1
Division of Stem Cell Regulation, Institute of Medical Science, The University
of Tokyo, Tokyo 108-8639, Japan
2
Laboratory of DNA Biology and Embryo Engineering, Institute of Medical
Science, The University of Tokyo, Tokyo 108-8639, Japan
3
Department of Life Sciences, The University of Tokyo, Tokyo 153-8902,
Japan
4
Mouse Cancer Genetics Program, National Cancer Institute at Frederick,
Frederick, MD 21702-1201, USA
5
Department of Pathology, Amgen, Thousand Oaks, CA 91320, USA
*
Author for correspondence (e-mail:
ryuichi{at}ims.u-tokyo.ac.jp
)
Accepted 25 May 2001
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Sall1, Kidney, Townes-Brocks syndrome, Mouse
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Humans have at least three sal-related genes (SALL1,
SALL2 and SALL3) (Kohlhase et al.,
1996; Kohlhase et al.,
1999a
). SALL1 is
located on chromosome 16q12.1 and heterozygous mutations of SALL1
lead to Townes-Brocks syndrome, an autosomal dominant disease characterized by
dysplastic ears, preaxial polydactyly, imperforate anus, and (less commonly)
kidney and heart anomalies (Kohlhase et al.,
1998
). The incidence of kidney
abnormality ranges from 20% to 62.5%, depending on the report in question
(Kohlhase et al., 1999b
;
O'Callaghan and Young, 1995
).
All mutations are localized 5' to the triple zinc-finger motif and
result in premature truncation (Kohlhase et al.,
1998
; Kohlhase et al.,
1999b
; Marlin et al.,
1999
).
The mouse also has three Sal genes. The previously reported msal
proved to be a homolog of human SALL3 and was renamed Sall3
(Ott et al., 1996; Kohlhase et
al., 1999a
). Homologs of
SALL1 and SALL2 have also been reported (Buck et al.,
2000
; Kohlhase et al.,
2000
).
The kidney develops in three stages: pronephros, mesonephros and metanephros. The nephric duct (Wolffian duct) develops in a craniocaudal direction from the intermediate mesoderm and acts upon surrounding mesenchyme as an inducer of epithelial transformation to nephric tubules. The pronephric tubules, mesonephric tubules and the anterior portion of the Wolffian duct eventually degenerates; it is the metanephros that becomes the permanent kidney in mammals. Although the pronephros represents a true excretory organ in fish and amphibians, it remains a rudimentary and transient structure in the mouse. The mesonephros appears after and caudal to the pronephros. In metanephros development, the metanephric mesenchyme induces sprouting of the ureteric bud from the caudal region of the Wolffian duct. Signals from the mesenchyme cause further branching of the ureteric bud, thus forming the kidney collecting system. Reciprocally, the ureteric bud invades the mesenchyme and induces epithelialization and differentiation of the mesenchyme into the nephron (glomerular, proximal tubular and distal tubular epithelium).
Molecular mechanisms of kidney development have been revealed mostly by
gene targeting. In Pax2 null mutants (paired-box transcription
factor), the Wolffian duct develops only partially and metanephric development
does not occur (Torres et al.,
1995). In mice deficient for a
zinc-finger transcription factor WT-1 (Wilm's tumor suppressor; Wt1
Mouse Genome Informatics), the ureter never reaches the mesenchyme and
consequently the mesenchyme undergoes apoptosis (Kreidberg et al.,
1993
). WT-1 is considered to
control expression of signals of the mesenchyme that regulate induction and
growth of the ureteric bud. A member of the TGFß superfamily, GDNF (glial
cell line-derived neurotrophic factor) expressed in the mesenchyme, acts on a
receptor tyrosine kinase Ret distributed in the ureteric bud epithelium and
induces branching of the ureter (Durbec et al.,
1996
; Trupp et al.,
1996
). Thus, the null mutants
of GDNF and Ret show perturbation of ureter invasion (Moore et al.,
1996
; Pichel et al.,
1996
; Sanchez et al.,
1996
; Schuchardt et al.,
1994
). Reciprocal signals from
the ureteric bud to the mesenchyme remained unidentified for a long period.
Recently, LIF (leukemia inhibitory factor) and its related cytokines were
reported to be ureter-derived regulators for mesenchymal-to-epithelial
conversion, though mice deficient in the common receptor gp130 show only
reduced nephron development with the initial induction occurring normally
(Barasch et al., 1999
). Mice
that lack Wnt4 fail to form pretubular aggregates, a transitional state from
mesenchyme to tubules, but other aspects of ureteric and mesenchymal
development are unaffected (Stark et al.,
1994
). Wnt4 acts as an
autoinducer of the mesenchyme-to-epithelial transition that may be activated
downstream of the LIF/gp130 system. BMP7 belongs to a bone morphogenetic
protein family and an initial ureter-mesenchymal interaction is unaffected in
Bmp7 mutants (Dudley et al.,
1995
; Luo et al.,
1995
). The subsequent
differentiation and survival of the mesenchyme does not occur, thus indicating
that BMP7 may be a maintenance signal for the mesenchyme.
