1 School of Animal and Microbial Sciences, University of Reading, Whiteknights PO Box 228, Reading RG6 6AJ; 2 Enteric, Respiratory and Neurological Virus Laboratory, Health Protection Agency, Central Public Health Laboratory, London, UK
Received 28 November 2003; returned 23 December 2003; revised 28 January 2004; accepted 2 February 2004
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Methods: Plaque reduction assays and neuraminidase enzyme inhibition assays were used to assess susceptibility to zanamivir. Receptor binding properties of the viruses were characterized by differential agglutination of red blood cells (RBCs) from different species. Sequence analysis of the haemagglutinin (HA) and neuraminidase (NA) genes was carried out.
Results: Characterization of a panel of H3N2 clinical isolates from 1968 to 2000 showed a gradual decrease in agglutination of chicken and guinea pig RBCs over time, although all isolates could agglutinate turkey RBCs equally. Sequence analysis of the HA and NA genes identified mutations in conserved residues of the HA1 receptor binding site, in particular Leu-226 Ile-226/Val-226, and modification of potential glycosylation site motifs. This may be indicative of changes in virus binding to sialic acid (SA) receptors in recent years. Although recent isolates had reduced susceptibility to zanamivir in MDCK cell based plaque reduction assays, no difference was found in an NA enzyme-inhibition assay. Assays with recombinant isogenic viruses showed that the recent HA, but not the NA, conferred reduced susceptibility to zanamivir.
Conclusion: This study demonstrates that recent clinical isolates of influenza A H3N2 virus no longer agglutinate chicken RBCs, but despite significant receptor binding changes as a result of changes in HA, there was little variation in sensitivity of the NA to zanamivir.
Keywords: haemagglutinin, neuraminidase, reverse genetics, sialic acid, zanamivir
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The H3N2 subtype of influenza A has circulated widely in the human population since its introduction from an avian source in 1968. Adaptation of a virus in a new host may produce further changes. The factors that govern the adaptation of influenza A to humans are not completely understood although the virus receptor specificity is considered to be important.
Influenza viruses gain entry into the host cell via binding of their HA protein to SA receptors. Human viruses preferentially bind SA linked to galactose by 2,6 linkages (SA
2,6Gal) whereas avian influenza viruses preferentially bind SA
2,3Gal.3,4 This difference reflects the predominant receptor in the respective hosts, for example, the ciliated epithelial cells of the human respiratory tract carry an abundance of SA
2,6Gal.5,6
The influenza receptor binding site (RBS) is a pocket of conserved amino acids on the globular head of the haemagglutinin (HA) surrounded by varying antigenic regions.7 Changes in HA receptor binding are concomitant with changes in the viral NA because of the requirement for a functional balance between receptor binding activity and the receptor destroying activity of NA.811
Receptor binding specificity of influenza viruses can be analysed by agglutination of RBCs from different animal species.12 The A/Aichi/2/68 (H3N2) strain of human influenza virus, which preferentially binds SA2,6Gal,3 agglutinates chicken RBCs but not RBCs from horses. Recent clinical isolates of influenza A H1N1 and H3N2 no longer bind chicken RBCs,1316 and this may reflect an underlying change in receptor binding properties.
Alteration in receptor binding may lead to virus variants altered in susceptibility to NI drugs. Viruses generated by passage in cell culture in the presence of NIs often contain mutations mapping to the RBS of the HA gene.17 The reduction in affinity of HA binding to SA alleviates the requirement for a functional NA in vitro. We investigated the relationship between natural evolution in humans and antiviral susceptibility to NI drugs. Specifically we asked whether the natural evolution of HA in H3N2 viruses has any impact on antiviral susceptibility of natural isolates. We have assembled a panel of H3N2 viruses representative of the virus evolution in the population during circulation over more than three decades from 1969 to 2000 and examined the relationship between receptor binding properties of the viruses and NI susceptibility.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Influenza A H3N2 human clinical isolates (England isolates) from 1969 to 2000 were obtained from archives at the Central Public Health Laboratory (CPHL), Colindale, London, UK. A panel of viruses was selected from archived strains that had been passaged in cell culture from the original respiratory sample before storage at 80°C. Viruses selected to form a panel were amplified by 23 passages in MDCK cells, and infectious supernatants were stored at 80°C.
