1 Development and Neurobiology, Walter and Eliza Hall Institute of Medical
Research, Parkville, Victoria 3050, Australia
2 Max-Planck-Institute of Biophysical Chemistry, Goettingen, Germany
* Author for correspondence (e-mail: avoss{at}wehi.edu.au)
Accepted 11 October 2002
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: C3G, Ras signalling, Vascular development, Focal adhesions, Integrins, PDGF
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
C3G is a guanine nucleotide exchange factor transmitting signals from the
extracellular matrix or growth factors to members of the Ras family of
GTPases. Specifically C3G has been shown to respond to B and T cell receptor
activation (Reedquist et al.,
1996; Smit et al.,
1996
), insulin and EGF (Okada
and Pessin, 1997
), integrin binding
(Arai et al., 1999
;
Uemura and Griffin, 1999
),
erythropoietin and interleukin 3 (Nosaka
et al., 1999
), and interferon
(Alsayed et al., 2000
).
Activation of C3G can lead to the activation of Jun kinase
(Mochizuki et al., 2000
;
Tanaka et al., 1997
) or MAP
kinase (Nosaka et al., 1999
).
C3G stimulated guanine nucleotide exchange predominantly on Rap1 and, to a
lesser extend, on R-Ras (Ichiba et al.,
1997
; Ohba et al.,
2001
). However, C3G-mediated activation of Jun kinase appears to
occur solely through activation of R-Ras
(Mochizuki et al., 2000
). The
rough eye phenotype caused by constitutive over-activation of DC3G in D.
melanogaster in vivo can be suppressed by reducing the gene dosage of
Ras1, rolled (MAPK) and Rap1
(Ishimaru et al., 1999
). Taken
together, these reports suggest an activation of both, the
Ras/Rap/MAPK-pathway and the Ras/Jun kinase-pathway, by C3G.
C3G was initially isolated as a protein binding to the amino-terminal SH3
domain of the adaptor protein, chicken retrovirus kinase (Crk)
(Knudsen et al., 1994;
Tanaka et al., 1994
). C3G
contains a carboxy-terminal CDC25-type catalytic domain stimulating the
guanine nucleotide exchange on Ras-family members
(Tanaka et al., 1994
).
Centrally located are four proline-rich domains that confer binding to the
amino-terminal SH3 domain of Crk and the adaptor protein Grb2
(Kirsch et al., 1998
;
Tanaka et al., 1994
).
Amino-terminal to these is one proline-rich region that confers binding to the
SH3 domain of the focal adhesion molecule p130Cas
(Kirsch et al., 1998
).
Crk and p130Cas have been shown to be integral parts of focal
adhesions. They form a complex with the docking protein paxillin and link
filamentous actin of the cytoskeleton to integrin receptors (reviewed by
Turner, 2000;
Schaller, 2001
). Crk, CrkL and
Grb2 have been shown to enhance C3G activity
(Ichiba et al., 1997
). Crk
does so by recruiting C3G to the cytoplasmic membrane. The SH2 domain of Crk
that confers binding to paxillin or the adaptor protein Shc is essential for
membrane recruitment of C3G (Ichiba et
al., 1997
). Paxillin, in turn, binds to integrins via src and
focal adhesion kinase (reviewed by
Schaller, 2001
).
A recently reported mutation of the C3G (Grf2) gene in
mice resulted in early post-implantation lethality thereby excluding the study
of the role of C3G later in development
(Ohba et al., 2001). We have
generated a mouse strain carrying a hypomorphic C3G allele,
C3Ggt. Here we reveal three previously unreported
functions of C3G. Firstly, C3G is required for the formation or stabilisation
of integrin ß1- and paxillin-positive focal adhesions. Secondly, C3G is
necessary for a normal response to PDGF. Thirdly, C3G is crucial for vascular
maturation. The observed defects in cell adhesion and PDGF-response may
explain the blood vessel development defect.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Total RNA was isolated from ES cells heterozygous for the insertion of
pGT1.8geo into the murine genome (clone F82). 5' rapid
amplification of cDNA ends was performed as described previously
(Voss et al., 1998b) using
oligonucleotides complementary to the lacZ gene of pGT1.8geo
as gene-specific primers. RACE products were cloned into pGemT and
sequenced. The gene-specific sequence obtained was used to screen databases.
To identify the site of integration within the C3G locus a series of
probes were used for Southern analysis including several probes cloned by PCR
from intron 1. These probes were generated through the use of the Celera
Discovery System and Celera Genomics' associated databases.
To test for the presence of C3G mRNA 3' of the gene trap
insertion site, RT-PCR was performed as described previously
(Voss et al., 1998b) on total
RNA isolated from homozygous embryos using oligo(dTTP) for the reverse
transcriptase reaction and using 5' TGT TTT CCG CCT TGT TAT GTT CCT
3' as the forward and 5' AGT GGC AGC GGC AGA CCT CAG 3' as
the reverse primer. This reaction generated a product complementary to bases
268-647 of a mouse EST (GenBank accession no. BG916265) spanning exons 21-24
of the C3G locus. To test for the presence of full-length protein
coding mRNA in homozygous embryos, RT-PCR representing all coding exons was
performed using primers in exon 21 (5' TGT TTT CCG CCT TGT TAT GTT CCT
3') and exon 1 (5' GCCCGGAAATGTCCGGCAAGATCG 3').