Many of the genes expressed in the metanephros are also found in the
pronephros. We earlier established an in vitro induction system for pronephros
in Xenopus (Moriya et al.,
1993; Uochi and Asashima,
1996
). Animal caps, a
presumptive ectoderm of Xenopus embryos at the blastula stage,
differentiate into three-dimensional pronephric tubules in three days in
chemically defined saline solution upon treatment with activin and retinoic
acid. We have used this system to identify molecules expressed in pronephros
and potentially in mesonephros and metanephros (Sato et al.,
2000
). One of the genes we
isolated was Xsal-3, a newly identified sal member of
Xenopus, which was expressed in the pronephros and the brain (Onuma
et al., 1999
). We then cloned
a member of the murine Sal family from the developing kidney, which proved to
be a mouse homolog of human SALL1. We now report cloning, expression
patterns and loss-of-function studies of mouse Sall1. Our data show
that murine Sall1 is essential for initial inductive events for
kidney development.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Interspecific mouse backcross mapping
Interspecific buckcross progeny were generated by mating (C57BL/6J x
Mus spretus) F1 females and C57BL/6J males as described
(Copeland and Jenkins, 1991). A
total of 205 N2 mice were used to map the Sall1 locus. DNA
isolation, restriction enzyme digestion, agarose gel electrophoresis, Southern
blot transfer and hybridization were essentially as described (Jenkins et al.,
1982
). The Sall1 probe used
was a ClaI-EcoRI 1.2 kb fragment (probe B). A fragment of
4.7 kb was detected in SphI digested C57BL/6J DNA and a fragment of
6.1 kb was detected in SphI digested M. spretus DNA. The
presence or absence of the 6.1 kb SphI M. spretus-specific
fragment was followed in backcross mice.
A description of the probes and RFLPs for the loci linked to
Sall1, including Cbln1 and Scyd1, has been reported
(Kavety et al., 1994; Rossi et
al., 1998
). Recombination
distances were calculated using Map Manager, version 2.6.5. Gene order was
determined by minimizing the number of recombination events required to
explain the allele distribution patterns.
Generation of Sall1-deficient mice
The Sall1-del targeting vector was constructed by incorporating
5' SmaI-EcoRI 5.4 kb fragment and 3'
HindIII-ClaI 2.8 kb fragment into a vector that contained
the neomycin-resistant (neor) gene (pMC1-neo polyA) and a
diphtheria toxin A subunit (pMC1-DTA) in tandem. The 5' fragment was
subcloned into a ClaI site 5' of the neor gene, and
the 3' fragment was cloned into an EcoRV site 3' of the
neor gene. For the Sall1-lacZ construct,
NotI-XhoI lacZ fragment (3.7 kb) from
pxCABlacZ (obtained from RIKEN, Japan) was fused in frame to 5'
SmaI-EcoRI 5.4 kb fragment and the resultant
SmaI-XhoI 9.1 kb fragment was cloned into the
ClaI-XhoI site of the vector described above. Both
constructs were linearized with NotI.
CCE embryonic stem cells were used for the Sall1-del construct and E14.1 cells (provided by Dr N. Yoshida) were used for the Sall1-lacZ construct. CCE and E14.1 cells were plated in mitomycin C-treated STO cell lines and primary embryonic fibroblasts, respectively, and clones resistant to G418 (250 µg/ml) were screened using Southern blots. The genomic DNA from clones was digested with HindIII, electrophoresed through 0.7% agarose, transferred to nylon membrane (HybondN+, Amersham-Pharmacia), and hybridized to a radioactive probe. The probe used to screen the samples was a ClaI-EcoRI 1.2 kb fragment downstream of 3' homology (probe B). The samples were also digested with BamHI or XhoI, and hybridized with probe B or 5' probe (probe A), respectively, to confirm the correct homologous recombination. A probe corresponding to the neor sequence was also used to verify that only one copy of the vector was integrated into the genome. Of 118 clones, eight were correctly targeted for Sall1-del, and 15 of 116 were targeted for Sall1-lacZ.
