(Received for publication, May 8, 1995; and in revised form, August 22, 1995)
From the
OmpR is a transcription factor in Escherichia coli whose function is modulated by phosphorylation in the presence of phosphorylated EnvZ, a transmembrane protein histidine kinase involved in osmosensing. Using a protein S-OmpR hybrid protein, we demonstrated that six OmpR molecules bind tandemly to the -100 to -39 sequence of ompF. This sequence consists of three 20-base pair units: F1, F2, and F3, each of which is bound by two OmpR proteins. Polymerase chain reaction selection of nine randomized base pairs within the F1 sequence revealed highly conserved C residues spaced 10 base pairs apart. Further mutational analysis of conserved bases indicated that two OmpR molecules bind tandemly to two direct repeats. Mobility shift assays showed that cooperative interactions play a role in enhancing binding of OmpR to lower affinity F2 and F3 sites. Activation and repression of ompF expression are thus regulated by a total of eight OmpR molecules, including two molecules that bind to a distal site (-380 to -361).
When exposed to changes in environmental osmolarity, Escherichia coli responds by altering the expression of OmpF and OmpC, two porin proteins present in the outer membrane (for review, see Csonka and Hanson(1991)). OmpF and OmpC each exist as homotrimeric proteins that span the outer membrane and serve as channels for the passive diffusion of small molecules between the external media and the periplasmic space (Nikaido and Vaara, 1987). Under low osmolarity conditions, OmpF is present in the outer membrane at significantly higher levels than OmpC. Upon a shift to high osmolarity, OmpF is no longer expressed, while the level of OmpC is increased (Kawaji et al., 1979).
Expression of the ompF and ompC genes is dependent upon two proteins, EnvZ and OmpR (Sarma and Reeves, 1977; Hall and Silhavy, 1981a, 1981b; Mizuno and Mizushima, 1987; Slauch et al., 1988; Slauch and Silhavy, 1989). These proteins belong to the family of highly conserved histidine kinase/response-regulator proteins that make up the two-component systems prevalent in prokaryotes (Nixon et al.(1986), Parkinson and Kofoid(1992), and for review, see Stock et al.(1989)). Such two-component systems have recently been identified in eukaryotes as well (Ota and Varshavsky, 1993; Chang et al., 1993). In each case, the histidine kinase is phosphorylated on a conserved histidine residue, using free ATP as the substrate. The response regulator then catalyzes the transfer of the phosphoryl group to a completely conserved aspartic acid residue, which accepts the phosphate from the histidine kinase. In many cases, the response regulator is a transcription factor with a DNA-binding domain.
EnvZ is phosphorylated at the histidine 243 residue to function as
the substrate for OmpR phosphorylation (Kanamaru et al., 1990;
Aiba et al., 1989a; Forst et al., 1989a; Igo and
Silhavy, 1988). OmpR is phosphorylated at Asp (Delgado et al., 1993; Kanamaru et al., 1990). EnvZ also acts
as an OmpR-phosphate phosphatase (Igo et al., 1989; Aiba et al., 1989a). The level of phosphorylated OmpR present in
the cell appears to be controlled through the regulation of EnvZ
phosphatase activity (Yang and Inouye, 1991; Russo and Silhavy, 1991;
Yang and Inouye, 1993; Jin and Inouye, 1993). At low osmolarity, EnvZ
phosphatase activity maintains a low concentration of phosphorylated
OmpR in the cytoplasm. Upon a shift to high osmolarity, the phosphatase
activity of EnvZ is decreased, allowing an increase in the level of
phosphorylated OmpR. Phosphorylation of OmpR enhances DNA-binding
activity (Aiba et al., 1989b; Aiba and Mizuno, 1990).
