3 Rational Drug Design Program, Department of Bacteriology and Immunology, Haartman Institute and Biomedicum, P.O. Box 63, FIN-00014 University of Helsinki, Finland; 4 MediCel, Haartmaninkatu 8, FIN-00290 Helsinki, Finland; 5 Department of Developmental Biology, Tampere University Medical School and Department of Pathology, Tampere University Hospital, Fin-33101 Tampere, Finland; 6 HUCH Laboratory Diagnostics, Helsinki University Central Hospital, P.O. Box 401, FIN-00029 HUCH, Helsinki, Finland
Received on May 27, 2004; revised on July 12, 2004; accepted on July 14, 2004
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Transporter / Golgi / fucosylation / sialylation / sulfation
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Sulfo sLex decorations are added to the proteins as posttranslational modifications in the Golgi as a result of consecutive enzymatic reactions. Specific transferases use the high-energy nucleotide derivates, CMPsialic acid (CMP-SA), GDP-fucose (GDP-Fuc), and adenosine 3'-phosphate 5'-phosphosulphate (PAPS) as donors to yield the sulfo sLex epitope. The synthesis of sulfo sLex glycans starts with 2,3 sialylation of the galactose followed by 6' sulfation and the
1,3 fucosylation of the N-acetylglucosamine (Bistrup et al., 1999
; Ellies et al., 1998
; Hiraoka et al., 1999
; Homeister et al., 2001
; Maly et al., 1996
; Mitoma et al., 2003
; Yeh et al., 2001
).
The CMP-SA is synthesized in the nucleus via the CMP-SA synthase (CMAS, LocLink 5590) (Eckhardt et al., 1996; Krapp et al., 2003
). Two different cytosolic pathways lead to the formation of GDP-L-fucose. The GDP-Fuc de novo pathway involves conversion of GDP-
-D-mannose to GDP-ß-L-fucose by two enzymes, the GDP-D-mannose-4,6-dehydratase (GMDS, LocLink 2762) and GDP-4-keto-6-deoxy-D-mannose-3,5-epimerase-4-reductase (TSTA3 or FX, LocLink 7264). In the alternative, that is, salvage biosynthetic pathway, L-fucokinase (FUK, Loclink 197258) synthesizes L-fucose-1-phosphate from L-fucose and ATP. GDP-L-fucose pyrophosphorylase (FUK, LocLink 8790) catalyzes the formation of GDP-L-fucose from L-fucose-1-P and GTP (Becker and Lowe, 2003
; Niittymaki et al., 2004
). PAPS serves as the universal sulfonate donor compound for all sulfotransferase reactions. PAPS is synthesized in two sequential steps and in humans the bifunctional PAPS synthase (isoforms PAPSS1 and PAPSS2, LocLinks 9060 and 9061, respectively) catalyzes the biosynthesis. Inorganic sulfate first combines with ATP to form adenosine 5'-phosphosulfate (APS) and pyrophosphate catalyzed by ATP sulfurylase domain. In the second step, APS combines with another molecule of ATP to form PAPS and ADP catalyzed by APS kinase domain (Xu et al., 2000
, 2003
).
After synthesis, all these donors are transported to the Golgi via specific transporters to serve as donors in the transferase reactions leading to the decoration of glycoproteins (see Figure 1). The genes coding for the CMP-SA transporter (SLC35A1, LocLink 10559) (Aoki et al., 2001; Eckhardt et al., 1996
, 1998
, 1999
; Ishida et al., 1998
; Oelmann et al., 2001
), the GDP-Fuc transporter (FUCT1, LocLink 55343) (Hidalgo et al., 2003
; Lubke et al., 2001
; Luhn et al., 2001
; Puglielli and Hirschberg, 1999
; Roos et al., 2002
) and for the PAPS transporter (SLC35B2, LocLink 347734) (Kamiyama et al., 2003
) have been recently characterized. They all are members of the multispan membrane proteins.
