1 Department of Medical Microbiology and Immunology, The Bartholin Building, University of Aarhus, DK-8000 Aarhus C, 2 Department of Molecular and Structural Biology, University of Aarhus, DK-8000 Aarhus C, 3 The Fertility Clinic, Braedstrup Hospital, DK-8740 Braedstrup, 4 The Fertility Clinic, Skejby Hospital, DK-8200 Aarhus N and 5 Loke Diagnostic ApS, Science Park, Gustav Wiedsvej 10C, DK-8000 Aarhus C, Denmark
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Chlamydia trachomatis/infertility/MgPa/Mycoplasma genitalium/salpingitis
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
M. genitalium was discovered in 1981 when it was isolated from the urethra of two men with non-gonococcal urethritis (Tully et al., 1981). The exact mode of infection and pattern of diseases caused by M. genitalium still remains to be solved, but the pathogen is presumed to be sexually transmitted, and the infections often appear to be chronic and asymptomatic (Wang et al., 1997
).
Most investigations have concerned male urethritis patients but M. genitalium has also been implicated in pelvic inflammatory disease (PID). Experiments with female monkeys where M. genitalium was inoculated into the oviducts resulted in salpingitis followed by a specific antibody response (Møller et al., 1985). Furthermore, an antibody response to M. genitalium has been demonstrated in some women with PID (Møller et al., 1984
).
The most common agents of PID are Neisseria gonorrhoeae, Chlamydia trachomatis and less frequently Mycoplasma hominis (Mårdh et al., 1981). If the PID develops into salpingitis, it may cause infertility, and some studies have indicated that non-gonococcal rather than gonococcal infections of the upper genital tract are likely to result in infertility (Westrom, 1975
; Eggert-Kruse et al., 1997
). Salpingitis caused by C. trachomatis has been shown to result in occlusion of the Fallopian tubes (Møller and Mårdh, 1980
).
The implication of M. genitalium in nongonococcal PID motivated a study of the possible involvement of M. genitalium in infertility due to compromised function of the uterine tubes. In this study, 308 women with infertility were investigated by immunoblotting for antibodies to the major adhesin, MgPa of M. genitalium G37 (Hu et al., 1987).
M. genitalium is closely related to the human pathogen M. pneumoniae, and cross-reactivity between them has been observed (Lind, 1982; Lind et al., 1984
). Therefore, the patient sera were also tested for antibodies against major antigens, P1 (MgPa homologue; Taylor-Robinson et al., 1983) and P116 (Duffy et al., 1997
) of M. pneumoniae, and the results were compared with results obtained by the use of a recombinant protein specific to the C-terminal part of MgPa.
Finally, the human serum samples were investigated for seropositivity to C. trachomatis using a commercial ELISA test. GroEL, the bacterial homologue to human heat shock protein (Hsp60), of chlamydia has been shown to cause a human serological response (Wagar et al., 1990). Therefore, the infertile sera were also investigated for antibodies to GroEL of M. genitalium.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
All women were examined by hysterosalpingography (HSG), and laparoscopy with insufflation of Methylene blue was also performed unless normal passage through two normal calibrated tubes was found by HSG. Ovulation was examined by measuring s-progesterones in the luteal phase. The patients were recruited/introduced to the project when they began the first IVF treatment. The serum samples were taken in connection with the routine pregnancy test, which was performed 2 weeks after embryo transfer. Semen analysis was carried out according to WHO criteria (World Health Organization, 1992). The semen samples were collected by masturbation after at least 3 days of abstinence. Semen volume, the concentration of spermatozoa and the percentage of motile and morphologically normal spermatozoa were measured.
Based on the routine investigations described, the couples were classified into various groups according to possible cause of infertility. The serum samples were from consecutive patients attending an infertility clinic for IVF treatment. However, the patients were only selected for the project if they belonged to one of the following three diagnostic groups: (i) tubal factor infertility due to lack of passage through one or both tubes verified by laparoscopy; (ii) unexplained infertility in case of normal results of HSG, s-progesterones and semen analysis; and (iii) male factor infertility with severely reduced semen quality, i.e. <600 000 motile, morphologically normal spermatozoa after PureSperm® (Nidacon International, Gothenburg, Sweden) and indication for intracytoplasmic sperm injection (ICSI).