MDCK cells were cultured in Dulbeccos modified Eagles medium (MEM) supplemented with 4500 mg/L glucose, pyridoxine HCl and 10% FBS (Invitrogen, Paisley, UK). Virus stocks were grown in the presence of TPCK-treated trypsin (Worthington, NJ, USA) added to media at a final concentration of 1 µg/mL.
NA inhibitors
Zanamivir (4-guanidino-Neu5Ac2en) was provided by Dr Margaret Tisdale of GlaxoSmithKline (Stevenage, UK).
Virus concentration
Tissue culture supernatants were purified by centrifugation at 25 000 r.p.m. in a Beckman SW28 rotor through a cushion of 30% sucrose in NTE (100 mM NaCl; 10 mM TrisHCl, pH 7.8; 1 mM EDTA) and viral pellets resuspended in PBS.
Plaque reduction assay
Confluent monolayers of MDCK cells were infected with virus (200 pfu). After 1 h of adsorption, the virus inoculum was removed and the cells overlaid with supplemented MEM containing trypsin (1 µg/mL) and 10-fold dilutions of zanamivir (0.00110 µg/mL). The cells were fixed and stained after 4 days incubation at 37°C. The IC50 value is defined as the concentration of zanamivir (µg/mL) at which the plaque number is reduced by 50%.
NA enzyme-inhibition assay
Fluorometric analysis based on previously described methods18,19 was used to determine inhibition of NA activity in the presence of zanamivir. NA activity of serial two-fold dilutions of purified virus diluted to a standard titre of 64 haemagglutinating units (HAU) (turkey RBCs) was determined. A suitable dilution of virus falling in the linear part of the NA activity curve was chosen for NA inhibition assays. NA inhibition was evaluated in the presence of serial four-fold dilutions of zanamivir (final drug concentration in the assay ranged between 0.0038 and 1000 nM) mixed with an equal volume of virus diluted in enzyme buffer (32.5 mM MES pH 6.5, 10 mM CaCl2) in a black 96-well plate (Greiner Bio-One, Frickenhausen, Germany) incubated at 37°C for 30 min. Substrate mix containing 4-methyl-umbelliferyl-N-acetyl neuraminic acid (MUNANA) (SigmaAldrich, Dorset, UK) at a final concentration of 100 µM was then added and incubated at 37°C for 1 h. The reaction was stopped by adding 150 µL 0.1 M NaOH in 80% ethanol, and the plate read immediately at an excitation wavelength of 360 nm and an emission wavelength of 465 nm on a GENios plate reader (Tecan, UK). The IC50 value reflects the concentration of drug that reduces the NA activity by 50%.
PCR amplification and sequencing of the HA and NA genes
Viral RNA was extracted from 150 µL of tissue culture fluid using guanidinium thiocyanate (Severn Biotech Ltd, Kidderminster, UK).20 cDNA synthesis was carried out using random hexamers as described previously.21 PCR amplification and sequencing of the HA1 region of HA used primers described previously.22 PCR amplification and sequencing of the coding region of NA genes was carried out with nested primer sets (primers sequences available on request). Sequencing was carried out on a Applied Biosystems 373A automated DNA sequencer using cycle sequencing dye-terminator chemistry (Applied Biosystems, Foster City, CA, USA).
Haemagglutination assays
Haemagglutination assays were carried out in V-bottomed microtitre plates using 50 µL of 0.5% suspensions of turkey, chicken or guinea pig RBCs in PBS (Harlan Sera-Lab Ltd, Loughborough, UK) added to 50 µL virus serially diluted in PBS. Virus titres were initially standardized to 32 HAU with turkey RBCs and this standard titre was tested with different species of RBCs. Horse RBCs were used at 1% with 0.5% BSA. Haemagglutination elution assays were carried out at 37°C.
PCR amplification and cloning of A/England/26/99 HA and NA
cDNA synthesis was carried out using universal primer RT F (AGCAAAAGCAGG). HA was amplified using PCR primers H3 F (CTGCAGGCTCTTCGACCCAGCAAAAGCAGGGGATAATTC) and H3 R (CTGCAGGCTCTTCTTATTAGTAGAAACAAGGGTGTTTT). NA was amplified using PCR primers N2 F (TATTGGCGT- CTCACCCAGCAAAAGCAGGAGT) and N2 R (ATATGCCGTCTC TTATTAGTAGAAACAAGGAGTTTTTT). All primer sequences are given in a 5'3' direction. Viral genes were cloned into the SapI or BsmBI site of pPolI-RT vector kindly supplied by Dr Thomas Zurcher, GlaxoSmithKline.
