Department of Anatomy and Cell Biology, Box 100235, 1600 SW Archer Road, University of Florida College of Medicine, Gainesville FL 32610-0235, USA
Received on July 24, 2000; revised on October 12, 2000; accepted on November 15, 2000.
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: ,
'-dipyridyl/cytoplasmic glycosylation/ethyl 3,4-dihydroxybenzoate/hydroxyproline/prolyl hydroxylase/ubiquitin ligase
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Target substrates for SCF E3 ubiquitin ligases reside in both the nucleus and the cytoplasm. Proteasomes, which are the ultimate destination of proteins ubiquitinated by the SCF E3 complex, are also found in both the nucleus and cytoplasm (Schauer et al., 1993). Skp1 is enriched in the nucleus of cultured mammalian cells based on immunolocalization studies (Freed et al., 1999
; Gstaiger et al., 1999
). Genetic and biochemical studies show Skp1 in yeast kinetochores (reviewed in Deshaies, 1999
), where it apparently belongs to a protein complex distinct from the SCF complex. In the cytoplasm, Skp1 is concentrated in the mammalian centrosome (Freed et al., 1999
; Gstaiger et al., 1999
) and partially associated with the microsomal fraction in a salt-sensitive fashion in Dictyostelium (Kozarov et al., 1995
). A 2-hybrid screen has suggested an association with the cytoplasmic actin-binding protein coronin (Uetz et al., 2000
). The mechanism by which Skp1 is distributed between the nucleus and cytoplasm is unknown. However, because the SCF complex is too large to diffuse passively through nuclear pores, nuclear localization might be an active process.
Multiple genetic isoforms of Skp1 are encoded in many eukaryotes (West et al., 1997). Additional structural variation of Skp1 has been seen in Dictyostelium (in which it was previously referred to as FP21), where it is modified at HyPro143 by a linear pentasaccharide with the sequence Gal
1,6Gal
1,Fuc
1,2Galß1,3GlcNAc (Teng-umnuay et al., 1998
). The Pro residue to which the pentasaccharide is attached after hydroxylation is highly conserved in many Skp1 genes detected in fungi, invertebrates, and higher plants. Structural variants of Skp1 may differentially localize in the cell or enter into specific multiprotein complexes.
To investigate the significance of Skp1 structural variation, we examined the expression, glycosylation, and cellular localization of the two genetic isoforms of Dictyostelium Skp1, Skp1A and Skp1B. This has revealed that both Skp1s are stable and expressed at the message level throughout the life cycle. They are similarly and mostly glycosylated, by a mechanism that shows some developmental regulation and is not necessarily cotranslational. They are each enriched in the nucleus and regions of the cytoplasm, and nuclear enrichment appears to depend on its glycosylation. These results provide the first clue about the function of the unusual glycosylation of Skp1, which is mediated by a novel glycosylation pathway that appears to reside in the cytoplasm rather than the secretory pathway of the cell (West et al., 1996; Teng-umnuay et al., 1999
).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The primer for reverse transcription of total cell RNA hybridized to a region near the 3' end of the coding region that was identical between Skp1A and Skp1B. Subsequent PCR was based on this and an upstream primer corresponding to a second shared sequence near the 5' end of the coding region. This yielded a predominant band of about 420 bp from HL-5 grown Ax3 cells (Figure 1, lane 16), similar to the 428-bp length expected for Skp1 cDNA. No bands were detected in the absence of RNA (data not shown). A control lacking reverse transcriptase produced very faint bands at 420 and 580 bp (data not shown) attributable to Skp1A and Skp1B DNA, because Skp1B DNA contains a 154-bp intron not present in Skp1A (West et al., 1997).
|
Similar levels of Skp1A and Skp1B cDNA were amplified by RT-PCR at all stages of the life cycle tested, including cells grown on bacteria or at different densities in HL-5 growth medium and after various times of starvation either in suspension or on filters (Figure 1). Total Skp1 mRNA levels were also similar throughout the life cycle, except that cells from HL-5 exhibited slightly higher levels (data not shown). Both Skp1A and Skp1B mRNAs are expressed at the protein level at least in stationary phase cells (saturation density in HL-5 growth medium), based on amino acid sequencing of total Skp1 from these cells (West et al., 1997).