Recipient blastocysts were from C57BL/6N mice. Chimeric animals were bred with C57BL/6N females. Mutant animals studied were of F2 and F3 generation. Mice were genotyped using Southern blots or genomic PCR. The primer sequences used for PCR were as follows: GTACACGTTTCTCCTCAGGAC and TCTCCAGTGTGAGTTCTCTCG for Sall1 (200 bp); and AAGGGACTGGCTGCTATTGG and ATATCACGGGTAGCCAACGC for neor (420 bp). The same primers for Sall1 were used for RT-PCR to show the absence of Sall1 transcript.
Many Sall1-lacZ heterozygotes died in the perinatal period without any apparent histological abnormalities. We assume that death was probably due to the toxicity of lacZ, as such lethality was not observed in Sall1-del heterozygotes. The surviving Sall1-lacZ heterozygotes bred normally and resultant homozygous mice showed phenotypes identical to those of Sall1-del homozygous mice.
Histological examination
Samples were fixed in 10% formalin and processed for paraffin-embedded
sectioning (6 µm), followed by double staining with Hematoxylin and Eosin.
X-gal staining was as described (Koseki et al.,
1991). All of the X-gal
staining patterns of heterozygous Sall1-lacZ mice described were
reconfirmed by in situ hybridization. For detection of apoptosis, ApopTag
Fluorescein Direct Kits (Intergen) were used for paraffin-embedded sections
and counterstained with Propidium Iodide. Omission of terminal
deoxynucleotidyl transferase gave no background signals.
In situ hybridization
In situ hybridization was carried out using digoxigenin-labeled antisense
riboprobes. Samples were fixed overnight in 4% paraformaldehyde (PFA) in
phosphate-buffered saline (PBS), then in sucrose and embedded with OCT
compound. Sections were cut, airdried and then fixed in 4% PFA for 15 minutes
at room temperature. After washing with PBS, sections were treated with
proteinase K (5 µg/ml for 15 minutes), refixed with PFA, washed with PBS,
treated with 0.2 M hydrochloride for 10 minutes and washed again with PBS.
Samples were acetylated for 10 minutes, washed with PBS and dehydrated with
ethanol. Hybridization mixture (50% formamide, 10 mM Tris-HCl pH 7.6, 200
µg/ml tRNA, 1x Denhardt's solution, 10% dextran sulfate, 600 mM NaCl,
0.25% SDS, 1 mM EDTA, and the probe) was then applied on top of the section,
overlaid with parafilm, and incubated overnight at 70°C in a humidified
chamber. Sections were washed for 30 minutes with 2xSSC/50% formamide at
70°C, treated with RNase for 30 minutes at 37°C, washed with
2xSSC for 20 minutes at 70°C and washed twice with 0.2xSSC for
20 minutes each at 70°C. Sections were rinsed with buffer 1 (100 mM
Tris-HCl pH7.5, 150 mM NaCl), blocked with 10% sheep serum in buffer 1 for 1
hour and incubated with alkaline phosphatase-conjugated sheep polyclonal
antidigoxigenin antibody (Roche) diluted 1:4000 in buffer 1 for 30 minutes.
After washing twice with buffer 1, alkaline phosphatase activity was detected
in the presence of NBT/BCIP (Roche).
A 800 bp XhoI-SpeI fragment of Sall1 cDNA was subcloned into pBluescript II KS- (Stratagene) and a transcript was generated with T7 polymerase. Wnt4 was a gift from Dr Andrew P. McMahon. cDNA for other probes was isolated by PCR, subcloned into pCRII (Invitrogen) and sequenced. None of the sense probes produced any signals.
Organ culture of metanephric mesenchyme
Metanephric rudiments are dissected from 11.5 dpc embryos and cultured at
air-fluid interface on Transwell (0.4 µm) (Corning) supplied with DMEM plus
10% fetal calf serum. For recombination experiments with spinal cord,
mesenchyme at 11.25 dpc was used to minimize apoptosis in the mutants. The
mesenchyme was removed from the ureteric bud after 5 minutes incubation with
0.2% collagenase (Sigma) and cultured in direct contact with spinal cord on
Transwell. As a specific size of the mesenchyme is required for the efficient
response to spinal cord, left and right mesenchyme were combined and
cultured.
GenBank Accession Number
The DDBJ/EMBL/GenBank Accession number for the Sall1 cDNA sequence
reported in this paper is AB051409.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Generation of Sall1-deficient mice
To examine developmental functions of this mouse homolog of SALL1,
we inactivated it in the mouse using embryonic stem cells
(Fig. 2A, B). Sall1
gene consists of three exons, the first intron being approximately 9 kb. Most
zinc-finger domains are located in exon 2 and the last 10th zinc-finger domain
is separated by a short second intron. We generated two types of targeting
constructs: one deleted the entire coding sequence, except for the N-terminal
52 amino acids, thus eliminating all the zinc-finger motifs
(Sall1-del); the other deleted the same region and lacZ was
fused in frame to N-terminal 52 amino acids (Sall1-lacZ). Homologous
recombinants were obtained from both constructs and chimeras from both
transmitted the mutations through the germline. Mutant mice from the two
constructs showed essentially the same phenotypes. Mice were genotyped by
Southern blots and genomic PCR (Fig. 2C,
D). RT-PCR revealed the absence of the Sall1 transcript
in the homozygous mutant mice (Fig.
