Activation-induced expression of murine CD83 on T cells and identification of a specific CD83 ligand on murine B cells
Sven O. Cramer,
Christine Trumpfheller,
Ute Mehlhoop,
Solveig Moré,
Bernhard Fleischer and
Arne von Bonin
Bernhard-Nocht-Institute for Tropical Medicine, Bernhard-Nocht-Strasse 74, 20359 Hamburg, Germany
Correspondence to:
A. von Bonin
 |
Abstract
|
---|
Human CD83 is a cell surface protein expressed predominantly by dendritic cells (DC) and lymphoid cells. So far, there exists no information on the function and distribution of mCD83. Here we demonstrate that mCD83 is moderately expressed on resting T cells and DC, but strongly increases in its expression on T cells following activation with antigenic peptides or T cell receptor-specific mAb. When returning to the resting state, T cells down-regulate CD83 again. Ig fusion proteins which express the extracellular part of the mCD83 molecule (mCD83Ig) specifically inhibit antigen-specific T cell proliferation and IL-2 secretion in spleen cell cultures from DO11.10 T cell receptor transgenic mice. Staining of spleen cells from BALB/c, XID and µMT (B cell) knockout mice with mCD83Ig proteins reveals the presence of a CD83 ligand predominantly expressed most likely by B220+ cells since spleen cells from µMT knockout mice do not bind mCD83Ig. CD83, besides its established expression on human dendritic cells, thus, also represents a new marker molecule on activated T cells which with its specific ligand is involved in the regulation of T cell responses.
Keywords: CD83, dendritic cells, T cell activation
 |
Introduction
|
---|
Human CD83 is a 45 kDa glycoprotein which belongs to the Ig superfamily (1,2). Recently the murine cDNA of CD83 has also been cloned, displaying a high degree of conserved amino acids between mouse and man at the level of the expressed protein (3). Human CD83 consists of a single extracellular Ig-like domain, a transmembrane region and a cytoplasmic tail, 39 amino acids long, which lacks any known consensus signaling motifs. In man, CD83 is mainly expressed on the surface of CD1+, interdigitating reticulum cells present in the T cells zones of lymphoid organs and on cells of the dendritic lineage (1). Recent data attribute to dendritic cells (DC) a central role in the activation of naive T lymphocytes and in the generation of primary T cell responses (4,5). Recent experiments revealed that CD83 on human immature DC is mainly expressed intracellularly and upon maturation of the DC can also be detected on the cell surface (6). CD83, thus, represents a typical surface maturation marker on human DC (7).
To achieve complete activation (8), T cells require a second co-stimulatory signal (9), which can be provided by ligands expressed on the cell surface of professional antigen-presenting cells including DC and B cells. Due to its expression pattern on antigen-presenting cells in T cell-rich areas, hCD83 and its potential ligand might also directly contribute to the activation of T cells. Presently, no data are available, however, that address whether CD83 has a specific ligand on hematopoetic cells and how CD83 or its ligand may influence immune responses. Here we used purified CD83Ig fusion proteins and an antiserum specific for mCD83 to analyze the expression pattern and kinetics as well as a possible immunological function of CD83 and its putative ligand in cultures containing spleen cells from DO11.10 TCR transgenic mice.
 |
Methods
|
---|
Cell lines and reagents
All cell lines were maintained in RPMI medium (Gibco/BRL, Eggenstein, Germany) supplemented with gentamicin, glutamine and 10% FCS. A20/7 is a H-2d B-cell line and J774 is a monocytic cell line. CD83-expressing transfectants were generated by electroporation of 20 µg pFM91-CD83 vector, containing the complete mCD83 cDNA, into 1x107 TCR 58
ß T cells (10), as described earlier (11). Neomycin-resistant clones were expanded and analyzed by flow cytometry using a FACScan (Becton Dickinson, Heidelberg, Germany).