Skp1 glycosylation is affected by inhibitors of prolyl hydroxylase
Prolyl hydroxylases that modify collagen and other secretory proteins can be inhibited in vivo by ,
'-dipyridyl and ethyl 3,4-dihydroxybenzoate (Kivirikko and Pihlajaniemi, 1998
). Because the Skp1 glycan is attached via a HyPro residue, inhibition of hydroxylation of this Pro residue would be expected to block its glycosylation. Preliminary results suggested that 1 mM
,
'-dipyridyl partially inhibits Skp1 prolyl hydroxylase activity in cell extracts (West, unpublished data). An effect of
,
'-dipyridyl on Skp1 glycosylation in cells was tested by Mr analysis of Skp1 by SDSpolyacrylamide gel electrophoresis (PAGE) and Western blotting, as affected Skp1 was expected to be reduced in mass by 851 Da. Strain Ax3 cells attached to tissue culture plastic wells were starved in KP buffer (17 mM KPO4, pH 6.5; developmental conditions) in 0.021 mM
,
'-dipyridyl for 17 h. The entire cell pellet was solubilized in SDSsample buffer and subjected to SDSPAGE/Western blotting with mAb 3F9 (Kozarov et al., 1995
), using 1520% polyacrylamide gradient gels to maximize separation of normal and nonhydroxylated Skp1. mAb 3F9 recognizes nonglycosylated Skp1 produced recombinantly in Escherichia coli, indicating that its epitope does not require glycosylation. After incubation in 0.05 mM
,
'-dipyridyl, the majority of Skp1 exhibited a lower lower Mr consistent with the absence of hydroxylation and glycosylation of Pro143 (Figure 2A, upper). The overall level of Skp1 was not greatly altered. At this concentration, incorporation of [35S]Met and [3H]Fuc into total acid precipitable material was reduced by 2% and 9%, suggesting that the effect was not the result of inhibiting overall protein synthesis via an effect on deoxyhypusyl hydroxylase (McCaffrey et al., 1995
). A similar effect of
,
'-dipyridyl on Skp1 Mr was seen when cells were incubated in HL-5 growth medium, where incorporation of [35S]Met and [3H]Fuc into total acid precipitable material was reduced by 33% and 39%. A smaller fraction of Skp1 was shifted to the lower Mr position at lower concentrations of
,
'-dipyridyl or shorter time periods of treatment (data not shown). The fraction of total unglycosylated Skp1 did not increase at higher concentrations, and cells tended to detach from the tissue culture plate. Similar partial effects on Skp1 glycosylation were observed using 200400 µM ethyl 3,4-dihydroxybenzoate (data not shown), an inhibitor that after intracellular de-esterification is thought to function by a mechanism distinct from that of
,
'-dipyridyl (Sasaki et al., 1987
; Kivirikko and Pihlajaniemi, 1998
). The concentrations of
,
'-dipyridyl and ethyl 3,4-dihydroxybenzoate that were inhibitory were similar to or less than those which affect collagen hydroxylation in mammalian cells (Sasaki et al., 1987
; Eleftheriades et al., 1995
). These results suggest that hydroxylation of Skp1's Pro143 is partially sensitive to inhibitors of known prolyl hydroxylases in vivo. Since negligible levels of normal Skp1 were seen at the inhibited position, nearly all Skp1 is usually glycosylated in the cell.
|
|
|
To determine whether Skp1B is glycosylated in the same way as are Skp1A and total Skp1, which were analyzed previously (Teng-umnuay et al., 1998), Skp1B-myc was purified to homogeneity from the high-level expressor strain HW302, reduced, alkylated, and digested with endo-Lys-C. The resulting peptides were separated on a reverse-phase high-performance liquid chromatography (RP-HPLC) column and analyzed by matrix-assisted laser desorption ionizationtime of flightmass spectrometry (MALDI-TOF-MS). Two sequential absorbance peaks were found to contain abundant ions with m/z ratios of 2487 and 1636, corresponding to the MH+ values of the pentasaccharide-peptide139155 and peptide139155 detected previously in Skp1A-myc (Teng-umnuay et al., 1998
). In-source fragmentation of the m/z 2487 ion revealed a series of daughter ions corresponding precisely to the sequence Hex-Hex-deoxyHex-Hex-HexNAc-HyPro-peptide, suggesting that the Skp1B oligosaccharide was identical to that of the Skp1A-myc oligosaccharide. The presence of the unmodified peptide, as indicated by the m/z 1636 ion, suggested the existence of unmodified Skp1B-myc in the cell, but the level of this isoform was low based on SDSPAGE/Western blot analysis as described above (Figure 2B).
Skp1 expressed in prespore cells is not glycosylated
To investigate possible developmental regulation of glycosylation, Skp1B-myc and Skp1B1(P143A)-myc were expressed under the control of the cotB promoter, which is absolutely specific for prespore cells (Fosnaugh and Loomis, 1993), which appear later in development. After 20 h of starvation, at which time about 75% of the cells have differentiated into prespore cells, Western blot analysis showed that each of these Skp1s was expressed at a high level compared to endogenous Skp1 (Figure 4B, lanes 2, 3). Their apparent Mr values were indistinguishable (Figure 4A, lanes 13), indicating that Skp1B-myc was not glycosylated. Although the capacity of the glycosylation pathway might have been saturated by the high level of Skp1B-myc expressed, there was no evidence for even partial glycosylation of expressed Skp1.
|
Localization of Skp1 in the cell
Previous studies concluded that Skp1 is concentrated in the nucleus and the centrosome, relative to the cytoplasm, based on indirect immunofluorescence microscopy of cultured mammalian cells (Freed et al., 1999; Gstaiger et al., 1999
). Localization of Skp1 in Dictyostelium was investigated based on a similar approach using the mAbs described in the Western blot studies above. Growing cells of the normal strain Ax3 were allowed to attach to cover slips in HL-5 growth medium, fixed in 4% paraformaldehyde, permeabilized with cold acetone, and immunoprobed using an indirect technique with mAb 3F9. This antibody was induced against denatured, gel-purified Skp1 and is monospecific for Skp1 based on Western blot analysis (Figure 5A, lane 1), and immunoprecipitation of either native or denatured cell extracts with mAb 3F9 failed to enrich for any additional reactive bands (Larner and West, unpublished data). Fluorescence was found throughout most of the cytoplasm and was concentrated in a few patches in the cytoplasm and in the nucleus, as determined by colabeling with 4',6'-diamidino-2-phenylindole (DAPI) (Figure 5B, panels 13). Only an indistinct haze was seen in the absence of primary antibody (panel 4). Cells that had become multinucleated while grown in suspension were labeled in all nuclei. Deconvolution microscopy demonstrated that Skp1 was localized in the nuclear interior (panels 13, insets). Similar results were obtained using mAb 4E1, an independent anti-Skp1 mAb that is also monospecific for Skp1 based on Western blot analysis (Kozarov et al., 1995
) (data not shown). Nuclear enrichment was also observed when paraformaldehyde-fixed cells were permeabilized with 0.1% NP-40 in place of acetone or MeOH, but was not as pronounced when cells were fixed with only cold MeOH or MeOH/HAc (data not shown), as previously reported for mammalian Skp1 (Freed et al., 1999
).
