGCAGGGTGAAGTT, were synthesized with an Applied Biosystem 394 DNA Synthesizer, and rabbit genomic DNA was used as a template for PCR. PCR amplification was carried out using a DNA thermal cycler (Perkin-Elmer), with 40 cycles consisting of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. The PCR products (229 bp) were blunt-ended, phosphorylated, and then subcloned into the EcoRV site of plasmid pBluescript SK(+).

Screening of the Rabbit Genomic DNA Library

About 2 10plaques of the rabbit genomic DNA library were screened by the standard hybridization method with the P-labeled random-primed (Amersham Corp.) PCR product (229 bp) as a probe. Two independent positive plaques containing 12.6-kb (RG11) and 14.9-kb (RG101) inserts were isolated to homogeneity.

DNA Sequence Analysis

The RG11 and RG101 DNA fragments were digested with appropriate restriction enzymes and then subcloned into vector plasmid pUC 119. The DNA sequences were determined by the dideoxynucleotide chain-termination method using an Autocycle DNA sequencing kit and an ALF DNA sequencer (Pharmacia Biotech Inc.). The sequences were analyzed using a PC/Gene (Teijin System Technology, Japan).

Northern and Southern Hybridization

Total RNA was prepared by the guanidium thiocyanate method and purified by ultracentrifugation through 5.7 M CsCl. Poly(A)-rich RNA was purified with Oligotex-dT30 (Takara). The poly(A)-rich RNA (5 µg) was fractionated on a denaturing formaldehyde-agarose gel (1.2%), and then transferred onto a nylon membrane (Nytran; Schleicher & Schell). Genomic DNA (10 µg) was digested for 2 h with several restriction enzymes and then loaded onto a 0.6% agarose gel. After electrophoresis, the gel was denatured (1 h) with 0.5 N NaOH and 1.5 M NaCl, and then the DNA was transferred to a nylon membrane. Both Northern and Southern filters were prehybridized in 50% formamide, 5 SSPE, 5 Denhardt's, 0.5% SDS, 0.25% sodium lauryl sarcosine, and 100 µg/ml denatured salmon sperm DNA at 37 °C for 2 h. Hybridization was then performed overnight at 37 °C with the PstI fragment (680 bp) for RFT-I and with the NaeI fragment (446 bp) for RFT-II labeled with P, using the random priming method. The filters were washed twice in 2 SSC, 0.1% SDS at 65 °C, and finally in 0.5 SSC, 0.1% SDS at 65 °C for 30 min.

Mammalian Vector Plasmid Construction

A SmaI fragment (1.5 kb) of RG11 DNA containing the full open reading frame of RFT-I was ligated into mammalian expression vector pcD-SR (19) , which had previously been digested with EcoRI, blunt-ended with T4 DNA polymerase, and dephosphorylated with bacterial alkaline phosphatase. RG101 DNA was digested with SalI and partially digested with XhoI, and a XhoI- SalI fragment (2.3 kb) containing the full open reading frame of RFT-II was ligated into pcD-SR, which had previously been digested with XhoI and then dephosphorylated. The single insertion in the correct orientation was finally analyzed with restriction enzymes.

To express the soluble forms of RFT-I and RFT-II, comprising recombinant fucosyltransferases in which the N-terminal part was replaced with the immunoglobulin signal peptide sequence, expression plasmids pUGS-RFT-I and pUGS-RFT-II were constructed. The genes encoding the putative catalytic domain and 3`-untranslated region were specifically amplified by PCR using a synthetic sense primer, 5`-TGTCTGGAATTCCAGCCGGTGCCAGCCCC-3`, and an antisense primer, 5`-TCTCCCGAATTCTGCCCAGGTAGAATCACT-3`, for RFT-I, and another sense primer, 5`-GTGGTCGAATTCCCCGGACACCTACCCC-3`, and another antisense primer, 5`-AAGTCTGAATTCAGACTCCGTGTGGGATCC-3`, for RFT-II (synthetic EcoRI site underlined). The amplified DNA fragments were digested with EcoRI and then ligated into the EcoRI site of pUGS (20) to generate pUGS-RFT-I and pUGS-RFT-II. The fusion constructs were verified by DNA sequencing to confirm fusion junction sequences.

