2Departments of Cardiovascular-Thoracic Surgery and Immunology, Rush University, 1653 West Congress Parkway, Chicago, IL 60612, USA and 3Institute of Gene Therapy, University of Pennsylvania, M6. 30 Malony, Philadelphia, PA 19104, USA
Received on September 12, 2001; accepted on October 8, 2001.
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: 1,3galactosyltransferase/
-gal epitope/adenovirus transduction/anti-Gal/Golgi
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The enzyme was found to reside within the trans-Golgi network in the same compartment as 2,3sialyltransferase (Smith et al., 1990
). The
1,3GT cDNA was cloned initially simultaneously from mouse (Larsen et al., 1989
) and bovine (Joziasse et al., 1989
) cDNA libraries and the organization of the
1,3GT gene was elucidated in the mouse genome (Joziasse et al., 1992
). Analysis of the
-gal epitope expression and of
1,3GT activity in a large number of species revealed a striking pattern of distribution. This enzyme and its product are abundant in nonprimate mammals, prosimians, and New World monkeys (Galili et al., 1987a
, 1988; Thall et al., 1991
). In contrast, nonmammalian vertebrates, Old World monkeys, apes, and humans lack
1,3GT and
-gal epitopes. These findings suggested that
1,3GT appeared early in mammalian evolution, as it is found both in marsupial and placental mammals, and it was inactivated in ancestral Old World primates (Galili et al., 1988
). Nevertheless, the
1,3GT gene is present in humans, apes, and Old World monkeys as a pseudogene that does not undergo transcription (Joziasse et al., 1989
, 1991; Larsen et al., 1990
; Galili and Swanson, 1991
). Comparative studies on the sequences of the pseudogene in primates suggested that the
1,3GT gene was inactivated in ancestral Old World primates 2025 million years ago (Joziasse et al., 1991
; Galili and Swanson, 1991
; Galili and Andrews, 1995
).
Whereas humans, apes, and Old World monkeys lack 1,3GT and
-gal epitopes, they produce large amounts of a natural antibody against the
-gal epitope (Galili et al., 1987a
). This antibody, designated anti-Gal, constitutes as much as 1% of circulating antibodies (Galili et al., 1984
), and it binds specifically to
-gal epitopes on glycoconjugates (Galili et al., 1985
, 1987b). This distribution of anti-Gal and
-gal epitopes in mammals has generated a major barrier for the transplantation of mammalian organs (e.g., pig heart or kidney) into humans (xenotransplantation). This is because the binding of circulating anti-Gal to
-gal epitopes on pig cells results in the rapid immune rejection of pig organs transplanted in humans, or in monkeys (Good et al., 1992
; Galili, 1993
; Sandrin et al., 1993
; Collins et al., 1995
).
We have proposed to exploit this interaction between anti-Gal and -gal epitopes for increasing the immunogenicity of autologous tumor vaccines in humans by engineering human tumor cells to express
-gal epitopes (LaTemple et al., 1996
; Galili and LaTemple, 1997
). This increased immunogenicity occurs because the in situ binding of the natural anti-Gal antibody to
-gal epitopes de novo expressed on the vaccinating autologous human tumor cells targets these cells for effective uptake by antigen-presenting cells. This, in turn, may result in the generation of an effective immune response against tumor-associated antigens and the subsequent destruction of metastatic tumor cells. The efficacy of autologous tumor vaccines engineered to express
-gal epitopes was recently demonstrated in the experimental animal model of
1,3GT knockout mouse and with the highly tumorigenic mouse melanoma cell line B16-BL6 (LaTemple et al., 1999
).
One of strategies we have explored for expression of -gal epitopes in human tumor cells involves the transduction of such cells with a replication defective adenovirus vector containing the open reading frame (ORF) of mouse
1,3GT gene. The experience gained in transduction of glycosyltransferases by adenovirus vector has been limited to the transduction of fucosyltransferase (Nagasaka et al., 1998
; Baboval et al., 2000
) and of sialyltransferase (Abe et al., 1999
) to increase their expression in cells that already have these enzymes as endogenous enzymes. The present study, demonstrating transduction of
1,3GT into human HeLa cells, is novel in that the transduced cells completely lack the enzyme as an endogenous glycosytransferase. Because the viral genome enters rapidly into the transduced cells, we could closely follow for the first time the kinetics of the appearance of
1,3GT mRNA, the production of the catalytically active enzyme within the cells and initial appearance of the product of this enzyme, that is, the
-gal epitope, on cell surface glycoconjugates. The information gained from this study enabled us to construct a precise timeline for the expression of glycosyltransferase genes and the biosynthesis and transport of their carbohydrate products to the surface of the cell.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Viral 1,3GT DNA.
