Five Lec1 CHO cell mutants have distinct Mgat1 gene mutations that encode truncated N-acetylglucosaminyltransferase I

Wei Chen and Pamela Stanley1

Department of Cell Biology, Albert Einstein College of Medicine, 1300 Morris Park Ave., New York, NY 10461, USA

Received on August 2, 2002; revised on August 21, 2002; accepted on August 23, 2002


    Abstract
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Lec1 CHO cell mutants lack N-acetylglucosaminyltransferase I (GlcNAc-TI) activity and do not synthesize complex or hybrid N-glycans. The origins of six independent lec1 mutations are shown to reside in the coding region of the Mgat1 gene, proving that GlcNAc-TI is mutated in Lec1 mutants. One mutant has Mgat1 gene transcripts of reduced size, whereas the others possess transcripts of approximately normal size and amount containing a unique insertion or transition mutation that leads to a premature stop codon in the Mgat1 gene coding region. The lec1 mutation in the Lec3.2.8.1 mutant, a line used to generate minimally glycosylated membrane glycoproteins for X-ray crystallography, is a G insertion that leads to a nonsense codon after amino acid 391. The Pro-Lec1.3C line from the ATCC and in laboratory stocks, a line used widely for diverse purposes, possesses a C insertion in the Mgat1 gene coding exon, causing a frame shift and producing a stable, truncated ~24-kDa product. Mgat1 gene mutations were confirmed by sequencing genomic DNA PCR products. Mutant cDNAs were reverted by site-directed mutagenesis and shown to confer wild-type lectin binding and GlcNAc-TI activity on Lec1 transfectants. Surprisingly, three Mgat1 gene nucleotide changes previously reported in Pro-Lec1.3C cells (Puthalakath et al. [1996] J. Biol. Chem., 271, 27818–27822) were not detected in this study. These Lec1 mutants provide a novel cohort for investigating the effects on Golgi trafficking and kin recognition of deletion mutants of GlcNAc-TI expressed at endogenous rather than nonphysiological levels.

Key words: GlcNAc-TI / lectin resistance / Mgat1 gene mutations / site-directed mutagenesis


    Introduction
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The Lec1 Chinese hamster ovary (CHO) glycosylation mutant Pro-Lec1.3C was isolated by single step selection from Pro-5 CHO cells for resistance to the leukoagglutinin from Phaseolus vulgaris (L-PHA) and termed PhaR 1–1 (Stanley et al., 1975aGo,bGo). A similar mutant was isolated from CHO-K1 cells using ricin and termed clone 15B (Gottlieb et al., 1974Go, 1975Go). Genetic complementation analyses showed that these and many other lectin-resistant CHO isolates with a related phenotype are mutated in the same gene (Stanley, 1985Go), and they were designated Lec1 mutants (Stanley, 1983Go). Mutants in this group lack UDP-N-acetylglucosamine: {alpha}-3-D-mannoside ß-1,2-N-acetylglucosaminyltransferase I (GlcNAc-TI; EC 2.4.1.101) activity and fail to synthesize complex and hybrid N-glycans (reviewed in Stanley, 1984Go). Different mutants with a lec1 mutation have been used to identify novel features of N-glycan synthesis (reviewed in Schachter et al., 1983Go; Kornfeld and Kornfeld, 1985Go), to assay for factors that affect vesicular trafficking in vitro (reviewed in Brandli, 1991Go), to aid in identifying carbohydrate recognition properties of pathogens (reviewed in Stanley, 1984Go; Stanley and Ioffe, 1995Go), to expression clone GlcNAc-TI (Kumar et al., 1990Go), and to produce recombinant glycoproteins with simple oligomannosyl N-glycans that are uniform in structure and can be removed with endoglycosidase H (reviewed in Stanley, 1992Go; Butters et al., 1999Go). Recombinant glycoproteins produced in Lec1 cells are efficiently targeted to the reticuloendothelial system in vivo (see Brady and Barton, 1994Go). Thus recombinant glucocerebrosidase from CHO cells with a lec1 mutation can be used directly in the treatment of Gaucher's disease (Hoppe, 2000Go). Analyses of the Notch1 receptor in Lec1 cells greatly facilitated the discovery that fringe is a ß1,3GlcNAc-transferase (Moloney et al., 2000Go). Lec1 was also used to show that complex or hybrid N-glycans are neither required for Jagged1 to induce Notch signaling nor for fringe to modify Notch signal transduction (Moloney et al., 2000Go; Chen et al., 2001aGo).

To further enhance the usefulness of CHO Lec1 mutants, it is important to know the molecular basis of mutation in the different Lec1 lines. Point mutations that inactivate or weaken GlcNAc-TI may be interpreted in the context of the crystal structure (Unligil et al., 2000Go; Chen et al., 2001bGo), and mutations that reduce transcription or translation of the Mgat1 gene would identify factors that regulate GlcNAc-TI expression. When the Mgat1 gene coding region was cloned, northern blot analysis revealed that Pro-Lec1.3C cells have normal levels of Mgat1 gene transcripts of apparently full length (Kumar et al., 1990Go). The same result was reported by Puthalakath et al. (1996)Go, who obtained Pro-Lec1.3C cells from the American Type Culture Collection (ATCC) that had been deposited with the ATCC by this laboratory in 1986. These authors identified three nucleotide differences between Mgat1 cDNAs from Pro-Lec1.3C cells and CHO cells. The change that converted Cys at amino acid 123 to Arg was the only one that inactivated rabbit GlcNAc-TI (Puthalakath et al., 1996Go). Although this result clearly identified a missense mutation that abrogates GlcNAc-TI activity, we show here that this is not the molecular basis of the lec1 mutation in Pro-Lec1.3C cells. We found that the Pro-Lec1.3C mutant line obtained from the ATCC and our earliest and recent laboratory stocks do not harbor any of the nucleotide changes reported previously. Rather the Pro-Lec1.3C mutant arose from a single insertion mutation that generates an inactive, truncated GlcNAc-TI of ~24 kDa. We have also identified the molecular basis of mutation in five additional CHO glycosylation mutants that carry a lec1 mutation. Each mutation falls in the Mgat1 gene coding exon and five of the six lec1 mutant alleles encode truncated GlcNAc-TI.


