2 Division of Medicinal Chemistry and Natural Products, School of Pharmacy, CB#7360, University of North Carolina, Chapel Hill, NC 27599; and 3 Proteomic Core Facility, Department of Biochemistry, University of North Carolina, Chapel Hill, NC 27599
Received on June 5, 2003; revised on July 9, 2003; accepted on July 10, 2003
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: antithrombin / anticoagulation / heparan sulfate / heparan sulfate sulfotransferase / herpes simplex virus
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
One approach to understanding the relationship between the functions of HS and the saccharide sequences is to investigate the mechanism for the biosynthesis of HS. HS is initially synthesized as a copolymer of glucuronic acid and N-acetylated glucosamine by D-glucuronyl and N-acetyl-D-glucosaminyltransferase, followed by various modifications in the Golgi apparatus (Lindahl et al., 1998). These modifications include N-deacetylation and N-sulfation of glucosamine, C5 epimerization of glucuronic acid to form iduronic acid residues, 2-O-sulfation of iduronic and glucuronic acid residues, as well as 6-O-sulfation and 3-O-sulfation of glucosamine residue. The enzymes that are responsible for the biosynthesis of HS have been cloned and characterized (Esko and Lindahl, 2001
).
HS sulfotransferases, except for HS 2-O-sulfotransferase, are present in multiple isoforms (Aikawa et al., 2001; Habuchi et al., 2000
, 2003
; Liu and Rosenberg, 2002
). The expression levels of these isoforms could play roles in regulating the biosynthesis of the HS with defined saccharide sequences (Liu et al., 1999b
). It is now known that the isoforms are expressed at different levels in different tissues. Grobe and Esko (2002)
reported that 5'-untranslated regions of N-deacetylase/N-sulfotransferase isoforms play an important role in determining the translational efficiency of the enzymes in different tissues. N-deacetylase/N- sulfotransferase isoforms and 3-O-sulfotransferase (3-OST) isoforms recognize the saccharide sequences around the modification sites to exhibit different substrate specificities (Aikawa et al., 2001
; Liu et al., 1999b
; Xia et al., 2002
), whereas distinct substrate specificities among isoforms of 6-OST were not detected (Jemth et al., 2003
; Smeds et al., 2003
).
The 3-O-sulfation of glucosamine represents the last important modification step during the biosynthesis of biologically active HS. The 3-O-sulfated HSs are known to bind to antithrombin, herpes simplex virus (HSV) 1 glycoprotein D (gD) and growth factor receptor and fibroblast growth factor 7 (Liu et al., 1996; McKeehan et al., 1999
; Shukla et al., 1999
; Ye et al., 2001
). The diversified biological functions of 3-O-sulfated HS are likely biosynthesized by different 3-OST isoforms. A total of six different 3-OST isoforms have been identified (Liu and Rosenberg, 2002
; Xia et al., 2002
). Recent reports have shown that the expression of 3-OST-2 in rat pineal is daylight sensitive and regulated by ß-adrenergic signaling pathway (Borjigin et al., 2003
). In addition, a lower expression of 3-OST-2 was discovered in various human cancers, suggesting a potential role of 3-OST-2 in controlling the transformation of normal cells to cancer cells (Miyamoto et al., 2003
).
The specific structures of the HSs that play roles in regulating anticoagulation and assisting HSV infection are known. It was reported that the enzymes for biosynthesizing antithrombin (AT)-binding HS and gD-binding HS belong to two 3-OST isoforms (Liu et al., 1996; Shukla et al., 1999
). The 3-OST-1-modified HS binds to AT, exhibiting anticoagulant activity, whereas the 3-OST-3-modified HS binds to gD, serving as an entry receptor for HSV-1. The results from structural analysis indicated that the saccharide structures of AT-binding sites and gD- binding sites are different (Atha et al., 1985
; Liu et al., 2002
). We have recently reported that 3-OST-5 generates both an AT-binding site and an entry receptor for HSV-suggesting that 3-OST-5 has unique substrate specificity (Xia et al., 2002
). In this article, we describe expression and purification of 3-OST-5 from insect cells using baculovirus expression approach. Using the purified enzyme, we uncovered a novel substrate specificity of 3-OST-5 that has broader substrate specificity than those of either 3-OST-1 or 3-OST-3. It is possible that 3-OST-5 may contribute to the biosynthesis of HS with unique biological functions.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
|
|
|
Characterization of the substrate specificity of 3-OST-5
3-OST-5 sulfates the glucosamine residue that is linked to a nonsulfated iduronic acid residue at the nonreducing end
As described in Figure 2, three unidentified 35S-labeled components were detected in nitrous aciddegraded 3-OST-5-modified HS, designated disaccharide 1 (eluted at 18.5 min), disaccharide 2 (21.0 min), and disaccharide 4 (43.0 min). Although the signals were relatively low, we found that those components were present consistently. We decided to purify these components by RPIP-HPLC to determine if they represented 3-O-sulfated disaccharides. We noted that both disaccharide 1 and 2 were eluted on RPIP-HPLC in the region where monosulfated disaccharides were eluted. Disaccharide 4 was eluted on RPIP-HPLC in the region where disulfated disaccharides were eluted. Those observations suggested that disaccharide 1 and 2 are monosulfated disaccharides, whereas disaccharide 4 is a disulfated disaccharide.