|
Immunohistochemical analyses have suggested that a rapid de novo induction of endothelial sulfo sLex epitopes is the key event guiding leukocyte infiltration into tissues at the initiation of an inflammatory process (Toppila et al., 1999; Turunen et al., 1995
). Thus much interest has been focused on understanding how this process is regulated. Both the enzymatic activity as well as the protein levels of relevant glycosyltransferases, such as the FucTVII enzyme (FUT7, LocLink 2529), crucial for the synthesis of the
1,3 fucosylation into sialylated acceptors, are induced within the Golgi during the inflammatory processes (Majuri et al., 1994
; Toppila et al., 1999
). In addition, the expression levels of various glycosyltransferase transcripts, such as sialyl- and fucosyltransferases, have been shown to be up-regulated in various settings related to inflammatory episodes or lymphocyte development (Gillespie et al., 1993
; Kannagi, 2002
; Smithson et al., 2001
).
Here we analyze the expression of CMP-SA-, GDP-Fuc-, and PAPS transporters by in situ hybridization and real-time polymerase chain reaction (PCR) during rat organ allograft rejection as a model for sulfo sLexdependent inflammatory events. Moreover, the expression profiles of CMP-SA and GDP-fucose transporters were analyzed in silico using data from 230 Affymetrix U133A human transcriptome gene chips.
![]() |
Results and discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Kidney and heart allograft rejection after transplantation between major histocompatibility complexincompatible inbred rat strains was chosen as a model of acute inflammation. Here de novo expressed sulfo sLex epitopes on the graft endothelium have been shown to play a crucial role in the recruitment of leukocytes into the site on inflammation (Kirveskari et al., 2000; Toppila et al., 1999
; Turunen et al., 1995
), and thus we analyzed whether the transcription of these three transporters, crucial for the synthesis of sulfo sLex glycans, would be coregulated.
In situ labeling of the sugar nucleotide transporters
In control kidneys, the level of GDP-Fuc transporter mRNA was below the detection limit with the in situ hybridization. Three days after transplantation, a clear up-regulation of transcription was seen in the kidney cortex and outer medulla, the site of leukocyte infiltration during the early phases of acute rejection. The inner medullary area was not infiltrated by leukocytes during allograft rejection and remained negative throughout the experiment. The signal was strong at the corticomedullary junction and in the transitional epithelium of renal pelvis. During the fourth postoperative day, the signal for GDP-Fuc transcripts was very strong and evenly distributed in the cortex, outer medulla, and transitional epithelium, after which it decreased and displayed a patchy expression pattern (Figure 2A).
|
To show that the inductions observed were not solely linked to kidney inflammation, we also performed rat heart allograft transplantations. Our previous studies have shown that the induction of inflammatory leukocyte extravasation in rat heart allografts is due to the induction of endothelial sulfo sLex glycans (Toppila et al., 1999). Although no signal for GDP-Fuc transporter was evident in control hearts, a specific signal was recorded under the epicardium 3 days after transplantation that coincides with the appearance of the first signs of acute allograft rejection, that is, inflammation. After 4 days, a very strong signal was evident, especially in the walls of the right ventricle and under the pericardium at sites where the leukocyte infiltration caused acute rejection. Low diffuse labeling was detected at 5 days after transplantation (Figure 2E). The GDP-Fuc was present in the lymphocytes and capillary endothelium, whereas cardiac muscle cells were nonlabeled (Figure 2F, H). The arteries did not exhibit any signal (Figure 2G).
No signal for the PAPS transporter was seen in control kidneys, but after 3 days a clear signal was present in cortex and outer medulla, that is, in the same area where the rejection occurred as well as the GDP-Fuc signal was induced (Figure 3A). The strongest signal was seen in the corticomedullary junction and in the transitional epithelium of renal pelvis. At 4 days both the cortex and inner medulla showed a strong signal for PAPS transporter, which then declined at day 5 (Figure 3A). In high-power micrographs, the glomeruli were not labeled (not shown), whereas peritubular capillaries in the cortex and medulla and the transitional epithelium displayed a clear signal (Figure 3B, C, D). The renal tubules and the inner medulla showed no labeling for the PAPS transporter.
|
Our results with oligoprobes against the rat CMP-SA transporter sequence gave no signals in the normal nor the transplanted heart or kidney allografts undergoing fulminant rejection at 35 days after surgery (data not shown).