2E). In situ hybridization also confirmed the absence of the
Sall1 transcript, but not Sall2, in the mutant mice (data
not shown).
|
Expression patterns of Sall1
Whole-mount X-gal staining of Sall1-lacZ heterozygous embryo at
11.5 dpc showed abundant expression of Sall1 in limb buds and a
relatively weaker signal in the spinal cord and the brain
(Fig. 3A). Staining of 14.5 dpc
embryo showed expression in limb buds, anorectal region, developing olfactory
bulb, nose and eye (Fig. 3B). Transverse section of 10.5 and 11.5 dpc showed Sall1 staining in
ventromedial parts of otic vesicles and endocardium
(Fig. 3C,D). In kidney
development, Sall1 expression was observed in the nephrogenic
primordium at 10.5 dpc (Fig.
3E). At 11.5 dpc, Sall1 was expressed in mesonephric
tubules and Wolffian ducts, and in the metanephric mesenchyme surrounding the
ureteric bud (Fig. 3F,G),
findings that were reconfirmed by in situ hybridization
(Fig. 3H). Expression of
Sall1 was reduced in the caudal area of the Wolffian duct and was
undetectable in ureteric buds. At 14.5 dpc, Sall1 expression was
observed in the mesenchyme around the ureteric buds and weakly in comma-shaped
bodies of metanephric tubules, but not in glomeruli, in the cortical regions
of the developing kidney (Fig.
3I,J). In the newborn, Sall1 staining was observed in
kidneys, hearts, livers, brain regions surrounding ventricles and olfactory
bulbs (data not shown). All this evidence was reconfirmed by in situ
hybridization. Thus, Sall1-lacZ mice serve as useful tools to monitor
Sall1 expression and Sall1 was shown to be expressed in
tissues affected in Townes-Brocks syndrome, namely limb, ear, anus, heart and
kidney. This expression pattern partly overlaps that of mouse Sall2
(data not shown) and msal (Sall3) (Ott et al.,
1996; Ott et al.,
2001
).
|
Kidney defects in Sall1-deficient mice
Homozygous mice were born at Mendelian frequency but all died within 24
hours after birth without suckling. Kidney agenesis or severe dysgenesis were
present (Fig. 4). Nine out of
28 mice (32.1%) had no kidneys or ureters, bilaterally
(Fig. 4B). Eight mice (28.6%)
had unilateral kidney agenesis and hypoplasia on the other side. Eleven mice
(39.3%) had two small remnant kidneys (Fig.
4C). In either case, the bladder contained no urine. Histological
examination of the remnant kidneys showed a disorganized cortical structure,
shrunken glomeruli, necrotic proximal tubules and multiple cysts
(Fig. 4F,G). Development of
other organs including brain, adrenal glands, bladder, testis or ovary was
normal. There was no limb deformity, anorectal anomaly or ear anomaly, all
characteristic of Townes-Brocks syndrome. The layer structure of olfactory
bulbs in Sall1 mutant newborn mice was slightly disorganized, though
adult phenotypes of Sall1 mutation could not be determined, owing to
the lethality of the mutant mice (data not shown).
|
At day 11.5 of gestation, the ureteric bud invades into metanephric mesenchyme and subsequent reciprocal interaction between these two tissues leads to development of a metanephric kidney (Fig. 5A). In the Sall1-null mice, mesonephros development was normal and morphologically distinct metanephric mesenchyme was formed, albeit reduced in size (Fig. 5B). By contrast, the ureteric bud formed but failed to invade the metanephric mesenchyme. Subsequent differentiation of mesenchyme and branching of the ureteric bud did not occur on either side (44.4%, n=18). Some mutants showed invasion of ureteric bud on one side (38.9%) or both (16.7%), but mesenchymal condensation and ureteric branching were significantly poorer than in wild-type littermates (Fig. 5C). Consequently, at day 12.5 and 14.5 of gestation, kidneys in mutant mice were absent or small, with poorly differentiated tubules and ureteric components (Fig. 5D-I). Furthermore, several apoptotic cells with dark nuclear fragments were found in the mesenchyme at 11.5 dpc and TUNEL analysis confirmed apoptosis in the mesenchyme at this stage (Fig. 5J,K). Thus, loss of Sall1 leads to a failure of ureteric bud invasion into mesenchyme and subsequent apoptosis of the mesenchyme. This phenotype is more severe than findings in mutant mice deficient in Wnt4, or BMP7, in which ureter-mesenchyme interaction does occur to some extent. The variability of the phenotypes may be due to the mixed genetic background of the animals analyzed or to residual activity of other Sall genes. Sall2 and Sall3 were expressed in developing kidney (data not shown).
|
Heterozygous mice were apparently normal and did not show phenotypes of Townes-Brocks syndrome, such as dysplastic ears, preaxial polydactyly, imperforate anus and renal anomaly.
