University of Saarland, Department of Anatomy, D-66421 Homburg/Saar, Germany
* These authors contributed equally to this work
Author for correspondence (e-mail: ankkri{at}med-rz.uni-sb.de)
Accepted March 21, 2001
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: TGF-ß, NGF, Cell death, Apoptosis, Chick, Retina
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The developing chick retina undergoes at least two discrete periods of PCD. Particularly in the central retina, the earlier period of PCD has been suggested to serve the purpose of creating space for incoming axons of retinal ganglion cells to form the optic nerve (embryonic day (E) 5-7;Cuadros and Rios, 1988; Martin-Partido et al., 1988), whereas PCD within the later period corresponds to the well-documented process of retinal ganglion cell death after innervation and synapse formation in the optic tectum (E10-E14; Rager, 1980). In the early period, apoptosis is induced by NGF acting via its p75 receptor (Frade et al., 1996; Frade and Barde, 1999). In contrast, brain-derived neurotrophic factor (BDNF) prevents retinal cell death in the early period of PCD (Frade et al., 1997). Both, BDNF and NGF are expressed in the avian retina during development, and their expressions peak around E12-E15 (Hallböök et al., 1996). In the E4 chick retina, blood-borne microglial cells have been identified as the source of death-inducing NGF in the developing eye, indicating an active role for macrophages in neuronal death (Frade and Barde, 1998).
Another growth factor that has been shown to induce PCD in the developing nervous system in vivo is transforming growth factor ß (TGF-ß; Krieglstein et al., 2000). TGF-ß was originally discovered because of its capacity to induce anchorage-independent growth of normal rat kidney cells and fibroblast cells (Moses et al., 1981; Roberts et al., 1981). It soon became apparent that the biological activity of TGF-ß was not restricted to this effect on cellular growth. The numerous functions of TGF-ß include cell cycle control, regulation of early development, differentiation, extracellular matrix formation, hematopoesis, angiogenesis, chemotaxis, immune functions and apoptosis (Roberts and Sporn, 1990; Lawrence, 1996; Böttner et al., 2000; Krieglstein et al., 2000; Massague and Chen, 2000). TGF-ß is also known as a contextually acting molecule, as its actions often depend on environmental cues, i.e. the cell type, the differentiational state of cells and the presence of other growth factors, best exemplified by its capacity either to stimulate or inhibit proliferation (Nathan and Sporn, 1991; Roberts and Sporn, 1990; Skoff et al., 1998; Ashley et al., 1998).
Three highly homologous, yet distinct isoforms of TGF-ß are known from several species including mammals and birds: TGF-ß1, TGF-ß2 and TGF-ß3 (Roberts and Sporn, 1990). TGF-ß proteins elicit their cellular responses through formation of heteromeric complexes of specific type I and type II serine/threonine kinase receptors (TßRI-TßRII; for reviews see Itoh et al., 2000; Massague and Chen, 2000). TßRII is a constitutively active kinase, which, upon ligand binding, initiates the signaling cascade that involves phosphorylation of the TßRI, and the propagation of the signal by Smad2 and Smad3. Activated phosphorylation then leads to nuclear translocation of these transcription factors and subsequent transactivation of several target genes (reviewed by Wrana and Attisano, 2000; Itoh et al., 2000).
TGF-ßs are expressed during the period of PCD of numerous neuron populations (Krieglstein et al., 1998a; Krieglstein et al., 1998b) including the developing retina. TGF-ß is released from cultured retinal pigment epithelial cells (Connor et al., 1988) and is expressed in the ontogenetically related ciliary epithelial cells (Helbig et al., 1991). At later developmental stages, TGF-ß2 was found to be the predominant endogenous isoform in the vitreous humor and retinal pigment epithelium (RPE) of monkey eyes (Pfeffer et al., 1994). Immunohistochemical evidence of TGF-ß in the retina was first obtained from human eyes, where immunoreactivity was reported to be associated with photoreceptor outer segments (Lutty et al., 1991; Lutty et al., 1993; Peffer et al., 1994).
