1 Institute of Neuroscience, University of Oregon, Eugene, OR 97403, USA
2 Biology Department, UMASS Amherst, MA 01002, USA
3 Department of Developmental Biology, Stanford University School of Medicine,
Stanford, CA 94305, USA
Author for correspondence (e-mail:
jpostle{at}uoneuro.uoregon.edu)
Accepted 22 December 2004
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Chondrogenesis, Craniofacial, Gene duplication, Genome duplication, Limb morphogenesis, Skeletogenesis, Subfunction partitioning
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The transcription factor Sox9 functions in the development of
crest, placodes, cartilage, and bone. Sox9 promotes crest-like
behaviors in neural plate cells and biases cells towards glial and melanocyte
fates (Cheung and Briscoe,
2003). Sox9 also helps determine crest-derived
chondrogenic lineages (Mori-Akiyama et
al., 2003
; Spokony et al.,
2002
; Yan et al.,
2002
), and it functions in morphogenesis and differentiation of
cartilage and bone (Bi et al.,
1999
; Bi et al.,
2001
; Yan et al.,
2002
; Zelzer and Olsen,
2003
). Despite these advances, the mechanisms by which
Sox9 acts in crest development are incompletely understood.
Sox9 also functions in placode development, including the otic
placode (Liu et al., 2003
;
Saint-Germain et al., 2004
),
and human patients with mutations in Sox9 sometimes lack olfactory
bulbs (Houston et al., 1983
).
Given its role in crest and placode development, elucidating the mechanisms of
Sox9 action could help us understand the origin of vertebrate
developmental innovations.
Our investigation of Sox9 function exploits a special situation in
teleost fish, the possession of two co-orthologs of tetrapod Sox9
(Chiang et al., 2001;
Cresko et al., 2003
;
Koopman et al., 2004
;
Li et al., 2002
). These
duplicated genes arose in an ancient genome duplication event that preceded
the teleost radiation (Amores et al.,
1998
; Koopman et al.,
2004
; Meyer and Schartl,
1999
; Postlethwait et al.,
1998
; Postlethwait et al.,
2000
; Postlethwait et al.,
2002
; Taylor et al.,
2003
; Vogel,
1998
; Wittbrodt et al.,
1998
). Although both genes still bind Sox9-binding
enhancer sequences in DNA (Bell et al.,
1997
; Chiang et al.,
2001
; Ng et al.,
1997
), gene expression studies suggest that ancestral
Sox9 gene subfunctions partitioned between the two duplicates,
leaving each with a subset of the original gene's functions
(Chiang et al., 2001
;
Cresko et al., 2003
;
Li et al., 2002
;
Liu et al., 2003
;
Yan et al., 2002
). This
behavior is predicted to be frequent in the evolution of duplicated genes
(Force et al., 1999
;
Hughes, 1994
;
Stoltzfus, 1999
). Subfunction
partitioning in teleosts may provide advantages for analysis
(Postlethwait et al., 2004
),
and haploinsufficiency of Sox9 mutations in mammals makes it
difficult to obtain homozygous embryos for investigation
(Bi et al., 2001
;
Mori-Akiyama et al., 2003
;
Sock et al., 2003
); but we
found that heterozygotes for mutations in zebrafish sox9 co-orthologs
are viable and produce homozygous mutant embryos.
To investigate the roles of Sox9 in the development of neural
crest and placodes, we conducted a genotype-driven screen for a mutation that
deletes sox9b activity. We studied the phenotype of sox9b
mutants, and compared them in single- and double-mutant combinations with
jellyfish (jefhi1134), a null mutation in
sox9a (Yan et al.,
2002). Results reveal distinct roles for sox9a and
sox9b in development of crest, otic placode, cartilage, and bone, and
illustrate how subfunction partitioning between teleost co-orthologs of human
genes can facilitate the analysis of conserved gene function. Finally, we
suggest that subfunction partitioning after duplications producing Sox8,
Sox9 and Sox10 may have facilitated the evolutionary origin of
neural crest and placodes.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Morpholino antisense oligonucleotides (MO) for sox9b (Gene Tools,
Philomath, OR) were: intron 2 splice donor junction (e2i2)
TGCAGTAATTTACCGGAGTGTTCTC, and intron 2 splice receptor junction (i2e3)
GCCCTGAGACTGACCTGCACACACA. A mixture of both MOs (1 ng each) was injected into
one-cell stage embryos. MOs for sox9a were as described
(Yan et al., 2002).
In situ hybridization was performed as described
(Jowett and Yan, 1996). Alcian
blue and Alizarin red stained cartilage and bone in fixed larvae as described
(Kimmel et al., 1998
;
Kimmel et al., 2003
). Confocal
imaging of live embryos and TUNEL assay was performed as described
(Crump et al., 2004
;
Gavrieli et al., 1992
).
The sox9bb971 mutation was made according to Fritz et
al. (Fritz et al., 1996).
Developing embryos were subjected to 150 to 300 rads of gamma radiation from a
cesium-137 source at 2 hpf (hours post fertilization). 126 G0 females were
squeezed to make G1 haploid embryos
(Streisinger et al., 1981
),
of which 12 from each female were screened by PCR for loss of the
sox9b 3' UTR using primers sox9b+1461 CTCTGCCCGCTCACATCCAATACTC
and sox9b-1695 AGCGCCAACTGCAGATTAGATTGAA. To control for sample loading, we
simultaneously amplified the 3'UTR of dlc (NM_130944) using
primers dlcF-GAGACTTGAAGACCCGAGGAAC and dlcR-AATAAAAGGCAAATACTCCACAG). From
one G0 female, six of twelve haploids lacked the sox9b but not the
dlc amplicon, and the mutation was inherited in Mendelian fashion.
Deficiency mapping was done by PCR on DNA of haploid embryos from carrier
females using Z-markers, gene-specific, and contig end-specific primers. To
identify b971 homozygotes, we amplified sox9b with
dlc as internal control, and jefhi1134
(sox9hi1134) heterozygotes were identified by PCR as
described (Yan et al.,
2002
).
To make mRNA for rescue and ectopic expression experiments, we inserted
sox9a and sox9b cDNA into pSP64T
(Chiang et al., 2001;
Krieg and Melton, 1984
). The
plasmid DNAs were linearized with BamH1, and were transcribed in
vitro with SP6 RNA polymerase using the SP6 mMESSAGE mMACHINE kit (Ambion).
For mRNA injections, 50 pg mRNA was injected into 1-4-cell stage zebrafish
embryos.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Pectoral fins and pharyngeal arches express both sox9 genes
(Chiang et al., 2001), but in
different domains. In the pectoral fin bud at 48 and 68 hpf
(Fig. 1G-J), precursors of the
scapulocoracoid express sox9a but not sox9b. In contrast,
the endochondral disc expresses sox9b at high levels, especially
distally, but expresses sox9a at lower levels. In the arches,
sox9a expresses at high levels in cartilage precursors deep in the
arch and at lower levels in a surrounding single cell layer, the perichondrium
(Fig. 1K,L), which later makes
osteoblasts and forms a bone collar around the cartilage
(Caplan and Pechak, 1987
). In
contrast, sox9b expresses in the ectoderm and endoderm of the
epithelial sheath that surrounds the sox9a- expressing perichondrium
and cartilage (Fig. 1M,N).
This analysis and earlier results
(Chiang et al., 2001;
Li et al., 2002
;
Liu et al., 2003
;
Yan et al., 2002
), show that
sox9a and sox9b transcripts accumulate in overlapping and
unique domains. Gene expression, however, does not equate to gene function.