Expression of Fucosyltransferase

COS-7 cells (100-mm culture dish) were transiently transfected with 10 µg of pcD-SR-RFT-I or pcD-SR-RFT-II using the DEAE-dextran procedure (21) . The cells were trypsinized and divided into several smaller dishes 24 h post-transfection. The cells were stained with FITC-labeled UEA-1 lectin or with monoclonal antibodies to blood group A or B at 72 h post-transfection. After washing with PBS, the cells were fixed with formaldehyde for 3 min, washed, and then incubated in 3% bovine serum albumin/PBS. After washing briefly with PBS, the cells were incubated in 2 ng/ml FITC-labeled UEA-1 lectin in 3% bovine serum albumin/PBS for 1.5 h, or in monoclonal antibodies to blood group A or B for 1.5 h, and then washed with PBS, followed by incubation with FITC-labeled anti-mouse Ig(G and M) for 1 h. After washing three times with PBS, the cells were observed under a fluorescence microscope. The cells from another dish were washed with PBS and then with 25 m M MES for 10 min, and then collected with a rubber policemen and pelleted by centrifugation. The pellets were resuspended in cold 1% Triton X-100 and then sonicated briefly (22) .

To obtain the soluble forms, COS-7 cells (100-mm culture dish) were transiently transfected with 10 µg of pUGS-RFT-I or pUGS-RFT-II by the DEAE-dextran method. The culture medium was concentrated 10-fold on Centricon 30 filters (Amicon) and then subjected to the fucosyltransferase assay.

Fucosyltransferase Assay

The fucosyltransferase assays were performed according to the previous report (22) , in a mixture of 25 m M sodium phosphate (pH 6.1), 5 m M ATP, 30 µ M GDP-fucose, 3 µ M GDP-[C]fucose (10.5 Bq/pmol), the enzyme solution and substrates in a final volume of 10 µl. Each reaction mixture was incubated at 37 °C for 2 h, and then applied to a Silica Gel 60 HPTLC plate (Merck, Germany). The plate was developed with ethanol:pyridine:1-butanol:water:acetic acid (100:10:10:30:3) for oligosaccharide acceptors, and with chloroform:methanol:0.5% CaCl(55:45:10) for glycolipid acceptors, respectively. When glycolipids and benzyl-oligosaccharides were used as substrates, the reaction mixture was applied to C-18 Sep-Pak cartridge (Waters-Millipore), washed with 2 ml of water, and then eluted with 1 ml of methanol. The eluate was then applied to a HPTLC plate and developed. The radioactivity on each plate was visualized and determined with a BAS2000 radioimage analyzer (Fuji Film, Japan).


RESULTS

Cloning and Nucleotide Sequence of Rabbit 1,2-FT

A DNA fragment (229 bp; Fig. 2 A, underlined) was obtained by PCR amplification with sense primer FT-12 and antisense primer FT-14 from rabbit genomic DNA. To obtain DNA encoding rabbit 1,2-FT, a rabbit genomic DNA library was screened with the PCR product as a probe. Two positive clones, RG11 (Fig. 1 A) and RG101 (Fig. 1 B), were obtained. Sequence analysis revealed that RG11 contained an entire open reading frame, encoding 373 amino acids with a predicted molecular mass of 42 kDa (RFT-I, Fig. 2 A) and that RG101 contained an entire open reading frame, encoding 354 amino acids with a predicted molecular mass of 40 kDa (RFT-II, Fig. 2 B).