    Results
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Molecular basis of five lec1 mutations
Previous studies showed that Pro-Lec1.3C cells lack GlcNAc-TI activity (Stanley et al., 1975bGo; Narasimhan et al., 1977Go; Chaney and Stanley, 1986Go) but contain full-length Mgat1 gene transcripts of the same size as in parental Pro-5 CHO cells (Kumar et al., 1990Go; Puthalakath et al., 1996Go). Figure 1 shows the expression of the Mgat1 gene in five other CHO glycosylation mutants that belong to the Lec1 genetic complementation group: Pro-Lec1.1C and Gat-Lec1.1N (Stanley et al., 1975cGo), Pro-Lec9.1.3C (Ripka et al., 1986Go), Pro-Lec3.2.8.1, and Pro-Lec 3.2.1.15C (Stanley, 1989Go). Northern blot analysis using an Mgat1 coding region probe on total RNA showed that Lec1.1N, Lec1.1C, Lec3.2.8.1, and Lec9.1.3C have Mgat1 gene transcripts of ~3 kb like CHO cells, whereas Lec3.2.1.15C has short Mgat1 gene transcripts of ~1.8 kb (Figure 1A). To obtain Mgat1 cDNAs for sequencing, reverse transcriptase–polymerase chain reaction (RT-PCR) was performed with total RNA using primers that flank the coding region of the Mgat1 gene. The RT-PCR products from CHO, Lec1.1N, Lec1.1C, Lec9.1.3C, and Lec3.2.8.1, were the expected size of ~1.4 kb. Reactions lacking reverse transcriptase gave no products, showing there was no genomic DNA contamination (Figure 1B). Lec3.2.1.15C gave a product of ~1.0 kb, indicating an ~400 nucleotide deletion in the coding region (data not shown). Therefore, like Pro-Lec1.3C, none of these Lec1 CHO mutants showed a marked reduction in Mgat1 gene transcription or transcript stability.



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. RT-PCR and northern blot analysis of Mgat1 gene expression in CHO and Lec1 cells. (A) Northern blot analysis of Mgat1 gene transcripts from CHO and Lec1 mutants. Total RNA prepared from CHO and Lec1 mutant cells was electrophoresed and transferred to membrane. The blot was hybridized to a 480-bp PstI fragment of the mouse Mgat1 gene coding region. 18S RNA was detected by ethidium bromide. (B) RT-PCR analysis of Mgat1 gene expression in CHO and Lec1 mutant cells using primers that span the 1.4-kb coding region. The lower panel shows that no product was obtained if reverse transcriptase was omitted from the reaction (-RT).

 
The northern blot and RT-PCR data indicated that Lec1.1N, Lec1.1C, Lec9.1.3C, and Lec3.2.8.1 might harbor point mutations or a small deletion/insertion in the Mgat1 gene. RT-PCR products and cloned Mgat1 cDNAs from CHO and Lec1 mutants were sequenced. The Mgat1 gene coding sequence obtained from Pro-5 CHO cells (accession number AF343963; Chen et al., 2001bGo) is identical to that reported by Puthalakath et al. (1996Go; accession number U65791) except that C1340 in the U65791 sequence is A1340 in our AF343963 sequence. This changes Thr447 in U65791 to Asn447 in AF343963. A C-terminal Asn is present in GlcNAc-TI of mouse (Kumar et al., 1992Go; Pownall et al., 1992Go), rat (Fukada et al., 1994Go), human (Kumar et al., 1990Go; Hull et al., 1991Go), Pro-Lec1.3C (U69792 of Puthalakath et al., 1996Go), and four Lec1A Mgat1 gene sequences (Chen et al., 2001bGo), and is likely to be correct.

Comparison of the wild-type Mgat1 coding sequence with Mgat1 cDNAs from the mutants is shown in Figure 2. The Lec3.2.8.1 Mgat1 coding sequence has a G insertion at nucleotide 1154 that causes a frame shift downstream of amino acid 384 and a stop codon after amino acid 391. The Lec1.1N sequence has a missense mutation at C784 (C->T) that introduces a stop codon after amino acid 261. The Lec9.1.3C sequence has a C insertion at nucleotide 310 that causes a reading frame shift after amino acid 103 and introduces a stop codon after amino acid 115. The Lec1.1C sequence has a 33-nucleotide insertion in the Mgat1 gene coding region, consistent with the slightly slower migration of its Mgat1 gene transcripts (Figure 1B). All lec1 mutations were also present in PCR products of genomic DNA from the respective mutants, and there was no indication from sequencing gels of mixtures due to either a mixed cell population, or the presence of wild-type and Mgat1 genes in a cell. Thus only one functional Mgat1 allele is present in the Pro-5 parent CHO line.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. GlcNAc-TI truncation mutations in five independent Lec1 mutants. A diagram of the coding region of the Mgat1 gene in five independently isolated Lec1 mutants with a mutation leading to a premature stop codon. Each sequence is designated by a line with the total number of nucleotides shown. The mutational change and the consequent frame shift to the first stop codon are given above each line. The number of amino acids (AA) missing from each C-terminus is shown in the right-hand column. A schematic representation of GlcNAc-TI protein is shown at the bottom: Cyt, cytoplasmic tail; TM, transmembrane domain; Catalytic, catalytic domain.