We determined susceptibilities of disaccharides 1, 2, and 4 to ß-glucuronidase and -iduronidase digestions. For disaccharide 1, we observed that the 35S-peak was shifted from 81 min to 8 min after ß-glucuronidase digestion on silica-based polyamine HPLC (PAMN-HPLC), suggesting that disaccharide 1 has a structure of GlcUA-AnMan3S (data not shown). For disaccharide 2, we observed that the 35S-peak was shifted from 86 min to 8 min on PAMN-HPLC after
-iduronidase digestion, suggesting that Disaccharide 2 has the structure of IdoUA-AnMan3S (Figure 3A). For disaccharide 4, we observed that the 35S-peak was shifted from 110 min to 87 min after
-iduronidase digestion on PAMN-HPLC (Figure 3B), and the resultant 35S-peak was coeluted with AnMan3S6S standard, suggesting that Disaccharide 4 has the structure of IdoUA-AnMan3S6S.
3-OST-5 sulfates N-sulfated glucosamine and N-unsubstituted glucosamine residues
It is known that 3-OST-1 and 3-OST-3 sulfate N-sulfated glucosamine and N-unsubstituted glucosamine residue, respectively (Liu et al., 1999a; Zhang et al., 1999
). We attempted to determine which type of glucosamine residue is modified by 3-OST-5. To this end, we used a mixture of heparin lyases, including heparin lyase I, II, III and heparitinase IV, to degrade 3-OST-5-modified HS. About 50% of [35S]HS was degraded to disaccharides (or [35S]sulfate) and 40% of [35S]HS was degraded to tetrasaccharides (Figure 4A). It is very important to note that 3-O-sulfated HS, generated by 3-OST-1 and 3-OST-3, could not be degraded to disaccharides by a mixture of heparin lyases (Liu et al., 1999a
; Zhang et al., 1999
). To further prove that a 35S-labeled disaccharide was present in the heparin-lyasedigested 3-OST-5-modified HS, we resolved the disaccharide pool using RPIP-HPLC (Figure 4B). As shown in Figure 4B, we indeed observed one major [35S]disaccharide (disaccharide X) eluted in the region where trisulfated disaccharides are eluted, suggesting that disaccharide X is a trisulfated disaccharide. (A large amount of [35S]sulfate was also observed. We speculated that [35S]sulfate was the desulfated product from 3-O-[35S]sulfated HS during the digestion of heparin lyases. We also found numerous minor [35S]peaks around disaccharide X. Because the amount of those minor peaks was low, we were unable to determine their structures readily.)
|
The positions of sulfate groups of disaccharide X were determined by examining its susceptibility to nitrous acid degradation and 4,5-glycuronate-2-sulfatase digestion (Figure 5). We found that the retention time of disaccharide X on RPIP-HPLC was shifted from 72 min to 62 min by treating with nitrous acid at pH 1.5 (Figure 5A). However, we did not observe a shift in retention time when the disaccharide was treated with nitrous acid at pH 4.5 (data not shown). The results suggest that disaccharide X contains an N-sulfated glucosamine residue based on the specificity of nitrous acid degradation at different pHs (Shively and Conrad, 1976
). We also found that disaccharide X is susceptible to
4,5-glycuronate-2-sulfatase digestion. The retention time of disaccharide X was shifted from 150 min to 138 min on PAMN-HPLC after digestion by
4,5-glycuronate-2-sulfatase, suggesting it contains a
UA2S residue (Figure 5B) (McLean et al., 1984
). Consistent with this conclusion, treatment of disaccharide X with HS glycuronidase showed no shift in retention time on PAMN-HPLC (data not shown). Taken together, our results suggest that disaccharide X has a structure of
UA2S-GlcNS3S.
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Three additional 3-O-sulfated disaccharides were observed in nitrous aciddegraded (pH 1.5) 3-OST-5-modified HS, including GlcUA-AnMan3S, IdoUA-AnMan3S, and IdoUA-AnMan3S6S. We proved the structures by determining their susceptibilities to ß-glucuronidase and -iduronidase, respectively. In a previous study, we observed the presence of IdoUA-AnMan3S6S but were unable to prove the structure because the amount of IdoUA-AnMan3S6S was low. Using the purified enzyme, we prepared a large amount of 3-OST-5-modified HS, which allowed us to obtain sufficient amount of the disaccharide to prove its structure. In addition, we purified and proved the presence of GlcUA-AnMan3S and IdoUA-AnMan3S. Together our results suggest that 3-OST-5 sulfates a glucosamine residue that is linked to an iduronic acid residue at the nonreducing end.