OmpR binds to sequences upstream of the ompF and ompC promoters to regulate the transcription of these genes. In vivo and in vitro footprinting has demonstrated that OmpR binds to the -100 to -80 and -74 to -40 sequences of ompC (Maeda and Mizuno, 1990), and to the -100 to -40 (Maeda and Mizuno, 1988; Maeda et al., 1988; Mizuno and Mizushima, 1986; Mizuno et al., 1988; Tsung et al., 1989) and -380 to -360 sequences of ompF (Rampersaud et al., 1994; Huang et al., 1994). Phosphorylated OmpR binds to the upstream regulatory region of ompC to activate ompC expression. However, in the case of ompF, OmpR acts as both an activator (during low osmolarity conditions) and repressor (during high osmolarity conditions) of transcription (Slauch and Silhavy, 1989; Forst et al., 1989b). Since low osmolarity conditions are correlated with low levels of phosphorylated OmpR, it would be expected that under these conditions, only high affinity sites are bound by OmpR. In contrast, under high osmolarity conditions when there is a higher level of phosphorylated OmpR in the cell, OmpR will bind to both high and low affinity sites. It is of interest to understand how OmpR carries out this dual function. Identifying high and low affinity sites will aid in identification of activator and repressor sites.
In the studies
presented here, an OmpR fusion protein was designed and used for
mobility shift assays to determine the exact number of OmpR molecules
that bind to sequences upstream of the ompF promoter.
Subsequently we were able to identify individual OmpR binding sites and
use a random sequence selection/PCR ()amplification method
to identify critical base pairs within the OmpR binding site. Finally,
mobility shift assays were used to demonstrate that cooperative
interactions between OmpR proteins bound to the DNA increase the
ability of OmpR to bind to low affinity sites. In this paper, we
demonstrate that six OmpR molecules cooperatively bind to the
-100 to -39 sequence of ompF. Taken with
previously published data regarding the distal -380 to -361
binding site, a total of eight OmpR molecules are involved in the
positive and negative regulation of ompF expression.
The construct pCF001 contains the upstream regulatory regions of both the ompC and ompF genes, cloned into pGEM3Zf(+) (Promega). The ompF upstream regulatory sequence was obtained from the plasmid pAR094 (Rampersaud et al., 1994). The ompC regulatory sequence was obtained from the plasmid pGR241 (Norioka et al., 1986). The fused sequence was created by a two-step PCR reaction. To amplify the ompC sequence, a 5`-PCR primer (AGGAATTCATTTCGCCATTCC) was annealed to the -199 to -187 sequence of ompC and also created an EcoRI site. The 3`-PCR primer (AACTGGATCCAATCCAACACGAATATGA) was annealed to the -44 to -27 sequence of the ompC gene and created a BamHI site. To amplify the ompF sequence, a 5`-PCR primer (GATTGGATCCAGTTCCTTAAATTTTACT) was annealed to the -112 to -95 sequence of ompF and created a BamHI site. The corresponding 3`-PCR primer (TCAAGCTTGCATGC) was annealed to the -2 to +12 sequence of ompF in pAR094, where a HindIII site is present. The two PCR products that encoded the ompF and ompC upstream regulatory sequences were then used in a second PCR reaction such that the sequences at the 3`-end of ompC sequence annealed to the 5`-end of the ompF sequence during the PCR reaction to fuse the two sequences. Thus, the final product contained the ompC -199 to -27 sequence upstream of the -112 to +1 sequence of ompF. A BamHI site is present between the two sequences, an EcoRI site is at the 5`-end, and a HindIII site is at the 3`-end. The correct sequence was confirmed by DNA sequencing.
The 20-base pair OmpR binding sites were synthesized on an Applied Biosystems DNA synthesizer. Complimentary strands were annealed to create double-stranded DNA sequences for mobility shift assays.