Culture of M. genitalium and M. pneumoniae
M. genitalium G37 (ATCC) and M. pneumoniae FH (ATCC) were cultured in 100 ml SP-4 medium (Tully et al., 1979) in TTP tissue culture flasks (MediCult, Copenhagen, Denmark) and incubated at 37°C. After 48 h growth, the medium changed colour from red to orange which indicated an exponential growth phase, and harvest was done. Mycoplasma cells attached to the bottom of the culture flask were scraped off in PBS and the cells were pelleted by centrifugation at 10000 g for 30 min. The cells were resuspended in 4 ml PBS and centrifuged in Eppendorf tubes at 20000 g for 15 min. The supernatant was removed and the pellets were stored at 70°C.
Generation of recombinant proteins
High Fidelity PCR was carried out on proteinase K-treated mycoplasmas or chlamydia Elementary Bodies (EB) using ExpandTM High Fidelity PCR System (Boehringer Mannheim). Primers to amplify groEL of Chlamydia pneumoniae were designed from the nucleotide sequence with GeneBank accession no. M69217. Nested PCR was carried out with the MgPa and P1 gene because of repetitive sequences scattered in the genomes of M. genitalium and M. pneumoniae respectively. Primers to amplify the MgPa and P1 genes were designed from the nucleotide sequences with GeneBank accession nos. M31431 and M18639 respectively.
One forward primer and two reverse primers positioned differently in the genome were designed to amplify two fragments of the C-terminal part MgPa: one fragment was used to make recombinant protein for production of a monospecific polyclonal antibody and the other to make a M. genitalium specific recombinant antigen. In addition, primers were constructed to amplify the C-terminal part of P1 and almost the entire P116 of M. pneumoniae. The positions of the primers were limited by tryptophan stop codons: Forward MgPa primer, 5'-CCTAAATCACTGTGGGATCCAACTGC-3' covering nucleotides 3323 3348; reverse MgPa primer, 5'-CACTACTATAGGAACAGTTACAATCAA-3' complementary to nucleotides 40664092 (used for production of recombinant antigen in immunoblotting), reverse MgPa primer, 5'- TTATTGTTTTACTGGAGGTTTTGGTGGGG 3' covering nucleotides 4307 4335 (used to make recombinant antigen for production of rabbit polyclonal antibodies), forward P1 primer 5'-ACGCCCCAGGACGTCGGTAACC-3' covering nucleotides 33193340, reverse P1 primer 5'-TTGGGGACCTTGACTGG-3' complementary to nucleotides 45384554, forward P116 primer 5'-ATGAAGCTTAGTGCTATTATCTCCC-3'-covering nucleotides 125, reverse P116 primer 5'-GTCAATAGGAATACCCAAGCG-3' complementary to nucleotides 2863 2883. DNA sequences were obtained from the GenBank (accession no. of P116 is Z71425). All the primers were designed with his-tags: Forward primer: 5'-GACGACGACAAGATX insert specific sequence 3', reverse primer: 5'-GAGGAGAAGCCCGGT insert specific sequence 3'.
PCR reagents were mixed in MicroAmp tubes (total volume of 25 µl); 17.25 µl double-distilled H2O, 2.5 µl, dNTP, 0.75 µl of each primer (10 pmol/µl), 2.5 µl 10xExpandTM High Fidelity buffer with 15 mmol/l MgCl2, 0.25 µl ExpandTM High Fidelity enzyme mix containing the Taq DNA polymerase and 1 µl template.
The cycling programme for each primer pair was: 94°C for 5 min, 10 cycles at 94°C for 15 s, 55°C for 30 s, 72°C for 3 min, 20 cycles at 94°C for 15 s, 55°C for 30 s, 72°C for 3 min and 5 s and 72°C for 7 min.
High Fidelity PCR products were ligated into the pET-30 Ek/LIC vector (Ligation Independent Cloning (LIC) kit; Novagene, Madison, WI, USA). The plasmids were expressed in E. coli NovaBlue Singles Competent Cells and subsequently purified by alkaline lysis (Sambrook et al., 1989). The purified plasmids were expressed in E. coli BL21(DE3) competent cells and recombinant proteins were purified using HiTrap affinity columns (Amersham Pharmacia Biotech).
Antibodies
Whole cells of M. genitalium (0.3 mg protein) were dissolved in 1 ml PBS and 1 ml Freund's incomplete adjuvant (Difco Laboratories, Detroit, MI, USA). Immunization of rabbits with M. genitalium G37, M. pneumoniae FH and M. hominis PG21 was performed as described in an earlier work (Birkelund and Andersen, 1988). The polyclonal rabbit serum was denoted PabG37, PabFH and PabPG21 respectively.
