Suggestive Evidence for Association of Human Chromosome 18q12-q21 and Its Orthologue on Rat and Mouse Chromosome 18 With Several Autoimmune Diseases

Tony R. Merriman, Heather J. Cordell, Iain A. Eaves, Patrick A. Danoy, Francesca Coraddu, Rachael Barber, Francesco Cucca, Simon Broadley, Stephen Sawcer, Alastair Compston, Paul Wordsworth, Jane Shatford, Steve Laval, Johan Jirholt, Rikard Holmdahl, Argyrios N. Theofilopoulos, Dwight H. Kono, Jaakko Tuomilehto, Eva Tuomilehto-Wolf, Raffaella Buzzetti, Maria Giovanna Marrosu, Dag E. Undlien, Kjersti S. Rønningen, C. Ionesco-Tirgoviste, Julian P. Shield, Fleming Pociot, Jorn Nerup, Chaim O. Jacob, Constantin Polychronakos, Steve C. Bain, and John A. Todd

From the Wellcome Trust Centre for Molecular Mechanisms in Disease (T.R.M., H.J.C., I.A.E., R.Ba., J.A.T.), University of Cambridge, Cambridge, U.K.; the Department of Biochemistry (T.R.M.), University of Otago, Dunedin, New Zealand; the University of Cambridge Neurology Unit (F.Co., S.B., S.S., A.C.), Addenbrooke's Hospital, Cambridge, U.K.; the Clinica Pediatrica (F.Cu.) and Chair of Neurophysiopathology (M.G.M.), University of Cagliari, Cagliari, Italy; the Wellcome Trust Centre for Human Genetics (T.R.M., P.A.D., P.W., J.S., S.L.), University of Oxford, Oxford, U.K.; Department of Genetics and Pathology (J.J., R.H.), Biomedical Center, Uppsala University, Uppsala, Sweden; the Department of Immunology (A.N.T., D.H.K.), the Scripps Research Institute, La Jolla, California; the Department of Epidemiology and Health Promotion (J.T., E.T.-W.), National Public Health Institute, Helsinki, Finland; Istituto Clinica Medica II (R.Bu.), University of Rome `La Sapienza, Rome, Italy; the Institute of Transplantation Immunology (D.E.U.), the National Hospital, Oslo, Norway; the Department of Population Health Sciences (K.S.R.), National Institute of Public Health, Oslo, Norway; the Clinic of Nutrition and Metabolic Diseases (C.I.-T.), Bucharest, Romania; the Institute of Child Health (J.P.S.), University of Bristol, Royal Hospital for Sick Children, Bristol, U.K.; Steno Diabetes Center (F.P., J.N.), Gentofte, Denmark; the Department of Medicine (C.O.J.), University of Southern California School of Medicine, Los Angeles, California; Montreal Children's Hospital (C.P.), Montréal, Québec, Canada; and the Department of Medicine (S.C.B.), University of Birmingham, Birmingham Heartlands Hospital, Birmingham, U.K.

Address correspondence reprint requests to Tony R. Merriman, PhD, Department of Biochemistry, University of Otago, Box 56, Dunedin, New Zealand. E-mail: tony.merriman{at}stonebow.otago.ac.nz .


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Some immune system disorders, such as type 1 diabetes, multiple sclerosis (MS), and rheumatoid arthritis (RA), share common features: the presence of autoantibodies and self-reactive T-cells, and a genetic association with the major histocompatibility complex. We have previously published evidence, from 1,708 families, for linkage and association of a haplotype of three markers in the D18S487 region of chromosome 18q21 with type 1 diabetes. Here, the three markers were typed in an independent set of 627 families and, although there was evidence for linkage (maximum logarithm of odds score [MLS] = 1.2; P = 0.02), no association was detected. Further linkage analysis revealed suggestive evidence for linkage of chromosome 18q21 to type 1 diabetes in 882 multiplex families (MLS = 2.2; {lambda}s = 1.2; P = 0.001), and by meta-analysis the orthologous region (also on chromosome 18) is linked to diabetes in rodents (P = 9 x 10-4). By meta-analysis, both human chromosome 18q12-q21 and the rodent orthologous region show positive evidence for linkage to an autoimmune phenotype (P = 0.004 and 2 x 10-8, respectively, empirical P = 0.01 and 2 x 10-4, respectively). In the diabetes-linked region of chromosome 18q12-q21, a candidate gene, deleted in colorectal carcinoma (DCC), was tested for association with human autoimmunity in 3,380 families with type 1 diabetes, MS, and RA. A haplotype ("2-10") of two newly characterized microsatellite markers within DCC showed evidence for association with autoimmunity (P = 5 x 10-6). Collectively, these data suggest that a locus (or loci) exists on human chromosome 18q12-q21 that influences multiple autoimmune diseases and that this association might be conserved between species.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
As much as 5% of the population suffers from autoimmune disease, a failure of the homeostatic regulation of the immune system to prevent tissue damage and maintain self-tolerance. Predisposition to autoimmune disease is universally associated with alleles of the major histocompatibility complex (MHC) genes on chromosome 6p21 (1). However, the MHC is not sufficient to explain disease occurrence, and non-MHC susceptibility genes are predicted. In type 1 diabetes in humans, the evidence for non-MHC genes is incomplete (2,3), owing to the small, statistically underpowered data sets analyzed so far. In rodent models of disease, however, the existence and location of several non-MHC loci are established (1). It has also been shown in humans and mice that autoimmunity loci, mapped in a variety of autoimmune disease models, including those for type 1 diabetes and multiple sclerosis (MS), cluster significantly (1,4,5). Furthermore, congenic strains conclusively show that Idd3, a mouse non-MHC type 1 diabetes susceptibility locus, also influences susceptibility to experimental allergic encephalomyelitis (EAE), a model of MS (6), and iddm4 in rats may be a universal autoimmunity locus (7). In addition to the well-established linkage and association of the MHC region to multiple autoimmune phenotypes, the CTLA-4 gene locus on human chromosome 2 has been reported to be either linked or associated with type 1 diabetes, Graves' disease, and MS (8,9,10).

Previously, we reported some positive evidence of linkage (P = 0.005) and association (Pc = 0.01) of diabetes to chromosome 18q21 in the vicinity of D18S487 (provisionally designated IDDM6) (11,12,13). In the present study, we were unable to replicate the D18S487 association result, but we have consolidated evidence of linkage of the region to type 1 diabetes by analysis of 882 families and by metaanalyses of other linkage studies of a variety of autoimmune diseases in humans and rodents. Finally, a large family-based study suggests that the human deleted in colorectal carcinoma (DCC) gene region of chromosome 18q21 is associated with autoimmune disease.


    RESEARCH DESIGN AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Families with type 1 diabetes, MS, and rheumatoid arthritis. The families used for the association analysis were white European or European-derived with both parents and at least one affected sibling per family. The 2,359 type 1 diabetic families are summarized in Table 1. In the Sardinian, Finnish, Canadian, and Italian data sets, ages of diagnoses were <17 years, <15 years, <18 years, and <29 years, respectively. Table 1 summarizes the composition of the 1,708-family diabetes data set (13), the independent 627 families studied here, and the combined 2,335 and 2,359 families.


View this table:
[in this window]
[in a new window]
 
TABLE 1
 

The 229 Sardinian MS families have been previously described (18). The 667 U.K. simplex MS families had a clinical diagnosis of disease based on the Poser criteria (19). The 125-family U.K. rheumatoid arthritis (RA) data set consisted of simplex and multiplex families, and all cases satisfied the 1987 American College of Rheumatology criteria for disease and were recruited from the Arthritis Research Campaign Epidemiology Unit in Manchester University and the Rheumatology Department at the Nuffield Orthopaedic Centre in Oxford. Healthy siblings were collected in all data sets except the U.K. MS families. In all cases, sample collection was approved by the appropriate institutional review board. The total 3,380-family autoimmune data set comprised the 2,359 type 1 diabetes families, 896 MS families, and 125 RA families.

The 882 affected sib-pair pedigrees available to us that were tested for linkage to disease consisted of 415 of the 423 U.K. families used in the association study, 284 U.S. families including the 241 used in the association study, 58 Italian families of which 57 were used in the association study, 54 of the 55 Danish multiplex families, 32 Finnish affected sib-pair families including the 24 used in the association study, and 39 Norwegian multiplex families from the previously described 420 families.