Real-time PCR analysis of the transporters
To have a more quantitative evaluation (even without spatial information) of the expression levels of the transporter transcripts during kidney and heart allograft rejection, we performed quantitative real-time PCR. Both the GDP-Fuc and PAPS transporters were clearly induced in a time-dependent manner during the rejection episodes in both organs, and these data are very much in concordance with the data obtained with the in situ hybridizations (Figure 4). Usually the kidney allograft rejection affected larger areas of tissue and thus could at least partly explain the difference between the levels of expression of the transporter mRNAs in kidneys and hearts.
|
In silico analysis of the expression of CMP-SA and GDP-Fuc transporters
Our wet lab results suggested that the two genes, CMP-SA and GDP-Fuc transporters, are coregulated on an inflammatory stimuli caused by the allograft rejection-induced inflammation. Next we wanted to know whether these two genes would be coregulated over a large number of experiments from diverse cell types and a broad range of physiological and experimental conditions.
The current rapidly increasing, publically available transcriptome data from gene chip analysis allows one to rapidly perform experiments in silico, which used to a require extensive wet lab experimentation. After extracting data from 230 Affymetrix human U133A gene chip experiments containing the probes for both CMP-SA and GDP-Fuc transporters (Affymetrix codes 203306_s_at and 218485_s_at, respectively), we were able to show that they are not substantially coregulated, because their correlation coefficient for these two transporters was only 0.53 (Figure 5). Thus there seems to be many other conditions in which the cell prefers to synthesize either sialylated or fucosylated but perhaps not dually decorated glycans. Unfortunately the PAPS transporter and the endothelial-specific sulfotransferases were not present in the first edition of the Affymetrix U133A/B, and thus their expression levels could not be analyzed in this in silico assay.
|
|
|
|
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
In situ hybridization
After decapitation of the animals, the kidneys and hearts were excised and frozen on dry ice. Serial 14-µm-thick sections were cut with a Microm HM-500 cryostat (Microm, Heidelberg, Germany), the sections were thawed on polysine glasses (Menzel-Gläser, Germany) and stored at 20°C until used. For each gene three oligonucleotide probes were designed and used as a mixture in in situ hybridization experiments.
Oligonucleotide probes for PAPS transporter (interim name: solute carrier family 35, member B2; gene symbol: Slc35b2; LocusLink ID: 316241) were designed based on GeneBank/EMBL/DDBJ entry AC096454 as follows: 5'-CGCCAGCACCTGGGTAGGGAAGCTGACGAACTTA-3' (covering nucleotides 137370 to 137403), 5'-CATGATGATGGGAAAGCTGGTGTCTCGGCGCAGC-3' (covering nucleotides 137346 to 137313), and 5'-TGTCACTGTGGTGGGG-GGACTGGGAGTAGCTGTG-3' (covering nucleotides 136848 to 136815).
Oligonucleotide probes for rat protein similar to GDP-Fuc transporter 1 (gene model name: LOC311204; LocusLink ID: 311204) were designed based on GeneBank/EMBL/DDBJ entry BF557232 as follows: 5'-AAGATGGGGGTATCCAGCTGCAGGGAGGGGCTGT-3' (covering nucleotides 9 to 42), 5'-ACCATGCCA GGGCAGCAGGTGGCCAGAGTGCTGA-3' (covering nucleotides 90 to 123), and 5'-CATGCCGATAAAGACCACGGACAGCGGCAGCACA-3' (covering nucleotides 166 to 199).
Oligonucleotide probes for rat protein similar to CMP-SA transporter (gene model name: LOC313139; LocusLink ID: 313139) were designed based on GeneBank/EMBL/DDBJ entry AI072449 as follows: 5'-GGGCTGGTTTCCACTGTACAAGTGTGACCCCACC-3' (covering nucleotides 343 to 376), 5'-GGTCACCTGGTACACTGCCGCATCCAGGTTACTG-3' (covering nucleotides 473 to 506), and 5'-CCACCACTGACGTGTAGAGGCCTCCCACACTAGC-3' (covering nucleotides 43 to 76).