Transduced HeLa cells were obtained after 10, 30, 60, and 120 min of incubation with the virus vector, and the presence of the viral 1,3GT gene was determined by polymerase chain reaction (PCR) of the ORF (1118 bp). Whereas the DNA from untransduced HeLa cells did not yield a PCR product, DNA from HeLa cells incubated for the short period of 10 min yielded a positive PCR product (Figure 1A). These findings imply that Ad
GT binds to its corresponding receptor on HeLa cells very fast. Thus, it is probable that the virus genome including
1,3GT gene penetrates into the cell by the first hour of incubation.
|
1,3GT mRNA.
To analyze the transcription of 1,3GT within the transduced cells, the extracted RNA from 2 x 106 cells was treated with endonucleases to cleave the DNA, then subjected to reverse transcriptase (RT)-PCR with the same primers as those used above for the amplification of ORF of
1,3GT. As shown in Figure 1B, a positive RT-PCR product was observed only with RNA preparations obtained 4 h or more posttransduction. Two controls were used in the experiment: (1) Analysis of the quality of extracted RNA: the cultures incubated for 3 h or less had sufficient amounts of mRNA for the template, as indicated by the amplification of the ß-actin mRNA (Figure 1B). (2) Analyses for false-positive RT-PCR reactions: to determine the complete digestion of DNA template, the RNA preparations were assayed for uncleaved
1,3GT DNA by direct PCR. No PCR products were detected following direct PCR of any of the mRNA preparations (data not shown). These findings imply that despite rapid entry of Ad
GT into the cells, completion of
1,3GT gene transcription appears to occur
4 h after the initial exposure of the cells to the transducing virus vector.
Appearance of 1,3GT enzyme in the transduced cells
The catalytic activity of the de novo produced 1,3GT within transduced HeLa cells was analyzed in cell lysates with a sugar acceptor that is similar to the physiologic intracellular sugar acceptor, that is, N-linked carbohydrate chains that have terminal N-acetyllactosamine units on solid-phase asialofetuin and UDP-Gal as sugar donor (LaTemple et al., 1996
). The de novo synthesized
-gal epitopes were identified by the subsequent specific binding of the monoclonal anti-Gal antibody M86 (Galili et al., 1998
). This assay was found to be very sensitive, as it could detect the enzyme activity in a lysate of as few as 7.5 x 104 cells/ml, 24 h posttransduction (Figure 2). In contrast, original HeLa cells completely lacked any enzyme activity. Transduced HeLa cells assayed for
1,3GT activity up to 5 h posttransduction also were completely devoid of enzyme activity. However,
1,3GT appeared in the cells 6 h posttransduction (Figure 2). At this time point the activity of the enzyme was approximately 60-fold lower than that observed 24 h posttransduction.
|
|
As shown in Figure 4, HeLa cells transduced with the control adenovirus vector (1 x 1010 MOI/ml), lacking 1,3GT cDNA, and assayed 24 h posttransduction, bound no M86 (i.e., no inhibition of M86 binding to
-gal BSA), implying complete lack of
-gal epitopes. Similarly, HeLa cells transduced with Ad
GT at a concentration of 1 x 1010 MOI/ml for up to 8 h expressed no
-gal epitopes. However,
-gal epitopes appeared on the transduced cells 10 h posttransduction, as indicated by the distinct inhibition of M86 binding to
-gal BSA at 40 x 106 cells/ml. This inhibition was higher in cells assayed 12 h posttransduction and further increased after 24 h, implying increased expression of
-gal epitopes on the cells.
|
Correlation between the number of AdGT copies,
1,3GT activity, and
-gal epitope expression in transduced HeLa cells
To determine whether there is a direct correlation between the number of AdGT copies, the activity of
1,3GT within the transduced HeLa cells, and the number of
-gal epitopes expressed per cell, the cells were transduced with Ad
GT at different concentrations of the vector (i.e., 1 x 1010, 1 x 109, 1 x 108, and 1 x 107 MOI/ml). After 4 h incubation, fresh medium was added to the cells, which were further cultured for a total period of 24 h. At the end of incubation, the cells were harvested and studied for the number of Ad
GT copies, the activity of
1,3GT, and the number of
-gal epitopes/cell. The number of Ad
GT copies was determined by limiting dilution PCR of exon 9 of the mouse
1,3GT gene and comparing the end point to that of mouse DNA-yielding PCR product. As shown in Figure 5, cells transduced with the original suspension of 1 x 1010 MOI/ml virus vector contained
20 copies of the
1,3GT gene per cell. This is based on the finding that the end point of DNA amount yielding a PCR product (0.1 ng) was
10-fold higher than that found with mouse DNA (i.e., DNA containing two copies of the gene per cell). The number of Ad
GT copies decreased proportionally to the concentration of the Ad
GT vector in the transducing suspension. It was found to be
2 copies/cell in cells incubated with 1 x 109 MOI/ml of the adenovirus vector,
0.2 copies/cell in cells incubated with 1 x 108 MOI/cell (i.e., one copy per five cells), and
0.02 copies/cell (i.e., one copy per 50 cells) in cells incubated with 1 x 107 MOI/ml (Figure 5).