Binding reactions were carried
out in 50 mM Tris-HCl, pH 7.5, 50 mM KCl, 5 mM CaCl, 5% glycerol, 0.0025% Nonidet P-40, and 200 ng of
poly(dI-dC). First, OmpR was phosphorylated in vitro using ATP
and the purified catalytic cytoplasmic domain of EnvZ (amino acids
Arg
-Gly
), referred to as EnvZ(C)
(Delgado et al., 1993). OmpR was incubated with 7 nM EnvZ(C) in the binding buffer with 60 mM ATP at 25 °C
for 10 min. Appropriate amounts of purified OmpR or
PrS
-OmpR were then added and allowed to incubate for
another 15 min at 25 °C. Labeled DNA was added to each reaction,
and the final reaction volume was 15 µl. Binding reactions were
incubated at 4 °C for 30 min and then loaded onto a 5%
acrylamide/bisacrylamide (40:1.2) gel. The gel was run at 4 °C in 1
TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA)
and run at 120 V. The dried gel was exposed to autoradiography film
overnight at -80 °C.
OmpR was fused to protein S, a protein present on the
spore coat of a Gram-negative soil bacterium, Myxococcus xanthus (Inouye et al., 1979, 1981). Protein S has a high
-sheet content (90%) and is known to be very stable in solution
(Bagby et al., 1994). Two tandem copies of a DNA fragment
encoding the amino-terminal 92 amino acid residues of protein S were
fused to the 5`-end of the ompR gene to encode a hybrid
protein with a molecular mass of 47 kDa, which is 20 kDa larger than
OmpR. The purpose of fusing protein S to OmpR was to increase the size
of OmpR without affecting OmpR DNA-binding activity. Thus, in a
mobility shift assay, the addition of PrS
-OmpR to
DNA-binding reactions should simply result in the production of slower
mobility bands relative to the mobility of the DNA fragment bound by
the intact OmpR molecule. The T7 expression system was used to express
this hybrid protein, referred to as PrS
-OmpR (Fig. 1A).
Figure 1:
OmpR and PrS-OmpR bind to
the ompF upstream regulatory sequences to form a total of
three complexes. A, schematic of the PrS
-OmpR
fusion protein in which two N-terminal domains of protein S were fused
to the wild-type OmpR to create a protein with a molecular mass of 42
kDa. B, increasing concentrations of OmpR, as indicated above
the gel, were phosphorylated in vitro with EnvZ(C) and ATP.
Labeled DNA containing the ompF -100 to -40
sequence was added to the phosphorylation reactions, and the reactions
were incubated on ice for 30 min. Binding reactions were then loaded on
a 5% polyacrylamide gel and run at 4 °C in 1
TE buffer. a, b, and c indicate the three OmpR-DNA
complexes formed. C, increasing concentrations of PrS2-OmpR
were phosphorylated in vitro and incubated with the ompF -100 to -40 DNA as described for OmpR in A. A
control reaction using wild-type OmpR is shown in the far right lane as
a comparison of the mobilities of the three complexes a, b, and c.
Previous studies have shown that OmpR binds to
the -100 to -40 region of ompF. The BamHI-HindIII fragment of pCF001, containing the
-100 to -40 region of ompF and referred to as
100/1, was used for mobility shift assays. The gel retardation analysis
of this fragment with increasing amounts of phosphorylated OmpR is
shown in Fig. 1B. A total of 3 bands, labeled a, b, and c, represent binding by different
numbers of OmpR molecules. Band a represents the DNA fragment
bound by the minimum number of OmpR molecules under the binding
conditions used in the present study. Higher concentrations of OmpR
resulted in the binding of all of the DNA with exclusive formation of band c, suggesting that this band represents the DNA fragment
bound by the maximum number of OmpR molecules. The existence of three
bands indicates that there are three distinct OmpR-binding units in the
100/1 fragment. A similar gel shift pattern consisting of three bands a, b, and c, is observed when this DNA
fragment is incubated with increasing concentrations of
PrS-OmpR (Fig. 1C). These three bound
complexes correspond to the three complexes formed when using intact
OmpR (Fig. 1C, far right lane), but the
mobility of the DNA bound by PrS
-OmpR is slower due to its
higher molecular weight. Formation of the complexes required
PrS
-OmpR concentrations similar to those of intact OmpR,
indicating that fusion of protein S to OmpR did not affect OmpR
DNA-binding activity. The PrS
-OmpR-DNA complexes appear as
doublets, possibly due to conformational effects imparted by the
protein S domain. In vitro copper phenanthroline footprinting
in the presence of PrS
-OmpR resulted in a protection
pattern identical to that observed in the presence of the intact OmpR
(data not shown). This provides further evidence that both OmpR and
PrS
-OmpR bind to the 100/1 fragment in an identical manner.
