Department of Ecology and Evolution, State University of New York at Stony Brook, Stony Brook, NY 11794-5245, USA
Present address: Department of Molecular and Cell Biology, 385 LSA, University of California at Berkeley, Berkeley, CA 94720-3200 USA
¶ Present address: Department of Biology, Duke University, Box 90338, Durham, NC 27708-0338, USA
*Author for correspondence (e-mail: abely{at}uclink.berkeley.edu)
Accepted April 9, 2001
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Regeneration, Fission, Post-embryonic development, Annelid, Gene expression, Evolution, Homeobox gene, orthodenticle, engrailed, Pristina leidyi
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Although virtually all animals are capable of embryonic development, the ability to regenerate or reproduce agametically varies widely (Vorontsova and Liosner, 1960; Brusca and Brusca, 1990), sometimes even between closely related species (Scadding, 1977; Bely, 1999). This highlights the fact that there has been extensive evolution of post-embryonic capabilities. Furthermore, many animals can regenerate but cannot reproduce agametically, indicating that these two phenomena are in some way distinct. Nevertheless, regeneration and agametic reproduction appear to be related: agametic reproduction has evolved primarily within groups capable of extensive regeneration (Vorontsova and Liosner, 1960), and all animals capable of agametic reproduction whose regenerative capabilities have been investigated can regenerate.
Although the established animal model systems of developmental biology have been extremely useful for investigating embryogenesis, most of these animals undergo determinate growth, have poor regenerative capabilities, and are not capable of agametic reproduction. This has left a striking gap between our understanding of embryonic and post-embryonic developmental processes. We have chosen to work on the segmented worm Pristina leidyi (Annelida: Oligochaeta: Naididae), which is capable of several different forms of post-embryonic development (Van Cleave, 1937). This tiny freshwater worm grows continuously as an adult, is capable of regenerating a new head and tail, and routinely undergoes agametic reproduction by paratomic fission (Fig. 1), in which a new head and tail are intercalated in the middle of a worms body. Pristina is not known to reproduce sexually under laboratory conditions. However, its embryos are very similar to those of its close relatives, the leeches, which have been the subject of numerous embryological studies (Irvine and Martindale, 1996; Shankland and Savage, 1997), but which cannot add segments as adults, regenerate or reproduce agametically. Pristina therefore provides an exceptional opportunity to investigate relationships between embryogenesis, regeneration and agametic reproduction.
|
We now report the isolation of oligochaete homologs of two homeobox genes, engrailed (en) and orthodenticle (otd/Otx), and describe their expression patterns during adult growth, regeneration, and paratomic fission in Pristina. These genes were chosen because they play crucial and putatively conserved roles in neurogenesis (en, Otx), segmentation (en), and head patterning (Otx) in several phyla (Finkelstein et al., 1990; Simeone et al., 1993; Patel, 1994; Wada et al., 1996; Holland et al., 1997; Bruce and Shankland, 1998; Duman-Scheel and Patel, 1999). We compare gene expression patterns between fission and regeneration to test the hypothesis that the evolution of fission in Pristina involved recruitment of regenerative processes. Furthermore, to investigate the possibility that embryonic developmental pathways are redeployed during post-embryonic development, we compare our gene expression data for regeneration and fission with published data for leech embryos.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Regeneration studies
Worms were anesthetized in 5% ethanol in spring water and cut with a scalpel under a dissecting microscope. To permit the most direct comparisons between fission and regeneration, for anterior regeneration studies worms were decapitated at segment boundary VII/VIII (see Brinkhurst and Jamieson, 1971 for segment nomenclature), removing exactly those structures normally produced anteriorly during fission. As the presence of fission zones in regenerating worms could interfere with the posterior regeneration process (Galloway, 1899), worms were decaudalized for posterior regeneration studies by cutting two segments in front of the anterior-most fission zone (corresponding to a cut ranging from segment boundary XI/XII to XVI/XVII), or at segment boundary XIV/XV if no fission zone was visible. After amputation, worms were cultured individually at room temperature in spring water. After 2 days, posteriorly amputated worms were fed, as this was found to accelerate the posterior regeneration process.
Worms were fixed (see below) at multiple time points during regeneration, beginning 12 hours after amputation and then daily over the course of 5 days, by which time both anterior and posterior regeneration were normally complete. Because regeneration rate varied considerably between individuals, we refer to the stage of regeneration (early, mid, late, see Fig. 1) rather than the exact time point.