Reverse genetics
Recombinant viruses of A/England/26/99 and A/Victoria/3/75 were generated by plasmid-based reverse genetics as previously described.23,24 Wild-type recombinant A/Victoria/3/75 virus was recovered on day 4 of the rescue. Recombinant viruses containing mixtures of A/Victoria/3/75 and A/England/26/99 segments were recovered after 68 days, which probably reflected the impaired growth characteristics of these recombinants. Full-length sequence of the RNA segments 4 and 6 for all recombinant viruses was obtained following RT-PCR in order to verify that no additional sequences changes had been selected during virus recovery.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Haemagglutination of RBCs from different species
Isolates were tested in haemagglutination assays with RBCs from different animal species. Viruses isolated from 1990 onwards had a decreasing ability to agglutinate chicken RBCs (Table 1) which was unchanged with the inclusion of the NI drug zanamivir (10 µg/mL) in the assay, indicating that the reduced chicken RBC agglutination was unlikely to be accounted for by increases in receptor destroying (NA) activity (data not shown). Significantly, the most recent isolates (viruses isolated in the 19981999 season onwards) were completely unable to haemagglutinate chicken RBCs. Since turkey RBCs have a higher level of SA2,6Gal than SA
2,3Gal, and the amount of SA
2,6Gal is higher on turkey RBCs than on chicken RBCs, the data indicate a shift towards selective binding of SA
2,6Gal for recent isolates.
|
Changes in receptor specificity may impact on NI susceptibility. Plaque reduction assays were used to assess the susceptibility of viruses to zanamivir in MDCK cell culture. Control viruses known to be susceptible and resistant to zanamivir had IC50 values of 0.1 and 10 µg/mL, respectively in this assay. The recent isolate A/England/26/99 had an IC50 value 100-fold higher than that of an older isolate A/England/327/90 (1.0 and 0.01 µg/mL, respectively) (Table 1). The oldest H3N2 strain A/Aichi/2/68 is also highly susceptible to zanamivir with an IC50 of 0.014 µM (0.005 µg/mL) in plaque reduction assays.26 Plaque size was generally reduced before plaque number and, with the exception of A/England/26/99 where there was no difference, IC50 values based on reduction in plaque size were 10-fold lower (data not shown).
Inhibition of NA enzyme activity with zanamivir
We investigated the sensitivity of the NA of each virus in the panel to zanamivir in a fluorometric NA enzyme inhibition assay. As a control, recombinant viruses known to be either susceptible or resistant to zanamivir in MUNANA NA enzyme inhibition assays were used (T. Zurcher, personal communication) and gave values of 0.36 and 101.31 nM, respectively. IC50 values ranged between 0.44 and 2.06 nM for the clinical H3N2 viruses (Table 1). Recent clinical isolates were as susceptible to inhibition by the drug as the oldest isolate A/England/878/69. The IC50 values were similar in range, although slightly lower in the case of recent isolates, to previously published values for susceptible clinical isolates.19,27
The NA activities of these viruses varied throughout the panel to the extent that the NA activity of A/Eng/288/90 was too low to determine an IC50 value in the assay used.
Analysis of HA gene sequences of H3N2 viruses isolated in UK 19692000
The HA and NA genes of each isolate were sequenced. Analysis of HA1 showed that some mutations which arose in conserved residues in the HA receptor binding site have become fixed in more recent isolates. Mutations were found in a key receptor binding site residue, amino acid 226. Until the mid-1990s, human H3N2 viruses contained Leu-226. However, all recent isolates had a mutation to either isoleucine or valine that could potentially affect binding to SA receptors. The change Ile-226 was first observed as early as 1994 and became increasingly frequent during the 19941995 influenza season,28 although the first isolate in the panel with this mutation was isolated during the 19951996 season in the UK (A/England/492/95). The mutation to Val-226 appeared during the 19941995 influenza season and became increasingly common the following year.28 Similarly, this mutation is not seen in the panel of UK isolates until the following season (19961997). Although Val-226 became predominant in the following years, viruses with Ile-226 still circulated although the incidence of these was much lower.