The oligonucleotide probes were labeled with [-33P]dATP (NEN, Boston, MA) using terminal deoxynucleotidyltransferase (Amersham, Bucks, UK) to a specific activity of 6 x 109 cpm µg1. The in situ hybridization was carried out as described (Schultz et al., 2003
)
The sections were briefly air-dried and hybridized at 42°C for 18 h with 5 ng/ml of the probes in the hybridization cocktail. After hybridization, the sections were rinsed four times at 55°C in 1x saline sodium citrate buffer (SSC) for 15 min each and subsequently left to cool down for 1 h at room temperature. The sections were dipped in distilled water, dehydrated with 60% and 90% ethanol, and air-dried. Thereafter the sections were covered with Kodak MR autoradiography film (Kodak, Rochester, NY) or dipped in Kodak NTB2 emulsion. The autoradiography films were developed using Kodak LX24 developer and AL4 fixative. The dipped sections were developed with D19 (Kodak) developer, fixed with G333 (Agfa Gevaert, Cologne, Germany) fixative, counterstained with cresyl violet, and coverslipped.
Reverse transcription and quantitative real-time PCR
Frozen kidney and heart allograft specimens were homogenized, and total RNA was isolated using Qiagen RNeasy Midi kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. The samples were analyzed for RNA quality and quantity using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). cDNA synthesis from total RNA was performed using the Invitrogen SuperScript cDNA synthesis kit (Invitrogen, Carlsbad, CA). Prior to cDNA synthesis, RNA was treated with amplification-grade DNase I (1 U/1 µg RNA, Invitrogen). DNase-treated RNA (1 µg) was reverse transcribed with random hexamers according to the manufacturer's instructions. Parallel reactions were run in the absence of SuperScript II (-RT controls) to assess the degree of contaminating genomic DNA.
The resulting cDNA samples were subjected to real-time quantitative PCR assay (Heid et al., 1996) to detect the expression levels of CMP-SA, GDP-Fuc, and PAPS transporter mRNAs. Primers and probes were designed using the Primer Express (version 1, PE Applied Biosystems, Foster City, CA), a software provided with the ABI 7000 Sequence Detection System (PE Applied Biosystems). Forward and reverse primers were positioned as close as possible to each other without overlapping with the probe. Probes were synthesized with the fluorescent reporter FAM (6-carboxy-fluorescein) in the 5' end and the quencher TAMRA (6-carboxy-tetramethyl-rhodamine) in the 3' end. The primers and probes used were as follows: GDP-Fuc transporter forward: 5'ATCTTCGTCACCTTCTACCAATGC3', reverse 5'GCAGCAGGTGGCCAGAGT3', probe 5'CTCACTGCTGTGCAA GGGCCTCAG3', CMP-SA transporter forward 5'GGATTTTTCTATGGCTACACGTATTATG3', reverse 5'TTCACCACCACTGACGTGTAGAG3', probe 5'CCTCCCACACTAGCAAGGAAGATAACAAACCAG3'; and PAPS transporter forward 5'TCTTGGCAGG TCCTGAAGCT3', reverse 5'TGCAGTACACCCCAAGTCAGAT3', probe 5'CTTCTGTGCCGCGGGACTCCAG3'.
cDNA was amplified in a total volume of 25 µl containing 1x Universal Master Mix (PE Applied Biosystems) on an ABI Prism 7000 Sequence Detection System (PE Applied Biosystems) using 1 µl cDNA as a template. Assays for each transcript were carried out as duplicates, and PCR amplification was repeated twice. Any inefficiencies in RNA input or reverse transcription were corrected by normalization to a housekeeping gene (18S rRNA Control Reagents; PE Applied Biosystems). Primer concentrations for target amplicons were optimized to yield maximal amplification with minimal primer concentration. Primer concentrations used were 300 nM/300 nM (F/R) for GDP-Fuc and CMP-SA transporters and 300 nM/900 nM (F/R) for the PAPS transporter, respectively. Concentration of the FAM-TAMRA-labeled probe was 200 nM. Relative amounts of GDP-Fuc, CMP-SA, and PAPS transporter mRNAs were calculated based on standard curves (Applied Biosystems User Bulletin 2) prepared by a serial dilution of control cDNA.
