Department of Microbiology, School of Medicine, University of Patras, 26500 Rion, Patras, Greece
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The expression of the mecA gene and the resulting production of PBP2a is regulated by proteins encoded by the penicillinase-associated blaR1blaI inducerrepressor system and the corresponding genomic mecR1mecI elements.79 Hiramatsu et al.10 identified in Staphylococcus aureus N315 the mecR1mecI regulator element, which is located upstream of the mecA gene and is divergently transcribed from mecA. The mecI gene codes for a repressor protein and the mecR1 gene for a ß-lactam-sensing transmembrane signalling protein. Methicillin and oxacillin are, however, not good inducers for this system, often resulting in slow induction of methicillin resistance. Phenotypically susceptible strains, known as pre-methicillin-resistant S. aureus (pre-MRSA) and pre-methicillin-resistant coagulase-negative staphylococci (pre-MRCNS), have been discovered, which do not express methicillin resistance, as mecA is fully repressed by mecI.11,12 The induction of mecA transcription is very slow and might be due to mutations of mecI.12
The distribution of mec regulator genes among methicillin-resistant Staphylococcus strains from various countries has already been studied by hybridization and sequencing, which showed that the loss or inactivation of the mecI gene leads to derepression of mecA gene transcription.1214 In vitro amplification of DNA by PCR is a rapid and sensitive method for the detection of specific DNA sequences and requires fewer cells than DNA hybridization protocols.15,16 The method has already been applied for the identification of mecA-positive strains directly in clinical specimens or in DNA extracts.15,17
In this study, we have determined the distribution of mecA, mecR1 and mecI genes by PCR, among 145 Staphylococcus clinical isolates expressing resistance to methicillin (MIC 4 mg/L), isolated from clinical specimens from in-patients. Using several combined pairs of primers in seven reactions, we have detected some alterations and deletions of the genes described above. These alterations have been correlated with the MIC for all isolates and with the staphylococcal species. The location of deletions or alterations of mec elements might explain the expression of resistance to methicillin.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
One-hundred and forty-five Staphylococcus isolates from clinical specimens of in-patients at the University Hospital of Patras were included in this study. The Clinical Microbiology Laboratory identified 49 isolates as S. aureus, 76 as Staphylococcus epidermidis, eight as Staphylococcus hominis, eight as Staphylococcus haemolyticus, three as Staphylococcus lugdunensis and one as Staphylococcus xylosus, by Gram's stain, catalase and coagulase production, and by the use of API Staph. System (bioMérieux, La Balme les Grottes, France).
The control strains BB225 (methicillin-sensitive S. aureus), BB270 (MRSA, mecA positive) and BB830 [methicillin-resistant S. epidermidis (MRSE), mecA/mecR1/mecI positive], kindly provided by Professor B. Berger-Bächi, were used for the establishment of PCR conditions.
Antibiotic susceptibility testing and ß-lactamase production
Resistance to methicillin was detected by the KirbyBauer disc diffusion method on MuellerHinton agar, using 1 µg oxacillin discs (Difco Laboratories, Detroit, MI, USA), according to NCCLS standards.18 MICs of methicillin (Sigma, St Louis, MO, USA) were determined by agar dilution method in MuellerHinton agar, supplemented with 4% NaCl, after 24 h incubation at 35°C using 105 cfu/well. The resistance breakpoint to methicillin was 4 mg/L.19 The production of ß-lactamase was tested with nitrocefin discs (Difco) according to the manufacturer's instructions.19
Preparation of chromosomal DNA
Cells from an overnight culture in LuriaBertani broth [5 g/L NaCl, 5 g/L yeast extract, 10 g/L tryptone (Difco)] collected by centrifugation, were suspended in 3 mL buffer (0.1 M TrisHCl pH 7.5, 0.1 M EDTA pH 8, 0.15 M NaCl) with 1 mg lysozyme (Sigma) and 0.2 mg lysostaphin (Sigma). After incubation of the resulting mixture at 37°C for 30 min, 0.3 mL of 5% SDS in 50% ethanol (Merck, Darmstadt, Germany) was added, followed by phenol: chloroform:isoamylalcohol (25:24:1) extraction. The DNA was precipitated by the addition of two volumes 100% ethanol and was suspended in 2 mL TE buffer (10 mM TrisHCl pH 8, 1 mM EDTA pH 8) with 1 µL RNase H (103 U/mL, Boehringer, Mannheim, Germany). The samples were incubated overnight at room temperature, measured for the DNA quantity at 260 nm (Gene Quant II, RNA/DNA calculator, Pharmacia Biotech, CE, Cambridge, England) and kept at 4°C.20
Oligonucleotides
Two of the primers used for the detection of the mecA gene (named P2 and P3) have already been published21 and one more sense primer was designed by us (P1).22 The primer sequences were: P1, 5'-(911)GGTCCCATTAACTCTGAAG(929)-3'; P2, 5'-(1427)ATCGATGGTAAAGGTTGGC(1445)-3'; and P3, 5'-(1956)AGTTCTGCAGTACCGGATTTGC(1935)-3' (Genset, Paris, France), according to the sequence numbers as described by Matsuhashi et al.6 The two sense primers (P1, P2) and one antisense (P3) have been applied in two reactions, and gave rise to PCR products of 1046 and of 530 bp, respectively.