Isolation and sequencing of engrailed and orthodenticle homologs
To isolate en- or Otx-class genes, small fragments (including part of the homeobox) were amplified from genomic DNA through two rounds of PCR using degenerate primers. Primers were EN-A+ and EN-D- for the first en PCR, EN-B+ and EN-C- for the second en PCR, OTX-A+ and OTX-B- for the first Otx PCR, and OTX-C+ and OTX-B- for the second Otx PCR. Primer sequences (written 5' to 3', followed by corresponding amino acids) were:
EN-A+: GATGARAARMGICCIMGIAC (DEKRPRT)
EN-D: TGRTTRTAIARICCYTGIGC (AQGLYNH)
EN-B+: GARAARMGTCCIMGIACIGC (EKRPRTA)
EN-C: TGTGCCATIARYTGIARIGC (ALQLMAQ)
OTX-A+: MGTAARCARMGTMGIGARMGIAC (RKQRRERT)
OTX-B: TGAACTCTKGAYTCTGGIARATT (NLPESTVQ)
OTX-C+: ACGACTTTYACKMGIRCICA (TTFTR[T/A]Q)
For the first PCR, 30 cycles were performed at 60°C to 45°C (temperature decreased 0.5°C/cycle) annealing, followed by 20 cycles at 50°C annealing. For the second PCR, 35 cycles were performed at 50°C annealing.
To obtain additional sequences, we performed 3'RACE for all three genes isolated by degenerate PCR (Pl-en, Pl-Otx1, Pl-Otx2, see Results), as well as 5'RACE for Pl-en. For 3'RACE, total RNA (isolated from 50 mg of actively fissioning worms, using RNAzol [Tel-Test]) was reverse transcribed according to Frohman (Frohman, 1990). For 3'RACE, gene-specific primers for the first and second PCR, respectively, were EN-F+ and EN-H+ for Pl-en, OTX-D+ and OTX-E+ for Pl-Otx1, and OTX-M+ and OTX-N+ for Pl-Otx2:
EN-F+: ACAGCCGGGCAACTCGAACG (TAGQLER)
EN-H+: CGACAGCAAATACCTCACCG (DYSKYLTE)
OTX-D+: TACTCGAGACGCTGTTCC (VLETLFH)
OTX-E+: AAGACTCGCTACCCAGAC (KTRYPD)
OTX-M+: AAAACGCGGTATCCGGAC (KTRYPD)
OTX-N+: ACATATTCACCCGAGAGG (DIFTREE)
For 5'RACE of Pl-en, total RNA was reverse transcribed (5'RACE System, GIBCO BRL) using EN-L, and the gene-specific primers for the first and second PCRs were, respectively, EN-M and EN-N:
EN-L: AACCCGACGAATGATTG (NHSSG)
EN-M: AGCCCTGAGCCATCAACTG (QLMAQG)
EN-N: AAGGGCTAGTTGGTTTC(RNQLAL)
Conditions and anchor primers for all RACE amplifications were those of Frohman (Frohman, 1990).
PCR products were cloned into pGEM-T (Promega) and sequenced using standard methods. We used NCBI BLAST searches (Altschul et al., 1990) to identify related sequences. Amino acid sequences of conserved gene regions (specifically, homeodomains and en domain EH5) were used to generate neighbor-joining trees using PAUP* (version 4.0b2, Swofford, 1999).
Whole-mount in situ hybridization
The cloned 3'RACE fragments of the en homolog (Pl-en) and the two Otx homologs (Pl-Otx1 and Pl-Otx2) served as templates to synthesize sense and antisense digoxigenin-labeled riboprobes (Boehringer Mannheim). Probe lengths were Pl-en, 567 bp; Pl-Otx1, 2.2 kb; and Pl-Otx2, 2.1 kb.
We used an in situ hybridization protocol based on that of Nardelli-Haefliger and Shankland (Nardelli-Haefliger and Shankland, 1992) for leech embryos. Relevant specifications or deviations from the published protocol are as follows. Worms were relaxed 15 minutes in 10 mM MgCl2/5 mM NaCl/1 mM KCl/8% ethanol prior to fixation; Pronase E digestion lasted 10 minutes; hybridization was carried out using 0.6-1 ng/µl unhydrolyzed probe at 58°C (Pl-en) or 67°C (Pl-Otx1/Otx2); the post-hybridization RNase treatment was omitted; preabsorbed antibody was used at 1:2000 dilution; color reactions proceeded for 1-3 hours. Some worms were incubated in Hoechst 33258 (1 µg/ml) to stain nuclei. Specimens were mounted in 70-90% glycerol and photographed (with or without Nomarski optics) on a Zeiss Axioskop microscope using a Spot digital camera (Diagnostic Instruments) or on a Zeiss Axiophot microscope using 35 mm slide film.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Pl-en is clearly a member of the en-class gene family: just downstream of the homeodomain, it possesses an amino acid motif (domain EH5) unique to and conserved across en-class genes from both protostomes and deuterostomes (Fig. 2) (Bürglin, 1994). In addition, phylogenetic analyses based on the homeodomain and domain EH5 place Pl-en within a poorly resolved but strongly supported (by bootstrap analysis) en clade (data not shown), and a BLASTP search identifies ht-en, the en-class gene from the leech Helobdella triserialis (Wedeen et al., 1991), as the most similar sequence to Pl-en.
|
|
Expression of Pl-en during adult growth, regeneration and fission
In situ hybridization controls using the sense probe gave no staining, or at most a faint and diffuse haze in dense tissues, suggestive of nonspecific probe trapping. Using the antisense probe, Pl-en expression was detected primarily in newly formed tissues; in older segments, all segmental expression fades below detection levels. Pl-en expression patterns are very similar during adult growth, regeneration and fission.