The jef mutation destroys sox9a activity
(Yan et al., 2002
), but to
learn the role of sox9b, we mounted a genotype-driven screen.
b971 deletes sox9b
Using our previous strategy (Fritz et
al., 1996), we conducted a genotype-driven screen for mutation of
sox9b. Among 252 gamma ray-treated chromosomes, one lacked the
sox9b PCR amplification product. This mutation, called b971,
is inherited as a simple Mendelian recessive, and mapped to the lower end of
LG3 (data not shown), the site of sox9b
(Chiang et al., 2001
). Haploid
b971 embryos were screened by PCR for loci previously mapped near
sox9b (Barbazuk et al.,
2000
; Geisler et al.,
1999
; Hukriede et al.,
1999
; Knapik et al.,
1998
; Postlethwait et al.,
2000
; Postlethwait et al.,
1998
; Woods et al.,
2000
). Results showed that b971 is a terminal deletion
removing about 10 cM of the lower tip of LG3
(Fig. 2A). Embryos homozygous
for sox9bb971 do not contain sox9b transcript
(Fig. 2B,C), as expected for a
deletion. The mutation also deletes an EST for sox8 (fc23c10)
(Cresko et al., 2003
), but
because it is not expressed at least up to hatching (data not shown), it is
unlikely to affect the phenotype of b971 embryos. To control for
other ESTs deleted in b971, we treated wild types with sox9b
morpholinos as explained below. Note that the splice-directed MOs caused
sox9b transcript to accumulate in the nucleus rather than in the
cytoplasm (Fig. 2D,E), suggesting that it remained in an unspliced form, as observed previously for
sox9a (Yan et al.,
2002
), and confirming MO efficacy.
|
|
The neurocranium responds like the arches. Mutations in sox9a delete all neurocranial cartilages except a few unidentified nodules (Fig. 3P,Q). In contrast, in sox9bb971 mutants, the neurocranium, including rostral ethmoid plate, anterior basicranial commissure cartilages, posterior basicapsular commissures, and occipital arches, is merely reduced (Fig. 3R). Animals injected with sox9b MO show a similar phenotype (Fig. 3I,S). Double mutants lack all traces of the neurocranium (Fig. 3T).
The sox9 genes also have overlapping and distinct roles in the
pectoral fin. The wild-type pectoral appendage includes cleithrum (dermal
bone), scapulocoracoid (chondral bone), endochondral disc (or endoskeletal
disc), and dermally derived actinotrichia
(Grandel and Schulte-Merker,
1998) (Fig. 3U).
Lack of sox9a function deletes the scapulocoracoid, but not the
cleithrum, endochondral disc, or actinotrichia
(Fig. 3V). As with
sox9a, lack of sox9b leaves the cleithrum unchanged, but
also leaves the scapulocoracoid intact, while decreasing the size of the
endochondral disc and the number of actinotrichia, although those remaining
are of normal length (Fig. 3W).
Animals treated with sox9b MO have the same defect
(Fig. 3X), showing that this
mutant phenotype is due to lack of sox9b function. In the double
mutant, the scapulocoracoid, endochondral disc, and nearly all of the
actinotrichia disappear, leaving only the cleithrum
(Fig. 3Y). The phenotype of the
double mutant is more extreme than the sum of the phenotypes of the single
mutants: the endochondral disc and most actinotrichia are missing from the
double mutant.
Because fin bud development was substantially altered in sox9
mutants, we wondered whether the conserved genetic pathway that controls
appendage patterning (Capdevila and
Izpisua Belmonte, 2001;
Richardson et al., 2004
;
Tanaka et al., 2000
) was
intact in double mutants. We therefore examined the expression patterns of two
components, shh, which is expressed in the zone of polarizing
activity (Neumann et al.,
1999
), and dlx2a, which is expressed in the apical
ectodermal ridge (Akimenko et al.,
1994
). In the pectoral fin buds of 34 and 52 hpf embryos,
expression of both genes was highly similar in normal animals, single mutants,
and double sox9 mutants (Fig.
4). We conclude that sox9 activity, although essential
for the development of the cartilaginous components of the proximal fin bud,
is not required for the establishment of the main signaling centers in
appendage development.
|
|
|
sox9 mutations and pigment cell development
In addition to craniofacial cartilages, neural crest forms melanocytes,
xanthophores, and iridophores (Rawls et
al., 2001). A striking feature of sox9bb971
homozygotes and double mutants is the presence of melanocytes with dispersed
melanosomes even in the light (Fig.
3C; Fig. 7A,C,D).
To learn whether sox9bb971 affects melanocyte development,
we examined expression of dopachrome tautomerase (dct), an enzyme of
melanin biosynthesis (Kelsh et al.,
2000
), and found that the number, size, and distribution of
dct-expressing cells was normal in sox9bb971
animals (Fig. 7E-H). This
suggests that the melanocyte phenotype may be a function of cell physiology
rather than development. Xanthophores appeared normal in
sox9bb971 animals, as did the distribution of cells
expressing xanthine dehydrogenase mRNA (data not shown). Dark field microscopy
showed that sox9ahi1134 mutants have the normal number and
distribution of iridophores (Fig.
7I,J), but sox9bb971 and double mutants had
reduced populations of iridophores (Fig.
7K,L). Melanocyte and iridophore phenotypes were like
sox9bb971 mutants in animals injected with
sox9b-MO (Fig. 7C,K;
data not shown). We conclude that sox9b is essential for normal
development of iridophores and for the distribution of melanosomes within
melanocytes.
|
What is the position of sox9 in the hierarchy of crest gene expression?
Our in situ hybridization experiments
(Fig. 1B) showed that
sox9b is expressed at high levels in premigratory neural crest about
as early as other early crest markers such as foxd3 (formerly
fkd6) (Odenthal and
Nusslein-Volhard, 1998), snai1b (formerly
snail2) (Thisse et al.,
1995
), and tfap2a (formerly AP2alpha)
(Barrallo-Gimeno et al., 2004
;
Knight et al., 2003
;
Knight et al., 2004
;
O'Brien et al., 2004
). Double
in situ hybridization experiments with sox9b and either
foxd3 or snai1b showed that these three genes are expressed
in largely overlapping cell populations in this domain (data not shown).
Results showed that at the three-somite stage, sox9ahi1134 embryos express snai1b nearly normally (Fig. 8A,B), but sox9bb971 embryos have a substantially smaller snai1b expression domain (Fig. 8C). The same results were obtained with foxd3 and sox10 (data not shown). We used three different combinations of mutations and MOs to generate animals lacking activity of both sox9a and sox9b (sox9bb971;sox9a-MO and sox9b-MO;sox9ahi1134, and sox9bb971;sox9ahi1134 double mutants). All combinations showed greatly reduced expression of snai1b (Fig. 8D shows only the double mutant, and results with foxd3 and sox10 expression were similar to snail1b at the three-somite stage, data not shown). We conclude that sox9b function is required for full development of the snai1b-, foxd3- and sox10-expressing neural crest subpopulation in three-somite stage embryos.
|
To learn whether sox9 genes play a role in migrating neural crest,
we examined dlx2a, which is expressed in a subset of premigratory,
and postmigratory crest that forms pharyngeal arches
(Akimenko et al., 1994;
Kelsh and Raible, 2002
;
Miller et al., 2000
). Results
showed that dlx2a-expressing cells were unaffected in
sox9ahi1134 embryos
(Fig. 8E,F), even though
sox9a and dlx2a are expressed in very similar domains. In
contrast, the dlx2a-expression domain was somewhat smaller in
sox9bb971 embryos and double mutants
(Fig. 8G,H). This shows that
sox9 function is not essential for cranial crest migration in
zebrafish, but that sox9b may help determine the size of the
dlx2-expressing cell population.
To discover the effect of sox9 on chondrocyte differentiation, we
investigated col2a1 (Yan et al.,
1995), which encodes a major collagen of cartilage. Embryos
homozygous for sox9ahi1134 or wild-type embryos injected
with sox9a MO (data not shown) had, by 68 hpf, little expression in
the pharyngeal arches, otic vesicle, and eye capsule
(Fig. 8I,J). In contrast,
sox9bb971 homozygotes
(Fig. 8K) or wild-type embryos
injected with sox9b MO (data not shown) had much smaller
col2a1 expression domains in the arches. In the pectoral fin, sox9a
mutants lacked col2a1 expression in the scapulocoracoid and had
reduced expression in the endochondral disc, whereas sox9b mutants had a
smaller col2a1 domain in the endochondral disc but a normal
scapulocoracoid domain. In the double mutant
(Fig. 8L) and in
sox9ahi1134 embryos injected with sox9b MO (data
not shown), col2a1 expression was greatly reduced in the arches and
ear, was absent from the scapulocoracoid region, and was reduced in the
endochondral disc. We conclude that sox9a and sox9b are
required either for the expression of col2a1 in overlapping sets of
cartilaginous cells, or for the survival and/or proliferation of cells that
normally express col2a1.
Colorless (sox10) is expressed early in most premigratory
neural crest, a subpopulation of trunk crest cells migrating in the medial
pathway (Dutton et al., 2001),
and in craniofacial ectomesenchyme (Kelsh
and Raible, 2002
). Expression of sox10 was nearly normal
in trunk crest of homozygous sox9ahi1134 embryos
(Fig. 8M,N,Q,R). In homozygous
sox9bb971 (Fig.