|
|
As shown in Figure 7, the cells that underwent three cell divisions (i.e., 5-day cultures), expressed 75% less -gal epitopes than the original number of epitopes observed 24 h posttransduction. Thus, proliferation of one cell into eight cells resulted in the in decrease in
-gal epitope expression. This suggests that the initial number of
1,3GT gene copies introduced into the HeLa cells by Ad
GT is not maintained in the proliferating cells but decreases along with the cell divisions. An additional fourfold decrease in the number of
-gal epitopes was further observed in cells undergoing 5 divisions, whereas no epitopes were observed after 10 divisions, that is, proliferation of each cell into 1000 cells within 14 days.
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
To synthesize -gal epitopes on glycoconjugates, this de novo produced enzyme has to be transported to the trans-Golgi network. Previous studies on transport of proteins from the RER to the Golgi apparatus demonstrated that this process takes 23 h (Rothman and Orci, 1992
). Thus it is probable that
1,3GT reaches the trans-Golgi network
8 h posttransduction. The detection of cell surface
-gal epitopes 10 h posttransduction, further suggests that the first glycoconjugates carrying de novo synthesized
-gal epitopes within the trans-Golgi network reach the cell surface within
2 h after the synthesis of this carbohydrate epitope (Figure 9).
Whereas the activation of the 1,3GT gene within Ad
GT by CMV promoter is much faster than that of the cellular
1,3GT gene by retinoic acid (Cho et al., 1996
), it is probable that the translation of the mRNA and the synthesis of
-gal epitopes are independent of the source of the gene. Therefore, the timeline in Figure 9 is likely to reflect the general timeline for production of glycosyltransferases from mRNA and the subsequent synthesis of the corresponding carbohydrate units within the Golgi apparatus.
Although the 1,3GT cDNA introduced by the Ad
GT vector does not integrate into the genomic DNA, it is stable within the nucleus for more than 1 week and does not seem to be affected significantly by endonucleases within the cell. This is implied from detection of the transduced
1,3GT gene, 9 days posttransduction. Nevertheless, the Ad
GT vector does not seem to replicate but is divided between the daughter cells. This is suggested by the observation that the expression of
-gal epitope decreases from 2 x 106 epitopes/cell in the transduced cells, to 0.4 x 106 epitopes/cell on each of the eight daughter cells generated from three successive divisions of a cell. The subsequent decrease of
-gal epitopes expression after 5 divisions and the lack of such epitopes after 10 divisions (i.e., the original cell proliferating into
1000 cells), further supports this assumption.
The extent of transduction by AdGT correlated with the enzyme activity within the HeLa cells. The relative amount of
1,3GT within the Golgi apparatus of cells incubated with Ad
GT at 1 x 1010 MOI/ml was approximately 10-fold higher than that in cells incubated with Ad
GT at 1 x 109 MOI/ml and 100-fold higher than that in cells incubated with Ad
GT at 1 x 108 MOI/ml, respectively. This further correlated with the number of transducing copies of the vector per cell as well. Nevertheless, the number of
-gal epitopes/cell was significantly higher than that expected if there would have been direct correlation between the enzyme activity and carbohydrate expression. Thus HeLa cells transduced by the vector at 1 x 109 MOI/ml had half the number of epitopes on cells transduced with 1 x 1010 MOI/ml. These data suggest that the concentration of
1,3GT may decrease within the Golgi apparatus by several-fold with no parallel decrease in the expression of the
-gal epitope on the cell membrane. Thus the amount of
1,3GT seems to be above a saturation level for maximum synthesis of
-gal epitopes. It is also probable that the competition between sialyltransferase and
1,3GT within the trans-Golgi network (Smith et al., 1990
) also limits the number of produced
-gal epitopes.
The study of transduction by AdGT may also be of clinical significance because the transduced cells expressing
-gal epitopes bind human natural anti-Gal IgG molecules. It remains to be determined whether similar transduction of freshly obtained tumor cells from cancer patients, by the Ad
GT vector, results in expression of a sufficient number of
-gal epitopes to enable effective in vivo binding of anti-Gal. Hypothetically, if the de novo expression of these epitopes is sufficient, such cells may be considered for studies as autologous tumor vaccines, in which the in situ binding of anti-Gal to these
-gal epitopes, targets the vaccinating cells to antigen-presenting cells. Such targeting may ultimately result in increased immune response against tumor antigens on the vaccinating cells and the possible destruction of metastatic cells expressing these antigens (LaTemple et al., 1996
, 1999; Galili and LaTemple, 1997
).