Generation of the C3Ggt mutant mouse line and
genotyping of mice and embryos
Chimeras were produced as describes previously
(Voss et al., 1998b) and mated
to wild-type females of the mouse strains C57B1/6 and Random Swiss. In timed
pregnant female mice, noon of the day on which the vaginal plug was observed
was termed day 0.5 of gestation (E0.5). Genotyping was carried out using DNA
isolated from tail biopsies or embryonic membranes by C3G
gene-specific Southern analysis using an [
-32P]dATP-labelled
probe near the insertion site of pGT1.8geo in intron 1 (probe 1,
Fig. 1A). Probe 1 comprised 203
bp sequence located 22 kb 3' of exon 1. It was PCR generated using
5' GGA GCA GGC AGG ACT CCT CAC T 3' and 5' TCT CCC ATC TAA
GAG GCT CTG G 3' as primers.
|
Whole embryo and histological analysis
Embryos were dissected from the uteri, placed in phosphate-buffered saline
(PBS), viewed and photographed using a low-magnification stereomicroscope
(Zeiss) and a digital camera (Axiocam, Zeiss). Embryonic membranes were used
for genotyping by C3G-specific Southern analysis. For histological
analysis, embryos were fixed in 4% paraformaldehyde, dehydrated, infiltrated
and embedded in paraffin. 8 µm serial sections were cut, deparaffinised and
stained with Haematoxylin and Eosin using standard techniques. Slides were
viewed and photographed using a compound microscope (Zeiss) and a digital
camera. Photographs of mutant and control embryos were compared in detail.
Northern analysis and in situ hybridisation
A lacZ- or C3G-specific
[-32P]dATP-labelled probe 3' of the insertion site
(probe 2, Fig. 1A) was used for
northern analysis of total RNA isolated from embryos, adult tissues and cell
lines and, in vitro transcribed and labelled with 35S-labelled
UTP
S, for in situ hybridisation as described previously
(Voss et al., 2000
). Probe 2
was PCR generated using 5' CGC CCC TGC TTC TCA ATG GTT AGC C 3'
and 5' CCA TCC AAG AAG GGA AAG CCA GCC G 3' and was complementary
to 431 bases spanning exons 2-5 of the C3G locus. Probe 2 was cloned
into pBluescript KS+ and sequenced.
Western analysis
Lysates of primary murine embryonic fibroblasts (MEFs) isolated from E10.5
embryos of heterozygous intercrosses were separated by 8% to 16% SDS-PAGE,
electrotransferred to membrane (Immobilon P), blocked in 1% BSA, 0.1% Tween 20
PBS, incubated with primary rabbit polyclonal antibody (1:200 or 1:1000, Santa
Cruz), washed, incubated with secondary horseradish peroxidase-conjugated
antibody (1:3000 to 1:20000, Biorad), washed and detected by chemiluminescence
(Pierce). Densitometry was carried out using a computing densitometer
(Molecular Dynamics).
Immunohistochemistry and immunocytochemistry
Horseradish peroxidase-immunohistochemistry was performed as described
previously (Thomas et al.,
2000). In addition, horseradish peroxidase-immunohistochemistry
was performed on cryosections for the detection of platelet and endothelial
cell adhesion molecule 1 (PECAM 1). Fluorescence immunohistochemistry was
carried out using standard techniques. In brief, after treatment with 0.25%
gelatine and 0.1% Triton X-100 in PBS paraformaldehyde-fixed or acetone-fixed
cryosections (PECAM 1 and smooth muscle
-actin (SM
A) staining)
or deparaffinised sections (SM
A and all other antigens) were treated
with intervening PBS washes with first antibody solution, second fluorescent
antibody solution and then counter-stained with 0.1 µg/ml bis-benzimide in
0.25% gelatine in PBS (Molecular Probes). The sections were then mounted with
Mowiol, viewed and photographed using a fluorescence microscope (Zeiss) and a
digital camera. Immunocytochemistry was carried out as described previously
(Voss et al., 2000
).
The first antibodies and dilutions used were mouse anti-smooth muscle
-actin (SM
A; Sigma, 1:400), rat anti-mouse CD31 (PECAM 1;
Pharmingen, 1:200 for cryosections and 1:20 for whole mounts), rabbit
anti-nidogen (kindly provided by M. Dziadek, 1:200), biotinylated hamster
anti-rat CD29 (Integrin ß1 chain, Pharmingen, 1:250), mouse anti-chick
paxillin (BD Transduction, 1:250), rabbit anti-human integrin ß3
(Chemicon, 1:20), mouse anti-chicken vinculin (Sigma, 1:50). Secondary
antibodies and streptavidin used were biotinylated goat anti-rat (Vector,
1:150), biotinylated horse anti-mouse and rabbit (Vector, 1:50), Alexa Fluor
546 goat anti-mouse (Molecular Probes, 1:1000), Alexa Fluor 488 goat
anti-mouse (Molecular Probes, 1:1000), TRITC goat anti-rabbit (Jackson,
1:200), TRITC-streptavidin (Southern Biotechnology, 1:50).
Isolation of primary murine embryonic fibroblasts and cell culture,
PDGF treatment, cell adhesion and cell migration assays and statistics
Primary murine embryonic fibroblasts (MEFs) were isolated essentially as
described previously (Voss and Thomas,
2001) omitting the glass bead dissociation step. Briefly, E10.5
embryos were transferred individually into 250 µl of trypsin/EDTA solution,
incubated for 5 minutes at 37°C followed by mechanical dissociation by
pipetting and plated into 6-well tissue culture plates in Dulbecco's minimum
essential medium with 10% foetal bovine serum (DMEM 10% FBS). The cells were
used at passage 3 and 4. Ninety-six-well plates or cover slip inserts for
24-well plates were coated for 1 hour with 10 µg/ml human plasma
fibronectin (Roche), 10 µg/ml gelatine (Sigma) or 10 µg/ml natural mouse
laminin (Life Technology). Cells were plated at subconfluent density (20,000
cells per well, 24-well plate) with or without 0.1% or 10% FBS.