Figure 2:
Six OmpR proteins bind to the -100
to -40 sequence of ompF. Varying concentrations of OmpR
and PrS-OmpR were mixed, phosphorylated in vitro with EnvZ(C) and ATP, and incubated with the 100/1 fragment,
containing the -100 to -40 sequence of ompF (A); the 100/64 fragment, containing the -100 to
-64 sequence of ompF (B); and the 100/81
fragment, containing the -100 to -81 sequence of ompF (C). The concentrations of OmpR and PrS
-OmpR
are indicated for each lane. The binding reactions were incubated on
ice for 30 min and loaded onto a 5% acrylamide gel and run at 4 °C
in 1
TE buffer. To the right of each gel is a
diagrammatic representation of the number of OmpR and
PrS
-OmpR proteins present in each bound complex.
symbolizes PrS
-OmpR and
symbolizes
OmpR.
Footprinting of the ompF upstream regulatory sequences in the presence of the OmpR2
protein, a DNA-binding mutant, results in protection of the -100
to -60 sequence, but no protection of the -60 to -40
sequence (Mizuno et al., 1988; Tsung et al., 1989).
Also, binding studies previously done in this laboratory using a
synthetic DNA fragment containing the -100 to -64 sequence
of ompF, demonstrated that phosphorylated OmpR can bind this
DNA (Rampersaud et al., 1989). Mobility shift assays of OmpR
and PrS-OmpR with the synthetic DNA fragment containing the
-100 to -64 fragment are shown in Fig. 2B.
A total of five bands are formed, indicating that four OmpR molecules
bind to this fragment. In the presence of increasing concentrations of
intact OmpR only (Fig. 2B), two binding events are
observed as shown by the presence of two complexes.
Finally, a 20-bp
fragment representing the ompF -100 to -81
sequence was used in a mobility shift assay with OmpR and
PrS-OmpR. With increasing concentrations of phosphorylated
OmpR alone, only a single bound complex is formed (Fig. 2C). The addition of increasing concentrations of
PrS
-OmpR to OmpR leads to the formation of three complexes (Fig. 2C), indicating that the 20-mer is bound by two
OmpR molecules.
The results obtained above indicate that two OmpR molecules bind to each of the three 20-bp sequences in the region downstream of -100 and that a total of six OmpR molecules bind to the region from -100 to -40. The binding of the 100/1 fragment using increasing concentrations of OmpR resulted in the step-wise formation of three distinct complexes. These results suggest that OmpR binds to the DNA ``two-at-a-time'' and that bands a, b, and c in Fig. 1B thus correspond to two, four, and six OmpR molecules binding to the 100/1 fragment. There are not sufficient data at present to indicate that OmpR forms dimers prior to binding DNA. Binding by two OmpR molecules may occur in a highly cooperative manner, such that formation of a complex with an OmpR monomer was not detected by the mobility shift assay. It is evident that there are three OmpR binding units in the -100 to -40 sequence of ompF. Each consists of approximately 20 bp, to which two OmpR molecules bind. These units are assigned F1, F2, and F3 and determined to be from -100 to -81, -80 to -61, and -58 to -39, respectively, on the basis of the results above and a consensus sequence as described below (see Fig. 3).
Figure 3: The -100 to -39 sequence of ompF is composed of three OmpR binding sites, each 20 base pairs long, and designated F1, F2, and F3.