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The study was performed with HeLa cells, which originate from a human cervical carcinoma and purchased from American Tissue Typing Cell Collection. The cells were grown in Dulbeccos modified Eagle medium supplemented with 10% heat-inactivated fetal calf serum and antibiotics. All cell incubations with the viral vector were performed in this medium, as well.
Construction of AdGT vector
The ORF of the mouse 1,3GT cDNA was inserted into a replication defective adenovirus vector, in which the early genes E1 and E3 were deleted as previously described (Gao et al., 1996
). This was achieved by the use of a pAd shuttle plasmid containing the
1,3GT cDNA that allows for homologous recombination of the cDNA into the replication defective adenovirus vector. In addition, the cells that propagated the virus were of the human kidney cell line 293 (ATCC) which contains the E1 complementing viral gene. To generate pAd shuttle plasmid containing
1,3GT cDNA, the ORF of
1,3GT mRNA was amplified by RT-PCR of mouse RNA, based on the sequence described by Larsen et al. (1989)
. This PCR product was ligated into pAdCMVlink by the use of Hind III and blunted Spe I sites. This plasmid contains adenovirus sequence map unit (m.u.) 01, which includes the 5' inverted terminal repeat and the packaging signal, a CMV promoter for the effective expression of the inserted gene in mammalian cells, a multiple cloning site, an SV40 polyadenylation site, and flanking regions to the E1 genes of adenovirus (m.u. 916) for homologous recombination (Gao et al., 1996
; Davis et al., 1998
). The pAdCMV-
1,3 GT plasmid was cotransfected into 293 cells with Cla Idigested H5.030CMVEGFP viral backbone containing deletions in map units 19 of the E1 region and in E3 region (Davis et al., 1998
) to create a hybrid viruses by homologous recombination of the regions flanking the viral E1 gene. Recombinant plaques were initially isolated through green/white selection (Davis et al., 1998
). The positive plaque was plaque-purified and grown up in 293 cells for CsCl gradient purification (Gao et al., 1996
). Subsequently, each of the viral clones was assayed for presence of
1,3GT cDNA that produces catalytically active enzyme, by transduction of 293 cells and analysis of
-gal epitope expression after 24 h by flow cytometry following BS lectin binding, as described below. Like other human cells, 293 cells also lack
-gal epitopes. Expression of this epitope following transduction indicated that the assayed adenovirus vector contained the intact
1,3GT cDNA. The viral clone proven to induce expression of
-gal epitopes was designated Ad
GT and was further propagated in the 293 cells and used for transduction of HeLa cells, as described below.
The concentration of AdGT was determined as MOI units per ml and defined as the highest dilution of adenovirus vector that displayed cytopathic effects in 293 cells, 6 days postinfection. The assay was performed in 24 well plates containing 293 monolayers and incubated with Ad
GT suspensions at 10-fold serial dilutions. The cytopathic effects of the replicating virus within the cells was determined as rounding of the cells and detachment from the well followed by cell lysis.
Transduction of HeLa cells by AdGT
HeLa cell monolayers were incubated with AdGT at various concentrations of the viral vector for 4 h at 37°C. Subsequently, culture medium was added to dilute the Ad
GT suspension fivefold and cell monolayers were incubated for additional 20 h. In monolayers incubated for several days, the culture medium was changed 24 h posttransduction.
PCR analysis of transduced 1,3GT DNA and mRNA
The transduced 1,3GT cDNA was detected by PCR with the following primers that amplify the ORF of the mouse gene (Larsen et al., 1989
): 5'ATGAATGTCAAGGGAAAAG and 3'TCAGACATTATTTCTAACCA. For this purpose DNA was extracted from cells and subjected as 100 ng to PCR with these primers for 40 cycles, each including 30 s at 94°C, 20 s at 62°C, and 20 s at 72°C. The first cycle included 5 min at 94°C to achieve complete denaturation of the DNA. For quantifying the number of Ad
GT copies within the transduced cells, the extracted DNA was subjected to PCR at different amounts of DNA template, and the end point was compared to that observed in mouse cells containing two copies of this gene in their genome.
For analysis of 1,3GT transcription in the transduced cells, the RNA was extracted and the contaminating DNA was destroyed by endonuclease. cDNA was generated by the use of reverse transcriptase with random hexamers. Subsequently, PCR was performed, as described above. To confirm complete elimination of any contaminating Ad
GT DNA, the isolated RNA was shown to lack any template for direct PCR with the two primers described above.