As both NGF and TGF-ß have been shown to regulate PCD in vivo, this study addresses the questions of whether TGF-ß (like NGF) is required to regulate cell death in the avian retina and, if so, whether NGF and TGF-ß are dependent on each other or activate different pathways.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Immunoneutralization of TGF-ß and NGF in chicken embryos
Eggs were incubated for 3 days (until stage 19 of development) and were then opened at the blunt pole. The shell membrane was removed and 100 µl phosphate-buffered saline (PBS) solution containing 5 µg anti-NGF (Chemicon), 10 µg neutralizing monoclonal anti-TGF-ß 1/2/3 (R&D Systems), or a combination of both, was layered onto the chorioallantoic membrane. In additional experiments, the eggs were treated with 10 µg neutralizing monoclonal anti-TGF-ß 1/2/3 (R&D Systems) in combination with 20 µg recombinant NGF (Roche).
The antibodies used are known to block the biological activity of NGF and TGF-ß, respectively, as reported elsewhere (Korsching and Thoenen, 1987; Frade and Barde, 1998; Krieglstein et al., 2000). The eggs were sealed and returned to the incubator. This procedure was repeated each 24 hours until the embryos were sacrificed at day 6 (stage 29). Controls were treated with either 100 µl PBS solution or PBS containing 10 µg mouse IgG1 FITC conjugated (DAKO).
Heads of 6-day-old (stage 29) chicken embryos were fixed in Bouins fixative (picric acid, formaldehyde and glacial acetic acid) for several hours; the tissue was then dehydrated in a graded series of ethanol and embedded in paraffin wax. In addition, embryos were fixed for 6 hours in PBS/4% paraformaldehyde. After overnight incubation at 4°C in PBS (pH 7.3) containing 30% sucrose, the tissue was embedded in OCT compound (Tissue-Tek) and sectioned at 10 µm using a cryostat.
Immunohistochemistry
Paraffin sections (10 µm) were deparaffinized and heated in citrate buffer in a microwave oven to improve antigen retrieval (Jordan et al., 1997). Sections were pre-incubated with 10% normal goat serum (NGS) in PBS containing 0.3% Triton-X 100 for 1 hour. Immunostaining was performed using isoform-specific anti-TGF-ß, or anti-TGF-ß receptor (TßR) antibodies (TGF-ß1, sc-146; TGF-ß2, sc-90; TGF-ß3, sc-82; TßRI, sc-402; TßRII, sc-400; Santa Cruz) (Flanders et al., 1989) at dilutions of 1:50-1:200. The reaction was visualized (1) with 3,3'-diaminobenzidine (DAB; KEMENTEC), using the rabbit Vectastain Elite ABC avidin-biotin-kit (PK-6101; Vector); or (2) using Cy3- or FITC-conjugated goat anti-rabbit IgG secondary antibodies (ZYMED) at dilution of 1:100-1:200 in 10% NGS/PBS/Triton-X 100.
In addition, we used a polyclonal anti-human p75 antibody (1:100; Promega) to detect the neurotrophin receptor p75 (p75NTR) in the developing chick retina. Reactions were carried out on 10 µm cryosections after preincubation with 10% NGS and visualized using FITC-conjugated or Cy3-conjugated (ALEXA; 1:1000) secondary antibodies.
In all cases, PBS was substituted for the primary antisera as a control, in order to test for nonspecific labeling. No specific cellular staining was observed when the primary antiserum was omitted. Additionally, the specificity of the primary antibodies was tested and confirmed by western blotting (data not shown).
Some cross sections of control and anti-TGF-ß-treated embryos were counterstained with Hematoxylin and Eosin for morphological studies.
Acidic phosphatase labeling
Sections of E4 and E6 embryos were stained with a method previously described (Cuadros et al., 1992). In brief, sections were incubated for 4 hours in the medium described by Namba et al. (Namba et al., 1983) containing 0.01 M sodium tartrate, which reduces or abolishes acidic phosphatase activity in nearly all cells except macrophages (Cuadros et al., 1992). To test the specificity of the histochemical reaction, control sections were incubated in medium without substrate (naphtol AS BI phosphate) or in complete medium containing 0.01 M sodium fluoride, a specific inhibitor of acidic phosphatase activity (data not shown). No enzyme activity was found in these sections.