Rabbit monospecific polyclonal antibodies were made against the recombinant proteins of MgPa, P1, P116 and chlamydia GroEL. The rabbits were immunized by intramuscular injections of 50 µg fusion protein emulsified in 1 ml Freund's incomplete adjuvant once a week for 3 weeks following a break of 2 weeks. Then, intravenous injections were carried out once a week for 3 weeks and after another 2 weeks the rabbits were killed by exsanguination, and the sera were stored at 20°C. The sera were designated PabMgPa, PabP1, PabP116 and PabGroEL respectively.
Immunoblotting
A 100 µg sample of M. genitalium protein (whole cells) or 50 µg fusion proteins were dissolved in 150 µl SDS sample buffer (62.5 mmol/l TrisHCl pH 6.8, 10% v/v glycerol, 2.3% w/v SDS, 5% v/v ß- mercaptoethanol, 0.05% w/v bromphenol blue) and boiled for 2 min. The proteins were separated by SDSPAGE using 7.5% or 10% SDSpolyacrylamide gels with a 5% stacking gel.
The proteins were transferred to nitrocellulose (Schleicher & Schull, Dassel, Germany) by electroblotting. The marker was cut from the membrane and stained with Amido Schwartz for 2 min. The rest of the membrane was blocked with blocking buffer (20 mmol/l Tris-base, 500 mmol/l NaCl, 3% gelatine) for 15 min at 37°C.
The immunostaining was carried out by a method of Bio-Rad. The membrane was cut into 3 mm strips and incubated with primary antibodies for 1 h at 37°C. Human sera were diluted 1:200 while the rabbit sera were diluted 1:1000 in antibody buffer (20 mmol/l Tris-base, 500 mmol/l NaCl, 3% gelatine, 0.05% Tween-20). The secondary antibodies used were alkaline phosphatase (AP)-conjugated goat anti-human IgG (H + L) diluted 1:2000 or goat anti-rabbit IgG (H + L) diluted 1:3000 and were incubated with strips for another hour. The membrane was washed with washing buffer (20 mmol/l Tris-base, 500 mmol/l NaCl, 0.05% Tween-20) after each incubation. Finally, the strips were developed for 10 min with nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate p-toluidium (NBT/BCIP) solution.
ELISA
For measuring C. trachomatis specific antibodies, a commercial ELISA test was used (pELISA, Medac, Hamburg). The test was performed according to the manufacturer.
Statistical analysis
Multiple logistic regression analysis was used to investigate the connection between seropositivity to MgPa and a list of explanatory variables. The explanatory variables were an indicator for each of the three groups of patients with TFI, male or unexplained factor infertility, age of the patients, age squared, as well as indicators for seropositivity to P114 of M. genitalium, P1, P116 both of M. pneumoniae and C. trachomatis. Age squared was included in case the dependence of age on MgPa seropositivity was non-linear. The model was reduced by backward selection (reduction in the statistical model mean by repeatedly removing insignificant explaining variables one by one). Values of P < 0.05 were considered significant.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
The recombinant protein, rMgPa, verified all positive sera detected with whole cells of M. genitalium as antigen, and PabFH (antibodies to M. pneumoniae) did not recognize this part of MgPa (Figure 3b).
Of the 308 women tested, 40 were positive to MgPa. Twenty-nine of them were from TFI patients (Table I).
|
If the odds ratios were interpreted as relative risks, it is seen that patients with TFI had a nearly four times higher risk of being MgPa seropositive compared to women with normal tubes. To be more specific, this probability relation was estimated at 3.8 (with a 95% confidence interval (CI) of 1.79.4) which was significant with a P-value of 0.003.
The age of the patients had no influence on the probability of being seropositive to MgPa and was removed from the model.