For the detection of the regulatory genes mecR1mecI, five pairs of eight primers were used in combination, as follows: for the detection of the 5' end of the mecR1 gene designated as membrane spanning (MS), we used the primers: sense SA18, 5'-(130)ATCCTCCTTATATAAGACTAC(150)-3'; antisense SA19, 5'-(277)CATATCGTGAGCAATGAACTG(257)-3' (Figure).
|
The mecI gene was detected by the application of three primers in two reactions, in order to identify further alterations. The primers used in the first reaction were: sense SA9, 5'-(1923)AATGGCGAAAAAGCACAACA(1942)-3'; and antisense SA10, 5'-(2403)GACTTGATTGTTTCCTCTGTT(2383)-3'. In the second reaction SA15 was used as sense with the antisense SA10 (Figure). The primers SA9, SA10, SA13, SA14, SA17, SA18 and SA19 were those published by Suzuki et al.14
PCR conditions
The DNA extract (600 ng) was amplified by PCR in a final volume of 50 µL, containing 0.25 mM of each dNTP, 40 pmol of each primer, 0.5 IU Taq DNA polymerase (Promega Corporation, Madison, WI, USA) and buffer provided by the manufacturer. The denaturation was performed for 1 min at 95°C, the annealing was for 1 min at 58°C for the detection of mecA gene and for the other reactions at 55°C, and the primer extension for 2 min at 72°C, with a total of 30 cycles. A sample of 10 µL from each reaction was analysed by gel electrophoresis in a 0.8% agarose gel with ethidium bromide.20 As molecular weight marker, X174 digested by HaeIII was used.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The isolates were classified into two groups on the basis of their MIC levels. The first group included 31 S. aureus, 51 S. epidermidis and 11 other CNS for which methicillin MICs ranged from 4 to 128 mg/L. Higher methicillin MICs (>128 mg/L) were found in 18 S. aureus, 25 S. epidermidis and nine other CNS. The majority of isolates in both groups were ß-lactamase producers with 39 S. aureus (79.6%), 64 S. epidermidis (84.2%) and 19 other CNS (95%) giving positive results with the nitrocefin test.
Detection of the mecA gene among S. aureus strains
Forty-nine S. aureus strains were identified as mecA positive, yielding PCR products with at least one pair of primers. Of these mecA-positive strains, 43 (87.8%) did not have alterations at the primer-binding sites, since the combinations P1P3 and P2P3 gave rise to DNA products of 1046 and 530 bp, respectively, as expected. Four strains (8.2%) showed alterations at the site of the primer P2, giving rise to positive reactions only with the P1P3 pair. Finally, two strains (4%) presented alterations at the site of the primer P1 (positive PCR deriving only from the pair P2P3) (Table I).
|
With the mecA-positive S. epidermidis strains, 72 of 76 (94.7%) did not show any alterations of the specific regions with complementarity to the primers used. The specific DNA bands were detected in both reactions and were the same size as those seen with S. aureus. Three strains (4%) showed alterations at the annealing site of primer P2, while one strain (1.3%) showed alterations at the annealing site of primer P1 (Table I).
Detection of the mecA gene among the other CNS
From the 20 isolates in our collection, 14 (70%) carried intact the specific region of the mecA gene: positive reactions occurred with both pairs of primers and the DNA bands detected were of the same size as those of S. aureus. Five isolates (25%), comprising three S. hominis and two S. lugdunensis, carried the gene with alterations at the binding site of primer P2, while the isolate of S. xylosus showed alterations at the binding site of primer P1 (Table I).
