1Division of Cardiology, University of Padua Medical School, Padova, Italy
2Institute of Pathology, University of Padua Medical School, Padova, Italy
3Department of Biology, University of Padua, Padova, Italy
4Department of Biochemistry and Pharmacy, Abo Akademi University, Turku, Finland
Received 3 November 2004; revised 22 April 2005; accepted 28 April 2005; online publish-ahead-of-print 7 June 2005.
* Corresponding author. Tel: +39 049 8272283; fax: +39 049 8272284. E-mail address: cardpath{at}unipd.it
See page 1582 for the editorial comment on this article (doi:10.1093/eurheartj/ehi343)
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Methods and results Thirty-eight subjects belonging to four families showing different DSP mutations (three missense and one in the intronexon splicing region) underwent clinical and genetic investigation, including annual 12-lead ECG, signal averaged ECG, 24 h Holter ECG, and two-dimensional echocardiography. Twenty-six family members (11 males and 15 females) were found to carry a DSP mutation. After a follow-up of 124 years, median 6, 14 (54%) fulfilled (mean age at diagnosis 33±15 years) and 12 (mean age 43±24 years at the last follow-up) did not fulfil the established diagnostic criteria of ARVC, although five of them had some cardiac abnormalities. Clinical presentations were palpitations in six, sudden death (SD) in three, syncope in one, and chest pain with increased myocardial enzymes in two. Abnormal 12-lead ECG findings were present in 15 cases (58%), ventricular arrhythmias in 12 (46%), and late potentials in 11 (42%). Fourteen (54%) had abnormal echocardiographic findings, with left ventricular involvement in seven of them. SD occurred in six subjects and in three it was the first symptom of the disease; moreover, one subject died due to heart failure. The annual disease-related death and SD/aborted SD were 0.028 and 0.023 patient/year, respectively.
Conclusion Familial ARVC caused by DSP mutations is characterized by a high occurrence of SD even as first clinical manifestation. Left ventricular involvement is not a rare feature of the disease, which frequently escapes clinical diagnosis by applying the currently available criteria. Genetic screening is mandatory for early identification of asymptomatic carriers and preventive strategies within a family with a genotyped index case.
Key Words: Arrhythmia Cardiomyopathy Genetics Pathology Sudden death
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Since the identification of the first ARVC locus in 1994,6 five disease genes have been identified so far.712 A 2 bp deletion in the plakoglobin has been proved to cause a recessive form of ARVC associated with palmoplantar keratosis and woolly hair, i.e. Naxos disease.7 Mutations of ryanodine receptor type 2 gene and regulatory mutations in transforming growth factor ß3 gene have been found in ARVD2 and ARVD1, respectively.8,12 Moreover, mutations in the desmosomal proteins desmoplakin (DSP, ARVD8) and plakophilin-2 (ARVD9) have been discovered, in the absence of skin and hair abnormalities.9,11 DSP is the most represented protein of the desmosomes, which are cell-to-cell junctions particularly abundant in the keratinocytes and cardiomyocytes.13,14 Remarkably, mutations in the DSP gene have already been shown to underlie some autosomal dominant and recessive skin disorders, either with or without cardiac involvement.10,1519 The identification of DSP mutations and the availability of genetic screening in affected family members enable us to gain an insight into the clinical features of the familial ARVD8 variant of the disease.
![]() |
Methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
A control group of healthy and unrelated subjects (200 alleles) from the Italian population was used to exclude that the detected mutations were DNA polymorphisms. They were selected as first 100 subjects who responded to the advertisement of healthy control population recruitment and met all necessary criteria, i.e. absence of both personal and family history of heart disease.
The mutation screening was performed in all living family members of index cases in which a DSP mutation was detected.
In order to sequence the aberrant transcript of patient carrying the c.423-1G>A mutation, mRNA was isolated from 2.5 mL whole blood of the patient, using PAXgeneTM Blood RNA kit (Qiagen, Hilden, Germany) following the supplier protocol. The corresponding cDNA was obtained from an RTPCR reaction using 2 µg total RNA. The following primers were used to amplify the fragment corresponding to exons 3, 4, and 5. Primer forward: ATCAGAGAGATGCGGCAGAT; primer reverse: GCTGTTAATGTGCTGCTCCA.