Both IdoUA-AnMan3S and IdoUA-AnMan3S6S are rare in the HS isolated from natural sources. The disaccharide of IdoUA-AnMan3S was observed in the HS isolated from glomerular basement membrane (Edge and Spiro, 1990, 2000
), whereas the disaccharide of IdoUA-AnMan3S6S was observed in the clams Anomalocardia brasiliana and Tivela mactroides (Pejler et al., 1987
). The biological functions of the HS containing IdoUA-AnMan3S6S is unknown, and it is not associated with antithrombin binding (Pejler et al., 1987
). Edge and Spiro (2000)
reported that decreased levels of IdoUA-AnMan3S and IdoUA2S-AnMan3S in HS isolated from the glomerular basement membrane were observed in diabetic patients. The authors suggested that the specific 3-O-sulfated HS might contribute to defects in the anionic filtration barrier in diabetic patients. It should be noted that the previously characterized 3-OST-1, 3-OST-3A, and 3-OST-2 do not generate either IdoUA-AnMan3S or IdoUA-AnMan3S6S (Liu et al., 1996
, 1999a
, 1999b
). (Zhang and colleagues reported that 3-OST-1-modified HS can contain IdoUA-AnMan3S and IdoUA-AnMan3S6S [Zhang et al., 2001b
]. However, the altered substrate specificity of 3-OST-1 was observed by using the HS that is absence of 2-O-sulfated iduronic acid or 2-O-sulfated glucuronic acid residues [Bai and Esko, 1996
].) Given the fact that 3-OST-5 enzyme generates the saccharide sequences containing both IdoUA-AnMan3S and IdoUA2S-AnMan3S, it is possible that 3-OST-5-modified HS plays roles in regulating the functions of anionic filtrations, in addition to the activities in generating anticoagulant HS and an entry receptor for HSV-1.
3-OST-5 enzyme sulfates both N-sulfated glucosamine (GlcNS) and N-unsubstituted glucosamine (GlcNH2) residues. This conclusion was based on the structural analysis of the products of heparin lyasesdigested 3-OST-5- modified HS. Given the facts that 3-OST-1 sulfates GlcNS and 3-OST-3 sulfates GlcNH2, our results suggest that 3-OST-5 has more relaxed substrate specificities. Currently we do not know whether 3-OST-5 sulfates N-acetylated glucosamine residue because we could not analyze the structures of all 3-O-[35S]sulfated oligosaccharides, which are in low abundance or unstable. To our surprise, we observed a 3-O-sulfated disaccharide with a structure of UA2S-GlcNS3S from the heparin lyasesdigested products. It has been reported that HS tetrasaccharides containing 3-O-sulfated glucosamine residues are resistant to the digestions by heparin lyases (Liu et al., 1999a
; Sundaram et al., 2003
; Yamada et al., 1995
; Zhang et al., 1999
). (Two disaccharides carrying a 3-O-sulfate group, with structures of
UA-GlcNS3S and
UA-GlcNS3S6S, were observed in the heparin lyasesdigested 3-OST-1-modifed in the presence of heparin/heparan sulfate interacting protein [Zhang et al., 2001a
]. It is still unclear why this protein alters the substrate specificities of heparin lyases to yield the 3-O-sulfated disaccharides.) Indeed, we only found tetra- and hexasaccharides in the products of heparin lyasesdigested 3-OST-3-modified HS (data not shown). It remains to be investigated why 3-OST-5-modified HS can be digested into a disaccharide and 3-OST-1 and 3-OST-3-modified HS cannot. It is possible that the saccharide sequences around the 3-O-sulfation sites within the 3-OST-5-modified HS are unique, which allows the actions of heparin lyases to occur.
It remains to be investigated the relative sulfation efficiency by 3-OST-5 to GlcNH2 and GlcNS. It is likely that the sulfated saccharide sequences around GlcNH2 or GlcNS contribute to the susceptibility to 3-OST-5 sulfation. To eliminate the contribution of the sulfate patterns around the modification sites, the study will require a series of structurally defined oligosaccharides substrates differed by only GlcNH2 versus GlcNS residue. Unfortunately, those oligosaccharides are still unavailable.
