Sulfation of sialyl N-acetyllactosamine oligosaccharides and fetuin oligosaccharides by keratan sulfate Gal-6-sulfotransferase

Takayoshi Torii, Masakazu Fukuta and Osami Habuchi1

Department of Life Science, Aichi University of Education, Igaya-cho, Kariya, Aichi 448–8542, Japan

Received on June 3, 1999; revised on July 19, 1999; accepted on July 21, 1999.


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
We have previously cloned keratan sulfate Gal-6-sulfotransferase (KSGal6ST), which transfers sulfate from 3'-phosphoadenosine 5'-phosphosulfate to position 6 of Gal residue of keratan sulfate. In this study, we examined whether KSGal6ST could transfer sulfate to sialyl N-acetyllactosamine oligosaccharides or fetuin oligo­saccharides. KSGal6ST expressed in COS-7 cells catalyzed transfer of sulfate to NeuAc{alpha}2-3Galß1-4GlcNAc (3'SLN), NeuAc{alpha}2-3Galß1-4GlcNAcß1-3Galß1-4GlcNAc (SL1L1), NeuAc{alpha}2-3Galß1-4(6-sulfo)GlcNAcß1-3(6-sulfo)Galß1-4(6-sulfo)GlcNAc (SL2L4), and their desialylated derivatives except for Galß1-4GlcNAc, but not to NeuAc{alpha}2-3Galß1-4(Fuc{alpha}1-3)GlcNAc (SLex). When the sulfated product formed from 3'SLN was degraded with neuraminidase and reduced with NaBH4, the resulting sulfated disaccharide alditol showed the same retention time in SAX-HPLC as that of [3H]Gal(6SO4)ß1-4GlcNAc-ol. KSGal6ST also catalyzed sulfation of fetuin. When the sulfated oligosaccharides released from the sulfated fetuin after sequential digestion with proteinase and neuraminidase were subjected to a reaction sequence of hydrazin­olysis, deaminative cleavage and NaBH4 reduction, the major product was co-eluted with [3H]Gal(6SO4)ß1-4anhydromannitol in SAX-HPLC. These observations show that KSGal6ST is able to sulfate position 6 of Gal residue of 3'SLN and fetuin oligosaccharides. The relative rates of the sulfation of SL2L4 was much higher than the rate of the sulfation of keratan sulfate. These results suggest that KSGal6ST may function in the sulfation of sialyl N-acetyllactosamine oligosaccharide chains attached to glycoproteins.

Key words: sialyl N-acetyllactosamine/keratan sulfate/sulfotransferase/fetuin/sialyl Lewis x


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Sulfation of sugar residues occurs not only in glycosamino­glycans but also in various oligosaccharide chains present in glyco­proteins and glycolipids (Brockhausen and Kuhns, 1997Go). Sulfate moiety of sugar residues attached to oligosaccharide chains has been implicated in the high-affinity binding to L-selectin (Imai et al., 1993Go; Tsuboi et al., 1996Go; Galustian et al., 1997Go; Mitsuoka et al., 1998Go), the roles of HNK-1 epitope in laminin-binding, neural cell migration and outgrowth of neurons and astrocytes (Schmitz et al., 1994Go), regulation of circulatory half-life of glycoprotein hormones by binding to the specific receptor (Baenziger et al., 1992Go; Fiete et al., 1991Go, 1997), and progression of renal cancer (Sakakibara et al., 1989Go; Kobayashi et al., 1993Go; Honke et al., 1998Go). Sulfotransferases involved in the sulfation of oligosaccharides have been characterized (Hooper et al., 1995Go; Spiro et al., 1996Go; Chandrasekaran et al., 1997Go; Degroote et al., 1997Go; Bowman et al., 1988Go; Spiro and Bhoyroo, 1998Go) and some sulfotransferases were cloned (Bakker et al., 1997Go; Ong et al., 1998Go; Uchimura et al., 1998Go; Bistrup et al., 1999Go).

Although the sulfotransferases involved in the sulfation of oligosaccharides were found to share some molecular features such as being type II transmembrane protein and having putative PAPS-binding sites (Kakuta et al., 1998Go) with glycosaminoglycan sulfotransferases so far cloned, our know­ledge about the relation of the specificity between the two sulfotransferase groups has been limited. We previously showed that chondroitin 6-sulfotransferase (C6ST), which transfers sulfate to position 6 of GalNAc residues of chondroitin (Habuchi et al., 1993Go), transferred sulfate to position 6 of Gal residue of keratan sulfate (Fukuta et al., 1995Go; Habuchi et al., 1996Go) and position 6 of sialyl N-acetyllactosamine oligosaccharides (Habuchi et al., 1997Go). A sulfotransferase which transferred sulfate to position 6 of nonreducing terminal GlcNAc residue and promoted the formation of 6-sulfo sialyl Lewis x in the transfected COS-7 cells was cloned and was found to have a significant sequence homology with C6ST (Uchimura et al., 1998Go). A putative sulfotransferase, NSIST, showing relatively high sequence homology to C6ST was cloned by expression cloning using mAb 3B3, which recognized a carbohydrate-containing epitope expressed on dystroglycan and other constituent of the postsynaptic membranes of Torpedo electric organ (Nastuk et al., 1998Go). The epitope recognized by mAb 3B3 was sensitive to the digestion with neuraminidase but not to the digestion with chondroitinase, keratanase or heparitinase (Bowe et al., 1994Go).

Keratan sulfate Gal-6-sulfotransferase (KSGal6ST), which catalyzes transfer of sulfate to position 6 of Gal residue of keratan sulfate, was cloned from the fetal human brain library (Fukuta et al., 1997Go). When the cloned cDNA was transfected in COS-7 cells, the expressed sulfotransferase transferred sulfate to position 6 of Gal residue of keratan sulfate, but not to chondroitin. Recently KSGal6ST was shown to be involved in the formation of L-selectin ligand (Bistrup et al., 1999Go). In this paper we investigated whether KSGal6ST could transfer sulfate to sialyl N-acetyllactosamine oligosaccharides in vitro as observed in C6ST. We also investigated whether oligo­saccharides attached to intact fetuin could be sulfated by KSGal6ST. As a result we found that sialyl N-acetyllacto­samine oligosaccharides were found to serve as acceptors for KSGal6ST as efficiently as keratan sulfate.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Characterization of the expressed KSGal6ST
Some properties of the expressed KSGal6ST were determined using keratan sulfate as the acceptor. KSGal6ST was activated with various metal ions such as Mn2+, Ca2+, Co2+, Sr2+, Ba2+, Mg2+; among these ions, Ca2+ and Mn2+ showed the highest stimulatory effects. Protamine, which was the best activator for C6ST, was a less efficient activator than Ca2+. Optimal pH was around 6.5 (Figure 1A), and optimal concentration of Ca2+ was 10 mM (Figure 1B). Dithiothreitol hardly affected the activity of KSGal6ST (Figure 1C). Km for PAPS was 0.58 µM (Figure 1D).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. Effects of pH (A), concentration of CaCl2 (B), and dithiothreitol (C) on KSGal6ST activity, and the determination of Km for PAPS (D). (A) The sulfotransferase activity was determined as described under Materials and methods except that 0.05 M imidazole-HCl contained in the standard reaction mixture was replaced with 0.05 M buffers with various pH values; sodium acetate (open squares), MES (solid circles), imidazole-HCl (open circles), and Tris-HCl (solid triangles). (B) The concentration of CaCl2 was varied. (C) The concentration of dithiothreitol was varied. (D) The sulfotransferase activity was determined as described under Materials and methods except that the concentration of [35S]PAPS was varied. Values of ordinate of the double reciprocal plot represent 1/(pmol/min/µg protein).