For PDGF treatment, cells were serum starved for 16 hours and then treated
with or without 2 ng/ml or 10 ng/ml platelet-derived growth factor-AA
(PDGF-AA) or PDGF-BB (both recombinant human; Pepro Tech). Numbers of actin
rings were counted per treatment in more than 500 cells per cultures isolated
from 3 C3Ggt/gt homozygous and 3 wild-type embryos in
duplicates and compared by 2 test. Results are given as mean
± standard error of the mean with P values.
For adhesion assays 7,000 and 14,000 cells were plated into 96-well plates. After 1 hour or 2 hours, non-adherent cells were washed off twice with PBS and cells were fixed with 3% paraformaldehyde, 2% sucrose at room temperature for 5 minutes. Adherent cells were stained with 0.5% Crystal Violet in 20% methanol. Plates were washed in H2O and air-dried. Stained adherent cells were solubilised in 0.1 M citric acid in 50% ethanol, pH 4.2. The optical absorbance was determined at 570 nm using an ELISA reader (SpectraFluor Plus, Tecan). Results were compared by two-factor analysis of variance with genotype and animal as the two factors. Results are given as mean ± standard error of the mean with P values.
Cell migration assays were performed as described previously
(Lallemand et al., 1998). In
brief, a rectangular wound was created in monolayers of cells on the day they
became confluent using a 20-200 µl micropipette tip. Dislodged cells were
washed off and medium was replaced. Images of the monolayer wounds were taken
at the time of wounding (0 hours) and 7 hours later. The area free of cells
was measured using image analysis software (NIH Image 1.62). The area covered
by cells within 7 hours after wounding was calculated. Results were compared
by two-factor analysis of variance with genotype and experiment as the two
factors. Results are given as means ± standard error of the mean with
P values.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The gene trap insertion was located in the 59 kb long intron 1, approximately 16 kb 3' of exon 1 (Fig. 1A). Southern analysis of EcoRV-digested wild-type, heterozygous and homozygous DNA showed that the insertion of the gene trap construct caused a shift in the size of the third EcoRV fragment of intron 1 (14830 bases to 26997 bases from exon 1, Fig. 1B). Southern analysis of the 5' and 3' adjacent EcoRV fragments of intron 1 revealed no polymorphism in heterozygous or homozygous DNA, confirming the absence of rearrangements of the C3G locus outside of the gene trap insertion site. Loss of sequences 5' or 3' of the gene trap insertion was ruled out by 5'RACE (see above) and RT-PCR (below).
Northern analysis of total RNA isolated from E10.5 embryos wild type,
heterozygous or homozygous for the C3Ggt mutant allele
showed C3G/ß-gal/neo fusion mRNA of the expected size of about
4.7 kb and no detectable mRNA 3' of the gene trap insertion site
(Fig. 2A). Likewise radioactive
in situ hybridisation on homozygous and wild-type E11.5 embryos did not reveal
mRNA 3' of the gene trap insertion (compare
Fig. 3K and L with I and J). However, limiting dilution RT-PCR revealed C3G mRNA 3' of the
gene trap insertion in homozygous mutant embryos at less than 1% of wild-type
levels (Fig. 2B). This 3'
mRNA was generated presumably by splicing around the gene trap insertion in
intron 1. RT-PCR using primers to exons 21 and 1 revealed the presence of C3G
mRNA containing all coding exons in homozygous mutant embryos
(Fig. 2C). We have documented
this form of splicing for one of our other gene trap mouse strains previously
(Voss et al., 1998a). Finally,
western analysis of total primary embryonic fibroblast lysates showed two
prominent C3G bands in wild-type and heterozygous lysates. Instead of these,
two weak bands were visible in homozygous lysate
(Fig. 2D). Densitometrically
these amounted to less than 5% of the normal amount of C3G protein. In
conclusion, the C3Ggt allele generates less than 1% mRNA
containing all coding exons and no more than 5% C3G protein and, therefore, is
a hypomorphic rather than a null allele.
|
|
Expression of C3G in mid-gestation embryos and adult
tissues
It was previously reported that the C3G gene is expressed
ubiquitously in Drosophila melanogaster
(Ishimaru et al., 1999) and in
human foetal and adult tissues (Tanaka et
al., 1994
). Northern analysis of adult mouse tissues showed that
C3G is expressed at low levels ubiquitously, with higher levels of
expression in testes (not shown). The activity pattern of the
ß-galactosidase reporter inserted into the C3G locus
(Fig. 3A-D) and radioactive in
situ hybridisation of sections of E11.5 and E12.5 embryos confirmed this
result (Fig. 3E-L). Notably,
reporter activity and expression of the endogenous locus were observed in all
cells including vascular endothelial cells and blood vessel surrounding cell,
both in large (Fig. 3I) and
small blood vessels (Fig.
3D,J).
The C3Ggt/gt mutant phenotype in
vivo
We did not recover any homozygous C3Ggt/gt mutant
offspring from heterozygous inter-crosses at weaning. Among 361 embryos (36
litters) recovered between E9.5 and E14.5, 26% were homozygous, 49%
heterozygous for the C3Ggt allele and 25% wild-type at the
C3G locus (Table 1 and
Fig. 1B). Nine percent of the
implanted embryos were resorbed at an early stage and could not be genotyped.