The potential role of 3-OST-5 in biosynthesizing anticoagulant HS was proposed by HajMohammadi and colleagues (2003). Analysis of 3-OST-1-null mice has failed to detect any phenotype in hemostasis. The authors suggested that another isoform of 3-OST performs the function of the biosynthesis of anitcoagulant HS. Given the fact that 3-OST-5 generates anticoagulant HS, further studies of the role of 3-OST-5 in biosynthesizing anticoagulant HS in vivo, in conjunction with 3-OST-1, could help us to understand the regulating role of HS in coagulation at molecular levels.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Preparation of recombinant 3-OST-5 enzyme
Preparation of 3-OST-5 baculovirus expression plasmid
The secreted form of 3-OST-5 was constructed by removing the 29 amino acid residues from N-terminus consisting of the proposed transmembrane domain (Xia et al., 2002). The construction of the expression plasmid was involved in two-step cloning. A partial 3-OST-5 cDNA (about 900 bp) was first cloned from pcDNA3.1-3OST5 into the baculovirus expression vector containing a honeybee melittin signal using EcoR I/Xba I sites (Liu et al., 1999a
; Xia et al., 2002
). The remaining 3-OST-5 sequence was amplified by a polymerase chain reaction using two specific primers and pcDNA3.13OST5 as a template. The sequences of the two specific primers are: 5'-primer AATTTGGATCCCCAGAGTTGGGAGCTTGGATAG with a BamH I site (underscored); 3'-primer AACAAAACTTATTACAAGTTTGAGA. The product (559 bp) was digested with BamH I and EcoR I to yield a fragment with 82 bp. The resultant 82-bp fragment was then cloned into the construct that contains part of 3-OST-5 sequence using BamH I/EcoR I sites. The reading frame was confirmed by sequencing analysis. It should be noted that the construct does not contain the (His)6 sequence.
Expression of 3-OST-5
3-OST-5 recombinant baculovirus was prepared from 3-OST-5 baculovirus expression plasmid using the Bac-to-Bac baculovirus system (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Briefly, Sf9 cells (1 x 106 cells/ml, Invitrogen) were grown in serum-free media in a spinner bottle and were infected by 3-OST-5 recombinant virus. The medium was harvested 72 h after infection. The harvested medium was centrifuged at 1000 x g for 15 min, and 3-[(3-cholamidopropyl)diethylammonio]-1-propane sulfonate (CHAPS) was added to a final concentration of 0.6%. This solution was frozen in liquid nitrogen and stored at -80°C for subsequent purification.
Measurement of 3-OST-5 activity
The activity of 3-OST-5 was determined by measuring the amount of [35S]sulfate transferred to HS polysaccharide. A similar method was used to determine the activity of 3-OST-3 (Liu et al., 1999a). Briefly, a typical 50-µl reaction contained various amount of 3-OST-5 enzyme, 200 µg/ml HS, 1 x 107 cpm of [35S] PAPS, 50 mM 2-[N-morpholino]ethanesulfonic acid, pH 7.0, 10 mM MnCl2, 5 mM MgCl2, 100 mM NaCl, 120 µg/ml bovine serum albumin, and 1% Triton X- 100 (v/v). The reaction mixture was incubated at 37°C for 1 h. The [35S] HS was isolated by a DEAE-Sephacel column (Xia et al., 2002
).
Purification of recombinant 3-OST-5
The entire purification was carried out at 4°C. The harvested medium (about 1.5 L) was mixed with 4-[N-morpholino] propanesulfonic acid (MOPS) to a final concentration of 20 mM, adjusted pH to 7.0 with 1 M NaOH. The preparation was centrifuged to remove insoluble particles. The supernatant was mixed with an equal volume of cold 20 mM MOPS, pH 7.0, and then loaded on a heparin-Sepharose CL-6B column (1 x 10 cm), which was equilibrated with 20 mM MOPS, 0.6% CHAPS, 2% glycerol, pH 7.0 (MCG buffer) and 150 mM NaCl at 4 ml/min. The column was then washed with MCG buffer containing 150 mM NaCl for 20 min and eluted with a linear gradient of NaCl from 150 mM to 1000 mM in 50 min. The fractions (48 ml) containing 3-OST-5 activity were pooled and dialyzed against 50 mM NaCl in MCG buffer. The solution was then loaded on a 3',5'-ADP-agarose column (0.5 x 8 cm) equilibrated with 150 mM NaCl in MCG buffer at 0.3 ml/min. The column was washed with MCG buffer containing 150 mM NaCl for 33 min and eluted with a linear gradient of NaCl from 150 mM to 1000 mM in 67 min followed by a 17-min wash of 1000 mM NaCl in MCG buffer. The fractions (8 ml) containing 3-OST-5 activity were pooled.
Protein identification by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS)
Purified 3-OST-5 was in-gel digested with a Genomics Solutions ProGest robot using trypsin in 50 mM ammonium bicarbonate (pH 8) (Borchers et al., 2000). Extracted peptides were lyophilized and reconstituted in 5 µl 50% methanol (v/v), 0.1% formic acid. Peptides (0.5 µl) were mixed with 1 µl saturated
-cyanohydroxycinnamic acid in 50% acetonitrile/0.1% trifluoracetic acid and analyzed using both a Bruker Reflex III MALDI-TOF and the Applied Biosystems 4700 MALDI-TOF/TOF. For protein identification, Mascot software (www.matrixscience.com) was used for matching molecular mass of peptides against the NCBInr database (2/15/2003). The digest (band 1 in Figure 1) was also analyzed by liquid chromatographymass spectrometry on a Waters Q/TOF API US coupled to a Waters CapLC using a 75-min gradient elution on a LCPackings 75 µm x 15 cm PepMap C18 reverse phase column.