Figure 2: Nucleotide and deduced amino acid sequences of rabbit RFT-I ( A) and RFT-II ( B), and comparison of the deduced amino acid sequences of human H blood-type 1,2-FT, RFT-I, and RFT-II ( C). A and B, the nucleotide and amino acid sequences are numbered from the presumed start codon and initiation methionine, respectively. The boxed amino acids correspond to a putative signal-anchor domain. The asterisks indicate potential N-glycosylation sites (Asn- X-Ser/Thr). The PCR product used as a probe for screening of the genomic DNA library is underlined. C, a putative signal-anchor domains is boxed. The asterisks indicate that the three aligned residues are identical.




Figure 1: Restriction maps for RG11 ( A) and RG101 ( B), and the sequence-analysis strategy. The coding region is depicted as a shaded box and the non-coding region as a solid line. The arrows indicate the direction and extent of sequencing.



Comparison of the primary structure of RFT-I and RFT-II revealed 56% of significant amino acid identity (Fig. 2 C). Deduced amino acid sequences of RFT-I and RFT-II showed 80% and 55% identity with that of human 1,2-FT, respectively.

Southern and Northern Blot Analysis

When the entire coding region was used as a probe, more than one band was detected on genomic Southern blot analysis. We then used the PstI fragment (680 bp) of RFT-I and the NaeI fragment (446 bp) of RFT-II as probes that hybridized to one band on Southern blotting (data not shown). Northern blot analysis revealed that a 3.8-kb mRNA of RFT-I was expressed in adult cerebrum and cerebellum (Fig. 3 A), and that a 1.6-kb mRNA of RFT-II was detected in salivary and lactating mammary glands (Fig. 3 B). The transcription of RFT-I in brain was first detected on embryonic day 28 and increased thereafter. The probe for RFT-II did not hybridize to embryonic tissues.


Figure 3: Northern blot analyses of RFT-I ( A) and RFT-II ( B). Poly(A)-rich rabbit RNAs (5 µg) were electrophoresed and then hybridized with the PstI fragment (680 bp) of RFT-I or with the NaeI fragment (446 bp) of RFT-II labeled with P.



Expression of RFT-I and RFT-II and the Enzyme Assay

Cell extracts from COS-7 cells transfected with pcD-SR-RFT-I or pcD-SR-RFT-II, and concentrated culture medium from COS-7 cells transfected with pUGS-RFT-I or pUGS-RFT-II were subjected to the fucosyltransferase assay. When phenyl-- D-Gal was used as a substrate, radiolabeled fucose was incorporated into the substrate with any of the enzyme preparations (Fig. 4), which meant both RFT-I and RFT-II were fucosyltransferases. FITC-labeled UEA-1 lectin staining, however, showed that pcD-SR-RFT-I transfected COS-7 cells were positive but that pcD-SR-RFT-II transfected COS-7 cells were negative (Fig. 5), which suggested differences in acceptor specificity between RFT-I and RFT-II. COS-7 cells transfected with pcD-SR-RFT-I or pcD-SR-RFT-II were positive for blood group A, but both were negative for blood group B (Fig. 5).


Figure 5: Expression of UEA-1 lectin-reactive glycoconjugates and blood group A antigens on RFT-I and RFT-II transfected COS-7 cells. COS-7 cells were transiently transfected with 10 µg of pcD-SR, pcD-SR-RFT-I, or pcD-SR-RFT-II using the DEAE-dextran procedure. The cells were divided into five dishes by trypsinization 24 h post-transfection, and were stained with UEA-1 lectin, anti-blood group A or B antibodies, or negative control IgG 72 h post-transfection. Transfection of RFT-I or RFT-II was verified by measuring fucosyltransferase activity using cell extract from another dish.