Clinical study
The clinical study protocol included basal 12-lead ECG, signal averaged ECG (SAECG), 24 h Holter ECG, and two-dimensional echocardiography.20 These investigations were performed every 12 months. The clinical diagnosis of ARVC was put forward based on the criteria proposed by the ESC-ISFC.21
ECG, SAECG, and arrhythmias
Standard ECG was recorded at rest (25 mm/s, 10 mm/mV). The difference between the widest QRS complex in leads V1V2V3 minus that in V6 was estimated (QRS dispersion), and also the presence of inverted T wave in the precordial leads. Recorded ventricular arrhythmias were divided into the following: (1) ventricular fibrillation (VF); (2) sustained ventricular tachycardia (VT) (when lasting more than 30 s); (3) non-sustained VT; and (4) frequent premature ventricular complexes (PVCs) (>30/h). SAECG was performed using a MAC 15 system (Marquette Inc., Milwaukee, WI, USA); time domain analysis was obtained using three different filters at 25, 40, and 80 Hz.20
Echocardiography
M Mode, two-dimensional and Doppler echocardiography were done with Hewlett Packard Sonos 5500 system with S4 probe. Right and left ventricular end-diastolic and end-systolic volumes (RVEDV, RVESV, LVEDV, LVESV), right and left ventricular ejection fraction (RVEF, LVEF), and segmental or diffuse (two regions) kinetic abnormalities were evaluated. LVEDV and LVESV were calculated using an ellipsoid biplane arealength model derived from LV images in the apical four-chamber view.22 The ejection fraction was calculated using the following formula: end-diastolic volume minus end-systolic volume divided by end-diastolic volume. RVEDV and RVESV were calculated using an arealength method derived from orthogonal planes (apical four-chamber and subcostal long axis views).23 RVEDV was considered normal at 48±6 mL/m2.24 Structural progression was defined as a progressive alteration in ventricular dimensions and/or wall motion abnormalities during serial echocardiographic evaluation.25
Statistical analysis
Comparisons between patient groups were performed using a 2 test or Fisher exact test for the categorical variables. All continuous variables were expressed as the mean value±1 SD for each measurement. All tests were two-tailed and a P-value <0.05 was considered statistically significant. KaplanMeier curves were produced to reveal the event-free survival rate during all life or up to ARVC diagnosis in DSP mutations carriers, considering all events (sustained VT, SD/aborted SD, heart failure). As patients were coming from only four families, the underlying assumption that all observations are independent could be violated. Therefore, we used nested design t-test and Kaplan-Meier curves considering family membership of each patient as a weighed variable. Statistical calculations were performed using Statistica version 6.0 (Statsoft, Tulsa, OK, USA).
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
Mutation R1775I is located in the rod-domain of DSP, which is predicted to form the dimeric coil. Arginine is a hydrophilic aminoacid, whereas isoleucine is hydrophobic. This aminoacid change could destabilize the rod-domain preventing the formation of the coiled-coil. This view was confirmed by simulations obtained using PSIPRED.26
Mutation c.423-1G>A alters the acceptor splicing site of intron 3. Sequencing of the DSP transcript obtained from lymphocytes RNA of the proband showed the skipping of exon 4. This aberrant spliced mRNA contains a premature stop codon and should code for a truncated protein of 200 aminoacids in length.
In vitro studies are needed to evaluate the cellcell adhesion effects of these mutant DSPs.
Main clinical and genetic data of DSP mutation carriers are summarized in Table 1. Among the 26 subjects carrying a DSP mutation, 14 (54%) (six males and eight females, age at diagnosis 33±15 years, minimum 15 to maximum 59 years) fulfilled and 12 (five males and seven females, mean age 43±24 years at the last follow-up) did not fulfil the established diagnostic criteria for ARVC. The distribution of major and minor criteria is reported in Table 1. Owing to the small size of the remaining three families, the penetrance was calculated only in family 105 (in the former two generations) as 64%.
Clinical presentation
Palpitations occurred in six patients, cardiac arrest in three, and syncope in one as the first symptom of the disease. Moreover, chest pain associated with ST segment elevation on basal ECG (Figure 2) and myocardial enzyme release, in the setting of angiographically normal coronary arteries, occurred in two siblings. No skin and hair abnormalities were found at physical examination.
|
|
Ventricular arrhythmias
They were recorded in 12 subjects (46%) and ranged from VF (n=3) to monomorphic sustained VT with left bundle branch block morphology (n=4), non-sustained VT (n=2), and isolated monomorphic PVCs (n=3). In all subjects ventricular arrhythmias had left bundle branch block morphology, with variable QRS axis deviation. The total number of isolated PVCs ranged from 1000 to 3500/24 h. In two subjects (Patient 105, III, 10 and Patient 105, II, 4) sporadic isolated PVCs with right bundle branch block morphology were recorded.
Echocardiographic findings
Abnormal echocardiographic findings were present in 14 (54%) of DSP mutations carriers. An RV involvement was detected in 13 cases, showing a mean RVEDV of 81±30 mL/m2, a mean RVEF of 52±11%, and kinetic abnormalities involving one region in six and 2 regions in seven. An LV involvement was present in seven patients (mean age 35±19 years vs. 37±12 of those without LV involvement, P=0.830), which showed a mean LVEDV of 73±9 mL/m2, a mean LVEF of 53±8%, a mean RVEDV of 89±33 mL/m2 and a mean RVEF of 49±13%; LV kinetic abnormalities were diffuse in three and localized in four patients.