Given the Mendelian distribution of the C3Ggt allele,
these early resorptions are likely to involve all three genotypes. The
majority of the homozygotes recovered at E9.5 were phenotypically normal
(Table 2). At E10.5, one third
of the homozygotes showed phenotypic abnormalities or were dead. At E11.5 four
fifths were abnormal or dead. At E13.5 and 14.5 all homozygotes were either
dead or highly abnormal.
|
|
The majority of the C3Ggt/gt mutant embryos died between E10.5 and E11.5 exhibiting haemorrhage into the lumen of the neural tube (Fig. 4A-C). Mutant embryos dying between E13.5 and E14.5 showed massive subcutaneous oedema or haemorrhagic oedema (Fig. 4D-F). Most likely hypovolaemic cardiovascular failure was the cause of death. The vascular system defects are the subject of this report. Apart from the defects observed in the vascular system the homozygous embryos also showed defects in the nervous system (A. K. V. and T. T., unpublished).
|
Histological analysis of serial sections of 19 homozygous embryos and 19 controls at E9.5, E10.5 and E11.5 revealed that haemorrhage initiated from small cephalic blood vessels most often in the vicinity of the hindbrain neural epithelium (Fig. 4G-I), occasionally near the olfactory epithelium. Small blood vessels burst leading to an accumulation of blood in the interstitial space until the neural epithelium gave way and ruptured. The blood then drained into the lumen of the neural tube, probably causing hypovolaemia leading to death.
Mutant C3G small cephalic blood vessels lack blood vessel
supporting cells
Blood vessel maturation occurs in mice between E10.5 and E11.5
(Takahashi et al., 1996).
Blood vessel maturation involves the recruitment of supporting cells of
mesenchymal and other origin that differentiate into pericytes and smooth
muscle cells (reviewed by Carmeliet,
2000
). This process lends mechanical stability to blood
vessels.
In order to test if the fragility in C3Ggt/gt blood
vessels was due to a lack of blood vessel maturation we examined the
expression of smooth muscle -actin (SM
A) in 8 pairs of C3G
homozygous mutant embryos and littermate controls at E10.5 and E11.5. We found
few or no SM
A-positive cells around small cephalic blood vessels in
homozygous mutant embryos (compare Fig. 5A
with B and C with D). Those few SM
A-positive cells that
were found did not form a tight ring around the blood vessels as seen in the
controls. Rather they were loosely associated with the blood vessels and with
their environment. They had a rounded appearance with minimal contacts to
neighbouring cells. Larger blood vessels, e.g. the dorsal aorta or the basilar
artery, did acquire SM
A-positive cells. However, the coating of the
larger blood vessels was less complete in C3G mutant embryos than in controls
(basilar artery in Fig. 5G compared to
H). Significantly, the dorsal aorta was deficient in
SM
A-staining cells in its dorsal aspects which are known to develop
blood vessel supporting cells later than the ventral aspects
(Takahashi et al., 1996
). The
mutant vascular endothelial cells expressed platelet and endothelial cell
adhesion molecule 1 (PECAM 1) normally and secreted nidogen normally
(Fig. 5E,F,I,J,K,L). Structure
and arboration of blood vessels appeared normal in embryos stained for PECAM 1
as whole mounts (not shown). These data suggested that the primary defect in
C3G mutant vasculature was localised to vascular supporting cells.
Vascular endothelial cells, in contrast, appeared to be functioning
normally.
|
C3G mutant primary murine embryonic fibroblasts exhibit an
abnormal response to PDGF-BB
The initial stimulus for recruitment of vascular supporting cells has been
proposed to be an increase in shear force experienced by blood vessel
endothelial cells due to a gradual increase in blood pressure and flow as the
embryos grow and their heart function becomes more efficient. It has been
hypothesised that, in response to the increase in shear force, the endothelial
cells release PDGF, which signals to perivascular cells
(Risau, 1997). These then
migrate to and along the blood vessels and differentiate into supporting
cells. It appears that PDGF-BB is required for recruitment of pericytes to
capillaries, but is not required for recruitment of PDGFRß-positive cells
to large blood vessels (Leveen et al.,
1994
; Lindahl et al.,
1997
).
In order to study in more detail the possible phenotypic aberration of
mesenchymal cells, one source of blood vessel supporting cells, we isolated
primary murine embryonic fibroblasts (MEFs) from 3
C3Ggt/gt and 3 wild-type littermate control E10.5 embryos.
We exposed them to PDGF, which is one of the signals that mesenchymal cells
surrounding blood vessels would receive from endothelial cells in vivo.
Immortilised fibroblast cell lines have been reported to respond to PDGF-BB
with a prominent reorganisation of actin filaments into actin rings. The
mutant MEFs showed a much higher frequency of actin ring formation than
control cells in response to PDGF-BB, but not to PDGF-AA (compare
(Fig. 6A,B with C and D). Mutant MEFs showed not only one actin ring more frequently, they also often
formed multiple rings per cell (Fig.
6B) or actin rings spanning the whole perimeter of the cell
(Fig. 6A). In contrast, the
majority of control MEFs did not form actin rings. In 2% of these cells one
small actin ring was seen (Fig.
6C). After exposure to 10 ng/ml PDGF-BB, actin rings occurred with
a frequency of 0.33 per cell in mutant MEFs versus 0.02 in control MEFs
(P<0.001; Fig. 6D).
The frequency of actin rings in mutant and control MEFs in the absence of
PDGF-BB was low and not significantly different (0.01 per cell compared with
0.002 per cell). PDGF-AA had no effect on MEFs of either genotype in this
system. The frequencies of actin ring formation in response to PDGF-BB
observed in this study in primary embryonic fibroblasts were consistently
lower than those observed in immortalised fibroblast cell lines. The frequency
of actin rings has been reported to vary between cell lines and to be lower in
fibroblast cell lines established from isolates obtained prenatally than
postnatally (Hedberg et al.,
1993). In conclusion, the aberrant response of C3G mutant
fibroblasts to PDGF-BB may be one of the mechanisms involved in the
pathogenesis of the abnormal blood vessel phenotype.
|
|
C3G is necessary for cell adhesion to laminin and gelatine and
regulation of cell migration
To study the effects of the C3Ggt mutation on cell
adhesion, homozygous mutant and control MEFs were plated onto laminin,
gelatine or fibronectin in the absence of serum or onto gelatine or
fibronectin in the presence of 10% serum. The plating efficiency of
C3Ggt/gt mutant was significantly reduced on laminin and
gelatine with and without serum (Fig.