 
Incorporation of 35SO4 into various oligosaccharide acceptors
Oligosaccharides having sialyl N-acetyllactosamine or fetuin were incubated with the expressed KSGal6ST, and the radio­active products were separated by Superdex 30 chromato­graphy. The retention time of the sulfated products from these oligosaccharides were the same as those reported (Habuchi et al., 1997Go). Sulfated fetuin and sulfated keratan sulfate were eluted at the void volume of the column. Incorporation of 35SO4 into these oligosaccharides was determined from the elution profiles of 35S-radioactivity after subtraction of the radioactivity observed in the absence of the acceptors (Table I). Among these oligosaccharides, incorporation of 35SO4 was the highest in SL2L4 and was 2.5-fold of the incorporation into keratan sulfate. The incorporation into fetuin was the same magnitude of order as that into the non sulfated oligosaccharides such as L1L1 and 3'SLN. Comparison of the kinetic parameters between SL2L4 and L2L4 indicates that sialic acid attached to the nonreducing end of the sulfated oligosaccharide caused the marked decrease in Km. On the other hand, comparison of the kinetic parameters between SL2L4 and keratan sulfate indicates that the higher incorporation of sulfate into SL2L4 was mainly due to the increase in Vmax. The kinetic parameters for L1L1 could not be determined because Lineweaver-Burk’s plot did not show a straight line. Incorporation into Galß1-4GlcNAc (LN), Galß1-4GlcNAc(6SO4) (LNS) and sialyl Lewis x (SLex) tetrasaccharide could not be detected.


View this table:
[in this window]
[in a new window]
 
Table I. Incorporation of 35SO4 into sialyl N-acetyllactosamine oligosaccharides, fetuin, and keratan sulfate
 
Structural analyses of 35S-labeled 3'SLN
To determine the position to which 35SO4 was transferred to 3'SLN, we degraded the radioactive product formed from 3'SLN with neuraminidase and reduced with NaBH4. The disaccharide alditol thus obtained were subjected to Partisil 10-SAX HPLC after separation with paper electrophoresis (Figure 2). The 35S-radioactivity was eluted at the position of [3H]Gal(6SO4)ß1-4GlcNAcR and no radioactive peak was detected at the position of [3H]Galß1-4GlcNAcR(6SO4). These results indicate that 35SO4 was transferred to Gal residue of 3'SLN, but not to GlcNAc residue.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. HPLC separation of the desialylated and reduced product derived from 35S-labeled 3'SLN. 35S-labeled 3'SLN was digested with a neuraminidase and reduced with NaBH4 as described under Materials and methods and mixed with [3H]Gal(6SO4)ß1-4GlcNAcR and [3H]Galß1-4GlcNAcR(6SO4). The mixture was subjected to HPLC using a Partisil 10-SAX column. Radioactivity of 3H (open circles) and 35S (solid circles) of each fraction was determined. Peak 1 and peak 2 were assigned as [3H] Gal(6SO4)ß1-4GlcNAcR and [3H] Galß1-4GlcNAcR(6SO4), respectively.

 
Sensitivity of 35S-labeled products derived from L1L1 to ß-galactosidase digestion
L1L1 contained two Gal residues. To obtain the information about the location of 35SO4 transferred to L1L1, we investigated the sensitivity of the sulfated products to ß-galactosidase digestion. 35S-Labeled products derived from L1L1 was mixed with nonradioactive L1L1, and digested with ß-galactosidase. The mixture of 35S-labeled products and the nonradioactive oligosaccharides were applied to the Superdex 30 column before or after digestion with ß-galactosidase. The eluate from the column was monitored by absorption at 210 nm and 35S-radioactivity (Figure 3). After ß-galactosidase digestion of the mixture of 35S-labeled material derived from L1L1 and nonradio­active L1L1, both the absorption at 210 nm due to nonradioactive L1L1 and 35S-radioactivity were completely shifted to more retarded position (Figure 3B,D). Since ß-galacto­sidase is unable to cleave the glycosidic bond if the galactose is sulfated, these results suggest that all of 35SO4 transferred to L1L1 was located to the reducing end side Gal residue. Such a property of KSGal6ST appears to make a clear contrast to the property of C6ST; about one-third of 35SO4 was transferred to the reducing end side Gal residue of L1L1 by C6ST.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 3. ß-Galactosidase digestion of 35S-labeled L1L1. 35S-Labeled L1L1 was mixed with L1L1, and applied to Superdex 30 chromatography before (A, C) or after (B, D) ß-galactosidase digestion. The eluate was monitored by absorption at 210 nm (C, D), and radioactivity of each 0.5 ml fraction was determined (A, B).

 
Structural analysis of sulfated oligosaccharides released from sulfated fetuin
When 35S-labeled fetuin was digested with keratanase I, no depolymerized products were observed, while 35S-labeled keratan sulfate was completely degraded under the same conditions (Figure 4), indicating that the incorporation of 35SO4 into the polymer fraction was not due to the incorporation into the potentially contaminating keratan sulfate. We also confirmed that 35S-labeled fetuin was not degraded with chondroitinase ABC digestion (data not shown). After Actinase E digestion, 35S-labeled oligosaccharides with a size of about pentadecasaccharide were released (Figure 5A). When the pentadecasaccharide fraction was further digested with neuraminidase, oligosaccharides with a size of about undecasaccharide were formed (Figure 5B). The undecasaccharide fraction was subjected to the sequential reaction of deacetyl­ation, deaminative cleavage and NaBH4 reduction, and the final products were separated with paper chromatography (Figure 6A). About 45% of the total radioactivity was migrated to the position of [3H]Galß1-4AManR(6SO4) and [3H]Gal(6SO4)ß1-4AManR. 35S-Radioactivity remaining at the paper origin in Figure 6A may be due to the larger oligosaccharides, and was not examined further. The fractions indicated by a horizontal bar in Figure 6A was applied to a Partisil 10-SAX column (Figure 6B). Major 35S-radioactivity was eluted at the position of [3H]Gal(6SO4)ß1-4AManR, but no radioactive peak was observed at the position of [3H]Galß1-4AManR(6SO4). These results indicate that the structure of the nonreducing terminal region of major parts of 35S-oligosaccharides released after Actinase E digestion was sialyl Galß1-4GlcNAc(6SO4). Structures of minor components, however, remained to be determined because small peaks eluted at 12 min, 22 min and 27.5 min could not be assigned in this experiment. We used Gal(6SO4)ß1-4AManR and Galß1-4AManR(6SO4) prepared from keratan sulfate as standard materials in HPLC. Chromatographic behaviors of other possible disaccharide alditols such as Gal(2SO4)ß1-4AManR and Gal(4SO4)ß1-4AManR were not examined in this paper; therefore, the possibility that the reaction products might contain Gal(2SO4)ß1-4AManR or Gal(4SO4)ß1-4AManR could not be excluded.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. Keratanase I digestion of 35S-labeled fetuin. 35S-Labeled fetuin (A, B) and 35S-labeled keratan sulfate (C, D) were prepared as described under Materials and methods and applied to the Superdex 30 column before (A, C) or after (B, D) digestion with keratanase I. The arrow indicates the elution positions of blue dextran. 35S-Radioactivity of each fraction was determined.