8O,S), however, and in animals abrogated for function of both
sox9 co-orthologs (double mutants
(Fig. 8P,T); sox9bb971;sox9a-MO, and
sox9b-MO;sox9ahi1134 (data not shown)), the
extent of the sox10 expression domain in the trunk was reduced, and
sox10-expressing cells did not migrate as far ventrally as normal.
Results for crestin (Luo et al.,
2001
; Rubinstein et al.,
2000
) were similar (data not shown). We conclude that
sox9b and to a lesser extent, sox9a, is required for full
development of sox10- and crestin-expressing neural crest.
To complement these loss-of-function experiments, we conducted
gain-of-function experiments to investigate regulatory interactions among
early crest genes. In wild-type embryos injected with sox9a or
sox9b mRNAs, the injected mRNA was mosaically distributed in a
portion of each embryo (compare Fig. 9A and
B, and Fig. 9D and
F). Injection of sox9a mRNA caused ectopic expression of
sox9b (Fig. 9E), and
vice versa (Fig. 9C). This
suggests that sox9a and sox9b have a mutually positive
regulatory influence on each other, confirming our earlier results for ear
development (Liu et al., 2003;
Hans et al., 2004
). Injection
of sox9 mRNAs into zebrafish early cleavage stage embryos showed that
both sox9a and sox9b caused ectopic expression or rostral
extension of the expression domains for foxd3, sox10 and
snai1b (Fig. 9 G-O).
We conclude that foxd3, sox10 and snai1b can be upregulated
by sox9 genes in crest development, consistent with the results from
the loss-of-function experiments.
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The discovery of a genome duplication in zebrafish ancestry
(Amores et al., 1998;
Postlethwait et al., 1998
),
and the revelation that it may have occurred before the teleost radiation
(Amores et al., 1998
;
Koopman et al., 2004
;
Meyer and Schartl, 1999
;
Postlethwait et al., 1998
;
Postlethwait et al., 2000
;
Postlethwait et al., 2002
;
Taylor et al., 2003
;
Vogel, 1998
;
Wittbrodt et al., 1998
)
provides opportunities to learn how developmental pathways evolve after all
genes of the pathway are duplicated. In the parallel model, duplicated genes
sort into two parallel but non-interacting pathways, for example different
duplicates act exclusively in different cell types. Under the network model, a
reticulated pathway of regulation would interweave the functions of gene
duplicates at several levels of the pathway.
In mammals, Bmp2, Msx2, Sox9, Col2a1, Runx2 and Col1a1
interact in the developmental pathway leading from neural crest to cartilage
and bone (Healy et al., 1999;
Mori-Akiyama et al., 2003
;
Takahashi et al., 2001
).
Zebrafish has duplicate copies of these six genes
(Chiang et al., 2001
;
Ekker et al., 1997
;
Fisher et al., 2003
;
Flores et al., 2004
;
Martinez-Barbera et al., 1997
;
Postlethwait, 2004
;
Yan, et al., 1995
;
Yan et al., 2002
), and we
have begun to investigate their regulatory interactions to test the parallel
and network models for the evolution of developmental pathways after genome
duplication. In experiments reported here, we made null-activity animals for
one of the two sox9 co-orthologs, and compared them to mutants for
the other sox9 co-ortholog. The network model appears to receive
initial support because Sox9 co-orthologs perform redundant functions
in development of the ear, endochondral disc, and pharyngeal arches.
Sox9 expression patterns and subfunction partitioning
Our side-by-side comparison of sox9a and sox9b expression
patterns extends earlier reports (Chiang
et al., 2001; Li et al.,
2002
; Liu et al.,
2003
; Yan, et al.,
2002
), and shows that even when sox9a and sox9b
are expressed in the same organs, the precise cell type or timing can be
different. For example, in the pectoral appendage, sox9a is expressed
at high levels in the girdle and at low levels in the endochondral disc, while
reciprocally, sox9b is not expressed in the girdle but is expressed
at high levels in the endochondral disc. In mouse, Sox9 is expressed
in both the limb girdle and the endochondral elements of the forelimb
(Wright et al., 1995
),
suggesting that evolution has divided up ancestral roles of Sox9
between zebrafish co-orthologs. Likewise, sox9a and sox9b
are both expressed in the arches, but we show here that these are in different
cell types, either the central mesenchyme and perichondrium, or the
surrounding epithelial sheath. Embryos express sox9b at high levels
in the early neural crest in both the head and trunk as in tetrapod embryos,
but they express sox9a at much lower levels than sox9b in
that domain. In contrast, zebrafish embryos express sox9a at high
levels in the somites as in tetrapods
(Healy et al., 1999
;
Peters et al., 1999
), but
sox9b is not expressed in this domain. Together, these data show that
the expression patterns of sox9a and sox9b tend to sum to
the expression pattern in the mouse.
Parsimony suggests that expression domains shared by tetrapod and teleost
Sox9 genes probably existed 450 million years ago in their last
common ancestor. This supports the conclusion that specific independent
regulatory elements were driving those expression domains in the last common
ancestor of fish and tetrapods, and that those elements became partitioned
between the two zebrafish genes over time
(Force et al., 1999;
Hughes, 1994
;
Postlethwait et al., 2004
;
Stoltzfus, 1999
). Comparative
sequence analysis can identify candidates for such regulatory elements. For
example, five regions of non-coding sequence conserved with human and mouse
have been identified flanking fugu Sox9a
(Bagheri-Fam et al., 2001
;
Koopman et al., 2004
), and
these are candidates for regulatory elements driving expression in the limb
and vertebral column (Wunderle et al.,
1998
). The subfunction partitioning model would predict that
sox9a and sox9b in zebrafish would have different conserved
sequences, and that comparative analysis would reveal candidates for these
elements. Partitioned conserved non-coding sequences have already been
identified for some zebrafish duplicates of mammalian genes
(Postlethwait et al., 2004
).
Morpholino knockdown experiments for zebrafish duplicates of human
HOXB1 have shown that the two fish duplicated genes have distinct and
partially redundant functions, and study of conserved non-coding sequences has
shown that the co-orthologs have suffered complementary degenerative mutations
(McClintock et al., 2002
).
The b971 mutation deletes sox9b
Our reverse genetics mutation screen identified a terminal chromosome
deletion that removed sox9b and surrounding loci. We analyzed all
known loci in this region
(http://zfin.org/cgi-bin/mapper_select.cgi)
for those that might play a role in the phenotype, and only sox8
(Cresko et al., 2003) is an
obvious candidate for crest development
(Cheung and Briscoe, 2003
).
Because sox8 is not expressed in neural crest derivatives in
wild-type zebrafish embryos, and homozygous Sox8 knockout mice
survive with no abnormalities in neural crest derivatives
(Sock et al., 2001
), we
conclude that sox8 does not contribute to the phenotypes we
observe.
To further test whether the sox9bb971 phenotype is due to lack of sox9b, we increased wild-type sox9b activity in mutants and decreased sox9b activity in wild types. Splice-blocking sox9b MOs phenocopied each aspect of the sox9bb971 phenotype, as expected if sox9b loss is responsible for the phenotypes we observed. Reciprocally, mRNA injections mosaically rescued Alcian blue-stained cartilage in sox9bb971 mutants, despite the late phenotype, which gives ample opportunity for mRNA dilution and degradation. These tests confirmed that the effects we observed are due to the lack of sox9b rather than adjacent loci.
The role of sox9 genes in the genetic hierarchy of neural crest development
According to a recent model, neural folds originate at a threshold level of
a BMP gradient and form neural crest due to Wnt, FGF, and retinoic acid
signals (Aybar et al., 2002;
Lewis et al., 2004
;
Tribulo et al., 2003
). Early
cranial crest expresses sox9b, snai1b
(Thisse et al., 1995
),
foxd3 (Odenthal and
Nusslein-Volhard, 1998
) and tfap2a
(Barrallo-Gimeno et al., 2004
;
Knight et al., 2003
;
Knight et al., 2004
;
Luo et al., 2003
;
O'Brien et al., 2004
)
(http://zfin.org).
Tfap2a may respond directly to crest-inducing signals in
Xenopus (Luo et al.,
2003
). Expression of sox9b in premigratory neural crest
is normal in zebrafish tfap2a mutants
(Knight et al., 2003
), showing
that tfap2a does not regulate the induction of sox9b
expression. Reciprocally, we found that tfap2a expression in
premigratory crest is normal sox9bb971 mutants, as it is
in mouse (Mori-Akiyama et al.,
2003
); thus, sox9b does not induce tfap2a.