For proliferation assays, spleen cells (2x105/well) from 6- to 8-week-old, homozygous DO11.10tg [specific for chicken ovalbumin (OVA)323339 peptide in the context of H2-Ad] mice were cultured in 96-well microtiter plates with the indicated, titrated amounts of synthetic, HPLC-purified, chicken OVA323339 peptide in the presence or the absence of mCD83Ig fusion proteins, hCD83Ig, human B7Ig fusion proteins or purified human Ig at a final concentration of 40 µg/ml. On day 4 of culture 100 µl of each well was removed for IL-2 quantification and the remaining 100 µl was pulsed with [3H]thymidine (0.5 µCi/ml). IL-2 content in the cultures was assessed by [3H]thymidine uptake of the IL-2-dependent cell line CTLL-2 (5x103/well) (12) or by performing an IL-2-specific ELISA. To generate mCD83Ig fusion proteins, mRNA from in vitro cultured (10 ng/ml IL-4 and 10 ng/ml granulocyte macrophage colony stimulating factor) bone marrow-derived dendritic cells (day 6 of culture) was reverse transcribed using an oligo(dT) primer. The extracellular part of CD83 was amplified with the CD83-specific primer (GATCGATCAAGCTTTCCGCCATGTCGCAAGGCCTCCAGCTCCT, containing a HindIII site, and GATCGATCGGATCCGCCCTGTACTTCCTGAAAGTTGACTC, contain- ing a BamHI site). The resulting CD83 cDNA fragment was cloned into the HindIIIBamHI digested plasmid pcDNA1.1/Amp-hIg, 5' of a cDNA encoding for the Fc part of hIgG1. The resulting vector was sequenced and vectors containing the correct mCD83Ig sequence were transfected into COS-1 cells (13). After 14 days, supernatants were collected from transfected COS-1 cells and applied to Protein GSepharose columns. Bound mCD83Ig proteins were eluted with Imidazole, dialyzed against PBS and the protein content was determined using a Bradford assay (Pierce, Rockford, IL). Purity and integrity of mCD83Ig fusion proteins were analyzed by silver staining and Western blotting. The CD83-specific antiserum was obtained by immunizing rabbits with a keyhole limpet hemocyanin-coupled CD83-specific peptide corresponding to amino acid sequence 1731 of mCD83.
Staining procedures
For FACS staining, Fc receptors of 3x105 of the indicated cells were blocked with 10 µg of purified hIg and subsequently incubated (15 min, 4°C) with 1:25 to 1:50 dilution of the anti-mCD83-specific antiserum or 1:25 to 1:50 dilution preimmune serum from the same animal. After washing, Cyt2-labeled donkey anti-rabbit Ig (0.5 µg/sample; Dianova, Hamburg, Germany) was added for 10 min at 4°C. Following washing, samples were subsequently stained with phycoerythrin (PE)-conjugated anti-CD4-specific mAb (Caltag, San Francisco, CA) or PE-conjugated anti-B220-specific mAb (Caltag) for 10 min at 4°C. Cells were fixed and subsequently analyzed in a FACScan (Becton Dickinson).
 |
Results and discussion
|
---|
So far nothing is known about the function and cellular distribution of mCD83. Therefore we analyzed the expression pattern of CD83+ cells by using a CD83 peptide-specific antiserum, since no mAb are available. To demonstrate the specificity of the CD83 antiserum we used CD83 cDNA transfected cell lines which clearly stain with the immune but not with the preimmune serum from CD83 peptide-immunized rabbits (Fig. 1A
). Moreover, the CD83-specific antiserum binds to mCD83Ig in Western blotting but not to hCD83Ig or hCTLA-4 fusion proteins (Fig. 1B
). Flow cytometry analysis further revealed the expression of CD83 on the surface of the monocytic cell line J774 as well as on bone marrow-derived DC. Cell surface expressed CD83 in the human system was described as a marker for mature dendritic cells (7). Under our culture conditions used to generate bone marrow-derived DC, we could also observe a variable induction of mCD83 surface expression following addition of lipopolysaccharide (data not shown), a typical method to induce maturation of DC (14).