7A). In contrast, cell adhesion to fibronectin was not affected by
the C3G mutation. Over a period of 2 days the majority of the mutant
cells grown on laminin or gelatine in the absence of serum rounded up and
lifted off the plate. However, the mutant cells grown on fibronectin remained
attached, although they did not spread in a normal manner (without serum shown
in Fig. 7B). These data
suggested that C3G was required for binding to specific components of the
extracellular matrix and for cell spreading in general.
|
In monolayer wounding assays of isolates of primary fibroblasts from 3 C3G
mutant E10.5 embryos and 3 littermate control embryos we observed a
significant increase in cell migration activity in the mutant cells
(Fig. 7C,D). An increase in
cell motility had been observed previously in C3G-deficient fibroblasts
(Ohba et al., 2001). The
requirement of C3G for cell adhesion and the regulation of cell migration may
not be unrelated events.
C3G is required for integrin ß1 cluster formation
In order to explore the effects of the C3Ggt mutation
on integrin expression or distribution we stained mutant and control MEFs for
integrin ß1 and paxillin (Figs
8 and
9) or integrin ß3 and
paxillin (Fig. 9). Control
cells showed a punctate staining for integrin ß1
(Fig. 8B,H;
Fig. 9F) and ß3
(Fig. 9B,D). Both integrin
ß1- and ß3-positive foci coincided with paxillin staining
(Fig. 8F,L;
Fig. 9K; and data not shown).
The integrin ß1 foci were large and sparse, whereas the integrin ß3
foci were more numerous and generally smaller.
C3Ggt/gt mutant cells exhibited a marked
reduction in the number of integrin ß1 foci
(Fig. 8A compared with B, and G with
H). In contrast integrin ß3 foci appeared to be unaffected by
the C3Ggt mutation
(Fig. 9A-D). Integrin ß1
and paxillin double staining visualised the highly abnormal morphology of
C3Ggt/gt mutant cells in the absence of serum,
particularly on laminin (Fig.
8E) and gelatine (not shown) and, to a lesser extend, on
fibronectin (Fig. 8K). Integrin
ß1 immunostaining was markedly abnormal in the mutant cells. Instead of
the punctate staining distributed evenly across the cell as seen in the
control cells, integrin ß1 appeared to form abnormal aggregates usually
near the nucleus. Abnormal aggregates of integrin ß1 were most pronounced
on laminin (Fig. 8A), but also
obvious on gelatine (not shown) and fibronectin
(Fig. 8G).
|
To enable us to examine C3Ggt/gt mutant cells in a healthier state we grew cells for 2 days on gelatine in the presence of 10% FBS before starving them in 0.1% serum overnight. In addition, we grew cells in 10% serum on tissue culture plastic before plating them for 40 minutes onto fibronectin in the presence of 10% serum. In both cases the cells attached, spread more efficiently and exhibited a healthier morphology than without serum. However, integrin ß1 immunostaining was abnormal even under these conditions. Instead of the evenly distributed punctate staining seen in the control cells (Fig. 9F), mutant cells exhibited a few or no integrin ß1-positive foci (Fig. 9E). The few integrin ß1-positive foci sometimes coincided with paxillin staining in the C3G mutant cells (Fig. 9J compared with K). These data suggested that C3G was instrumental in the assembly or stabilisation of integrin ß1 clusters. Although adhesion to laminin was most severely affected, adhesion and spreading on other substrates was also abnormal. The observed abnormalities indicated that C3G is important as an integral part of the complex formation around integrin ß1, but not integrin ß3. Alternatively, signalling through C3G may be important for the stabilisation of integrin ß1 clusters.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Our hypothesis is that in C3G mutants PDGF signals from blood
vessel endothelial cells did not elicit a normal response in perivascular
cells. PDGF-B mutant embryos have been reported to fail to develop normal
numbers of vascular smooth muscle cells in microvasculature
(Lindahl et al., 1997), where
C3Ggt/gt mutants also show defects in smooth
muscle cells. In contrast, larger blood vessels develop smooth muscle cells at
least to some extent in PDGF-B, PDGF-Rß and C3G mutant embryos
(Leveen et al., 1994
;
Lindahl et al., 1997
;
Soriano, 1994
) (and our data).
However, the C3G mutant phenotype manifests itself earlier and shows
a wider variety of defects than mutations affecting the PDGF signalling
pathway only. This is presumably due to the fact that C3G is required for
other signalling pathways, such as integrin signalling.
Integrins mediate interactions between cells and extracellular matrix
components such as laminin and fibronectin. Integrins are heterodimers
consisting of an and a ß subunit. There are a large number of
and ß subunits, many of which bind multiple substrates
(Hynes, 1992
). Cell spreading
requires the cytoplasmic domain of the ß subunits
(Berrier et al., 2000
;
Ylanne et al., 1993
) and
involves activation of the Ras signalling pathway
(Berrier et al., 2000
). In this
context the requirement of C3G specifically for integrin ß1 focal points
was particularly interesting. In contrast to integrin ß1, integrin
ß3 foci formed without or with very little C3G. Although integrin ß1
is normally involved, adhesion to fibronectin can be mediated by integrin
ß3. In contrast, adhesion to laminin and collagen relies on integrin
ß1 for the ß subunit of the integrin heterodimers
(Hynes, 1992
). Accordingly,
C3G mutant cells, which form integrin ß3-positive cell
adhesions, but are deficient in integrin ß1-positive cell adhesions,
adhere to fibronectin, but only poorly to laminin or gelatine.