Figure 4: Computer alignment of OmpR binding sites. Five OmpR 20 base pair sites, which are each bound by two OmpR proteins, were aligned using the GCG version 7.2 Pileup program. The sites are as follows: F1 (ompF -100 to -81); F2 (ompF -80 to -61), F3, ompF -58 to -39; F4, ompF -380 to -361; and C1, ompC -58 to -89). Boldface letters indicate residues that are fully conserved, upper case letters indicate highly conserved residues, and lower case letters indicate poorly conserved residues. The numbers above the aligned sequence indicate the positions of the residues within the 20-bp motif as discussed in the text.
Random selection and PCR amplification
(Oliphant and Struhl, 1988) was used to determine a consensus sequence
for OmpR binding. Initially, an oligonucleotide was designed for OmpR
binding in which 20 bp were randomized. After repeated attempts failed,
a new PCR template was designed that contained the 5` 11 bp of the F1
sequence. The final PCR template thus used was 46 bp in length, having
the following sequence: GACGGATCCTTTTACTTTTGG(N9)CTGTAGGAATTCTCAC. The ompF -100 to -90 sequence (underlined) is followed
by nine randomized bases(N9) on the 3`-side. After four cycles of
binding and PCR amplification, 5% of the DNA was retarded in the
mobility shift gel electrophoresis. Essentially 100% of the DNA was
retarded after six cycles of binding and PCR amplification. This
shifted DNA was eluted, PCR-amplified in the presence of labeled
fragment, and used in a mobility shift assay in the presence of 200
nM OmpR and increasing concentrations of PrS-OmpR.
As shown in Fig. 5, the results demonstrate that the selected
sequence is bound by two OmpR molecules as judged from the formation of
three bands.
Figure 5:
The sequence obtained through random
selection and PCR amplification is bound by two OmpR molecules. The
selected pool of sequences was PCR-amplified using a PCR primer
end-labeled with [-
P]ATP and incubated with in vitro phosphorylated OmpR and PrS
-OmpR. The
concentrations of each protein are indicated above the
gel.
The PCR products were subcloned and 20 clones were sequenced. The results are shown in Fig. 6. Most striking are the 100% conserved ACA sequence at positions 3, 4, and 5 of the N9 sequence, and the highly conserved TTACA sequence at positions 1-5. It should be noted that the C at position 4 occurs 10 bp downstream of the C in the template, which represents the C at position -96 within the F1 box. Both C residues correspond to the C residues that are fully conserved in all five OmpR binding sequences shown in Fig. 3. Therefore, it is reasonable to assume that the C residue in the N9 sequence was selected by the distance from the C residue in the portion of the sequence held constant. This accurate determination of the distance can be explained by sequential binding of two OmpR molecules to the 20-mer sequence containing N9; an OmpR molecule first recognizes the motif in the 5`-half, TTAC, which governs the position of the second OmpR binding. This results in selection of the TTAC sequence within the N9 region as the most preferred sequence. It should also be noted that the consensus sequence in the N9 region from 20 independent clones was TTACATXTX (Fig. 6), which is identical to the 3`-half of the F1 sequence (TTACATATT; see Fig. 3) except for 2 Xs. Interestingly, the first X in F1 is A, and the PCR reaction selected A or T at this position in 17 out of 20 cases. Similarly, the second X in F1 is T, and the PCR reaction again picked A or T in 15 out of 20 cases. This result indicates that A or T is the highly preferred base at these positions.
Figure 6: A highly conserved TTACATNTN sequence was selected within the random pool of binding templates. The pool of amplified sequences after 6 rounds of selection was subcloned, and 20 clones were sequenced. The residues labeled constant represent the 11 bp in the 5`-half of the F1 site, which were present in the initial template for OmpR binding selection. N9 indicates the randomized portion of the initial binding template. The highly conserved residues that were selected are in boldface, and a consensus sequence is indicated at the bottom.