To analyze the expression kinetics of CD83 on T cells, we used spleen cell cultures from TCR-transgenic DO11.10 mice expressing a TCR specific for the OVA323339 peptide in the context of H2-Ad. As shown in Fig. 2
, parallel to the activation with antigenic OVA323339 peptide or TCR-specific mAb, the expression of CD83 on the surface of CD4+ T cells increases, reaching a high CD83 expression when the T cells proliferate and start to secrete IL-2 on day 3 of culture. After 7 days of culture, CD83 surface expression decreases, reaching background levels on day 9 again (data not shown). Cultures containing no additional supplements showed no viable CD4+ T cells in the preset FSC/SSC region during FACS analysis and could therefore not be analyzed on day 7.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 2. CD83 expression on activated DO11.10tg-derived CD4+ T cells. Spleen cells (2x105/well) were incubated in round-bottom 96-well microtiter plates in medium containing 500 ng/ml OVA323339 peptide (`OVA323339') or in cultures containing 1 µg/ml anti-CD3-specific mAb (`anti-TCR', clone 145.2C11). For FACS staining, 2x105 cultured spleen cells were labeled with a 1:50 dilution of the CD83 immune serum. Filled peaks show the staining (mean fluorescence-1 intensity) of 500010,000 analyzed CD4+ cells obtained with the CD83-specific antiserum, whereas the open peaks represent the staining background of cells cultured under the same conditions but which were incubated with a 1:50 dilution of the preimmune serum. Cells were first gated on viable cells in the forward/sideward scatter and in a second region on CD4+ cells on day 3 and 7 of culture. Cells were analyzed in a FACScan (Becton Dickinson). On day 7 almost no cells were left in the chosen forward scatter gate in cultures containing IL-2 without antigenic peptide, therefore only the data derived from OVA peptide and anti-TCR mAb containing cultures are shown.
|
|
To see whether CD83 (and a putative CD83 ligand) is involved in the activation of T cells, we added mCD83Ig fusion molecules to cultures containing freshly isolated spleen cells from DO11.10 TCR transgenic mice. mCD83Ig inhibited proliferation (Fig. 3A
) as well as IL-2 production (Table 1
). Especially at lower OVA323339 peptide concentrations there is a significant reduction of IL-2 secretion in mCD83Ig-treated cultures. Although mCD83Ig fusion proteins are not able to completely reduce the proliferation or IL-2 secretion, we take our results as a first hint that CD83 and its ligand may be involved in the process to fully activate T cells. Purified hIg (not shown) as well as hB7Ig fusion protein used as controls did not inhibit the antigen-specific proliferation and IL-2 secretion. To rule out that misfolding of hB7Ig or hCTLA-4Ig fusion proteins is responsible for the observed lack of inhibition in T cell proliferation assays, we tested the individual Ig fusion proteins on control cell lines. As shown in Fig. 3
(B), hB7Ig binds specifically to Jurkat T cells, whereas hCTLA-4Ig fusion proteins specifically stain the B cell line A20. Taken together, these data argue for a correct folding of the employed hB7Ig and hCTLA-4Ig fusion proteins.


View larger version (63K):
[in this window]
[in a new window]
|
Fig. 3. mCD83Ig fusion proteins inhibit proliferation. (A) Spleen cells (2x105) from DO11.10tg mice were incubated (triplicates) with titrated amounts of OVA323339 synthetic peptide in RPMI medium (`medium'), together with 40 µg/ml mCD83Ig (`mCD83Ig') or hB7Ig (`hB7Ig') fusion proteins. On day 4 of culture proliferation was determined by [3H]thymidine uptake (c.p.m.). Shown is a typical representative of four independent experiments. Error bars indicate SD of triplicate values. The unspecific background of cultures containing no peptide was <500 c.p.m. (B) Binding of Ig fusion proteins to murine A20 B cells and human Jurkat T cells. A20 and Jurkat cells (2x105) were incubated with the indicated Ig fusion proteins (1 µg/ml) for 30 min at 4°C, and were subsequently stained with an anti-human IgG1-specific, FITC-labeled mAb (1:50 dilution) and analyzed in the FACScan (open peaks). Controls were incubated without any fusion proteins (filled peaks). Shown is the relative fluorescence intensity (x-axis) versus the mean cell number (y-axis).