Quantification of cell death
Cell death was quantified in neural retinae from eye explants applying an enzyme-linked immunosorbent assay (ELISA) (Roche; cat. no. 1544675). This assay allows the quantification of soluble nucleosomes in cell lysates using a combination of antibodies that recognize histones and DNA (Frade et al., 1996; Frade et al., 1997). Retinae of control and treated animals were homogenized in 200 µl PBS and centrifuged at 20,000 g for 10 minutes. A portion of the supernatant was used to quantify proteins by standard methods, and the rest was diluted 1:10 in the buffer provided by the supplier and processed according to the manufacturers manual. Absorbence values were normalized with respect to the values obtained with control retinae.
TUNEL staining
As for the immunohistochemistry, heads of 6-day-old chicken embryos were fixed in Bouins solution and paraffin-embedded. Sections (10 µm) were deparaffinized and stained with in situ cell death detection kit (Roche) according to the manufacturers instructions.
BrdU staining
To test for proliferation, 100 µl BrdU stock solution (10 mM) was administered to control and anti-TGF-ß-treated E6 chick embryos. Embryos were sacrificed 4 hours later, the tissue fixed in 4% paraformaldehyde and cryosectioned (see above). Sections were stained with a monoclonal antibody to BrdU, according to the manufacturers instruction (Roche). Cell counts were taken from a defined area (visual field at 20x magnification) in the optic nerve region of control and anti-TGF-ß-treated retinae.
RT-PCR
Retinae of three control and three anti-TGF-ß treated animals were extracted in 2 ml RLT buffer (Qiagen) and homogenized in a rotor-stator homogenizer. The RNA was extracted according to the manufacturers instructions (RNeasy, Qiagen). An additional on-column DNAse digestion was performed to avoid cross contamination with genomic DNA. Equal amounts of RNA were reversed transcribed (Omniscript, Qiagen) for 1 hour. 2 µl of the RT-reaction mix were taken for PCR (25 cycles) with NGF- and GAPDH-specific primers (NGF (forward), CGACATCAAAGGCAAAGAG; NGF (reverse), GTCGATCCGGATAAATCTC; GAPDH (forward): GGGCTGCTAAGGCTGTGGGG; GAPDH (reverse), ATCAGCCTCTCCCACCTCCC). PCR products were separated in a 2% agarose gel and stained with ethidium bromide.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
To investigate whether the application of exogenous NGF blocks the cell death-decreasing effect of the TGF-ß neutralizing antibody, developing chick embryos were simultaneously treated with TGF-ß neutralizing antibody and recombinant NGF. As shown in Fig. 2E the application of NGF did not override the anti-TGF-ß effect, resulting in an equivalent decrease in apoptosis.
Increased size of the retina upon anti-TGF-ß treatment
Comparison of retinal morphology in HE-stained sections of control and anti-TGF-ß-treated chick embryos revealed a substantial change in eye morphology. Retinae of anti-TGF-ß treated embryos are (1) much thicker compared with control retinae (Fig. 3B,D), (2) folded and (3) often lose contact to adjacent cell layers (Fig. 3B). Measuring the thickness of the retinae in three random areas of each section (five sections per animal), we found that even in animals that show less drastic upfolding of the retina retinae of anti-TGF-ß treated animals were about 20 µm thicker than the average retina of control animals (97 µm; P=0.00027).
|
TGF-ß is a well-established inhibitor of proliferation in several systems (Lawrence, 1996; Gold, 1999). To test for alterations in cell proliferation, we applied BrdU to control and anti-TGF-ß-treated chick embryos, and studied BrdU incorporation in retinal sections. Fig. 4A-F shows that there was no apparent difference in BrdU incorporation in retinae of control or anti-TGF-ß treated embryos. Quantification of BrdU-positive cells in the central part of the retina (Fig. 4G) confirmed the staining results, suggesting no significant alteration in cell proliferation in response to neutralization of TGF-ß. However, cells treated with anti-TGF-ß may show some hyperplasia, which could account at least partially for the increased thickness of treated retinae.