|
|
The localization of Skp1 in early developing cells preparing for chemotactic aggregation was investigated after transferring cells into KP buffer for 28 h. The nuclear concentration of endogenous and expressed Skp1 that was seen in growing cells was conserved, but cytoplasmic labeling along the plasma membrane and in cytoplasmic extensions was more prevalent (Figure 6AD). Cytoplasmic labeling was often (but not always) correlated with F-actin as determined by colabeling with FITC-phalloidin. Prespore cells, formed late in development, also showed nuclear enrichment of Skp1 (data not shown). The varied range of distributions suggested that Skp1s cytoplasmic localization is dynamic, but that its enrichment in the nucleus is constant.
|
Two Skp1A-myc mutants described above, Skp1A1-myc and Skp1A2-myc (Table I), are poorly glycosylated and thus provided an opportunity to explore the relationship between glycosylation and nuclear concentration further. Skp1A1-myc was not enriched in the nucleus, but its localization in the cytoplasm of cells developed in KP buffer appeared normal (Figure 6E,F). Skp1A2-myc was similarly not concentrated in the nucleus (data not shown). These results show that when glycosylation is blocked by a different mechanism than the P143A mutation, nuclear concentration relative to the cytoplasm still does not occur. Because most Skp1A1-myc is hydroxylated at Pro143 (Teng-umnuay et al., 1998), hydroxylation alone was not sufficient for nuclear enrichment relative to the cytoplasm.
Localization of Skp1B-myc expressed in prespore cells, where it was not glycosylated, was also found to be not enriched in the nucleus (Figure 8A). This result was confirmed by deconvolution microscopy (Figure 8B). Its localization was similar to expressed Skp1B1(P143A)-myc (Figure 8C). Endogenous Skp1 was still nuclear-enriched in these cells (data not shown), showing they had not lost capacity of nuclear concentration. Nucleoli were especially devoid of Skp1B-myc (Figure 8C), and in some cells, Skp1 appeared to accumulate at the nuclear surface (Figure 8C).
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In developing cells, substantial fluorescence was also concentrated over regions of peripheral cytoplasm either at the cell margin or cell top, which sometimes superimposed over actin-rich regions of the cell (Figure 6). Localization in the cytoplasm is consistent with the compartmentalization of other substrates of SCF complexes, and data that Skp1 interacts with the actin-binding protein coronin (Uetz et al., 2000) and the barbed ends of F-actin in vitro (Bubb et al., unpublished data). Localization in the centrosome, seen previously using polyclonal antisera in mammalian cells (Freed et al., 1999
; Gstaiger et al., 1999
), was not observed in Dictyostelium using our mAbs. Despite its glycosylation, Skp1 is not vesicular consistent with the absence of targeting sequences or other evidence for entering the secretory pathway (Kozarov et al., 1995
).
Enrichment of Skp1 in the nucleus relative to the surrounding cytoplasm was consistently observed at all stages of development examined. This suggested that Skp1 might also be enriched in isolated nuclei relative to other cellular fractions, but this was not observed (Kozarov et al., 1995). Loss of proteins from nuclei isolated in aqueous media has been documented (Allfrey, 1959
; Paine et al., 1983
) and was also observed for mammalian Skp1 (Gstaiger et al., 1999
). However, the interpretation that Skp1 is normally concentrated in nuclei is strengthened by evidence, described below, that this apparent localization is modulated by specific structural changes in Skp1.
Nuclear concentration of Skp1 depends on its glycosylation
When the glycosylation site was mutated from Pro to Ala, Skp1A3-myc was not enriched in the nucleus relative to the nearby cytoplasm (Figure 7C,D). This did not appear to be the result of saturating the nuclear concentration process, as Skp1A3-myc was expressed at low levels in these strains relative to endogenous Skp1 (Figure 3), and high levels of expressed Skp1B-myc in other strains were still concentrated in the nucleus (Figure 5B, panels 58). However, mutant Skp1A3-myc did not appear to be absolutely excluded from the nucleus, though the exact level is uncertain because it was difficult to precisely establish the level of nonspecific labeling owing to variations in cell shape. It is unlikely that the glycosylation site mutation simply destabilized Skp1, as this amino acid substitution occurs naturally in certain Skp1 genes of A. thaliana and C. elegans, and Skp1B1-myc expressed in prespore cells was as stable as normal expressed Skp1B-myc (Figure 4).