In growing adults, Pl-en is expressed in several cells at the anterior limit of the pygidium (Fig. 4A). In the posterior growth zone and in young, recently formed, segments, Pl-en is expressed in scattered ventral and ventrolateral cells (Fig. 4A-C). These cells are unidentifiable in the growth zone, but in young segments, most localize to the ventral nerve cord (Fig. 4C).
|
|
|
Sense controls of both genes produced no staining or, at most, a faint haze in dense tissues, as described for Pl-en. Pl-Otx1/Otx2 are primarily expressed transiently in developing tissues, with expression fading below detection levels once tissues are fully formed. However, Pl-Otx1 (but not Pl-Otx2) is also expressed in a single medial cell of the ventral ganglia of certain fully formed midbody segments (Fig. 7C).
|
During mid to late stages of both anterior and posterior regeneration, when the new tissues are becoming visibly segmented, Pl-Otx1/Otx2 expression resembles that seen during adult growth (Fig. 8A,B,F). This is the only phase of expression seen during posterior regeneration. In contrast, Pl-Otx1/Otx2 are expressed extensively during early and mid stages of anterior regeneration, primarily in the body wall and foregut. When a small anterior blastema is formed, intense expression is detected near its anterior limit, in bilaterally symmetrical lateral crescents following the contour of the body wall (Fig. 8C,D). As this expression fades, a lateral cluster of unidentified cells transiently express Pl-Otx1/Otx2 on either side of the blastema (Fig. 8E). At mid and late stages of regeneration, Pl-Otx1/Otx2 are strongly expressed deep within the body in the regenerating foregut (Fig. 8E,F). Once the different regions of the foregut are distinguishable, expression of Pl-Otx1/Otx2 localizes specifically to the pharynx. When regeneration is nearly complete (and sometimes in normal, fully formed heads), dorsolateral patches of staining cells occur just below the body wall surface (Fig. 8G), lateral to each lobe of the cerebral ganglion. Some naidid species (though not P. leidyi) have pigmented eyespots in this location (Dehorne, 1916). As Otx-class genes are expressed in the eyes and/or associated nerve cells in a number of animals (Finkelstein et al., 1990; Simeone et al., 1993; Vandendries et al., 1996; Umesono et al., 1999), it is possible that Pl-Otx1/Otx2-expressing cells are associated with light-sensing organs, although studies of naidids with eyespots will be needed to confirm this.
|
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
A more controversial hypothesis is that en may have played a role in segmentation in the common ancestor of annelids and arthropods (Wedeen and Weisblat, 1991), or perhaps even annelids, arthropods and chordates (Kimmel, 1996; Holland et al., 1997). The involvement of en in segmentation appears to be an ancestral feature for arthropods: in all arthropods investigated to date, en is expressed in a stripe of cells in the posterior region of nascent segments (e.g. Patel, 1994; Peterson et al., 1998), and functional studies in Drosophila demonstrate that en plays a direct role in delineating segments (Lawrence and Struhl, 1996). Among chordates, stripes of en-class gene expression precede signs of morphological segmentation in anterior somites of amphioxus embryos (Holland et al., 1997), but in other chordates, en-class genes are expressed only after segments are delineated, making the ancestral chordate pattern uncertain. Furthermore, arthropods and chordates are now believed to be more closely related to non-segmented phyla than they are to each other (Adoutte et al., 2000), making it far from certain that the en stripes in arthropods and amphioxus represent homologous phases of expression. (A recent investigation in several molluscs, including the metameric chitons, suggests a role for en-class genes in skeletogenesis, rather than metamere delineation (Jacobs et al., 2000).)
As one of the three major groups of segmented animals, annelids are of critical importance for understanding the evolution of segmentation. In leech embryos, ht-en expression is segmentally iterated (Wedeen and Weisblat, 1991; Lans et al., 1993). However, unlike the broad stripes of contiguous expression seen in arthropod and amphioxus embryos, expression in leech occurs in isolated non-contiguous cells (but see discussion of a possible asynchronous stripe of expression by) (Lans et al., 1993). Furthermore, recent experimental studies have failed to find evidence to suggest en-class genes are linked to the segmentation process in this annelid (Shain et al., 1998; Seaver and Shankland, 2000; Seaver and Shankland, 2001). We have extended investigations of en homolog expression to a second major group of annelids, the oligochaetes, and to new forms of development, namely adult growth, regeneration and fission. Although post-embryonic segmentation in oligochaetes involves large fields of small cells, much like arthropod or amphioxus embryonic segmentation, our studies in Pristina failed to uncover any obvious similarity to the segmental expression patterns seen in arthropods and amphioxus. Rather, Pl-en expression occurs in scattered, isolated cells, primarily in the ventral body wall and nervous system (Figs 4-6). Functional investigations of annelid en homologs would be desirable, but currently no evidence suggests that en is involved in annelid segmentation, in striking contrast to what has been found in arthropods.