 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5. Separation by Superdex 30 chromatography of the products formed after sequential digestion of 35S-labeled fetuin with Actinase E and neuraminidase. 35S-Labeled fetuin was prepared as described under Materials and methods and sequentially degraded. (A) After digestion with Actinase E. The peak indicated by a horizontal bar was used for the neuraminidase digestion. (B) After digestion with neuraminidase. The peak indicated by a horizontal bar was used for the sequential degradation with hydrazine, nitrite, and NaBH4. Void volume and the elution positions of chondroitin oligosaccharides are shown by arrows. The figures above the arrows indicates the length of oligosaccharides.

 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6. Separation by paper chromatography and HPLC of the products formed from 35S-labeled fetuin oligosaccharides after sequential reactions. (A) The fraction obtained after neuraminidase digestion (indicated by a horizontal bar in Figure 5B) was subjected to sequential reaction with hydrazine/hydrazine sulfate, nitrite at pH 4 and NaBH4 as described under Materials and methods. The final products were mixed with a mixture containing [3H] Gal(6SO4)ß1-4AManR(6SO4), [3H] Gal(6SO4)ß1-4AManR, [3H] Galß1-4AManR(6SO4) and, AManR(6SO4), and separated with paper chromatography. Peak 1, peak 2, and peak 3 indicate the migration positions of [3H] Gal(6SO4)ß1-4AManR(6SO4), a mixture of [3H] Gal(6SO4)ß1-4AManR and [3H] Galß1-4AManR(6SO4), and AManR(6SO4), respectively. (B) The radioactive fraction which comigrated with [3H] Gal(6SO4)ß1-4AManR and [3H] Galß1-4AManR(6SO4) (indicated by a horizontal bar in (A) was eluted from the paper, purified with paper electrophoresis and subjected to SAX-HPLC. Radioactivity of 3H (open circles) and 35S (solid circles) of each fraction was determined. Peak 4 and peak 5 in (B) were assigned as [3H] Gal(6SO4)ß1-4AManR and [3H] Galß1-4AManR(6SO4), respectively.

 
Sulfation of oligosaccharides with FLAGKSGal6ST fusion protein
To confirm that the sulfotransferase activity toward sialyl N-acetyllactosamine oligosaccharides was due to the protein expressed from KSGal6ST cDNA, we expressed a recombinant KSGal6ST containing FLAG peptide at the N-terminal. The sulfotransferase activities toward keratan sulfate and SL2L4 were overexpressed about 5-fold and 19-fold, respectively, over the control. After the extracts of COS-7 cells were purified with anti-FLAG mAb-conjugated column, the sulfotransferase activity toward SL2L4 and keratan sulfate was detected only when COS-7 cells were transfected with FLAGKSGal6ST cDNA (Table II). Sulfotransferase activity toward chondroitin was not observed at all in the affinity-purified fractions. These results indicate that sulfation of SL2L4 and keratan sulfate was catalyzed by the same protein expressed from KSGal6ST cDNA. However, since the affinity-purified fraction was not homogeneous even after purification with FLAG-affinity column, the possibility that either or both of the sulfotransferase activities might be due to proteins of the host cells, whose synthesis might have be enhanced by the transfection of the cDNA, could not be completely excluded.


View this table:
[in this window]
[in a new window]
 
Table II. Incorporation (pmol/min/mg protein) of 35SO4 into keratan sulfate, SL2L4 and chondroitin catalyzed by the extracts from COS-7 cells transfected with FLAGKSGal6ST
 
Expression of KSGal6ST in immunologically relevant tissues
Since KSGal6ST was shown to be involved in the formation of L-selectin ligand (Bistrup et al., 1999Go), we investigated whether KSGal6ST is expressed in various immunologically relevant tissues. Among various human tissues, KSGal6ST mRNA with 2.9 kb was expressed in the spleen, lymph node, thymus and appendix (Figure 7). The size of the message was almost the same as that observed in the human brain (Fukuta et al., 1997Go). The expression of KSGal6ST in the various immuno­logically-relevant tissues suggests the important function in the immunological system.



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 7. Northern blot analysis of KSGal6ST messages in various immunologically relevant tissues. Northern blots with poly(A)+ RNA from the spleen (lane 1), lymph node (lane 2), thymus (lane 3), appendix (lane 4), periferal blood leukocytes (lane 5), bone marrow (lane 6), and fetal liver (lane 7) were hybridized with 32P-labeled DNA probe for human KSGal6ST cDNA. Each lane contained 2 µg of poly(A)+ RNA. The positions of the molecular size standards (kb) are indicated at the right.