A similar correlation between loss of nuclear enrichment and lack of glycosylation was also seen in mutants with amino acid substitutions at codons 34 and 71 (Skp1A1-myc), or codons 5456 (Skp1A2-myc) (Figures 2C, 6E,F). In contrast, concentration in the peripheral cytoplasm of developing cells was unaffected (Figure 6). Nuclear enrichment was also lost when Skp1B-myc was expressed in prespore cells (Figures 4, 8), in which case the lack of glycosylation did not involve any mutations in Skp1 itself. Finally, when Skp1 glycosylation was partially inhibited by the independent method of treating cells with the prolyl hydroxylase inhibitors ,
'-dipyridyl (Figure 2A) or ethyl 3,4,-dihydroxybenzoate, the concentration of nuclear Skp1 relative to nearby cytoplasm also appeared reduced (Figure 9). Taken together, these results strongly indicate that glycosylation of Skp1 is required for its enrichment in the nucleus relative to its level in nearby cytoplasm. However, an alternative explanation might be that absence of glycosylation resulted in change in Skp1 binding in the nucleus, thereby masking both the mAb 3F9 and 9E10 epitopes in the nucleus selectively. Such a differential effect on nuclear and cytoplasmic forms of Skp1 seems unlikely, however, because the effect was seen after acetone permeabilization and because most cellular Skp1 is thought to be bound in similar SCF complexes, but ruling out this formal possibility must await future studies.
The core disaccharide was sufficient for nuclear enrichment, as Skp1 was localized normally in the nuclei of the general fucosylation-defective strain HL250. Pro143 hydroxylation itself was insufficient, as Skp1A1-myc, which is mostly hydroxylated but not glycosylated (Teng-umnuay et al., 1998), was not enriched in the nucleus (Figure 6E,F).
Possible mechanism of nuclear concentration
Although the great majority of Skp1 is glycoslyated, only a fraction of it is present in the nucleus. Thus, glycosylation seems to be necessary but not sufficient for nuclear accumulation. In cell extracts, the majority of Skp1 is inaccessbile to immunoprecipiation by any of the anti-Skp1 mAbs except after denaturation, reduction, and alkylation (Larner and West, unpublished data), suggesting that Dictyostelium Skp1 is in protein complexes such as the SCF complex that would be too large to enter the nucleus unless actively transported. Although it is not known if complex formation occurs before or after Skp1s nuclear concentration, it is unlikely that glycosylation is necessary for SCF complex formation as recombinant Skp1 from E. coli, which is not glycosylated, enters the SCF complex (Deshaies, 1999). In addition, the glycosylation site in Dictyostelium maps to the opposite side of the contract interface between mammalian Skp1 and the F-box protein (Schulman et al., 2000
).
Previous studies with neoglycoproteins have suggested that sugars can potentiate nuclear uptake. When serum albumin is derivitized with 20 or more mono- or disaccharides of Glc or GlcNAc, it can be concentrated in permeabilized mammalian cells by a process that requires ATP (Duverger et al., 1995, 1996). If the Galß1,3GlcNAc-disaccharide of Skp1 is a structural mimic of neoglycosylated serum albumin on at least one site, then the nuclear enrichment of Skp1 might be related to stimulated uptake of neoglycoproteins.
The effect of Skp1 glycosylation on nuclear concentration might be mediated by a receptor. Eukaryotic cells contain abundant levels of galectins in the cytoplasm and nucleus (for example, Gaudin et al., 2000), including some that recognize substituted Galß1,3GlcNAc core disaccharides as seen in Skp1 (Henrick et al., 1998
). Dictyostelium expresses discoidins with related binding specificities at high levels in the nucleus and cytoplasm (Erdos and Whitaker, 1983
; Alexander et al., 1992
). Thus, cytoplasmic/nuclear lectins are potential candidates for participating in the mechanism of nuclear enrichment of Skp1.
Nuclear concentration of Skp1 might involve a shuttling mechanism in which the balance of import over export (Feldherr, 1998; Kaffman and O'Shea, 1999
) is influenced by glycosylation. Skp1 harbors an amino acid sequence upstream of its glycosylation site, 96-LFELILAANYL, that resembles Crm1-dependent nuclear export signals in proteins of other organisms (Nix and Beckerle, 1997
). Phosphorylation can promote or inhibit nuclear accumulation of some proteins (Kaffman and O'Shea, 1999
), including inhibiting StatA nuclear association in Dictyostelium (Ginger et al., 2000
). Interestingly, the Skp1 glycosylation site is adjacent to a string of four Glu residues and might cover this acidic patch. Alternatively, glycosylation may support nuclear localization indirectly via an effect on Skp1 folding or SCF-complex assembly.
Posttranslational modification of Skp1
Skp1 appeared to be constitutively expressed and glycosylated, except that when it was expressed in prespore cells under the cotB promoter it was not glycosylated (Figure 4). This indicates that an early step in the pathway or a critical donor substrate or cofactor is developmentally regulated. However, this effect may not be physiologically significant because it is not known whether Skp1 is normally produced by prespore cells, and nonglycosylated variants of endogenous Skp1 were not detected late in development (Figure 4). However, Skp1 expressed in these cells was stable and permitted an analysis of nuclear concentration and potential reglycosylation (see above). Both glycosylated and unglycosylated Skp1 were stable and long-lived, as they were detectable for up to 5 days when the prespore cells were returned to growth medium. Furthermore, prespore-expressed Skp1B-myc became partially glycosylated during this interval (Figure 4), showing that glycosylation is not necessarily coupled to its biosynthesis. Another conclusion that can be derived from the studies on mutant Skp1A1-myc and Skp1A2-myc is that glycosylation depends on the structure of Skp1, as their point mutations, which map to the N-terminal half of the protein distant from the glycosylation site, block its glycosylation (Table I).