Otx-class genes and anterior specification during regeneration and fission
It seems clear that early in the evolution of bilaterians, the Otx homolog(s) acquired a role in defining anterior structures during embryogenesis. Otx-class genes are expressed almost exclusively in the extreme anterior structures in embryos of diverse bilaterians, including an annelid (Bruce and Shankland, 1998), several arthropods (e.g. Finkelstein et al., 1990; Li et al., 1996; Telford and Thomas, 1998) and a variety of chordates (e.g. Simeone et al., 1993; Wada et al., 1996; Williams and Holland, 1996; Tomsa and Langeland, 1999), as well as around the mouth of the radially symmetrical juveniles of sea urchins (Lowe and Wray, 1997). Our studies in Pristina demonstrate that Otx-class genes are also involved almost exclusively in head development during regeneration and fission. During both anterior regeneration and fission, the earliest phase of Pl-Otx1/Otx2 expression occurs at the anterior limit of the new head, and occurs at very early stages of head development, before new morphological structures are apparent. Together, these findings suggest that Pl-Otx1/Otx2 may be involved in the early processes of post-embryonic head specification. Interestingly, Otx-class genes in regenerating planarians also are associated primarily with the development of anterior structures (Stornaiuolo et al., 1998; Umesono et al., 1999).
New evidence that the evolution of paratomic fission involved recruitment of regenerative processes
Paratomic fission, in which a new head and tail are intercalated in the middle of a worm, has evolved multiple times in annelids (Giese and Pearse, 1975). Important similarities between the morphogenetic events of paratomic fission and regeneration exist for a number of asexual annelids (Dehorne, 1916; Berrill, 1952; Herlant-Meewis, 1953). These similarities, coupled with the observation that fission is far less common than regeneration among annelids, and tends to occur within larger taxonomic groups capable of regeneration, suggest that the evolution of fission may depend on recruiting regeneration processes for a role in reproduction. According to this hypothesis, then, paratomic fission in annelids is effected by initiating regeneration in the middle of an undamaged worm.
This recruitment hypothesis is supported by our data, which demonstrate extensive similarities in the spatial and temporal expression of body patterning genes between fission and regeneration (compare Fig. 5 with Fig. 6, and Fig. 8 with Fig. 9). For example, at very early stages of head development during both fission and regeneration, Pl-Otx1/Otx2 are expressed in lateral crescents at the new anterior limit of the developing heads. At later stages of both processes, Pl-Otx1/Otx2 are expressed in the pharynx of the new foregut and Pl-Otx1/Otx2 and Pl-en are expressed in a number of ventral cells, including cells of the ventral nerve cord of developing segments. Thus, the similarity between regeneration and fission is not only notable at the level of morphogenesis, but extends also to the underlying developmental regulatory genes.
Nevertheless, despite the cellular and molecular similarities between fission and regeneration, it is clear that paratomic fission is not simply regeneration. For example, the two processes are not perfectly correlated: not all annelids capable of regeneration can undergo fission (Berrill, 1952), and at least one annelid (a naidid) capable of fission cannot fully regenerate (Bely, 1999). Thus, at least some aspects of development presumably differ between the two processes. Interestingly, we found that Pl-Otx2 expression associated with the development of the prostomium differs markedly between fission and regeneration. During fission, Pl-Otx2 expression encircles the base of the emerging prostomium throughout its development (Fig. 9C-E), whereas during anterior regeneration, no such expression is detectable during any stage of prostomium regeneration (Fig. 8). These data suggest the intriguing possibility that to evolve fission, naidid worms had to evolve a novel way of generating the prostomium, perhaps because the structure is added terminally during regeneration, whereas it must be intercalated during paratomic fission. We might then expect to find additional differences between fission and regeneration by investigating the formation of the other asegmental terminal structure, the pygidium.
Relationship between embryonic and post-embryonic development
A major aim in undertaking this work was to determine whether, in annelids, genes involved in embryonic body patterning are also expressed during growth, regeneration and fission, and if so, whether these genes appear to play similar roles during different modes of development. It is clear from our studies in Pristina that homeobox genes such as Pl-en and Pl-Otx1/Otx2 are indeed redeployed during post-embryonic development, and their transient and regional expression is consistent with a role in either body patterning or cell fate specification.
To investigate whether post-embryonic patterning resembles embryonic patterning, however, it is necessary to compare regeneration and fission to embryogenesis. Because Pristina is not known to reproduce sexually under laboratory conditions, we compare our findings with published data on embryonic expression of en- and Otx-class genes in embryos of the leech Helobdella triserialis (Wedeen and Weisblat, 1991; Lans et al., 1993; Bruce and Shankland, 1998). Leeches and oligochaetes are both clitellate annelids and share a form of direct development characteristic of this group (Anderson, 1973). For comparisons of en-class genes, it should be noted that we assayed mRNA distribution in Pristina, while protein distribution was investigated in Helobdella. With respect to Otx-class genes, our study and Bruce and Shanklands study were both performed using in situ hybridization, with nearly identical protocols and probe regions.