Microsatellite marker isolation and genotyping. With use of polymerase chain reaction (PCR) primers for DCC exons 19 and 29 (exon 29 is the 3' exon of DCC) (20), HPAC 88_h_2 and HBAC 55_g_22, respectively, were isolated from the De Jong libraries (ResGen). HBAC 55_g_22 is telomeric to HPAC 88_h_2. Microsatellite marker 88,21 was cloned from HPAC 88_h_2 and marker 55,26 from HBAC 55_g_22 using a previously described PCR-based method (13). Primer sequences for amplifying 88,21 are CTGA CAAAACTGGGACTACCTTCC and GAATACATCTCCGTATTTGCATC and for 55,26 are GGCTAGTGGTTGCCGTATTATAC and AAATCTCAGCATGTCAGT GAA. Primer sequences for amplifying other microsatellite markers either have been published elsewhere (12,13) or are available from http://www.gdb.org . Genotyping PCRs using fluorescently labeled primers were performed and analyzed as described previously (21). Haplotypes are given with the marker genotypes in centromeric to telomeric order.

Comparative mapping. Human, mouse, and rat chromosome 18 orthology relationships were established using www3.ncbi.nlm.nih.gov/Homology , www.informatics.jax.org/searches/oxfordgrid_form.shtml , www.nih.gov/niams/scientific/ratgbase , www.otsuka.genome.ad.jp/ratmap , and www.well.ox.ac.uk/~bihoreau . Distances along human chromosome 18 were taken from a combination of www.cedar.genetics.soton.ac.uk/pub and www.genethon.fr , along mouse chromosome 18 from www.informatics.jax.org , and along rat chromosome 18 from www.well.ox.ac.uk/~bihoreau and waldo.wi.mit.edu/rat/public/ .

Meta-analysis: Fisher's method. When there is no justification for assuming a common population variance between genome scans for linkage to differing autoimmune phenotypes in differing rodent strains and differing human populations, the only common measure that can form the basis for combination is the P value (22). The sum of (-2logeP) probability values from m independent tests of linkage is a {chi}2 statistic with 2m degrees of freedom (df) (23). Under the null hypothesis of no linkage of a region to disease, observed P values from separate studies have a uniform distribution regardless of the test statistic used or the distribution from which they arise (24). Thus, Fisher's method is appropriate even when considering studies that exhibit heterogeneity in the phenotype measured and test statistics used. Chromosome 18 data used here for the meta-analyses were derived from whole genome-wide scans and were obtained either directly from publications or from the corresponding author. P values were either published values or, when not presented, were determined as follows. For rodents, P values were calculated by a {chi}2 test of heterogeneity between affected and unaffected animals or, if unaffected animals were not genotyped, were calculated by a {chi}2 test of heterogeneity against the hypothesis of no linkage. For humans, P values were calculated for maximum logarithm-of-odds scores (MLS) and Z scores. If necessary, logarithm of odds scores were converted into {chi}2 (1df) statistics by multiplication by a factor of 4.6 (25) and the resulting P value included in the analysis. Autoimmune phenotypes that were characterized by both inflammation and association and/or linkage to the HLA region were analyzed. Where more than one scan was reported for a rodent autoimmune disease model, to reduce heterogeneity we chose the most consistently used end-point phenotype for each model. For type 1 diabetes, this end point was elevated urinary glucose levels, paralysis for EAE, swelling and erythema in joints for arthritis, and nephritis (which causes death) for systemic lupus erythematosus (SLE). Genome scans examining associated phenotypes (insulitis in diabetes and factors influencing autoantibody production, for example) were excluded. For two rat arthritis scans (26,27), which assessed linkage to severity of disease, data from severely affected animals were used and P values calculated by a {chi}2 test of heterogeneity against the null hypothesis of no linkage to arthritis. For the (BB x BN)F2 data (28,29), animals with a maximal arthritis score (MAS) >33 were compared, using a {chi}2 test for linkage, to animals with MAS <3. In two reports (30,31), a two-stage genotyping strategy was used requiring markers showing suggestive linkage to disease in an initial panel of animals to be genotyped over a second panel of animals; in the analysis presented here, data from the first panel of animals only were used. Data from the scans of Butterfield et al. (32) and Yang et al. (33) were analyzed using a {chi}2 test for linkage to disease susceptibility. In the (BB x WF)F1 x BB rat backcross, linkage of diabetes to chromosome 18 was not reported owing to the relative paucity of available polymorphic markers but tested here by a {chi}2 test of heterogeneity between affected and unaffected animals using data obtained from the corresponding author (34).

To meta-analyze linkage of the entire length of chromosome 18 to autoimmunity, the rodent and human chromosomes were divided into 10-cM intervals and P values combined as described above to yield a total P value for each of human and rodent (Tables 2 and 3). The -(log10) of these values were plotted at intervals of 10 cM (Fig. 2). Only scans with at least three markers, each in separate intervals of 10 cM, along the chromosome length were included. Six genome-wide scans (77,78,79,80,81,82) were excluded on this criterion. Scans in which partial data only were available for chromosome 18 (83,84,85) were excluded from this analysis (the first two publications reported positive linkage of the 40- to 50-cM portion of rat chromosome 18 to type 1 diabetes [P = 0.004 and 0.045, respectively] and the third reported positive linkage of chromosome 18q21 to Graves' disease [P = 3 x 10-4], but linkage data for other chromosome 18 markers were not available). When no chromosome 18 data were available either in the published paper or by request (36,59), P = 1.0 was included in each 10-cM window and 2 df added to each final {chi}2 statistic. Where a scan included no marker in a particular 10-cM window, no data were included for that window and no degrees of freedom added to the total {chi}2 statistic.


View this table:
[in this window]
[in a new window]
 
TABLE 2
 

View this table:
[in this window]
[in a new window]
 
TABLE 3
 


View larger version (22K):
[in this window]
[in a new window]
 
FIG. 2. Linkage of chromosome 18 to an autoimmune phenotype in (A) rodent and (B) human by Fisher's method of combining P values. Plotted points were taken from Tables 2 and 3, respectively, and are -log10(P) of total P values represented at the bottom of each table. Separate mouse and rat curves were plotted in Fig. 2A by summing appropriate P values, obtaining a combined P value, and plotting -log10(P). The region of synteny to human chromosome 18q12-q21 is marked ({longleftrightarrow}) on the rodent chromosome 18 curve, and the 18q12-q21 region is marked ({longleftrightarrow}) on the human chromosome 18 curve.

 

Meta-analysis: permutation method. A simulation/permutation method was used to additionally evaluate the pointwise significance of the test statistic obtained using Fisher's method. Test statistics at a single location were constructed using data from Tables 2 and 3, in 104 (for human) or 106 (for rodent) replicates. In each replicate, the P value contribution from a single study was chosen at random from the n possible contributions for that study at the n different locations (n = 6 for rodent and 13 for human). The P values from the m studies were combined using Fisher's method to give an overall test statistic for that replicate. Comparison of the observed Fisher's test statistic to that obtained using simulation allows an empirical P value for the observed statistic to be calculated. The -(log10) of these values were plotted at intervals of 10 cM (Fig. 3). This method relies on the assumption that at most locations, there is no linkage to disease. If a high proportion of the locations is, in fact, linked to disease, this method would give a conservative estimate of the empirical P value. Thus, in the case of the rodent meta-analysis in which there was a reasonable expectation of linkage of the 40- to 50-cM bin to disease (Fig. 2A), P values from the other five bins only (0-40 cM and 50 cM telomere) were used for a second permutation. The method would be anticonservative if the number of studies with missing information (in which the P value contribution was set to 1.0) was significantly smaller at the test location than at a random location. In our analyses, the test locations with higher Fisher's combined statistics did not have significantly fewer missing P values than other locations.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 3. Empirical significance of the Fisher's test statistics. Permutation on data in Tables 2 and 3 was performed as described in RESEARCH DESIGN AND METHODS, excluding the 40- to 50-cM bin in rodent, and -log10(P) of the permuted P values were plotted for (A) rodent and (B) human. The region of synteny to human chromosome 18q12-q21 is marked ({longleftrightarrow}) on the rodent chromosome 18 curve, and the 18q12-q21 region is marked ({longleftrightarrow}) on the human chromosome 18 curve.

 

Genome search meta-analysis method. The genome search meta-analysis (GSMA) method (86) can be applied to a wide range of study designs and to studies that differ in family ascertainment, population sampled, phenotype definition, markers genotyped, and analysis method used. The method requires ranking the results (test statistics or P values) at n bins within each study. The test statistic at each location is the sum (over m studies) of the ranks. Ten-cM bins were used, meaning 6 bins for rodent chromosome 18 and 13 bins for human chromosome 18. The exact distribution of the ranked statistic may be calculated (86). The -(log10) of the P values were plotted at intervals of 10 cM along rodent and human chromosome 18. Because our analysis was on a specific chromosome rather than from a whole genome scan, and our bins were smaller in length (and thus more correlated) than the recommended 20-cM bins (86), the significance of the test statistics was also evaluated using a simulation/permutation approach as described above (plotted in Fig. 4). P values using this method were very similar to theoretical P values.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 4. Linkage of chromosome 18 to an autoimmune phenotype in (A) rodent and (B) human by GSMA. Plotted points are -log10(P) of simulated (empirical) P values calculated as described in RESEARCH DESIGN AND METHODS, using data from Tables 2 and 3. The region of synteny to human chromosome 18q12-q21 is marked ({longleftrightarrow}) on the rodent chromosome 18 curve, and the 18q12-q21 region is marked ({longleftrightarrow}) on the human chromosome 18 curve.

 

Analysis of allelic association and linkage. Transmission of two-marker haplotypes was assessed from heterozygous parents to both affected and unaffected offspring using the transmission disequilibrium test (TDT) (87). To take account of the lack of independence (owing to linkage) between siblings in multiplex families and obtain a valid estimate of association, the TDT-based statistic (Tsp) was used (88). Tsp has a {chi}2 (1 df) distribution. When both parents were heterozygous for the same alleles at one marker in the haplotype, the family was removed from the analysis to prevent bias (89). Any families with missing parental data were also removed from the analysis to eliminate bias either from reconstruction of parental haplotypes or counting transmissions from a single parent (90,91). Transmission of haplotypes and Tsp were calculated assuming no recombination between 88,21 and 55,26. Percent T is the number of times an allele or haplotype was transmitted from heterozygous parents divided by the total of transmissions plus nontransmissions, expressed as a percentage. To assess linkage disequilibrium between haplotypes, D' values were calculated (92). D' values range from 1 (complete disequilibrium) through 0 (complete equilibrium) to -1 (alleles never found on same haplotype).

For the linkage analysis, up to 33 microsatellite markers spanning a 42-cM region of 18q12-q21 were typed in 882 affected sib-pair families from six populations. Centromeric to telomeric, these were as follows: D18S57, D18S454, D18S474, D18S484, D18S1156,88,21,55,26,114,1,30T7,129,6,129,12,129,11,IO43,56, D18S487, A181,2,49,12,49,22, D18S35, D18S69, D18S39, D18S41, D18S1152, D18S1129, D18S64, D18S38, D18S1134, D18S1148, D18S68, D18S42, D18S55, D18S483, D18S465, and D18S61. The 10 framework markers D18S454, D18S474, D18S487, D18S35, D18S69, D18S39, D18S41, D18S64, D18S38, and D18S42 were typed in all of the populations except the 39 Norwegian families. A further 11 of the 33 markers were typed in the Danish, Italian, and Norwegian data sets and 13 additional microsatellites were typed in the Finnish and U.S. data sets. All 33 were typed in the U.K. families. Markers were ordered with the Genome Analysis System (http://users.ox.ac.uk/~ayoung/gas.html ). When a physical map existed (13), it was used to order markers instead. Intermarker distances were calculated using the Aspex software (ftp://lahmed.stanford.edu/pub/aspex/index.html ) using all available family material. Multipoint MLS values were produced using Mapmaker/Sibs (ftp://ftp-genome.wi.mit.edu/distribution/software/sibs ).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previously, we cloned and physically mapped 10 microsatellite markers within a 650-kb region surrounding D18S487 on chromosome 18q21 (13). In 1,708 families, we showed that a haplotype ("10-2-4") of three of these markers (129, 11-IO43, 56-D18S487) showed some positive evidence of association with type 1 diabetes (P = 2 x 10-4) (13). Here, in an attempt to replicate this association, we typed the three markers in an independent set of 627 type 1 diabetes families and examined transmission of the 10-2-4 haplotype from heterozygous parents to affected offspring. The three-marker haplotype was negatively transmitted in these families (33 T vs. 53 NT), although there was evidence for linkage of the two markers to disease in the 140 multiplex family subset of the 627 (MLS = 1.2, P = 0.02). In the combined 2,335 families, there were 249 T vs. 199 NT (%T = 55.6, P = 0.02). In the context of genome-wide levels of statistical significance for allelic association of P < 5 x 10-8 (93), this is highly unlikely to be a true positive. This Bonferroni-based threshold may be too stringent, however, if there is prior evidence of linkage of a chromosome region with disease. We, therefore, reevaluated the evidence of linkage. Not only did we analyze linkage of chromosome 18q in 882 type 1 diabetic sib-pairs, but we also meta-analyzed linkage of the orthologous region of rodent chromosome 18 to type 1 diabetes. First, we typed up to 33 polymorphic microsatellite markers covering a 44-cM region (D18S57 to D18S61) in 882 type 1 diabetes—affected sib-pair pedigrees and tested for linkage to disease (Fig. 1). There was a peak MLS of 2.2 ({lambda}s = 1.2; P = 0.001), 3 cM telomeric to D18S487, suggestive evidence for linkage to disease (94).



View larger version (10K):
[in this window]
[in a new window]
 
FIG. 1. Linkage of human chromosome 18q to type 1 diabetes in 882 affected sib-pair families. The approximate positions of SMAD2, SMAD4, and DCC are shown. SMAD2 has been colocalized to YAC clones positive for D18S460, SMAD4 to YAC clones positive for D18S474, and DCC to YAC clones positive for D18S1156 (95). Microsatellite markers (represented by {diamondsuit}) are listed, centromeric to telomeric, in RESEARCH DESIGN AND METHODS.

 

On the basis of this result, we sought additional support for the possibility that chromosome 18q21 contains a diabetes gene by meta-analysis of the published evidence for linkage of the orthologous region to type 1 diabetes in rodent models of disease. A 25-cM segment of human chromosome 18q12-q21 is orthologous with an 8-cM segment of mouse chromosome 18, and mouse and rat chromosome 18 are also conserved. Gene order is conserved between SMAD2 (65 cM on human chromosome 18q12.3 and 48 cM on mouse chromosome 18) and FECH (90 cM on human chromosome 18q21.3 and 40 cM on mouse chromosome 18). The content and order of mapped genes is also conserved between mouse and rat chromosome 18 along the entire length, except for Gja1 (which maps at 59 cM on rat chromosome 18 and 29 cM on mouse chromosome 10). Four independent genome scans of rodent type 1 diabetes, with at least three markers along chromosome 18, have been published. The distal portion of rodent chromosome 18 (40-50 cM), orthologous with human chromosome 18q12-q21, showed evidence of linkage to type 1 diabetes (P = 9 x 10-4; Table 2).

Human 18q12-q23 has also been reported as being linked to Graves' disease, SLE, and RA (65,70,85), and the orthologous region on distal rodent chromosome 18 has been linked to EAE (39,95), to Theiler's virus-induced demyelination in mouse (a model of MS) (96), and in the murine model of lupus (45). To test the hypothesis that the distal end of rodent chromosome 18 and the orthologous region on human chromosome 18q12-q21 was linked to a phenotype of autoimmunity rather than to just a single autoimmune disease such as type 1 diabetes, the meta-analysis was extended to all published genome scans of autoimmune disease, beginning with the rodent model. Scans for linkage in rodent models of type 1 diabetes, EAE, lupus, arthritis, orchitis, gastritis, sialadenitis, and uveoretinitis were available (Table 2; Fig. 2A). Strongest linkage was observed to the 40- to 50-cM portion of chromosome 18 (P = 2 x 10-8). When plotted separately, the rat and mouse curves were similar, with linkage peaking in the 40- to 50-cM window for each (Fig. 2A; P = 2 x 10-6 and P = 0.001, respectively). Meta-analysis of human chromosome 18 was then performed on published human autoimmune disease genome scans of type 1 diabetes, inflammatory bowel disease, psoriasis, MS, RA, SLE, and Graves' disease. Peak P = 0.004 was obtained in the chromosome 18q21 region (Table 3; Fig. 2B). Note that three type 1 diabetes studies (2,3,11) were excluded owing to overlap in families used.

Genome scans using families or animal cohorts of small size (Tables 2 and 3) may increase the chance of type 1 error owing to the possibility of the respective test statistics not being continuous. Therefore, we repeated the human and rodent analyses excluding the five smallest studies from each. P values by Fisher's method were 0.004 for the 70- to 80-cM bin of human chromosome 18 and 4 x 10-9 for the 40- to 50-cM bin of rodent chromosome 18. Excluding these studies did not greatly affect the combined statistic.

To further evaluate the significance of the meta-analysis—based linkage obtained using Fisher's method, we applied a simulation method to the data (Fig. 3). For rodents, P = 2 x 10-4 (with a reasonable expectation of linkage of the 40- to 50-cM region to disease, this region was excluded from the permutation, P = 0.005 when this region was included) was obtained for linkage of the 40- to 50-cM bin of chromosome 18 to autoimmunity and P = 0.01 for linkage of human chromosome 18q12-q21 to autoimmunity. If any of the other positions used for the permutation are, in fact, linked to disease, then P = 2 x 10-4 will be a conservative estimate of the empirical level of significance in rodent. The permutation accounts for any residual linkage present on chromosome 18 and indicates that the linkages observed using Fisher's method are unlikely to have occurred owing to chance.

A separate method of meta-analysis, the GSMA method (86), was applied to the data (Fig. 4). This analysis supported the results obtained using Fisher's method of combining P values, with linkage observed both to the distal end of rodent chromosome 18 (40- to 50-cM portion, P = 0.03) and the chromosome 18q12-q21 region in humans (70- to 80-cM portion, P = 0.02). Simulated P values were 0.02 and 0.01, respectively (Fig. 4). The GSMA P values are less significant than the Fisher's P values (Fig. 2), probably because the GSMA method does not take into account the actual P values obtained in the individual studies.

At this stage of the investigation, we concluded that there was sufficient justification to commence a functional candidate gene approach to finding the disease locus (or loci) in the potentially linked region. As a first step, we chose the DCC gene because it has been well characterized at the genomic level, its product functions in apoptosis (97), and apoptosis defects can cause autoimmune disease. Using two microsatellite markers (88,21 and 55,26) cloned from within introns of DCC, we tested DCC for association with autoimmunity in the 2,359 type 1 diabetes families (Table 1), 896 MS families, and 125 RA families (n = 3,380; Table 4). All four haplotypes with a frequency >5% in parental chromosomes (2-10 [19.5%], 2-11 [10.9%], 7-1 [9.2%], and 2-12 [5.8%]) were tested for association with autoimmunity in the 3,380 families. The Tsp statistics were 20.8 (1,332 T, 1,100 NT; P = 5 x 10-6), 1.2 (821 T, 780 NT; P = 0.28), 1.0 (674 T, 643 NT; P = 0.32), and 0.0 (432 T, 500 NT; P = 1.0), respectively. Thus, only 2-10, the most common haplotype, showed some positive association with autoimmunity (P = 5 x 10-6; Pc = 2.1 x 10-4). A correction factor of 42 takes account of the 38 independent tests done in previous association analyses of the region (12,13) and the four separate 88,21-55,26 haplotypes tested here. Even if we anticipate 5,000 tests within this 20-cM chromosome 18q region, corrected P would still be <0.05. Association between the 2-10 haplotype and the separate autoimmune phenotypes was also tested (Table 4). Evidence for association with type 1 diabetes (P = 2 x 10-4) and with MS (P = 0.03) but not with RA (P = 0.09) was obtained. Transmission of the 2-10 haplotype to unaffected siblings did not differ from random expectations in the 3,380 families (633 T and 595 NT; % T = 51.5, P = 0.28).


View this table:
[in this window]
[in a new window]
 
TABLE 4
 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A multifaceted approach to study of a non-MHC type 1 diabetes susceptibility locus on chromosome 18q21 that incorporates all currently available clinical resources and data is presented here. On the basis of suggestive evidence for linkage of the chromosome 18q12-q21 region with type 1 diabetes in 882 families (Fig. 1; P = 0.001), a meta-analysis was undertaken providing evidence for linkage of the orthologous region in rodent to type 1 diabetes (P = 9 x 10-4). Evidence for linkage of the same region to an autoimmune phenotype in both rodent and human (P = 2 x 10-8 and 0.004, respectively, simulated P = 2 x 10-4 and 0.01, respectively) was obtained by further meta-analyses. Finally, with use of a positional candidate gene approach, association of microsatellite markers within the DCC gene was demonstrated to an autoimmune phenotype in humans (3,380 families, P = 5 x 10-6; Pc = 2.1 x 10-4).

The markers within DCC associated with autoimmunity (88,21 and 55,26) are within one megabase of D18S487 (98), which is part of the three-marker 129, 11-IO43, 56-D18S487 haplotype ("10-2-4") that we had previously found to be weakly associated with type 1 diabetes. The associated 2-10 haplotype of markers 88,21 and 5,26 was not in linkage disequilibrium with any of the five most common haplotypes, including the weakly associated 10-2-4 haplotype, at 129, 11-IO43, 56-D18S487. The D' values were between -0.19 and 0.21 in the diabetes families. The 10-2-4 haplotype was positively transmitted to affected offspring in the 1,708 families previously studied (Tsp = 12.0; P = 5 x 10-4) (13) but was negatively transmitted in the second independent set of 627 type 1 diabetes families studied here (33 T, 53 NT). In contrast, the 2-10 haplotype was associated with disease in both sets of families (P = 0.003 and 0.01, respectively). The results for the 129, 11-IO43, 56-D18S487 markers may represent either a false-positive association, or weaker linkage disequilibrium with the same locus detected by the DCC markers, or a very weak disease association distinct from that detected at DCC.

Our conclusion that there is suggestive evidence supporting association and linkage of human chromosome 18q12-q21 and its orthologue on rat and mouse chromosome 18 with multiple autoimmune phenotypes was reached only when considering the sum of the analyses presented here. Considering the conservation between human, mouse, and rat of association and linkage with autoimmunity, the results presented here are unlikely to be artifactual but rather indicate involvement of one or—more likely—more than one gene on chromosome 18 in susceptibility to autoimmunity. It is important to note that when examining each of the individual analyses in isolation (DCC association study in human and the rodent and human meta-analyses), none provides convincing evidence for involvement of chromosome 18 in autoimmunity—only the type 1 diabetes linkage analysis (Fig. 1) can be considered to provide "stand alone" suggestive evidence. For a number of reasons, however, our finding of possible involvement of chromosome 18 in autoimmune susceptibility is unlikely to be a false positive. P = 2 x 10-8 for linkage to rodent autoimmunity was obtained in the 40- to 50-cM portion of distal chromosome 18 (Table 2; Fig. 2A, empirical P = 2 x 10-4); the separate mouse and rat chromosome 18 meta-analyses were similar (Fig. 2A); linkage to rodent autoimmunity was replicated in the 70- to 80-cM orthologous region of human chromosome 18q21 (Fig. 2B; Table 3, P = 0.004; Fig. 3B, empirical P = 0.01). The GSMA method (Fig. 4) also supported linkage of the 40- to 50-cM portion of rodent chromosome 18 and 70- to 80-cM portion of human chromosome 18, to autoimmunity (P = 0.03 and 0.02, respectively). In addition, markers within DCC (which maps at 74 cM on human chromosome 18q21) are associated with autoimmune disease (Table 4; P = 5 x 10-6, Pc = 2.1 x 10-4), and there is suggestive evidence for linkage of chromosome 18q21 to type 1 diabetes (Fig. 1; P = 0.001).

Several caveats concerning the meta-analyses need to be discussed. Possibly the most significant problem is the methodology used when combining data from heterogeneous sources. For example, the rodent meta-analysis combined data from backcrosses and intercrosses between 17 and 10 independent mouse and rat crosses, respectively. This represents 22 separate strains, with an unknown number and origin of allele(s) at the putative chromosome 18 autoimmunity locus (or loci). Because of this heterogeneity, to obtain an estimate of the true significance of the combined data, it was necessary to combine P values by Fisher's method (22), rather than combine raw data. It should be noted that, if possible, it is preferable to combine raw data or parameter estimates; combining P values tends to cause more false-positive results and miss more true-positive loci than other approaches (99,100). In addition, we were unable to control for the fact that genome scan data might have higher marker density in regions of interest (for example, IDDM6 may be considered a region of interest in an autoimmune genome scan), thus biasing the meta-analysis. It is not possible to state whether evidence supporting linkage of chromosome 18 to autoimmunity in the meta-analyses reached either suggestive or significant levels; this would require modeling of the meta-analysis methods presented here, in addition to performing a genome-wide meta-analysis. Our study took into account all genome-wide studies irrespective of the significance of the chromosome 18 linkage data. It does not select positive results, as in the work of Becker et al. (4), and is unlikely to be affected by publication bias of positive results, since the data for chromosome 18 come from whole genome scan studies. We excluded available unpublished data from the following individuals: D. Baker, showing linkage of the 40- to 50-cM region of mouse chromosome 18 to cyclophosphamide-induced diabetes in (ABH x NOD) x NOD (personal communication; P = 0.0015); R. Holmdahl, showing linkage to EAE of markers syntenic to the mouse 40- to 50-cM region in a (E3 x DA)F2 rat intercross (P = 0.02); J. Otto, showing linkage of proteoglycan-induced arthritis to the mouse 40- to 50-cM region in a (C3H x C57Bl/6)F2 intercross (personal communication; P = 4 x 10-4); and D. Kono and C. Teuscher (personal communication), showing no evidence for linkage of the 40- to 50-cM region of mouse chr 18 to SLE in (BXSB x NZW)F2 (P = 0.93) and to EAE in (SJL/J x B10.S)F1 x B10.S (P = 0.63), respectively. These unpublished data were excluded from our meta-analysis to remove any bias owing to the possibility of preferentially obtaining positive chromosome 18 data over negative data. If these P values were combined (using Fisher's method) with the total P values presented in Table 2, and published data not included in the chromosome 18 meta-analysis owing to availability of only some chromosome 18 data (see RESEARCH DESIGN AND METHODS), then P for the 40- to 50-cM portion of rodent chromosome 18 would be 7 x 10-13. Similarly, adding P = 0.001 from the partial linkage map of chromosome 18 in human diabetes (Fig. 1), in addition to other partial human chromosome 18 data (85), to the data presented in Table 3 gives P = 6 x 10-6 supporting linkage of the 70- to 80-cM portion of human chromosome 18 to autoimmunity.