Characterization of 3-OST-5-modified HS
Preparation of 3-OST-5-modified HS
Purified 3-OST-5 (70 ng) was mixed with 1 µg HS and 20 µM [35S] PAPS (1 x 107 cpm) in the enzyme reaction buffer as described. Twenty reactions were prepared to obtain enough 3-OST-5-modified HS for structure analysis. Alternatively, the HS was replaced by 3H-labeled HS (0.1 µg), which was prepared from [3H]glucosamine (ICN) metabolically labeled CHO cells, to prepare [3H, 3-O-35S]HS.
Determination of 3-OST-5 modified HS binding to AT and to gD
The binding of 3-OST-5-modified HS to AT was determined using an AT/concanavalin ASepharose (Sigma) approach (Liu et al., 1996). The assay for determining the binding of 3-OST-5-modified HS to gD was carried out by an immunoprecipitation procedure using anti-gD monoclonal antibody (Shukla et al., 1999
).
Disaccharide analysis
The [35S] HS was degraded by nitrous acid (pH 1.5) followed by reduction with sodium borohydride (Shively and Conrad, 1976). The resultant disaccharides were desalted on a BioGel P-2 column (0.5 x 200 cm), which was equilibrated with 0.1 M ammonium bicarbonate at 4 ml/h. The disaccharides were then resolved by RPIP-HPLC to determine the identities of 35S-labeled disaccharides by coeluting with appropriate standards (Liu et al., 2002
; Xia et al., 2002
).
Degradations of 3-O-[35S]HS by enzymes
The conditions for digesting HS by a mixture of heparin lyases, including heparinase, heparitinase I, heparitinase II and heparitinase IV, were described elsewhere (Zhang et al., 1999). The conditions for the digestion with
-iduronidase and ß-glucuronidase were previously described (Liu et al., 1999a
). The conditions for the digestions by
4,5-glycuronate-2-sulfatase and HS glycuronidase were described elsewhere (Liu et al., 2002
).
HPLC
We employed both RPIP-HPLC and anion-exchange HPLC to resolve 3-O-[35S]sulfated disaccharides and 3-O-[35S]tetrasaccharides. For the analysis of the mixture of disaccharides containing trisulfated disaccharides, we used a C18-reversed phase column (0.46 x 25 cm, Vydac) under the RPIP-HPLC condition (Liu et al., 1999a). The column was eluted with acetonitrile at 8% for 45 min, at 15% for 15 min, and at 19.5% for 30 min, in a solution containing 38 mM ammonium phosphate monobasic, 2 mM phosphoric acid, and 1 mM tetrabutylammonium phosphate monobasic (Fluka) at a flow rate of 0.5 ml/min.
For the analyses of -iduronidase, glucuronidase, and
4,5-glycuronate-2-sulfatase-treated 3-O-[35S]sulfated disaccharides, we employed a PAMN-HPLC column (0.46 x 25 cm, Waters, Milford, CT). The column was eluted with 30 mM KH2PO4 for 70 min, followed by a linear gradient of KH2PO4 from 30 to 1000 mM in 130 min at a flow rate of 0.8 ml/min. To isolate 3-O-[35S]sulfated tetrasaccharides, the PAMN-HPLC was eluted with a linear gradient of KH2PO4 from 350 mM to 1000 mM in 60 min, followed by additional wash with 1000 mM KH2PO4 for 20 min at a flow rate of 0.8 ml/min.
nESI-MS
The experiment was carried out on a Micromass Quattro II with QhQ geometry, a Z-spray source, and pulled borosilicate glass nanovials. The conditions for the analysis of HS disaccharides were described elsewhere (Pope et al., 2001). An extensive desalting procedure was used to obtain the MS spectrum of disaccharide X. The disaccharide was desalted by a DEAE-Sephacel column and eluted with 1 M triethylammonium bicarbonate (pH 8). The resultant disaccharide was further desalted by a BioGel P-2 column, which was eluted with 0.1 M ammonium acetate at a flow rate of 4 ml/h.
Kinetic analysis
We determined the kinetic constants (Km and Vmax) of 3-OST-5 toward both HS and PAPS. We have observed that the rate of reaction remained constant up to 10 min. Thus we incubated the reactions for 5 min, and the reaction velocity represented the initial velocity.
To determine the Km and Vmax with respect to HS, various concentrations of HS (0.1258 µM) were employed in a standard 50-µl reaction as described, containing 20 µM 35[S]PAPS (1 x 107 cpm). The molar concentrations of HS were calculated using the average molecular weight at 14,000 Da (provided by manufacturer). Reactions were quenched by adding 100 µl of a buffer containing 50 mM sodium acetate, 6 M Urea, 150 mM NaCl, 1 mM ethylenediamine tetra-acetic acid and 0.1% Triton X-100, pH 5.5. The samples were then subjected into a 200 µl DEAE-Sepharose column. The resultant [35S] HS were eluted from the column by 1000 mM NaCl (Liu et al., 1996).