3T3 cell adhesion to fibronectin, laminin, collagen I and vitronectin
results in CrkL-mediated C3G phosphorylation and, presumably, activation
(de Jong et al., 1998).
Adhesion of other cell types is at least partly mediated by C3G
(Arai et al., 2001
;
Arai et al., 1999
). While these
studies used cell adhesion to extracellular matrix components as their end
point, we showed here that C3G was crucial for the assembly or stabilisation
of integrin-positive focal adhesions. Moreover, we showed that lack of C3G
affected specifically integrin ß1, and not integrin ß3.
Interestingly, the reported phenotype of C3G null mutant mice
(Ohba et al., 2001
) is similar
to that of integrin ß1 null mutants
(Fassler and Meyer, 1995
;
Stephens et al., 1995
). Taking
our data into consideration it is possible that the peri-implantation
lethality of C3G null mutants may in part be caused by a deficiency
in integrin ß1-mediated cell adhesion.
Focal adhesions are large extracellular matrix-induced clusters of
integrins linked to the ends of large actin bundles. One of the proteins
making the link is paxillin (Turner,
2000; Schaller,
2001
). C3G deficiency caused a greatly reduced number of much
smaller paxillin-positive focal adhesions. The reduction in focal adhesions is
most likely the cause of reduced cell attachment properties and failure of
cell spreading. Previously, it had been shown that C3G binds to Crk and it was
known that Crk in turn binds to paxillin
(Knudsen et al., 1994
;
Salgia et al., 1995
;
Schaller, 2001
;
Tanaka et al., 1994
). We
showed here for the first time that C3G is crucial for the formation and/or
re-enforcement of focal adhesions. Lack of focal adhesions has been observed
in fibroblasts expressing a negative regulator of Src. Consistent with our
finding, over-expression of C3G reverses this phenotype (Li, 2002). This
together with our data suggests that signalling through C3G rather than the
C3G molecule itself is important for the formation and/or stabilisation of
focal adhesions.
The loss-of-function phenotype observed in our study shows considerable
overlap with mutant phenotypes caused by loss of function of other members of
the same signalling pathway. Besides activation through Crk-C3G, members of
the Ras family of GTPases can be activated through the phosphotyrosine docking
molecule ShcA, the adaptor protein Grb2 and the guanine nucleotide exchange
factors Sos1 and Sos2. Embryos lacking ShcA succumb to cardiovascular defects
between E10.5 and E11.5 (Lai and Pawson,
2000). Similar to C3G mutants, in ShcA mutant
embryos the mature vasculature is not established efficiently. Reduced
staining for smooth muscle
-actin and impaired cell-cell and
cell-extracellular matrix adhesions were observed in the ShcA mutant
embryos (Lai and Pawson,
2000
). The loss-of-function phenotype of Sos1 was
reported as cardiovascular defects, haemorrhage and death between E11.5 and
E12.5 (Wang et al., 1997
) or
as death due to placental defects between E9.5 and E11.5
(Qian et al., 2000
).
Sos2 mutant mice are viable
(Esteban et al., 2000
).
Similarities between the loss-of-function phenotypes of the Crk-C3G and the
Shc-Sos aspects of the signalling pathway were somewhat unexpected. These two
aspects of the Ras-signalling pathway had been observed to act
antagonistically in vitro (Okada et al.,
1998
). In contrast, the observed similarities in the
loss-of-function phenotypes would suggest synergistic action, at least with
respect to blood vessel maturation.
Taken together our data show that C3G is essential for normal PDGF signalling and for normal response to the extracellular matrix environment. C3G is critical for the process of vascular myogenesis. These results place C3G in a central role for cell-cell and cell-matrix interactions during blood vessel maturation.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alsayed, Y., Uddin, S., Ahmad, S., Majchrzak, B., Druker, B. J.,
Fish, E. N. and Platanias, L. C. (2000). IFN-gamma activates
the C3G/Rap1 signaling pathway. J. Immunol.
164,1800
-1806.
Arai, A., Nosaka, Y., Kanda, E., Yamamoto, K., Miyasaka, N. and
Miura, O. (2001). Rap1 is activated by erythropoietin or
interleukin-3 and is involved in regulation of beta1 integrin-mediated
hematopoietic cell adhesion. J. Biol. Chem.
276,10453
-10462.
Arai, A., Nosaka, Y., Kohsaka, H., Miyasaka, N. and Miura,
O. (1999). CrkL activates integrin-mediated hematopoietic
cell adhesion through the guanine nucleotide exchange factor C3G.
Blood 93,3713
-3722.
Berrier, A. L., Mastrangelo, A. M., Downward, J., Ginsberg, M.
and LaFlamme, S. E. (2000). Activated R-ras, Rac1, PI
3-kinase and PKCepsilon can each restore cell spreading inhibited by isolated
integrin beta1 cytoplasmic domains. J. Cell Biol.
151,1549
-1560.
Carmeliet, P. (2000). Mechanisms of angiogenesis and arteriogenesis. Nat. Med. 6, 389-395.[CrossRef][Medline]
de Jong, R., van Wijk, A., Heisterkamp, N. and Groffen, J. (1998). C3G is tyrosine-phosphorylated after integrin-mediated cell adhesion in normal but not in Bcr/Abl expressing cells. Oncogene 17,2805 -2810.[CrossRef][Medline]
Dorin, J. R., Farley, R., Webb, S., Smith, S. N., Farini, E., Delaney, S. J., Wainwright, B. J., Alton, E. W. and Porteous, D. J. (1996). A demonstration using mouse models that successful gene therapy for cystic fibrosis requires only partial gene correction. Gene Ther. 3,797 -801.[Medline]
Esteban, L. M., Fernandez-Medarde, A., Lopez, E., Yienger, K.,
Guerrero, C., Ward, J. M., Tessarollo, L. and Santos, E.