|
|
|
|
|
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cell death in the chick retina and localization of endogenous TGF-ß
TGF-ß receptor (TßRII), TGF-ß2 and TGF-ß3 were detected immunocytochemically in the optic nerve region of the developing central chick retina at E6. This staining pattern overlaps with the region where cell death is most prominent in the early phase of PCD (Frade et al., 1997; Cuadros and Rios, 1988). In addition, TGF-ß3 staining was localized in retinal pigment epithelium (RPE) cells, in structures spanning the neuroepithelium, resembling Müller glial cells and fibers, and in the presumptive retinal ganglion cell (RGC) layer. TßRII is distributed evenly over the retinal surface and essentially expressed in all cell types. Its distribution overlaps with p75 expression in the optic nerve region and the presumptive ganglion cell layer (compare Fig. 1B with Fig. 7). Our results resemble the findings of Frade and Barde, who showed p75 expression in the RGC layer and optic nerve of E15.5 mice (Frade and Barde, 1999).
Localization of TGF-ß receptor and TGF-ß isoforms in the optic nerve region, an area where apoptosis is most prominent during the early period of PCD strongly suggests that TGF-ß plays a role in the regulation of ontogenetic cell death.
Reduction of endogenous TGF-ß prevents PCD in the developing chick retina
In the present study, neutralizing endogenous TGF-ß by application of an anti-TGF-ß antibody to developing chick embryos in ovo (E3 to E6) resulted in a substantial reduction of cell death revealed (1) by counting TUNEL-positive cells in the central retina and (2) comparing the amount of free nucleosome levels in retinal extracts (ELISA). These data are in accordance with the pro-apoptotic role of endogenous TGF-ß during ontogenetic neuron death in vivo, most recently demonstrated by Krieglstein et al. (Krieglstein et al., 2000). In this study, PCD of chick ciliary, dorsal root and spinal motoneurons was largely prevented after application of a neutralizing antibody that recognizes all three TGF-ß isoforms. Likewise, preventing TGF-ß signaling by blocking the TGF-ß receptor II during the period of PCD in the ciliary ganglion rescued all neurons that normally die. TUNEL staining revealed decreased numbers of apoptotic cells after TGF-ß antibody treatment, whereas application of exogenous TGF-ß was able to rescue the TGF-ß-deprived phenotype (Krieglstein et al., 2000).
The substantial changes in eye morphology seen in anti-TGF-ß-treated chick embryos strongly resembles retinal phenotypes of Apaf1 and caspase 3 mouse mutants (Pettmann and Henderson, 1998; Cecconi, 1999; Nicholson and Thornberry, 1997). Both molecules are acknowledged executioners of the apoptotic cascade and, similar to our observations, retinae of homozygous E12.5 Apaf1 mutants are noticeably thicker. At E14.5, the hyperplasic retina occupies most of the eye cup and is folded (Cecconi et al., 1998). Moreover, caspase 3-deficient mice that die perinatally with massive cell overgrowth in the CNS (as a result of apoptosis deficiency), likewise exhibit retinal hyperplasia. There are protrusions and indentations of the retinal neuroepithelium, causing compression on the lens (Kuida et al., 1996). Cross sections of retinae from caspase 3 mutants closely resemble the phenotype of anti-TGF-ß-treated chick embryos (Fig. 3B). Together, these data further add to the notion that the phenotype detected in the developing chick retina after reduction of endogenous TGF-ß is due to decreased PCD. However, as TGF-ß may also effect extracellular matrix assembly (Roberts et al., 1992), folding and detachment of the retina in anti-TGF-ß-treated chick embryos may result from an independent effect.
Comparison with NGF-induced cell death
As the anti-TGF-ß-dependent reduction of apoptotic cell death in the chick retina was comparable with that induced by application of NGF neutralizing antibodies (Frade et al., 1996; Fig. 2), it was important to elucidate the selective significance of each of the two growth factors. As co-application of NGF- and TGF-ß-neutralizing antibodies did not result in any further reduction of cell death, we conclude that both molecules, TGF-ß and NGF, act on the same populations of cells. If the pathways were clearly different, NGF would block the anti-TGF-ß effect. However, simultaneous application of both, TGF-ß neutralizing antibody and recombinant NGF did not affect the reduction in apoptosis evoked by TGF-ß neutralization. One might interpret these data as a hint that the biological response to NGF depends on the presence of active TGF-ß. However, the efficiency of NGF in inducing cell death in the chick retina seems to depend on its local presentation by microglial cells (Frade and Barde, 1998). Mechanistically, it is conceivable that TGF-ß and NGF may act consecutively, or may signal by feeding into a common downstream pathway.