In addition, mutations were observed in several other residues known to be important in the interaction of HA with its SA receptor. Several amino acid codons in the HA1 receptor binding site at positions 135, 138, 190, 194 and 226, are known to be under positive selection to change and mutations at these positions give a selective advantage to the virus.29 Viruses across our panel had several different amino acid mutations at these positions, with the exception of 194 which was conserved throughout.
The viral HA protein contains N-glycans attached both to the stem region and the globular head of the protein near the receptor binding site. Glycosylation of the viral HA is known to affect affinity of binding to SA receptors. Novel potential glycosylation sites were observed in the HA sequence of recent isolates as a result of changes at residues 124, 126, 133, 144 and 248. In particular, the changes at positions 124, 133 and 144 were first observed in recent isolates (A/England/26/99) concurrent with the complete loss of binding to chicken RBC (Table 1). With the exception of the potential glycosylation site motif created at position 144, which was only observed in A/England/ 26/99, these sites were conserved in viruses from the following season that were represented on the panel.
The NA catalytic region was mostly conserved across the panel of England isolates and no mutations associated with known NI resistance genotypes were observed in any of the clinical isolates.
Zanamivir susceptibility of recombinant isogenic viruses generated by reverse genetics
To determine the basis for the decreased susceptibility to zanamivir displayed by recent H3N2 viruses, one isolate, A/England/26/99, was selected for further analysis. A/England/26/99 has mutations in the receptor-binding site representative of recent H3N2 viruses, and also contains novel potential glycosylation site motifs that were conserved in later isolates. In addition, it was the first virus in the panel to completely lose the ability to agglutinate chicken RBC (Table 1).
To separate the contribution of the HA and NA of A/England/ 26/99 to the apparent decreased susceptibility to zanamivir in plaque reduction assays, the HA and NA genes were cloned and rescued as single and double gene reassortants in an isogenic genetic background using the influenza A plasmid-based reverse genetics system based on A/Victoria/3/75 (also H3N2). The recombinant viruses displayed characteristic plaque sizes in MDCK cells that were defined by the specific HA carried by the virus. Viruses containing A/England 26/99 HA typically have small, turbid plaques, whereas viruses containing A/Victoria/3/75 HA have large, well-defined plaques irrespective of the paired NA (Figure 1a, c, e, g).
|
The addition of exogenous bacterial NA (1 mU/mL) to the overlay of plaque assays of 26/99 HA/NA and 26/99 HA-Vic/75 reduced the titre and plaque size of these viruses compared to plaque assays with no additional NA, indicating that NA was not limiting (data not shown). This supports the hypothesis that the small plaque phenotype of these viruses in MDCK cells was due to reduced HA receptor binding.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Experiments with recombinant isogenic viruses generated by reverse genetics demonstrated that decreased susceptibility observed in plaque reduction assays was conferred by the HA of the recent H3N2 viruses which has reduced affinity for receptors on MDCK cells. This is in agreement with the findings of a previous study where reduced susceptibility of viruses to zanamivir in tissue culture correlated with the possession of an HA that can be readily released from SA receptors with reduced dependence on NA.32 The molecular determinants of this change in recent H3N2 viruses are likely to be the result of cumulative changes in the HA during evolution in the human host in the last three decades. Indeed sequence analysis of the HA and NA genes of each virus in the panel identified changes in potential glycosylation site motifs and key receptor binding site residues in HA1, in particular at position 226 which has been shown previously to be important in determining specificity of binding to SA2,6Gal or SA
2,3Gal.4 Similar changes at this position were identified in published sequences and have been observed by others.15,16 During the 19951996 influenza A season in the UK, two antigenically similar strains co-circulated, one of which had the amino acid change Ile-226 in the receptor binding site.33 The predominant circulating strain in following seasons had the Ile-226 amino acid change suggesting that this mutation in the receptor binding site was advantageous to the virus. The importance of the mutation E190D in the reduced virus binding to chicken RBC has been shown,14 and we also found this mutation in isolates from 1993 onwards. Virus A/England/26/99 has three mutations in the HA1 gene that generate new potential glycosylation site motifs (G124S; D133N; V144N) that are not seen in isolates before this time and two of which become fixed in viruses from later seasons. Additional glycosylation near the HA RBS may affect affinity of SA binding by steric hindrance of the receptorSA interaction. Interestingly, an isolate from the following season A/England/919/99 has a coding change (K93N) that results in a novel potential glycosylation site in the NA gene. Changes in HA resulting in reduced affinity for SA, as suggested by the reduced RBC agglutination, may be driving changes in the NA gene to maintain the balance between the two proteins that is crucial for the viability of the virus. Similarly A/England/356/96, which has an unusual mutation in the NA gene (D198N), also contains a new mutation (K135T) in a receptor binding site residue in HA1 that encodes a novel potential glycosylation site. These mutations in the HA and NA proteins may provide complementary effects that maintain the balance of functions in the virus. In future studies, we will dissect the functional importance of the receptor binding site mutations and potential glycosylation site motif changes that we have observed, by introducing them singly into recombinant viruses generated by reverse genetics.