(2000). Ras-guanine nucleotide exchange factor sos2 is
dispensable for mouse growth and development. Mol. Cell.
Biol. 20,6410
-6413.
Fassler, R. and Meyer, M. (1995). Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev. 9,1896 -1908.[Abstract]
Hedberg, K. M., Bengtsson, T., Safiejko-Mroczka, B., Bell, P. B. and Lindroth, M. (1993). PDGF and neomycin induce similar changes in the actin cytoskeleton in human fibroblasts. Cell Motil. Cytoskeleton 24,139 -149.[Medline]
Hynes, R. O. (1992). Integrins: versatility, modulation, and signaling in cell adhesion. Cell 69, 11-25.[Medline]
Ichiba, T., Hashimoto, Y., Nakaya, M., Kuraishi, Y., Tanaka, S.,
Kurata, T., Mochizuki, N. and Matsuda, M. (1999). Activation
of C3G guanine nucleotide exchange factor for Rap1 by phosphorylation of
tyrosine 504. J. Biol. Chem.
274,14376
-14381.
Ichiba, T., Kuraishi, Y., Sakai, O., Nagata, S., Groffen, J.,
Kurata, T., Hattori, S. and Matsuda, M. (1997). Enhancement
of guanine-nucleotide exchange activity of C3G for Rap1 by the expression of
Crk, CrkL, and Grb2. J. Biol. Chem.
272,22215
-22220.
Ishimaru, S., Williams, R., Clark, E., Hanafusa, H. and Gaul,
U. (1999). Activation of the Drosophila C3G leads to cell
fate changes and overproliferation during development, mediated by the
RAS-MAPK pathway and RAP1. EMBO J.
18,145
-155.
Kirsch, K. H., Georgescu, M. M. and Hanafusa, H.
(1998). Direct binding of p130(Cas) to the guanine nucleotide
exchange factor C3G. J. Biol. Chem.
273,25673
-25679.
Knudsen, B. S., Feller, S. M. and Hanafusa, H.
(1994). Four proline-rich sequences of the guanine-nucleotide
exchange factor C3G bind with unique specificity to the first Src homology 3
domain of Crk. J. Biol. Chem.
269,32781
-32787.
Lai, K. M. and Pawson, T. (2000). The ShcA
phosphotyrosine docking protein sensitizes cardiovascular signaling in the
mouse embryo. Genes Dev.
14,1132
-1145.
Lallemand, D., Ham, J., Garbay, S., Bakiri, L., Traincard, F.,
Jeannequin, O., Pfarr, C. M. and Yaniv, M. (1998).
Stress-activated protein kinases are negatively regulated by cell density.
EMBO Journal. 17,5615
-5626.
Leveen, P., Pekny, M., Gebre-Medhin, S., Swolin, B., Larsson, E. and Betsholtz, C. (1994). Mice deficient for PDGF B show renal, cardiovascular, and hematological abnormalities. Genes Dev. 8,1875 -187.[Abstract]
Li, L., Okura, M. and Imamoto, A. (2002). Focal
adhesions require catalytic activity of SRC family kinases to mediate
integrin-matrix adhesion. Mol. Cell. Biol.
22,1203
-1217.
Lindahl, P., Johansson, B. R., Leveen, P. and Betsholtz, C.
(1997). Pericyte loss and microaneurysm formation in
PDGF-B-deficient mice. Science
277,242
-245.
Mochizuki, N., Ohba, Y., Kobayashi, S., Otsuka, N., Graybiel, A.
M., Tanaka, S. and Matsuda, M. (2000). Crk activation of JNK
via C3G and R-Ras. J. Biol. Chem.
275,12667
-12671.
Nosaka, Y., Arai, A., Miyasaka, N. and Miura, O.
(1999). CrkL mediates Ras-dependent activation of the Raf/ERK
pathway through the guanine nucleotide exchange factor C3G in hematopoietic
cells stimulated with erythropoietin or interleukin-3. J. Biol.
Chem. 274,30154
-30162.
Ohba, Y., Ikuta, K., Ogura, A., Matsuda, J., Mochizuki, N.,
Nagashima, K., Kurokawa, K., Mayer, B. J., Maki, K., Miyazaki, J. et al.
(2001). Requirement for C3G-dependent Rap1 activation for cell
adhesion and embryogenesis. EMBO J.
20,3333
-3341.
Okada, S., Matsuda, M., Anafi, M., Pawson, T. and Pessin, J.
E. (1998). Insulin regulates the dynamic balance between Ras
and Rap1 signaling by coordinating the assembly states of the Grb2-SOS and
CrkII-C3G complexes. EMBO J.
17,2554
-2565.
Okada, S. and Pessin, J. E. (1997). Insulin and
epidermal growth factor stimulate a conformational change in Rap1 and
dissociation of the CrkII-C3G complex. J. Biol. Chem.
272,28179
-28182.
Posern, G., Rapp, U. R. and Feller, S. M. (2000). The Crk signaling pathway contributes to the bombesin-induced activation of the small GTPase Rap1 in Swiss 3T3 cells. Oncogene 19,6361 -6368.[CrossRef][Medline]
Qian, X., Esteban, L., Vass, W. C., Upadhyaya, C., Papageorge,
A. G., Yienger, K., Ward, J. M., Lowy, D. R. and Santos, E.
(2000). The Sos1 and Sos2 Ras-specific exchange factors:
differences in placental expression and signaling properties. EMBO
J. 19,642
-654.