 

    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
In this article, we showed that KSGal6ST transferred sulfate not only to keratan sulfate but also to sialyl N-acetyllacto­samine oligosaccharides. We have previously reported that C6ST also transferred sulfate to sialyl N-acetyllactosamine oligosaccharides (Habuchi et al., 1997Go). KSGal6ST was found to share the substrate specificity with C6ST. Both KSGal6ST and C6ST catalyzed transfer sulfate to position 6 of Gal residue of 3'SLN. Sulfate moiety attached to GlcNAc residue adjacent to the targeted Gal residue caused marked stimulation of the both enzymes. Fucose attached to GlcNAc may inhibit both the activities, since both KSGal6ST and C6ST could transfer sulfate to 3'SLN, but not to SLex. However, clear differences in the specificity were also observed between KSGal6ST and C6ST. The most prominent feature of KSGal6ST was that the rate of sulfation of SL2L4 was much higher than the rate of sulfation of keratan sulfate. In contrast, the rate of sulfation of SL2L4 by C6ST was 1.5% of the rate of sulfation of keratan sulfate (Habuchi et al., 1997Go). From these substrate specificities, KSGal6ST was supposed to be more suitable for the sulfation of oligosaccharides than C6ST. This assumption may be supported by the observation that oligosaccharides bound to intact fetuin were sulfated by KSGal6ST as efficiently as nonsulfated free oligosaccharides. ß-Galactosidase digestion of the sulfated oligosaccharides revealed that only reducing end side Gal residue of L1L1 was sulfated by KSGal6ST, while about one-third of 35SO4 incorporated to L1L1 by C6ST resided on the nonreducing terminal Gal residue. The affinity of KSGal6ST for the sulfated oligosaccharide bearing sialic acid on the nonreducing terminal (SL2L4) was much larger than that for the desialylated oligosaccharide (L2L4), suggesting that the nonreducing terminal sialic acid may cause the increase in the affinity for the acceptors when sulfate group is present on GlcNAc residue adjacent to the targeted Gal residue. We used partially purified KSGal6ST preparation expressed in COS-7 cells for the study of the substrate specificity. As described in our previous paper (Fukuta et al., 1997Go), the partially purified preparation was almost devoid of C6ST activity. However, the possibility that the transfection might have affected other endogenous sulfotransferase activity in COS-7 cells could not be excluded.

A microsomal sulfotransferase preparation obtained from the rat spleen was reported to have the ability to sulfate position 6 of Gal residues of glycoprotein oligosaccharides (Spiro and Bhoyroo, 1998Go). The substrate specificities of the rat spleen sulfotransferase was essentially the same as those of KSGal6ST; the rat spleen sulfotransferase catalyzed the transfer of sulfate to 3'SLN and fetuin oligosaccharides but not to SLex tetrasaccharide. In the human tissues, KSGal6ST mRNA was expressed in the brain (Fukuta et al., 1997Go) and in the various immunologically relevant tissues including spleen (Figure 7). On the other hand, the activity of 6-O-sulfation of the Gal residue was also found in various tissues including the brain (Spiro and Bhoyroo, 1998Go). The similarity in the specificity and distribution between KSGal6ST and the rat Gal-6-O-sulfotransferase suggests that the rat Gal-6-O-sulfotransferase activity may be carried by a rat counterpart of KSGal6ST or by a hypothetical isoform of KSGal6ST with the specificity similar to that of KSGal6ST. However, the possibility that the Gal-6-O-sulfotransferase activity in the spleen may be partly due to C6ST, since C6ST is also expressed in the spleen (Fukuta et al., 1998Go).

GlyCAM-1 is one of high endothelial venule-associated ligands (Imai et al., 1991Go; Lasky et al., 1992Go) and was reported to contain O-linked sugar chains containing sulfated sialyl Lewis x structure (Hemmerich and Rosen, 1994Go; Hemmerich et al., 1995Go). Structural analysis of GlyCAM-1 has identified Gal(6SO4) and GlcNAc(6SO4) as the major sulfated sugars (Hemmerich et al., 1994Go). Recently, KSGal6ST has been shown to be able to sulfate L-selectin ligand when COS cells with a cDNA encoding a GlyCAM-1/IgG chimera were transfected with a cDNA encoding KSGal6ST (Bistrup et al., 1999Go). When CHO/fucosyltransferase VII/core 2 ß1-6 N-acetylglucosaminyl transferase were transfected with KSGal6ST and HEC-GlcNAc6ST cDNAs (singly or in combination), the resulting cells showed positive binding to L-selectin/IgM. The combination of the two sulfotransferase cDNAs synergistically enhanced the binding of L-selectin/IgM. These interesting observations may be correlated with our findings that sulfation of Gal residues with KSGal6ST was strongly stimulated by the presence of sulfate group on the adjacent GlcNAc residue. Since KSGal6ST showed no activity toward SLex in vitro, introduction of sulfate to Gal residue catalyzed by KSGal6ST should precede the introduction of fucose.

Chiba et al. reported the structure of major oligosaccharides bound to {alpha}-dystroglycan, Neu{alpha}2-3Galß1-4GlcNAcß1-2Man (Chiba et al., 1997Go). They showed that, even after the neuraminidase digestion, a significant portion of the oligosaccharide fractions released by ß-elimination from {alpha}-dystroglycan was still absorbed to the anion exchange column. The structure of the neuraminidase-resistant negatively charged oligosaccharide is not known. It remains to be investigated whether sulfate group is present on the dystroglycan oligosaccharides. A mAb 3B3, which recognized agrin-binding proteins, was raised using the synaptic membrane proteins as the antigen (Bowe et al., 1994Go). One of the epitope-bearing proteins was found to be dystroglycan. The reactivity of the mAb was decreased by the digestion with neuraminidase but not affected by the digestion with chondroitinase or keratanase, suggesting that the epitope for the mAb may not be glycosaminoglycans but oligosaccharides with sialic acid. NSIST cDNA was cloned from Torpedo electric organ by detecting the expression of the epitope recognized by mAb 3B3 on the surface of COS cells (Nastuk et al., 1998Go). NSIST shows significant sequence homology to both C6ST and KSGal6ST; identity of amino acid sequence between NSIST and chick C6ST is 56% and identity of amino acid sequence between NSIST and human KSGal6ST is 38%. Such similarities in the amino acid sequence suggest that NSIST may be a novel sulfotransferase and that, in addition to sialic acid, sulfate group may be involved in the formation of the structure of the epitope for mAb 3B3. Although the substrate specificity of NSIST has not been revealed yet, it may possibly be similar to those of KSGal6ST.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
The following commercial materials were used: H235SO4 (NEX-042, NEN Life Science Products, Inc.) was from Daiichi Chemicals Co. Ltd. (Tokyo, Japan); [3H]NaBH4 (16.3 GBq/mmol) was from Amersham Japan (Tokyo, Japan). Unlabeled PAPS, fetal calf serum fetuin (F3004), galactosamine 6-sulfate and FLAG peptide were from Sigma (St. Louis, MO); Fast Desalting Column HR 10/10; Hiload Superdex 30 16/60; DEAE-Sephadex A-50 and DEAE-Sephacel were from Pharmacia, Biotech (Tokyo, Japan); chondroitinase ABC, Streptococcus neuraminidase, Streptococcus ß-galactosidase, keratanase I, keratanase II, NeuAc{alpha}2-3Galß1-4 (Fuc{alpha}1-3)GlcNAc (SLex), and NeuAc{alpha}2-3Galß1-4GlcNAc (3'SLN) were from Seikagaku Corp. (Tokyo, Japan); Actinase E (proteinase from Streptomyces griceus) was from Kaken Pharmaceutical Co. Ltd. (Tokyo, Japan); Partisil 10-SAX was from Whatman (Clifton, NJ); and Galß1-4GlcNAc (LN) was from Funakoshi (Tokyo, Japan). Keratan sulfate from bovine cornea and NeuAc{alpha}2-3Galß1-4GlcNAc(6SO4)ß1-3Gal(6SO4)ß1-4GlcNAc(6SO4) (SL2L4), which was prepared from keratan sulfate by keratanase II digestion (Nakazawa et al., 1989Go; Hashimoto et al., 1990Go), were products of Seikagaku Corporation and generously gifted from the company. NeuAc{alpha}2-3Galß1-4GlcNAcß1-3Galß1-4GlcNAc (SL1L1) and Galß1-4GlcNAcß1-3Galß1-4GlcNAc (L1L1), which were prepared by desulfation of the corresponding oligosaccharides, were generously gifted from Dr. Yutaka Kariya, Tokyo Research Institute of Seikagaku Corporation. [35S]PAPS was prepared as described previously (Delfert and Conrad, 1985Go). Since the commercial fetuin was found to be contaminated with chondroitin sulfate, fetuin was digested with chondroitinase ABC in the presence of protease inhibitors (50 µM N{alpha}-p-tosyl-L-lysine chloromethyl ketone, 30 µM N-tosyl-L-phenylalanine chloro­methyl ketone, 300 µM phenylmethyl sulfonyl fluoride) and the digest was applied to a DEAE-Sephacel column. The absorbed material was eluted with a gradient from 0 to 1 M NaCl. A peak fraction eluted around 0.5 M NaCl containing both protein and sialic acid was dialyzed against 1 mM Tris-HCl, pH 7.2 and lyophilized. [3H] Gal(6SO4)ß1-4AManR(6SO4), a mixture of [3H] Gal(6SO4)ß1-4AManR and [3H] Galß1-4AManR(6SO4), a mixture of [3H]Gal(6SO4)ß1-4GlcNAcR and [3H]Galß1-4Glc­NAcR(6SO4), used for the standard materials in HPLC were prepared as described previously (Habuchi et al., 1997Go). [3H]AManR(6SO4) was prepared from glucosamine 6-sulfate by a sequential reaction with nitrous acid and NaB3H4 as described previously (Habuchi et al., 1996Go). Galß1-4GlcNAc(6SO4)ß1-3Gal(6SO4)ß1-4GlcNAc(6SO4) (L2L4) was prepared from SL2L4 by neuraminidase digestion (Habuchi et al., 1997Go). For preparing Galß1-4GlcNAc(6SO4), keratan sulfate was digested with keratanase II and the digests were separated with Partisil 10-SAX HPLC as described previously (Fukuta et al., 1997Go).

