Department of Microbiological R & D, Statens Serum Institut, Artillerivej 5, 2300 Copenhagen, Denmark
Received 25 January 2002; returned 23 April 2002; revised 6 June 2002; accepted 2 July 2002
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Group I. Forty-four general practitioners in Roskilde County each received 20 Uricult Trio dipslides (Orion Diagnostica, Espoo, Finland), from February to April 1997, on which to perform consecutive urinary culturing on all patients with symptoms of UTI. The UTI was defined as uncomplicated if all of the following criteria were fulfilled: (i) female gender; (ii) age 1460 years; (iii) symptoms: dysuria, frequency, suprapubic pain, absence of loin pain, absence of fever; (iv) not pregnant; (v) no known deformity in the urinary tract; and (vi) less than three UTIs in the past year. All other UTIs were classified as complicated.1 All dipslides, including those with 105 cfu/mL, were sent to Statens Serum Institute, Department of Microbiological R & D.
Group II. The Department of Clinical Biochemistry at the county hospital in Roskilde (RAS) performed (from April to June 1999) all urinalyses at the hospital and forwarded cultivated consecutive strains from hospital-acquired UTIs (defined as UTI starting >3 days after admission).
Group III. A selection of E. coli bacteraemia strains from RAS tested at the Department of Clinical Microbiology (DCM) at Statens Serum Institute (19971999) was carried out according to the following criteria: probable focus in the urinary tract and infection acquired in the community (bacteraemia <3 days after hospitalization).
Identification
Group I: dipslides were inspected visually, according to the manufacturers manual, and the cfu/mL was determined on CLED agar, MacConkey agar and E. coli agar (ß-glucuronidase). Only dipslides with 103 cfu/mL were processed further, and were cultured on differential media. Identification for groups II and III relied on the identification originally performed at RAS and DCM, respectively.
Antibiotics
Mecillinam (Leo Pharmaceuticals, Ballerup, Denmark), ampicillin (Sigma Chemical Co.), sulfamethizole (Sigma), trimethoprim (Sigma) and nitrofurantoin (Sigma) were obtained from their respective manufacturers.
MIC determination
MICs were obtained by the agar dilution method according to the NCCLS,2 using MuellerHinton II agar (Becton Dickinson). The breakpoints used for Enterobacteriaceae were as defined by the NCCLS.3
PCR
All E. coli isolates were tested for the presence of sulphonamide resistance genes (sulI, sulII) and integron 1 gene (intI 1). The oligonucleotides were synthesized at TAG Copenhagen A/S, and their sequences were (5'3'): 16S-F, GCGGACGGGTGAGTAATGT; 16S-B, TCATCCTCTCAGACCAGCTA (200 bp); Sul 1-F, CGGCGTGGGCTACCTGAACG; Sul 1-B, GCCGATCGCGTGAAGTTCCG (433 bp); Sul 2-F, GCGCTCAAGGCAGATGGCATT; Sul 2-B, GCGTTTGATACCGGCACCCGT (293 bp); Int-F, GCCACTGCGCCGTTACCACC; Int-B, GGCCGAGCAGATCCTGCACG (898 bp) (GenBank accession numbers AF071413, M36657, AF071413, AE000452). The PCR mixture contained: 5 µL of template DNA, 5 µL of 10x PCR buffer (Perkin Elmer); 10 µL of dNTP mix (Pharmacia Biotech, Sweden); 4 µL of MgCl2 (25 mM; Perkin Elmer); 0.25 µL of AmpliTaq DNA polymerase (50 µM; Perkin Elmer); 2.5 µL of each primer 16S-F, 16S-B (40 µM), Sul 1-F, Sul 1-B, Sul 2-F, Sul 2-B, Int-F and Int-B (2 µM); 15.75 µL of distilled water (Gibco-BRL). Amplification (GeneAmp PCR System 2400; Perkin Elmer) was carried out by heating for 5 min at 94°C, followed by 30 cycles of 94°C for 15 s, 69°C for 30 s and 72°C for 60 s, followed by one cycle at 72°C for 7 min. Gel electrophoresis was carried out on 2% w/v agarose gel (1% NuSieve GTG agarose and 1% SeaKem GTG agarose) (FMC BioProducts, Rockland, ME, USA). D-15 DNA Marker (Novex, San Diego, CA, USA) was used as a marker and E. coli NCTC 50001, E. coli NCTC 50020 and a susceptible strain from our own collection were used as controls in each PCR run.