The hypothetical Skp1 prolyl hydroxylase appears to be related to known prolyl hydroxylases based on the sensitivity of Skp1 glycosylation to two different inhibitors of prolyl hydroxylases. Hydroxylation is thought to occur at the 4-position of Pro143 as a synthetic peptide containing 4-OH-Pro is a substrate of the Skp1-GlcNAc-transferase (Teng-umnuay et al., 1999). All known prolyl hydroxylases are residents of the lumen of the rER (Kivirikko and Pihlajaniemi, 1998
), which contrasts with the localization of Skp1 in the cytoplasm and nucleus. Current evidence suggests that Skp1 receives its GlcNAc and Fuc residues in the cytoplasm (West et al., 1996
; Teng-umnuay et al., 1999
); further work is required to localize the Skp1 prolyl hydroxylase.
Inhibitors of prolyl-4-hydroxylase have received considerable interest for their potential to interfere with collagen deposition, which depends on 4-hydroxylation of its Pro residues, in such diseases as liver cirrhosis and atherosclerosis. Although there is evidence for efficacy in cirrhosis, the mechanism seems to involve inhibition of differentiation of collagen secreting cells rather than a direct effect on collagen deposition per se (Matsumura et al., 1997; Sakaida et al., 1999
). A possible explanation for this and other effects (McCaffrey et al., 1995
) is action on previously unknown prolyl hydroxylases that modify cytoplasmic or nuclear rather than secretory substrates.
Summary
There is no evidence for differential expression or glycosylation of the two Skp1 proteins expressed in Dictyostelium. Both Skp1A and Skp1B are nearly quantitatively modified by similar if not identical pentasaccharides at Pro143, except when produced in prespore cells. Skp1 produced in this cell type is not fully glycosylated but can be subsequently modified when cells are returned to growth medium. The unusual oligosaccharide-protein linkage of Skp1 is susceptible to inhibitors of prolyl hydroxylases in vivo, which provides a new method for detecting this type of complex glycosylation on other cytoplasmic/nuclear proteins by Mr-shift analysis. Prevention of glycosylation either by mutation of the attachment site or other approaches inhibited concentration of Skp1 in the nucleus relative to the surrounding cytoplasm based on immunofluorescence analysis. Although the mechanism of this effect remains to be elucidated, it is apparent that this glycosyl modification has a functional consequence on the compartmentalization of this protein.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
RT-PCR
Aliquots of 107 cells were washed by centrifugation with KP buffer and frozen at 80°C in 1.5-ml microcentrifuge tubes. Samples were lysed with 1 ml TRIZOLTM Reagent (Life Technologies) by repetitive pipetting and incubated for 5 min at room temperature. Chloroform (0.2 ml; Fisher HPLC grade) was added, and the tubes were shaken vigorously and incubated again for 5 min at room temperature. Tubes were centrifuged at 12,000 x g for 10 min at 4°C. RNA was precipitated from the upper, aqueous phase by mixing with 0.5 ml of isopropanol, incubating for 10 min at room temperature, and centrifuging at 12,000 x g at 4°C for 10 min. The pellet was rinsed with 1 ml of 75% ethanol and dissolved in 50 µl of water, yielding 100150 µg of total RNA. One microgram RNA was subjected to reverse transcription using 20 pmol of the downstream primer (5'-TCTTCACACCATTCATTTTCTTTTCT), 1 mM of each dNTP, 20 U RNase inhibitor (Perkin Elmer), 5 mM MgCl2, and 50 U MuLV reverse transcriptase (Perkin Elmer), in a total vol of 20 µl of 1x PCR buffer. The reaction was allowed to proceed for 15 min at 42°C, 5 min at 99°C, and 5 min at 5°C. The reaction mixture was diluted fivefold in 1x PCR buffer to a final concentration of 2 mM MgCl2 and supplemented with 2.5 U AmpliTaq® DNA polymerase and 20 pmol of the upstream primer (5'-ATTGAAAAAGAAATCGCTTGTATGT). Primers corresponded to sequences that were identical in fpa1 and fpa2 (Skp1A and Skp1B genes). Amplification was carried out from 15 to 35 cycles (45 s, 94°C; 45 s, 49°C; 3 min, 72°C). DNA products were resolved by electrophoresis in 1% agarose and visualized with ethidium bromide. In some cases RT-PCR products were digested with SspI, BclI, and EcoRV and visualized after electrophoresis in 3% NuSieve GTG Agarose (FMC Bioproducts).