 
To show that mutations identified by sequencing provide the basis of the Lec1 phenotype, site-directed mutagenesis was performed to correct the mutation in Mgat1 cDNAs from Lec1.1N and Lec9.1.3C cells. The nonsense mutation T784 in Lec1.1N Mgat1 cDNA was corrected back to wild-type C784, and the C insertion in Lec9.1.3C Mgat1 cDNA was deleted. Corrections were confirmed by sequencing. The phenotype of stable Lec1 transfectants expressing a corrected cDNA was analyzed by binding of fluorescein isothiocyanate (FITC)–labeled L-PHA or FITC-labeled wheat germ agglutinin (WGA) by flow cytometry analysis and by GlcNAc-TI enzyme assay. Flow cytometry analysis showed that the mean fluorescence index (MFI) of Pro-Lec1.3C cells for WGA binding was reduced 75% compared to CHO cells, and the mutant bound only background levels of L-PHA (Figure 3). Correction of each mutation restored Lec1 binding to L-PHA and WGA to the level of wild-type CHO cells (Figure 3). Isolated Lec1 transfectants overexpressing corrected Mgat1 cDNA from Lec1.1N or from Lec9.1.3C had ~2.5-fold the GlcNAc-TI activity of parent CHO cells (Table I). Therefore, reversion of two lec1 point mutations was achieved, as expected, by correction of the respective single nucleotide change. The remaining Lec1 mutants also arose from a single nucleotide change.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 3. Flow cytometry of L-PHA and WGA binding to CHO, Lec1, and Lec1 Mgat1 cDNA transfectants. Lec1, CHO, and Lec1 cells stably transfected with the corrected Gat-Lec1.1N (REV1.1N), Pro-Lec9.1.3C (REV9.1.3C), or Pro-Lec1.3C (REV1.3C) Mgat1 cDNA were incubated with FITC-L-PHA (A and C) or FITC-WGA (B and D), washed, and analyzed by flow cytometry as described in Materials and methods. Results are plotted as histogram overlays (A and B), and as the MFI determined from each profile and compared to that of CHO (100%) (C and D). MFI was ~500 for WGA and ~140 for L-PHA in CHO cells.

 

View this table:
[in this window]
[in a new window]
 
Table I. GlcNAc-TI activity of Lec1 transfectants expressing a corrected Mgat1 cDNA

 
Pro-Lec1.3C cells have a cytidine insertion in the Mgat1 gene coding region
In the course of analyzing the cohort of Lec1 CHO mutants already described, we also sequenced Mgat1 cDNAs from the Pro-Lec1.3C line that we had deposited with the ATCC in 1986. As expected (Kumar et al., 1990Go; Puthalakath et al., 1996Go), northern blot analysis showed that the size and amount of Mgat1 gene transcripts were indistinguishable from those in wild-type CHO cells (Figure 1A). RT-PCR of total RNA from Pro-Lec1.3C cells was used to obtain Mgat1 cDNAs that span the ~1.4-kb coding region. PCR performed without RT gave no product, excluding the possibility of genomic DNA contamination (Figure 1B). Both RT-PCR products, cloned Mgat1 cDNAs and genomic DNA PCR products, were sequenced.

The Mgat1 coding sequence we obtained from Pro-Lec1.3C cDNAs differed significantly from that reported previously (accession number U65792; Puthalakath et al., 1996Go). Our sequence contained a single C insertion in a run of four cytidines (nucleotides 702–705) causing ACCCCT in wild type to become ACCCCCT in Pro-Lec1.3C cells (Figure 4). This leads to a frameshift after amino acid 235 and a stop codon after amino acid 244 of the GlcNAc-TI sequence (Figures 2 and 4). By contrast, Puthalakath et al. (1996)Go did not observe the C insertion but found three nucleotide changes in the Pro-Lec1.3C Mgat1 gene coding region (i.e., T367C, Cys123 to Arg123; A1016G, Gln339 to Arg339; and A1202G, Lys401 to Arg401). To investigate the unexpected discrepancy between these findings, we compared Mgat1 cDNA and genomic DNA sequences from three different Pro-Lec1.3C stocks that were frozen on different dates after varying times in culture. Stock 1, cultured for 1.3 months after cloning, had been stored in liquid nitrogen or at -135°C; stock 2, cultured for 1.6 months after cloning, had been stored at -70°C; and stock 3 was obtained from the ATCC. All stocks were derived from the clone described originally as WgaR1.3C (Stanley et al., 1975cGo).



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 4. The lec1 mutation in Pro-Lec1.3C Cells. (A) The region from nucleotide 700–707 of the CHO Mgat1 gene shows four C peaks from 702 to 705. (B) The region from nucleotide 700–708 of the ATCC Pro-Lec1.3C Mgat1 coding sequence shows five C peaks from 702 to 706. (C) Myc-tagged CHO or Pro-Lec1.3C Mgat1 cDNA was transiently transfected into Lec1 cells and cell lysates were analyzed by SDS–PAGE. The blot was hybridized to an anti-myc antibody.

 
Sequencing of cDNAs subloned into pCR2.1, or uncloned RT-PCR products, from all three stocks revealed none of the Mgat1 gene mutations obtained by Puthalakath et al. (1996)Go. At all three positions, wild-type Mgat1 gene sequence was obtained (i.e., T at nucleotide 367, A at nucleotide 1016, and A at nucleotide 1202). However, Mgat1 cDNA sequences from each source contained a C insertion at nucleotides 702–705, which causes a shift in reading frame after amino acid 235, leading to a stop codon after amino acid 244 (Figure 2). The mutation was confirmed by sequencing genomic DNA PCR products from the Mgat1 gene coding region of each Pro-Lec1.3C stock.

Correction of the Pro-Lec1.3C Mgat1 gene mutation
To prove that the single C insertion is the basis of the Pro-Lec1.3C mutant phenotype, site-directed mutagenesis was used to correct the Pro-Lec1.3C mutant cDNA. Primers were designed to delete the extra C and the corrected Mgat1 cDNA was transfected into Lec1 cells that have no GlcNAc-TI activity. Stable G418-resistant colonies were picked and examined for binding of FITC-L-PHA or FITC-WGA by flow cytometry analysis. Lec1 cells expressing a corrected Pro-Lec1.3C Mgat1 cDNA bound L-PHA and WGA similarly to wild-type CHO cells (Figure 3). The GlcNAc-TI activity of Lec1 cells expressing the corrected Mgat1 cDNA was also reverted (Table I). For comparison, ß4galactosyltransferase (ß4GalT) activity was also measured. Wild-type CHO cells had GlcNAc-TI activity of ~4 nmol/mg protein/h, whereas Pro-Lec1.3C cells had no GlcNAc-TI activity. Background cpm obtained in the assay is not present in authentic product (Chaney and Stanley, 1986Go). The GlcNAc-TI activity of transfectants expressing a corrected Mgat1 cDNA was 8–13-fold higher than CHO GlcNAc-TI. Therefore the C insertion (Figure 4) is the basis of the Mgat1 gene mutation in Pro-Lec1.3C cells.