Microarray data set
We used our own 37 experiments with human conjunctival epithelial cells taken from healthy and allergic patients. These data are under analysis process and will be published in another article. The study was approved by the ethical committee of the Helsinki University Central Hospital.
One hundred forty-three experiments were downloaded from Gene Expression Omnibus (Edgar et al., 2002) (GEO; www.ncbi.nlm.nih.gov/geo). The following experiments were downloaded from Microarray Center of Childrens National Medical Center (Washington, DC) (http://microarray.cnmcresearch.org). Twenty-nine experiments came from PGA human CD4plus lymphocytes. Twenty-four experiments came from PGA + human + muscle + obese. Six experiments from: PGA human obstructive pulmonary.
Gene expression profiling data analysis
CEL files were analyzed using MicroArray Suite 5.0 software (Affymetrix). Average intensities for each array were scaled to a target intensity of 100. Signal intensities were normalized across all the experiments using quantile normalization method (Bolstad et al., 2003). Pearson's correlation coefficients were calculated as a similarity measure of any two different expression profiles. For each gene the variance, mean and median were calculated over the entire data set.
![]() |
Acknowledgements |
---|
![]() |
Footnotes |
---|
1 These authors contributed equally to this work.
![]() |
Abbreviations |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
Becker, D. and Lowe, J. (2003) Fucose: biosynthesis and biological function in mammals. Glycobiology, 13, 41R53R.
Bistrup, A., Bhakta, S., Lee, J.K., Belov, Y.Y., Gunn, M.D., Zuo, F.R., Huang, C.C., Kannagi, R., Rosen, S.D., and Hemmerich, S. (1999) Sulfotransferases of two specificities function in the reconstitution of high endothelial cell ligands for L-selectin. J. Cell Biol., 145, 899910.
Bolstad, B., Irizarry, R., Astrand, M., and Speed, T. (2003) A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics, 19, 185193.
Eckhardt, M., Muhlenhoff, M., Bethe, A., and Gerardy-Schahn, R. (1996) Expression cloning of the Golgi CMP-sialic acid transporter. Proc. Nati Acad. Sci. USA, 93, 75727576.
Eckhardt, M., Gotza, B., and Gerardy-Schahn, R. (1998) Mutants of the CMP-sialic acid transporter causing the Lec2 phenotype. J. Biol. Chem., 273, 2018920195.
Eckhardt, M., Gotza, B., and Gerardy-Schahn, R. (1999) Membrane topology of the mammalian CMP-sialic acid transporter. J. Biol. Chem., 274, 87798787.
Edgar, R., Domrachev, M., and Lash, A. (2002) Gene expression omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res., 30, 207210.
Ellies, L.G., Tsuboi, S., Petryniak, B., Lowe, J.B., Fukuda, M., and Marth, J.D. (1998) Core2 oligosaccharide biosynthesis distinguishes between selectin ligands essential for leukocyte homing and inflammation. Immunity, 9, 881890.[ISI][Medline]
Fukuda, M. (2002) Roles of mucin-type O-glycans in cell adhesion. Biochim. Biophys. Acta, 3, 394405.
Gillespie, W., Paulson, J.C., Kelm, S., Pang, M., and Baum, L.G. (1993) Regulation of alpha 2,3-sialyltransferase expression correlates with conversion of peanut agglutinin (PNA)+ to PNA phenotype in developing thymocytes. J. Biol. Chem., 268, 38013804.
Heid, C., Stevens, J., Livak, K., and Williams, P. (1996) Real time quantitative PCR. Genome Res., 6, 986994.[Abstract]
Hemmerich, S. and Rosen, S.D. (2000) Carbohydrate sulfotransferases in lymphocyte homing. Glycobiology, 10, 849856.
Hidalgo, A., Ma, S., Peired, A.J., Weiss, L.A., Cunningham-Rundles, C., and Frenette, P.S. (2003) Insights into leukocyte adhesion deficiency type 2 from a novel mutation in the GDP-fucose transporter gene. Blood, 101, 17051712.