Because neither of these genes induces the other, each must respond
independently to the diffusible signals that specify neural crest, or each
gene is controlled by different factors in parallel pathways. After cranial
crest begins to migrate, expression domains of sox9a and
sox9b decrease in tfap2a mutants
(Barrallo-Gimeno et al., 2004
;
Knight et al., 2004
). This
shows that tfap2a is required to establish the full range of
sox9a- and sox9b-expressing cells.
In tetrapods, Snail is expressed in about the same temporal and
spatial pattern as Sox9 and is the earliest known gene expressed in
Xenopus neural crest (Essex et
al., 1993; Spokony et al.,
2002
). Zebrafish has two co-orthologs of Snail, called
snai1a and snai1b (formerly sna2), as well as
snai2 (formerly slug)
(Locascio et al., 2002
), but
only snai1b is expressed at high levels in premigratory neural crest
(Locascio et al., 2002
;
Thisse et al., 1993
;
Thisse et al., 1995
). Because
the snai1b expression domain in premigratory crest was reduced in
zebrafish embryos lacking sox9b function, we conclude that
sox9b, but not sox9a, is required for full development of
the snai1b-expressing neural crest population. In Sox9
MO-treated Xenopus embryos
(Spokony et al., 2002
),
Snail expression is also diminished, suggesting that the dependence
of Snail on Sox9 activity may be general among
vertebrates.
To learn whether sox9 plays a role in migrating neural crest, we
examined the expression of dlx2a, which is expressed in a subset of
premigratory, migratory, and postmigratory crest that forms the pharyngeal
arches (Akimenko et al., 1994;
Kelsh and Raible, 2002
;
Miller et al., 2000
). The
dlx2a-expression domain was smaller in sox9b, but not
sox9a mutants, showing that sox9 activity is not required
for cranial crest migration, but that sox9b function is essential to
establish the full size of the dlx2-expressing cell population.
sox10 is expressed in most premigratory neural crest in a
subpopulation of trunk crest cells that migrates in the medial pathway
(Dutton et al., 2001) and in
postmigratory craniofacial precursors
(Kelsh and Raible, 2002
).
Likewise, crestin is expressed in premigratory and migratory neural
crest, overlapping the initial sox10 and sox9b expression
pattern (Li et al., 2002
;
Luo et al., 2001
;
Rubinstein et al., 2000
).
Activity of sox9b, but not sox9a, was necessary for full
ventral migration of sox10- and crestin-expressing cells in
the trunk and tail, but apparently not in the head.
These experiments, taken with results from tetrapods
(Cheung and Briscoe, 2003;
Mori-Akiyama et al., 2003
;
Spokony et al., 2002
), show
that Sox9 activity is essential for the establishment of the
chondrogenic crest in vertebrates generally. On the other hand, among pigment
cells, sox9 appears to act only in iridophore development. Although
melanocytes appeared enlarged in sox9b mutants, melanocyte precursors
were normal. The melanocyte phenotype may be due to defective eyes in
sox9 mutants because blind fish secrete more alpha-melanocyte
stimulating hormone, which causes them to become more darkly pigmented than
normal fish (Rodrigues and Sumpter,
1984
).
The roles of zebrafish sox9 genes in skeletogenesis
In mammals, Sox9 protein binds to a chondrocyte-specific enhancer in an
intron of Col2a1, and stimulates its transcription
(Bell et al., 1997;
Lefebvre et al., 1997
;
Ng et al., 1997
;
Zhou et al., 1998
). Zebrafish
col2a1 is co-expressed in several domains with sox9a and
sox9b. Reduction of col2a1 expression in mutants correlated
well with the sox9 co-ortholog predominantly expressed in each
domain. In regions where the sox9 duplicates were co-expressed,
double mutants summed the effect of the two homozygous mutations on
col2a1 expression. This indicates that sox9a and
sox9b act in the differentiation of chondrocytes in similar ways in
overlapping sets of cartilaginous cells.
In the pectoral fin, sox9 co-orthologs have additive and exclusive
roles. The scapulocoracoid, a chondral bone, expresses sox9a at high
levels, and the sox9a mutant lacks this skeletal element. Likewise,
human campomelic dysplasia patients are SOX9 heterozygotes and have
hypoplastic scapulae (Houston et al.,
1983; Mortier et al.,
1997
). In contrast, sox9b is not expressed in the
scapulocoracoid, and this element is nearly normal in the sox9b
mutant. The fin's endochondral disc is nearly normal in sox9a
mutants, but the distal portion is greatly reduced in sox9b mutants,
again reflecting gene expression patterns. In the proximal portion of the
endochondral disc, the two sox9 orthologs play additive roles because
the double mutant lacks this cartilage. Double mutants retain Alcian staining
in the anlage of the cleithrum, a dermal bone.
Zebrafish sox9 co-orthologs play different roles in chondrocyte
morphogenesis and survival. By imaging live developing embryos, we confirmed
that sox9a does not regulate prechondrocyte cell number or
condensation (a role of Sox9 in mouse)
(Bi et al., 2001)), but does
control the stacking of chondrocytes in orderly cell rows
(Yan et al., 2002
). On the
other hand, sox9b does not control stacking, but is necessary for
pharyngeal cartilages to acquire their normal cell number, either by
suppressing cell death or increasing cell proliferation. Although chondrocytes
stack in sox9b mutants, individual pharyngeal cartilage organs are
not well shaped, showing that sox9b activity is important for fine
aspects of cartilage patterning.
Analysis of zebrafish mutants showed that sox9a and sox9b play different roles in development of the bony skeleton. The sox9a gene is expressed in the mesenchyme and perichondrium of branchial arches, while sox9b is expressed in the epithelium that surrounds each arch, and is required for the differentiation of these cartilages into bone. This suggests that a sox9b-dependent signal emanating from the pharyngeal pouch epithelium may trigger the sox9a-expressing perichondrium to differentiate into osteoblasts and form bone.
Runx2 encodes a transcription factor expressed in pre-hypertrophic
and hypertrophic chondrocytes and osteoblasts
(Takeda et al., 2001), and it
promotes chondrocyte maturation and osteoblast differentiation
(Inada et al., 1999
;
Komori et al., 1997
;
Otto et al., 1997
). Expression
of runx2b was normal in sox9a mutants, but was severely
reduced in the arches of sox9b mutants, suggesting that
sox9b exerts its effect on bone formation by supporting
runx2b expression. This suggests that sox9b in the arch
epithelium, but not sox9a in the central chondrocytes, is required
for runx2b expression in the periochondrium, which in turn is
necessary for the perichondrium to differentiate into osteocytes and finally
bone. Only a portion of two dermal bones, the opercle in the craniofacial
skeleton and the cleithrum in the pectoral girdle, are largely independent of
sox9 activity.
Chimeric mice bearing Sox9-deficient cells also show interactions
of Runx2 and Sox9. Depleting Sox9 in the nasal
region causes an expansion of the Runx2 expression domain, suggesting
that Sox9 negatively regulates Runx2 in these cells
(Mori-Akiyama et al., 2003).
In contrast, Sox9-deficient mouse limb buds lack Runx2
expression, suggesting that Sox9 positively regulates Runx2
in limb buds. Sox9 may positively regulate Runx2 in cases in
which Sox9-deficient cells fail to complete chondrocyte
differentiation and become osteoblasts
(Mori-Akiyama et al., 2003
).
In other situations, lack of Sox9 activity may block cells from later
steps necessary for bone formation. Reciprocally, Sox9 expression is
expanded in mouse tissue culture cells lacking Runx2 and in the limbs
of Runx2 mouse mutants, showing that Runx2 is a negative
regulator of Sox9 (Stock et al.,
2004
; Yoshida et al.,
2002
). While Runx2 is expressed in the perichondrium in
mouse (Bronckers et al.,
2003
), Sox9 is not
(Smits et al., 2001
),
demonstrating that in this tissue, Sox9 cannot be a direct
transcription factor for Runx2. Subfunction partitioning between the
two recently described Runx2 co-orthologs in zebrafish
(Flores et al., 2004
) may
facilitate analysis of these problems.