Downregulation of metanephric mesenchymal genes in
Sall1-deficient mice
To examine kidney phenotypes in more detail, we next examined expression
patterns of several well-characterized molecular markers of either mesenchyme
or ureteric bud-derived cells.
Pax2-deficient mice do not develop mesonephric tubules and lack
ureteric buds (Torres et al.,
1995). In metanephros at 11.5
dpc, Pax2 is expressed both in ureteric bud and condensed mesenchyme
surrounding the ureteric bud (Fig.
6A). In Sall1 mutant mice, expression of Pax2
was unaltered in the ureteric bud, though no bulging of ureteric bud tip was
observed (Fig. 6B). Expression
domain size of the mesenchymal component of Pax2 was significantly
reduced, thereby reflecting the size of the mesenchyme. Thus, Pax2
expression in the mutant mice was consistent with the histological
characteristics: failure of the ureteric bud to invade and reduced size of the
mesenchyme.
|
Mice deficient in the tyrosine-kinase type receptor, Ret, as well as its
ligand GDNF, show failure of ureteric bud invasion and subsequent failure of
mesenchymal differentiation (Moore et al.,
1996; Pichel et al.,
1996
; Sanchez et al.,
1996
; Schuchardt et al.,
1994
). Ret was exclusively
expressed in the ureteric bud in the wild type, and its expression in
Sall1 mutant mice was unaltered, though bulging of ureteric bud tip
was not evident (Fig. 6C,D).
This result, together with that of ureteric bud component of Pax2, indicates
that markers of ureteric bud were not affected in the absence of
Sall1.
GDNF is a ligand for Ret and is expressed in the metanephric mesenchyme.
GDNF is weakly expressed in the uninduced mesenchyme and strongly upregulated
upon ureteric bud invasion (Fig.
6E). Sall1 mutant mice showed a reduced expression of
GDNF at 11.5 dpc (Fig. 6F).
GDNF expression before ureteric bud invasion (10.5 dpc) was, however,
unaffected in the mutant mice (data not shown). Expression of Eya1, a putative
upstream molecule of GDNF (Xu et al.,
1999), was not significantly
affected in the mutants at 10.5 or 11.5 dpc, except for the reduced size of
the expression domain at 11.5 dpc (data not shown).
BMP7-deficient mice show normal initial metanephric induction, though the
size of the kidney is reduced (Dudley et al.,
1995; Luo et al.,
1995
). BMP7 is expressed both
in the ureteric bud and in the mesenchyme
(Fig. 6G). In Sall1
mutant mice, BMP7 expression was reduced in the mesenchyme and relatively
unaffected in the ureteric bud (Fig.
6H).
Wnt4 is required for epithelialization of the induced mesenchyme but not
for the initial induction by ureter (Stark et al.,
1994). It is expressed in
mesenchymal cells on sides of the ureteric bud at 11.5 dpc and correlates to
the site where the first pretubular aggregates form
(Fig. 6I).
Sall1-deficient mice showed significantly reduced Wnt4 expression
(Fig. 6J).
WT-1 is expressed in the metanephric mesenchyme and its absence leads to
failure of mesenchymal induction (Kreidberg et al.,
1993). Expression domain size
of WT-1 was also significantly reduced in the absence of Sall1
(Fig. 6K,L).
Thus, Sall1 deficiency led to remarkable downregulation of some mesenchymal markers (GDNF, BMP7, Wnt4) and reduced size of expression domain of others (Pax2 and WT-1). These data are consistent with histological findings that Sall1 mutant metanephric mesenchyme was significantly reduced in size and was not invaded by the ureteric bud. Downregulation of the markers suggests that the mutant mesenchyme is not induced properly by signals from the ureteric bud. None of the mesenchymal markers was, however, completely absent, but was reduced, thus indicating that specification of the mesenchyme occurs in Sall1 deficiency.