Hiraoka, N., Petryniak, B., Nakayama, J., Tsuboi, S., Suzuki, M., Yeh, J.C., Izawa, D., Tanaka, T., Miyasaka, M., Lowe, J.B., and Fukuda, M. (1999) A novel, high endothelial venule-specific sulfotransferase expresses 6-sulfo sialyl Lewis(x), an L-selectin ligand displayed by CD34. Immunity, 11, 7989.[ISI][Medline]
Homeister, J.W., Thall, A., Petryniak, B., Maly, P., Rogers, C.E., Smith, P.L., Kelle, R.J., Gersten, K.M., Askari, S.W., Cheng, G., and others (2001) The (1,3)fucosyltransferase FucT-IV and FucT-VII exert collaborative control over selectin-dependent leukocyte recruitment and lymphocyte homing. Immunity, 15, 115126.[CrossRef][ISI][Medline]
Ishida, N., Ito, M., Yoshioka, S., Sun-Wada, G.H., and Kawakita, M. (1998) Functional expression of human golgi CMP-sialic acid transporter in the Golgi complex of a transporter-deficient Chinese hamster ovary cell mutant. J. Biochem., 124, 171178.[Abstract]
Kamiyama, S., Suda, T., Ueda, R., Suzuki, M., Okubo, R., Kikuchi, N., Chiba, Y., Goto, S., Toyoda, H., Saigo, K., and others. (2003) Molecular cloning and identification of 3'-phosphoadenosine 5'-phosphosulfate transporter. J. Biol. Chem., 278, 2595825963.
Kannagi, R. (2002) Regulatory roles of carbohydrate ligands for selectins Sin the homing of lymphocytes. Curr. Opin. Struct. Biol., 12, 599608.[CrossRef][ISI][Medline]
Kirveskari, J., Paavonen, T., Hayry, P., and Renkonen, R. (2000) De novo induction of endothelial L-selectin ligands during kidney allograft rejection. J. Am. Soc. Nephrol., 11, 23582365.
Krapp, S., Munster-Kuhnel, A., Kaiser, J., Huber, R., Tiralongo, J., Gerardy-Schahn, R., and Jacob, U. (2003) The crystal structure of murine CMP-5-N-acetylneuraminic acid synthetase. J. Mol. Biol., 334, 625637.[CrossRef][ISI][Medline]
Lowe, J. (2003) Glycan-dependent leukocyte adhesion and recruitment in inflammation. Curr. Opin. Cell Biol., 15, 531538.[CrossRef][ISI][Medline]
Lowe, J.B. and Marth, J.D. (2003) A genetic approach to mammalial glycan functions. Annu. Rev. Biochem., 72, 643691.[CrossRef][ISI]
Lubke, T., Marquardt, T., Etzioni, A., Hartmann, E., von Figura, K., and Korner, C. (2001) Complementation cloning identifies CDG-IIc, a new type of congenital disorders of glycosylation, as a GDP-fucose transporter deficiency. Nat. Genet., 28, 7376.[CrossRef][ISI][Medline]
Luders, F., Segawa, H., Stein, D., Selva, E., Perrimon, N., Turco, S., and Hacker, U. (2003) Slalom encodes an adenosine 3'-phosphate 5'-phosphosulfate transporter essential for development in Drosophila. EMBO J., 22, 36353644.
Luhn, K., Wild, M.K., Eckhardt, M., Gerardy-Schahn, R., and Vestweber, D. (2001) The gene defective in leukocyte adhesion deficiency II encodes a putative GDP-fucose transporter. Nat. Genet., 28, 6972.[CrossRef][ISI][Medline]
Majuri, M., Pinola, M., Niemela, R., Tiisala, S., Natunen, J., Renkonen, O., and Renkonen, R. (1994) Alpha 2,3-sialyl and alpha 1,3-fucosyltransferase-dependent synthesis of sialyl Lewis x, an essential oligosaccharide present on L-selectin counterreceptors, in cultured endothelial cells. Eur. J. Immunol., 24, 32053210.[ISI][Medline]
Maly, P., Thall, A.D., Petryniak, B., Rogers, C.E., Smith, P.L., Marks, R.M., Kelly, R.J., Gersten, K.M., Cheng, G., Saunders, T.L., and others. (1996) The (1,3)fucosyltransferase Fuc-TVII controls leukocyte trafficing through an essential role in L-, E-, and P-selectin ligand biosynthesis. Cell, 86, 643653.[ISI][Medline]
Mandon, E.C., Milla, M.E., Kempner, E., and Hirschberg, C.B. (1994) Purification of the Golgi adenosine 3'-phosphate 5'-phosphosulfate transporter, a homodimer within the membrane. Proc. Natl Acad. Sci. USA, 91, 1070710711.