Although microsatellites are informative markers for association mapping, their typing in very large data sets is problematic owing to the failure to fully automate allele scoring. Therefore, single nucleotide polymorphisms, because their scoring can be automated in a robust and accurate way, should improve the feasibility of further characterizing the contribution of human chromosome 18 to autoimmune susceptibility. Our results also indicate the importance of animal models in mapping of disease genes. Congenic mapping will allow further investigation of the role of chromosome 18 in rodent autoimmunity.


    ACKNOWLEDGMENTS
 
This work was funded by the Wellcome Trust, the British Diabetic Association, the U.K. Medical Research Council, the Juvenile Diabetes Foundation International (JDFI), the Arthritis Research Campaign, and the New Zealand Health Research Council. We thank the Finnish Childhood Registry Group, the Novo Nordisk Foundation, the Finnish Academy, and National Institutes of Health for their support for the Finnish part of the study. T.R.M. was a JDFI Postdoctoral Fellow and is currently a Wellcome Trust—New Zealand Health Research Council Overseas Postdoctoral Fellow. I.A.E was the recipient of a Wellcome Trust Prize Studentship, and J.A.T. was a Wellcome Trust Principal Research Fellow.

We acknowledge the following people who generously shared their data for this study: Marie-Claude Babron, David Baker, Alan Baxter, Elizabeth Blankenhorn, Jean-Francois Bureau, Russell Butterfield, Judy Cho, Francoise Clerget-Darpoux, Ingrid Dahlman, Dave Dyment, George Ebers, John Harley, Michelle Haywood, Jennifer Kelly, Brian Kotzin, Ed Leiter, Joseph Michalski, John Mordes, Bernie Morley, Jeffrey Otto, Miles Parkes, Luc Reininger, Elaine Remmers, Marie-Paule Roth, Jennifer Salström, Jack Satsangi, Pablo Silveira, Cory Teuscher, Yaron Tomer, Richard Trembath, Colin Veal, and Michael Weil. We also thank all authors who made their entire genome-wide linkage data publicly available, either in the relevant publication or electronically. Helen Yates and the Arthritis Research Campaign Epidemiology Research Unit are thanked for recruiting RA families. Frank Dudbridge is thanked for help in data analysis.


    FOOTNOTES
 
J.A.T. was a paid consultant of Merck Research Laboratories, which provided grants to his laboratory to conduct studies on the genetics of type 1 diabetes.

DCC, deleted in colorectal carcinoma; df, degrees of freedom; EAE, experimental allergic encephalomyelitis; GSMA, genome search meta-analysis; JDFI, Juvenile Diabetes Foundation International; MAS, maximal arthritis score; MHC, major histocompatibility complex; MLS, maximum logarithm-of-odds score; MS, multiple sclerosis; PCR, polymerase chain reaction; RA, rheumatoid arthritis; SLE, systemic lupus erythematosus; TDT, transmission disequilibrium test; Tsp, TDT-based statistic.

Received for publication April 6, 2000 and accepted in revised form September 8, 2000