Tubule induction in Sall1-deficient metanephric
mesenchyme
To further demonstrate that kidney development is impaired in
Sall1 deficient mice at the initial stage, kidney rudiments were
isolated from Sall1 mutant mice at 11.5 dpc and cultured in vitro
(Fig. 7A-C). All wild-type or
heterozygous rudiments developed into a fully branched kidney structure in 3
days (n=7 and n=20, respectively). Sall1 mutants,
however, formed no (n=9) or only small numbers (n=5) of
branched structures (if any), findings that are consistent with phenotypes in
vivo.
|
To determine if the kidney abnormality in Sall1-deficient mice was
due to an autonomous cell defect of metanephric mesenchyme, or to the
imcomplete invasion of the ureteric bud that is a normal inducer, the mutant
mesenchyme was recombined with the spinal cord. The mesenchyme cultured in
vitro degenerates when removed from the ureteric bud. When recombined with the
spinal cord, however, 11 out of 11 wild-type and 15 of 16 heterozygous
mesenchymes formed renal tubules within 5 days, as shown in
Fig. 7D (Saxen,
1987). Wnt family members
expressed in spinal cord bypass the inductive signal from the ureter by
mimicking the normal mesenchymal action of Wnt4 (Kispert et al.,
1998
). Eleven out of 12
metanephric mesenchymes from Sall1-deficient mice formed renal
tubules when recombined with the wild-type or heterozygous spinal cord
independent of the severity of the ureteric invasion impairment
(Fig. 7E). This indicates that
the Sall1-deficient mesenchyme is competent with respect to
epithelial transformation. Induced mutant tubules were consistently smaller
than those of wild type or heterozygotes, perhaps because of reduced cell
number of the mutant mesenchyme at the time of dissection. These data
demonstrate that there is no inherent defect in the ability of
Sall1-deficient metanephric mesenchyme to make tubules upon
induction; thus, the kidney phenotype of the Sall1-deficient mice is
likely to be primarily caused by the lack of invasion of the ureteric bud that
is a normal inducer.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Based on impaired invasion of the ureteric bud in Sall1-deficient kidney (Fig. 5) and responsiveness of Sall1-null mesenchyme to spinal cord-derived signal in organ culture (Fig. 7), loss of Sall1 expression in the mesenchyme is likely to lead to failure to attract the ureteric bud that is a normal inducer, and to subsequent failure of tubule differentiation in the mesenchyme. Reduced but persistent expression of early mesenchymal markers is also consistent with this model.
The most severe cases of Sall1 knockout were similar to those of GDNF or WT-1 deficient mice. GDNF is expressed in the metanephric mesenchyme and is a key molecule for attracting ureteric bud, which acts through the Ret receptor. Thus, GDNF knockouts show failure of ureteric bud invasion. GDNF expression in the mesenchyme is reduced in Sall1 knockout at 11.5 dpc, but not at 10.5 dpc (before ureteric bud invasion). This indicates that Sall1 is not absolutely required for GDNF expression. Furthermore, expression of Eya1, an upstream molecule of GDNF, is relatively unaffected in the mutants. Therefore, GDNF reduction in Sall1 mutants, which could lead to incomplete ureteric bud invasion, is not likely to be caused by a direct effect of Sall1 on GDNF expression.
WT-1 is also expressed in the metanephric mesenchyme, and its absence leads to failure of ureteric bud invasion and apoptosis of the mesenchyme. WT-1 expression in Sall1-deficient mice was, however, weakly detected, though reduced, thus indicating that Sall1 is not essential for WT-1 expression. Furthermore WT-1 knockout show extrarenal phenotypes such as abnormal heart, lung and gonad development, which were not observed in the Sall1 knockouts. Therefore, Sall1 is unlikely to be upstream of WT-1. It is still possible that Sall1 is a downstream effector of WT-1, or that Sall1 and WT-1 are synergistic for metanephric development.
Identification of downstream direct targets of Sall1 is needed to
fully explain kidney phenotypes of Sall1-deficient mice.
Sall1 contains 10 zinc-finger motifs, most of which are clustered in
duplex or triplet. It is not known which zinc-finger domain is involved in DNA
binding or in transactivation. Some sets of zinc fingers may bind to DNA and
other sets may serve for protein-protein interactions, as in the case of Olf-1
associated zinc finger (OAZ), which has 30 zinc fingers (Hata et al.,
2000). OAZ uses different zinc
fingers depending on target promoters and Sall1 may use similar
mechanisms. Drosophila spalt-related (salr) binds to an
A/T-rich consensus sequence through its triplet zinc fingers, but endogenous
targets have not been identified (Barrio et al.,
1996
). Drosophila
sal/salr is reported to regulate the expression of knirps and
iroquios in wing veins, but direct binding of sal/salr to
their promoters was not seen (Lunde et al.,
1998
; de Celis and Barrio,
2000
). A search for
Sall1 target genes is under way in our laboratory.