In this study, we have observed that recent human influenza A viruses displayed markedly reduced agglutination of RBC species with either less SA2,6Gal or less SA overall. These observations could be explained by a general reduction in affinity for SA and/or by a change in affinity for specifically linked SA residues. These two possibilities might be better distinguished by measuring HA affinity for synthetic receptor analogues displaying either
2,3- or
2,6-linked SA such as those used in recent studies.34 If the changes seen represent an adaptation of the virus to replication in humans, then the question is what is the selective pressure driving the virus towards this receptor binding change? Human influenza viruses infect ciliated epithelial cells of the human respiratory tract, which display SA
2,6Gal.5,6 However, human respiratory mucins present in the mucosal layer of the airway carry SA
2,3Gal and the presence of these highly glycosylated inhibitory proteins may be driving evolution of human viruses towards a decreased affinity for SA
2,3Gal.35
A reduction in the affinity of HA for its SA receptor should produce a corresponding decrease in NA activity due to the necessity of balancing HA and NA activities for virus fitness.9,11 Therefore, we wanted to establish whether the NA activities of the viruses in the panel had changed over time to match HA. NA elution assays demonstrated that the earliest isolate A/England/878/69 had much stronger NA activity compared to more recent isolates, but there were few differences between the later isolates using this relatively insensitive method (data not shown). Therefore, we attempted to determine relative specific NA activities for the virus panel by standardizing input NA in an ELISA and determining NA activity in a fluorometric assay.36,37 The virus panel was tested by ELISA using monoclonal antibodies or fetuin to capture purified virus and then detection with a polyclonal anti-N2 NA antibody. However, as a result of antigenic drift, we were not able to accurately quantify NA by this method as the antibodies available did not recognize the drifted NAs equally.
Our observations demonstrate the importance of using substrates and reagents with appropriate receptors both in isolation and characterization of natural influenza A isolates. This study clearly indicates that the use of chicken RBC in haemagglutination assays or HI tests with recent clinical isolates is no longer appropriate. Turkey RBCs are recommended for such tests as they carry higher levels of the appropriate SA receptor.
Similarly, although the importance of using MDCK isolates rather than egg-grown isolates in the study has already been stressed, the use of primary human airway epithelial cells and the development of cell lines bearing increased levels of SA2,6Gal will be more appropriate for the study of human isolates.38 This is particularly pertinent for the testing of isolates for susceptibility to NIs, as plaque reduction assays in MDCK cells have been shown to produce misleading data because of the presence of both SA
2,3Gal and SA
2,6Gal on these cells.26,39
In conclusion, the recent influenza A H3N2 viruses isolated in the UK showed little change in the level of sensitivity of NA to zanamivir, although changes in HA binding to the SA receptor complicate the interpretation of cell-based drug susceptibility assays.
![]() |
Acknowledgements |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
2 . Tisdale, M. (2000). Monitoring of viral susceptibility: new challenges with the development of influenza NA inhibitors. Reviews in Medical Virology 10, 4555.[CrossRef][ISI][Medline]
3 . Rogers, G. N. & Paulson, J. C. (1983). Receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the H3 hemagglutinin based on species of origin. Virology 127, 36173.[ISI][Medline]
4 . Connor, R. J., Kawaoka, Y., Webster, R. G. et al. (1994). Receptor specificity in human, avian, and equine H2 and H3 influenza virus isolates. Virology 205, 1723.[CrossRef][ISI][Medline]
5 . Couceiro, J. N. S. S., Paulson, J. C. & Baum, L. G. (1993). Influenza virus strains selectively recognise sialyloligosaccharides on human respiratory epithelium; the role of the host cell in selection of hemagglutinin receptor specificity. Virus Research 29, 15565.[CrossRef][ISI][Medline]
6 . Baum, L. G. & Paulson, J. C. (1990). Sialyloligosaccharides of the respiratory epithelium in the selection of human influenza virus receptor specificity. Acta Histochemica 40, Suppl., 358.