Despite the drastic differences between developing embryos, regenerating adults and fissioning adults, several striking parallels emerge from a comparison of leech embryonic expression and oligochaete post-embryonic expression. During anterior regeneration and fission, the earliest Pl-Otx1/Otx2 expression is in the anterior body wall (Figs 8C,D, 9A,B). Similarly, in leech embryos, the earliest detected expression of Lox22-Otx is in the anterior-most ectoderm of the germinal plate. In both Pristina and Helobdella, early expression is broad and not localized to a particular morphological structure. Although it is far from certain that these represent functionally equivalent phases of expression, Otx-class genes do appear to play an early role in defining anterior tissue domains in annelids during both embryonic and post-embryonic head development.
Otx-class genes are also expressed in the developing foregut during both regeneration/fission (in Pristina) and embryogenesis (in leech). In Pristina, Pl-Otx1/Otx2 are expressed in the developing pharynx (Fig. 8E,F, 9C,D), while in leech embryos, Lox22-Otx is expressed in the proboscis (thought to be homologous to the oligochaete pharynx) (Anderson, 1973), as well as in the esophagus. Interestingly, during oligochaete embryogenesis, regeneration and fission, the pharynx arises from a deep mass of cells that becomes hollow, and is distinct from the ectodermal cells that will invaginate to form the lining of the buccal cavity (Dehorne, 1916; Anderson, 1973). Therefore, both tissue morphogenesis and Otx-class gene expression support the idea that pharynx formation occurs by similar processes in both embryonic and post-embryonic development.
Finally, during regeneration and fission, as well as adult growth, Pl-en and Pl-Otx1/Otx2 are expressed in a few cells of developing ventral nerve cord ganglia in Pristina (Figs 4-9), just as their homologs are in Helobdella. Therefore, en- and Otx-class genes appear to be involved in the development of particular neuronal phenotypes during embryonic as well as post-embryonic development.
Despite these extensive similarities, differences in body patterning between embryogenesis and regeneration/fission are also suggested by our data. For example, in leech embryos, Lox22-Otx is intensely expressed in a ring around the developing mouth throughout much of early development. In contrast, circum-oral expression was never observed in regenerating or fissioning Pristina. Pl-Otx1/Otx2 occurs in the lateral (Pl-Otx1/Otx2) and dorsal (Pl-Otx2) body wall (Figs 8, 9), but the new mouth is described as invaginating from the ventral surface in naidid worms (Dehorne, 1916), far from the site of Pl-Otx1/Otx2 expression. During later stages of fission (but not regeneration), circum-prostomial Pl-Otx2 expression marks the boundary between the prostomium and peristomium of Pristina. No comparable expression has been described for leech embryogenesis. However, the comparison between leech and naidid heads is made difficult by the fact that leeches have a highly modified anterior end, and it is not clear where (or even if) the prostomium/peristomium boundary exists in leeches. Nevertheless, the expression patterns described for leech embryogenesis and Pristina regeneration and fission are difficult to reconcile, and suggest that some aspects of mouth and/or prostomium development may differ between them. To confirm that the above comparisons do indeed reflect differences between embryonic and post-embryonic development, rather than differences between leeches and oligochaetes, it will be important to investigate embryos of the closest possible relative to Pristina.
Investigations of amphibian limb patterning based on grafting experiments provided some of the first direct evidence suggesting that some patterning mechanisms are similar between embryonic and post-embryonic development (Muneoka and Bryant, 1982; Muneoka and Bryant, 1984). Since then, several studies have investigated expression of body patterning genes during regeneration, primarily in vertebrates, hydra and planarians (see Introduction), but only a handful of these have compared their findings specifically with embryonic patterning. The existing studies demonstrate that some genes expressed during embryogenesis are re-expressed, and in a similar way, during regeneration (Del Rio-Tsonis et al., 1995; Loosli et al., 1996; Stark et al., 1998; Cadinouche et al., 1999; Gardiner et al., 1999; Technau and Bode, 1999). However, some studies have also uncovered differences between embryogenesis and regeneration in the relative timing of expression of genes (Gardiner et al., 1995), as well as differences with respect to which tissues express a particular gene (Akimenko et al., 1995). Extending studies of post-embryonic development to include a broader range of taxa remains crucial if we are to achieve a general understanding of how post-embryonic development is effected in metazoans. Our study of Pristina, which represents the first analysis of developmental regulatory gene expression during annelid regeneration, and the first during fission, lends support to the idea that embryogenesis, regeneration, and fission employ largely similar, but clearly not identical, body patterning mechanisms.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Adoutte, A., Balavoine, G., Lartillot, N., Lespinet, O., Prudhomme, B. and de Rosa, R. (2000). The new animal phylogeny: reliability and implications. Proc. Natl. Acad. Sci. USA 97, 4453-4456.