To determine the Km and Vmax with respect to PAPS, various concentrations of unlabeled PAPS (from 1 to 20 µM) and 1 x 107 cpm [35S]PAPS were employed in a standard 50-µl reaction. The reactions were quenched after 5 min incubation. The corresponding initial velocities were plotted against the concentrations of HS or PAPS. The plot was fitted to the equation V = Vmax * S/(Km + S), where S represents either the concentration of HS or PAPS, to obtain Km and Vmax.
![]() |
Acknowledgements |
---|
![]() |
Footnotes |
---|
![]() |
Abbreviations |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alexander, C.M., Reichsman, F., Hinkes, M.T., Lincecum, J., Becker, K.A., Cumberledge, S., and Bernfield, M. (2000) Syndecan-1 is required for Wnt-1-induced mammary tumorigenesis in mice. Nat. Genet., 25, 329332.[CrossRef][ISI][Medline]
Atha, D.H., Lormeau, J.-C., Petitou, M., Rosenberg, R.D., and Choay, J. (1985) Contribution of monosaccharide residues in heparin binding to antithrombin III. Biochemistry, 24, 67236729.[ISI][Medline]
Bai, X., and Esko, J.D. (1996) An animal cell mutant defective in heparan sulfate hexuronic acid 2-O-sulfation. J. Biol. Chem., 271, 1771117717.
Bame, K.J. and Esko, J.D. (1989) Undersulfated heparan sulfate in a Chinese hamster ovary cell mutant defective in heparan sulfate N-sulfotransferase. J. Biol. Chem., 264, 80598065.
Bernfield, M., Gotte, M., Park, P.W., Reizes, O., Fitzgerald, M.L., Lincecum, J., and Zako, M. (1999) Functions of cell surface heparan sulfate proteoglycans. Ann. Rev. Biochem., 68, 729777.[CrossRef][ISI][Medline]
Borchers, C., Peter, J.F., Hall, M.C., Kunkel, T.A., and Tomer, K.B. (2000) Identification of in-gel digested proteins by complementary peptide-mass fingerprinting and tandem mass spectrometry data obtained on an electrosprayionization quadrupole time-of-flight mass spectrometer. Anal. Chem., 72, 11631168.[CrossRef][ISI][Medline]
Borjigin, J., Deng, J., Sun, X., Jesus, M., Liu, T., and Wang, M.W. (2003) Diurnal pineal 3-O-sulphotransferase 2 expression controlled by ß-andrenergic repression. J. Biol. Chem., 278, 1631516319.
Edge, A.S.B. and Spiro, R.G. (1990) Characterization of novel sequences containing 3-O-sulfated glucosamine in glomerular basement membrane heparan sulfate and localization of sulfated disaccharides to a peripheral domain. J. Biol. Chem., 265, 1587415881.
Edge, A.S.B. and Spiro, R.G. (2000) A specific structural alteration in the heparan sulphate of human glomerular basement membrane in diabetes. Diabetologia, 43, 10561059.[CrossRef][ISI][Medline]
Esko, J.D., and Lindahl, U. (2001) Molecular diversity of heparan sulfate. J. Clin. Invest., 108, 169173.
Grobe, K. and Esko, J.D. (2002) Regulated translation of heparan sulfate GlcNAc N-deacetylase/N-sulfotransferase isozymes by structured 5'-untranslated regions and internal ribosome entry sites. J. Biol. Chem., 277, 3069930706.
Habuchi, H., Habuchi, O., and Kimata, K. (1995) Purification and characterization of heparan sulfate 6-sulfotransferase from the culture medium of Chinese hamster ovary cells. J. Biol. Chem., 270, 4172.
Habuchi, H., Tanaka, M., Habuchi, O., Yoshida, K., Suzuki, H., Ban, K., and Kimata, K. (2000) The occurance of three isoforms of heparan sulfate 6-O-sulfotransferase having different specificities for hexuronic acid adjacent to the targeted N-sulfoglucosamine. J. Biol. Chem., 275, 28592868.
Habuchi, H., Miyake, G., Nogami, K., Kuroiwa, A., Matsuda, Y., Kusche-Gullberg, M., Habuchi, O., Tanaka, M., and Kimata, K. (2003) Biosynthesis of heparan sulphate with diverse structures and functions: two alternatively spliced forms of human heparan sulphate 6-O-sulphotransferase-2 having different expression patterns and properties. Biochem. J., 371, 131142.[CrossRef][ISI][Medline]
HajMohammadi, S., Enjyoji, K., Princivalle, M., Christi, P., Lech, M., Beeler, D.L., Rayburn, H., Schwartz, J.J., Barzegar, S., de Agostini, A.I., and others. (2003) Normal levels of anticoagulant heparan sulfate are not essential for normal hemostasis. J. Clin. Invest., 111, 989999.