|
|
Since the inhibition of T cell activation indicates binding to a specific ligand for mCD83, which is not present on long-term cultured A20 or Jurkat cells (Fig. 3B
) nor on J774 (murine monocytic cell line), 3DO4, DO11.10 (OVA-specific T cell hybridomas) and human Raji B cells (data not shown), we analyzed B220 or CD4 and mCD83Ig double-stained spleen cells in flow cytometry analysis. As shown in Fig. 4
, mCD83Ig (and hCTLA-4Ig as a positive control) bound specifically to a B220+ cell population but not to CD4+ T cells. In contrast, hB7Ig proteins did not stain B220+ B cells. CD11b+ cells showed a high unspecific background staining and complexed hCTLA-4Ig, hB7Ig and mCD83Ig molecules with a comparable affinity (data not shown). B cells from XID mice, which lack B1 B cells, nevertheless displayed a clear staining with mCD83Ig and hCTLA-4Ig, but not with hB7Ig molecules. In contrast, spleen cells from µMT (B cell) knockout mice, which are completely deficient for peripheral B cells, were negative for mCD83Ig and hCTLA-4Ig fusion protein binding cells. Thus, the specific ligand for the mCD83 molecule is expressed predominantly on a subpopulation of splenic B cells which do not belong to the class of B1 B cells.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 4. mCD83Ig fusion proteins bind to B220+ spleen cells. Spleen cells (2x105) from BALB/c, XID or µMT knockout mice were stained with the indicated Ig fusion proteins (1 µg/ml). Control (`neg.') were incubated without any Ig fusion protein. The diagrams show the mean fluorescence-1 intensity of cells stained with the indicated fusion protein (FITC) (x-axis) versus the mean fluorescence-2 intensity (PE) [y-axis, B220 (A) or CD4 (B)] of 10,000 (BALB/c and µMT/) and 20,000 (XID) analyzed cells.
|
|
In this study we analyzed a possible immunological function of CD83 as well as of a so far putative CD83 ligand. Using an antiserum specific for the mCD83 molecule as well as employing a panel of Ig fusion proteins we could show for the first time the cellular distribution and regulation of the mCD83 molecule and the involvement of a CD83 ligand which is dominantly expressed on B220+ B cells. Because of its expression kinetics and its cellular distribution, CD83 and its ligand apparently play an important role in the antigen-specific activation of T cells. Since B cells seem to represent the major cell pool of CD83 ligand-positive cells, it will be interesting to learn how these different cell types interact and how CD83-dependent interactions modulate the immune response. Due to our in vitro experiments one could speculate that the interaction of CD83 and its putative ligand induces signaling cascades as already known T cell-expressed co-receptors like CD2 or CD28. The lack of conventional signaling motifs in the cytoplasmic tail of CD83, however, makes it unlikely that CD83 itself is transducing T cell stimulatory signals but rather that the CD83 ligand is triggered by binding of the CD83 molecule and in consequence these signaling events lead to the modulation of a CD4+ T cell response. In vivo, CD83 might be also involved in directing or `homing' activated T cells to immune competent organs like the spleen or lymph nodes. The frequently observed localization of mCD83Ig binding cells in close contact to blood vessels (unpublished observations) supports this idea and makes it promising to look further in this direction. In this respect, the cloning and molecular characterization of the specific CD83 ligand is a major focus of ongoing experiments. Taken together our data reveal an important immunological function of the CD83 molecule having direct consequences for the stimulation of CD4+ T cells. In this respect the usage of gene manipulated animals might provide new insights for the role of CD83 also during T cell development, since in humans, CD83 is also expressed on cells in the thymic epithelium (1).