One possibility concerning TGF-ß acting upstream of NGF may be a chemoattractant role of TGF-ß (Wahl et al., 1987; Yao et al., 1990; Pratt and McPherson, 1997) for microglial cells. NGF-presenting blood-borne microglial cells have been shown to be the cellular source of NGF and to mediate the NGF-dependent cell death (Frade and Barde, 1998). However, the failure to detect any apparent differences in distribution of microglial cells, retinal localization of NGF or p75NTR expression in anti-TGF-ß-treated retinae compared with untreated retinae suggests that endogenous NGF is not sufficient to induce retinal cell death on neutralization of TGF-ß. Alternatively, if TGF-ß is not upstream of NGF (i.e. it does not change NGF-related parameters), NGF may act upstream of TGF-ß. We therefore tested for changes in the expression pattern of TGF-ßs and receptor in anti-NGF treated E6 chick retinae and found an identical localization of TGF-ß2 and TGF-ß3 as well as TßRII, suggesting that NGF and TGF-ß do not act consecutively, but are both required to induce cell death.
TGF-ß is well known as a contextual acting molecule (Unsicker and Krieglstein, 2000; Nathan and Sporn, 1991), which means that many functions of TGF-ß are dependent on the presence of other growth factors. For example, TGF-ß acts synergistically with established neurotrophic factors to promote survival of many neuron populations (Krieglstein et al., 1995; Krieglstein et al., 1998a; Krieglstein et al., 1998b). TGF-ß synergizes with glial-derived neurotrophic factor to promote survival of peripheral and CNS dopaminergic neurons in vitro and in vivo (Krieglstein et al., 1998b; Schober et al., 1999). With regard to the regulation of apoptosis, TGF-ß has been shown to interact cooperatively with tumor necrosis factor (TNF
) to induce cell death in Schwann cells in vitro (Skoff et al., 1998). Neither TNF
nor TGF-ß alone is capable of inducing cell death in these cells alone, despite the fact that both growth factors induce cell death in a variety of different cell types (Smyth and Johnstone, 2000; Wahl et al., 2000; Gold, 1999). Taken together, the present study provides the first evidence to suggest that TGF-ß and NGF cooperate in inducing developmental cell death in the central retina in vivo. Notably, the TNF
receptor belongs to the same family of death receptors as p75NTR (Casaccia-Bonnefil et al., 1999). One might therefore speculate that under certain circumstances during embryonic development signaling through this receptor family may require TGF-ß to induce cell death.
We have shown for the first time that endogenous TGF-ß is required for cell death occurring in the developing chick retina in vivo, which was previously attributed to NGF. Our results strongly suggest that both NGF and TGF-ß cooperate in the regulation of PCD.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ashley, D. M., Kong, F. M., Bigner, D. D. and Hale, L. P. (1998). Endogenous expression of transforming growth factor beta1 inhibits growth and tumorigenicity and enhances Fas-mediated apoptosis in a murine high-grade glioma model. Cancer Res. 58, 302-309.[Abstract]
Barker, P. A. (1998). p75NTR: a study in contrasts. Cell Death Differ. 5, 346-356.[Medline]
Böttner, M., Krieglstein, K. and Unsicker, K. (2000). The TGF--ßs: structure, signaling and roles in nervous system development and functions. J. Neurochem. 75, 2227-2240.[Medline]
Casaccia-Bonnefil, P., Gu, C. and Chao, M. V. (1999). Neurotrophins in cell survival/death decisions. Adv. Exp. Med. Biol. 468, 275-282.[Medline]
Cecconi, F., Alvarez-Bolado, G., Meyer, B.I., Roth, K. A. and Gruss, P. (1998). Apaf1 (CED-4 homolog) regulates programmed cell death in mammalian development. Cell 94, 727-737.[Medline]
Cecconi, F. (1999). Apaf1 and the apoptotic machinery. Cell Death Differ. 6, 1087-1098.[Medline]
Connor, T., Roberts, A. B., Sporn, M. B., Davis, J. and Glaser, B. (1988). RPE cells synthesize and release transforming growth factor-ß: A modulator of endothelial cell growth and wound healing. Invest. Ophthalmol. Vis. Sci. 29, Suppl., 307.