Construction of pCXNKSGal6ST and preparation of keratan sulfate Gal 6-sulfotransferase from COS-7 cells transfected with pCXNKSGal6ST
The human KSGal6ST cDNA was inserted in an expression vector pCXN2 (pCXN2 was generously donated from Dr. Jun-ichi Miyazaki, Department of Disease-related Gene Regulation, Faculty of Medicine, University of Tokyo) and pCXNKSGal6ST was constructed as described previously (Fukuta et al., 1997Go). Transient expression of KSGal6ST cDNA in COS-7 cells and the preparation of the partially purified KSGal6ST with DEAE-Sephadex A-50 and heparin-Sepharose CL 6B were described previously (Fukuta et al., 1997Go).

Preparation of a FLAG-KSGal6ST fusion protein
Recombinant KSGal6ST was also expressed as a fusion protein with FLAG peptide. A DNA fragment which codes for full open reading frame was amplified by PCR using human KSGal6ST cDNA as a template. The 5' and 3' primers were CGCAAGCT­T­ATGCAATGTTCCTGGAAGGCC and CAGGAATTCTC­A­C­GAGAAGGGGCGGAAGTC, respectively. At the 5'-end of the oligonucleotide primers, restriction enzyme recognition sites were introduced; HindIII site for the sense primer and EcoRI site for the antisense primer. The PCR product was digested with EcoRI and HindIII, and subcloned into these sites of pFLAG-CMV-2 plasmid (Kodak, New Haven, CT). The resulting plasmid was transfected in COS-7 cells as described previously (Fukuta et al., 1997Go) and the fusion protein produced was extracted from the cells with buffer B containing 10 mM Tris-HCl, pH 7.2, 0.15 M NaCl, 10 mM MgCl2, 2 mM CaCl2, 0.5% Triton X-100, 20% glycerol by gentle shaking on a rotatory shaker for 30 min at 4°C. The extracts were centrifuged at 10,000 x g for 10 min. The supernatant fraction (crude extract) was applied to an anti-FLAG mAb-conjugated affinity column (Kodak) equilibrated with the buffer B. The absorbed materials were eluted with FLAG peptide under the conditions recommended by the manufacturer.

Incorporation of 35SO4 into oligosaccharides, keratan sulfate, and fetuin
The reaction mixture contained 2.5 µmol of imidazole-HCl, pH 6.4, 0.5 µmol of CaCl2, 0.1 µmol dithiothreitol, 0.025 µmol of oligosaccharides or 0.025 µmol (as glucosamine) of keratan sulfate or 0.025 µmol (as sialic acid) of fetuin, 50 pmol [35S]PAPS (about 5 x 105 cpm), and the partially purified KSGal6ST or FLAG-KSGal6ST in a final volume of 50 µl. The reaction mixtures were incubated at 37°C for 60 min for the partially purified KSGal6ST or 20 min for FLAG-KSGal6ST and the reaction was stopped by immersing the reaction tubes in a boiling water bath for 1 min. After the reaction was stopped, 35S-labeled products were separated from 35SO4 and [35S]PAPS by Superdex 30 gel chromatography, and the radioactivity was determined. As a control, reaction mixture without acceptors was applied to the Superdex 30 column, and the radioactivity observed in the control was subtracted. When fetuin was used as an acceptor, the reaction was stopped by placing on ice and the reaction mixture was immediately injected into a Superdex 30 column. When keratan sulfate was used as acceptor, sulfotransferase reaction proceeded linearly up to 1.5 µg of the partially purified KSGal6ST and up to 60 min under the conditions described above.

Neuraminidase digestion and NaBH4 reduction of 35S-labeled 3'SLN
35S-Labeled 3'SLN was prepared using the partially purified KSGal6ST (2 µg as protein) as described above except that concentration of [35S]PAPS was increased to 6.8-fold and incubation was carried out for 20 h. The 35S-labeled 3'SLN eluted from the Superdex 30 column was lyophilized, purified by paper electrophoresis, and digested with neuraminidase as described below. Aliquot of the sample after neuraminidase digestion was dried, dissolved in 10 µl of 0.5 M NaBH4/0.2 M Na2CO3, pH 10.2. After 2 h at 0°C, 10 µl of the same solution was added and the reduction was continued for further 2 h at 0°C. After the reduction, excess NaBH4 was destroyed by addition of 10 µl of 3 M acetic acid. The reaction mixtures were dried under N2 stream, dissolved in a small volume of water, and applied to a Dowex 50 H+ column (bed volume 0.2 ml). The flow through fraction was dried and suspended in methanol. Boric acid was removed as methyl ester by drying in vacuo.