Akimenko, M.-A., Johnson, S. L., Westerfield, M. and Akker, M. (1995). Differential induction of four msx homeobox genes during fin development and regeneration in zebrafish. Development 121, 347-357.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol. 215, 403-410.[Medline]
Anderson, D. T. (1973). Embryology and Phylogeny in Annelids and Arthropods. Braunschweig: Pergamon Press.
Arendt, D., Technau, U. and Wittbrodt, J. (2001). Evolution of the bilaterian larval foregut. Nature 409, 81-85.[Medline]
Baguñà, J. (1998). Planarians. In Cellular and Molecular Basis of Regeneration: from Invertebrates to Humans (ed. P. Ferretti and J. Géraudie), pp. 135-165. West Sussex: John Wiley and Sons.
Bely, A. E. (1999). Decoupling of fission and regenerative capabilities in an asexual oligochaete. Hydrobiologia 406, 243-251.
Berrill, N. J. (1952). Regeneration and budding in worms. Biol. Rev. 27, 401-438.
Bosch, T. C. G. (1998). Hydra. In Cellular and Molecular Basis of Regeneration: from Invertebrates to Humans (ed. P. Ferretti and J. Géraudie), pp. 111-134. West Sussex: John Wiley and Sons.
Brinkhurst, R. O. and Jamieson, B. G. M. (1971). Aquatic Oligochaeta of the World. Edinburgh: Oliver and Boyd.
Bruce, A. E. E. and Shankland, M. (1998). Expression of the head gene Lox22-Otx in the leech Helobdella and the origin of the bilaterian body plan. Dev. Biol. 201, 101-112.[Medline]
Brusca, R. C. and Brusca, G. J. (1990). Invertebrates. Sunderland, MA: Sinauer.
Bürglin, T. R. (1994). A comprehensive classification of homeobox genes. In Guidebook to the Homeobox Genes (ed. D. Duboule), pp. 27-71. Oxford: Oxford University Press.
Cadinouche, M. Z. A., Liversage, R. A., Muller, W. and Tsilfidis, C. (1999). Molecular cloning of the Notophthalmus viridescens radical fringe cDNA and characterization of its expression during forelimb development and adult forelimb regeneration. Dev. Dyn. 214, 259-268.[Medline]
Dehorne, L. (1916). Les naïdimorphes et leur reproduction asexuée. Arch. Zool. Exp. Gén. 56, 25-157.
Del Rio-Tsonis, K., Washabaugh, C. H. and Tsonis, P. A. (1995). Expression of pax-6 during urodele eye development and lens regeneration. Proc. Natl. Acad. Sci. USA 92, 5092-5096.[Abstract]
Dick, M. H. and Buss, L. W. (1994). A PCR-based survey of homeobox genes in Ctenodrilus serratus (Annelida: Polychaeta). Mol. Phylogenet. Evol. 3, 146-158.[Medline]
Duman-Scheel, M. and Patel, N. H. (1999). Analysis of molecular marker expression reveals neuronal homology in distantly related arthropods. Development 126, 2327-2334.
Ferretti, P. and Géraudie, J. (1998). Cellular and Molecular Basis of Regeneration: from Invertebrates to Humans. West Sussex: John Wiley and Sons.
Finkelstein, R., Smouse, D., Capaci, T., Spradling, A. C. and Perrimon, N. (1990). The orthodenticle gene encodes a novel homeo domain protein involved in the development of the Drosophila nervous system and ocellar visual structures. Genes Dev. 4, 1516-1527.[Abstract]
Frigerio, G., Burri, M., Bopp, D., Baumgartner, S. and Noll, M. (1986). Structure of the segmentation gene paired and the Drosophila PRD gene set as part of a gene network. Cell 47, 735-746.[Medline]
Frohman, M. A. (1990). Rapid Amplification of cDNA Ends (RACE): user-friendly cDNA cloning. Amplifications: A forum for PCR users (a Perkin Elmer publication) 5, 11-15.
Furukawa, T., Morrow, E. M. and Cepko, C. L. (1997). Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell 91, 531-541.[Medline]
Galliot, B., de Vargas, C. and Miller, D. (1999). Evolution of homeobox genes: Q50 Paired-like genes founded the Paired class. Dev. Genes Evol. 209, 186-197.[Medline]
Galloway, T. W. (1899). Observations on non-sexual reproduction in Dero vaga. Bull. Museum Comp. Zoöl. 35, 1-140.
Gardiner, D. M., Blumberg, B., Komine, Y. and Bryant, S. V. (1995). Regulation of HoxA expression in developing and regenerating axolotl limbs. Development 121, 1731-1741.
Gardiner, D. M., Carlson, M. R. J. and Roy, S. (1999). Towards a functional analysis of limb regeneration. Semin. Cell Dev. Biol. 10, 385-393.[Medline]
Giese, A. C. and Pearse, J. S. (1975). Reproduction of Marine Invertebrates. Annelids and Echiurans. Vol. 3. New York: Academic Press.