 |
Abbreviations
|
---|
DC dendritic cell |
DO11.10tg DO11.10 TCR transgenic mice |
h/mCD83Ig human/mouse CD83Ig fusion protein |
PE phycoerythrin |
OVA ovalbumin |
 |
Notes
|
---|
Published data contain the main parts of S. C.'s PhD thesis
Transmitting editor: T. Hünig
Received 29 February 2000,
accepted 30 May 2000.
 |
References
|
---|
-
Zhou, L.-J., Schwarting, R., Smith, H. M. and Tedder, T. F. 1992. A novel cell-surface molecule expressed by human interdigitating reticulum cells, Langerhans cells, and activated lymphocytes is a new member of the Ig superfamily. J. Immunol. 149:735.[Abstract/Free Full Text]
-
Engel, P. and Tedder, T. F. 1994. New CD from the B cell section of the Fifth International Workshop on Human Leukocyte Differentiation Antigens. Leuk. Lymphoma 13:61.
-
Twist, C. J., Beier, D. R., Disteche, C. M., Edelhoff, S. and Tedder, T. F. 1998. The mouse CD83 gene: structure, domain organiza- tion, and chromosome localization. Immunogenetics 48:383.[ISI][Medline]
-
Steinman, R. M. 1991. The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9:271.[ISI][Medline]
-
Cella, M., Sallusto, F. and Lanzavecchia, A. 1997. Origin, maturation and antigen presenting function of dendritic cells. Curr. Opin. Immunol. 9:10.[ISI][Medline]
-
Albert, M. L., Pearce, S. F., Francisco, L. M., Sauter, B., Roy, P., Silverstein, R. L. and Bhardwaj, N. 1998. Immature dendritic cells phagocytose apoptotic cells via alphavbeta5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med. 188:1359.[Abstract/Free Full Text]
-
Zhou, L. J. and Tedder, T. F. 1995. Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily. J. Immunol. 154:3821.[Abstract/Free Full Text]
-
Weiss, A. and Littman, D. R. 1994. Signal transduction by lymphocyte antigen receptors. Cell 76:263.[ISI][Medline]
-
Jenkins, M. K., Ashwell, J. D. and Schwartz, R. H. 1988. Allogeneic non-T spleen cells restore the responsiveness of normal T cell clones stimulated with antigen and chemically modified antigen-presenting cells. J. Immunol. 140:3324.[Abstract/Free Full Text]
-
Letourneur, F. and Malissen, B. 1989. Derivation of a T cell hybridoma variant deprived of functional T cell receptor
and ß chain transcripts reveals a nonfunctinal
-mRNA of BW5147 origin. Eur. J. Immunol. 19:2269.[ISI][Medline]
-
von Bonin, A., Plaga, S., Ruh, H., Hebbelmann, S., Pflugfelder, U., Martin, S. and Weltzien, H. U. 1996. Analysis of major histocompatibility complex class-I restricted hapten recognition by mutation of the VJ joining of T cell receptor
-chains. Eur. J. Immunol. 26:179.[ISI][Medline]
-
Grabstein, K., Eisenmann, J., Modizuki, D., Schanebeck, P., Cordon, P., Hopp, T., March, C. and Gilles, S. 1986. Purification to homogeneity of B cell stimulating factor. J. Exp. Med. 163:1405.[Abstract]
-
Ishiura, M., Hirose, S., Uchda, T., Hamada, Y., Suzuki, Y. and Okada, Y. 1982. Phage particle-mediated gene transfer to cultured mammalian cells. Mol. Cell. Biol. 2:607.[ISI]
-
Cella, M., Engering, A., Pinet, V., J., P. and Lanzavecchia, A. 1997. Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388:782.[ISI][Medline]