Because the fucosyltransferase activity of the cell extracts was virtually identical with and stronger than that of concentrated culture medium, respectively, the cell extracts were used for further kinetic analysis. Both RFT-I and RFT-II could transfer fucose to pNP--Gal but not to pNP--Gal or pNP--GalNAc. Both enzymes could also fucosylate lactose to form fucosyl lactose, which comigrated with Fuc1,2lactose on HPTLC with several solvent systems. As shown in Table I, RFT-I exhibited almost the same reactivity with type 1 (Gal1,3GlcNAc), type 2 (Gal1,4GlcNAc), and type 3 (Gal1,3GalNAc) acceptors, but RFT-II showed higher reactivity with type 1 or type 3 than type 2 acceptors. Lineweaver-Burk plots for LNT, LNnT, phenyl-- D-Gal, and types 1, 2, and 3 oligosaccharides are shown in Fig. 6. RFT-I and RFT-II could transfer fucose not only to asialoglycoproteins but also to glycolipids. Experiments were performed in triplicate, and typical plots and values of Kand V/ Kwere shown in Fig. 6 and , respectively.


Figure 6: Lineweaver-Burk plots. Lineweaver-Burk plots for RFT-I ( closed circles) and RFT-II ( closed squares) used to calculate the K and V/ K values are shown. Experiments were performed in triplicate, and typical plots are shown.




DISCUSSION

RFT-I and RFT-II catalyze the transfer of GDP-fucose to a -Gal residue but not to -Gal or -GalNAc. Fucosyl lactose formed from fucose and lactose by both enzymes comigrated with standard Fuc1,2lactose on HPTLC with several solvent systems. COS-7 cells transfected with RFT-I were stained with UEA-1 lectin, which is thought to recognize the fucosylated type 2 chain of glycoproteins with an 1,2 linkage (23) . Whereas COS-7 cells maintain N-acetylgalactosaminyltransferase activity, both RFT-I and RFT-II transfected COS-7 cells were positive for monoclonal antibodies to blood group A, which is specific to GalNAc1,4-(Fuc1,2)--galactoside. These observations support the notion that RFT-I and RFT-II could be 1,2-FTs.

The deduced amino acid sequence of RFT-I showed 80% identity with that of human H blood-type 1,2-FT (16) , whereas the deduced amino acid sequence of RFT-II showed 55% and 56% identity with those of RFT-I and human H blood-type 1,2-FT, respectively. The Kvalues of RFT-I are comparable for phenyl-- D-Gal, and types 1, 2, and 3 acceptors, which suggests that the binding specificity of RFT-I is primarily restricted to terminal - D-Gal residues of acceptors. This observation is consistent with the kinetic properties of human H blood-type 1,2-FT (14) . RFT-I exhibited reactivity with glycolipids that share the same terminal determinant with a free oligosaccharide, but there were some discrepancies regarding the reactivity of H blood-type 1,2-FT with glycolipids among previous reports (14, 24, 25) . The structural and kinetic characteristics support that RFT-I is a rabbit counterpart of human H blood-type 1,2-FT. Human H blood-type 1,2-FT is expressed in tissues of mesodermal origin (1, 12) , whereas the expression of RFT-I is limited in the brain. It is not uncommon that an expression pattern differs from species to species.

RFT-II has higher affinity to types 1 and 3 acceptors than type 2 ones. It exhibits significantly lower affinity for phenyl-- D-Gal and type 2 acceptors, compared with RFT-I. The kinetic parameters of RFT-II are comparable with those of human Se-type 1,2-FT, which has higher affinity for types 1 and 3 acceptors than type 2 ones and phenyl-- D-Gal (15) . The transcription distribution of RFT-II in secretory glands is similar to that of human Se-type 1,2-FT (13) . We conclude that RFT-II is a rabbit counterpart of putative human Se-type 1,2-FT. RFT-II transfected COS-7 cells were negative for UEA-1 lectin staining but were positive for blood group A. RFT-II is possibly unable to accept type 2 glycochains as acceptors, and, in this case, the blood group A antigens of RFT-II transfected COS-7 cells comprise type 1 glycochains. Another possible explanation is that RFT-II transfers fucose in a lower amount to type 2 glycochains, which are then completely converted to blood group A active molecules.