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 RESEARCH DESIGN AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Vyse TJ, Todd JA: Genetic analysis of autoimmune disease. Cell 85:311 -318, 1996[Medline]
  2. Concannon P, Gogolin-Ewens KJ, Hinds DA, Wapelhorst B, Morrison VA, Stirling B, Mitra M, Farmer J, Williams SR, Cox NJ, Bell GI, Risch N, Spielman RS: A second-generation screen of the human genome for susceptibility to insulin-dependent diabetes mellitus. Nat Genet19 : 292-296,1998[Medline]
  3. Mein CA, Esposito L, Dunn MG, Johnson GC, Timms AE, Goy JV, Smith AN, Sebag-Montefiore L, Merriman ME, Wilson AJ, Pritchard LE, Cucca F, Barnett AH, Bain SC, Todd JA: A search for type 1 diabetes susceptibility genes in families from the United Kingdom. Nat Genet19 : 297-300,1998[Medline]
  4. Becker KG, Simon RM, Bailey-Wilson JE, Freidlin B, Biddison WE, McFarland HF, Trent JM: Clustering of non-major histocompatibility complex susceptibility candidate loci in human autoimmune diseases. Proc Natl Acad Sci USA 95:9979 -9984, 1998[Abstract/Free Full Text]
  5. Becker KG: Comparative genetics of type 1 diabetes and autoimmune disease: common loci, common pathways? Diabetes48 : 1353-1358,1999[Abstract]
  6. Encinas JA, Wicker LS, Peterson LB, Mukasa A, Teuscher C, Sobel R, Weiner HL, Seidman CE, Seidman JG, Kuchroo VK: QTL influencing autoimmune diabetes and encephalomyelitis map to a 0.15 cM region containing Il2.Nat Genet 21:158 -160, 1999[Medline]
  7. Martin A-M, Maxson MN, Leif J, Mordes JP, Greiner DL, Blakenhorn EP: Diabetes-prone and diabetes-resistant BB rats share a common major diabetes susceptibility locus, iddm4. Diabetes48 : 2138-2144,1999[Abstract]
  8. Nisticò L, Buzzetti R, Pritchard LE, Van der Auwera B, Giovannini C, Bosi E, Larrad MTM, Rios MS, Chow CC, Cockram CS, Jacobs K, Mijovic C, Bain SC, Barnett AH, Vandewalle CL, Schuit F, Gorus FK, Belgian Diabetes Registry, Tosi R, Pozzilli P, Todd JA: The CTLA-4 gene region of chromosome 2q33 is linked to, and associated with, type 1 diabetes. Hum Mol Genet 5:1075 -1080, 1996[Abstract/Free Full Text]
  9. Vaidya B, Imrie H, Perros P, Young ET, Kelly WF, Carr D, Large DM, Toft AD, McCarthy MI, Kendall-Taylor P, Pearce SHS: The cytotoxic T lymphocyte antigen-4 is a major Graves' disease locus. Hum Mol Genet 7:1195 -1199, 1999[Abstract/Free Full Text]
  10. Harbo HF, Celius EG, Vartdal F, Spurkland A: CTLA4 promoter and exon 1 dimorphisms in multiple sclerosis. Tissue Antigens 53:106 -110, 1999[Medline]
  11. Davies JL, Kawaguchi Y, Bennett ST, Copeman JB, Cordell HJ, Pritchard LE, Reed PW, Gough SCL, Jenkins SC, Palmer SM, Balfour KM, Rowe B, Farrall M, Barnett AH, Bain SC, Todd JA: A genome-wide search for human type 1 diabetes susceptibility genes. Nature371 : 130-136,1994[Medline]
  12. Merriman T, Twells R, Merriman M, Eaves I, Cox R, Cucca F, McKinney P, Shield J, Baum D, Bosi E, Pozzilli P, Nisticò L, Buzzetti R, Joner G, Ronningen K, Thorsby E, Undlien D, Pociot F, Nerup J, Bain S, Barnett A, Todd J: Evidence by allelic association-dependent methods for a type 1 diabetes polygene (IDDM6) on chromosome 18q21. Hum Mol Genet6 : 1003-1010,1997[Abstract/Free Full Text]
  13. Merriman TR, Eaves IA, Twells RC, Merriman ME, Danoy PA, Muxworthy CE, Hunter KM, Cox RD, Cucca F, McKinney PA, Shield JP, Baum JD, Tuomilehto J, Tuomilehto-Wolf E, Ionesco-Tirgoviste C, Joner G, Thorsby E, Undlien DE, Pociot F, Nerup J, Ronningen KS, Bain SC, Todd JA: Transmission of haplotypes of microsatellite markers rather than single marker alleles in the mapping of a putative type 1 diabetes susceptibility gene (IDDM6). Hum Mol Genet 7:517 -524, 1998[Abstract/Free Full Text]
  14. Wadsworth EJK, Shield JPH, Hunt LP, Baum JD: A case-control study of environmental factors associated with diabetes in the under 5s. Diabet Med 14:390 -396, 1997[Medline]
  15. Lernmark A, Ducat L, Eisenbarth G, Ott J, Permutt MA, Rubenstein P, Spielman R: Family cell lines available for research. Am J Hum Genet 47:1028 -1030, 1990[Medline]
  16. Pociot F, Norgaard K, Hobolth N, Andersen O, Nerup J: A nationwide population-based study of the familial aggregation of type 1 (insulin-dependent) diabetes mellitus in Denmark. Diabetologia 36:870 -875, 1993[Medline]
  17. Kristiansen OP, Zamani M, Johannesen J, Mandrup-Poulsen T, Cassiman JJ, Nerup J, Pociot F: Linkage and association between a CD4 gene polymorphism and IDDM in Danish IDDM patients. Diabetes47 : 281-283,1998[Medline]
  18. Marrosu MG, Murru MR, Costa G, Murru R, Muntoni F, Cucca F: DRB1-DQA1-DQB1 loci and multiple sclerosis predisposition in the Sardinian population. Hum Mol Genet 7:1235 -1237, 1998[Abstract/Free Full Text]
  19. Poser CM, Paty DW, Scheinberg L, McDonald WI, Davis FA, Ebers GC, Johnson KP, Sibley WA, Silberberg DH, Tourtellotte WW: New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann Neurol 13:227 -231, 1983[Medline]
  20. Kong X-T, Choi SH, Inoue A, Xu F, Chen T, Takita J, Yokota J, Bessho F, Yanagisawa M, Hanada R, Yamamoto K, Hayashi Y: Expression and mutational analysis of the DCC, DPC4, and MADR2/JV18-1 genes in neuroblastoma. Cancer Res 57:3772 -3778, 1997[Abstract]
  21. Reed PW, Davies JL, Copeman JB, Bennett ST, Palmer SM, Pritchard LE, Gough SCL, Kawaguchi Y, Cordell HJ, Balfour KM, Jenkins SC, Powell EE, Vignal A, Todd JA: Chromosome-specific microsatellite sets for fluorescence-based, semi-automated genome mapping. Nat Genet 7: 390-395,1994[Medline]
  22. Tippett LHC: The Methods of Statistics. 4th ed., revised. London, Benn, Williams and Norgate, 1952, p.159
  23. Fisher RA: Statistical Methods for Research Workers. London, Oliver and Boyd, 1932
  24. Hedges LV, Olkin I: Statistical Methods for Meta-Analysis. New York, Academic Press, 1985, p.28
  25. Ott J: Analysis of Human Genetic Linkage(revised edition). Baltimore, MD, Johns Hopkins University Press,1991
  26. Gulko PS, Kawahito Y, Remmers EF, Reese VR, Wang J, Dracheva SV, Ge L, Longman RE, Shepard JS, Cannon GW, Sawitzke AD, Wilder RL, Griffiths MM: Identification of a new non-major histocompatibility complex genetic locus on chromosome 2 that controls disease severity in collagen-induced arthritis in rats. Arthritis Rheum 41:2122 -2131, 1998[Medline]
  27. Kawahito Y, Cannon GW, Gulko PS, Remmers EF, Longman RE, Reese VR, Wang J, Griffiths MM, Wilder RL: Localization of quantitative trait loci regulating adjuvant-induced arthritis in rats: evidence for genetic factors common to multiple autoimmune diseases. J Immunol161 : 4411-4419,1998[Abstract/Free Full Text]
  28. Salström JL, Furuya T, Cannon GW, Remmers EF, Griffiths MM, Wilder RL: Rat models of autoimmune diseases: the genetic dissection of complex traits (Abstract). Am J Hum Genet 65 (Suppl.):A467 , 1999
  29. Furuya T, Salström JL, Cannon GW, Remmers EF, Griffiths MM, Wilder RL: Identification of three new non-MHC genomic regions controlling collagen-induced arthritis (CIA) in rats with a shared epitope. Arthritis Rheum42 (Suppl.): S383,1999
  30. Dahlman I, Jacobsson L, Glaser A, Lorentzen JC, Andersson M, Luthman H, Olsson T: Genome-wide linkage analysis of chronic relapsing experimental autoimmune encephalomyelitis in the rat identifies a major susceptibility locus on chromosome 9. J Immunol162 : 2581-2588,1999[Abstract/Free Full Text]
  31. Mähler M, Bristol IJ, Sundberg JP, Churchill GA, Birkenmeier EH, Elson CO, Leiter EH: Genetic analysis of susceptibility to dextran sulfate sodium-induced colitis in mice. Genomics 55:147 -156, 1999[Medline]
  32. Butterfield RJ, Sudweeks JD, Blankenhorn EP, Korngold R, Marini JC, Todd JA, Roper RJ, Teuscher C: New genetic loci that control susceptibility and symptoms of experimental allergic encephalomyelitis in inbred mice. J Immunol 161:1860 -1867, 1998[Abstract/Free Full Text]
  33. Yang H-T, Jirholt J, Svensson L, Sundvall M, Jansson L, Pettersson U, Holmdahl R: Identification of genes controlling collagen-induced arthritis in mice: striking homology with susceptibility loci previously identified in the rat. J Immunol 163:2916 -2921, 1999[Abstract/Free Full Text]
  34. Martin A-M, Blankenhorn EP, Maxson MN, Zhao M, Leif J, Mordes JP, Greiner DL: Non-major histocompatibility complex-linked diabetes susceptibility loci on chromosomes 4 and 13 in a backcross of the DP-BB/Wor rat to the WF rat. Diabetes 48:50 -58, 1999[Abstract]