Cuadros, M. A. and Rios, A. (1988). Spatial and temporal correlation between early nerve fiber growth and neuroepithelial cell death in the chick embryo retina. Anat. Embryol. 178, 543-551.[Medline]
Cuadros, M. A., Moujahid, A., Martin-Partido, G. and Navascues, J. (1992). Microglia in the mature and developing quail brain as revealed by a monoclonal antibody recognizing hemopoietic cells. Neurosci. Lett. 148, 11-14.[Medline]
Dechant, G. and Barde, Y. A. (1997). Signalling through the neurotrophin receptor p75NTR. Curr. Opin. Neurobiol. 7, 413-418.[Medline]
Flanders, K. C., Thompson, N. L., Cissl, D. S., Van Obberghen-Schilling, E., Baker, C. C., Kass, M. E., Ellingsworth, L. R., Roberts, A. B. and Sporn, M. B. (1989). Transforming growth factor-ß1: histochemical localization with antibodies to different epitopes. J. Cell Biol. 108, 653-660.[Abstract]
Frade, J. M., Rodriuez-Tebar, A. and Barde, Y. A. (1996). Induction of cell death by endogenous nerve growth factor through its p75 receptor. Nature 383, 166-168.[Medline]
Frade, J. M., Bovolenta, P., Martinez-Morales, J. R., Arribas, A., Barbas, J. A. and Rodriguez-Tebar, A. (1997). Control of early cell death by BDNF in the chick retina. Development 124, 3313-3320.
Frade, J. M. and Barde, Y. A. (1998). Microglia-derived nerve growth factor causes cell death in the developing retina. Neuron 20, 35-41.[Medline]
Frade, J. M. and Barde, Y. A. (1999). Genetic evidence for cell death mediated by nerve growth factor and the neurotrophin receptor p75 in the developing mouse retina and spinal cord. Development 126, 683-690.
Gold, L. (1999). The role for transforming growth factor-ß (TGF--ß) in human cancer. Crit. Rev. Oncol. 10, 303-360
Grande, J. P. (1997). Role of transforming growth factor-beta in tissue injury and repair. Proc. Soc. Exp. Biol. Med. 214, 27-40.[Abstract]
Hallböök, F., Bäckström, A., Kullander, K., Ebendal, T. and Carri, N. G. (1996). Expression of neurotrophins and Trk receptros in the avian retina. J. Comp. Neurol. 364, 664-676.[Medline]
Hamburger, V. and Hamilton, H. L. (1951). A series of normal stages in the development of the chick embryo. J. Morphol. 88, 49-92.
Hamburger, V. (1992) History of the discovery of neuronal death in embryos. J. Neurobiol. 23, 1116-1123.[Medline]
Helbig, H., Kittredge, K. L., Coca-Prados, M., Davis, J., Paslestine, A. G. and Nussenblatt, R. B. (1991). Mammalian ciliary body epithelial cells in culture produce transforming growth factor-ß. Graefes Arch. Clin. Exp. Ophthalmol. 229, 84-87.[Medline]
Itoh S., Itoh, F., Goumans, M. J. and ten Dijke, P. (2000) Signaling of transforming growth factor-ß family members through Smad proteins. Eur. J. Biochem. 267, 6954-6967.
Jacobson, M. D., Weil, M. and Raff, M. C. (1997). Programmed cell death in animal development. Cell. 88, 347-354.[Medline]
Jordan, J., Böttner, M., Schluesner, H., Unsicker, K. and Krieglstein, K. (1997). Bone morphogenetic proteins: neurotrophic roles for midbrain dopaminergic neurons and implications of astroglial cells. Eur. J. Neurosci. 9, 1699-1710.[Medline]
Kaplan, D. R., Hempstead, B. L., Martin-Zanca, D., Chao, M. V., Parada, L. F. (1991) The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science 252, 554-558.[Medline]
Korsching, S. and Thoenen, H. (1987). Two-site immunoassay for nerve growth factor. In Methods in Enzymology: Peptide Growth Factors. Vol. 147, Part B (ed. D. Barnes and D. A. Sirbasku), pp. 167-185. New York: Academic Press.