Considering only those subjects who fulfil the currently available diagnostic criteria (n=14), right ventricular abnormalities were detected in 86%, LV abnormalities in 43%, ventricular arrhythmias in 79%, SD/aborted SD in 36%, and heart failure in 14%.
DSP mutations carriers not fulfilling the ARVC diagnostic criteria
Twelve subjects did not fulfil the ESC-ISFC diagnostic criteria of ARVC. However, besides family history, five of them (42%) showed some cardiac signs, such as PVCs originating from the outflow tract of the RV (Patient 105, III, 7), LV kinetic alterations and positive late potentials (Patient 146, II, 2), regional RV abnormalities (Patient 151, III, 4) and positive late potentials (Patient 151, IV, 1), and qS in inferior leads (Patient 105, II, 1). This last patient died suddenly during follow-up. Noteworthy, no gender difference was found between DSP mutations carriers who fulfilled the ARVC diagnostic criteria (six out of 11 males, 55% vs. eight out of 15 females, 53%, P=0.677). Moreover, 33% of female DSP carriers did not present any cardiac sign vs. 18% of male (P=0.07).
Therapy
Eight patients underwent antiarrhythmic therapy, i.e. amiodarone (either alone or in association with beta-blocker), dysopiramide in association with beta-blocker, propafenone, and sotalol; two received an implantable cardioverter defibrillator (ICD).
Follow-up
During follow-up (range 124 years, median 6 years), six mutation carriers who had been considered normal at the first evaluation (mean age 23±10 years), developed symptoms of the disease (mean age at diagnosis 28±10). A structural progression on echocardiography was detected in 23%, and on ECG and/or SAECG in 31% of DSP carriers. During this period, three patients had SD, two had aborted SD, and one died due to heart failure. The annual disease-related and SD/aborted SD mortality were 0.028 and 0.023 patient/year, respectively. KaplanMeier curves for event-free survival rate in DSP mutations carriers are indicated in Figure 3. By the age of 45, the event-free survival was 58%.
|
Patient 105, IV, 4, who had been considered unaffected during familial screening at the age of 13, died suddenly 2 years later. The retrospective analysis of a 12-lead resting ECG, performed 8 months before death for sports eligibility, showed incomplete right bundle branch block with mild ST segment elevation in V1V2, negative T wave in V1, and Q wave in D2, D3, and AVF (Figure 4).
|
|
Finally, Patient 152, II, 1 had suffered VF on effort as first symptom at the age of 40 years and was successfully resuscitated. Following the event, an ICD was implanted.
Autopsy findings
The heart was available for a detailed postmortem examination in two patients. In Patient 105, IV, 4 the heart weight was 300 g, and no evidence of coronary artery and valve disease, myocardial hypertrophy, cavity enlargement, and aneurysm formation was found. An infarct-like band of acutesubacute myocyte necrosis associated with inflammation was evident in the outer midsubepicardial layer of the postero-septal and postero-lateral walls of the LV (Figure 4B and C). The inflammatory infiltrate was polymorphous and was associated with contraction band necrosis, myocytolysis, granulation tissue, and loose fibrous and fatty tissue repair. Foci of coagulative and contraction band necrosis were also present in the RV myocardium with spotty intramural fatty infiltration. In Patient 146, III, 1 the heart weight was increased (500 g) and no evidence of coronary artery and valve disease was found. RV dilatation together with inferior and infundibular aneurysms was present. At histology, an extensive myocardial atrophy with transmural fibro-fatty tissue replacement was visible at the level of antero-lateral, inferior, and infundibular walls of the RV, as well as in the mid-outer thirds of the anterior, lateral, antero-septal, and postero-septal walls of the LV (Figure 5). Myocytolysis and lymphocytic inflammatory infiltrates were also detected.