N-Deacetylation, deamination, and NaBH4 reduction of 35S-labeled oligosaccharides released from the sulfated fetuin
35S-Labeled oligosaccharides were released from the sulfated fetuin by the digestion with Actinase E and neuraminidase, and separated with Superdex 30 chromatography. The oligosaccharides were then subjected to N-deacetylation, deaminative cleavage and NaBH4 reduction as described (Shaklee and Conrad, 1986Go; Habuchi et al., 1996Go) using nonradioactive NaBH4. The final sample was dissolved in 60 µl of water and spotted on a strip of Whatman 3 paper and developed with the solvent described below.

Digestion with neuraminidase, ß-galactosidase, keratanase I, and Actinase E
Digestion with neuraminidase was carried out for 60 min at 37°C in the reaction mixture containing, in a final volume of 50 µl, 35S-labeled oligosaccharide, 5 µmol of potassium acetate buffer, pH 6.5, 0.5 µmol of CaCl2 and 20 mU of neuraminidase (Kiyohara et al., 1974Go). Reaction mixture for ß-galactosidase digestion contained 35S-labeled L1L1, 25 nmol of L1L1, 2.5 µmol of sodium acetate buffer, pH 5.5, and 5 mU of the enzyme in a final volume of 50 µl (Kiyohara et al., 1976Go). The reaction mixtures were incubated at 37°C for 20 h. Keratanase I digestion was carried out for 15 h at 37°C in the reaction mixture containing, in a final volume of 25 µl, 35S-labeled keratan sulfate or 35S-labeled fetuin, 1.25 µmol of Tris-HCl, pH 7.4, 100 mU of keratanase I, and protease inhibitors (50 µM Na{alpha}-p-tosyl-L-lysine chloromethyl ketone, 30 µM N-tosyl-L-phenylalanine chloromethyl ketone, 300 µM phenylmethyl sulfonyl fluoride). Reaction mixture for Actinase E contained 35S-labeled fetuin, 2 µmol of Tris-HCl, pH 8.0 and 250 µg of Actinase E in a final volume of 40 ml. The reaction mixtures were incubated at 37°C for 20 h.

Superdex 30 chromatography, paper electrophoresis, paper chromatography, and HPLC
Hiload Superdex 30 16/60 column was equilibrated with 0.2 M NH4HCO3. The flow rate was 1 ml/min; 1 ml or 0.5 ml fractions were collected, mixed with 4 ml Clearsol (Nakarai Tesque, Kyoto), and the radioactivity was determined. Oligosaccharides were monitored by absorption at 210 nm. Paper electrophoresis was carried out on Whatman No. 3 paper (2.5 cm x 57 cm) in pyridine/acetic acid/water (1:10:400, by volume, pH 4) at 30 V/cm for 40 min. Samples for paper chromatography was spotted on a Whatman No. 3 paper (2.5 cm x 57 cm) and developed with 1-butanol/acetic acid/1 M NH3 (3:2:1, by volume). The dried paper strips after paper electrophoresis or paper chromatography were cut into 1.25 cm segments and radioactivity was determined by liquid scintillation counting. HPLC separation of 35S-labeled disaccharide alditols was carried out on a Whatman Partisil 10-SAX column (4.5 x 25 cm) equilibrated with 5 mM KH2PO4. The column was developed with 5 mM KH2PO4. The flow rate was 1 ml/min and the column temperature was 40°C; 0.5 ml fractions were collected, mixed with 4 ml Clearsol, and the radioactivity was determined.

Determination of glucosamine and sialic acid
The glucosamine contents of oligosaccharides were determined by the Elson-Morgan method as modified by Strominger et al. (Strominger et al., 1959Go) after hydrolysis of the glycosaminoglycans with 6 M HCl at 100°C for 4 h. Sialic acid was determined by thiobarbituric acid method (Aminoff, 1961Go) after hydrolysis with 0.1 M H2SO4 at 80°C for 60 min.

Northern blot hybridization
Human Multiple Tissue Northern Blot Filters (Clontech), on which 2 µg poly (A)+ RNAs from various adult human tissues were blotted, were prehybridized in a solution containing 50% formamide, 5x SSPE, 5x Denhardt’s solution, 0.5% SDS, and 0.1 mg/ml of denatured salmon sperm DNA for 3 h at 42°C. Hybridization was carried out in the same buffer containing 32P-labeled probe for 16 h at 42°C. The radioactive probe was prepared from the EcoRI fragment containing 2415 bp cDNA (Fukuta et al., 1997Go) by the random oligonucleotide-primed labeling method using [{alpha}-32P]dCTP (Amersham) and a DNA random labeling kit (Takara Shuzo). The filters were washed at 65°C in 2x SSPE, 0.1% SDS, and subsequently in 1x SSPE, 0.1% SDS. The membrane was exposed to x-ray film for 26 h with an intensifying screen at –80°C.


    Acknowledgments
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
This work was supported by the Grants-in-Aid for Scientific Research on Priority Areas No. 10178102 from the Ministry of Education, Science, Sports and Culture of Japan, by the Special Coordination Funds of the Science and Technology Agency of the Japanese Government, Grants-in-Aid of Mizutani Foundation for Glycoscience, and by a special research fund from Seikagaku Corporation.


    Abbreviations
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
KSGal6ST, keratan sulfate Gal-6-sulfotransferase; C6ST, chondroitin 6-sulfotransferase; PAPS, 3'-phosphoadenosine 5'-phosphosulfate; HPLC, high performance liquid chromato­graphy; Gal(6SO4), 6-O-sulfo-D-galactose; GlcNAc(6SO4), 6-O-sulfo-N-acetyl-D-glucosamine; GlcNAc(6SO4)R, 6-O-sulfo-N-acetyl-D-glucosaminitol; AManR, 2,5-anhydro-D-mannitol; AManR(6SO4), 6-O-sulfo-2,5-anhydro-D-mannitol; LN, Galß1-4GlcNAc; LNS, Galß1-4GlcNAc (6SO4); 3'SLN, NeuAc{alpha}2-3Galß1-4GlcNAc; SLex, NeuAc{alpha}2-3Galß1-4 (Fuc{alpha}1-3)GlcNAc; L1L1, Galß1-4GlcNAcß1-3Galß1-4Glc­NAc; SL1L1, NeuAc{alpha}2-3Galß1-4GlcNAcß1-3Galß1-4GlcNAc; L2L4, Galß1-4GlcNAc(6SO4)ß1-3Gal(6SO4)ß1-4GlcNAc(6SO4); and SL2L4, NeuAc{alpha}2-3Galß1-4GlcNAc(6SO4)ß1-3Gal (6SO4)ß1-4GlcNAc(6SO4).