Metabolic labeling
To test the effects of prolyl hydroxylase inhibitors on general metabolism, growth phase cells were deposited at 107 cells/well of a 24-well tissue culture plate in HL-5 growth medium. After cell attachment (15 min), the medium was replaced with 320 µl 01000 µM ,
'-dipyridyl (Sigma) or 0400 µM ethyl 3,4-dihydroxybenzoate (Sigma) prepared in HL-5. After 30 min, the medium was supplemented with [35S]Met (1000 Ci/mmol; New England Nuclear) or [6-3H]L-Fuc (85.2 Ci/mmol; New England Nuclear), which had been dried down and reconstituted at 10x strength in HL-5, to a final concentration of 10 µCi/ml, and cells were allowed to incubate for an additional 3 h. For labeling of differentiating cells, HL-5 was replaced with KP buffer after cell attachment, and cells were incubated for 6 h in KP buffer before drug treatment and metabolic labeling as above. Cells were transferred to 15-ml tubes, diluted in KP, and centrifuged to recover the washed cells. The pellet was resuspended in 1 ml of 0.2% NP-40 in KP buffer. An aliquot of 0.25 ml was transferred to a microcentrifuge tube and supplemented with 200 µl 0.125 mg/ml bovine serum albumin in water. Protein was precipitated with 50 µl of 100% trichloroacetic acid for 2 h on ice and collected on a GF/C glass fiber filter, rinsed with cold 10% trichloroacetic acid and acetone, and assayed by liquid scintillation counting.
Mass spectrometry of glycopeptides
Skp1B-myc was purified from strain HW302, digested with endo-Lys-C, and fractionated on a C18-reversed-phase column as described previously (Teng-umnuay et al., 1998). All fractions were analyzed by MALDI-TOF-MS on a Perceptive Biosystems Voyager DE in the UF Protein Chemistry Core Lab as also described in that report.
Skp1 expression constructs
The expression constructs were derived from pVEIIATG by insertion of C-terminal myc-tagged Skp1-coding cDNA into the KpnI and SacI sites of its MCS, positioned downstream of the discoidin 1
promoter intended to drive expression during late growth phase and early development, as previously described (Teng-umnuay et al., 1998
, 1999). The original strain HW120 expressed a version of Skp1 (Skp1A1-myc) with two PCR-derived missense mutations (Table I). A plasmid expressing normal Skp1A-myc was constructed by repeating the procedure. The Skp1B-myc expression construct was created by introducing an A39S substitution in the Skp1A-myc plasmid using the QuikChange site-specific mutagenesis kit (Stratagene, La Jolla, CA), with 5'-GGTGAATCAGATGCGCCAATTCCATTA as a primer. A newly created HhaI site was used to screen for the altered plasmid. P143A substitutions were created by similar site-specific mutagenesis, using 5'CAAGAACGACTTTACTGCAGAAGAAGAAGAAC as a primer and screening for the newly created PstI site. Skp1A2-myc, which contained amino acid substitutions at codons 5355, was similarly prepared using GCACTATTTTAGAAGCTTCTTCTGACTATTGCAGAC as a primer, and screening for the introduced HindIII site. All sequences were confirmed directly. Myc-tagged Skp1 was expressed throughout growth and early development in these strains, and the expected substantial suppression by folic acid (Blusch et al., 1992
) was not observed (data not shown). To direct expression of the Skp1 constructs in prespore cells, the discoidin promoter was replaced by the cotB promoter as previously described (Zhang et al., 1999
). Plasmids were transfected into Dictyostelium strain Ax3 as CaPO4 precipitates (Blusch et al., 1992
) or by electroporation (Pang et al., 1999
), and transformants were isolated in the presence of 15 µg/ml G418 and cloned.
Electrophoresis
Cells were pelleted in a microcentrifuge tube, lysed in Laemmli sample buffer, and separated on 1520% linear gradient SDSpolyacrylamide slab gels. Gels were electrophoretically transferred on a semi-dry apparatus and immunochemically probed as described elsewhere (West et al., 1997).
Immunofluorescence localization
Growing cells from HL-5 medium were deposited on glass cover slips and allowed to attach for 15 min. In some cases, attached cells were either maintained in HL-5 or rinsed in KP buffer and allowed to develop, for up to 17 h, in the absence or presence of a range of concentrations of ,
'-dipyridyl or ethyl 3,4-dihydroxybenzoate. Cells were fixed by treatment with 24% paraformaldehyde in KP buffer, pH 7.4, for 15 min, followed by treatment with either acetone (20°C) or 0.1% NP-40 in KP buffer for 5 min. Similar results were obtained with both methods. Alternatively, cells were fixed in 50% acetone:50% methanol at room temperature for 2 min, followed by replacement with phosphate buffered saline (PBS), or in 95% ethanol:5% glacial HAc at 20°C for 5 min, followed by PBS (Harlow and Lane, 1988
). After rinsing in KP or PBS, cells were blocked in 5% nonfat dry milk in TBS for 5 min, followed by incubation in 1°C antibody diluted in the milk solution for 1 h, rinsing in TBS, and incubation in 1:200 dilution of affinity-purified Texas red conjugated rabbit anti-mouse antibody (Sigma). Alternatively, fixed cells were blocked in 3% (v/v) goat serum in PBS, incubated with antibodies diluted in 1% goat serum, and probed with a 1:2,000 dilution of affinity-purified Alexa 568-conjugated goat anti-mouse antibody (Molecular Probes). In some cases, cells were subsequently incubated with FITC-phalloidin (Molecular Probes) to detect F-actin. FITC-phalloidin was prepared by drying an aliquot in a vacuum centrifuge, replacing with the same volume of 10% Triton X-100, and diluting 1200-fold in PBS. After final washing in TBS, cover slips were mounted in Vectashield (Vector Labs) containing 0.1 µg/ml DAPI. Images were collected digitally on a Zeiss Axiophot microscope equipped with a SPOT-2 camera, or on an Applied Precision deconvolution microscope equipped with Deltavision software. Multiple color channel recordings were taken from the same focal plane. Related images were processed similarly in Adobe Photoshop. Conclusions were based on multiple trials involving many cells viewed by independent observers. Unless otherwise indicated, cells shown were representative of the entire population.