Null mutations in genes that are essential at several developmental stages
(pleiotropy) will block development at the earliest essential subfunction,
which can obscure later gene roles. In some cases, conserved temporal
subfunctions have partitioned between teleost duplicates. For example mouse
Nodal mutants are blocked in gastrulation
(Conlon et al., 1994;
Varlet et al., 1997
), masking
later gene functions. Zebrafish has two Nodal genes
(Blader and Strähle,
1998
; Dougan et al.,
2003
; Feldman et al.,
1998
; Rebagliati et al.,
1998
; Sampath et al.,
1998
), and mutant analysis reveals both early and late functions.
Likewise, in Xenopus Sox9 knockdown embryos, a role for Sox9
in chondrocyte stacking was obscured because early Sox9 function
(which in zebrafish partitions to sox9b) is required for the
formation of the cells that stack
(Spokony et al., 2002
). Thus,
subfunction partitioning in zebrafish permitted ready identification of late
gene functions obscured in tetrapods by early gene functions and by
haploinsufficiency.
Subfunction partitioning, sox9 and sox10
sox8, sox9 and sox10 belong to the SoxE gene family and
are expressed in overlapping domains in neural crest, heart, limb buds, glia,
and gonads (Bell et al., 2000;
Bowles et al., 2000
;
Cheng et al., 2001
;
Chimal-Monroy et al., 2003
;
Schepers et al., 2000
;
Sock et al., 2001
).
Premigratory crest expresses both Sox9 and Sox10, but
Sox9 is required for ectomesenchymal crest, and Sox10 for
non-ectomesenchymal crest (Akiyama et al.,
2002
; Dutton et al.,
2001
). We propose that an ancestral non-vertebrate chordate
possessed a single Sox9/10 gene that was expressed in cells at the
neural plate border and was essential for specifying pigment cells,
mesenchyme, glia, and some neurons (see
Jeffery et al., 2004
). After
gene duplication prior to the divergence of zebrafish and human lineages
(Bowles et al., 2000
;
Chiang et al., 2001
;
Dutton et al., 2001
;
Li et al., 2002
), subfunction
partitioning (Force et al.,
1999
) may have resulted in ectomesenchymal functions largely
partitioning to Sox9, and non-ectomesenchymal functions mainly
segregating to Sox10, but with some overlap due to the retention of a
few ancestral subfunctions by both genes. This proposed process is analogous
to subfunction partitioning between the zebrafish sox9 duplicates
documented here. Because the advent of neural crest is a key to the evolution
of vertebrates, the duplication of SoxE and subfunction partitioning
among its descendent genes may have been a crucial step in vertebrate origins.
This hypothesis makes specific predictions about the roles of SoxE in
the development of non-vertebrate chordates that have yet to be tested.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
Footnotes |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Akimenko, M.-A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to Distal-less: part of a homeobox gene code for the head. J. Neurosci. 14,3475 -3486.[Abstract]
Akiyama, H., Chaboissier, M. C., Martin, J. F., Schedl, A. and
de Crombrugghe, B. (2002). The transcription factor Sox9 has
essential roles in successive steps of the chondrocyte differentiation pathway
and is required for expression of Sox5 and Sox6. Genes
Dev. 16,2813
-2828.
Amores, A., Force, A., Yan, Y.-L., Joly, L., Amemiya, C., Fritz,
A., Ho, R. K., Langeland, J., Prince, V., Wang, Y.-L. et al.
(1998). Zebrafish hox clusters and vertebrate genome
evolution. Science 282,1711
-1714.
Aybar, M. J., Glavic, A. and Mayor, R. (2002). Extracellular signals, cell interactions and transcription factors involved in the induction of the neural crest cells. Biol. Res. 35,267 -275.[Medline]
Bagheri-Fam, S., Ferraz, C., Daemaille, J., Scherer, G. and Pfeifer, D. (2001). Comparative genomics of the SOX9 region in human and Fugu rubripes: conservation of short regulatory sequence elements within large intergenic regions. Genomics 78, 73-82.[CrossRef][Medline]
Barbazuk, W. B., Korf, I., Kadavi, C., Heyen, J., Tate, S., Wun,
E., Bedell, J. A., McPherson, J. D. and Johnson, S. L.
(2000). The syntenic relationship of the zebrafish and human
genomes. Genome Res. 10,1351
-1358.
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E.
W. (2004). Neural crest survival and differentiation in
zebrafish depends on mont blanc/tfap2a gene function.
Development 131,1463
-1477.
Bassham, S. and Postlethwait, J. (2000). Brachyury (T) expression in embryos of a larvacean urochordate, Oikopleura dioica and the ancestral role of brachyury. Dev. Biol. 220,322 -333.[CrossRef][Medline]
Begbie, J. and Graham, A. (2001). The ectodermal placodes: a dysfunctional family. Phil. Trans. R. Soc. Lond. B. 356,1655 -1660.[CrossRef][Medline]
Bell, D. M., Leung, K. K., Wheatley, S. C., Ng, L.-J., Zhou, S., Ling, K. W., Sham, M. H., Koopman, P., Tam, P. P. L. and Cheah, K. S. E. (1997). SOX9 directly regulates the type-II collagen gene. Nat. Genet. 16,174 -178.[Medline]
Bell, K. M., Western, P. S. and Sinclair, A. H. (2000). SOX8 expression during chick embryogenesis. Mech. Dev. 94,257 -260.[CrossRef][Medline]
Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R. and de Crombrugghe, B. (1999). Sox9 is required for cartilage formation. Nat. Genet. 22, 85-89.[CrossRef][Medline]
Bi, W., Huang, W., Whitworth, D. J., Deng, J. M., Zhang, Z.,
Behringer, R. R. and de Crombrugghe, B. (2001).
Haploinsufficiency of Sox9 results in defective cartilage primordia
and premature skeletal mineralization. Proc. Natl. Acad. Sci.
USA 98,6698
-6703.
Blader, P. and Strähle, U. (1998). Developmental biology: casting an eye over cyclopia. Nature 395,112 -113.[CrossRef][Medline]
Bowles, J., Schepers, G. and Koopman, P. (2000). Phylogeny of the SOX family of developmental transcription factors based on sequence and structural indicators. Dev. Biol. 227,239 -255.[CrossRef][Medline]
Bronckers, A. L., Sasaguri, K. and Engelse, M. A. (2003). Transcription and immunolocalization of Runx2/Cbfa1/Pebp2alphaA in developing rodent and human craniofacial tissues: further evidence suggesting osteoclasts phagocytose osteocytes. Microsc. Res. Tech. 61,540 -548.[CrossRef][Medline]
Capdevila, J. and Izpisua Belmonte, J. C. (2001). Patterning mechanisms controlling vertebrate limb development. Annu. Rev. Cell Dev. Biol. 17, 87-132.[CrossRef][Medline]
Caplan, A. I. and Pechak, D. G. (1987). The cellular and molecular embryology of bone formation. In Bone and Mineral Research (ed. W. A. Peck), pp.117 -183. New York: Elsevier.
Cheng, Y. C., Lee, C. J., Badge, R. M., Orme, A. T. and Scotting, P. J. (2001). Sox8 gene expression identifies immature glial cells in developing cerebellum and cerebellar tumours. Brain Res. Mol. Brain Res. 92,193 -200.[Medline]
Cheung, M. and Briscoe, J. (2003). Neural crest
development is regulated by the transcription factor Sox9.
Development 130,5681
-5693.
Chiang, E. F., Pai, C. I., Wyatt, M., Yan, Y. L., Postlethwait, J. and Chung, B. (2001). Two sox9 genes on duplicated zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev. Biol. 231,149 -163.[CrossRef][Medline]
Chimal-Monroy, J., Rodriguez-Leon, J., Montero, J. A., Ganan, Y., Macias, D., Merino, R. and Hurle, J. M. (2003). Analysis of the molecular cascade responsible for mesodermal limb chondrogenesis: Sox genes and BMP signaling. Dev. Biol. 257,292 -301.[CrossRef][Medline]
Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert,
A., Herrmann, B. and Robertson, E. J. (1994). A primary
requirement for nodal in the formation and maintenance of the primitive streak
in the mouse. Development
120,1919
-1928.
Cresko, W. A., Yan, Y. L., Baltrus, D. A., Amores, A., Singer, A., Rodriguez-Mari, A. and Postlethwait, J. H. (2003). Genome duplication, subfunction partitioning, and lineage divergence: Sox9 in stickleback and zebrafish. Dev. Dyn. 228,480 -489.[CrossRef][Medline]
Crump, J. G., Swartz, M. E. and Kimmel, C. B. (2004). An integrin-dependent role of pouch endoderm in hyoid cartilage development. PLoS Biol. 2, E244.[Medline]
Dougan, S. T., Warga, R. M., Kane, D. A., Schier, A. F. and
Talbot, W. S. (2003). The role of the zebrafish nodal-related
genes squint and cyclops in patterning of mesendoderm.