Estimation of the number of AdGT copies in transduced cells
Cells were detached 24 h posttransduction and DNA extracted. PCR was performed with DNA at different amounts. The primers used, amplified exon 9 of the mouse 1,3GT gene, which corresponds to the catalytic domain of the gene (Joziasse et al., 1992
; Henion et al., 1994
). The primers used to amplify exon 9 were 5'AGACTTTCTGGAGTCTGCTGACAT and 3'TCAGATATTAAAAGTGTCAAGGTA. The DNA amounts used for PCR ranged from 100 ng to 0.01 ng per reaction at serial 10-fold dilutions, and the end point for PCR product was determined. The results were compared to PCR products obtained with various amounts of mouse genomic DNA. The number of copies of Ad
GT was estimated by comparing the lowest amount of DNA from transduced cells that yielded a positive PCR, with the lowest amount of mouse DNA yielding PCR, that is, DNA containing two copies of the gene.
Analysis of 1,3GT activity in transduced HeLa cells
The activity of 1,3GT produced in the transduced cells was assessed in an assay that simulates the synthesis of
-gal epitopes on glycoproteins within the Golgi apparatus, as we have previously described (LaTemple et al., 1996
). The assay was based on the ability of the enzyme to transfer galactose from the sugar donor UDP-Gal to terminal N-acetyllactosamine residues on N-linked carbohydrate chains of asialofetuin. Fetuin is a protein obtained from fetal calf serum that carries three N-linked carbohydrate chains, on which the terminal N-acetyllactosamine residues are capped by sialic acid (Green et al., 1988
). The removal of these sialic acid units exposes nine N-acetyllactosamine residues that function as sugar acceptors. Synthesized
-gal epitopes were identified by a nonradioactive assay in which the monoclonal anti-Gal antibody M86 (Galili et al., 1998
) binds to the de novo synthesized epitopes and the binding is measured by ELISA. Desialylation of fetuin was performed by incubation of fetuin in 50 mM sulfuric acid at 80°C for 2 h and subsequent repeated dialysis (LaTemple et al., 1996
). Asialofetuin (20 µg/ml) in carbonate buffer (pH 9.5) was used to coat microtiter ELISA plates. Subsequently, the wells were blocked with 1% BSA in carbonate buffer.
HeLa cells transduced by AdGT were detached from the tissue culture flasks by 1 mM EDTA in PBS, washed with saline, and frozen as pellets each containing 2 x 106 cells. The pelleted cells were lysed by resuspension in 0.1 ml of enzyme buffer (25 mM 2-[N-morpholino]ethan sulfonate in saline, 25 mM MnCl2, and 1 mM UDP-Gal, pH 6.2) containing 0.5% Triton X-100. The cells were incubated for 20 min at 37°C with occasional vortexing for achieving complete lysis. Subsequently, the lysates were centrifuged to remove the particulated material. The supernatants were assayed for
1,3GT activity by serial twofold dilutions in enzyme buffer as above, which contained 0.05% Triton X-100 instead of 0.5% of the detergent. The diluted supernatants of the cell lysates were incubated in the ELISA plates coated with asialofetuin at 50 µl/well for 2 h at 37°C. The plates were then washed and incubated for 2 h with the monoclonal anti-Gal antibody M86 (Galili et al., 1998
). At the end of incubation the antibody was removed, and the plates were washed and incubated with HRP-conjugated anti-mouse IgM as secondary antibodies for 1 h at room temperature. After additional washing the color reaction with O-phenylenediamine was measured at 492 nm. The monoclonal anti-Gal binds in the ELISA assay only to wells in which
-gal epitopes were synthesized by the de novo produced
1,3GT. The enzyme activity was expressed as the optical density units measured in wells containing the enzyme within supernatants of cell lysates at various concentrations of the cells.
Flow cytometry analysis of -gal epitope expression on transduced HeLa cells
HeLa cells were incubated at a concentration of 1 x 106 cells/ml for 2 h at 4°C with 10 µg/ml FITCBS-lectin in PBS containing 1% BSA. This lectin binds specifically to -gal epitopes (Wood et al., 1979
). Cells were then washed three times with PBS, fixed and analyzed in FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA), as we have previously described (Gorelik et al., 1995
). Similar studies were performed with cells incubated with purified human anti-Gal (Galili et al., 1985
, 1987a,b) (10 µg/ml), followed by phycoerythrine-conjugated rabbit anti-human IgG (Dako, Denmark).