Figure 7:
Mutating the conserved residues of the
20-base pair OmpR binding motif decreases binding by OmpR. Twenty-base
pair oligonucleotides were synthesized and annealed to form
double-stranded DNA molecules for OmpR binding assays. The sequences
are shown in A. wt is the wild-type F1 sequence. Numbers above this sequence indicate the positions of the
residues within the 20-bp sites as discussed in the text. Boldface residues indicate the point mutations within the mutated 20-bp
sequences. 90/70(T11G) is the ompF -90 to -71
sequence in which the T at position -80 is changed to a G. The
mobility shift assays are shown in B. The 20-mers were labeled
with [-
P]ATP and T4 kinase and incubated
with or without in vitro phosphorylated OmpR (100
nM).
Next we analyzed the role of the two fully conserved C residues by individually substituting them with T. Interestingly, the change of C to T at positions 5 and 15 of the 20-mer caused a decrease in binding to approximately 10% of the wild-type 20-mer sequence (Fig. 7B, lanes C5T and C15T). This result indicates that although two OmpR molecules bind to the F1 sequence at the same time, a single OmpR molecule is unable to individually bind to either the 5`- or 3`-half.
The results
described above support the notion that two OmpR molecules bind
tandemly to two direct repeats, each of which exists in a 10-bp subunit
sequence; one is the 5`-half (which we will call subunit a), and the
other is the 3`-half (which we will call subunit b). Examination of all
five binding sequences shown in Fig. 4reveals an interesting
feature; 33 Ts out of a total of 50 bases (66%) are found within
subunit a, while only 15 Ts out of a total of 50 bases (30%) are found
within subunit b. To examine the significance of this finding, the
order of subunits was reversed by placing subunit b of F1 as the
5`-half and subunit a of F2 as the 3`-half. The 20-mer fragment thus
encompasses the ompF upstream sequence from -90 to
-71 (90/71 fragment, Fig. 7A). This fragment was
not bound by OmpR (data not shown). Since the substitution of G with T in F1 resulted in a substantial reduction of OmpR binding
(see Fig. 7B), we examined whether the substitution of
the T residue with G at position 11 of the 90/71 fragment recovers OmpR
binding ability. The resultant fragment (Fig. 7A, 90/71(T11G)) was poorly bound by OmpR (Fig. 7B). These results indicate that the T-richness
in the 5`-half of the OmpR-binding 20-mer fragments plays an important
role in the coordinate binding of two OmpR molecules to the fragment.
Figure 8:
Cooperative interaction between OmpR
molecules bound to F2 and F3 are required for binding to these low
affinity sites. Increasing concentrations of in vitro phosphorylated OmpR were incubated with the 100/1 fragment
(containing the F1, F2, and F3 sites) and with the 80/1 fragment
(containing the F2 and F3 sites). The three complexes a, b, and c were formed with the 100/1 fragment, but
only one complex was formed with the 80/1 fragment. Binding assays with
PrS-OmpR showed that the single complex with the 80/1
fragment was bound by four OmpR proteins (data not
shown).
This cooperative binding can be further supported by
mutational analysis of the 100/1 fragment containing either the
C
T or the C
T mutation, which
corresponds to C
T and C
T (C5T and C15T in Fig. 7A),
respectively. The C
T mutation completely
eliminated OmpR binding to the F1 20-mer (Fig. 7B, lane
marked C15T). The mutated sequence was bound by six OmpR
molecules as determined by gel shift analysis with PrS
-OmpR
(data not shown). However, unlike the wild-type ompF sequence
in which incubation with increasing OmpR concentrations leads to the
formation of three bands, incubation of increasing OmpR concentrations
with the mutated sequences produced only two complexes, b and c (Fig. 9). Gel shift assays with PrS
-OmpR showed that
this mutated fragment is bound by six proteins (data not shown). This
suggests that although OmpR can bind to the mutated sequence at
-96 or -86, this binding requires OmpR binding to the
downstream F2-F3 region.
Figure 9:
Substitution of C with T
resulted in the loss of the a complex bound by two OmpR proteins.
Increasing concentrations of in vitro phosphorylated OmpR were
incubated with the 100/1 fragment (containing the F1, F2, and F3 sites)
and with the 100/1 fragment containing the C
T
mutation. Only complexes b (bound by four OmpR proteins) and c (bound by six OmpR proteins) were formed with the mutated
fragment, as demonstrated by binding assays using PrS
-OmpR
(data not shown).