Development 130,1837
-1851.
Dutton, K. A., Pauliny, A., Lopes, S. S., Elworthy, S., Carney,
T. J., Rauch, J., Geisler, R., Haffter, P. and Kelsh, R. N.
(2001). Zebrafish colourless encodes sox10 and
specifies non-ectomesenchymal neural crest fates.
Development 128,4113
-4125.
Eisen, J. S. and Weston, J. A. (1993). Development of the neural crest in the zebrafish. Dev. Biol. 159,50 -59.[CrossRef][Medline]
Ekker, M. (1999). Saving zebrafish mutants. BioEssays 21,94 -98.[Medline]
Ekker, M., Akimenko, M., Allende, M., Smith, R., Drouin, G., Langille, R., Weinberg, E. and Westerfield, M. (1997). Relationships among msx gene structure and function in zebrafish and other vertebrates. Mol. Biol. Evol. 14,1008 -1022.[Abstract]
Essex, L. J., Mayor, R. and Sargent, M. G. (1993). Expression of Xenopus snail in mesoderm and prospective neural fold ectoderm. Dev. Dyn. 198,108 -122.[Medline]
Feldman, B., Gates, M. A., Egan, E. S., Dougan, S. T., Renneback, G., Sirotkin, H. I., Schier, A. F. and Talbot, W. S. (1998). Zebrafish organizer development and germ-layer formation require nodal-related signals. Nature 395,181 -185.[CrossRef][Medline]
Fisher, S., Jagadeeswaran, P. and Halpern, M. E. (2003). Radiographic analysis of zebrafish skeletal defects. Dev. Biol. 264,64 -76.[CrossRef][Medline]
Flores, M. V., Tsang, V., Hu, W., Kalev-Zylinska, M. L., Postlethwait, J. H., Crosier, P., Crosier, K. and Fisher, S. (2004). Duplicate zebrafish runx2 orthologues are expressed in developing skeletal elements. Gene Expr. Patterns 4, 573-581.[CrossRef][Medline]
Force, A., Amores, A. and Postlethwait, J. H. (2002). Hox cluster organization in the jawless vertebrate Petromyzon marinus. J. Exp. Zool. 294, 30-46.[CrossRef][Medline]
Force, A., Lynch, M., Pickett, F. B., Amores, A., Yan, Y.-L. and
Postlethwait, J. (1999). Preservation of duplicate genes by
complementary, degenerative mutations. Genetics
151,1531
-1545.
Fritz, A., Rozowski, M., Walker, C. and Westerfield, M.
(1996). Identification of selected gamma-ray induced deficiencies
in zebrafish using multiplex polymerase chain reaction.
Genetics 144,1735
-1745.
Gans, C. and Northcutt, R. G. (1983). Neural crest and the origin of vertebrates: a new head. Science 220,268 -274.
Gavrieli, Y., Sherman, Y. and Ben-Sasson, S. A. (1992). Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119,493 -501.[Abstract]
Geisler, R., Rauch, G.-J., Baier, H., van Bebber, F., Brobeta, L., Dekens, M. P. S., Finger, K., Fricke, C., Gates, M. A., Geiger, H. et al. (1999). A radiation hybrid map of the zebrafish genome. Nat. Genet. 23,86 -89.[CrossRef][Medline]
Graham, A. and Begbie, J. (2000). Neurogenic placodes: a common front. Trends Neurosci. 23,313 -316.[CrossRef][Medline]
Graham, A., Begbie, J. and McGonnell, I. (2004). Significance of the cranial neural crest. Dev. Dyn. 229,5 -13.[CrossRef][Medline]
Grandel, H. and Schulte-Merker, S. (1998). The development of the paired fins in the zebrafish (Danio rerio). Mech. Dev. 79,99 -120.[CrossRef][Medline]
Hans, S., Liu, D. and Westerfield, M. (2004).
Pax8 and Pax2a function synergistically in otic specification, downstream of
the Foxi1 and Dlx3b transcription factors. Development
131,5091
-5102.
Healy, C., Uwanogho, D. and Sharpe, P. T. (1999). Regulation and role of Sox9 in cartilage formation. Dev. Dyn. 215,69 -78.[CrossRef][Medline]
Hokamp, K., McLysaght, A. and Wolfe, K. H. (2003). The 2R hypothesis and the human genome sequence. J. Struct. Funct. Genomics 3, 95-110.[CrossRef][Medline]
Holland, P. W. H., Garcia-Fernàndez, J., Williams, N. A. and Sidow, A. (1994). Gene duplications and the origins of vertebrate development. Development 120,125 -133.
Houston, C. S., Opitz, J. M., Spranger, J. W., Macpherson, R. I., Reed, M. H., Gilbert, E. F., Herrmann, J. and Schinzel, A. (1983). The campomelic syndrome: review, report of 17 cases, and follow-up on the currently 17-year-old boy first reported by Maroteaux et al. in 1971. Am. J. Med. Genet. 15, 3-28.[Medline]
Hughes, A. L. (1994). The evolution of functionally novel proteins after gene duplication. Proc. R. Soc. Lond. B Biol. Sci. 256,119 -124.[Medline]
Hughes, A. L. (1999). Phylogenies of developmentally important proteins do not support the hypothesis of two rounds of genome duplication early in vertebrate history. J. Mol. Evol. 48,565 -576.[Medline]
Hukriede, N. A., Joly, L., Tsang, M., Miles, J., Tellis, P.,
Epstein, J. A., Barbazuk, W. B., Li, F. N., Paw, B., Postlethwait, J. H. et
al. (1999). Radiation hybrid mapping of the zebrafish genome.
Proc. Natl. Acad. Sci. USA
96,9745
-9750.
Inada, M., Yasui, T., Nomura, S., Miyake, S., Deguchi, K., Himeno, M., Sato, M., Yamagiwa, H., Kimura, T., Yasui, N. et al. (1999). Maturational disturbance of chondrocytes in Cbfa1-deficient mice. Dev. Dyn. 214,279 -290.[CrossRef][Medline]
Jeffery, W. R., Strickler, A. G. and Yamamoto, Y. (2004). Migratory neural crest-like cells form body pigmentation in a urochordate embryo. Nature 431,696 -699.[CrossRef][Medline]
Jowett, T. and Yan, Y. L. (1996). Double fluorescent in situ hybridization to zebrafish embryos. Trends Genet. 12,387 -389.[Medline]
Karsenty, G. and Wagner, E. F. (2002). Reaching a genetic and molecular understanding of skeletal development. Dev. Cell 2,389 -406.[Medline]
Kelsh, R. and Raible, D. W. (2002). Specification of zebrafish neural crest. In Pattern Formation in Zebrafish (ed. L. Solinica-Krezel), pp.216 -236. Berlin: Springer-Verlag.
Kelsh, R. N., Schmid, B. and Eisen, J. S. (2000). Genetic analysis of melanophore development in zebrafish embryos. Dev. Biol. 225,277 -293.[CrossRef][Medline]
Kimmel, C. B., Miller, C. T., Kruze, G., Ullmann, B., BreMiller, R. A., Larison, K. D. and Snyder, H. C. (1998). The shaping of pharyngeal cartilages during early development of the zebrafish. Dev. Biol. 203,246 -263.[CrossRef]
Kimmel, C. B., Ullmann, B., Walker, M., Miller, C. T. and Crump,
J. G. (2003). Endothelin 1-mediated regulation of pharyngeal
bone development in zebrafish. Development
130,1339
-1351.
Knapik, E., Goodman, A., Ekker, M., Chevrette, M., Delgado, J., Neuhauss, S., Shimoda, N., Driever, W., Fishman, M. and Jacob, H. (1998). A microsatellite genetic linkage map for zebrafish (Danio rerio). Nat. Genet. 18,338 -343.[Medline]
Knight, R. D., Javidan, Y., Nelson, S., Zhang, T. and Schilling, T. (2004). Skeletal and pigment cell defects in the lockjaw mutant reveal multiple roles for zebrafish tfap2a in neural crest development. Dev. Dyn. 229,87 -98.[CrossRef][Medline]
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y.,
Geisler, R., Rauch, G. J. and Schilling, T. F. (2003).
lockjaw encodes a zebrafish tfap2a required for early neural crest
development. Development
130,5755
-5768.
Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M. et al. (1997). Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89,755 -764.[Medline]
Koopman, P., Schepers, G., Brenner, S. and Venkatesh, B. (2004). Origin and diversity of the Sox transcription factor gene family: genome-wide analysis in Fugu rubripes. Gene 328,177 -186.[CrossRef][Medline]
Krieg, P. A. and Melton, D. A. (1984). Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs. Nucleic Acids Res. 12,7057 -7070.[Abstract]
Larhammar, D., Lundin, L. and Hallbook, F.
(2002). The human Hox-bearing chromosome regions did arise by
block or chromosome (or even genome) duplications. Genome
Res. 12,1910
-1920.
Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N. and de Crombrugghe, B. (1997). SOX9 is a potent activator of the chondrocyte-specific enhancer of the pro alpha1(II) collagen gene. Mol. Cell. Biol. 17,2336 -2346.[Abstract]
Lewis, J. L., Bonner, J., Modrell, M., Ragland, J. W., Moon, R.
T., Dorsky, R. I. and Raible, D. W. (2004). Reiterated Wnt
signaling during zebrafish neural crest development.
Development 131,1299
-1308.
Li, M., Zhao, C., Wang, Y., Zhao, Z. and Meng, A. (2002). Zebrafish sox9b is an early neural crest marker. Dev. Genes Evol. 212,203 -206.[CrossRef][Medline]
Liu, D., Chu, H., Maves, L., Yan, Y. L., Morcos, P. A.,
Postlethwait, J. H. and Westerfield, M. (2003). Fgf3 and Fgf8
dependent and independent transcription factors are required for otic placode
specification. Development
130,2213
-2224.
Locascio, A., Manzanares, M., Blanco, M. J. and Nieto, M. A.
(2002). Modularity and reshuffling of Snail and Slug expression
during vertebrate evolution. Proc. Natl. Acad. Sci.
USA 99,16841
-16846.
Luo, R., An, M., Arduini, B. L. and Henion, P. D. (2001). Specific pan-neural crest expression of zebrafish Crestin throughout embryonic development. Dev. Dyn. 220,169 -174.[CrossRef][Medline]
Luo, T., Lee, Y. H., Saint-Jeannet, J. P. and Sargent, T. D.
(2003). Induction of neural crest in Xenopus by
transcription factor AP2alpha. Proc. Natl. Acad. Sci.
USA 100,532
-537.
Martinez-Barbera, J. P., Toresson, H., Da Rocha, S. and Krauss, S. (1997). Cloning and expression of three members of the zebrafish Bmp family: Bmp2a, Bmp2b and Bmp4. Gene 198, 53-59.[CrossRef][Medline]
McClintock, J. M., Kheirbek, M. A. and Prince, V. E. (2002). Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention. Development 129,2339 -2354.[Medline]
Meulemans, D., McCauley, D. and Bronner-Fraser, M. (2003). Id expression in amphioxus and lamprey highlights the role of gene cooption during neural crest evolution. Dev. Biol. 264,430 -442.[CrossRef][Medline]
Meyer, A. and Schartl, M. (1999). Gene and genome duplications in vertebrates: the one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr. Opin. Cell Biol. 11,699 -704.[CrossRef][Medline]
Miller, C. T., Schilling, T. F., Lee, K., Parker, J. and Kimmel,
C. B. (2000). sucker encodes a zebrafish
Endothelin-1 required for ventral pharyngeal arch development.
Development 127,3815
-3828.
Mori-Akiyama, Y., Akiyama, H., Rowitch, D. H. and de
Crombrugghe, B. (2003). Sox9 is required for determination of
the chondrogenic cell lineage in the cranial neural crest. Proc.
Natl. Acad. Sci. USA 100,9360
-9365.
Mortier, G. R., Rimoin, D. L. and Lachman, R. S. (1997). The scapula as a window to the diagnosis of skeletal dysplasias. Pediatr. Radiol. 27,447 -451.[CrossRef][Medline]
Neumann, C. J., Grandel, H., Gaffield, W., Schulte-Merker, S.
and Nusslein-Volhard, C. (1999). Transient establishment of
anteroposterior polarity in the zebrafish pectoral fin bud in the absence of
sonic hedgehog activity. Development
126,4817
-4826.
Ng, L.-J., Wheatley, S., Muscat, G. E. O., Conway-Campbell, J., Bowles, J., Wright, E., Bell, D. M., Tam, P. P. L., Cheah, K. S. E. and Koopman, P. (1997). SOX9 binds DNA, activates transcription, and coexpresses with type II collagen during chondrogenesis in the mouse. Dev. Biol. 183,108 -121.[CrossRef][Medline]
Northcutt, R. G. and Gans, C. (1983). The genesis of neural crest and epidermal placodes: a reinterpretation of vertebrate origins. Quart. Rev. Biol. 58, 1-28.[Medline]
O'Brien, E. K., d'Alencon, C., Bonde, G., Li, W., Schoenebeck, J., Allende, M. L., Gelb, B. D., Yelon, D., Eisen, J. S. and Cornell, R. A. (2004). Transcription factor Ap-2alpha is necessary for development of embryonic melanophores, autonomic neurons and pharyngeal skeleton in zebrafish. Dev. Biol. 265,246 -261.[CrossRef][Medline]
Odenthal, J. and Nusslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]
Ohno, S. (1970). Evolution by Gene Duplication. New York: Springer-Verlag.
Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W., Beddington, R. S., Mundlos, S., Olsen, B. R. et al. (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89,765 -771.[Medline]
Peters, H., Wilm, B., Sakai, N., Imai, K., Maas, R. and Balling,
R. (1999). Pax1 and Pax9 synergistically regulate vertebral
column development. Development
126,5399
-5408.
Postlethwait, J. (2004). Evolution of the zebrafish genome. In Fish Development and Genetics: The Zebrafish and Medaka Models, pp. 581-611 (ed. Z. G. A. V. Korzh). World Scientific.
Postlethwait, J., Amores, A., Cresko, W., Singer, A. and Yan, Y. L. (2004). Subfunction partitioning, the teleost radiation and the annotation of the human genome. Trends Genet. 20,481 -490.[CrossRef][Medline]
Postlethwait, J. H., Amores, A., Yan, G. and Austin, C. A. (2002). Duplication of a portion of human chromosome 20q containing Topoisomerase (Top1) and Snail genes provides evidence on genome expansion and the radiation of teleost fish. In Aquatic Genomics: steps toward a great future (ed. N. Shimizu, T. Aoki, I. Hirono and F. Takashima), pp. 20-31. Tokyo: Springer-Verlag.
Postlethwait, J. H., Woods, I. G., Ngo-Hazelett, P., Yan, Y.-L.,
Kelly, P. D., Chu, F., Huang, H., Hill-Force, A. and Talbot, W. S.
(2000). Zebrafish comparative genomics and the origins of
vertebrate chromosomes. Genome Res.
10,1890
-1902.
Postlethwait, J. H., Yan, Y.-L., Gates, M., Horne, S., Amores, A., Brownlie, A., Donovan, A., Egan, E., Force, A., Gong, Z. et al. (1998). Vertebrate genome evolution and the zebrafish gene map. Nat. Genet. 18,345 -349.[Medline]
Puschel, A. W., Westerfield, M. and Dressler, G. R. (1992). Comparative analysis of Pax-2 protein distributions during neurulation in mice and zebrafish. Mech. Dev. 38,197 -208.[CrossRef][Medline]
Rawls, J. F., Mellgren, E. M. and Johnson, S. L. (2001). How the zebrafish gets its stripes. Dev. Biol. 240,301 -314.[CrossRef][Medline]
Rebagliati, M. R., Toyama, R., Haffter, P. and Dawid, I. B.
(1998). cyclops encodes a nodal-related factor involved
in midline signaling. Proc. Natl. Acad. Sci. USA
95,9932
-9937.
Richardson, M. K., Jeffery, J. E. and Tabin, C. J. (2004). Proximodistal patterning of the limb: insights from evolutionary morphology. Evol. Dev. 6, 1-5.[CrossRef][Medline]
Rodrigues, K. T. and Sumpter, J. P. (1984). The radioimmunoassay of alpha-melanocyte-stimulating hormone and endorphin in trout (Salmo gairdneri) and the effect of blinding on the plasma levels of these peptides. Gen. Comp. Endocrinol. 54, 69-75.[CrossRef][Medline]
Rubinstein, A. L., Lee, D., Luo, R., Henion, P. D. and Halpern, M. E. (2000). Genes dependent on zebrafish cyclops function identified by AFLP differential gene expression screen. Genesis 26,86 -97.[CrossRef][Medline]
Saint-Germain, N., Lee, Y. H., Zhang, Y., Sargent, T. D. and
Saint-Jeannet, J. P. (2004). Specification of the otic
placode depends on Sox9 function in Xenopus.