Goriely, A., Stella, M., Coffinier, C., Kessler, D., Mailhos, C., Dessain, S. and Desplan, C. (1996). A functional homologue of goosecoid in Drosophila. Development 122, 1641-1650.
Goss, R. J. (1969). Principles of Regeneration. New York: Academic Press.
Herlant-Meewis, H. (1953). Contribution a létude de la régénération chez les oligochètes Aeolosomatidae. Ann. Soc. Roy. Zool. Belg. 84, 117-161.
Holland, L. Z., Kene, M., Williams, N. A. and Holland, N. D. (1997). Sequence and embryonic expression of the amphioxus engrailed gene (AmphiEn): the metameric pattern of transcription resembles that of its segment-polarity homolog in Drosophila. Development 124, 1723-1732.
Holland, P. (1992). Homeobox genes in vertebrate evolution. BioEssays 14, 267-273.[Medline]
Irvine, S. M. and Martindale, M. Q. (1996). Cellular and molecular mechanisms of segmentation in annelids. Semin. Cell Dev. Biol. 7, 593-604.
Jacobs, D. K., Wray, C. G., Wedeen, C. J., Kostriken, R., DeSalle, R., Staton, J., Gates, R. D. and Lindberg, D. R. (2000). Molluscan engrailed expression, serial organization, and shell evolution. Evol. Dev. 2, 340-347.[Medline]
Kathman, R. D. and Brinkhurst, R. O. (1998). Guide to the Freshwater Oligochaetes of North America. College Grove, TN: Aquatic Resources Center.
Kimmel, C. B. (1996). Was Urbilateria segmented? Trends Genet. 12, 329-331.[Medline]
Laforest, L., Brown, C. W., Poleo, G., Géraudie, J., Tada, M., Ekker, M. and Akimenko, M.-A. (1998). Involvement of the Sonic Hedgehog, patched 1 and bmp2 genes in patterning of the zebrafish dermal fin rays. Development 125, 4175-4184.
Lans, D., Wedeen, C. J. and Weisblat, D. A. (1993). Cell lineage analysis of the expression of an engrailed homolog in leech embryos. Development 117, 857-871.
Lawrence, P. A. and Struhl, G. (1996). Morphogens, compartments, and pattern: Lessons from Drosophila. Cell 85, 951-961.[Medline]
Li, Y., Brown, S. J., Hausdorf, B., Tautz, D., Denell, R. E. and Finkelstein, R. (1996). Two orthodenticle-related genes in the short-germ beetle Tribolium castaneum. Dev. Genes Evol. 206, 35-45.
Logan, C., Hanks, M. C., Noble-Topham, S., Nallainathan, D., Provart, N. J. and Joyner, A. L. (1992). Cloning and sequence comparison of the mouse, human, and chicken engrailed genes reveal potential functional domains and regulatory regions. Dev. Genet. 13, 345-358.[Medline]
Loosli, F., Kmita-Cunisse, M. and Gehring, W. J. (1996). Isolation of a Pax-6 homolog from the ribbonworm Lineus sanguineus. Proc. Natl. Acad. Sci. USA 93, 2658-2663.
Lowe, C. J. and Wray, G. A. (1997). Radical alterations in the roles of homeobox genes during echinoderm evolution. Nature 389, 718-721.[Medline]
Manzanares, M., Marco, R. and Garesse, R. (1993). Genomic organization and developmental pattern of expression of the engrailed gene from the brine shrimp Artemia. Development 118, 1209-1219.
Muneoka, K. and Bryant, S. V. (1982). Evidence that patterning mechanisms in developing and regenerating limbs are the same. Nature 298, 369-371.[Medline]
Muneoka, K. and Bryant, S. V. (1984). Cellular contribution to supernumerary limbs resulting from the interaction between developing and regenerating tissues in the axolotl. Dev. Biol. 105, 179-187.[Medline]
Nardelli-Haefliger, D. and Shankland, M. (1992). Lox2, a putative leech segment identity gene, is expressed in the same segmental domain in different stem cell lineages. Development 116, 697-710.
Patel, N. H. (1994). The evolution of arthropod segmentation: insights from comparisons of gene expression patterns. Development 120, Suppl., 201-207.
Peterson, M. D., Popadic, A. and Kaufman, T. C. (1998). The expression of two engrailed-related genes in an apterygote insect and a phylogenetic analysis of insect engrailed-related genes. Dev. Genes Evol. 208, 547-557.[Medline]
Poole, S. J., Kauvar, L. M., Drees, B. and Kornberg, T. (1985). The engrailed locus of Drosophila: structural analysis of an embryonic transcript. Cell 40, 37-43.[Medline]
Sánchez Alvarado, A. (2000). Regeneration in the metazoans: why does it happen? BioEssays 22, 578-590.[Medline]
Scadding, S. R. (1977). Phylogenetic distribution of limb regeneration capacity in adult amphibia. J. Exp. Zool. 202, 57-68.