Krieglstein, K., Suter-Crazzolara, C., Fischer, W. H. and Unsicker, K. (1995). TGF--ß superfamily members promote survival of midbrain dopaminergic neurons and protect them against MPP toxicity. EMBO J. 14, 736-742.[Abstract]
Krieglstein, K., Farkas, L. and Unsicker, K. (1998a) TGF--ß regulates the survival of ciliary ganglionic neurons synergistically with ciliary neurotrophic factor and neurotrophins. J. Neurobiol. 37, 563-572.[Medline]
Krieglstein, K., Henheik, P., Farkas, L., Jaszai, J., Galter, D., Krohn, K. and Unsicker, K. (1998b) Glial cell line-derived neurotrophic factor requires transforming growth factor-beta for exerting its full neurotrophic potential on peripheral and CNS neurons. J.Neurosci. 18, 9822-9834.
Krieglstein, K., Richter, S., Farkas, L., N. Schuster, N. Dünker, Oppenheim, R. W. and Unsicker, K. (2000). Reduction of endogenous TGF--ß prevents ontogenetic neuron death. Nat. Neurosci. 3, 1085-1090.[Medline]
Kuida, K., Zheng, T. S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic, P. and Flavell, R. A. (1996). Decreased apoptosis in the brain and premature lethality in CPP32-deficient mice. Nature 384, 368-372.[Medline]
Lawrence, D. A. (1996). Transforming growth factor-beta: a general review. Eur. Cytokine Netw. 7, 363-374.[Medline]
Levi-Montalcini, R. (1987). The nerve growth factor 35 years later. Science 237, 1154-1162.[Medline]
Lewin, G. R. and Barde, Y. A. (1996). Physiology of the neurotrophins. Annu. Rev. Neurosci. 19, 289-317.[Medline]
Lutty, G. A., Ikeda, K., Chander, C. and McLeod, D. S. (1991). Immunohistochemical localization of transforming growth factor-ß in human photoreceptors. Curr. Eye Res. 10, 61-74.[Medline]
Lutty, G. A., Merges, C., Threlkeld, A. B., Crone, S. and McLeod, D. S. (1993). Heterogeneity in localization of isofomrs of TGF--ß in humna retina, vitreous, and choroid. Invest. Ophthalmol. Vis. Sci. 34, 477-487.[Abstract]
Martin-Partido, G., Rodriguez-Gallardo, L., Alvarez, I. S. and Navascues, J. (1988). Cell death in the ventral region of the neural retina during the early development of the chick embryo eye. Anat. Rec. 222, 272-281.[Medline]
Massague, J. and Chen, Y. G. (2000). Controlling TGF--beta signaling. Genes Dev. 14, 627-644.
Metzstein, M. M., Stanfield, G. M. and Horvitz, H. R. (1998). Genetics of programmed cell death in C. elegans: past, present and future. Trends Genet. 14, 410-416.[Medline]
Moses, H. L., Branum E. L. Proper J. A. and Robinson R. A. (1981). Transforming growth factor production by chemically transformed cells. Cancer Res. 41, 2842-2848.[Abstract]
Namba, M., Dannenberg, A. M. and Tanaka, F. (1983). Improvement in the histochemical demonstration of acid phosphatase, ß-galactosidase and nonspecific esterose in glycol methacrylate tissue sections by cold temperature embedding. Stain Technol. 58, 207-213.[Medline]
Nathan, C. and Sporn, M. (1991). Cytokines in context. J. Cell Biol. 113, 981-986.[Medline]
Nebreda, A. R., Martin-Zanca, D., Kaplan, D. R., Parada, L. F. and Santos, E. (1991). Induction by NGF of meiotic maturation of Xenopus oocytes expressing the trk proto-oncogene product. Science 252, 558-561.[Medline]
Nicholson, D. W. and Thornberry, N. A. (1997). Caspases: killer proteases. Trends Biochem. Sci. 22, 299-306.[Medline]
Oppenheim, R. W. (1991). Cell death during development of the nervous system. Annu. Rev. Neurosci. 14, 453-501.[Medline]
Pettmann, B. and Henderson, C. E. (1998). Neuronal cell death. Neuron 4, 633-647.