Based on the C insertion mutation, Pro-Lec1.3C cells were predicted to synthesize a truncated GlcNAc-TI protein of ~24 kDa compared to ~48 kDa full-length GlcNAc-TI. Unfortunately, many attempts with three different affinity-purified antibodies—a polyclonal sheep antibody raised against denatured rabbit GlcNAc-TI (Burke et al., 1992Go) used by Puthalakath et al. (1996)Go, a rabbit polyclonal antibody against a rat GlcNAc-TI fusion protein (Yoshida et al., 1999Go), and an affinity-purified chicken antibody against bacterially produced mouse GlcNAc-TI (described in Materials and methods)—failed to detect GlcNAc-TI in CHO microsomes by western blot analysis or by immunoprecipitation after prolonged labeling with 35S-Met/Cys. Although each antibody readily detected bacterially produced mouse GlcNAc-TI, no specific signal was obtained from 50 µg CHO microsomes with any affinity-purified preparation. Therefore, detecting endogenous levels of GlcNAc-TI in CHO cells may require the development of antibodies against native CHO GlcNAc-TI.

To detect the protein produced by Pro-Lec1.3C Mgat1 mutant cDNA, a myc epitope sequence was fused in frame with an Mgat1 cDNA from Pro-Lec1.3C cells. After transfection into Lec1 cells, lysates were subjected to western blot analysis and the expected ~24-kDa (Pro-Lec1.3C ) or ~48-kDa (CHO control) band was obtained (Figure 4). Thus the mutant Mgat1 gene of Pro-Lec1.3C cells generates an ~24-kDa protein that is stably expressed in CHO cells, as predicted.


    Discussion
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
The molecular origins of six independent Lec1 CHO mutants are shown to reside in the Mgat1 gene, providing formal proof that GlcNAc-TI is encoded by the gene mutated in Lec1 CHO mutants. Of the six, one possesses a Mgat1 gene coding region deletion, and four arise from a nucleotide insertion that changes the Mgat1 gene reading frame and shortly leads to the introduction of a nonsense codon and premature termination. The sixth arose from a transversion mutation that introduced a stop codon into the Mgat1 gene. C-terminally truncated, inactive GlcNAc-TI is the predicted product of five of the mutant Mgat1 genes (Figure 2). Unfortunately, despite many attempts, a variety of antibodies against GlcNAc-TI failed to detect endogenous or overexpressed CHO GlcNAc-TI in microsomes. However, the production of stable truncated GlcNAc-TI was confirmed in the case of myc-tagged GlcNAc-TI from Pro-Lec1.3C Mgat1 cDNA. Other studies of GlcNAc-TI deletion mutants suggest that all the truncated forms described here will be stably produced (Sarkar et al., 1998Go). The longest mutant form in Lec3.2.8.1 cells lacks only the C-terminal 56 amino acids of GlcNAc-TI (Figure 2). However, it is not surprising that this form is inactive because the removal of only seven C-terminal amino acids reduces GlcNAc-TI activity by 40% (Sarkar et al., 1998Go).

The Mgat1 gene in the most commonly used Lec1 mutant, Pro-Lec1.3C from the ATCC, is shown here to contain a C insertion between nucleotides 702 and 705 causing a run of four cytidines to become five, and an ~24-kDa catalytically inactive GlcNAc-TI to be produced. This type of sequence change can quite readily be missed (e.g., see Ruiz-Gomez et al., 2000Go), which may explain why it was not observed in the Pro-Lec1.3C Mgat1 cDNA sequence of Puthalakath et al. (1996)Go. The region of the gel at ~24 kDa, where truncated GlcNAc-TI would migrate is not shown in Puthalakath et al. (1996)Go. In subsequent studies with CHO cells, myc-tagged GlcNAc-TI was used (Opat et al., 2000Go, 2001Go) rather than the sheep antibody that bound many nonspecific bands (Puthalakath et al., 1996Go; present study). It is less easy to understand why Puthalakath et al. (1996)Go found three nucleotide differences that we did not find in Mgat1 cDNAs or genomic DNA from either the ATCC stock or early and more recent stocks of Pro-Lec1.3C. We also determined by genomic DNA sequencing that clone 15B, a GlcNAc-TI mutant used frequently by cell biologists (reviewed in Kornfeld and Kornfeld, 1985Go; Stanley, 1984Go; Brandli, 1991Go), did not arise from the Cys123 to Arg123 mutation of Puthalakath et al. (1996)Go (data not shown). Puthalakath et al. (1996)Go confirmed the presence of three nucleotide changes in genomic DNA from their stock of Pro-Lec1.3C cells, and thus it seems likely that mutations had accumulated during cell culture. Pro-Lec1.3C arose spontaneously and contains only one functional Mgat1 allele because mixed sequences were not observed in uncloned RT-PCR or PCR products. Therefore, we conclude that the Pro-Lec1.3C mutant available from the ATCC carries a single point mutation in the Mgat1 gene coding region—a C insertion giving rise to truncated, inactive GlcNAc-TI of ~24 kDa that lacks 203 C-terminal amino acids.

It is interesting that none of the six lec1 mutations we analyzed arose from a missense inactivating mutation, despite the fact that three of them were isolated following chemical mutagenesis (see Materials and methods). Such mutations would be helpful in designing structure–function studies of GlcNAc-TI in the context of the crystal structure (Unligil et al., 2000Go). Several mutations that inactivate or weaken GlcNAc-TI have already been described: the change of amino acid 123 from Cys to Arg inactivates rabbit GlcNAc-TI (Puthalakath et al., 1996Go) as does the mutation Gly320Asp in GlcNAc-TI from the BHK mutant RicR14 (Opat et al., 1998Go). Removal of the N-terminal 106 amino acids has no effect, although further removal of 14 amino acids results in complete loss of GlcNAc-TI activity (Sarkar et al., 1998Go). Two point mutations in Lec1A CHO glycosylation mutants (D212N and R303W) weaken GlcNAc-TI by altering its kinetic properties (Chen et al., 2001bGo). D212 is the central residue of the motif E211DD213 present in all GlcNAc-TIs. This mutation may perturb interactions that both D212 and R117 make with UDP-GlcNAc. R117 also participates in the loop structuring required for acceptor binding (amino acids 318–330). A large panel of Lec1 and Lec1A mutants could easily be obtained using a specific lectin selection protocol described previously (Stanley, 1981Go) because Lec1 mutants arise at a frequency of ~10-3 after mutagenesis (Stanley et al., 1975aGo).