Detection of mecR1mecI genes among S. aureus strains
For the detection of the regulator genes mecR1mecI eight primers were used, which were combined in five pairs (see Figure). All the strains were examined for the presence of the regulator region. From the 49 mecA-positive strains, 13 (26.5%) carried intact mecR1mecI genes, at least with regard to the regions complementary to the primers used. The PCRs were positive with all primers and the DNA bands showed the expected sizes relative to the control strain. Seven isolates (14.3%) carried the whole mec regulator region with an alteration at the binding site of the primer SA15 and a positive result when using the pair SA9SA10. Three isolates (6.1%) also carried the region which presented an alteration at the site complementary to the primer SA9, with a positive result when the pair SA15SA10 was used and one strain (2.1%) revealed an alteration at the annealing site of primer SA17. From the remaining isolates, 11 (22.4%) carried only the mecR1 gene (deletion of the mecI gene and a positive result with the pair SA15SA17), seven (14.3%) carried only the MS part of the mecR1 gene (positive PCR results when we used at least one of the pairs SA13SA14 and SA18SA19), and seven (14.3%) did not carry the mec regulator region at all (Table II
). The PCR products were the same size as that of the control strain.
|
The distribution of the regulator genes in these strains was studied by the application of the same reactions. Forty-four of the 76 mecA-positive S. epidermidis isolates (57.9%) carried the whole regulator region without alterations in the binding sites for the primers used. Three isolates (3.9%) revealed alterations at the annealing site of primer SA15, six isolates (7.9%) at the site of primer SA9 and four isolates (5.3%) at the annealing site of primer SA17. Deletion of the mecI gene was detected in only one isolate (1.3%), while deletion of the PB domain of the mecR1 gene was detected in 16 isolates (21.1%). Two of the 76 isolates (2.6%) lacked the regulator gene (Table II). All the DNA bands detected were of the same size as those of S. aureus.
Detection of the mecR1mecI genes among the other CNS
Two of the 20 mecA-positive CNS carried the whole regulator region without alterations. Eight isolates (40%) showed a deletion of the PB domain of the mecR1 gene and 10 isolates (50%) lacked the regulator genes (mecR1/mecI negative) (Table II). The PCR products were the same size as those produced with S. aureus.
Correlation of MIC levels with the presence of regulator genes
Twenty-five S. aureus isolates were found to be negative for the presence of mecI, 23 of them (46.9%) with lower MIC values (Table III). From the mecI-positive isolates, four of eight with lower MICs and seven of 16 with MICs > 128 mg/L, carried alterations at the PB domain of mecR1. Most of the S. epidermidis isolates were positive for the presence of mecI but 17 (22.4%) mecI-negative isolates had low MICs. Eight of the 34 isolates with low methicillin MICs and five of the 23 showing high methicillin MICs had alterations at the PB site of mecR1. Among the other CNS, only two isolates were found to carry the mecI gene and had low methicillin MICs, while none of these isolates had any alterations detected with the primers used.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
A minority (2.8%) of the isolates showed alterations at the annealing site of primer P1, including two MRSA. At the complementary region of primer P2, which includes the ClaI restriction site, more strains showed alterations, including four MRSA, three MRSE and five MRCNS other than S. epidermidis (25%). S. hominis and S. lugdunensis, which expressed this alteration, have c. 35% DNA relatedness.28 After digestion of their chromosomal DNA by ClaI and hybridization with mecA probe, all these strains showed two hybridization bands (data not shown). The MIC of methicillin for these isolates ranged from 8 to 500 mg/L. These findings lead us to conclude that the alterations in those sites are restricted without affecting the ClaI restriction sequence or the enzymic activity of PBP2a.