Mitoma, J., Petryniak, B., Hiraoka, N., Yeh, J.C., Lowe, J.B., and Fukuda, M. (2003) Extended core 1 and core 2 branched O-glycans differentially modulate sialyl Lewis x-type L-selectin ligand activity. J. Biol. Chem., 278, 99539961.
Niittymaki, J., Mattila, P., Roos, C., Huopaniemi, L., Sjoblom, S., and Renkonen, R. (2004) Cloning and expression of murine enzymes involved in the salvage pathway of GDP-L-fucoseL-fucokinase and GDP-L-fucose pyrophosphorylase. Eur. J. Biochem., 271, 7886.
Oelmann, S., Stanley, P., and Gerardy-Schahn, R. (2001) Point mutations identified in Lec8 Chinese hamster ovary glycosylation mutants that inactivate both the UDP-galactose and CMP-sialic acid transporters. J. Biol. Chem., 276, 2629126300.
Paavonen, T. and Renkonen, R. (1992) Selective expression of sialyl-Lewis x and sialyl Lewis a, putative ligands for L-selectin, on peripheral lymph node high endothelial venules. Am. J. Pathol., 141, 12591264.[Abstract]
Puglielli, L. and Hirschberg, C.B. (1999) Reconstitution, identification, and purification of the rat liver golgi membrane GDP-fucose transporter. J. Biol. Chem., 274, 3559635600.
Renkonen, J., Tynninen, O., Hayry, P., Paavonen, T., and Renkonen, R. (2002) Glycosylation might provide endothelial zip codes for organ-specific leukocyte traffic into inflammatory sites. Am. J. Pathol., 161, 543550.
Renkonen, R., Fukuda, M.N., Petrov, L., Paavonen, T., Renkonen, J., Hayry, P., and Fukuda, M. (2002) A peptide mimic of selectin ligands abolishes in vivo inflammation but has no effect on the rat heart allograft survival. Transplantation, 74, 26.[CrossRef][ISI][Medline]
Renkonen, R., Turunen, J., Rapola, J., and Häyry, P. (1990) Characterization of high endothelial-like properties of peritubular capillary endothelium during acute allograft rejection. Am. J. Pathol., 137, 643651.[Abstract]
Roos, C., Kolmer, M., Mattila, P., and Renkonen, R. (2002) Composition of Drosophila melanogaster proteome involved in fucosylated glycan metabolism. J. Biol. Chem., 277, 31683175.
Rosen, S.D. (1999) Endothelial ligands for L-selectin. From lymphocyte recirculation to allograft rejection. Am. J. Pathol., 155, 10131020.
Satomaa, T., Renkonen, O., Helin, J., Kirveskari, J., Makitie, A., and Renkonen, R. (2002) O-glycans on human high endothelial CD34 putatively participating in L-selectin recognition. Blood, 99, 26092611.
Schultz, R., Suominen, J., Varre, T., Hakovirta, H., Parvinen, M., Toppari, J., and Pelto-Huikko, M. (2003) Expression of aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator messenger ribonucleic acids and proteins in rat and human testis. Endocrinology, 144, 767776.
Schwarzkopf, M., Knobeloch, K., Rohde, E., Hinderlich, S., Wiechens, N., Lucka, L., Horak, I., Reutter, W., and Horstkorte, R. (2002) Sialylation is essential for early development in mice. Proc. Natl Acad. Sci. USA, 99, 52675270.
Smith, P.L., Myers, J.T., Rogers, C.E., Zhou, L., Petryniak, B., Becker, D.J., Homeister, J.H., and Lowe, J.B. (2002) Conditional control of selectin ligand expression and global fucosylation events in mice with targeted mutation at the FX locus. J. Cell Biol., 158, 801815.