Overexpression of GlcNAc-TI deletion mutants has been effectively used to characterize the role of the cytoplasmic tail, transmembrane domain, and stem region of GlcNAc-TI in Golgi localization and in interactions with other Golgi enzymes, a process referred to as kin recognition (Burke et al., 1992Go; Nilsson et al., 1996Go). Recently, evidence that medial Golgi enzymes, including GlcNAc-TI, exist as complexes formed via their lumenal domains was reported (Opat et al., 2000Go). The residues in the stem region of GlcNAc-TI thought to be critical for kin recognition (Nilsson et al., 1996Go) were shown not to be required for Golgi localization, complex formation, or the transferase function of GlcNAc-TI (Opat et al., 2000Go, 2001Go). The five Lec1 mutants with endogenous levels of C-terminally truncated inactive GlcNAc-TI described here (Figure 2) represent tools for studying the effects of physiological levels of GlcNAc-TI of different lengths on medial Golgi enzyme complex formation and potentially other aspects of Golgi function.


    Materials and methods
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Materials
Bovine serum albumin, Polybrene, and Nonidet P-40 were purchased from Sigma-Aldrich (St. Louis, MO). FITC- conjugated WGA and L-PHA were from Vector Laboratories (Burlingame, CA). G418 was from Gemini Bio-Product (Calabasas, CA); concanavalin A–Sepharose was from Pharmacia (Uppsala, Sweden). TRIzol reagent, Superscript II reverse transcriptase, and fetal bovine serum (FBS) was purchased from Gemini Bio-Products (Woodland, CA). Oligonucleotide primers were from Life Technologies (Grand Island, NY). Taq polymerase was from Perkin Elmer. Pfu polymerase and QuikChange Site-Directed Mutagenesis kit were from Stratagene (La Jolla, CA). Protease inhibitor tablets, RnaseH, DnaseI, and Rnase inhibitor were from Boehringer Mannheim (Indianapolis, IN). UDP-N-acetyl-D-glucosamine, [glucosamine-6-3H](UDP-[3H]-GlcNAc), 25 µCi/mmol; UDP-galactose, [galactose-1-3H](UDP-[3H]-Gal), 25 µCi/mmol; and ({alpha}-32P) dCTP (6000 Ci/mmol) were from DuPont NEN Products (Boston, MA). Man5GlcNAc2 Asn was prepared as described previously (Chaney and Stanley, 1986Go). Myc antibody was kindly provided by Dr. E. Richard Stanley.

Cell culture
Parental CHO (Pro-5 and Gat-2) and the Lec1 mutants (Pro-Lec1.3C, Pro-Lec1.1C, and Gat-Lec1.1N (Stanley et al., 1975cGo), Pro-Lec9.1.3C (Ripka et al., 1986Go), Pro-Lec3.2.8.1, and Pro-Lec3.2.1.15C (Stanley, 1989Go) from laboratory stocks and Pro-Lec1.3C from the ATCC (CRL 1735) were cultured in suspension or monolayer at 37°C in {alpha} medium containing 10% FBS. Among the six Lec1 mutants, Lec9.1.3C, Lec3.2.8.1, and Lec3.2.1.15C were selected from chemically mutagenized cell populations, and the remainder arose spontaneously. Transfectants carrying cDNA constructs in pcDNA3.1(+) (Invitrogen, Carlsbad, CA) were grown in the same medium containing G418 at 1.0 mg/ml active weight.

Northern blot analysis and RT-PCR
Northern analysis of total RNA was performed as described (Chen et al., 2001bGo). Blots were hybridized with a Mgat1 gene coding region probe from a mouse Mgat1 cDNA (Kumar et al., 1992Go). RT-PCR was performed on total RNA as described using an oligodT12 primer and Superscript II reverse transcriptase to generate cDNA and primers 150 (forward), 5'CCAAGCTTCCTCCCCKGY-GGGGGCCAGG3' and 154 (reverse), 5'GGCTCGAG-CCCAGRARGGAMAGGCAGGWGCT3' that span the Mgat1 gene coding region. The PCR reaction was performed as described elsewhere (Chen et al., 2001bGo).

Site-directed mutagenesis
Site-directed mutagenesis was performed on cDNA clones in pcDNA3.1(+) using the QuikChange Site-Directed Mutagenesis Kit and pfu DNA polymerase. The primers used to correct the C702–705 insertion in Pro-Lec1.3C were forward, 5' GCTCAGAACAGACC-CCTCCCTTTGG3', and reverse, 5'CCAAAGGGAGGGGTCTGTTCTGAGC3'. The primers used to correct C784 to T784 in Lec1.1N were forward, 5'CCTGAGCTGCTCTATCGAACAGAC-TTT-TTTCC3', and reverse, 5'GGAAAAAAGTCTGTT-CGATAGAGCAGCTCAGG3'. The primers used to correct the C310 insertion in Lec9.1.3C were forward, 5'GTGTGCCTGCGACCCC-CTCCCAG3', and reverse, 5'CTGGTGAGGGGGTCGCAGGCACAC3'. Cycling conditions were 95°C for 2 min, 18 cycles at 95°C for 30 s, 55°C for 1 min, 68°C for 12 min. Corrected sequences were confirmed by sequencing both strands.