The present results unambiguously demonstrated that six OmpR molecules bind to the -100 to -39 region of ompF. We determined that this region contains three individual binding sites, 20 base pairs in length, which are each bound by two OmpR proteins. The binding sites were designated F1, F2, and F3, representing the -100 to -81, -80 to -61, and -58 to -39 sequences of ompF, respectively (Fig. 3). Recent data have shown a far upstream OmpR binding site located at the -380 to -361 sequence of ompF (Huang et al., 1994; Rampersaud et al., 1994), which also shares sequence identity with F1, F2, and F3. Based on the results reported in this paper, we defined this distal site as F4. Although the number of OmpR molecules bound to this site was not determined due to poor binding to this sequence by OmpR, it is reasonable to assume that two OmpR proteins bind to this 20-base pair motif. Similarly, the ompC -98 to -79 sequence is another independent binding site bound by two OmpR molecules (data not shown) and assigned C1.
Although two OmpR molecules bind to a 20-base pair sequence, each
20-mer is considered a single site since binding of a single OmpR
molecule was never detected. Three complexes observed in mobility shift
assays with OmpR and the DNA fragment containing the F1, F2, and F3
sequences (Fig. 1B) were thus formed by binding of two
(to F1), four (to F1 and F2), or six OmpR (to F1, F2, and F3) proteins.
Currently, there are not sufficient data to suggest that OmpR dimerizes
in solution prior to binding DNA. Methods such as gel filtration and
light scattering detect only OmpR monomers. ()Co-precipitation of OmpR (not fused to protein S) with
PrS
-OmpR bound to M. xanthus spores occurred only
in the presence of DNA. (
)It is likely that significant
OmpR-OmpR interactions occur only upon binding to DNA.
The finding
that two proteins bind to a 20-base pair site led to the question of
whether the proteins bind to two direct repeats or to two inverted
repeats. Random selection of an optimal OmpR binding sequence by PCR
amplification was done using a synthetic fragment, which contained 11
base pairs from the 5`-half of the F1 site followed by nine random base
pairs. The sequence TTACATNTN was selected within the randomized
portion. This suggests that the most preferred OmpR binding sequence
consists of two direct repeats consisting of TTACATNTN, since sequences
similar to TTACATNTN are seen in the 5`-half of F1 and the 5`- and
3`-halves of F2, F3, F4, and C1. Note that T,
C
, A
, and C
are invariable in all
of the 20-base pair binding motifs. Substitution of the C
with T in a 20-bp template resulted in decreased OmpR binding,
while substitution of the C
to T in a 20-base pair binding
template resulted in a complete loss of OmpR binding activity. These
data are consistent with the data of Rampersaud et al.(1989)
who showed that incubation of phosphorylated OmpR with a fragment
containing the -100 to -60 sequence of ompF resulted in the formation of two bands. Introduction of the
C
T or C
T mutation within this
fragment resulted in a decrease in affinity of OmpR for this DNA as
well as the loss of the faster complex (that bound by only two
proteins). Again, the C
T mutation was more
detrimental to binding than the C
T mutation.
However, a T
A mutation within this fragment
increased binding by OmpR, confirming that the ACA sequence obtained
through the random selection is a preferred binding sequence in both
the 5`- and 3`-half of the 20-base pair motif. The present results
clearly indicate that two OmpR proteins bind to direct repeat sequences
rather than inverted repeat sequences. Note that in F1 there are not
inverted repeat sequences consisting of more than three bases.
Furthermore, the existence of two absolutely conserved C residues in
the two halves of the 20-base pair motif makes it unlikely that OmpR
proteins bind to an inverted repeat structure.