Seaver, E. C. and Shankland, M. (2000). Leech segmental repeats develop normally in the absence of signals from either anterior or posterior segments. Dev. Biol. 224, 339-353.[Medline]
Seaver, E. C. and Shankland, M. (2001). Establishment of segment polarity in the ectoderm of the leech Helobdella. Development 128, 1629-1641.
Shain, D. H., Ramírez-Weber, F.-A., Hsu, J. and Weisblat, D. A. (1998). Gangliogenesis in leech: morphogenetic processes leading to segmentation in the central nervous system. Dev. Genes Evol. 208, 28-36.[Medline]
Shankland, M. and Savage, R. M. (1997). Annelids, the segmented worms. In Embryology: Constructing the Organism, (ed. S. F. Gilbert and A. M. Raunio), pp. 219-235. Sunderland, MA: Sinauer Associates.
Simeone, A., Acampora, D., Mallamaci, A., Stornaiuolo, A., DApice, M. R., Nigro, V. and Boncinelli, E. (1993). A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J. 12, 2735-2747.[Abstract]
Simeone, A., DApice, M. R., Nigro, V., Casanova, J., Graziani, F., Acampora, D. and Avantaggiato, V. (1994). Orthopedia, a novel homeobox-containing gene expressed in the developing CNS of both mouse and Drosophila. Neuron 13, 83-101.[Medline]
Smith, K. M., Gee, L., Blitz, I. L. and Bode, H. R. (1999). CnOtx, a member of the Otx gene family, has a role in cell movement in Hydra. Dev. Biol. 212, 392-404.[Medline]
Stark, D. R., Gates, P. B., Brockes, J. P. and Ferretti, P. (1998). Hedgehog family member is expressed throughout regenerating and developing limbs. Dev. Dyn. 212, 352-363.[Medline]
Stornaiuolo, A., Bayascas, J. R., Saló, E. and Boncinelli, E. (1998). A homeobox gene of the orthodenticle family is involved in antero-posterior patterning of regenerating planarians. Int. J. Dev. Biol. 42, 1153-1158.[Medline]
Swofford, D. L. (1999). Phylogenetic Analysis Using Parsimony (*and other methods). Sunderland, MA: Sinauer Associates.
Technau, U. and Bode, H. R. (1999). HyBra1, a Brachyury homologue, acts during head formation in Hydra. Development 126, 999-1010.
Telford, M. J. and Thomas, R. H. (1998). Expression of homeobox genes shows chelicerate arthropods retain their deutocerebral segment. Proc. Natl. Acad. Sci. USA 95, 10671-10675.
Tomsa, J. M. and Langeland, J. A. (1999). Otx expression during lamprey embryogenesis provides insights into the evolution of the vertebrate head and jaw. Dev. Biol. 207, 26-37.[Medline]
Ueki, T., Kuratani, S., Hirano, S. and Aizawa, S. (1998). Otx cognates in a lamprey, Lampetra japonica. Dev. Genes Evol. 208, 223-228.[Medline]
Umesono, Y., Watanabe, K. and Agata, K. (1999). Distinct structural domains in the planarian brain defined by the expression of evolutionarily conserved homeobox genes. Dev. Genes Evol. 209, 31-39.[Medline]
Van Cleave, C. D. (1937). A study of the process of fission in the naid Pristina longiseta. Physiological Zool. 10, 299-314.
Vandendries, E. R., Johnson, D. and Reinke, R. (1996). orthodenticle is required for photoreceptor cell development in the Drosophila eye. Dev. Biol. 173, 243-255.[Medline]
Vorontsova, M. A. and Liosner, L. D. (1960). Asexual Propagation and Regeneration. London: Pergamon Press.
Wada, S., Katsuyama, Y., Sato, Y., Itoh, C. and Saiga, H. (1996). Hroth, an orthodenticle-related homeobox gene of the ascidian, Halocynthia roretzi: its expression and putative roles in the axis formation during embryogenesis. Mech. Dev. 60, 59-71.[Medline]
Webster, P. J. and Mansour, T. E. (1992). Conserved classes of homeodomains in Schistosoma mansoni. Mech. Dev. 38, 25-32.[Medline]
Wedeen, C. J., Price, D. J. and Weisblat, D. A. (1991). Cloning and sequencing of a leech homolog to the Drosophila engrailed gene. FEBS Lett. 279, 300-302.[Medline]
Wedeen, C. J. and Weisblat, D. A. (1991). Segmental expression of an engrailed-class gene during early development and neurogenesis in an annelid. Development 113, 805-814.[Abstract]
Williams, N. A. and Holland, P. W. H. (1996). Old head on young shoulders. Nature 383, 490.
Wray, C. G., Jacobs, D. K., Kostriken, R., Vogler, A. P., Baker, R. and DeSalle, R. (1995). Homologues of the engrailed gene from five molluscan classes. FEBS Lett. 365, 71-74.[Medline]