  35. Ghosh S, Palmer SM, Rodrigues NR, Cordell HJ, Hearne CM, Cornall RJ, Prins J-B, McShane P, Lathrop GM, Peterson LB, Wicker LS, Todd JA: Polygenic control of autoimmune diabetes in nonobese mice. Nat Genet 4: 404-409,1993[Medline]
  36. de Gouyon B, Melanitou E, Richard MF, Requart M, Hahn IH, Guenet JL, Demenais F, Julier C, Lathrop GM, Boitard C, Avner P: Genetic analysis of diabetes and insulitis in an interspecific cross of the nonobese diabetic mouse with Mus spretus. Proc Natl Acad Sci U S A90 : 1877-1881,1993[Abstract]
  37. Yokoi N, Kanazawa M, Kitada K, Tanaka A, Kanazawa Y, Suda S, Ito H, Serikawa T, Komeda K: A non-MHC locus essential for autoimmune type 1 diabetes in the Komeda diabetes-prone rat. J Clin Invest8 : 2015-2021,1997
  38. Encinas JA, Lees MB, Sobel RA, Symonowicz C, Greer JM, Shovlin CL, Weiner HL, Cousin K, Bell RB, Hader W, Paty DW, Hashimoto S, Oger J, Duquette P, Warren S, Gray T, O'Connor P, Nath A, Auty A, Metz L, Francis G, Paulseth JE, Murray TJ, Pryse-Phillips W, Nelson R, Freedman M, Brunet D, Bouchard J-P, Hinds D, Risch N: Genetic analysis of susceptibility to experimental autoimmune encephalomyelitis in a cross between SJL/J and B10.S mice. J Immunol 157:2186 -2192, 1996[Abstract]
  39. Baker D, Rosenwasser OA, O'Neill JK, Turk JL: Genetic analysis of experimental allergic encephalomyelitis in mice. J Immunol 155:4046 -4051, 1995[Abstract]
  40. Croxford JL, O'Neill JK, Baker D: Polygenic control of experimental autoimmune encephalomyelitis in Biozzi ABH and BALB/c mice. J Neuroimmunol 74:205 -211, 1997[Medline]
  41. Sundvall M, Jirholt J, Yang H-T, Jansson L, Engstrom A, Pettersson U, Holmdahl R: Identification of murine loci associated with susceptibility to chronic experimental autoimmune encephalomyelitis. Nat Genet 10:313 -318, 1995[Medline]
  42. Roth M-P, Viratelle C, Dolbois L, Delverdier M, Borot N, Pelletier L, Druet P, Clanet M, Coppin H: A genome-wide search identifies two susceptibility loci for experimental autoimmune encephalomyelitis on rat chromosomes 4 and 10. J Immunol162 : 1917-1922,1999[Abstract/Free Full Text]
  43. Drake CG, Babcock SK, Palmer E, Kotzin BL: Genetic analysis of the NZB contribution to lupus-like autoimmune disease in (NZB x NZW)F1 mice. Proc Natl Acad Sci U S A91 : 4062-4066,1994[Abstract]
  44. Vyse TJ, Halterman RK, Rozzo SJ, Izui S, Kotzin BL: Control of separate pathogenic autoantibody responses marks MHC contributions to murine lupus. Proc Natl Acad Sci U S A96 : 8098-8103,1999[Abstract/Free Full Text]
  45. Kono DH, Burlingame RW, Owens DG, Kuramochi A, Balderas RS, Balomenos D, Theofilopoulos AN: Lupus susceptibility loci in New Zealand mice. Proc Natl Acad Sci U S A 91:10168 -10172, 1994[Abstract/Free Full Text]
  46. Vidal S, Kono DH, Theofolipoulos AN: Loci predisposing to autoimmunity in MRL-Faslpr and C57BL/6-Faslpr mice. J Clin Invest101 : 696-702,1998[Abstract/Free Full Text]
  47. Remmers E, Longman RE, Du Y, O'Hare A, Cameron GW, Griffiths MM, Wilder RL: A genome scan localizes five non-MHC loci controlling collagen-induced arthritis in rats. Nat Genet14 : 82-85,1996[Medline]
  48. Vingsbo-Lundberg C, Nordquist N, Olofsson P, Sundvall M, Saxne T, Pettersson U, Holmdahl R: Genetic control of arthritis onset, severity and chronicity in a model for rheumatoid arthritis in rats. Nat Genet 20:401 -404, 1998[Medline]
  49. Jirholt J, Cook A, Emahazion T, Sundvall M, Jansson L, Nordquist N, Pettersson U, Holmdahl R: Genetic linkage analysis of collagen-induced arthritis in mouse. Eur J Immunol28 : 3321-3328,1998[Medline]
  50. Otto JM, Cs-Szabó G, Gallagher J, Velins S, Mikecz K, Buzás EI, Enders JT, Olsen BR, Glant TT: Identification of multiple loci linked to inflammation and autoantibody production by a genome scan of a murine model of rheumatoid arthritis. Arthritis Rheum 42:2524 -2531, 1999[Medline]
  51. Meeker ND, Hickey WF, Korngold R, Hansen WK, Sudweeks JD, Wardell BB, Griffith JS, Teuscher C: Multiple loci govern the bone marrow-derived immuno-regulatory mechanism controlling dominant resistance to autoimmune orchitis. Proc Natl Acad Sci U S A92 : 5684-5688,1995[Abstract]
  52. Sun S-H, Silver PB, Caspi RR, Du Y, Chan C-C, Wilder RL, Remmers EF: Identification of genomic regions controlling experimental autoimmune uveoretinitis in rats. Int Immunol11 : 529-534,1999[Abstract/Free Full Text]
  53. Nishihara M, Terada M, Kamogawa J, Ohashi Y, Mori S, Nakatsuru S, Nakamura Y, Nose M: Genetic basis of autoimmune sialadenitis in MRL/lpr lupus-prone mice: additive and hierarchical properties of polygenic inheritance. Arthritis Rheum42 : 2616-2623,1999[Medline]
  54. Greco L, Corazza G, Babron MC, Clot F, Fulchignoni-Lataud MC, Percopo S, Zavattari P, Bouguerra F, Dib C, Tosi R, Troncone R, Ventura A, Mantavoni W, Magazzu G, Gatti R, Lazzari R, Giunta A, Perri F, Iacono G, Cardi E, de Virgiliis S, Cataldo F, de Angelis G, Musumeci S, Ferrari R, Balli F, Bardella M-T, Volta U, Catassi C, Torre G, Eliaou J-F, Serre J-L, Clerget-Darpoux F: Genome search in celiac disease. Am J Hum Genet 62:669 -675, 1998[Medline]
  55. Zhong F, McCombs CC, Olson JM, Elston RC, Stevens FM, McCarthy CF, Michalski JP: An autosomal screen for genes that predispose to celiac disease in the western counties of Ireland. Nat Genet14 : 329-333,1996[Medline]
  56. Satsangi J, Parkes M, Louis E, Hashimoto L, Kato N, Welsh K, Terwilliger JD, Lathrop GM, Bell JI, Jewell DP: Two stage genome-wide search in inflammatory bowel disease provides evidence for susceptibility loci on chromosomes 3, 7 and 12. Nat Genet14 : 199-202,1996[Medline]
  57. Cho JH, Nicolae DL, Gold LH, Fields CT, LaBuda MC, Rohal PM, Pickles MR, Qin L, Fu Y, Mann JS, Kirschner BS, Jabs EW, Weber J, Hanauer SB, Bayless TM, Brant SR: Identification of novel susceptibility loci for inflammatory bowel disease on chromosomes 1p, 3q and 4q: evidence for epistasis between 1p and IBD1. Proc Natl Acad Sci U S A 95: 7502-7507,1998[Abstract/Free Full Text]
  58. Hampe J, Schreiber S, Shaw SH, Lau KF, Bridger S, Macpherson AJS, Cardon LR, Sakul H, Harris TJR, Buckler A, Hall J, Stokkers P, van Deventer SJH, Nürnberg P, Mirza MM, Lee JCW, Lennard-Jones JE, Mathew CG, Curran ME: A genomewide analysis provides evidence for novel linkages in inflammatory bowel disease in a large European cohort. Am J Hum Genet 64:808 -816, 1999[Medline]
  59. Hugot J-P, Laurent-Puig P, Gower-Rousseau C, Olson JM, Lee JC, Beaugerie L, Naom I, Dupas J-L, Gossum AV, Groupe d'Etude Thérapeutique des Affections Inflammatoires Digestives, Orholm M, Boniati-Pellie C, Weissenbach J, Mathew CG, Lennard-Jones JE, Cortot A, Colombel J-F, Thomas G: Mapping of a susceptibility locus for Crohn's disease on chromosome 16. Nature 379:821 -823, 1996[Medline]
  60. Ma Y, Ohmen JD, Li Z, Bentley LG, McElree C, Pressman S, Targan SR, Fischel-Ghodsian N, Rotter JI, Yang H: A genome-wide search identifies potential new susceptibility loci for Crohn's disease. Inflamm Bowel Dis 5:271 -278, 2000
  61. Duerr RH, Barmada MM, Zhang L, Pfützer R, Weeks DE: High-density genome scan in Crohn disease shows confirmed linkage to chromosome 14q11-12. Am J Hum Genet 66:1857 -1862, 2000[Medline]
  62. Rioux JD, Silverberg MS, Daly MJ, Steinhart AH, McLeod RS, Griffiths AM, Green T, Brettin TS, Stone V, Bull SB, Bitton A, Williams CN, Greenberg GR, Cohen Z, Lander ES, Hudson TJ, Siminovitch KA: Genomewide search in Canadian families with inflammatory bowel disease reveals two novel susceptibility loci. Am J Hum Genet66 : 1863-1870,2000[Medline]
  63. Gaffney PM, Ortmann WA, Selby SA, Shark KB, Ockenden TC, Rohlf KE, Walgrave NL, Boyum WP, Malmgren ML, Miller ME, Kearns GM, Messner RP, King RA, Rich SS, Behrens TW: Genome screening in human systemic lupus erythematosus: results from a second Minnesota cohort and combined analyses of 187 sib-pair families. Am J Hum Genet 66:547 -556, 2000[Medline]
  64. Moser KL, Neas BR, Salmon JE, Yu H, Gray-McGuire C, Asundi N, Bruner GR, Fox J, Kelly J, Henshall S, Bacino D, Dietz M, Hogue R, Koelsch G, Nightingale L, Shaver T, Abdou NI, Albert DA, Carson C, Petri M, Treadwell EL, James JA, Harley JB: Genome scan of human systemic lupus erythematosus: evidence for linkage on chromosome 1q in African-American pedigrees. Proc Natl Acad Sci U S A 95:14869 -14874, 1998[Abstract/Free Full Text]
