1 Epithelial Cell Biology Research Center, Department of Physiology, Faculty of Medicine, Chinese University of Hong Kong, Shatin, NT, Hong Kong, 2 Department of Obstetrics & Gynecology, 3 Department of Pathology, Faculty of Medicine, The University of Hong Kong, and 4 Department of Anatomy and 5 Department of Obstetrics & Gynecology, Faculty of Medicine, The Chinese University of Hong Kong, SAR, China
6 To whom correspondence should be addressed. Email: hsiaocchan{at}cuhk.edu.hk
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: CFTR/female reproductive tract/hydrosalpinx/hydrosalpinx fluid/infertility
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Movement of ions across the tubal epithelium is essential for the movement of fluid, which is not actively transported but moves in response to osmotic gradients largely established by the transport of ions across epithelium, particularly Cl ions through ion channels such as the cystic fibrosis transmembrane conductance regulator (CFTR), a cAMP-dependent Cl channel located in the apical membrane and mainly responsible for Cl secretion in many epithelia (Dickens and Leese, 1994; Quinton, 1999
). CFTR has previously been shown to be expressed in the female reproductive tract of rodents (Rochwerger and Buchwald, 1993
; Chan et al., 2002
) and humans (Rochwerger and Buchwald, 1993
; Tizzano et al., 1994
). Previous studies from our laboratory have provided molecular and electrophysiological evidence of CFTR involvement in transepithelial fluid transport in the female reproductive tract of mice (Chan et al., 1999
, 2002
). Cyclic changes in uterine fluid volume have been explained by differential regulation of CFTR by ovarian hormones (Chan et al., 2002
). The demonstration of cAMP-activated oviductal Cl secretion in normal but not CFTR mutant mice (Leung et al., 1995
) indicate a functional role of CFTR in oviductal secretory function. Therefore, it is likely that CFTR may play a crucial and important role in regulating fluid balance in the Fallopian tubes and that abnormality of the tubal epithelium as in hydrosalpinx may lead to elevated CFTR expression, and thus HF formation. We undertook the present study to test this hypothesis by examining epithelial pathology and CFTR expression in the Fallopian tubes of infertile HSP patients seeking assisted reproduction treatments.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
HSP was obtained from six patients undergoing laparoscopic bilateral salpingectomy because of visible HSP shown on transvaginal scanning during IVF cycles of infertile women who had tubal factor infertility only. Normal Fallopian tubes (NFT) were obtained from three healthy women of reproductive age who agreed to have laparoscopic bilateral salpingectomy for tubal sterilization. Salpingectomy was done during midlate proliferative stages (day 712) of their uterine cycles when CFTR expression is observed to be highest. Immediately after surgical removal, hydrosalpinges and NFT were collected into sterile tubes containing cold minimum essential medium (MEM; Life Technologies, Invitrogen, USA), placed on ice and transported to the laboratory.
Masson's trichrome staining
HSP and NFT tissue pieces were fixed overnight in 4% paraformaldehyde (Fisher brand, Fisher Scientific, USA). Tissue samples were dehydrated in graded ethanol and embedded in paraffin wax. Sections were cut at 5 µm using a ReichertJung, Biocut Rotary Microtome 1130 (Germany), and dried unto Superfrost microscope slides (Fisher brand).
Slides were dewaxed in xylene and redehydrated in graded alcohol and stained in Celestine Blue for 30 min and washed, stained again in Mayer's haematoxylin for another 30 min and washed in water. Slides were decolorized for a short time in acid alcohol and washed also in Scott's tap water. Slides were then stained in 1% Xylidine Ponceau in 0.5% HAC for 2 min and washed in water, and finally stained in 0.5% Fast Green for 20 s, blot dried, dehydrated in absolute alcohol, cleared and mounted using Permount (Fisher Scientific Fair Lawn, USA). Observation was done under inverted microscope (Leica; DMR BE, Germany).
RNA extraction and RTPCR
HSP and NFT were cut into small pieces after the removal of fatty tissues. Tissue pieces for RTPCR were immediately snap-frozen in liquid nitrogen and later stored at 80 °C until used.
RNA was isolated from HSP and NFT small pieces using TRIzol reagent (Gibco Invitrogen, USA). RTPCR was performed and repeated three times using RNA obtained from small pieces of HSP and NFT. The specific oligonucleotide primers for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were: GTGGGGCGCCCCAGGCACCA (sense) and CTCCTTAATGTCACGCACGATTTC (antisense), with expected cDNA of 515 base pairs (bp). The specific oligonucleotide primers for human CFTR were: AGCTGGACCAGACCAATTTTGAGGAAA (sense) and CCACACGAAATGTGCCAATGCAAGTCC (antisense), with expected cDNA of 554 bp. The conditions were: denaturation at 94 °C for 45 s; annealing at 53 °C, 58 °C for 60 s; extension at 72 °C for 60 s; 30, 33 cycles for GAPDH and CFTR respectively. Optimal amplification cycles are determined based on the linear relationship between the amount of PCR product detected and the number of amplification cycles. Due to the relatively small number of samples and in order to minimize unnecessary variables, RNA obtained from all the samples for each group were polled together, reverse-transcribed and then used for PCR. The PCR products were analysed using 2% agarose gel electrophoresis stained with ethidium bromide and visualized in an UV-illuminated imager, Alpha Imager 2200 (Alpha Innotech Corporation, USA). The intensities of the bands of CFTR were normalized to that of GAPDH, which was amplified simultaneously and used as internal marker. Experiments in the absence of reverse transcriptase were conducted as negative control and experiments were repeated four times.
Immunohistochemistry
Tissue sections dried onto Superfrost microscope slides (Fisher brand) were deparaffinized in xylene and rehydrated in ethanol. Endogenous peroxidase activity was quenched using 3% hydrogen peroxide incubation for 30 min. The slides were then placed in a cooling jar with sodium citrate buffer (pH 6) for antigen retrieval for 5 min. After cooling, slides were rinsed in 1xphosphate-buffered saline (PBS) and incubated in normal blocking serum (Vectastain Elite ABC kit, Vector Laboratories, Inc., USA) for 30 min and washed with PBS. Slides were then incubated overnight with the primary antibody (CFTR, NeoMarkers, Lab Vision Corp., USA; 1:500 v/v in buffer) at 4 °C overnight. Tissue sections were then washed with PBS and immunostaining was performed using a biotinylated secondary antibody, a horseradish peroxidaseH conjugate and a substratechromogen mixture (Vectastain Elite ABC reagent: ABC kit). Reaction was revealed by incubation with vasoactive intestinal peptide (VIP) substrate (Vector Laboratories, Inc., USA) for another 15 min, rinsed in water and counterstained with haematoxylin (Merck, Germany). Tissue sections were dehydrated in graded ethanol, mounted with Permount (Fisher Scientific, USA) and observed under an Olympus epifluorescence microscope (Olympus IX-70, Japan). Intense purple colour deposits indicated the site of positive immunostaining. The experiment was repeated three times and negative controls were applied for all tissue sections by using normal serum and omitting the primary antibody. Three people who never took part in slide preparations evaluated the slides individually. Interpersonal variability was <1%. CFTR immunostaining intensity values of NFT and HSP tissues were then analysed using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA).
Immunofluorescence staining
Tissue sections dried onto Superfrost microscope slides (Fisher brand) were deparaffinized in xylene, rehydrated in graded ethanol and rinsed in tap water. Incubating slides in a solution of 0.3% hydrogen peroxide in water for 30 min quenched endogenous peroxidase activity. Then slides were washed in water and incubated in normal blocking serum (Vectastain Elite ABC kit) for another 30 min to block non-specific sites. Excess serum was removed from the slides by blotting and incubated overnight in primary antibody (CFTR1: 500 V/V in buffer, Neo Markers; Lab Vision Corp., USA) at 4 °C. Tissue sections were washed for 5 min three times with PBS and incubated for 30 min in a diluted biotinylated secondary antibody solution (Vectastain Elite ABC kit). Tissue sections were again washed for 5 min three times in PBS and incubated for 2030 min in FITC-conjugated anti-mouse antibody (Vector Laboratories, Inc.), washed again in PBS, mounted with glycerol and observed under an Olympus epifluorescence microscope (Olympus IX-70, Japan). Three people who never took part in the slide preparation also evaluated the slides. Intensity values of immunofluorescence staining of NFT and HSP tissues were also analysed using Meta Morph image analysis software version 6.0 (Universal Imaging Corp., USA).
Statistical analysis
Data presented are mean (SEM) for the ratio of CFTR/GAPDH expression intensities as analysed using 2% agarose gel electrophoresis. Differences between groups were assessed using MannWhitney U-test and analysis of variance (ANOVA) with NewmanKeuls multiple comparison test for immunohistochemical staining intensity and immunofluorescence staining intensity values. P0.05 was considered significant. Statistical analysis was done using GraphPad Prism (GraphPad Software Inc., USA).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ion channels are membrane proteins that act as gated pathways for the movement of ions across cell membranes. Fluid movements across secretory epithelia are secondary to ion movements, particularly Cl. The importance of ion movements across epithelia lies in their coupling with the movement of water, which is not actively transported but moves in response to osmotic gradients established by the transport of ions (Leese, 1988). CFTR expression has been reported in the reproductive tissues of rodents (Rochwerger and Buchwald, 1993
; Chan et al., 2002
) and humans (Rochwerger and Buchwald, 1993
; Tizzano et al., 1994
); its regulation by ovarian hormones has been well documented (Rochwerger and Buchwald, 1993
; Mularoni et al., 1995
) and attributed to the cyclic changes in uterine fluid volume (Chan et al., 2002
) since expression of CFTR is expected to lead to significant increase in the osmotic water permeability (Kunzelmann and Mall, 2002
). Therefore, transformed epithelial cells with increased expression of CFTR in HSP, as observed in this study, may be one of the underlying mechanisms for abnormal fluid secretion and accumulation in the HSP lumen. Increased CFTR expression in HSP, significantly more than the expression in NFT during midlate proliferative stage of the uterine cycle, when CFTR expression is maximal, is also suggestive of increased fluid secretion. The abnormal fluid accumulation in HSP may also result from the indirect effect of CFTR as a regulator of other epithelial channels and transporters, such as water channels, protein (aquaporin AQP) and epithelial sodium channels (ENaC). Up-regulation of water channel (Kunzelmann and Schreiber, 1997
; Kunzelmann, 1999
) and inhibition of ENaC function, and thus fluid reabsorption (Stutts et al., 1995
) by CFTR could both lead to a net accumulation of fluid in HSP.
Although the reason for the increased expression of CFTR observed in HSP remains to be investigated further, one possible cause may be infection. Salpingitis and pelvic inflammatory disease (PID) precede HSP and our previous study demonstrated evidence of chronic ongoing low-grade infection in HSP (L.C.Ajonuma et al., unpublished data). It has been reported that bacterial infections up-regulate CFTR expression (Resta-Lenert and Barrett, 2002). Cytokines produced during infection, suggested to be contributory to the adverse effects of HF (David et al., 1969
) such as interleukin 1 beta (IL-1
) are potent modulators of CFTR (Cafferata et al., 2000
). During infection, bacteria binding may stimulate receptor signalling, leading to protein tyrosine phosphorylation, and finally increased CFTR expression. The significance of the presence of focally attenuated and pseudostratified epithelium in HSP is not clear at the moment. However, it has been reported that Chlamydial infection alters the transcription of host cell genes including those for cell differentiation, transcription factors and inhibition of apoptosis (Xia et al., 2003
). Proliferating and dedifferentiating epithelial cells may show changes in their ion transport or channel expression. Recently, it has been demonstrated that enhanced cAMP-activated Cl secretion in the hyperproliferative colonic mucosa was caused by elevated CFTR expression (Umar et al., 2000
). The epithelial changes seen in this study, possibly induced by Chlamydial chronic infection, may have contributed at least in part to the increased CFTR expression. It has also been demonstrated that C. trachomatis infection results in increased tyrosine phosphorylation of several host proteins including those involved in signal transduction pathways (Bliska et al., 1993
; Brikeland et al., 1994; Fawaz et al., 1997
; Xia et al., 2003
). In fact, our preliminary data showed that C. trachomatis inoculated into healthy SpragueDawley rat uteri induced uterine infection, massive uterine fluid accumulation (as in HSP) and increased CFTR mRNA expression (Ajonuma et al., 2004
), supporting the notion that infection may lead to up-regulation of CFTR with concomitant changes in ion flux across the apical membrane including hypersecretion of chloride ions and inhibition of sodium reabsorption, together contributing to the net increase in electrolytes in the Fallopian tube accompanied with increased fluid accumulation producing HSP.
Accumulation of HF in the Fallopian tubes and its regurgitation into the uterine cavity may be a contributing factor for infertility observed in HSP patients, and impaired implantation or endometrium receptivity of transferred embryos during IVF (Mansour et al., 1991; Meyer et al., 1997
). This is consistent with the present finding that CFTR is up-regulated in HSP. In fact, the observed improved IVF outcome in HSP patients pretreated with antibiotics (Sharara et al., 1996
; Hurst et al., 2001
) may be due to the return of CFTR expression back to the normal level when infection had subsided, leading to reduced HF reflux into the uterine cavity. Salpingectomy prior to IVF has been reported to be beneficial (Strandell et al., 1999
, 2001
; Johnson et al., 2002
), and currently, salpingectomy for large hydrosalpinges prior to IVF is an accepted practice. However, most patients are reluctant to consent to this procedure, which is also reflected in the small sample numbers in our study. Whether this represents the general HSP, most or a particular HSP histological type remains to be evaluated further. If treatment with CFTR specific inhibitors in conjunction with antibiotics improves IVF and embryo transfer outcome in a clinical trial, it will certainly be a more attractive option to most patients than salpingectomy. Therefore, clinical applicability of CFTR-specific inhibitors with antibiotics as potential adjunct treatment for HSP should be evaluated.
In summary, the present study has demonstrated for the first time epithelial transformation with increased CFTR expression in human HSP, thus providing a possible molecular mechanism of HF formation in HSP and infertility. These findings may lead to the development of a new treatment strategy for tubal factor infertile patients with HSP.
![]() |
Acknowledgements |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ajonuma LC, Haines CJ and Chan HC (2001) Hydrosalpinx fluid and in vitro mouse embryo development. J Obstet Gynaecol Res 27, 237239.[ISI][Medline]
Ajonuma LC, Ng EH-Y and Chan HC (2002) New insights into the mechanism underlying hydrosalpinx fluid and its adverse effect on IVF outcome. Hum Reprod Update 8, 255264.
Ajonuma LC, Tsang LL, Ho LS, Chung YW, Chan PSK and Chan HC (2004) Chlamydia trachomatis induced cystic fibrosis transmembrane conductance regulator (CFTR) expression in rat uterus and human colonic T84 cells. Cell Biol Inter 28, S4.
Arrighi CV, Lucas H, El-mowafi D, Campana A and Chardonnes D (2001) Effects of human hydrosalpinx fluid on in vitro murine fertilization. Hum Reprod 16, 676682.
Bayler SA, James KP and Meyer WR (1997) Hydrosalpingeal fluid inhibits in vitro embryonic development in a murine model. Hum Reprod 12, 27242728.[Abstract]
Birkelund S, Johnson H and Christiansen G (1994) Chlamydia trachomatis serovar L2 induces protein tyrosine phosphorylation during uptake by Hela Cells. Infect Immun 62, 49004908.[Abstract]
Blazar AS, Hogan JW, Seifer DB, Frishman GN, Wheeler CA and Haning RV (1997) The impact of hydrosalpinx on successful pregnancy in tubal factor infertility treated by in vitro fertilization. Fertil Steril 67, 517520.[CrossRef][ISI][Medline]
Bliska JB, Galan JE and Falkow S (1993) Signal transduction in the mammalian cell during bacteria attachment and entry. Cell 73, 903920.[CrossRef][ISI][Medline]
Cafferata EG, Gonzalez-Guerrico AM, Giordano L, Pivetta OH and Santa-Coloma TA (2000) Interleukin-1B regulates CFTR expression in human intestinal T84 cells. Biochim Biophys Acta 1500, 241248.[ISI][Medline]
Camus E, Poncelet C, Goffinet F, Wainer B, Merlet F, Nisand I and Philippe HJ (1999) Pregnancy rates after in-vitro fertilization in cases of tubal infertility with and without hydrosalpinx: a meta-analysis of published comparative studies. Hum Reprod 14, 12431249.
Carrasco I, Cebral E, Benitez R and Vantman D (2001) Hydrosalpinx fluid affects murine embryonic development in a coculture system with epithelial endometrial cells. Fertil Steril 75, 10041008.[CrossRef][ISI][Medline]
Chan LN, Chung YW, Leung PS, Liu CQ and Chan HC (1999) Activation of an adenosine 3'5'-cyclic monophosphate-dependent Cl-conductance in response to neurohormonal stimuli in mouse endometrial epithelial cells: the role of cystic fibrosis transmembrane conductance regulator. Biol Reprod 60, 374380.
Chan LN, Rochelle LG, Boucher RC and Chan HC (2002) Distribution of epithelial sodium channels (ENaC) subunits and cystic fibrosis transmembrane conductance regulator (CFTR) in murine reproductive tract. J Membr Biol 185, 165176.[CrossRef][ISI][Medline]
David A, Garcia CR and Czernobilsky B (1969) Human hydrosalpinx: histologic study and chemical composition of fluid. Am J Obstet Gynecol 105, 400411.[ISI][Medline]
Dickens CJ and Leese HJ (1994) The regulation of rabbit oviduct fluid formation. J Reprod Fertil 100, 377381.
Fawaz FS, Van ooij C and Homola E (1997) Infection with Chlamydia trachomatis altars the tyrosine phosphorylation and /or localization of several host Cell protein including contacting. Infect Immun 53015308.
Hurst BS, Turker KE, Awoniyi CA and Schlaff WD (2001) Hydsrosalpinx treated with extended doxycycline does not compromise the success of in vitro fertilization. Fertil Steril 75, 10171019.[CrossRef][ISI][Medline]
Johnson NP, Mak W and Sowter MC (2002) Laparoscopic salpingectomy for women with hydrosalpinges enhances the success of IVF: a Cochrane review. Hum Reprod 17, 543548.
Koong MK, Jun JH, Song SJ, Lee HJ, Song IO and Kang IS (1998) A second look at the embryotoxicity of hydrosalpinx fluid: an in-vitro assessment in a murine model. Hum Reprod 13, 16201624.[Abstract]
Kunzelmann K (1999) The cystic fibrosis transmembrane conductance regulator and its function in epithelial transport. Rev Physiol Biochem Pharmacol 137, 170.[Medline]
Kunzelmann K and Mall M (2002) Electrolyte transport in the mammalian colon: mechanisms and implications for disease. Physiol Rev 82, 245280.
Kunzelmann K and Schreiber R (1997) CFTR, a regulator of channels. J Membr Biol 168, 18.[CrossRef]
Leese HJ (1988) The formation and function of oviduct fluid. J Reprod Fertil 82, 843856.[ISI][Medline]
Leung AY, Wong PY, Gabriel SE, Yankaskas JR and Boucher RC (1995) cAMP-but not Ca2+ -regulated Cl conductance in the oviductuct is defect in mouse model of cystic fibrosis. Am J Physiol. 268, C708C712.[ISI][Medline]
Mansour R, Aboulghar M, Serour G and Riad R (1991) Fluid accumulation of the uterine cavity before embryo transfer: a possible hindrance for implantation. J In Vitro Fertil Embryo Transfer 8, 157159.[CrossRef][ISI][Medline]
Meyer WR, Castelbaum AJ, Somkuti S, Sagoskin AW, Doyle M, Harris JE and Lessey BA (1997) Hydrosalpinges adversely affects markers of endometrial receptivity. Hum Reprod 12, 13931398.[Abstract]
Mukherjee T, Copperman AB, McCaffrey C, Cook CA, Bustillo M and Obasaju MF (1996) Hydrosalpinx fluid has embryotoxic effects on murine embryogenesis: a case for prophylactic salpingectomy. Fertil Steril 66, 851853.[ISI][Medline]
Mularoni A, Beck L, Sadir R, Adessi GL and Nicollier M (1995) Down-regulation by progesterone of CFTR expression in endometrial epithelial cells: a study by competitive RT-PCR. Biochem Biophy Res Commun 217, 11051111.[CrossRef][ISI][Medline]
Murray CA, Clarke HJ, Tulandi T and Tan SL (1997) Inhibitory effect of human hydrosalpingeal fluid on mouth preimplantation embryonic development is significantly reduced by the addition of lactate. Hum Reprod 11, 25042507.[CrossRef]
Ng EH, Yeung WS and Ho PC (1997) The presence of hydrosalpinx may not adversely affect the implantation and pregnancy rates in in vitro fertilization treatment. J Assist Reprod Genet 14, 508512.[CrossRef][ISI][Medline]
Ng EHY, Ajonuma LC, Lau EYL, Yeung WSB and Ho PC (2000) Adverse effects of hydrosalpinx fluid on sperm motility and survival. Hum Reprod 15, 772777.