Seropositivity to M. pneumoniae
Because of the similarity of M. genitalium and M. pneumoniae the serum samples were tested for reactivity with M. pneumoniae antigen in immunoblotting (Figure 3c). The patient sera reacted with several proteins of M. pneumoniae, and some of them reacted as strongly as hyper-immune polyclonal rabbit serum against whole cells of M. pneumoniae (PabFH). Yet, as with M. genitalium, a characteristic pattern of two proteins recognized to be P1 and P116 was seen (Figure 3b
). Of the 308 patients, 151 were positive to P1 and 142 were positive to P116. Patients seropositive to P1 or P116 distributed almost equally in the three groups (Table II
).
|
|
Cross-reactions between M. genitalium and M. hominis were also investigated. Immunoblotting with whole cells M. genitalium and M. hominis were made and membranes were reacted with rabbit antibodies raised against whole cells of M. genitalium and M. hominis respectively. There were no cross-reactions between the two species except for a single faint band of lower molecular weight than MgPa and P114 (data not shown). The lack of cross-reactions between M. hominis and M. genitalium was in agreement with the lack of cross-reactivity of M. hominis and other mycoplasma species (Birkelund and Andersen, 1998).
Seropositivity to C. trachomatis
C. trachomatis is a common cause of TFI. Therefore all sera were tested with the pELISA (Medac) specific for C. trachomatis. The ELISA results are shown in Table IV. A cut-off value of 0.8 was used. One hundred and six patients were C. trachomatis seropositive, of which 75 were women with TFI. Of the C. trachomatis positive TFI patients, 21 were also positive to MgPa of M. genitalium, which resulted in eight MgPa positive patients negative to C. trachomatis (Table V
). Analysis of seropositivity to C. trachomatis showed a significant correlation between MgPa- and C. trachomatis seropositive patients (P = 0.044). The probability of being seropositive to MgPa was 2.2 times greater when patients were at the same time seropositive to C. trachomatis (CI 1.04.6).
|
|
Cross-reaction between chlamydia GroEL and a 57 kDa protein of M. genitalium
Identification of chlamydia GroEL is shown in Figure 4a. The monospecific polyclonal antibodies of chlamydia GroEL cross-reacted with a 57 kDa protein of M. genitalium (Figure 4b
, lane PabGroEL). This was in agreement with the amino acid sequence of M. genitalium GroEL obtained from the GenBank (accession no. U39721) which was calculated to have a molecular size of 58.4 kDa (www.expasy.ch/tools/pi_tool.html). A cross-reaction of PabGroEL with mycoplasma GroEL is likely because of a sequence homology of 43% (calculated by GAP program downloaded from www.biobase.dk). These results demonstrate that the 57 kDa protein is GroEL of M. genitalium. PabG37 reacted weakly with this protein as seen in Figure 4
and the position of the reacting band was used to localize M. genitalium GroEL in Figure 3a
. None of the human sera reacted with GroEL of M. genitalium, as is illustrated in Figure 3a
.
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Earlier studies (Lind, 1982; Lind et al., 1984
) showed a widespread cross-reactivity between M. genitalium and M. pneumoniae using sera from rabbits immunized with sonicated or live M. genitalium and M. pneumoniae cells and sera from pneumonia patients. The methods used were micro immunofluorescence (MIF), complement fixation test (CF) and indirect haemagglutination (IHA) using sonicated whole mycoplasma cells as antigen. In these experiments the specific antigenic proteins were not known. As shown in the current study, rabbit sera, PabG37 and PabFH, cross-reacted extensively with low molecular weight proteins of M. genitalium and M. pneumoniae. Therefore, this highlights the problem of using methods such as MIF, CF and IHA to differentiate between M. genitalium and M. pneumoniae.
By using immunoblotting as in this study, a single antigen, MgPa, was shown to be specific to M. genitalium. Rabbit polyclonal antibodies to M. genitalium (PabG37) did not cross-react with P1 of M. pneumoniae and several human sera that were positive to P1 did not cross-react with MgPa. The rabbit serum against M. pneumoniae (PabFH) reacted weakly with MgPa, but the rabbit and human sera do not necessarily produce antibodies against the same epitopes, partly because of the very different doses of the bacteria used and the method of immunization.
Monospecific polyclonal antibodies to the C-terminal part of MgPa (Figure 1) cross-reacted with P1 (Figure 3c
, lane PabMgPa). The high sequence homology between MgPa and P1 in the C-terminal region could explain this observed cross-reaction. The reason why this cross- reaction are not seen with human and rabbit sera could be that this domain is transmembranous and is therefore not exposed on the mycoplasma surface. A transmembrane domain in the C-terminal part of both MgPa and P1 has been predicted by using www.cbs.dtu.dk/services/TMHMM-2.0/.