Comparison of the rabbit 1,2-FTs and recently cloned rat DNA fragments of the putative 1,2-FTs (26) revealed that the deduced amino acid sequence of RFT-I showed more homology with that of rat FTA (84% identity) than with that of rat FTB (72% identity). The deduced amino acid sequence of RFT-II showed 74% and 80% identity with those of rat FTA and rat FTB, respectively. However, this does not necessarily mean that rat FTA and FTB are genes corresponding to RFT-I and RFT-II, respectively, because there might be additional and closely related 1,2-FTs other than RFT-I and RFT-II. Molecular cloning of the entire genes and kinetic analysis of putative rat 1,2-FTs are necessary before coming to a conclusion regarding the relationship between RFT-I, RFT-II, and rat FTA and FTB.

Our previous histochemical study revealed that the expression of fucosyl Gand UEA-1 lectin reactive antigens was strictly regulated during development, especially during the perinatal period (7, 8) . In rabbit DRG neurons, fucosyl Gis readily detected immunohistochemically on embryonic day 25, followed by the appearance of UEA-1 lectin-reactive antigens postnatally (7) . UEA-1 lectin-reactive antigens of DRG neurons in postnatal rabbits could be formed through fucosylation catalyzed by RFT-I, although we could not analyze the developmental expression pattern of RFT-I in DRG because of the scarcity of the tissue and the relative non-abundance of RFT-I expression. On the contrary, fucosyl Gobserved in DRG neurons of embryonic day 25 rabbits might not be the product of RFT-I because UEA-1 lectin-reactive antigens are not detected at that stage. This observation suggests the existence of another type of 1,2-FT that catalyzes preferential fucosylation of glycolipids.

  
Table: Acceptor specificities of RFT-I and RFT-II

The table shows the apparent Kand V/ Kvalues and relative activities as to the incorporation of fucose into phenyl-- D-Gal as a substrate.



FOOTNOTES

*
This work was supported by Grants-in-aid 05274103 and 06254213 for Scientific Research on Priority Areas from the Ministry of Health and Welfare, Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked `` advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank/EMBL Data Bank with accession number(s) X80225 and X80226.

§
To whom correspondence should be addressed: Shuichi Tsuji, Molecular Glycobiology, Frontier Research Program, The Institute of Physical and Chemical Research (RIKEN), Wako, Saitama 351-01, Japan. Tel.: 81-48-462-1111 (ext. 6521); Fax: 81-48-462-4692.

The abbreviations used are: 1,2-FT, GDP- L-fucose:- D-galactoside 2-- L-fucosyltransferase; kb, kilobase(s); bp, base pair(s); PCR, polymerase chain reaction; PBS, phosphate-buffered saline; MES, 2-( N-morpholino)ethanesulfonic acid; FITC, fluorescein isothiocyanate; HPTLC, high performance thin layer chromatography; DRG, dorsal root ganglia; UEA-1, Ulex europaeus agglutinin 1; Se-type, secretor-type; nomenclature for gangliosides and glycolipids follows the system of Svennerholm (27).


ACKNOWLEDGEMENTS

We thank Drs. Nobuyuki Kurosawa, Takashi Nakaoka, Naoya Kojima, and Toshiro Hamamoto for helpful discussions.