It has been reported that considerable variation in the presence of the other genes involved in the expression of methicillin resistance exists.12,14 The regulatory elements mecR1 and mecI have been detected in 6095% of MRSA.14,29 Clinical isolates before 1970 had deletions of the PB domain of mecR1, while more recent isolates tend to have mecI polymorphism and mecA promoter mutations.14,24,30 Intact and fully functional mec regulator genes appear to strongly repress PBP2a production.31,32 In contrast, mecA-positive strains with deletions of the PB site of mecR1 and of the downstream mecI, express PBP2a constitutively, provided that the strain does not contain inducible ß-lactamase and the regulatory elements blaR1 blaI, which coregulate the enzyme production.7,27
Previous studies have detected mecR1 and mecI among different species of MRCNS.14,29 Evidence that mutations in mecI play a role in derepression of mecA in CNS has not as yet been discovered.12
In this study, we tried to locate alterations or deletions of regulator genes among methicillin-resistant clinical isolates from a large teaching hospital and to correlate these findings with methicillin MIC and species, using a combination of several PCR primers. Deletion of mecI alone was identified in 11 (22.4%) MRSA and only one MRSE, while seven more MRSA and 16 MRSE were found with deletion of mecI and of the PB domain of mecR1, carrying only the MS part of the gene. Loss of both regulator elements was detected in seven MRSA, two MRSE and 10 of 20 MRCNS. It is interesting that the MRSE strains seem to be stable, while the majority of the other MRCNS (18 of 20) have deletions of mecI together with the PB domain of mecR1 or of both regulator genes. None of the MRCNS isolates was found to carry the PB domain with alterations, as far as we can ascertain from the primers used. The absence of regulator genes has been discussed for methicillin-resistant S. haemolyticus isolates.12,14
It has already been reported that the old epidemic MRSA carried only the mecA gene, but investigators considered that it was more likely that these strains lost their regulator genes by a deletional event after they had acquired the original mec component.14
According to the results presented, we postulate that MRSE seem to be the source of mec determinants in the hospital environment and that the other staphylococcal species have lost or altered parts of the genes after acquisition of mec elements. Allelic variation of chromosomal enzyme loci, as well as hybridization and sequence analysis, of strains isolated in different or in the same geographical areas, support the hypothesis of continuous horizontal gene transfer among staphylococci.12,14,33
Correlation of the deletions and alterations identified with the methicillin MICs revealed that 23 (46.9%) MRSA, even though mecI negative, had MICs 128 mg/L. This fact might be partially explained by the possibility that these strains carry an inducible ß-lactamase element, since 16 of them were ß-lactamase producers and that mecA repression is due to the function of blaI.1,7 For the remaining seven isolates, which were ß-lactamase negative, another mechanism must be responsible for the regulation of resistance.34,35 The presence of the regulatory genes with or without alterations at the PB domain of mecR1 among 16 MRSA with high MICs (>128 mg/L) leads us to the conclusion that either the alterations at the PB domain are not essential for ß-lactam binding at the protein, or that other mechanisms are also involved in the expression of high-level resistance.12,14,34,36
Among the MRSE group, 26 strains (34.2%) that carried intact the regulator genes and eight strains (10.5%) with alterations at the PB domain of mecR1, had lower MICs (128 mg/L) indicating a slow induction of mecA.35 Of the 17 mecI-negative isolates with low MIC, 16 were ß-lactamase producers, leading us to the hypothesis that blaR1blaI could be responsible for the regulation of mecA.
These results can classify the MRSE strains, as pre-MRCNS, that are phenotypically susceptible (MIC 48 mg/L), mecA positive and are more common than pre-MRSA.11 Among the MRCNS other than S. epidermidis, the two strains that carry intact the regulatory elements had low MICs, as expected, while eight of the nine mecI- negative isolates expressing low MICs were ß-lactamase positive. The remaining MRCNS (nine isolates) with high MICs lacked regulator genes (Table III).
In summary, this study has revealed the presence of pre-MRSE isolates that might be the reservoir of mec-related resistance determinants. The population of mecA-positive S. aureus strains seems to have emerged after acquisition of mec elements followed by genetic alterations. Evidence was also found that mecR1 and mecI may be deleted often among the other staphylococcal species, and not only in S. haemolyticus. The expression of methicillin resistance is not only the result of interaction between mecA, mecR1 and mecI, but is a more complex mechanism that involves several regulatory elements.
![]() |
Acknowledgments |
---|
![]() |
Notes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
2 . Chambers, H. F. (1987). Coagulase-negative staphylococci resistant to beta-lactam antibiotics in vivo produce penicillin-binding protein 2a. Antimicrobial Agents and Chemotherapy 31, 91924.