Many of the human sera were positive to both MgPa and P1, but this was expected since M. pneumoniae is a ubiquitous and common pathogen of the human respiratory tract. Despite these patients being positive to both MgPa and P1, this was not a general pattern in the present work. The correlation between P1 and MgPa was not significant and P1 was therefore removed from the model in the statistical analysis. Another study (Wang et al., 1997) found specific antigens in M. genitalium. The most immunogenic of these proteins had sizes of 150, 112 and 66 kDa matching the MgPa, the 114 kDa protein and the 66 kDa protein presented here. These antigens were shown not to cross-react with patient serum samples positive to M. pneumoniae by either immunoblotting or ELISA.
The connection found in the statistical analysis between P116 and MgPa could not be explained by cross-reactivity, since PabP116 did not react with any proteins of M. genitalium. The correlation is therefore more likely a coincidence.
The results of one study are contradictory to the detection of M. genitalium in salpingitis patients (Lind and Kristensen, 1987). In this work an IHA was performed using sonicated M. genitalium cells to sensitized sheep erythrocytes. Forty-two patients with acute salpingitis determined by laparoscopy were investigated for antibodies to M. genitalium and none of the patients were tested positive. One explanation for this might be that the measurements of antibodies were done by different methods, IHA and immunoblotting. Another reason for the lack of antibodies to M. genitalium could be the relatively small sample size of 42 symptomatic patients tested.
The correlation between infection with C. trachomatis and M. genitalium could be explained by the fact that these two physiologically very different human pathogens have adapted to the same human tissue type. Some kind of biological correlation is unlikely. Seropositivity to C. trachomatis was expected to dominate in the patients with TFI based on the results of previous work (Møller and Mårdh, 1980). The fact that sera from eight patients positive to MgPa were negative to C. trachomatis indicate that M. genitalium is able to establish an infection independently of C. trachomatis.
Since the sera tested in this work did not derive from patients with acute disease, it was not possible to determine titre variations. The patients had no symptoms of PID when they visited the infertility clinics. Perhaps infections with M. genitalium as with C. trachomatis are primarily asymptomatic as suggested in an earlier study with sexually active men and women attending STD clinics (Wang et al., 1997).
The heat shock protein GroEL of C. trachomatis has been shown to elicit an inflammatory immune response of the host with subsequent chronic sequelae (Morrison et al., 1989; Wagar et al., 1990
). M. genitalium also expresses the heat shock protein, GroEL, but it was not immunogenic as shown by the lack of reactivity with human sera. Accordingly, the direct interaction between the mycoplasma and the host seems different from that of the chlamydia.
As seen in this study at least two proteins of M. genitalium, MgPa and a 114 kDa protein, seem to be immunogenic in human infections. The fact that seropositivity was only determined for MgPa since the 114 kDa protein in general reacted more weakly with patient sera than MgPa does not necessarily imply less importance of the 114 kDa protein in the pathogenesis of M. genitalium.
![]() |
Acknowledgements |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Notes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Collier, A.M., Carson, J.L., Hu, P.C. et al. (1990) Attachment of Mycoplasma genitalium to the ciliated epithelium of human Fallopian tubes. In Recent Advances in Mycoplasmology. Gustav Fischer Verlag, Stuttgard, pp. 730732.
Duffy, M.F., Walker, I.D. and Browning, G.F. (1997) The immunoreactive 116 kDa surface protein of Mycoplasma pneumoniae is encoded in an operon. Microbiology, 143, 33913402.[Abstract]
Eggert-Kruse, W., Rohr, G., Demirakca, T. et al. (1997) Chlamydial serology in 1303 asymptomatic subfertile couples. Hum. Reprod., 12, 14641475.[Abstract]
Fraser, C.M., Gocayne, J.D., White, O. et al. (1995) The minimal gene complement of Mycoplasma genitalium [see comments]. Science, 270, 397403.[Abstract]
Hu, P.C., Schaper, U., Collier, A.M. et al. (1987) A Mycoplasma genitalium protein resembling the Mycoplasma pneumoniae attachment protein. Infect. Immun., 55, 11261131.[ISI][Medline]
International Committee on Systematic Bacteriology, SoToM. (1995) Revised minimum standards for description of new species of class Mollicutes (division Tenericutes). Int. J. Syst. Bacteriol., 45, 605612.