In Drosophila wing imaginal discs, sal is located
downstream of dpp, which is a BMP4 ortholog (de Celis et al.,
1996; Nellen et al.,
1996
). BMP7 is the major BMP
family gene expressed in mouse developing kidney and is essential for kidney
development (Dudley et al.,
1995
; Luo et al.,
1995
). It is tempting to
speculate that Sall1 expression is controlled by BMP7. The kidney
phenotype of Sall1 knockout is, however, more severe than that of
BMP7 knockout. In addition BMP7 deficient mice show eye abnormality, which is
not observed in Sall1-deficient mice. Therefore, Sall1 is
unlikely to be a downstream signaling component of BMP7.
Recently, sal was found to be downstream of the wingless
signal in the Drosophila tracheal system and sal deletion
results in absence of dorsal trunks of the trachea (Chihara and Hayashi,
2000; Llimargas,
2000
). Though Wnt4 is
essential for kidney development, a normal ureter-mesenchyme interaction
occurs in its mutants, which is different from phenotypes of
Sall1-deficient mice (Stark et al.,
1994
). Furthermore
Sall1 is not expressed in trachea and lungs, and
Sall1-deficient mice apparently have no lung defects. Therefore, the
simple analogy of Drosophila does not apply to mammals.
LIF and related cytokines are ureter-derived regulators for
mesenchymal-to-epithelial conversion (Barasch et al.,
1999). Sall1
expression was, however, unaffected in mice deficient in gp130, the common
receptor for LIF family cytokines (data not shown). Furthermore the kidney
phenotype of gp130-deficient mice is much milder than that of
Sall1-deficient mice (Barasch et al.,
1999
). Thus, Sall1 is
unlikely to be downstream of the LIF/gp130 signal. Identification of molecules
that govern the expression of Sall1 in mesenchymal cells will be
important for understanding mechanisms of kidney development:
Sall1-lacZ heterozygous mice represent be powerful tools with which
to achieve this.
We have found almost no abnormality in Sall1 mutant mice except for that in the kidney, despite abundant expression in various tissues. Expression of GDNF, BMP7, Pax2, Wnt4 in other regions, such as in the brain and spinal cord, remained intact in the Sall1 mutant mice (data not shown). As some of expression patterns of Sall2 and Sall3 overlapped those of Sall1, they may compensate for each other. Elimination of these other Sall gene family members would elucidate their roles in other tissues as well as in the kidney.
Another intriguing point is that heterozygous mutant mice do not show similar phenotypes of Townes-Brocks syndrome therefore cannot serve as a disease model for human disease. Even phenotypes of homozygous mutant mice differed from those of the human disease. The relative importance of SALL1 over SALL2 and SALL3 may be higher in humans than in mice, and Sall1 deficiency may be compensated for by Sall2 and Sall3 in mice. Alternatively, heterozygous mutations in humans, which result in premature truncation 5' to the triple zinc-finger motif, may serve in a dominant-negative fashion and eliminate functions of all SALL genes. To test these hypotheses, generating transgenic mice carrying a truncated Sall1, as well as deleting all Sall genes in mice, would be necessary. Nonetheless, the kidney phenotypes observed in Townes-Brocks syndrome are likely to be explained by the essential role of SALL1 in the initial key step of kidney development. Elucidation of upstream and downstream molecular events will lead to better understanding of kidney development, as well as to finding potential therapy targets for individuals with this disease.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Barasch, J., Yang, J., Ware, C. B., Taga, T., Yoshida, K., Erdjument-Bromage, H., Tempst, P., Parravicini, E., Malach, S., Aranoff, T. and Oliver, J. A. (1999). Mesenchymal to epithelial conversion in rat metanephros is induced by LIF. Cell 99,377 -386.[Medline]
Barrio, R., Shea, M. J., Caruli, J., Lipkow, K., Gaul, U., Frommer, G., Schuh, R., Jackle, H. and Kafatos, F. C. (1996). The spalt-related gene of Drosophila melanogaster is a member of an ancient gene family, defined by the adjacent, region-specific homeotic gene spalt. Dev. Genes Evol. 206,315 -325.
Buck, A., Archangelo, L., Dixkens, C. and Kohlhase, J. (2000). Molecular cloning, chromosomal localization, and expression of the murine SALL1 ortholog Sall1. Cytogenet. Cell Genet. 89,150 -153.[Medline]
Chihara, T. and Hayashi, S. (2000). Control of
tracheal tubulogenesis by wingless signaling.
Development 127,4433
-4442.