![]() |
Acknowledgments |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Abbreviations |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Footnotes |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Allfrey, V. (1959) The isolation of subcellular components. In J. Brachet and A.E. Mirsky, eds., The Cell, vol. I. Academic Press, New York, pp 193290.
Blusch, J., Morandini, P., and Nellen, W. (1992) Transcriptional regulation by folate: inducible gene expression in Dictyostelium transformants during growth and early development. Nucleic Acids Res., 20, 62356238.[Abstract]
Chung, C.Y., Reddy, T.B., Zhou, K., and Firtel, R.A. (1998) A novel, putative MEK kinase controls developmental timing and spatial patterning in Dictyostelium and is regulated by ubiquitin-mediated protein degradation. Genes Dev., 12, 35643578.
Deshaies, R.J. (1999) SCF and cullin/RING H2-based ubiquitin ligases. Annu. Rev. Cell. Dev. Biol., 15, 435467.[ISI][Medline]
Duverger, E., Pellerin-Mendes, C., Mayer, R., Roche, A.-C., and Monsigny, M. (1995) Nuclear import of glycoconjugates is distinct from the classical NLS pathway. J. Cell Sci., 108, 13251332.
Duverger, E., Roche, A.-C., and Monsigny, M. (1996) N-acetyl-Glucosamine dependent nuclear import of neoglycoproteins. Glycobiology, 6, 381386.[Abstract]
Eleftheriades, E.G., Ferguson, S.G., Spragia, M.L., and Sameral, A.M. (1995) Prolyl hydroxylation regulates intracellular procollagen degradation in culture rat cardiac fibroblasts. J. Mol. Cell Cardiol., 27, 14591473.[ISI][Medline]
Ennis, H.L., Dao, D.N., Pukatzki, S.U., and Kessin, R.H. (2000) Dictyostelium amoebae lacking an F-box protein form spores rather than stalk in chimeras with wild type. Proc. Natl. Acad. Sci. USA, 97, 32923297.
Erdos, G.W., and Whitaker, D. (1983) Failure to detect immunocytochemically reactive endogenous lectin on the cell surface of Dictyostelium discoideum. J. Cell Biol., 97, 9931000.[Abstract]
Feldherr, C.M. (1998) Macromolecular exchanges between the nucleus and cytoplasm. J. Cell. Biochem. Suppl., 3031, 214219.
Fosnaugh, K., and Loomis, W.F. (1993) Enhancer regions responsible for temporal and cell-type-specific expression of a spore coat gene in Dictyostelium. Dev. Biol., 157, 3848.[ISI][Medline]
Freed, E., Lacey, K.R., Huie, P., Lyapina, S.A., Deshaies, R.J., Stearns, T., and Jackson, P.K. (1999) Components of an SCF ubiquitin ligase localize to the centrosome and regulate the centrosome duplication cycle. Genes Develop., 13, 22422257.
Gaudin, J.C., Mehul, B., and Hughes, R.C. (2000) Nuclear localisation of wild type and mutant galectin-3 in transfected cells. Biol. Cell, 92, 4958.[ISI][Medline]
Ginger, R.S., Dalton, E.C., Ryves, W.J., Fukuzawa, M., Williams, J.G., and Harwood, A.J. (2000) Glycogen synthase kinase-3 (GSK-3) enhances nuclear export of a Dictyostelium STAT protein. EMBO J., 119, 54835491.
Gonzalez-Yanes, B., Mandell, R.B., Girard, M., Henry, S., Aparicio, O., Gritzali, M., Brown, R.D., Erdos, G.W., and West, C.M. (1989) The spore coat of a fucosylation mutant in Dictyostelium discoideum. Dev. Biol., 133, 576587.[ISI][Medline]
Gstaiger, M., Marti, A., and Krek, W. (1999) Association of human SCF (SKP2) subunit p19 (SKP1) with interphase centrosomes and mitotic spindle poles. Exp. Cell Res., 247, 554562.[ISI][Medline]
Harlow, E., and Lane, D. (1988) Antibodies. A Laboratory Manual. Cold Spring Harbor Laboratory, New York, p. 385.
Henrick, K., Bawumia, S., Barboni, E.A., Mehul, B., and Hughes, R.C. (1998) Evidence for subsites in the galectins involved in sugar binding at the nonreducing end of the central galactose of oligosaccharide ligands: sequence analysis, homology modeling and mutagenesis studies of hamster galectin-3. Glycobiology, 8, 4557.
Kaffman, A., and OShea, E.K. (1999) Regulation of nuclear localization: a key to a door. Annu. Rev. Cell. Dev. Biol., 15, 291339.[ISI][Medline]
Kivirikko, K.I., and Pihlajaniemi, T. (1998) Collagen hydroxylases and the protein disulfide isomerase subunit of prolyl-4-hydroxylases. Adv. Enzymol. Relat. Areas Mol. Biol., 72, 325398.[ISI][Medline]
Koepp, D.M., Harper, J.W., and Elledge, S.J. (1999) How the cyclin became a cyclin: regulated proteolysis in the cell cycle. Cell, 97, 431434.[ISI][Medline]
Kozarov, E., van der Wel, H., Field, M., Gritzali, M., Brown R.D. Jr., and West, C.M. (1995) Characterization of FP21, a cytosolic glycoprotein from Dictyostelium. J. Biol. Chem., 270, 30223030.