Krause, D.C. (1996) Mycoplasma pneumoniae cytadherence: unravelling the tie that binds. Mol. Microbiol., 20, 247253.[ISI][Medline]
Kristensen, G.B., Bollerup, A.C., Lind, K. et al. (1985) Infections with Neisseria gonorrhoeae and Chlamydia trachomatis in women with acute salpingitis. Genitourinary Med., 61, 179184.[ISI]
Lind, K. (1982) Serological cross-reactions between `Mycoplasma genitalium' and M. pneumoniae [letter]. Lancet, 11581159.
Lind, K. and Kristensen, G.B. (1987) Significance of antibodies to Mycoplasma genitalium in salpingitis. Eur. J. Clin. Microbiol., 6, 205207.[ISI][Medline]
Lind, K., Lindhardt, B.O., Schutten, H.J. et al. (1984) Serological cross-reactions between Mycoplasma genitalium and Mycoplasma pneumoniae. J. Clin. Microbiol., 20, 10361043.[ISI][Medline]
Mårdh, P.A., Lind, I., Svensson, L. et al. (1981) Antibodies to Chlamydia trachomatis, Mycoplasma hominis, and Neisseria gonorrhoeae in sera from patients with acute salpingitis. Br. J. Vener. Dis., 57, 125129.[ISI][Medline]
Møller, B.R. and Mårdh, P.A. (1980) Experimental salpingitis in grivet monkeys by Chlamydia trachomatis. Modes of spread of infection to the Fallopian tubes. Acta Pathol. Microbiol. Scand. Sect. B, 88, 107114.[ISI][Medline]
Møller, B.R., Taylor-Robinson, D. and Furr, P.M. (1984) Serological evidence implicating Mycoplasma genitalium in pelvic inflammatory disease. Lancet, 11021103.
Møller, B.R., Taylor-Robinson, D., Furr, P.M. et al. (1985) Acute upper genital-tract disease in female monkeys provoked experimentally by Mycoplasma genitalium. Br. J. Exp. Pathol., 66, 417426.[ISI][Medline]
Morrison, R.P., Belland, R.J., Lyng, K. et al. (1989) Chlamydial disease pathogenesis. The 57 kD chlamydial hypersensitivity antigen is a stress response protein. J. Exp. Med., 170, 12711283.[Abstract]
Razin, S., Yogev, D. and Naot, Y. (1998) Molecular biology and pathogenicity of mycoplasmas. Microbiol. Mol. Biol. Rev., 62, 10941156.
Sambrook, J. Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning. A Laboratory Manual, Second Edition. Cold Spring Harbor Laboratory Press.
Taylor-Robinson, D., Furr, P.M. and Tully, J.G. (1983) Serological cross-reactions between Mycoplasma genitalium and M. pneumoniae [letter]. Lancet, i, 527.
Tully, J. G., Rose, D. L., Whitcomb, R. F. et al. (1979) Enhanced isolation of Mycoplasma pneumoniae from throat washings with a newly modified culture medium. J. Infect. Dis., 139, 478482.[ISI][Medline]
Tully, J.G., Taylor-Robinson, D., Cole, R.M. et al. (1981) A newly discovered mycoplasma in the human urogenital tract. Lancet, i, 12881291.
Uno, M., Deguchi, T., Komeda, H. et al. (1997) Mycoplasma genitalium in the cervices of Japanese women. Sex Transm. Dis., 24, 284286.[ISI][Medline]
Wagar, E.A., Schachter, J. Bavoil, P. et al. (1990) Differential human serological response to two 60 000 molecular weight Chlamydia trachomatis antigens. J. Infect. Dis., 162, 922927.[ISI][Medline]
Wang, R.Y., Grandinetti, T., Shih, J.W. et al. (1997) Mycoplasma genitalium infection and host antibody immune response in patients infected by HIV, patients attending STD clinics and in healthy blood donors. FEMS Immunol. Med. Microbiol., 19, 237245.[ISI][Medline]
Westrom, L. (1975) Effect of acute pelvic inflammatory disease on fertility. Am. J. Obstet. Gynecol., 121, 707713.[ISI][Medline]
Wilson, M.H. and Collier, A.M. (1976) Ultrastructural study of Mycoplasma pneumoniae in organ culture. J. Bacteriol., 125, 332339.[ISI][Medline]
World Health Organization (1992) WHO Laboratory Manual for the Examination of Human Semen and the SpermCervical Mucus Interaction, Third Edition, Cambridge University Press, Cambridge.
Submitted on December 20, 2000; accepted on May 16, 2001.