Pfeffer, B. A., Flanders, K. C., Guerin, C. J., Danielpour, D. and Anderson, D. H. (1994). Transforming growth factor-beta 2 is the predominant isoform in the neural retina, rtinal pigment epithelium-choroid, and vitreus of the monkey eye. Exp. Eye Res. 59, 323-333.[Medline]
Pratt, B. M. and McPherson, J. M. (1997). TGF--ß in the central nervous system: Potential roles in ischemic injury and neurodegenerative diseases. Cytokine Growth Factor Rev. 8, 267-292.[Medline]
Rager, G. H. (1980). Development of the retinotectal projection in the chicken. Adv. Anat. Embryol. Cell Biol. 63, 1-92.[Medline]
Roberts A. B., Anzano M. A., Lamb L. C., Smith J. M. and Sporn M. B. (1981). New class of transforming growth factors potentiated by epidermal growth factor: isolation from non-neoplastic tissues. Proc. Natl. Acad. Sci USA 78, 5339-5343.[Abstract]
Roberts, A. B. and Sporn, M. B. (1990). The transforming growth factor-ßs. In Handbook of Experimental Pharmacology. Peptide Growth Factors and their Receptors. Vol. 95/I. (ed. M. B. Sporn and A. B. Roberts), pp. 419-472. Heidelberg, Germany: Springer-Verlag.
Roberts, A.B., McCune, B.K. and Sporn, M.B. (1992). TGF--beta: regulation of extracellular matrix. Kidney Int. 41, 557-559.[Medline]
Schober A., Hertel R., Arumae U., Farkas L., Jaszai J., Krieglstein K., Saarma M and Unsicker K. (1999). Glial cell line-derived neurotrophic factor rescues target-deprived sympathetic spinal cord neurons but requires transforming growth factor-beta as cofactor in vivo. J Neurosci. 19, 2008-2015.
Silver, J. and Sidman, R. L. (1980). A mechanism for the guidance and topographic patterning of retinal ganglion cell axons. J. Comp. Neurol. 189, 101-111.[Medline]
Silver, J. and Sapiro, J. (1981). Axonal guidance during development of the optic nerve: the role of pigmented epithelia and other extrinsic factors. J. Comp. Neurol. 202, 521-538.[Medline]
Skoff, A. M., Lisak, R. P., Bealmea,R. B. and Benjamins, J. A. (1998). TNF-alpha and TGF--beta act synergistically to kill Schwann cells. J. Neurosci. Res. 53, 747-756.[Medline]
Smyth, M. J. and Johnstone, R. W. (2000). Role of TNF in lymphocyte-mediated cytotoxicity. Microsc. Res. Tech. 50, 196-208.[Medline]
Unsicker, K. and Krieglstein, K. (2000). Co-activation of TGF--ss and cytokine signaling pathways are required for neurotrophic functions. Cytokine Growth Factor Rev. 11, 97-102.[Medline]
Wahl, S. M., Hunt, D. A., Wakefield, L., McCartney-Francis, N., Wahl, L.M., Roberts, A. B. and Sporn, M. B. (1987). Transforming growth factor beta (TGF--ß) induces monocyte chemotaxis and growth factor production. Proc. Natl. Acad. Sci. USA 84, 57788-57792.
Wahl, S. M., Orenstein, J. M. and Chen W. (2000). TGF--beta influences the life and death decisions of T lymphocytes. Cytokine Growth Factor Rev. 11, 71-79.[Medline]
Wrana, J. L. and Attisano, L. (2000). The Smad pathway. Cytokine Growth Factor Rev. 11, 5-13.[Medline]
Yao, J., Harvath, L., Gilbert, D. L. and Colton, C. A. (1990). Chemotaxis by a CNS macrophage, the microglia. J. Neurosci. Res. 27, 36-42.[Medline]