    Footnotes
 
1 To whom correspondence should be addressed at: Department of Life Science, Aichi University of Education, Kariya, Aichi 448–8542, Japan Back


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 Acknowledgments
 Abbreviations
 References
 
Aminoff,D. (1961) Methods for the quantitative estimation of N-acetylneuraminic acid and their application to hydrolysates of sialomucoids. Biochem. J., 81, 384–392.[ISI]

Baenziger,J.U., Kumar,S., Brodbeck,R.M., Smith,P.L. and Beranek,M.C. (1992) Circulatory half-life but not interaction with the lutropin/chorionic gonadotropin receptor is modulated by sulfation on bovine lutropin oligosaccharides. Proc. Natl Acad. Sci. USA, 89, 334–338.[Abstract]

Bakker,H., Friedmann,I., Oka,S., Kawasaki,T., Nifant’ev,N., Schachner,M. and Mentei,N. (1997) Expression cloning of a cDNA encoding a sulfotransferase involved in the biosynthesis of the HNK-1 carbohydrate epitope. J. Biol. Chem. 272, 29942–29946[Abstract/Free Full Text]

Bistrup,A., Bhakta,S., Lee,J.K., Belov,Y.Y., Gunn,M.D., Zuo,F.-R., Huang,C.-C., Kannagi,R., Rosen,S.D. and Hemmerich,S. (1999) Sulfotransferases of two specificities function in the reconstitution of high endothelial cell ligands for L-selectin. J. Cell Biol., 145, 899–910.[Abstract/Free Full Text]

Bowe,M.A., Deyst,K.A., Leszyk,J.D. and Fallon,J. (1994) Identification and purification of an agrin receptor from Torpedo postsynaptic membranes: a heteromeric complex related to the dystroglycans. Neuron, 12, 1173–1180.[ISI][Medline]

Bowman,K.G., Hemmerich,S., Bakhta,S., Singer,M.S., Bistrup,A., Rosen,S.D. and Bertozzi,C.R. (1988) Identification of N-acetylglucosamine-6-O-sulfotransferase activity specific to lymphoid tissue: an enzyme with a possible role in lymphocyte homing. Chem. Biol., 5, 447–460.

Brockhausen,D. and Kuhns,W. (1997) Role and metabolism of glycoconjugate sulfation. Trends Glycosci. Glycotech., 9, 379–398.[ISI]

Chandrasekaran,E.V., Jain,R.K., Vig,R. and Matta,K.L. (1997) The enzymatic sulfation of glycoprotein carbohydrate unit: blood group T-hapten specific and two other distinct Gal:3-O-sulfotransferase as evident from specificities and kinetics and the influence of sulfate and fucose residues occurring in the carbohydrate chain on C-3 sulfation of terminal Gal. Glycobiology, 7, 753–768.[Abstract]

Chiba,A., Matsumura,K., Yamada,H., Inazu,T., Shimizu,T., Kusunoki,S., Kanazawa,I., Kobata,A. and Endo,T. (1997) Structures of sialylated O-linked oligosaccharides of bovine nerve {alpha}-dystroglycan. J. Biol. Chem., 272, 2156–2162.[Abstract/Free Full Text]

Degroote,S., Lo-Guidice,J.M., Strecker,G., Ducourouble,M.P., Roussel,P. and Lamblin,G. (1997) Characterization of an N-acetylglucosamine-6-O-sulfotransferase from human respiratory mucosa active on mucin carbohydrate chains. J. Biol. Chem., 272, 29493–29501.[Abstract/Free Full Text]

Delfert,D.M. and Conrad,H.E. (1985) Preparation and high-performance liquid chromatography of 3'-phosphoadenosine 5'-phospho[35S]sulfate with a predetermined specific activity. Anal. Biochem., 148, 303–310.[ISI][Medline]

Fiete,D., Baenziger,J.U. (1997) Isolation of the SO4-4-GalNAcß1, 4GlcNAcß1, 2Man{alpha}-specific receptor from rat liver. J. Biol. Chem., 272, 14629–14637.[Abstract/Free Full Text]

Fiete,D., Srivastava,V., Hindsgaul,O. and Baenziger,J.U. (1991) A hepatic reticuloendothelial cell receptor specific for SO4-4GalNAcß1, 4GlcNAcß1, 2Man{alpha} that mediates rapid clearance of lutropin. Cell, 67, 1103–1110.[ISI][Medline]

Fukuta,M., Uchimura,K., Nakashima,K., Kato,M., Kimata,K., Shinomura,T. and Habuchi,O. (1995) Molecular cloning and expression of chick chondrocyte chondroitin 6-sulfotransferase. J. Biol. Chem., 270, 18575–18580.[Abstract/Free Full Text]

Fukuta,M., Inazawa,J., Torii,T., Tsuzuki,K., Shimada,E. and Habuchi,O. (1997) Molecular cloning and characterization of human keratan sulfate Gal-6-sulfotransferase. J. Biol. Chem., 272, 32321–32328.[Abstract/Free Full Text]

Fukuta,M., Kobayashi,Y., Uchimura,K., Kimata,K. and Habuchi,O. (1998) Molecular cloning and expression of human chondroitin 6-sulfotransferase. Biochim. Biophys. Acta, 1399, 57–61.[ISI][Medline]

Galustian,C., Lawson,A.M., Komba,S., Ishida,H., Kiso,M. and Feizi,T. (1997) Sialyl-Lewisx sequence 6-O-sulfated at N-acetylglucosamine rather than at galactose is the preferred ligand for L-selectin and de-N-acetylation of the sialic acid enhances the binding strength. Biochem. Biophys. Res. Commun., 240, 748–751.[ISI]

Habuchi,O., Matsui,Y., Kotoya,Y., Aoyama,Y., Yasuda,Y. and Noda,M. (1993) Purification of chondroitin 6-sulfotransferase secreted from cultured chick embryo chondrocytes. J. Biol. Chem., 268, 21968–21974.[Abstract/Free Full Text]

Habuchi,O., Hirahara,Y., Uchimura,K. and Fukuta,M. (1996) Enzymatic sulfation of galactose residue of keratan sulfate by chondroitin 6-sulfotransferase. Glycobiology, 6, 51–57.[Abstract]

Habuchi,O., Suzuki,Y. and Fukuta,M. (1997) Sulfation of sialyl lactosamine oligosaccharides by chondroitin 6-sulfotransferase. Glycobiology, 7, 405–412[Abstract]

Hashimoto,N., Morikawa,K., Kikuchi,H., Yoshida,K. and Tokuyasu,K. (1990) Keratanase II: a novel enzyme acting on skeletal type keratan sulfate (KS-II). Abstracts of XV International Carbohydrate Symposium, Yokohama, Japan, pp. 271.