Smithson, G., Rogers, C.E., Smith, P.L., Scheidegger, E.P., Petryniak, B., Myers, J.T., Kim, D.S., Homeister, J.W., and Lowe, J.B. (2001) Fuc-TVII is required for T helper 1 and T cytotoxic 1 lymphocyte selectin ligand expression and recruitment in inflammation, and together with Fuc-TIV regulates naive T cell trafficking to lymph nodes. J. Exp. Med., 194, 601614.
Toppila, S., Paavonen, P., Nieminen, M., Hayry, P., and Renkonen, R. (1999) Endothelial L-selectin ligands are likely to recruit lymphocytes into rejecting human heart transplants. Am. J. Pathol., 155, 13031310.
Toppila, S., Paavonen, T., Laitinen, A., Laitinen, L., and Renkonen, R. (2000) Endothelial L-selectin ligands in bronchial asthma but not in other chronic inflammatory lung diseases. Am. J. Resp. Cell. Mol. Biol., 23, 492498.
Turunen, J.P., Paavonen, T., Majuri, M.-L., Tiisala, S., Mattila, P., Mennander, A., Gahmberg, C.G., Häyry, P., Tamatani, T., Miyasaka, M., and Renkonen, R. (1994) Sialyl Lewis x- and L-selectin-dependent site-specific lymphocyte extravasation into renal transplants during acute rejection. Eur. J. Immunol., 24, 11301136.[ISI][Medline]
Turunen, J., Majuri, M., Seppo, A., Tiisala, S., Paavonen, T., Miyasaka, M., Lemström, K., Penttilä, L., Renkonen, O., and Renkonen, R. (1995) De novo expression of endothelial sialyl Lewis a and sialyl Lewis x during cardiac transplant rejection. Superior capacity of a tetravalent sLex-oligosaccharide in inhibiting L-selectin-dependent lymphocyte adhesion. J. Exp. Med., 182, 11331142.[Abstract]
van Zante, A. and Rosen, S.D. (2003) Sulphated endothelial ligands for L-selectin in lymphocyte homing and inflammation. Biochem. Soc. Trans., 31, 313317.[ISI][Medline]
Vestweber, D. (2002) Regulation of endothelial cell contacts during leukocyte extravasation. Curr. Opin. Cell Biol., 14, 587593.[CrossRef][ISI][Medline]
Vestweber, D. (2003) Lymphocyte trafficking through blood and lymphatic vessels: more than just selectins, chemokines and integrins. Eur. J. Immunol., 33, 13611364.[CrossRef][ISI][Medline]
von Andrian, U. (2003) Homing and cellular traffic in lymph nodes. Nat. Rev. Immunol., 3, 867978.[CrossRef][ISI][Medline]
Xu, Z.H., Otterness, D.M., Freimuth, R.R., Carlini, E.J., Wood, T.C., Mitchell, S., Moon, E., Kim, U.J., Xu, J.P., Siciliano, M.J., and Weinshilboum, R.M. (2000) Human 3'-phosphoadenosine 5'-phosphosulfate synthetase 1 (PAPSS1) and PAPSS2: gene cloning, characterization and chromosomal localization. Biochem. Biophys. Res. Commun., 268, 437444.[CrossRef][ISI][Medline]
Xu, Z.H., Thomae, B.A., Eckloff, B.W., Wieben, E.D., and Weinshilboum, R.M. (2003) Pharmacogenetics of human 3'-phosphoadenosine 5'-phosphosulfate synthetase 1 (PAPSS1): gene resequencing, sequence variation, and functional genomics. Biochem. Pharmacol., 65, 17871796.[CrossRef][ISI][Medline]
Yeh, J.-C., Hiraoka, N., Petryniak, B.J.N., Ellies, L.G., Rabuka, D., Hindgaul, O., Marth, J.D., Lowe, J.B., and Fukuda, M. (2001) Novel sulfated lymphocyte homing receptors and their control by a core 1 extension ß1,3-N-acetylglucosaminyltransferase. Cell, 105, 957969.[CrossRef][ISI][Medline]
|