Hernaiz, M., Liu, J., Rosenberg, R.D., and Linhardt, R.J. (2000) Enzymatic modification of heparan sulfate on a biochip promotes its interaction with antithrombin III. Biochem. Biophys. Res. Commun., 276, 292297.[CrossRef][ISI][Medline]
Jemth, P., Smeds, E., Do, A.-T., Habuchi, H., Kimata, K., Lindahl, U., and Kusche-Gullberg, M. (2003) Oligosaccharide library-based assessment of heparan sulfate 6-O-sulfotransfer substrate specificity. J. Biol. Chem., forthcoming.
Kobayashi, M., Habuchi, H., Habuchi, O., Saito, M., and Kimata, K. (1996) Purification and characterization of heparan sulfate 2-sulfotransferase from cultured Chinese hamster ovary cells. J. Biol. Chem., 271, 76457653.
Lindahl, U., Kusche-Gullberg, M., and Kjellen, L. (1998) Regulated diversity of heparan sulfate. J. Biol. Chem., 273, 2497924982.
Liu, J. and Rosenberg, R.D. (2002) Heparan sulfate D-glucosaminyl 3-O-sulfotransferase. In N. Taniguchi, and M. Fukuda, Eds., Handbook of glycosyltransferases and their related genes. Tokyo, Springer-Verlag, pp. 475483.
Liu, J. and Thorp, S.C. (2002) Heparan sulfate and the roles in assisting viral infections. Med. Res. Rev., 22, 125.[CrossRef][ISI][Medline]
Liu, J., Shworak, N.W., Fritze, L.M.S., Edelberg, J.M., and Rosenberg, R.D. (1996) Purification of heparan sulfate D-glucosaminyl 3-O-sulfotransferase. J. Biol. Chem., 271, 2707227082.
Liu, J., Shriver, Z., Blaiklock, P., Yoshida, K., Sasisekharan, R., and Rosenberg, R.D. (1999a) Heparan sulfate D-glucosaminyl 3-O-sulfotransferase-3A sulfates N-unsubstituted glucosamine residues. J. Biol. Chem., 274, 3815538162.
Liu, J., Shworak, N.W., Sinaÿ, P., Schwartz, J.J., Zhang, L., Fritze, L.M.S., and Rosenberg, R.D. (1999b) Expression of heparan sulfate D-glucosaminyl 3-O-sulfotransferase isoforms reveals novel substrate specificities. J. Biol. Chem., 274, 51855192.
Liu, J., Shriver, Z., Pope, R.M., Thorp, S.C., Duncan, M.B., Copeland, R.J., Raska, C.S., Yoshida, K., Eisenberg, R.J., Cohen, G., and others. (2002) Characterization of a heparan sulfate octasaccharide that binds to herpes simplex viral type 1 glycoprotein D. J. Biol. Chem., 277, 3345633467.
McKeehan, W.L., Wu, X., and Kan, M. (1999) Requirement for anticoagulant heparan sulfate in the fibroblast growth factor receptor complex. J. Biol. Chem., 274, 2151121514.
McLean, M.W., Bruce, J.S., Long, W.F., and Williamson, F.B. (1984) Flavobacterium heparinum 2-O-sulfatase for 2-O-sulfato-4,5-glycuronate terminated oligosaccharides from heparin. Eur. J. Biochem., 145, 607615.[Abstract]
Miyamoto, K., Asada, K., Fukutomi, T., Okochi, E., Yagi, Y., Hasegawa, T., Asahara, T., Sugimura, T., and Ushijima, T. (2003) Methylation-associated silencing of heparan sulfate D-glucosaminyl 3-O-sulfotransferase-2 (3-OST-2) in human breast, colon, lung and pancreatic cancers. Oncogene, 22, 274280.[CrossRef][ISI][Medline]
Mochizuki, H., Yoshida, K., Gotoh, M., Sugioka, S., Kikuchi, N., Kwon, Y.-D., Tawada, A., Maeyama, K., Inaba, N., Hiruma, T., and others. (2003) Characterization of a heparan sulfate 3-O-sulfotransferase-5 an enzyme synthesizing a tetrasulfated disaccharide. J. Biol. Chem., forthcoming.
Nicola, A.V., Willis, S., Naidoo, N.N., Eisenberg, R.J., and Cohen, G.H. (1996) Structure-function analysis of soluble forms of herpes simplex virus glycoprotein D. J. Virol., 70, 38153822.[Abstract]
Pejler, G., Danielsson, A., Bjork, I., Lindahl, U., Nader, H.B., and Dietrich, C.P. (1987) Structure and antithrombin-binding properties of heparin isolated from the clams Anomalocardia brasiliana and Tivela mactroides. J. Biol. Chem., 262, 1141311421.