Sequence analysis
For Pro-Lec1.3C Mgat1 gene sequencing, two cDNA clones from each stock were sequenced in both directions, and the region spanning nucleotides 702–706 was sequenced five times for the ATCC stock and four times for each of the two laboratory stocks. Both RT-PCR and genomic DNA PCR products from each Pro-Lec1.3C stock were sequenced at least twice over the 702–706 area. For all other Lec1 mutants at least two cloned Mgat1 cDNAs were sequenced in both directions. All mutations found in a cDNA were confirmed by sequencing total RT-PCR products and PCR products from the corresponding genomic DNA in both directions. Sequencing was performed by the Sequencing Facility at the Albert Einstein College of Medicine.

Transfection of Lec1 cells and flow cytometry analysis
Transfection of cDNA into Lec1 cells was performed using Polybrene, as described (Chen et al., 2001bGo). After transfection, colonies resistant to G418 were picked, expanded in suspension culture, and tested for binding of L-PHA and WGA by flow cytometry as described previously (Chen et al., 2001bGo).

GlcNAc-TI and ß4GalT assays
GlcNAc-TI was assayed in a detergent extract as described (Chen et al., 2001bGo) using Man5GlcNAc2Asn as acceptor and UDP-3H-GlcNAc as donor. ß4GalT activity was assayed in 50 µl final volume. The reaction contained 5 µmol 2-(N-morpholino) ethanesulfonate buffer (pH 6.5), 3 µmol MnCl2, 1.2% Triton X-100, 25 µmol UDP-[6-3H]-Gal (~10,000 cpm/nmol), and 50–100 µg protein. Reactions lacking acceptor were used to determine incorporation into endogenous acceptors and degradation of donor sugar. Reactions were stopped by adding 1 ml cold water after incubation at 37°C for 2 h. Reactions were then passed through a 1-ml column of AG1-X4 (Cl- form) that was subsequently washed with 2 ml water to obtain unbound products. Radioactivity was measured by liquid scintillation counter.

Production of recombinant GlcNAc-TI
A Mgat1 cDNA from mouse (Kumar et al., 1992Go) was cloned into the pRSETB (Invitrogen) vector to express GlcNAc-TI with a His6 tag. Recombinant GlcNAc-TI protein was produced in Escherichia coli BL21 (DE3) (Invitrogen), bound to HisBind resin (Novagen, Madison, WI), and eluted with 500 mM imidazole. The eluted protein was treated with enterokinase (Biozyme) and electrophoresed on a 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) gel. The gel was stained with Coomassie Blue and the ~45-kDa band was cut out and stored in phosphate buffered saline (PBS) containing 0.5 mM Ca2+ and 0.5 mM Mg2+ at 4°C.

Preparation of chicken anti-GlcNAc-TI IgY
About 300 µg recombinant GlcNAc-TI in gel pieces was homogenized in 2 ml PBS and 2 ml Freund's complete adjuvant (Pierce, Rockford, IL). Chickens were injected with ~90 µg protein under each wing once every 2 weeks for 6 weeks. Subsequently, two more injections were given in incomplete Freund's adjuvant. Eggs collected daily were processed in batches of five to prepare IgY (Gassmann et al., 1990Go). IgY obtained 3 months after the first injection gave an OD405 nm in an enzyme linked immunosorbent assay three- to five-fold higher than pre-immune sera at a dilution of 1:5000. This IgY at a 1:1000 dilution readily detected 100 ng of recombinant GlcNAc-TI by western blot analysis. Affinity-purified antibody was prepared by incubating serum at 1:500 dilution in Tris-buffered saline (TBS) containing 0.05% NP-40 (TBSN) and 5% nonfat dry milk powder for 3 h at room temperature with ~100 µg recombinant GlcNAc-TI that had been gel-purified and transferred to polyvinylidene fluoride (PVDF) transfer membrane (PolyScreen, NEN Life Science Products). After four 5-min washes with TBSN and two with TBS, antibodies were eluted in 200 µl 100 mM glycine, pH 2.5, at 4°C for 10 min and neutralized with 1 M Tris-HCl, pH 8.0. This antibody was used at a dilution of 1:50 or 1:100 for western blot analysis.

Western blot analysis
Microsomes were prepared from cells washed in hypotonic lysis buffer (10 mM Tris, pH 7.4, 0.25 mM sucrose) containing protease inhibitors. After 20 min at 4°C, the swollen cells were passed seven times through a cell homogenizer at 4°C. Lysates were centrifuged at low speed (300 rpm) for 10 min to remove nuclei and unbroken cells, at medium speed (2000 rpm) for 10 min to remove lysosomes and mitochondria, and at 100,000xg for 2 h at 4°C to obtain microsomes. Microsomes were dissolved in 1.5% NP-40 in saline with protease inhibitors and 20% glycerol and stored at -80°C. Cell-free extract prepared as for enzyme assay (50 µg protein) or microsomes (50 µg protein) were electrophoresed on a 7.5–10% SDS-PAGE gel under reducing conditions and transferred to PVDF membrane. After blocking the membrane in 5% nonfat dry milk for 2 h at room temperature or overnight at 4°C, first antibody was added and incubated with the membrane for 1.5 h at room temperature followed by washing with TBSN, five times for 5 min each. The membrane was subsequently incubated with secondary antibody conjugated to horseradish peroxidase at room temperature for 1.5 h. After washing with TBSN five times and TBS twice for 5 min, bound antibody was visualized by incubating the membrane for exactly 1 min with Western Blot Chemiluminescence Reagent (Renaissance, NEN Life Science). A polyclonal sheep antibody raised against denatured rabbit GlcNAc-TI was a gift from Drs. Harry Schachter and Paul Gleeson (Burke et al., 1992Go; Puthalakath et al., 1996Go), a rabbit polyclonal antibody raised against a recombinant rat GlcNAc-TI fusion protein was from Dr. Tohru Komano (Yoshida et al., 1999Go), and the chicken antibody to bacterially produced mouse GlcNAc-TI was already described.


    Acknowledgements
 
We thank Subha Sundaram for excellent technical support and the preparation of the chicken anti-mouse GlcNAc-TI antibody. We also thank Drs. Harry Schachter, Paul Gleeson, and Tohru Komano for antibodies. This work was supported by a grant from the National Institutes of Health (ROI CA36434 to P.S.) and by partial support from Albert Einstein Cancer Center Grant POI 13330. Accession numbers: Lec1.3C, AF510636; Lec1.1N, AF510637; Lec9.1.3.C, AF510638; Lec3.2.8.1, AF510639; Lec1.1C, AF510640.