3 . Chambers, H. F. (1999). Penicillin-binding protein-mediated resistance in pneumococci and staphylococci. Journal of Infectious Diseases 179, Suppl. 2, S3539.[ISI][Medline]
4 . Hartman, B. J. & Tomasz, A. (1984). Low affinity penicillinbinding protein associated with beta-lactam resistance in Staphylococcus aureus. Journal of Bacteriology 158, 5136.[ISI][Medline]
5 . Pierre, J., Williamson, R., Bornet, M. & Gutmann, L. (1990). Presence of an additional penicillin-binding protein in methicillin-resistant Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, and Staphylococcus simulans with a low affinity for methicillin, cephalothin, and cefamandole. Antimicrobial Agents and Chemotherapy 34, 16914.[ISI][Medline]
6 . Matsuhashi, M., Song, M. D., Ishino, F., Wachi, M., Doi, M., Inoue, M. et al. (1986). Molecular cloning of the gene of a penicillin-binding protein supposed to cause high resistance to beta-lactam antibiotics in Staphylococcus aureus. Journal of Bacteriology 167, 97580.[ISI][Medline]
7 . Hackbarth, C. J. & Chambers, H. F. (1993). blaI and blaR1 regulate beta-lactamase and PBP2a production in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 37, 11449.[Abstract]
8 . Tesch, W., Ryffel, C., Strässle, A., Kayser, F. H. & Berger-Bächi, B. (1990). Evidence of a novel staphylococcal mec-encoded element (mecR) controlling expression of penicillin-binding protein 2'. Antimicrobial Agents and Chemotherapy 34, 17036.[ISI][Medline]
9
.
Sharma, V. K., Hackbarth, C. J., Dickinson, T. M. & Archer, G. L. (1998). Interaction of native and mutant MecI repressors with sequences that regulate mecA, the gene encoding penicillin binding protein 2a in methicillin-resistant staphylococci. Journal of Bacteriology 180, 21606.
10 . Hiramatsu, K., Asada, K., Suzuki, E., Okonogi, K. & Yokota, T. (1992). Molecular cloning and nucleotide sequence determination of the regulator region of mecA gene in methicillin-resistant Staphylococcus aureus. FEBS Letters 298, 1336.[ISI][Medline]
11 . Hiramatsu, K. (1995). Molecular evolution of MRSA. Microbiology and Immunology 39, 53143.[ISI][Medline]
12
.
Weller, T. M. A. (1999). The distribution of mecA, mecR1 and mecI and sequence analysis of mecI and the mec promoter region in staphylococci expressing resistance to methicillin. Journal of Antimicrobial Chemotherapy 43, 1522.
13 . Shimaoka, M., Yoh, M., Segawa, A., Takarada, Y., Yamamoto, K. & Honda, T. (1994). Development of enzyme-labeled oligonucleotide probe for detection of mecA gene in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology 32, 18669.[Abstract]
14 . Suzuki, E., Kuwahara-Arai, K., Richardson, J. F. & Hiramatsu, K. (1993). Distribution of mec regulator genes in methicillin-resistant Staphylococcus clinical strains. Antimicrobial Agents and Chemotherapy 37, 121926.[Abstract]
15 . Tokue, Y., Shoji, S., Satoh, K., Watanabe, A. & Motomiya, M. (1992). Comparison of a polymerase chain reaction assay and a conventional microbiologic method for detection of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 36, 69.[Abstract]
16 . Unal, S., Hoskins, J., Flokowitsch, J. E., Wu, C. Y., Preston, D. A. & Skatrud, P. L. (1992). Detection of methicillin-resistant staphylococci by using the polymerase chain reaction. Journal of Clinical Microbiology 30, 168591.[Abstract]
17 . Ubukata, K., Nakagami, S., Nitta, A., Yamane, A., Kawakami, S., Sugiura, M. et al. (1992). Rapid detection of the mecA gene in methicillin-resistant staphylococci by enzymatic detection of polymerase chain reaction products. Journal of Clinical Microbiology 30, 172833.[Abstract]
18 . National Committee for Clinical Laboratory Standards. (1999). Performance Standards for Antimicrobial Disk Susceptibility TestsSixth Edition. Approved Standard M2-A6. NCCLS, Wayne, PA.
19 . Low, D. E. (1997). Susceptibility testing for methicillin resistance. In The Staphylococci in Human Disease, (Crossley, K. B. & Archer, G. L., Eds), pp. 23845. Churchill Livingstone Inc., New York.