Development 131,1755
-1763.
Sampath, K., Rubinstein, A. L., Cheng, A. M., Liang, J. O., Fekany, K., Solnica-Krezel, L., Korzh, V., Halpern, M. E. and Wright, C. V. (1998). Induction of the zebrafish ventral brain and floorplate requires cyclops/nodal signalling. Nature 395,185 -189.[CrossRef][Medline]
Satoh, N. (2003). The ascidian tadpole larva: comparative molecular development and genomics. Nat. Rev. Genet. 4,285 -295.[CrossRef][Medline]
Schepers, G., Bullejos, M., Hosking, B. M. and Koopman, P.
(2000). Cloning and characterization of the SRY-related
ttranscription factor gene Sox8. Nucleic Acids Res.
28,1473
-1480.
Seo, H. C., Edvardsen, R. B., Maeland, A. D., Bjordal, M., Jensen, M. F., Hansen, A., Flaat, M., Weissenbach, J., Lehrach, H., Wincker, P. et al. (2004). Hox cluster disintegration with persistent anteroposterior order of expression in Oikopleura dioica. Nature 431,67 -71.[CrossRef][Medline]
Shimeld, S. M. and Holland, P. W. (2000).
Vertebrate innovations. Proc. Natl. Acad. Sci. USA
97,4449
-4452.
Sidow, A. (1996). Gen(om)e duplications in the evolution of early vertebrates. Curr. Opin. Gen. Dev. 6, 715-722.[CrossRef][Medline]
Skrabanek, L. and Wolfe, K. H. (1998). Eukaryote genome duplication - where's the evidence? Curr. Opin. Genet. Dev. 8,694 -700.[CrossRef][Medline]
Smits, P., Li, P., Mandel, J., Zhang, Z., Deng, J. M., Behringer, R. R., de Crombrugghe, B. and Lefebvre, V. (2001). The transcription factors L-Sox5 and Sox6 are essential for cartilage formation. Dev. Cell 1,277 -290.[Medline]
Sock, E., Pagon, R. A., Keymolen, K., Lissens, W., Wegner, M.
and Scherer, G. (2003). Loss of DNA-dependent dimerization of
the transcription factor SOX9 as a cause for campomelic dysplasia.
Hum. Mol. Genet. 12,1439
-1447.
Sock, E., Schmidt, K., Hermanns-Borgmeyer, I., Bosl, M. R. and
Wegner, M. (2001). Idiopathic weight reduction in mice
deficient in the high-mobility-group transcription factor Sox8.
Mol. Cell Biol. 21,6951
-6959.
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and Saint-Jeannet, J. P. (2002). The transcription factor Sox9 is required for cranial neural crest development in Xenopus. Development 129,421 -432.[Medline]
Stock, M., Schafer, H., Fliegauf, M. and Otto, F. (2004). Identification of novel target genes of the bone-specific transcription factor Runx2. J. Bone Miner. Res. 19,959 -972.[Medline]
Stoltzfus, A. (1999). On the possibility of constructive neutral evolution. J. Mol. Evol. 49,169 -181.[Medline]
Streisinger, G., Walker, C., Dower, N., Knauber, D. and Singer, F. (1981). Production of clones of homozygous diploid zebrafish (Brachydanio rerio). Nature 291,293 -296.[Medline]
Takahashi, K., Nuckolls, G. H., Takahashi, I., Nonaka, K., Nagata, M., Ikura, T., Slavkin, H. C. and Shum, L. (2001). Msx2 is a repressor of chondrogenic differentiation in migratory cranial neural crest cells. Dev. Dyn. 222,252 -262.[CrossRef][Medline]
Takeda, S., Bonnamy, J. P., Owen, M. J., Ducy, P. and Karsenty,
G. (2001). Continuous expression of Cbfa1 in nonhypertrophic
chondrocytes uncovers its ability to induce hypertrophic chondrocyte
differentiation and partially rescues Cbfa1-deficient mice. Genes
Dev. 15,467
-481.
Tanaka, M., Cohn, M. J., Ashby, P., Davey, M., Martin, P. and
Tickle, C. (2000). Distribution of polarizing activity and
potential for limb formation in mouse and chick embryos and possible
relationships to polydactyly. Development
127,4011
-4021.
Taylor, J., Braasch, I., Frickey, T., Meyer, A. and Van De Peer,
Y. (2003). Genome duplication, a trait shared by 22,000
species of ray-finned fish. Genome Res.
13,382
-390.
Thisse, C., Thisse, B. and Postlethwait, J. H. (1995). Expression of snail2, a second member of the zebrafish Snail family, in cephalic mesendoderm and presumptive neural crest of wild-type and spadetail mutant embryos. Dev. Biol. 172,86 -99.[CrossRef][Medline]
Thisse, C., Thisse, B., Schilling, T. and Postlethwait, J.
H. (1993). Structure of the zebrafish snail1 gene
and its expression in wild-type, spadetail and no tail
mutant embryos. Development
119,1203
-1215.
Tribulo, C., Aybar, M. J., Nguyen, V. H., Mullins, M. C. and
Mayor, R. (2003). Regulation of Msx genes by a Bmp gradient
is essential for neural crest specification.
Development 130,6441
-6452.
Varlet, I., Collignon, J. and Robertson, E. J.
(1997). Nodal expression in the primitive endoderm is required
for specification of the anterior axis during mouse gastrulation.
Development 124,1033
-1044.
Vogel, G. (1998). Doubled genes may explain
fish diversity. Science
281,1119
-1121.
Wittbrodt, J., Meyer, A. and Schartl, M. (1998). More genes in fish? BioEssays 20,511 -515.[CrossRef]
Woods, I. G., Kelly, P. D., Chu, F., Ngo-Hazelett, P., Yan, Y.
L., Huang, H., Postlethwait, J. H. and Talbot, W. S. (2000).
A comparative map of the zebrafish genome. Genome Res.
10,1903
-1914.
Wright, E., Hargrave, M. R., Christiansen, J., Cooper, L., Kun, J., Evans, T., Gangadharan, U., Greenfield, A. and Koopman, P. (1995). The SRY-related gene Sox9 is expressed during chondrogenesis in mouse embryos. Nat. Genet. 9, 15-20.[Medline]
Wunderle, V. M., Critcher, R., Hastie, N., Goodfellow, P. N. and
Schedl, A. (1998). Deletion of long-range regulatory elements
upstream of SOX9 causes campomelic dysplasia. Proc. Natl.
Acad. Sci. USA 95,10649
-10654.
Yan, Y.-L., Hatta, K., Riggleman, B. and Postlethwait, J. H. (1995). Expression of a type II collagen gene in the zebrafish embryonic axis. Dev. Dyn. 203,363 -376.[Medline]
Yan, Y. L., Miller, C. T., Nissen, R., Singer, A., Liu, D.,
Kirn, A., Draper, B., Willoughby, J., Morcos, P. A., Amsterdam, A. et al.
(2002). A zebrafish sox9 gene required for cartilage
morphogenesis. Development
129,5065
-5079.
Yasuo, H. and Satoh, N. (1998). Conservation of the developmental role of Brachyury in notochord formation in a urochordate, the ascidian Balocynthia roretzi. Dev. Biol. 200,158 -170.[CrossRef][Medline]
Yoshida, T., Kanegane, H., Osato, M., Yanagida, M., Miyawaki, T., Ito, Y. and Shigesada, K. (2002). Functional analysis of RUNX2 mutations in Japanese patients with cleidocranial dysplasia demonstrates novel genotype-phenotype correlations. Am. J. Hum. Genet. 71,724 -738.[CrossRef][Medline]
Zelzer, E. and Olsen, B. R. (2003). The genetic basis for skeletal diseases. Nature 423,343 -348.[CrossRef][Medline]
Zhou, G., Lefebvre, V., Zhang, Z., Eberspaecher, H. and de
Crombrugghe, B. (1998). Three high mobility group-like
sequences within a 48-base pair enhancer of the Col2a1 gene are required for
cartilage-specific expression in vivo. J. Biol. Chem.
273,14989
-14997.