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The annual disease-related and SD mortality were 0.028 and 0.023 patient/year, respectively, which is similar to that reported in Naxos disease.25
ARVC and intercellular junction protein mutations
DSP is a protein of the desmosomes, which are intercellular junctions particularly abundant in the epidermidis and heart muscle, where they play an important role for cell rigidity and strength.2629 A deletion of another cell adhesion protein, i.e. plakoglobin, has been identified in Naxos disease, a recessive syndrome in which ARVC is associated with palmoplantar keratosis and woolly hair.7,25,30 More recently, mutations of plakophilin-2 have been found in 27% of unrelated ARVC probands.11 Mutations of DSP gene have already been shown to underlie autosomal diseases characterized by hair and skin disorders, either alone or in association with cardiac involvement.1519 Although in the Carvajal syndrome a cardiac phenotype of dilated cardiomyopathy has been reported,1618 a clinical picture of ARVC has been recently described in a Muslim-Arab family from Jerusalem.10
Different from these recessive cardio-cutaneous syndromes, ARVD8 has a dominant pattern of inheritance, in which heterozygous carriers of the mutation show typical cardiac abnormalities, in the absence of macroscopic skin and hair involvement. However, dominant DSP mutations associated only with skin abnormalities have also been described.15,19 The mutation Q331X reported by Armstrong et al.,15 as the one by Wittock et al.,19 resulted in haploinsufficiency and led to palmoplantar keratosis. The reason why mutation c.423-1G>A leads to ARVC, without macroscopic evidence of keratosis, is still unknown and functional studies are required.
In the original Carvajal paper, low voltage QRS complex were present in all but one patient, inverted T wave in the precordial and inferior leads in half, and ventricular arrhythmias in all,17 clinical features more in keeping with ARVC than with dilated cardiomyopathy. Moreover, the pathology of the heart in Carvajal syndrome disclosed RV aneurysms in the triangle of dysplasia as well as massive LV involvement, all features in keeping with biventricular ARVC, although in the absence of substantial fatty infiltration.31
Validation of ARVC diagnostic criteria
Although our study is not dealing with unrelated ARVC index patients carrying different DSP mutations, which might result in a broader spectrum of clinical features, our patient selection gives the opportunity to evaluate the entire clinical spectrum of the disease from concealed forms to the overt ones. Nearly half of DSP mutations carriers did not fulfil the established diagnostic criteria for ARVC.21 However, 42% of them had a few cardiac signs, not diagnostic for ARVC, and one of them died suddenly during the follow-up showing only q waves in inferior leads. Noteworthy, a q wave in inferior leads was present in more than one-fourth of DSP carriers and it could be related to the presence of fibrosis in the inferior LV wall, as evidenced by clinicalpathologic correlation in Patient 105, IV, 4. These findings allow us to speculate whether the established criteria are too restrictive in the setting of a familial disease where unspecific instrumental abnormalities could have otherwise a high probability of being the expression of a gene defect. By applying the broadened criteria proposed by Hamid et al.,32 four additional family members might have been considered affected. Our study confirms that genetic screening for DSP mutation is a valuable tool for early pre-symptomatic diagnosis of ARVC within a family with a genotyped index case, as many affected family members were diagnosed during family screening and remained fully asymptomatic. However, we must admit that, with the advent of genetic testing, a growing number of asymptomatic carriers with mild or subclinical disease expression will be identified with obvious management dilemmas. We suggest the following plan for asymptomatic gene carriers: six monthly follow-up, avoidance of strenuous physical activity, and advice of reporting any symptom to a cardiologist. Moreover, we must be aware that this strategy would probably not have prevented some of the adverse events documented in our population, given that SD may occur at rest, without prominent clinical findings, and in the absence of warning symptoms.
Histopathologic findings
The features are quite unique as autopsy was performed in two cases, with and without a clinical diagnosis of ARVC, respectively. In the former, the autopsy findings, consisting of transmural fibro-fatty replacement with aneurysms formation, were in keeping with a typical form of ARVC, whereas in the latter the arrhythmogenic substrates of the disease at early stage were documented, consisting of an extensive myocardial necrosis together with inflammation, loose fibrous, and fatty tissue repair. Noteworthy, in two additional patients the disease onset was characterized by an infarct-like picture with chest pain, ST segment ECG changes, and myocardial enzyme release. These data further support the hypothesis that these symptoms/signs could be a manifestation of a myocyte necrosis occurring as a part of the disease process. To this regard, we previously demonstrated in ARVC that myocardial destruction with replacement by fat may be episodic rather than gradual and continuous and these bursts are characterized by acute symptoms and signs.33
The absence of either wall thinning or aneurysms, which are considered the morphologic hallmarks of ARVC, is explained by the recent onset with early subepicardial location of the myocyte injury and repair process, in the absence of transmural extension towards the endocardium. These results broaden our concept of the histologic spectrum of ARVC. As DSP is present in all cardiomyocytes, there is no reason for a preferential RV involvement. Noteworthy, both heart specimens had extensive LV involvement. Owing to the thinner wall, the RV involvement may manifest clinically earlier than the LV one in terms of kinetic abnormalities and cavity enlargement, although the pathologic process is already going on in both ventricles. Another potential mechanism of preferential RV manifestation of ARVC might be related to the higher propensity to stretch-related rupture of vulnerable cellcell contact due to latent damage caused by heterozygous mutations in genes encoding desmosomal proteins.
![]() |
Conclusions |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
Acknowledgements |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Related articles in EHJ: