PDX-1 Protein Containing Its Own Antennapedia-Like Protein Transduction Domain Can Transduce Pancreatic Duct and Islet Cells
Hirofumi Noguchi,
Hideaki Kaneto,
Gordon C. Weir, and
Susan Bonner-Weir
From the Section on Islet Transplantation and Cell Biology, Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts
 |
ABSTRACT
|
---|
The pancreatic and duodenal homeobox factor-1 (PDX-1), also known as IDX-1/STF-1/IPF1, a homeodomain-containing transcription factor, plays a central role in regulating pancreatic development and insulin gene transcription. Furthermore, even in adults, PDX-1 is associated with islet neogenesis and differentiation of insulin-producing cells from progenitor cells. Here, we report for the first time that PDX-1 protein can permeate cells due to an Antennapedia-like protein transduction domain sequence in its structure and that transduced PDX-1 functions similarly to endogenous PDX-1; it binds to the insulin promoter and activates its expression. PDX-1 protein can also permeate into isolated pancreatic islets, which leads to stimulation of insulin gene expression. Moreover, PDX-1 protein transduced into cultures of pancreatic ducts, thought to be islet progenitor cells, induces insulin gene expression. These data suggest that PDX-1 protein transduction could be a safe and valuable strategy for enhancing insulin gene transcription and for facilitating differentiation of ductal progenitor cells into insulin-producing cells without requiring gene transfer technology.
Since the discovery of protein transduction domains (PTDs) that allow proteins to be translocated across the plasma membrane and into nuclei without endocytosis, there has been increasing interest in their potential for the delivery of bioactive peptides and proteins into eukaryotic cells as a valuable strategy for the transduction of therapeutic proteins into patients. The small PTDs from TAT protein of HIV-1 (1) and from VP22 protein of Herpes simplex virus (2) have been fused to proteins with the remarkable result of delivery of proteins into many mammalian tissues (1,2). The presence of a PTD in the third
-helix of the homeodomain of Antennapedia, a Drosophila transcription factor, has been shown to be necessary and sufficient for an "unconventional" translocation of this peptide into the cytoplasm and nuclei of living cells (3).
We noticed that the transcription factor PDX-1 protein, which itself contains an Antennapedia-like homeodomain in its structure, has the same amino acid sequence, except for one amino acid toward the NH2-terminus, as the Antennapedia PTD (Fig. 1A). The presence of a PTD in PDX-1 is intriguing because PDX-1 plays such a crucial role in pancreatic development (46), ß-cell differentiation (79), and maintenance of normal ß-cell function by its regulation of multiple important ß-cell genes (10,11), including insulin (12,13). Adenoviral-mediated introduction of PDX-1 induced insulin expression in the liver and improved the glucose tolerance of streptozotocin-induced diabetic mice (8). The ability of the PDX-1 protein to both regulate its own gene expression through an A-box element in its promoter (14) and to induce the expression of other ß-cell genes is thought to be the basis of this induced insulin expression.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1. Transduction of PDX-1 protein into cells and protein transduction domain. A: Antennapedia PTD and PDX-1 sequences. PDX-1 has the same amino acid sequence as Antennapedia PTD except for one amino acid. B: Full-length PDX-1 protein, mutant PDX-1 protein that deleted the 16 amino acids similar to Antennapedia PTD, and the PTD peptide of the 16 amino acids are shown. Full-length PDX-1 protein and mutant PDX-1 protein were confirmed by Western blotting. C: HeLa cells showed a nuclear and cytoplasmic fluorescence signal after 6 h treatment with 1 µmol/l FITC-conjugated PDX-1 or PDX-1PTD peptide but not with FITC-conjugated mutant protein with deleted PTD. Modified EGFP (EGFP-11R protein) (17), which can be transduced into cells, was used as control.
|
|
Here, we report for the first time that PDX-1 protein can permeate cells due to the Antennapedia-like protein transduction domain sequence in its structure and that transduced PDX-1 functions similarly to endogenous PDX-1.
 |
RESEARCH DESIGN AND METHODS
|
---|
Construction of vectors and purification of recombinant PDX-1 proteins.
Full-length PDX-1 cDNA was amplified by PCR using appropriate linker-primers and then subcloned into the NdeI and XhoI sites of pET21a (+) (Novagen, Madison, WI) using a ligation kit (TaKaRa, Tokyo, Japan). For deletion of the PTD, sequences before and after the PTD of PDX-1 cDNA were amplified by PCR using appropriate linker-primers and then subcloned into the NdeI-BamHI and BamHI-XhoI sites of pET21a (+), respectively. For EGFP-11 arginine (11R), full-length enhanced green fluorescent protein cDNA was amplified by PCR using appropriate linker-primers, and 11R sequence was synthesized by Genosys-Sigma (The Woodlands, TX) and then subcloned into the NdeI-BamHI and NotI-XhoI sites of pET21a (+). BL21 (DE3) cells containing the expression plasmids were grown at 37°C to an OD600 of 0.8. Isopropyl-ß-D-thiogalactopyranoside was added to a final concentration of 0.1 mmol/l, and the cells were then incubated for 12 h at 24°C. Cells were sonicated, and the supernatants were recovered and applied to a column of Ni-NTA agarose (Invitrogen, San Diego, CA). Purified PDX-1 proteins were conjugated using a fluorescein isothiocyanate (FITC)-labeling kit (American Qualex Antibodies, San Clemente, CA). FITC-labeled PDX-1 PTD peptide was synthesized by Genosys-Sigma.
Western blotting.
After three washings with PBS, cells were scrapped from the dish and sonicated. Ten micrograms of cell extracts were fractionated by 10% SDS-PAGE and transferred to polyvinylideno fluoride membranes (Immun-Blot PVDF Membrane; Bio-RAD, Hercules, CA) using transfer buffer containing 20% methanol, 25 mmol/l Tris base, and 192 mmol/l glycine (300 mA, 2 h). After blocking at room temperature for 1 h in 50 mmol/l Tris-HCl, 150 mmol/l NaCl, and 0.1% Tween-20 (Tris-buffered saline with Tween [TBST]) with 5% nonfat dry milk, the membranes were incubated overnight at 4°C in TBST using 5% nonfat dry milk containing rabbit anti-PDX-1 (6), anti6 His antibody coupled to horseradish peroxidase (HRP) (1:5,000; Invitrogen), or mouse anti-actin antibody (1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA), and then for 1 h at room temperature in TBST with 5% nonfat dry milk containing anti-rabbit (PDX-1) or anti-mouse IgG (actin) antibody coupled to HRP (1:1,000; Bio-RAD).
Immunostaining.
Cells were fixed with 4% paraformaldehyde in PBS buffer. After blocking with donkey serum for 30 min at room temperature, cells were incubated overnight at 4°C with rabbit antiPDX-1 antiserum (6) (1:1,000 in PBS containing 1% BSA) and then for 1 h at room temperature with FITC-conjugated donkey anti-rabbit IgG (1:100; Jackson Immunochemicals, West Grove, PA).
Gel-mobility shift assay.
Nuclear extract (2 µg) was incubated with 2 µg poly (dI-dC), 10 mmol/l HEPES (pH 7.8), 0.1 mmol/l EDTA, 75 mmol/l KCl, 2.5 mmol/l MgCl2, and 1 mmol/l dithiothreitol, 3% Ficoll, at room temperature. The binding reaction was initiated by adding [32P]-labeled double-stranded oligonucleotide probes. A double-stranded oligonucleotide reproducing the rat insulin gene II PDX-1 binding region and surrounding sequences (ACGTCC TCTTAAGAC TCTAATTACCCTACG T) (Sigma Genosys) was used as a binding probe. In some of the binding assays, anti-PDX-1 (6), anti6 His, and preimmune antisera were added to the reaction mixture 1 h before addition of the DNA probes.
Gene transfection and luciferase assay.
Rat insulin II promoter-reporter (luciferase) plasmid (1.0 µg) containing 238-bp 5'-flanking sequences of the rat insulin II promoter region or A3-box mutated insulin II promoter-reporter plasmid (1.0 µg) (13,15) was transfected into cells with LipofectAMINE (Invitrogen) using the conditions recommended by the manufacturer. Forty-eight hours after transfection, cells were harvested and assayed (Promega, Madison, WI).
Isolation and culture of rat pancreatic islets and duct cells.
Islets and pancreatic ducts were isolated from pancreases of Sprague-Dawley rats (Taconic Farms, Germantown, NY). All animal procedures were approved by the Animal Care Committee of the Joslin Diabetes Center. For islet isolation, the common bile duct was cannulated and injected with 6 ml cold M199 medium containing 1.5 mg/ml collagenase (Roche Boehringer Mannheim, Indianapolis, IN). The islets were separated on Histopaque 1077 (Sigma, St. Louis, MO) density gradient, hand-picked under a dissecting microscope to ensure a pure islet preparation, and used immediately afterward. Common pancreatic ducts were isolated using a modified islet isolation method and were cultured in Dulbeccos modified Eagles medium/F12. After cells attached and spread, nonductal cells were removed mechanically with a rubber scrapper and the remaining ductal cells passaged; this was repeated four to five times. The ductal cells used in these experiments were from passages 79. In these experiments islets and ductal cells were cultured in RPMI medium with 10% FCS.
Semiquantitative radioactive multiplex PCR.
PCRs were performed in a Perkin-Elmer 9700 Thermocycler with 3 µl cDNA (20 ng RNA equivalents), 160 µmol/l cold dNTPs, 2.5 µCi [
-32P]dCTP (3,000 Ci/mmol), 10 pmol appropriate oligonucleotide primers, 1.5 mmol/l MgCl2, and 5 units AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, CT). The oligonucleotide primers and cycle number used for semiquantitative-radioactive multiplex PCR were insulin (forward) TCTTCTACACACCCATGTCCC, (reverse) GGTGCAGCACTGATCCAC, 15 cycles for islets, 28 cycles for duct cells; PDX-1 (forward) CGGACATCTCCCCATACG, (reverse) AAAGGGAGATGAACGCGG, 28 cycles; islet amyloid polypeptide (IAPP) (forward) CAACCCTCAGGTGGACAAAC, (reverse) CTCTGCCACATTCCTCTTCC, 35 cycles; glucokinase (GK): (forward) TGACAGAGCCAGGATGGAG, (reverse) TCTTCACGCTCCACTGCC, 35 cycles; Nkx6.1: (forward) TCTTCTGGCCTGGGGTGATG, (reverse) GGCTGCGTGCTTCTTTCTCCA, 35 cycles; Cyclophilin: (forward) AACCCCACCGTGTTCTTC, (reverse) TGCCTTCTTTCACCTTCCC, 28 cycles, and the primers for rRNA were purchased from AMBION (Austin, TX) (15 cycles). The thermal cycle profile used a 10-min denaturing step at 94°C followed by amplification cycles (1 min denaturation at 94°C, 1 min annealing at 55°C, and 1 min extension at 72°C) and an extension step of 10 min at 72°C. The steps taken to validate these measurements were previously reported (16).
 |
RESULTS
|
---|
Transduction of PDX-1 protein into cells.
To test whether purified PDX-1 protein with its native PTD sequence can be transduced into cells, cervix-derived HeLa, liver-derived HepG2, and ß-cell-derived MIN6 cells were treated with FITC-conjugated PDX-1 protein. Six hours after this treatment, PDX-1 was observed as a fluorescence signal in almost all of the HeLa (Fig. 1C), HepG2, and MIN6 cells (data not shown). To test whether the 16 amino acids of PDX-1 truly form a PTD, we compared the penetration of FITC-conjugated full-length PDX-1, PTD-deleted PDX-1 (mutant PDX-1), and the PTD peptide (PDX-1 PTD) (Fig. 1B). The peptide of the 16 amino acids similar to Antennapedia PTD transduced HeLa cells and was seen in the nuclei and cytoplasm in living cells, but PTD-deleted PDX-1 protein did not penetrate the cells (Fig. 1C). These data show that the 16 amino acids of PDX-1 form a functional PTD.
Effects of transduced PDX-1 on clonal cells.
To test the effectiveness and stability of the transduced PDX-1 protein, HepG2, HeLa, and MIN6 cells were treated with PDX-1 protein at several concentrations and for variable times. In MIN6 (Fig. 2A), HepG2 (Fig. 2B), and HeLa (Fig. 2C) cells, PDX-1 protein was transduced in a dose-dependent manner up to 1 µmol/l and was stable for at least 48 h. In treated MIN6 cells, the band for the transduced PDX-1 could be separated from the endogenous PDX-1 by running the gel for a longer time. Additionally, the transduced PDX-1 could be detected by using an antibody to the histidine tag included in this synthesized protein.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2. Western blotting on extracts of MIN6 (A), HepG2 (B), and HeLa (C) cells treated with PDX-1 protein. PDX-1 protein was transduced in a dose-dependent manner up to 1 µmol/l and was stable for at least 48 h in all three cell lines. In A, the transduced PDX-1 can be distinguished from the endogenous PDX-1 both by blotting with an antibody to the histidine tag (6His) and by the separation of bands by molecular weight (endogenous 46kDa, transduced 1 kDa larger). MIN6 cells without treatment served as positive controls; actin expression is used as a loading control. Each gel is representative of three independent experiments. D: Stability of purified proteins. PDX-1 and mutant PDX-1 proteins (100 nmol/l) were incubated at 37°C in culture medium for 48 h, and then Western blotting was performed. Both proteins were stable in culture medium for at least 48 h.
|
|
To test whether transduced PDX-1 protein binds to the insulin enhancer element, we used gel shift assays. Using nuclear extracts from PDX-1treated MIN6 cells there was increased A-box binding complex (Fig. 3B). Additionally, the A-box binding complex was observed in nuclear extracts from treated HeLa (Fig. 3A) and HepG2 cells (data not shown). Treatment with either mutant PDX-1 or EGFP-11R, which can be transduced into cells (Fig. 1C) (17), did not induce A-box complexes in the non-islet-derived cells nor increase them in MIN6 cells.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 3. Increase of PDX-1 binding activity by transduced PDX-1 protein. After treatment with 1 µmol/l PDX-1 protein for 24 h, nuclear extracts from MIN6 and HeLa cells were used in gel-shift assays. The A-box binding complex was observed in nuclear extracts from treated HeLa cells (A), and with increased intensity in nuclear extracts from treated MIN6 cells (B). Treatment with mutant PDX-1, which cannot enter the cells, and EGFP-11R protein, which can be transduced into cells, were used as controls. Anti-PDX-1, Anti-6 His antiserum, and preimmune serum were used to show specificity. This gel is representative of three independent experiments. Arrow shows the band of A-Box-PDX-1 complex.
|
|
To test whether transduced PDX-1 protein can activate insulin gene transcription, we examined its effect on insulin promoter activity using a luciferase assay. Insulin promoter activity was increased by treatment with PDX-1 protein in HepG2, MIN6, and HeLa cells (Fig. 4) but not with mutant PDX-1 or EGFP-11R protein. Mutated insulin promoter activity was not significantly changed by any treatments.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4. Increase of insulin promoter activity by transduced PDX-1 protein. Twenty-four hours after transient transfection of wild-type (A) or mutant (B) insulin promoter-luciferase plasmid, HepG2, HeLa, and MIN6 cells were treated with 100 nmol/l PDX-1 protein for 24 h; then luciferase activity was measured. Wild-type insulin promoter activity was significantly (P < 0.05) increased by treatment with PDX-1 protein in all three cell lines but not by treatment with mutant PDX-1 or EGFP-11R. Mutated insulin promoter activity was not significantly changed by any treatment. Data are expressed as mean ± SE with the basal insulin promoter activity being arbitrarily set at 1; the basal level activity in the HepG2 and HeLa is very low compared with that in the MIN6 (n = 4).
|
|
Together these results suggest that exogenous PDX-1 protein can be transduced into cells and their nuclei, bind to the A-box, and activate the insulin promoter.
Effect of PDX-1 on islets.
To examine whether exogenous PDX-1 protein can penetrate into primary islet cells, isolated islets from Sprague-Dawley rats were treated with PDX-1 protein. The FITC-conjugated PDX-1 was observed as a fluorescence signal in both nuclei and cytoplasm in islets (Fig. 5A), and PDX-1 was transduced in a dose-dependent manner up to 1 µmol/l and was stable for at least 48 h in islets (Fig. 5B) as shown in the cell lines. To test whether PDX-1 protein enhances insulin gene expression, islets were treated with PDX-1 protein for 3 days (protein added day 0 and day 3). The expression of insulin mRNA was enhanced by treatment with exogenous PDX-1 protein but not with the mutant PDX-1 nor EGFP-11R protein (Fig. 5C). These results show that exogenous PDX-1 protein can enhance insulin gene transcription in primary islets as well as in the MIN6 cell line.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 5. Effect of PDX-1 on islets. A. Isolated rat islets were treated with 1 µmol/l FITC-conjugated PDX-1 protein for 6 h. FITC-conjugated PDX-1 was transduced in islets. At higher magnification the PDX-1 was observed as a fluorescence signal in both nuclei and cytoplasm. B: Western blotting on extracts of islets treated with PDX-1 protein. PDX-1 protein was transduced in a dose-dependent manner up to 1 µmol/l and was stable for at least 48 h. Transduced PDX-1 can be distinguished from the endogenous PDX-1 by molecular weight differences seen in separated bands and by blotting with antibody to the histidine tag (6His). Results shown are representative of three independent experiments. Actin expression is used as a loading control. C: Insulin gene expression in islets treated with PDX-1 protein. PDX-1 protein (1 µmol/l) was added to islets with fresh media two times in 3 days (days 0 and 3), and 24 h after final treatment, RNA was extracted for semiquantitative RT-PCR examination of insulin mRNA. Mutant PDX-1 and EGFP-11R protein (1 µmol/l) were used as a control. Insulin mRNA expression was significantly enhanced by treatment with purified PDX-1 protein compared with treatment of mutant PDX-1 or EGFP-11R (P < 0.05). Data are expressed as insulin-to-rRNA ratio with that of the untreated islets arbitrarily set at 1 (n = 3).
|
|
Effect of PDX-1 on cultured pancreatic duct cells.
Since ductal cells can differentiate into islets in vitro (9) and in vivo (18), we examined whether exogenous PDX-1 protein could permeate into ductal cells. FITC-conjugated PDX-1 was clearly detected in nuclei and cytoplasm in treated ductal cells (Fig. 6A). Additionally, PDX-1 was clearly detected by immunostaining in nuclei in treated but not untreated ductal cells (Fig. 6A), and PDX-1 protein was transduced in a dose-dependent manner up to 1 µmol/l and was stable for at least 48 h (Fig. 6B).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 6. Effect of PDX-1 on cultured pancreatic duct cells. A: Passaged rat duct cells were treated with 1 µmol/l PDX-1 protein for 6 h. When FITC-conjugated PDX-1 was used, a fluorescence signal was observed in nuclei and cytoplasm of treated duct cells. When non-labeled PDX-1 was used, PDX-1 was clearly detected by immunohistochemical staining (IHC) in nuclei of treated duct cells but not of untreated. B. Western blotting on extracts of duct cells treated with PDX-1 protein. PDX-1 protein was transduced in a dose-dependent manner up to 1 µmol/l and was stable for at least 48 h in duct cells. The transduced PDX-1 runs slightly above the endogenous PDX-1 seen in the MIN6 control. Actin expression is used as a loading control. Data are representative of three independent experiments. C: Induction of insulin, PDX-1, IAPP, GK, and Nkx6.1 gene expression in duct cells treated with PDX-1 protein. Cultured duct cells were treated with 100 nmol/l PDX-1 protein three times in a week (days 0, 3, and 6); 24 h after final treatment, RNA was extracted for examination of insulin, PDX-1, IAPP, GK, and Nkx6.1 mRNA levels by RT-PCR. In duct cells treated with PDX-1 protein insulin, PDX-1, IAPP, GK, and Nkx6.1 mRNA were clearly detected. In contrast with native islets, the expression level in treated duct cells is low as seen in D.
|
|
To test whether purified PDX-1 protein could induce differentiation of ductal cells into insulin-producing cells, ductal cells were treated with PDX-1 protein for 1 week. Insulin mRNA was clearly detected in ducts treated with PDX-1 protein but not in untreated, mutant PDX-1-treated, or EGFP-11R-treated cells (Fig. 6C). We also examined PDX-1 mRNA levels in these cells since it has been reported that pdx-1 gene transcription is, at least in part, autoregulated by PDX-1 (14). As shown in Fig. 6C, under these RT-PCR conditions PDX-1 mRNA was not detected in untreated, mutant PDX-1-treated, or EGFP-11R-treated ductal cells but was clearly detected after PDX-1 treatment. IAPP, GK, and Nkx6.1 mRNA were also detected when a higher number of cycles (35 cycles) were used in the PCR in PDX-1-treated ductal cells but not in the untreated or mutant PDX-1- or EGFP-11R-treated cells (Fig. 6C). These results suggest that once some PDX-1 protein is transduced into ductal cells, endogenous pdx-1 gene transcription is amplified by this PDX-1 and may facilitate their differentiation to insulin-producing cells. Thus, purified PDX-1 protein could be a useful tool to trigger differentiation of progenitors/precursors to become insulin-producing cells.
 |
DISCUSSION
|
---|
PDX-1, also known as IDX-1/STF-1/IPF1, a homeodomain-containing transcription factor, plays a central role in regulating pancreatic development and insulin gene transcription (46,19,20). Furthermore, even in adults, PDX-1 is associated with islet neogenesis and differentiation of insulin-producing cells from progenitor cells (79). PDX-1 contains an Antennapedia-like homeodomain with only one amino acid substitution. We would expect that such sequence difference would not affect the function, since deletion of several NH2-terminal amino acids does not prevent the Antennapedia PTD from being transduced into cells (21). In fact, we have shown that the PTD of PDX-1 has the ability to drive PDX-1 protein into cells. The 16 amino acids of the PDX-1 PTD are extremely important in several other aspects of its function. This sequence includes both the nuclear localization signal of PDX-1 (the six amino acids RRMKWKK) that is necessary for its transport into the nucleus (22) and the KIWFQN motif that is particularly important in DNA binding (23).
Our study shows that PDX-1 protein has a native PTD and can without modification permeate into several cell types and enhance insulin expression in these cells. This finding of a transduced native protein that influences differentiation is unique. Our finding of a functional PTD in the transcription factor PDX-1 suggests that exogenous PDX-1 might be used as a novel approach for enhancing insulin gene transcription without requiring gene transfer technology.
 |
ACKNOWLEDGMENTS
|
---|
This research was supported by National Institutes of Health Grants DK61251 and DK44523; the Joslin DERC Animal, Media and Advanced Microscopy Cores (DK36836); the Diabetes Research and Wellness Foundation; and an important group of private donors. Hideaki Kaneto was a recipient of a fellowship and grant from the Japan Society for the Promotion of Science.
We thank Dr. Masayuki Matsushita and Dr. Masakiyo Sakaguchi (Okayama University) for valuable suggestions, Dr. Arun Sharma for helpful discussions, and Dr. Yoshitaka Kajimoto and Dr. Junichi Miyazaki (Osaka University) for kindly providing PDX-1 antibody and MIN6 cells, respectively.
Address correspondence and reprint requests to Dr. Susan Bonner-Weir, Section on Islet Transplantation and Cell Biology, Joslin Diabetes Center, One Joslin Place, Boston, MA 02215. E-mail: susan.bonner-weir{at}joslin.harvard.edu
Received for publication December 26, 2002
and accepted in revised form April 11, 2003
FITC, fluorescein isothiocyanate; GK, glucokinase; HRP, horseradish peroxidase; IAPP, islet amyloid polypeptide; PDX-1, pancreatic and duodenal homeobox factor-1; PTD, protein transduction domain; TBST, Tris-buffered saline with Tween
 |
REFERENCES
|
---|
- Schwarze SR, Ho A, Vocero-Akbani A, Dowdy SF: In vivo protein transduction: delivery of a biologically active protein into the mouse.
Science285
:1569
1572,1999[Abstract/Free Full Text]
- Elliott G, OHare P: Intercellular trafficking and protein delivery by a herpes virus structural protein.
Cell88
:223
233,1997[Medline]
- Prochiantz A: Messenger proteins: homeoproteins, TAT and others.
Curr Opin Cell Biol12
:400
406,2000[Medline]
- Jonsson J, Carlsson L, Edlund T, Edlund H: Insulin-promoter-factor 1 is required for pancreas development in mice.
Nature37
:606
609,1994
- Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BL, Wright CV: PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum.
Development122
:983
995,1996[Abstract/Free Full Text]
- Kaneto H, Miyagawa J, Kajimoto Y, Yamamoto K, Watada H, Umayahara Y, Hanafusa T, Matsuzawa Y, Yamasaki Y, Higashiyama S, Taniguchi N: Expression of heparin-binding epidermal growth factor-like growth factor during pancreas development: a potential role of PDX-1 in transcriptional activation.
J Biol Chem272
:29137
29143,1997[Abstract/Free Full Text]
- Kojima H, Nakamura T, Fujita Y, Kishi A, Fujimiya M, Yamada S, Kudo M, Nishio Y, Maegawa H, Haneda M, Yasuda H, Kojima I, Seno M, Wong NCW, Kikkawa R, Kashiwagi A: Combined expression of pancreatic duodenal homeobox 1 and islet factor 1 induces immature enterocytes to produce insulin.
Diabetes51
:1398
1408,2002[Abstract/Free Full Text]
- Ferber S, Halkin A, Cohen H, Ber I, Einav Y, Goldberg I, Barshack I, Seijffers R, Kopolovic J, Kaiser N, Karasik A: Pancreatic and duodenal homeobox gene 1 induces expression of insulin genes in liver and ameliorates streptozotocin-induced hyperglycemia.
Nat Med6
:568
572,2000[Medline]
- Bonner-Weir S, Taneja M, Weir GC, Tatarkiewicz K, Song KH, Sharma A, ONeil JJ: In vitro cultivation of human islets from expanded ductal tissue.
Proc Natl Acad Sci U S A97
:7999
8004,2000[Abstract/Free Full Text]
- Waeber G, Thompson N, Nicod P, Bonny C: Transcriptional activation of the GLUT2 gene by the IPF-1/STF-1/IDX-1 homeobox factor.
Mol Endocrinol10
:1327
1334,1996[Abstract]
- Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H: ß-cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the ß-cell phenotype and maturity onset diabetes.
Genes Dev12
:1763
1768,1998[Abstract/Free Full Text]
- German MS, Wang J: The insulin gene contains multiple transcriptional elements that respond to glucose.
Mol Cell Biol14
:4067
4075,1994[Abstract]
- Sharma A, Stein R: Glucose-induced transcription of the insulin gene is mediated by factors required for beta-cell-type-specific expression.
Mol Cell Biol14
:871
879,1994[Abstract]
- Marshak S, Benshushan E, Shoshkes M, Havin L, Cerasi E, Melloul D: Functional conservation of regulatory elements in the pdx-1 gene: PDX-1 and hepatocyte nuclear factor 3beta transcription factors mediate beta-cell-specific expression.
Mol Cell Biol20
:7583
7590,2000[Abstract/Free Full Text]
- Kaneto H, Sharma A, Suzuma K, Laybutt DR, Xu G, Bonner-Weir S, Weir GC: Induction of c-Myc expression suppresses insulin gene transcription by inhibiting NeuroD/BETA2-mediated transcriptional activation.
J Biol Chem277
:12998
13006,2002[Abstract/Free Full Text]
- Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes.
J Biol Chem274
:14112
14121,1999[Abstract/Free Full Text]
- Matsushita M, Tomizawa K, Moriwaki A, Li ST, Terada H, Matsui H: A high-efficiency protein transduction system demonstrating the role of PKA in long-lasting long-term potentiation.
J Neurosci21
:6000
6007,2001[Abstract/Free Full Text]
- Bonner-Weir S, Baxter LA, Schuppin GT, Smith FE: A second pathway for regeneration of adult exocrine and endocrine pancreas: a possible recapitulation of embryonic development.
Diabetes42
:1715
1720,1993[Abstract]
- Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR: Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells.
Mol Endocrinol7
:1275
1283,1993[Abstract]
- Miller CP, McGehee RE, Habener JF: IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene.
EMBO J13
:1145
1156,1994[Abstract]
- Fischer PM, Zhelev NZ, Wang S, Melville JE, Fahraeus R, Lane DP: Structure-activity relationship of truncated and substituted analogues of the intracellular delivery vector Penetratin.
J Pept Res55
:163
172,2000[Medline]
- Moede T, Leibiger B, Pour HG, Berggren P, Leibiger IB: Identification of a nuclear localization signal, RRMKWKK, in the homeodomain transcription factor PDX-1.
FEBS Lett461
:229
234,1999[Medline]
- Lu M, Miller C, Habener JF: Functional regions of the homeodomain protein IDX-1 required for transactivation of the rat somatostatin gene.
Endocrinology137
:2959
2967,1996[Abstract]