    Footnotes

1 To whom correspondence should be addressed; e-mail: stanley{at}aecom.yu.edu Back


    Abbreviations
 
ß4GalT, ß4Galactosyltransferase; ATCC, American Type Culture Collection; CHO, Chinese hamster ovary; FBS, fetal bovine serum; FITC, fluorescein isothiocyanate; GlcNAc-TI, UDP-N-acetylglucosamine; {alpha}-3-D-mannoside ß-1,2-N-acetylglucosaminyl-transferase I; L-PHA, Phaseolus vulgaris leukoagglutinin; MFI, mean fluorescence index; PBS, phosphate buffered saline; RT-PCR, reverse transcriptase polymerase chain reaction; TBS, Tris buffered saline; WGA, wheat germ agglutinin


    References
 Top
 Abstract
 Introduction
 Results
 Discussion
 Materials and methods
 References
 
Brady, R.O. and Barton, N.W. (1994) Enzyme replacement therapy for Gaucher disease: critical investigations beyond demonstration of clinical efficacy. Biochem. Med. Metab. Biol., 52, 1–9.[CrossRef][ISI][Medline]

Brandli, A.W. (1991) Mammalian glycosylation mutants as tools for the analysis and reconstitution of protein transport. Biochem. J., 276, 1–12.[ISI][Medline]

Burke, J., Pettitt, J.M., Schachter, H., Sarkar, M., and Gleeson, P.A. (1992) The transmembrane and flanking sequences of ß1, 2-N-acetylglucosaminyltransferase I specify medial-Golgi localization. J. Biol. Chem., 267, 24433–24440.[Abstract/Free Full Text]

Butters, T.D., Sparks, L.M., Harlos, K., Ikemizu, S., Stuart, D.I., Jones, E.Y., and Davis, S.J. (1999) Effects of N-butyldeoxynojirimycin and the Lec3.2.8.1 mutant phenotype on N-glycan processing in Chinese hamster ovary cells: application to glycoprotein crystallization. Protein Sci., 8, 1696–1701.[Abstract]

Chaney, W. and Stanley, P. (1986) Lec1A Chinese hamster ovary cell mutants appear to arise from a structural alteration in N-acetylglucosaminyltransferase I. J. Biol. Chem., 261, 10551–10557.[Abstract/Free Full Text]

Chen, J., Moloney, D.J., and Stanley, P. (2001a) Fringe modulation of Jagged1-induced Notch signaling requires the action of beta 4galactosyltransferase-1. Proc. Natl Acad. Sci. USA, 98, 13716–13721.[Abstract/Free Full Text]

Chen, W., Unligil, U.M., Rini, J.M., and Stanley, P. (2001b) Independent Lec1A CHO glycosylation mutants arise from point mutations in N-acetylglucosaminyltransferase I that reduce affinity for both substrates. Molecular consequences based on the crystal structure of GlcNAc-TI. Biochemistry, 40, 8765–8772.[CrossRef][ISI][Medline]

Fukada, T., Iida, K., Kioka, N., Sakai, H., and Komano, T. (1994) Cloning of a cDNA encoding N-acetylglucosaminyltransferase I from rat liver and analysis of its expression in rat tissues. Biosci. Biotechnol. Biochem., 58, 200–201.[ISI][Medline]

Gassmann, M., Thommes, P., Weiser, T., and Hubscher, U. (1990) Efficient production of chicken egg yolk antibodies against a conserved mammalian protein. FASEB J., 4, 2528–2532.[Abstract/Free Full Text]

Gottlieb, C., Skinner, A.M., and Kornfeld, S. (1974) Isolation of a clone of Chinese hamster ovary cells deficient in plant lectin-binding sites. Proc. Natl Acad. Sci. USA, 71, 1078–1083.[Abstract]

Gottlieb, C., Baenziger, J., and Kornfeld, S. (1975) Deficient uridine diphosphate-N-acetylglucosamine:glycoprotein N-acetylglucosaminyltransferase activity in a clone of Chinese hamster ovary cells with altered surface glycoproteins. J. Biol. Chem., 250, 3303–3309.[Abstract]

Hoppe, H. (2000) Cerezyme-recombinant protein treatment for Gaucher's disease. J. Biotechnol., 76, 259–261.[CrossRef][ISI][Medline]

Hull, E., Sarkar, M., Spruijt, M.P., Höppener, J.W., Dunn, R., and Schachter, H. (1991) Organization and localization to chromosome 5 of the human UDP-N-acetylglucosamine:{alpha}-3-D-mannoside ß-1, 2-N-acetylglucosaminyltransferase I gene. Biochem. Biophys. Res. Commun., 176, 608–615.[ISI][Medline]

Kornfeld, R. and Kornfeld, S. (1985) Assembly of asparagine-linked oligosaccharides. Annu. Rev. Biochem., 54, 631–664.[CrossRef][ISI][Medline]

Kumar, R., Yang, J., Larsen, R.D., and Stanley, P. (1990) Cloning and expression of N-acetylglucosaminyltransferase I, the medial Golgi transferase that initiates complex N-linked carbohydrate formation. Proc. Natl Acad. Sci. USA, 87, 9948–9952.[Abstract]

Kumar, R., Yang, J., Eddy, R.L., Byers, M.G., Shows, T.B., and Stanley, P. (1992) Cloning and expression of the murine gene and chromosomal location of the human gene encoding N-acetylglucosaminyltransferase I. Glycobiology, 2, 383–393 [erratum Glycobiology (1999) 9, ix].[Abstract]

Moloney, D.J., Panin, V.M., Johnston, S.H., Chen, J., Shao, L., Wilson, R., Wang, Y., Stanley, P., Irvine, K.D., Haltiwanger, R.S., and Vogt, T.F. (2000) Fringe is a glycosyltransferase that modifies Notch. Nature, 406, 369–375.[CrossRef][ISI][Medline]