Quantifying -gal epitope expression on transduced cells
Detection of -gal epitopes de novo expressed on transduced cells was performed by the ELISA inhibition assay, in which the number of
-gal epitopes per cell could be determined by the subsequent binding of the monoclonal anti-Gal antibody M86 (Galili et al., 1998
; Stone et al., 1998
; Chen et al., 2001
). This assay, which is analogous to radioimmunoassays, is the most sensitive assay for quantifying
-gal epitopes on cells (Galili et al., 1998
) and is a modification of the original assay for measuring
-gal epitope expression on soluble glycoproteins (Thall and Galili, 1990
).
The assayed cells were brought to a concentration of 40 x 106 cells/ml and subjected to serial twofold dilutions in 100-µl aliquots of PBS containing 1% BSA. The cells in each dilution were mixed with equal volume of monoclonal anti-Gal M86 at the final dilution of 1:100 of the antibody. This concentration of the antibody yields ELISA absorption results at the slope of the binding curve. The mixture was incubated overnight at 4°C with constant rotation to enable maximum binding of the antibody to -gal epitopes. Subsequently, the cells with bound M86 IgM molecules were removed by centrifugation, and the activity of free M86 remaining in the supernatant was determined by ELISA with
-gal BSA as solid phase antigen, using HRP-conjugated goat anti-mouse IgM antibody as secondary antibody.
The cells expressing -gal epitopes bind the antibody proportionally to the number of
-gal epitopes expressed on the cell. Therefore, the amount of free M86 antibody remaining in the supernatant is inversely proportional to the number of epitopes per cell. By comparing the binding of M86 to cells with known number of
-gal epitopes per cell (standard cells) to that of the antibody binding to the assayed cells, it is possible to determine the number of
-gal epitopes per cell. Rabbit red cells were used as the standard cells because they were previously shown to express 2 x 106
-gal epitopes per cell (Galili et al., 1998
). Thus, if the transduced cells are 10-fold less effective than rabbit red cells in the ELISA inhibition assay (i.e., 10-fold higher concentration of transduced HeLa cells than that of rabbit red cells is required for 50% inhibition of anti-Gal M86 binding to
-gal BSA in ELISA), the number of
-gal epitopes on the tested cells is approximately 2 x 105 per cell.
![]() |
Acknowledgments |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Abbreviations |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Baboval, T., Crandall, J.E., Kinnally, E., Chou, D.K., and Smith, F.I. (2000) Restriction of high CD15 expression to a subset of rat cerebellar astroglial cells can be overcome by transduction with adenoviral vectors expressing the rat 1, 3-fucosyltransferase IV gene. Glia, 31, 144154.[CrossRef][ISI][Medline]
Basu, M. and Basu, S. (1973) Enzymatic synthesis of a blood group B-related pentaglycosylceramide by an -galactosyltransferase from rabbit bone marrow. J. Biol. Chem., 248, 17001706.
Betteridge, A. and Watkins, W.M. (1983) Two -3-D-galactosyltransferases in rabbit stomach mucosa with different acceptor substrate specificities. Eur. J. Biochem. 132, 2935.[Abstract]
Blake, D.A. and Goldstein, I.J. (1981) An -D-galactosyltransferase activity in Ehrlich ascites tumor cells. Biosynthesis and characterization of a trisaccharide (
-D-galactose-(1 goes to 3)-N-acetyllactosamine). J. Biol. Chem., 256, 53875393.
Blanken, W.M. and Van den Eijnden, D.H. (1985) Biosynthesis of terminal Gal 1-3Gal ß1-4GlcNAc-R oligosaccharide sequences on glycoconjugates. Purification and acceptor specificity of a UDP-Gal:N-acetyllactosaminide
1-3-galactosyltransferase from calf thymus. J. Biol. Chem., 260, 1292712934.
Chen, Z.C., Tanemura, M., and Galili, U. (2001) Synthesis of -gal epitopes (Gal
1-3 Galß1-4GlcNAc-R) on human tumor cells by recombinant
1, 3galactosyltransferase produced in Pichia pastoris. Glycobiology, 11, 577586.
Cho, S.K., Yeh, J., Cho, M., and Cummings, R.D. (1996) Transcriptional regulation of 1, 3-galactosyltransferase in embryonal carcinoma cells by retinoic acid. Masking of Lewis X antigens by
-galactosylation. J. Biol. Chem., 271, 32383246.
Collins, B.H., Cotterell, A.H., McCurry, K.R., Alvarado, C.G., Magee, J.C., Parker, W., and Platt, J.L. (1995) Cardiac xenografts between primate species provide evidence for the importance of the -galactosyl determinant in hyperacute rejection. J. Immunol., 154, 55005510.
Cummings, R.D. and Mattox, S.A. (1988) Retinoic acid-induced differentiation of the mouse teratocarcinoma cell line F9 is accompanied by an increase in the activity of UDP-galactose: ß-D-galactosyl- 1, 3-galactosyltransferase. J. Biol. Chem., 263, 511519.
Davis, A.R., Meyers, K., and Wilson, J.M. (1998) High throughput method for creating and screening recombinant adenoviruses. Gene Ther., 5, 11481152.[CrossRef][ISI][Medline]
Galili, U. (1993) Interaction of the natural anti-Gal antibody with -galactosyl epitopes: a major obstacle for xenotransplantation in humans. Immunol. Today, 14, 480482.[CrossRef][ISI][Medline]
Galili, U. and Anaraki, F. (1995) -Galactosyl (Gal
1-3Gaß1-4GlcNAc-R) epitopes on human cells: synthesis of the epitope on human red cells by recombinant primate
1, 3galactosyltransferase expressed in E. coli. Glycobiology, 5, 775782.[Abstract]
Galili, U. and Andrews, P. (1995) Suppression of -galactosyl epitopes synthesis and production of the natural anti-Gal antibody: a major evolutionary event in ancestral Old World primates. J. Human Evol., 29, 433442.
Galili, U. and LaTemple, D.C. (1997) Natural anti-Gal antibody as a universal augmenter of autologous tumor vaccine immunogenicity. Immunol. Today, 18, 281285.[ISI][Medline]
Galili, U. and Swanson, K. (1991) Gene sequences suggest inactivation of 1, 3-galactosyltransferase in catarrhines after the divergence of apes from monkeys. Proc. Natl Acad. Sci. USA, 88, 74017404.[Abstract]
Galili, U., Clark, M.R., Shohet, S.B., Buehler, J., and Macher, B.A. (1987a) Evolutionary relationship between the natural anti-Gal antibody and the Gal 1-3Gal epitope in primates. Proc. Natl Acad. Sci. USA, 84, 13691373.[Abstract]
Galili, U., Buehler, J., Shohet, S.B., and Macher, B.A. (1987b) The human natural anti-Gal IgG. III. The subtlety of immune tolerance in man as demonstrated by crossreactivity between natural anti-Gal and anti-B antibodies. J. Exp. Med., 165, 693704.[Abstract]
Galili, U., LaTemple, D.C., and Radic, M.Z. (1998) A sensitive assay for measuring -Gal epitope expression on cells by a monoclonal anti-Gal antibody. Transplantation, 65, 11291132.[ISI][Medline]
Galili, U., Macher, B.A., Buehler, J., and Shohet, S.B. (1985) Human natural anti--galactosyl IgG. II. The specific recognition of
(1-3)-linked galactose residues. J. Exp. Med., 162, 573582.[Abstract]
Galili, U., Rachmilewitz, E.A., Peleg, A., and Flechner, I. (1984) A unique natural human IgG antibody with anti--galactosyl specificity. J. Exp. Med., 160, 15191531.[Abstract]
Galili, U., Shohet, S.B., Kobrin, E., Stults, C.L., and Macher, B.A. (1988) Man, apes, and Old World monkeys differ from other mammals in the expression of -galactosyl epitopes on nucleated cells. J. Biol. Chem., 263, 1775517762.
Gao, G.P., Yang, Y., and Wilson, J.M. (1996) Biology of adenovirus vectors with E1 and E4 deletions for liver-directed gene therapy. J. Virol., 70, 89348943.[Abstract]
Good, A.H., Cooper, D.K., Malcolm, A.J., Ippolito, R.M., Koren, E., Neethling, F.A., Ye, Y., Zuhdi, N., and Lamontagne, L.R. (1992) Identification of carbohydrate structures that bind human antiporcine antibodies: implications for discordant xenografting in humans. Transplant Proc., 24, 559562.[ISI][Medline]
Gorelik, E., Duty, L., Anaraki, F., and Galili, U. (1995) Alterations of cell surface carbohydrates and inhibition of metastatic property of murine melanomas by 1, 3 galactosyltransferase gene transfection. Cancer Res., 55, 41684173.[Abstract]
Greber, U.F., Willetts, M., Webster, P., and Helenius, A. (1993) Stepwise dismantling of adenovirus 2 during entry into cells. Cell, 75, 477486.[ISI][Medline]
Green, E.D., Adelt, G., Baenziger, J.U., Wilson, S., and Van Halbeek, H. (1988) The asparagine-linked oligosaccharides on bovine fetuin. Structural analysis of N-glycanase-released oligosaccharides by 500-megahertz 1H NMR spectroscopy. J. Biol. Chem., 263, 1825318268.
Henion, T.R., Macher, B.A., Anaraki, F., and Galili, U. (1994) Defining the minimal size of catalytically active primate 1, 3 galactosyltransferase: structure-function studies on the recombinant truncated enzyme. Glycobiology, 4, 193201.[Abstract]
Joziasse, D.H., Shaper, J.H., Jabs, E.W., and Shaper, N.L. (1991) Characterization of an 1-3-galactosyltransferase homologue on human chromosome 12 that is organized as a processed pseudogene. J. Biol. Chem., 266, 69916998.
Joziasse, D.H., Shaper, J.H., Van den Eijnden, D.H., Van Tunen, A.J., and Shaper, N.L. (1989) Bovine 1-3-galactosyltransferase: isolation and characterization of a cDNA clone. Identification of homologous sequences in human genomic DNA. J. Biol. Chem., 264, 1429014297.
Joziasse, D.H., Shaper, N.L., Kim, D., Van den Eijnden, D.H., and Shaper, J.H. (1992) Murine 1, 3-galactosyltransferase. A single gene locus specifies four isoforms of the enzyme by alternative splicing. J. Biol. Chem., 267, 55345541.
Larsen, R.D., Rajan, V.P., Ruff, M.M., Kukowska-Latallo, J., Cummings, R.D., and Lowe, J.B. (1989) Isolation of a cDNA encoding a murine UDPgalactose:ß-D-galactosyl- 1, 4-N-acetyl-D-glucosaminide -1, 3-galactosyltransferase: expression cloning by gene transfer. Proc. Natl. Acad. Sci. USA, 86, 82278231.[Abstract]
Larsen, R.D., Rivera-Marrero, C.A., Ernst, L.K., Cummings, R.D., and Lowe, J.B. (1990) Frameshift and nonsense mutations in a human genomic sequence homologous to a murine UDP-Gal:ß-D-Gal(1, 4)-D-GlcNAc (1, 3)-galactosyltransferase cDNA. J. Biol. Chem., 265, 70557061.
LaTemple, D.C., Abrams, J.T., Zhang, S.Y., and Galili, U. (1999) Increased immunogenicity of tumor vaccines complexed with anti-Gal: studies in knockout mice for 1, 3galactosyltransferase. Cancer Res., 59, 34173423.
LaTemple, D.C., Henion, T.R., Anaraki, F., and Galili, U. (1996) Synthesis of -galactosyl epitopes by recombinant
1, 3galactosyl transferase for opsonization of human tumor cell vaccines by anti-galactose. Cancer Res., 56, 30693074.[Abstract]
Nagasaka, T., Hayashi, S., Tachi, Y., Liu, D., Koike, C., Namii, Y., Katayama, A., Negita, M., Kobayashi, T., Hamada, H., and others. (1998) Inhibitory effect of alpha(1, 2) fucosyltransferase recombinant adenoviral vector on Gal expression. Transplant Proc., 30, 38373838.[CrossRef][ISI][Medline]
Rothman, J.E. and Orci, L. (1992) Molecular dissection of the secretory pathway. Nature, 355, 409415.[CrossRef][ISI][Medline]
Sandrin, M.S., Vaughan, H.A., Dabkowski, P.L., and McKenzie, I.F. (1993)Anti-pig IgM antibodies in human serum react predominantly with Gal( 1-3)Gal epitopes. Proc. Natl Acad. Sci. USA, 90, 1139111395.[Abstract]
Smith, D.F., Larsen, R.D., Mattox, S., Lowe, J.B., and Cummings, R.D. (1990) Transfer and expression of a murine UDP-Gal:ß-D-Gal-1, 3-galactosyltransferase gene in transfected Chinese hamster ovary cells. Competition reactions between the
1, 3-galactosyltransferase and the endogenous
2, 3-sialyltransferase. J. Biol. Chem., 265, 62256234.
Stone, K.R., Ayala, G., Goldstein, J., Hurst, R., Walgenbach, A., and Galili, U. (1998) Porcine cartilage transplants in the cynomolgus monkey. III. Transplantation of -galactosidase-treated porcine cartilage. Transplantation, 65, 15771583.[ISI][Medline]
Thall, A. and Galili, U. (1990) Distribution of Gal 1-3Gal ß1-4GlcNAc residues on secreted mammalian glycoproteins (thyroglobulin, fibrinogen, and immunoglobulin G) as measured by a sensitive solid-phase radioimmunoassay. Biochemistry, 29, 39593965.[ISI][Medline]
Thall, A., Etienne-Decerf, J., Winand, R.J., and Galili, U. (1991) The -galactosyl epitope on mammalian thyroid cells. Acta Endocrinol., 124, 692699.[ISI][Medline]
Wood, C., Kabat, E.A., Murphy, L.A., and Goldstein, I.J. (1979) Immunochemical studies of the combining sites of the two isolectins, A4 and B4, isolated from Bandeiraea simplicifolia. Arch. Biochem. Biophys., 198, 111.[ISI][Medline]