7 . Weis, W., Brown, J. H., Cusack, S. et al. (1988). Structure of the influenza virus haemagglutinin complexed with its receptor, sialic acid. Nature 333, 42631.[CrossRef][ISI][Medline]
8 . Baum, L. G. & Paulson, J. C. (1991). The N2 neuraminidase of human influenza virus has acquired a substrate specificity complementary to the hemagglutinin receptor specificity. Virology 180, 105.[ISI][Medline]
9 . Kaverin, N. V., Gambaryan, A. S., Bovin, N. V. et al. (1998). Postreassortment changes in influenza A virus hemagglutinin restoring HA-NA functional match. Virology 244, 31521.[CrossRef][ISI][Medline]
10
.
Matrosovich, M., Zhou, N., Kawaoka, Y. et al. (1999). The surface glycoproteins of H5 influenza viruses isolated from humans, chickens and wild aquatic birds have distinguishable properties. Journal of Virology 73, 114655.
11
.
Wagner, R., Wolff, T., Herwig, A. et al. (2000). Interdependence of hemagglutinin glycosylation and neuraminidase as regulators of influenza virus growth: a study by reverse genetics. Journal of Virology 74, 631623.
12 . Ito, T., Suzuki, Y., Mitnaul, L. et al. (1997). Receptor specificity of influenza A viruses correlates with the agglutination of erythrocytes from different animal species. Virology 227, 4939.[CrossRef][ISI][Medline]
13 . Morishita, T., Kobayashi, S., Miyake, T. et al. (1993). Host-specific hemagglutination of influenza A (H1N1) virus. Microbiology and Immunology 37, 6615.[ISI][Medline]
14 . Nobusawa, E., Ishihara, H., Morishita, T. et al. (2000). Change in receptor-binding specificity of recent human influenza A viruses (H3N2): a single amino acid change in hemagglutinin altered its recognition of sialyloligosaccharides. Virology 278, 58796.[CrossRef][ISI][Medline]
15 . Medeiros, R., Escriou, N., Naffakh, N. et al. (2001). Hemagglutinin residues of recent human A (H3N2) influenza viruses that contribute to the inability to agglutinate chicken erythrocytes. Virology 289, 7485.[CrossRef][ISI][Medline]
16 . Abed, Y., Bourgault, A.-M., Fenton, R. J. et al. (2002). Characterization of 2 influenza A (H3N2) clinical isolates with reduced susceptibility to neuraminidase inhibitors due to mutations in the hemagglutinin gene. Journal of Infectious Diseases 186, 107480.[CrossRef][ISI][Medline]
17 . McKimm-Breschkin, J. L., Blick, T. J., Sahasrabudhe, A. et al. (1996). Generation and characterization of variants of NWS/G70C influenza virus after in vitro passage in 4-amino-Neu5Ac2en and 4-guanidino-Neu5Ac2en. Antimicrobial Agents and Chemotherapy 40, 406.[Abstract]
18 . Potier, M., Mameli, L., Belisle, M. et al. (1979). Fluorometric assay of neuraminidase with a sodium (4-methylumbelliferyl-alpha-D-N-acetylneuraminate) substrate. Analytical Biochemistry 94, 28796.[ISI][Medline]
19
.
McKimm-Breschkin, J., Trivedi, T., Hampson, A. et al. (2003). Neuraminidase sequence analysis and susceptibilities of influenza virus clinical isolates to zanamivir and oseltamivir. Antimicrobial Agents and Chemotherapy 47, 226472.
20 . Boom, R., Sol, C. J. A., Salimans, M. M. M. et al. (1990). Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 28, 495503.[ISI][Medline]
21 . Ellis, J. S., Fleming, D. M. & Zambon, M. C. (1997). Multiplex reverse transcription-PCR for surveillance of influenza A and B viruses in England and Wales in 1995 and 1996. Journal of Clinical Microbiology 35, 207682.[Abstract]
22 . Ellis, J. S., Chakraverty, P. & Clewley, J. P. (1995). Genetic and antigenic variation in the haemagglutinin of recently circulating human influenza A (H3N2) viruses in the United Kingdom. Archives of Virology 140, 18891904.[ISI][Medline]
23 . Neumann, G. & Kawaoka, Y. (1999). Genetic engineering of influenza and other negative-strand RNA viruses containing segmented genomes. Advances in Virus Research 53, 265300.[ISI][Medline]
24 . Elleman, C. & Barclay, W. S. (2004). The influenza A virus matrix protein controls virus morphology. Virology in press.