Narasimhan, S., Stanley, P., and Schachter, H. (1977) Control of glycoprotein synthesis. Lectin-resistant mutant containing only one of two distinct N-acetylglucosaminyltransferase activities present in wild type Chinese hamster ovary cells. J. Biol. Chem., 252, 3926–3933.[ISI][Medline]

Nilsson, T., Rabouille, C., Hui, N., Watson, R., and Warren, G. (1996) The role of the membrane-spanning domain and stalk region of N-acetylglucosaminyltransferase I in retention, kin recognition and structural maintenance of the Golgi apparatus in HeLa cells. J. Cell Sci. 109, 1975–1989.[Abstract/Free Full Text]

Opat, A.S., Houghton, F., and Gleeson, P.A. (2000) Medial Golgi but not late Golgi glycosyltransferases exist as high molecular weight complexes. Role of luminal domain in complex formation and localization. J. Biol. Chem., 275, 11836–11845.[Abstract/Free Full Text]

Opat, A.S., Houghton, F., and Gleeson, P.A. (2001) Steady-state localization of a medial-Golgi glycosyltransferase involves transit through the trans-Golgi network. Biochem. J., 358, 33–40.[CrossRef][ISI][Medline]

Opat, A.S., Puthalakath, H., Burke, J., and Gleeson, P.A. (1998) Genetic defect in N-acetylglucosaminyltransferase I gene of a ricin-resistant baby hamster kidney mutant. Biochem. J., 336, 593–598.[ISI][Medline]

Pownall, S., Kozak, C.A., Schappert, K., Sarkar, M., Hull, E., Schachter, H., and Marth, J.D. (1992) Molecular cloning and characterization of the mouse UDP-N-acetylglucosamine:{alpha}-3-D-mannoside ß-1, 2-N-acetylglucosaminyltransferase I gene. Genomics, 12, 699–704.[ISI][Medline]

Puthalakath, H., Burke, J., and Gleeson, P.A. (1996) Glycosylation defect in Lec1 Chinese hamster ovary mutant is due to a point mutation in the N-acetylglucosaminyltransferase I gene. J. Biol. Chem., 271, 27818–27822.[Abstract/Free Full Text]

Ripka, J., Shin, S., and Stanley, P. (1986) Decreased tumorigenicity correlates with expression of altered cell surface carbohydrates in Lec9 CHO cells. Mol. Cell Biol., 6, 1268–1275.[ISI][Medline]

Ruiz-Gomez, M., Coutts, N., Price, A., Taylor, M.V., and Bate, M. (2000) Drosophila dumbfounded: a myoblast attractant essential for fusion. Cell, 102, 189–198.[ISI][Medline]

Sarkar, M., Pagny, S., Unligil, U., Joziasse, D., Mucha, J., Glossl, J., and Schachter, H. (1998) Removal of 106 amino acids from the N-terminus of UDP-GlcNAc:{alpha}-3-D- mannoside ß-1, 2-N-acetylglucosaminyltransferase I does not inactivate the enzyme. Glycoconj. J., 15, 193–197.[CrossRef][ISI][Medline]

Schachter, H., Narasimhan, S., Gleeson, P., and Vella, G. (1983) Control of branching during the biosynthesis of asparagine-linked oligosaccharides. Can. J. Biochem. Cell Biol., 61, 1049–1066.[ISI][Medline]

Stanley, P. (1981) Selection of specific wheat germ agglutinin-resistant (WgaR) phenotypes from Chinese hamster ovary cell populations containing numerous lecR genotypes. Mol. Cell Biol., 1, 687–696.[ISI][Medline]

Stanley, P. (1983) Selection of lectin-resistant mutants of animal cells. Methods Enzymol., 96, 157–184.[ISI][Medline]

Stanley, P. (1984) Glycosylation mutants of animal cells. Annu. Rev. Genet., 18, 525–552.[CrossRef][ISI][Medline]

Stanley, P. (1985) Membrane mutants of animal cells: rapid identification of those with a primary defect in glycosylation. Mol. Cell Biol., 5, 923–929.[ISI][Medline]

Stanley, P. (1989) Chinese hamster ovary cell mutants with multiple glycosylation defects for production of glycoproteins with minimal carbohydrate heterogeneity. Mol. Cell Biol., 9, 377–383.[ISI][Medline]

Stanley, P. (1992) Glycosylation engineering. Glycobiology, 2, 99–107.[ISI][Medline]

Stanley, P. and Ioffe, E. (1995) Glycosyltransferase mutants: key to new insights in glycobiology. FASEB J., 9, 1436–1444.[Abstract/Free Full Text]

Stanley, P., Caillibot, V., and Siminovitch, L. (1975a) Stable alterations at the cell membrane of Chinese hamster ovary cells resistant to the cytotoxicity of phytohemagglutinin. Som. Cell Genet., 1, 3–26.[ISI]

Stanley, P., Narasimhan, S., Siminovitch, L., and Schachter, H. (1975b) Chinese hamster ovary cells selected for resistance to the cytotoxicity of phytohemagglutinin are deficient in a UDP-N-acetylglucosamine-glycoprotein N-acetylglucosaminyltransferase activity. Proc. Natl Acad. Sci. USA, 72, 3323–3327.[Abstract]

Stanley, P., Caillibot, V., and Siminovitch, L. (1975c) Selection and characterization of eight phenotypically distinct lines of lectin-resistant Chinese hamster ovary cell. Cell, 6, 121–128.[ISI][Medline]

Unligil, U.M., Zhou, S., Yuwaraj, S., Sarkar, M., Schachter, H., and Rini, J.M. (2000) X-ray crystal structure of rabbit N-acetylglucosaminyltransferase I: catalytic mechanism and a new protein superfamily. EMBO J., 19, 5269–5280.[Abstract/Free Full Text]

Yoshida, S., Suzuki, M., Yamano, S., Takeuchi, M., Ikenaga, H., Kioka, N., Sakai, H., and Komano, T. (1999) Expression and characterization of rat UDP-N-acetylglucosamine: {alpha}-3-D-mannoside ß-1, 2-N-acetylglucosaminyltransferase I in Saccharomyces cerevisiae. Glycobiology, 9, 53–58.[Abstract/Free Full Text]