REFERENCES
  1. Watkins, W. M. (1980) Adv. Hum. Genet. 10, 1-136 [Medline] [Order article via Infotrieve]
  2. Szulman, A. E. (1962) J. Exp. Med. 115, 977-996
  3. Szulman, A. E. (1964) J. Exp. Med. 119, 503-516
  4. Fenderson, B. A., Holmes, E. H., Fukushi, Y., and Hakomori, S. (1986) Dev. Biol. 114, 12-21 [Medline] [Order article via Infotrieve]
  5. Kusunoki, S., Inoue, K., Iwamori, M., Nagai, Y., and Mannen, T. (1989) Brain Res. 494, 391-395 [Medline] [Order article via Infotrieve]
  6. Kusunoki, S., Inoue, K., Iwamori, M., Nagai, Y., and Mannen, T. (1991) Neurosci. Lett. 126, 159-162 [Medline] [Order article via Infotrieve]
  7. Kusunoki, S., Inoue, K., Iwamori, M., Nagai, Y., Mannen, T., and Kanazawa, I. (1992) Neurosci. Res. 15, 74-80 [Medline] [Order article via Infotrieve]
  8. Kusunoki, S., Chiba, A., Shimizu, T., and Kanazawa, I. (1994) Biochim. Biophys. Acta 1214, 27-31 [Medline] [Order article via Infotrieve]
  9. Bird, J. M., and Kimber, S. J. (1984) Dev. Biol. 104, 449-460 [Medline] [Order article via Infotrieve]
  10. Fenderson, B. A., Zehavi, U., and Hakomori, S. (1984) J. Exp. Med. 160, 1591-1596 [Abstract]
  11. Eggens, I., Fenderson, B., Toyokuni, T., Dean, B., Stroud, M., and Hakomori, S. (1989) J. Biol. Chem. 264, 9476-9484 [Abstract/Free Full Text]
  12. Le Pendu, J., Lemieux, R. U., Lambert, F., Dalix, A.-M., and Oriol, R. (1982) Am. J. Hum. Genet. 34, 402-415 [Medline] [Order article via Infotrieve]
  13. Le Pendu, J., Cartron, J. P., Lemieux, R. U., and Oriol, R. (1985) Am. J. Hum. Genet. 37, 749-760 [Medline] [Order article via Infotrieve]
  14. Sarnesto, A., Köhlin, T., Thurin, J., and Blaszczyk-Thurin, M. (1990) J. Biol. Chem. 265, 15067-15075 [Abstract/Free Full Text]
  15. Sarnesto, A., Köhlin, T., Hindsgaul, O., Thurin, J., and Blaszczyk-Thurin, M. (1992) J. Biol. Chem. 267, 2737-2744 [Abstract/Free Full Text]
  16. Larsen, R. D., Ernst, L. K., Nair, R. P., and Lowe, J. B. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 6674-6678 [Abstract]
  17. Kelly, R. J., Ernst, L. K., Larsen, R. D., Bryant, J. G., Robinson, J. S., and Lowe, J. B. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5843-5847 [Abstract]
  18. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  19. Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M., and Arai, N. (1988) Mol. Cell. Biol. 8, 466-472 [Medline] [Order article via Infotrieve]
  20. Kurosawa, N., Hamamoto, T., Lee, Y.-C., Nakaoka, T., Kojima, N., and Tsuji, S. (1994) J. Biol. Chem. 269, 1402-1409 [Abstract/Free Full Text]
  21. McCutchan, J. H., and Pagano, J. S. (1968) J. Natl. Cancer Inst. 41, 351-357 [Medline] [Order article via Infotrieve]
  22. Rajan, V. P., Larsen, R. D., Ajmera, S., Ernst, L. K., Lowe, J. B. (1989) J. Biol. Chem. 264, 11158-11167 [Abstract/Free Full Text]
  23. Pereira, M. E. A., Kisailus, E. C., Gruezo, F., and Kabat, E. A. (1978) Arch. Biochem. Biophys. 185, 108-115 [Medline] [Order article via Infotrieve]
  24. Pacuszka, T., and Koscielak, J. (1976) Eur. J. Biochem. 64, 499-506 [Abstract]
  25. Beyer, T. A., and Hill, R. L. (1980) J. Biol. Chem. 255, 5373-5379 [Abstract/Free Full Text]
  26. Piau, J.-P., Labarriere, N., Dabouis, G., and Denis, M. G. (1994) Biochem. J. 300, 623-626 [Medline] [Order article via Infotrieve]
  27. Svennerholm, L. (1980) Adv. Exp. Biol. Med. 125, 533-544

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.