  65. Shai R, Quismorio FP Jr, Li L, Kwon O-J, Morrison J, Wallace DJ, Neuwelt CM, Brautbar C, Gauderman WJ, Jacob CO: Genome-wide screen for systemic lupus erythematosus susceptibility genes in multiplex families. Hum Mol Genet 8:639 -644, 1999[Abstract/Free Full Text]
  66. Kuokkanen S, Gschwend M, Rioux JD, Daly MJ, Terwilliger JD, Tienari PJ, Wikström J, Palo J, Stein LD, Hudson TJ, Lander ES, Peltonen L: Genome-wide scan of multiple sclerosis in Finnish multiplex families. Am J Hum Genet61 : 1379-1387,1997[Medline]
  67. The Multiple Sclerosis Genetics Group: A complete genomic screen for multiple sclerosis underscores a role for the major histocompatibility complex. Nat Genet 13:469 -471, 1996[Medline]
  68. Sawcer S, Jones HB, Feakes R, Gray J, Smaldon N, Chataway J, Robertson N, Clayton D, Goodfellow PN, Compston A: A genome screen in multiple sclerosis. Nat Genet 13:464 -468, 1996[Medline]
  69. Ebers GC, Kukay K, Bulman DE, Sadovnick AD, Rice G, Anderson C, Armstrong H, Cousin K, Bell RB, Hader W, Paty DW, Hashimoto S, Oger J, Duquette P, Warren S, Gray T, O'Connor P, Nath A, Auty A, Metz L, Francis G, Paulseth JE, Murray TJ, Pryse-Phillips W, Nelson R, Freedman M, Brunet D, Bouchard J-P, Hinds D, Risch N: A full genome search in multiple sclerosis. Nat Genet 13:472 -476, 1996[Medline]
  70. Cornelis F, Faure S, Martinez M, Prud'homme JF, Fritz P, Dib C, Alves H, Barrera P, de Vries N, Balsa A, Pascual-Salcedo D, Maenaut K, Westhovens R, Migliorini P, Tran TH, Delaye A, Prince N, Lefevre C, Thomas G, Poirier M, Soubigou S, Alibert O, Lasbleiz S, Fouix S, Bouchier C, Liote F, Loste M-N, Lepage V, Charron D, Gyapay G, Lopes-Vaz A, Kuntz D, Bardin T, Weissenbach J: New susceptibility locus for rheumatoid arthritis suggested by a genome-wide linkage study. Proc Natl Acad Sci U S A95 : 10746-10750,1998[Abstract/Free Full Text]
  71. Jawaheer D, Costello T, Amos C, Monteiro J, Seldin M, Criswell L, Bridges SL, Schroeder H, Pisetsky D, Kastner D, Wilder R, Pope R, Clegg D, Ward R, Albani S, Nelson JL, Wener M, Callahan L, Pincus T, Gregersen PK: Analysis of affected sibling pairs with rheumatoid arthritis: the North American rheumatoid arthritis consortium (Abstract). Am J Hum Genet 65 (Suppl.):A276 , 1999
  72. Nair RP, Henseler T, Jenisch S, Stuart S, Bichakjian CK, Lenk W, Westphal E, Guo S-W, Christophers E, Voorhees JJ, Elder JT: Evidence for two psoriasis susceptibility loci (HLA and 17q) and two novel candidate regions (16q and 20p) by genome-wide scan. Hum Mol Genet6 : 1349-1356,1997[Abstract/Free Full Text]
  73. Trembath RC, Clough RL, Rosbotham JL, Jones AB, Camp RDR, Frodsham A, Browne J, Barber R, Terwilliger J, Lathrop GM, Barker JNWN: Identification of a major susceptibility locus on chromosome 6p and evidence for further disease loci revealed by two stage genome-wide search in psoriasis. Hum Mol Genet 6:813 -820, 1997[Abstract/Free Full Text]
  74. Samuelsson L, Enlund F, Torinsson A, Yhr M, Inerot A, Enerbäck C, Wahlström J, Swanbeck G, Martinsson T: A genome-wide search for genes predisposing to familial psoriasis by using a stratification approach. Hum Genet105 : 523-529,1999[Medline]
  75. Hashimoto L, Habita C, Beressi JP, Delepine M, Besse C, Cambon-Thomsen A, Deschamps I, Rotter JI, Djoulah S, James MR, Froguel P, Weissenbach J, Lathrop GM, Julier C: Genetic mapping of a susceptibility locus for insulin-dependent diabetes mellitus on chromosome 11q. Nature 371:161 -164, 1994[Medline]
  76. Tomer Y, Barbesino G, Greenberg DA, Concepcion E, Davies TF: Mapping the major susceptibility loci for familial Graves' and Hashimoto's diseases: evidence for genetic heterogeneity and gene interactions. J Clin Endocrinol Metab 84:4656 -4664, 1999[Abstract/Free Full Text]
  77. Morel L, Rudofsky UH, Longmate J, Schiffenbauer J, Wakeland EK: Polygenic control of susceptibility to murine systemic lupus erythematosus. Immunity 1:219 -229, 1994[Medline]
  78. McAleer M, Reifsnyder P, Palmer SM, Prochazka M, Love JM, Copeman JB, Powell EE, Rodrigues NR, Prins J-B, Serreze DV, DeLarato NH, Wicker LS, Peterson LB, Schork NJ, Todd JA, Leiter EH: Crosses of NOD mice with the related NON strain: a polygenic model for IDDM. Diabetes 44:1186 -1195, 1995[Abstract]
  79. Drake CG, Rozzo SJ, Hirschfield HF, Smarnworawong NP, Palmer E, Kotzin BL: Analysis of the New Zealand black contribution to lupus-like renal disease: multiple genes that operate in a threshold manner. J Immunol 154:2441 -2447, 1995[Abstract/Free Full Text]
  80. Hogarth MB, Slingsby JH, Allen PJ, Thompson EM, Chandler P, Davies KA, Simpson E, Morley BJ, Walport MJ: Multiple lupus susceptibility loci map to chromosome 1 in BXSB mice. J Immunol161 : 2753-2761,1998[Abstract/Free Full Text]
  81. Santiago M-L, Mary C, Parzy D, Jacquet C, Montagutelli X, Parkhouse RME, Lemoine R, Izui S, Reininger L: Linkage of a major quantitative trait locus to Yaa gene-induced lupus-like nephritis in (NZW x C57BL/6)F1 mice. Eur J Immunol28 : 4257-4267,1998[Medline]
  82. Silveira PA, Baxter AG, Cain WE, van Driel IR: A major linkage region on distal chromosome 4 confers susceptibility to mouse autoimmune gastritis. J Immunol 162:5106 -5111, 1999[Abstract/Free Full Text]
  83. Klöting I, Vogt L, Serikawa T: Locus on chromosome 18 cosegregates with diabetes in the BB/OK rat subline. Diabetes Metab 21:338 -344, 1995
  84. Klöting I, Schmidt S, Kovacs P: Mapping of novel genes predisposing or protecting diabetes development in the BB/OK rat. Biochem Biophys Res Commun245 : 483-486,1998[Medline]
  85. Vaidya B, Imrie H, Perros P, Young ET, Kelly WF, Carr D, Large DM, Toft AD, Kendall-Taylor P, Pearce SHS: Evidence for a new Graves' disease susceptibility locus at chromosome 18q21. Am J Hum Genet 66:1710 -1714, 2000[Medline]
  86. Wise LH, Lanchbury JS, Lewis CM: Meta-analysis of genome searches. Ann Hum Genet 63:263 -272, 1999[Medline]
  87. Spielman R, McGinnis R, Ewens W: Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am J Hum Genet52 : 506-516,1993[Medline]
  88. Martin ER, Kaplan NL, Weir BS: Tests for linkage and association in nuclear families. Am J Hum Genet61 : 439-448,1997[Medline]
  89. Dudbridge F, Koeleman PC, Todd JA, Clayton DG: Unbiased application of the transmission/disequilibrium test to multilocus haplotypes. Am J Hum Genet 66:2009 -2012, 2000[Medline]
  90. Curtis D: Use of siblings as controls in case-control association studies. Ann Hum Genet 61:319 -323, 1997[Medline]
  91. Curtis D, Sham PC: A note on the application of the transmission disequilibrium test when a parent is missing. Am J Hum Genet 56:811 -812, 1995[Medline]
  92. Devlin B, Risch N: A comparison of linkage disequilibrium measures for finescale mapping. Genomics29 : 311-322,1995[Medline]
  93. Risch N, Merikangas K: The future of genetic studies of complex human diseases. Science 273:1516 -1517, 1996[Medline]
  94. Lander E, Kruglyak L: Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 11:241 -247, 1995[Medline]
  95. Dahlman I, Wallström E, Weissert R, Storch M, Kornek B, Luthman H, Lassman H, Linington C, Olsson T: Linkage analysis of myelin oligodendrocyte glycoprotein-induced experimental autoimmune encephalomyelitis in the rat identifies a susceptibility locus for demyelination on chromosome 18. Hum Mol Genet8 : 2183-2190,1999[Abstract/Free Full Text]
  96. Bureau J-F, Montagutelli X, Bihl F, Lefebvre S, Guenet J-L, Brahic M: Mapping loci influencing the persistence of Theiler's virus in the murine central nervous system. Nat Genet5 : 87-91,1993[Medline]
  97. Mehlen P, Rabizadeh S, Snipas SJ, Assa-Munt N, Salvesen GS, Bredesen DE: The DCC gene product induces apoptosis by a mechanism requiring receptor proteolysis. Nature395 : 801-804,1998[Medline]
  98. Eppert K, Scherer SW, Ozcelik H, Pirone R, Hoodless P, Kim H, Tsui L-C, Bapat B, Gallinger S, Andrulis IL, Thomsen GH, Wrana JL, Attisano L: MADR2 maps to 18q21 and encodes a TGFß-regulated MAD-related protein that is functionally mutated in colorectal carcinoma. Cell 86:543 -552, 1996[Medline]
  99. Goldstein DR, Sain SR, Guerra R, Etzel CJ: Meta-analysis by combining parameter estimates: simulated linkage studies. Genet Epidemiol 17 (Suppl. 1):S581 -S586, 1999[Medline]
  100. Guerra R, Etzel CJ, Goldstein DR, Sain SR: Meta-analysis by combining P-values: simulated linkage studies. Genet Epidemiol 17 (Suppl. 1):S605 -S609, 1999[Medline]