Hemmerich,S. and Rosen,S.D. (1994) 6'-Sulfated sialyl Lewis x is a major capping group of GlyCAM-1. Biochemistry, 33, 4830–4835.[ISI][Medline]

Hemmerich,S., Bertozzi,C.R., Leffler,H. and Rosen,S.D. (1994) Identification of the sulfated monosaccharides of GlyCAM-1, an endothelial-derived ligand for L-selectin. Biochemistry, 33, 4820–4829.

Hemmerich,S., Leffler,H. and Rosen,S.D. (1995) Structure of the O-glycans in GlyCAM-1, an endothelial-derived ligand for L-selectin. J. Biol. Chem., 270, 12035–12047.

Honke,K., Tsuda,M., Hirahara,Y., Miyao,N., Tsukamoto,T., Satoh,M. and Wada,Y. (1998) Cancer-associated expression of glycolipid sulfotransferase gene in human renal cell carcinoma cells. Cancer Res., 58, 3800–3805.[Abstract]

Hooper,L.V., Hindsgaul,O. and Baenziger,J.U. (1995) Purification and characterization of the GalNAc-4-sulfotransferase responsible for sulfation of GalNAcß1, 4GlcNAc-bearing oligosaccharides. J. Biol. Chem., 270, 16327–16332.

Imai,Y., Singer,M.S., Fennie,C., Lasky,L.A. and Rosen,S.D. (1991) Identification of a carbohydrate-based endothelial ligand for a lymphocyte homing receptor. J. Cell Biol., 113, 1213–1221.[Abstract]

Imai,Y., Lasky L.A. and Rosen,S.D. (1993) Sulphation requirement for GlyCAM-1, an endothelial ligand for L-selectin. Nature, 361, 555–557.

Kakuta,Y., Pedersen,L.G., Pedersen,L.C. and, Negishi,M. (1998) Conserved structural motifs in the sulfotransferase family. Trends Biochem. Sci. Sci., 23, 129–130.[ISI][Medline]

Kiyohara,T., Terao,T., Nakano,K. and Osawa,T. (1974) Purification and properties of a neuraminidase from Streptococcus K 6646. Arch. Biochem. Biophys., 164, 575–582[ISI][Medline]

Kiyohara,T., Terao,T., Shioiri-Nakano,K. and Osawa,T. (1976) Purification and characterization of ß-N-acetylhexosaminidases and ß-galactosidase from Streptococcus 6646 K. J. Biochem., 80, 9–17.[Abstract]

Kobayashi,T., Honke,K., Kamio,K., Sakakibara,N., Gasa,S., Miyao,N., Tsukamoto,T., Ishizuka,I., Miyazaki,T. and Makita,A. (1993) Sulfolipid and glycolipid sulfotransferase activities in human renal carcinoma cells. Br. J. Cancer, 67, 76–80.[ISI][Medline]

Lasky,L.A., Singer,M.S., Dowbenko,D., Imai,Y., Henzel,E.J., Fennie,C., Gillett,N., Watson,S.R. and Rosen,S.D. (1992) An endothelial ligand for L-selectin is a novel mucin-like molecule. Cell, 69, 927–938.[ISI][Medline]

Mitsuoka,C., Sawada-Kasugai,M., Ando-Furui,K., Izawa,M., Nakanishi,H., Nakamura,S., Ishida,H., Kiso,M. and Kannagi,R. (1998) J. Biol. Chem., 273, 11225–11233[Abstract/Free Full Text]

Nakazawa,K., Ito,M., Yamagata,T. and Suzuki,S. (1989) In Greiling,H. and Scott,J.E. (eds.), Keratan Sulfate: Chemistry and Chemical Pathology. The Biochemical Society, London, pp. 99–110.

Nastuk,M.A., Davis,A., Yancopoulos,G.D. and Fallon,J.R. (1998) Expression cloning and characterization of NSIST, a novel sulfotransferase expressed by a subset of neurons and postsynaptic targets. J. Neurosci., 18, 7167–7177.[Abstract]

Ong,E., Yeh, J-C., Ding,Y., Hindsgaul,O. and Fukuda,M. (1998) Expression cloning of a human sulfotransferase that directs the synthesis of the HNK-1 glycan on the neural cell adhesion molecule and glycolipid. J. Biol. Chem., 273, 5190–5195.[Abstract/Free Full Text]

Sakakibara,N., Gasa,S., Kamio,K., Makita,A. and Koyanagi,T. (1989) Association of elevated sulfatides and sulfotransferase activities with human renal carcinoma. Cancer Res., 49, 335–339.[Abstract]

Schmitz,B., Schachner,M., Ito,Y., Nakano,T. and Ogawa,T. (1994) Determination of structural elements of the L2/HNK-1 carbohydrate epitope required for its function. Glycoconj. J., 11, 345–352.[ISI][Medline]

Shaklee,P.N. and Conrad,H.E. (1986) The disaccharides formed by deaminative cleavage of N-deacetylated glycosaminoglycans. Biochem. J., 235, 225–236.[ISI][Medline]

Spiro,R.G., Yasumoto,Y. and Bhoyroo,V. (1996) Characterization of a rat liver Golgi sulphotransferase responsible for the 6-O-sulphation of N-acetylglucosamine residue in ß-linkage to mannose: role in assembly of sialyl-galactosyl-N-acetylglucosamine 6-sulphate sequence of N-linked oligosaccharides. Biochem. J., 319, 209–216.[ISI][Medline]

Spiro,R.G. and Bhoyroo,V.D. (1998) Characterization of a spleen sulfotransferase responsible for the 6-O-sulfation of the galactose residue in sialyl-N-acetyl-lactosamine sequences. Biochem. J., 331, 265–271.[ISI][Medline]

Strominger,J.L., Park,J.T. and Thompson,R.E. (1959) Composition of the cell wall of Staphylococcus aureus: Its relation to the mechanism of action of Penicillin. J. Biol. Chem., 234, 3263–3268.[Free Full Text]

Tsuboi,S., Isogai,Y., Hada,N., King,J.K., Hindsgaul,O. and Fukuda,M. (1996) 6'-Sulfo sialyl Lex but not 6-sulfo sialyl Lex expressed on the cell surface supports L-selectin-mediated adhesion. J. Biol. Chem. 271, 27213–27216.[Abstract/Free Full Text]

Uchimura,K., Muramatsu,H., Kadomatsu,K., Fan, Q-W., Kurosawa,N., Mitsuoka,C., Kannagi,R., Habuchi,O. and Muramatsu,T. (1998) Molecular cloning and characterization of an N-acetylgalactosamine-6-O-sulfotransferase. J. Biol. Chem., 273, 22577–22583.[Abstract/Free Full Text]