Reedquist, K. A., Fukazawa, T., Panchamoorthy, G., Langdon, W.
Y., Shoelson, S. E., Druker, B. J. and Band, H. (1996).
Stimulation through the T cell receptor induces Cbl association with Crk
proteins and the guanine nucleotide exchange protein C3G. J. Biol.
Chem. 271,8435
-8442.
Risau, W. (1997). Mechanisms of angiogenesis. Nature 386,671 -674.[CrossRef][Medline]
Salgia, R., Uemura, N., Okuda, K., Li, J. L., Pisick, E.,
Sattler, M., de Jong, R., Druker, B., Heisterkamp, N. and Chen, L. B.
(1995). CRKL links p210BCR/ABL with paxillin in chronic
myelogenous leukemia cells. J. Biol. Chem.
270,29145
-29150.
Schaller, M. D. (2001). Paxillin: a focal adhesion-associated adaptor protein. Oncogene 20,6459 -6472.[CrossRef][Medline]
Senechal, K., Heaney, C., Druker, B. and Sawyers, C. L.
(1998). Structural requirements for function of the Crkl adapter
protein in fibroblasts and hematopoietic cells. Mol. Cell.
Biol. 18,5082
-5090.
Skarnes, W. C., Moss, J. E., Hurtley, S. M. and Beddington, R. S. (1995). Capturing genes encoding membrane and secreted proteins important for development. Proc. Natl. Acad. Sci. USA 92,6592 -6596.[Abstract]
Smit, L., van der Horst, G. and Borst, J.
(1996). Sos, Vav, and C3G participate in B cell receptor-induced
signaling pathways and differentially associate with Shc-Grb2, Crk, and Crk-L
adaptors. J. Biol. Chem.
271,8564
-8569.
Soriano, P. (1994). Abnormal kidney development and hematological disorders in PDGF beta-receptor mutant mice. Genes Dev. 8,1888 -1896.[Abstract]
Stephens, L. E., Sutherland, A. E., Klimanskaya, I. V., Andrieux, A., Meneses, J., Pedersen, R. A. and Damsky, C. H. (1995). Deletion of beta 1 integrins in mice results in inner cell mass failure and peri-implantation lethality. Genes Dev. 9,1883 -1895.[Abstract]
Takahashi, Y., Imanaka, T. and Takano, T. (1996). Spatial and temporal pattern of smooth muscle cell differentiation during development of the vascular system in the mouse embryo. Anat. Embryol. (Berl). 194,515 -526.[Medline]
Tanaka, S., Morishita, T., Hashimoto, Y., Hattori, S., Nakamura, S., Shibuya, M., Matuoka, K., Takenawa, T., Kurata, T. and Nagashima, K. (1994). C3G, a guanine nucleotide-releasing protein expressed ubiquitously, binds to the Src homology 3 domains of CRK and GRB2/ASH proteins. Proc. Natl. Acad. Sci. USA 91,3443 -3447.[Abstract]
Tanaka, S., Ouchi, T. and Hanafusa, H. (1997).
Downstream of Crk adaptor signaling pathway: activation of Jun kinase by v-Crk
through the guanine nucleotide exchange protein C3G. Proc. Natl.
Acad. Sci. USA 94,2356
-2361.
Thomas, T., Voss, A. K., Chowdhury, K. and Gruss, P.
(2000). Querkopf, a MYST family histone acetyltransferase, is
required for normal cerebral cortex development.
Development 127,2537
-2548.
Turner, C. E. (2000). Paxillin and focal adhesion signalling. Nature Cell Biol. 2,E231 -236.[CrossRef][Medline]
Uemura, N. and Griffin, J. D. (1999). The
adapter protein Crkl links Cbl to C3G after integrin ligation and enhances
cell migration. J. Biol. Chem.
274,37525
-37532.
Voss, A. K. and Thomas, T. (2001). Identification of novel genes by gene trap mutagenesis. Methods Mol. Biol. 175,377 -396.[Medline]
Voss, A. K., Thomas, T. and Gruss, P. (1997). Germ line chimeras from female ES cells. Exp. Cell Res. 230,45 -49.[CrossRef][Medline]
Voss, A. K., Thomas, T. and Gruss, P. (1998a). Compensation for a gene trap mutation in the microtubule associated protein 4 locus by alternative polyadenylation and alternative splicing. Dev. Dyn. 212,258 -266.[CrossRef][Medline]
Voss, A. K., Thomas, T. and Gruss, P. (1998b). Efficiency assessment of the gene trap approach. Dev. Dyn. 212,171 -180.[CrossRef][Medline]
Voss, A. K., Thomas, T., Petrou, P., Anastassiadis, K., Scholer,
H. and Gruss, P. (2000). Taube nuss is a novel gene essential
for the survival of pluripotent cells of early mouse embryos.
Development 127,5449
-5461.
Wang, D. Z., Hammond, V. E., Abud, H. E., Bertoncello, I., McAvoy, J. W. and Bowtell, D. D. (1997). Mutation in Sos1 dominantly enhances a weak allele of the EGFR, demonstrating a requirement for Sos1 in EGFR signaling and development. Genes Dev. 11,309 -320.[Abstract]
Ylanne, J., Chen, Y., O'Toole, T. E., Loftus, J. C., Takada, Y. and Ginsberg, M. H. (1993). Distinct functions of integrin alpha and beta subunit cytoplasmic domains in cell spreading and formation of focal adhesions. J. Cell Biol. 122,223 -233.[Abstract]
Zhai, B., Huo, H. and Liao, K. (2001). C3G, a guanine nucleotide exchange factor bound to adapter molecule c-Crk, has two alternative splicing forms. Biochem. Biophys. Res. Commun. 286,61 -66.[CrossRef][Medline]