Pope, M., Raska, C., Thorp, S.C., and Liu, J. (2001) Analysis of heparan sulfate oligosaccharides by nanoelectrospray ionization mass spectrometry. Glycobiology, 11, 505513.
Reizes, O., Lincecum, J., Wang, Z., Goldberger, O., Huang, L., Kaksonen, M., Ahima, R., Hinkes, M. T., Barsh, G. S., Rauvala, H., and Bernfield, M. (2001) Transgenic expression of syndecan-1 uncovers a physiological control of feeding behavior by syndecan-3. Cell, 106, 105116.[ISI][Medline]
Rosenberg, R.D., Showrak, N.W., Liu, J., Schwartz, J.J., and Zhang, L. (1997) Heparan sulfate proteoglycans of the cardiovascular system: specific structures emerge but how is synthesis regulated? J. Clin. Invest., 99, 20622070.
Sasisekharan, R., Shriver, Z., Venkataraman, G., and Narayanasami, U. (2002) Roles of heparin-sulphate glycosaminoglycans in cancer. Nat. Rev. Cancer, 2, 521528.[CrossRef][ISI][Medline]
Shively, J.E. and Conrad, H.E. (1976) Formation of anhydrosugars in the chemical depolymerization of heparin. Biochemistry, 15, 39323942.[ISI][Medline]
Shukla, D., Liu, J., Blaiklock, P., Shworak, N.W., Bai, X., Esko, J.D., Cohen, G.H., Eisenberg, R.J., Rosenberg, R.D., and Spear, P.G. (1999) A novel role for 3-O-sulfated heparan sulfate in herpes simplex virus 1 entry. Cell, 99, 1322.[ISI][Medline]
Shworak, N.W., Shirakawa, M., Colliec-Jouault, S., Liu, J., Mulligan, R.C., Birinyi, L.K., and Rosenberg, R.D. (1994) Pathway-specific regulation of the biosynthesis of anticoagulantly active heparan sulfate. J. Biol. Chem., 269, 2494124952.
Smeds, E., Habuchi, H., Do, A.-T., Hjertson, E., Grundberg, H., Kimata, K., Lindahl, U., and Kusche-Gullberg, M. (2003) Substrate specificities of mouse heparan sulphate glucosaminyl 6-O-sulfotransferases. Biochem. J., forthcoming.
Sundaram, M., Qi, Y., Shriver, Z., Liu, D., Zhao, G., Venkataraman, G., Langer, R., and Sasisekharan, R. (2003) Rational design of low-molecular weight heparins with improved in vivo activity. Proc. Natl Acad. Sci. USA, 100, 651656.
Wlad, H., Maccarana, M., Eriksson, I., Kjellen, L., and Lindahl, U. (1994) Biosynthesis of heparin. Different molecular forms of O-sulfotransferases. J. Biol. Chem., 269, 2453824541.
Xia, G., Chen, J., Tiwari, V., Ju, W., Li, J.-P., Malmström, A., Shukla, D., and Liu, J. (2002) Heparan sulfate 3-O-sulfotransferase isoform 5 generates both an antithrombin-binding site and an entry receptor for herpes simplex virus, type 1. J. Biol. Chem., 277, 3791237919.
Yamada, S., Murakami, T., Tsuda, H., Yoshida, K., and Sugahara, K. (1995) Isolation of the porcine heparin tetrasaccharides with glucuronate 2-O-sulfate. J. Biol. Chem., 270, 86968705.[ISI][Medline]
Ye, S., Luo, Y., Lu, W., Jones, R.B., Linhardt, R.J., Capila, I., Toida, T., Kan, M., Pelletier, H., and McKeehan, W.L. (2001) Structural basis for interaction of FGF-1, FGF-2, and FGF-7 with different heparan sulfate motifs. Biochemistry, 40, 1442914439.[CrossRef][ISI][Medline]
Zhang, L., Yoshida, K., Liu, J., and Rosenberg, R.D. (1999) Anticoagulant heparan sulfate precursor structures in F9 embryonic carcinoma cells. J. Biol. Chem., 274, 56815691.
Zhang, L., Beeler, D.L., Lawrence, R., Lech, M., Liu, J., Davis, J.C., Shriver, Z., Sasisekharan, R., and Rosenberg, R.D. (2001a) 6-O-sulfotransferase-1 represents a critical enzyme in the anticoagulant heparan sulfate biosynthetic pathway. J. Biol. Chem., 276, 4231142321.
Zhang, L., Lawrence, R., Schwartz, J.J., Bai, X., Wei, G., Esko, J.D., and Rosenberg, R.D. (2001b) The effect of precursor structures on the action of glucosaminyl 3-O-sulfotransferase-1 and the biosynthesis of anticoagulant heparan sulfate. J. Biol. Chem., 276, 2880628813.