20 . Maniatis, T., Fritsch, E. F. & Sambrook, J. E. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
21 . Murakami, K., Minamide, W., Wada, K., Nakamura, E., Teraoka, H. & Watanabe, S. (1991). Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. Journal of Clinical Microbiology 29, 22404.[ISI][Medline]
22 . Spiliopoulou, I., Petinaki, E., Arvaniti, A., Roumelioti, E. & Dimitracopoulos, G. (1997). A study of mec genes among coagulase negative staphylococci by PCR. Acta Microbiologica Hellenica 42, 34553.
23 . Suzuki, E., Hiramatsu, K. & Yokota, T. (1992). Survey of methicillin-resistant clinical strains of coagulase-negative staphylococci for mecA gene distribution. Antimicrobial Agents and Chemotherapy 36, 42934.[Abstract]
24 . Archer, G. L., Niemeyer, D. M., Thanassi, J. A. & Pucci, M. J. (1994). Dissemination among staphylococci of DNA sequences associated with methicillin resistance. Antimicrobial Agents and Chemotherapy 38, 44754.[Abstract]
25 . Beck, W. D., Berger-Bächi, B. & Kayser, F. H. (1986). Additional DNA in methicillin-resistant Staphylococcus aureus and molecular cloning of mec-specific DNA. Journal of Bacteriology 165, 3738.[ISI][Medline]
26 . Ryffel, C., Tesch, W., Birch-Machin, I., Reynolds, P. E., Barberis-Maino, L., Kayser, F. H. et al. (1990). Sequence comparison of mecA genes isolated from methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis. Gene 94, 1378.[ISI][Medline]
27 . Ubukata, K., Nonoguchi, R., Song, M. D., Matsuhashi, M. & Konno, M. (1990). Homology of mecA gene in methicillin-resistant Staphylococcus haemolyticus and Staphylococcus simulans to that of Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 34, 1702.[ISI][Medline]
28 . Kloos, W. (1997). Modern concepts of species. In The Staphylococci in Human Disease, (Crossley, K. B. & Archer, G. L., Eds), pp. 1147. Churchill Livingstone Inc., New York.
29 . Kobayashi, N., Taniguchi, K., Kojima, K., Urasawa, S., Uehara, N., Omizu, Y. et al. (1996). Genomic diversity of mec regulator genes in methicillin-resistant Staphylococcus aureus and Staphylococcus epidermidis. Epidemiology and Infection 117, 28995.[ISI][Medline]
30 . Hürlimann-Dalel, R. L., Ryffel, C., Kayser, F. H. & Berger-Bächi, B. (1992). Survey of the methicillin-resistance associated genes mecA, mecR1mecI, and femAfemB in clinical isolates of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 36, 261721.[Abstract]
31 . Kuwahara-Arai, K., Kondo, N., Hori, S., Tateda-Suzuki, E. & Hiramatsu, K. (1996). Suppression of methicillin resistance in a mecA-containing pre-methicillin-resistant Staphylococcus aureus is caused by the mecI-mediated repression of PBP2' production. Antimicrobial Agents and Chemotherapy 40, 26805.[Abstract]
32 . Ryffel, C., Kayser, F. H. & Berger-Bächi, B. (1992). Correlation between regulation of mecA transcription and expression of methicillin resistance in staphylococci. Antimicrobial Agents and Chemotherapy 36, 2531.[Abstract]
33 . Musser, J. M. & Kapur, V. (1992). Clonal analysis of methicillin-resistant Staphylococcus aureus strains from intercontinental sources: association of the mec gene with divergent phylogenetic lineages implies dissemination by horizontal transfer and recombination. Journal of Clinical Microbiology 30, 205863.[Abstract]
34 . Berger-Bächi, B., Strässle, A., Gustafson, J. E. & Kayser, F. H. (1992). Mapping and characterization of multiple chromosomal factors involved in methicillin resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 36, 136773.[Abstract]
35 . Berger-Bächi, B. (1997). Resistance not mediated by ß-lactamase (methicillin resistance). In The Staphylococci in Human Disease, (Crossley, K. B. & Archer, G. L., Eds), pp. 15874. Churchill Livingstone Inc., New York.
36 . De Lencastre, H., Sa Figueiredo, A. M., Urban, C., Rahal, J. & Tomasz, A. (1991). Multiple mechanisms of methicillin resistance and improved methods for detection in clinical isolates of Staphylococcus aureus. Antimicrobial Agents and Chemotherapy 35, 6329.[ISI][Medline]
Received 5 June 2000; returned 4 September 2000; revised 17 October 2000; accepted 20 November 2000