25 . Katz, J. M., Wang, M. & Webster, R. G. (1990). Direct sequencing of the HA gene of influenza (H3N2) virus in original clinical samples reveals sequence identity with mammalian cell-grown virus. Journal of Virology 64, 180811.[ISI][Medline]
26 . Woods, J. M., Bethell, R. C., Coates, J. A. V. et al. (1993). 4-Guanidino-2,4-dideoxy-2,3-dehydro-N-acetylneuraminic acid is a highly effective inhibitor both of the sialidase (neuraminidase) and of growth of a wide range of influenza A and B viruses in vitro. Antimicrobial Agents and Chemotherapy 37, 14739.[Abstract]
27
.
Gubareva, L. V., Webster, R. G. & Hayden, F. G. (2001). Comparison of the activities of zanamivir, oseltamivir, and RWJ-270201 against clinical isolates of influenza virus and neuraminidase inhibitor-resistant variants. Antimicrobial Agents and Chemotherapy 45, 34038.
28 . Macken, C., Lu, H., Goodman, J. et al. (2001). The value of a database in surveillance and vaccine selection. In Options for the Control of Influenza IV (Osterhaus, A. D. M. E., Cox, N. & Hampson, A. W., Eds), pp. 1036. Elsevier Science, Amsterdam.
29
.
Bush, R. M., Bender, C. A., Subbarao, K. et al. (1999). Predicting the evolution of human influenza A. Science 286, 19215.
30 . Zambon, M. & Hayden, F. G. (2001). Position statement: global neuraminidase inhibitor susceptibility network. Antiviral Research 49, 14756.[CrossRef][ISI][Medline]
31
.
Hayden, F. G., Osterhaus, A. D. M. E., Treanor, J. J. et al. (1997). Efficacy and safety of the neuraminidase inhibitor zanamivir in the treatment of influenza virus infections. New England Journal of Medicine 337, 87480.
32 . Baigent, S. J., Bethell, R. C. & McCauley, J. W. (1999). Genetic analysis reveals that both haemagglutinin and neuraminidase determine the sensitivity of naturally occurring avian influenza viruses to zanamivir in vitro. Virology 263, 32338.[CrossRef][ISI][Medline]
33 . Ellis, J. S., Sadler, C. J., Laidler, P. et al. (1997). Analysis of influenza A H3N2 strains isolated in England during 19951996 using polymerase chain reaction restriction. Journal of Medical Virology 51, 23441.[CrossRef][ISI][Medline]
34 . Mochalova, L., Gambaryan, A., Romanova, J. et al. (2003). Receptor-binding properties of modern human influenza viruses primarily isolated in Vero and MDCK cells and chicken embryonated eggs. Virology 313, 47380.[CrossRef][ISI][Medline]
35
.
Matrosovich, M., Tuzikov, A., Bovin, N. et al. (2000). Early alterations of the receptor-binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals. Journal of Virology 74, 850212.
36 . Bethell, R. C., Hart, G. J., Blick, T. J. et al. (1999). Biochemical methods for the characterization of influenza viruses with reduced sensitivity to 4-Guanidino-Neu5Ac2en. In Antiviral Methods and Protocols (Kinchington, D. & Schinazi, R. F., Eds), pp. 36773. Humana Press Inc., Totowa, NJ, USA.
37 . Gerentes, L., Kessler, N. & Aymard, M. (1998). A sensitive and specific ELISA immunocapture assay for rapid quantitation of influenza A/H3N2 neuraminidase protein. Journal of Virological Methods 73, 18595.[CrossRef][ISI][Medline]
38
.
Matrosovich, M., Matrosovich, T., Carr, J. et al. (2003). Overexpression of the -2,6-sialyltransferase in MDCK cells increases influenza virus sensitivity to neuraminidase inhibitors. Journal of Virology 77, 841825.
39 . Gubareva, L. V., Kaiser, L., Matrosovich, M. N. et al. (2001). Selection of influenza virus mutants in experimentally infected volunteers treated with oseltamivir. Journal of Infectious Diseases 183, 52331.[CrossRef][ISI][Medline]
|