Laney, J.D., and Hochstrasser, M. (1999) Substrate targeting in the ubiquitin system. Cell, 97, 427430.[ISI][Medline]
Matsumura, Y., Sakaida, I., Uchida, K., Kimura, T., Ishihara, T., and Okita, K. (1997) Prolyl 4-hydroxylase inhibitor (HOE 077) inhibits pig serum-induced rat liver fibrosis by preventing stellate cell activation. J. Hepatol., 27, 185192.[ISI][Medline]
McCaffrey, T.A., Pomerantz, K.B., Sanborn, T.A., Spokojny, A.M., Du, B., Park, M, -H., Folk, J.E., Lamberg, A., Kivirikko, K.I., Falcone, D.J., and others (1995) Specific inhibition of elF-5A and collagen hydroxylation by a single agent. J. Clin. Invest., 95, 446455.[ISI][Medline]
Nelson, M.K., Clark, A., Abe, T., Nomura, A., Yadava, N., Funair, C.J., Jermyn, K.A., Mohanty, S., Firtel, R.A., and Williams, J.G. (2000) An F-box/WD40 repeat-containing protein important for Dictyostelium cell-type proportioning, slug behavior, and culmination. Dev. Biol., 224, 4259.[ISI][Medline]
Nix, D.A., and Beckerle, M.C. (1997) Nuclear-cytoplasmic shuttling of the focal contact protein, zyxin: a potential mechanism for communication between sites of cell adhesion and the nucleus. J. Cell Biol., 138, 11391147.
Paine, P.L., Austerberry, C.F., Desjarlais, L.J., and Horowitz, S.B. (1983) Protein loss during nuclear isolation. J. Cell Biol., 97, 12401242.[Abstract]
Pang, K.M., Lynes, M.A,. and Knecht, D.A. (1999) Variables controlling the expression level of exogenous genes in Dictyostelium. Plasmid, 41, 187197.[ISI][Medline]
Sakaida, I., Uchida, K., Hironaka, K., and Okita, K. (1999) Prolyl 4-hydroxylase inhibitor (HOE 077) prevents TIMP-1 gene expression in rat liver fibrosis. J. Gastroenterol., 34, 376377.[ISI][Medline]
Sasaki, T., Majamaa, K., and Uitto, J. (1987) Reduction of collagen production in keloid fibroblast cultures by ethyl-3, 4-dihydroxybenzoate. J. Biol. Chem., 262, 93979403.
Schauer, T.M., Nesper, M., Kehl, M., Lottspeich, F., Muller-Taubenberger, A., Erisch, G., and Gerisch, G. (1993) Proteasomes from Dictyostelium discoideum: characterization of structure and function. J. Struct. Biol., 111, 135147.[ISI][Medline]
Schulman, B.A., Carrano, A.C., Jeffrey, P.D., Bowen, Z., Kinnucan, E.R.E., Finnin, M.S., Elledge, S.J., Harper, J.W., Pagano, M., and Pavelick, N.P. (2000) Insights into SCF ubiquitin ligases from the structure of the Skp1-Skp2 complex. Nature, 408, 381386.[ISI][Medline]
Teng-umnuay, P., Morris, H.R., Dell, A., Panico, M., Paxton, T., and West, C.M. (1998) The cytoplasmic F-box binding protein Skp1 contains a novel pentasaccharide linked to hydroxyproline in Dictyostelium. J. Biol. Chem., 273, 1824218249.
Teng-umnuay, P., van der Wel, H., and West, C.M. (1999) Identification of a UDP-GlcNAc:Skp1-hydroxyproline GlcNAc-Transferase in the cytoplasm of Dictyostelium. J. Biol. Chem., 274, 3639236402.
Uetz, P., Giot, L., Cagney, G., Mansfield, T.A., Judson, R.S., Knight, J.R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P., and others (2000) A comprehensive analysis of proteinprotein interactions in Saccharomyces cerevisiae. Nature, 403, 623627.[ISI][Medline]
West, C.M., Kozarov, E., and Teng-umnuay, P. (1997) The cytosolic glycoprotein FP21 of Dictyostelium discoideum is encoded by two genes resulting in a polymorphism at a single amino acid position. Gene, 200, 110.[ISI][Medline]
West, C.M., Scott-Ward, T., Teng-umnuay, P., van der Wel, H., Kozarov, E., and Huynh, A. (1996) Purification and characterization of an 1, 2-L-fucosyltransferase, which modifies the cytosolic protein Skp1, from the cytosol of Dictyostelium. J. Biol. Chem., 271, 1202412035.
Williams, A.R., Goh, T., Taylor, L., Chernushevich, I., Shevchenko, A., and Tyers, M. (1999) SCF ubiquitin protein ligases and phosphorylation-dependent proteolysis. Phil. Trans. R. Soc. Lond. B Biol. Sci., 354, 15331550.[ISI][Medline]
Zhang, Y., Zhang, P., and West, C.M. (1999) A linking function for the cellulose-binding protein SP85 in the spore coat of Dictyostelium discoideum. J. Cell Sci., 112, 46674677.