Statistical methods
Fishers exact test was used, with P < 0.05 considered as significant.
![]() |
Results and discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Table 1 shows the distribution of resistance in E. coli. Resistance to ampicillin, mecillinam and sulfamethizole was significantly higher in the hospital than in the community E. coli in total. Trimethoprim and nitrofurantoin resistance were not significantly different in the three strain collections. Trimethoprim and sulfamethizole resistance among the complicated UTIs were significantly higher compared with the uncomplicated UTIs. Compared with a Danish study in general practice published in 1980,4 our data show a significant increase in the ampicillin and trimethoprim resistance, a moderate increase in the sulphonamide resistance and a decrease or status quo in the mecillinam and nitrofurantoin resistance in general practice in Denmark. Data from others with respect to uncomplicated UTIs,5 and in general practice in total,6 support our findings. The high incidence of resistance among hospital UTIs and bacteraemia resembles that from a British survey.7
|
All 292 E. coli were tested for sul and int genes by the multiplex PCR assay (Figure 1). Strains with MICs ranging from 8 to 512 mg/L (n = 184) did not possess any sul genes. One E. coli with an MIC of 512 mg/L was sulI and sulII posi-tive. Among the 107 E. coli with MICs > 2048 mg/L, the distribution of sul genes was as follows: 54 sulII positive, 30 sulI positive, 20 sulI and sulII positive; three strains lacked any of these genes. Of the 51 sulI-positive isolates, 49 carried the integron-associated integrase gene IntI 1. The genetics of clinical sulphonamide-resistant E. coli has been published recently,8 and the distribution among strains with MICs 512 mg/L resembles what we have found.
|
The common opinion in Denmark that sulphonamides and ampicillin are safe to use for empirical treatment of UTIs has to be re-evaluated in light of the resistance level and the risk of selecting for resistant bacterial populations.
![]() |
Acknowledgements |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
2 . National Committee for Clinical Laboratory Standards. (2000). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow AerobicallyFifth Edition: Approved Standard M7-A5. NCCLS, Villanova, PA, USA.
3 . National Committee for Clinical Laboratory Standards. (2001). Performance Standards for Antimicrobial Susceptibility Testing: Approved Standard M100-S12. NCCLS, Wayne, PA, USA.
4 . Thamsborg, G. M., Balslev, I., Mabeck, C. E. & Vejlsgaard, R. (1980). Urinary tract infections in general practice. I. Clinical features and bacterial flora. Ugeskrift for Laeger 142, 165760.[Medline]
5
.
Kahlmeter, G. (2000). The ECO*SENS Project: a prospective, multinational, multicentre epidemiological survey of the prevalence and antimicrobial susceptibility of urinary tract pathogensinterim report. Journal of Antimicrobial Chemotherapy 46, Suppl. A, 1522.
6 . Nissinen, A. & Huovinen, P. (2000). FiRe worksthe Finnish Study Group for Antimicrobial Resistance (FiRe). Eurosurveillance 5, 1335.[Medline]
7 . Grüneberg, R. N. (1994). Changes in urinary pathogens and their antibiotic sensitivities, 19711992. Journal of Antimicrobial Chemotherapy 33, Suppl. A, 18.[ISI][Medline]
8 . Enne, V. I., Livermore, D. M., Stephens, P. & Hall, L. M. (2001). Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet 357, 13258.[ISI][Medline]
9 . Amyes, S. G. (1989). The success of plasmid-encoded resistance genes in clinical bacteria. An examination of plasmid-mediated ampicillin and trimethoprim resistance genes and their resistance mechanisms. Journal of Medical Microbiology 28, 7383.[ISI][Medline]
10 . Vorland, L. H., Carlson, K. & Aalen, O. (1985). Antibiotic resistance and small R plasmids among Escherichia coli isolates from outpatient urinary tract infections in northern Norway. Antimicrobial Agents and Chemotherapy 27, 10713.[ISI][Medline]