Quinton PM (1999) Physiological basis of cystic fibrosis: a historical perspective. Physiol Rev 79, S3S22.[Medline]
Rawe VJ, Liu J, Shaffer S et al. (1997) Effect of human hydrosalpinx fluid on murine embryo development and implantation. Fertil Steril 68, 668670.[CrossRef][ISI][Medline]
Resta-Lenert S and Barett KE (2002) Enteroinvasive bacteria alter barrier and transport properties of human intestinal epithelium: role of iNOS and COX-2. Gastroenterology 122, 10701087.[CrossRef][ISI][Medline]
Roberts JE, Clarke HJ, Tulandi T and Tan SL (1999) Effects of hydrosalpingeal fluid on murine embryo development and implantation. J Assist Reprod Genet 16, 421424.[CrossRef][ISI][Medline]
Rochwerger L and Buchwald M (1993) Stimulation of the cystic fibrosis transmembrane conductance regulator expression by estrogen in vivo. Endocrinology 133, 921930.[Abstract]
Sachdev R, Kemmann E, Bohrer MK and El-Danasouri I (1997) Detrimental effect of hydrosalpinx fluid on the development and blastulation of mouse embryos in vitro. Fertil Steril 68, 531533.[CrossRef][ISI][Medline]
Sharara FI, Scott RT, Jr, Marut EL and Queenan JT, Jr (1996) In-vitro fertilization outcome in women with hydrosalpinx. Hum Reprod 11, 526530.[Abstract]
Spandorfer SD, Liu HC, Neuer A, Barmat LI, Davis O and Rosenwaks Z (1999) The embryo toxicity of hydrosalpinx fluid is only apparent at high concentrations: an in vitro model that simulates in vivo events. Fertil Steril 71, 619626.[CrossRef][ISI][Medline]
Strandell A, Waldenstrom U, Nilsson L and Hamberger L (1994) Hydrosalpinx reduces in-vitro fertilization/embryo transfer pregnancy rates. Hum Reprod 9, 861863.[Abstract]
Strandell A, Sjogren A, Bentin-Ley U, Thorburn J and Hamberger L (1998) Hydrosalpinx fluid does not adversely affect the normal development of human embryos and implantation in vitro. Hum Reprod 13, 29212925.
Strandell A, Lindhard A, Waldenstrom U, Thorburn J, Janson PO and Hanberger L (1999) Hydrosalpinx and IVF outcome: a prospective, randomized multicenter trial in Scandinavia on salpingectomy prior to IVF. Hum Reprod 14, 27622769.
Strandell A, Lindhard A, Waldenstrom U and Thorburn J (2001) Hydrosalpinx and IVF outcome: cumulative results after salpingectomy in a randomized controlled trial. Hum Reprod 16, 24032410.
Stutts MJ, Canesasa MC, Olsen JC, Hamrick JA, Rossier BC and Boucher RC (1995) CFTR as a cAMP-dependent regulator of sodium channels. Science 269, 847850.[ISI][Medline]
Tizzano EF, Silver MM, Chitayat D, Benichou JC and Buchwald M (1994) Differential cellular expression of cystic fibrosis transmembrane regulation in human reproductive tissues. Clues for the infertility in patients with cystic fibrosis. Am J Pathol 144, 906914.[Abstract]
Umar S, Scott J, Sellin JH, Dubinsky WP and Morris AP (2000) Murine colonic mucosa hyperproliferation. Elevated CFTR expression and enhanced cAMP-dependent Cl secretion. Am J Physiol Gastrointest Liver Physiol 278, G753G764.
Xia MS, Bumgarner RE, Lampe MF and Stamm WE (2003) Chlamydia trachomatis infection alters host cell transcription in diverse cellular pathways. J Infect Dis 187, 424434.[CrossRef][ISI][Medline]
Zeyneloglu HB, Arici A and Olive DL (1998) Adverse effects of hydrosalpinx on pregnancy rates after in vitro fertilization-embryo transfer. Fertil Steril 70, 492499.[CrossRef][ISI][Medline]
Submitted on February 20, 2004; resubmitted on January 4, 2005; accepted on January 10, 2005.
|