Previously, we had assigned each of the direct repeats in F1 as two binding sites, Fa and Fb, which share the 10-base pair sequence NTTACNTNTN (Tsung et al., 1989). It should be noted that Fa is highly T-rich in comparison with Fb. The T-richness in the 5`-halves of the 20-base pair motifs is common in all sequences as shown in Fig. 4and appears to contribute asymmetry to the 20-base pair motif, since exchanging the position between the two halves resulted in the loss of OmpR binding. Maeda et al.(1991) also proposed an asymmetric consensus motif with the sequence TTTTACTTTTTGTAACATAT. Interestingly, Makino et al.(1989) proposed that the OmpR homologue PhoB binds to an asymmetric 18-base pair sequence, the pho box, which is tandemly repeated upstream of promoters controlled by PhoB (Kimura et al., 1989; Kasahara et al., 1991).
Binding of
protein dimers to direct repeats has been reported for AraC (Carra and
Schleif, 1993), GABP (Thompson et al., 1991), and Mat2
(Smith and Johnson, 1992). In each case, the authors propose the
presence of a flexible linker domain between the dimerization domain
and the DNA-binding domain. The flexible linker allows AraC (Carra and
Schleif, 1993) and Mat
2 (Smith and Johnson, 1992) to bind to the
nucleotide sequence repeats in either a direct or inverted orientation,
as well as to repeats with variable spacing. In contrast, there appears
to be little or no flexibility in the positioning of the two OmpR
binding sequences within a 20-base pair motif. One possibility is that
the nucleotide sequence of the binding motif confers a strict
conformation on the DNA to position the two direct repeats such that
two bound OmpR proteins can cooperatively interact for stabilization of
the complex. T-rich sequences are known to cause bending of DNA, and
bending of the ompF upstream regulatory sequence has been
experimentally shown. (Mizuno, 1987; Slauch and Silhavy, 1991).
Note that identification of the fully conserved C residues of an OmpR binding site aided in the more precise identification of the F3 site, which is actually two base pairs removed from the F2 site. This positioning of the F3 site may function to place the bound OmpR proteins on the same face of the DNA helix. Since a full helical turn is 10.5 base pairs in length, the 40 base pairs of the F1 and F2 sites may fall short of four full turns. The location of the F3 site may compensate for this.
Computer alignment of the five OmpR binding
sites (Fig. 4) agrees well with the established affinity
hierarchy, F1 > C1 > F2 > F3 > F4 (Rampersaud et
al., 1994). ()Comparison of these sequences suggests
that F3 and F4 have the most mismatches and thus are likely to have the
lowest affinity for OmpR. Both F3 and F4 lack the highly conserved G
residue at position 11 of the 20-base pair site. F4, which seems to
have the lowest affinity for OmpR, also lacks the T-richness in its
5`-half.
Cooperative interactions also affect the ability of OmpR to bind to the sites upstream of the ompF promoter. Rampersaud et al.(1994) showed that binding of the F4 site depended upon prior binding of OmpR to the downstream region. The present data show that cooperative interactions are also important for binding to the lower affinity F2 and F3 sites. Deletion of the F1 site resulted in a decreased affinity of OmpR for the F2 and F3 sites. It was clear that OmpR was not able to bind to the F2 or F3 sites alone. Clearly, binding of these low affinity sites was enhanced by the presence of OmpR-OmpR interactions.
According to the model proposed above, six OmpR proteins bind tandemly to six direct repeats upstream (-100 to -39) of the ompF promoter. In addition to these six OmpR molecules, two other molecules are bound to F4, making a total of eight molecules involved in the regulation of ompF expression. Multiple transcription factor binding sites upstream of a promoter is also known in other systems (for review, see Collado-Vides et al.(1991)). In the case of ompF, this allows more flexibility and fine-tuning in the regulation of transcription, as more OmpR binding shifts the function of OmpR from activation to repression. Binding is clearly regulated by the concentration of phosphorylated OmpR in the cell. An increase in medium osmolarity is accompanied by an increase in the number of phosphorylated OmpR molecules (Forst et al., 1990), leading to binding of additional, lower affinity sites. In addition, the need for cooperative interactions ensures that binding of proteins to high affinity sites precedes binding to adjacent low affinity sites.