Copeland, N. G. and Jenkins, N. A. (1991). Development and applications of a molecular genetic linkage map of the mouse genome. Trends Genet. 7,113 -118.[Medline]
de Celis, J. F. and Barrio, R. (2000). Function of the spalt/spalt-related gene complex in positioning the veins in the Drosophila. wing. Mech. Dev. 91, 31-41.[Medline]
de Celis, J. F., Barrio, R. and Kafatos, F. C. (1996). A gene complex acting downstream of dpp in Drosophila wing morphogenesis. Nature 381,421 -424.[Medline]
Dudley, A. T., Lyons, K. M. and Robertson, E. J. (1995). A requirement for bone morphogenetic protein-7 during development of the mammalian kidney and eye. Genes Dev. 9,2795 -2807.[Abstract]
Durbec, P., Marcos-Gutierrez, C. V., Kilkenny, C., Grigoriou, M., Wartiowaara, K., Suvanto, P., Smith, D., Ponder, B., Costantini, F., Saarma, M., Sariola, H. and Pachnis, V. (1996). GDNF signalling through the Ret receptor tyrosine kinase. Nature 381,789 -793.[Medline]
Hata, A., Seoane, J., Lagna, G., Montalvo, E., Hemmati-Brivanlou, A. and Massague, J. (2000). OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell 100,229 -240.[Medline]
Jenkins, N. A., Copeland, N. G., Taylor, B. A. and Lee, B. K. (1982). Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus. J. Virol. 43,26 -36.[Medline]
Jurgens, G. (1988). Head and tail development of the Drosophila embryos involves spalt, a novel homeotic gene. EMBO J. 7,189 -196.
Kavety, B., Jenkins, N. A., Fletcher, C. F., Copeland, N. G. and Morgan, J. I. (1994). Genomic structure and mapping of precerebellin and a precerebellin-related gene. Mol. Brain Res. 27,152 -156.[Medline]
Kispert, A., Vainio, S. and McMahon, A. P.
(1998). Wnt-4 is a mesenchymal signal for epithelial
transformation of metanephric mesenchyme in the developing kidney.
Development 125,4225
-4234.
Kohlhase, J., Schuh, R., Dowe, G., Kuhnlein, R. P., Jackle, H., Schroeder, B., Schulz-Schaeffer, W., Kretzschmar, H. A., Kohler, A., Muller, U., Raab-Vetter, M., Burkhardt, E., Engel, W. and Stick, R. (1996). Isolation, characterization, and organ-specific expression of two novel human zinc finger genes related to the Drosophila gene spalt. Genomics 38,291 -298.[Medline]
Kohlhase, J., Wischermann, A., Reichenbach, H., Froster, U. and Engel, W. (1998). Mutations in the SALL1 putative transcription factor gene cause Townes-Brocks syndrome. Nat. Genet. 18,81 -83.[Medline]
Kohlhase, J., Hausmann, S., Stojmenovic, G., Dixkens, C., Bink, K., Schulz-Schaeffer, W., Altmann, M. and Engel, W. (1999a). SALL3, a new member of the human spalt-like gene family, maps to 18q23. Genomics 62,216 -222.[Medline]
Kohlhase, J., Taschner, P. E., Burfeind, P., Pasche, B., Newman, B., Blanck, C., Breuning, M. H., ten Kate, L. P., Maaswinkel-Mooy, P., Mitulla, B. et al. (1999b). Molecular analysis of SALL1 mutations in Townes-Brocks syndrome. Am. J. Hum. Genet. 64,435 -445.[Medline]
Kohlhase, J., Altmann, M., Archangelo, L., Dixkens, C. and Engel, W. (2000). Genomic cloning, chromosomal mapping, and expression analysis of msal-2. Mamm. Genome 11, 64-68.[Medline]
Koseki, C., Herzlinger, D. and al-Awqati, Q.
(1991). Integration of embryonic nephrogenic cells carrying a
reporter gene into functioning nephrons. Am. J.
Physiol. 261,C550
-C554.
Kreidberg, J. A., Sariola, H., Loring, J. M., Maeda, M., Pelletier, J., Housman, D. and Jaenisch, R. (1993). WT-1 is required for early kidney development. Cell 74,679 -691.[Medline]
Kuhnlein, R. P., Frommer, G., Friedrich, M., Gonzalez-Gaitan, M., Weber, A., Wagner-Bernholz, J. F., Gehring, W. J., Jackle, H. and Schuh, R. (1994). spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo. EMBO J. 13,168 -179.[Abstract]
Llimargas, M. (2000) wingless and its
signalling pathway have common and separable functions during tracheal
development. Development
127,4407
-4417.
Lunde, K., Biehs, B., Nauber, U. and Bier, E.
(1998) The knirps and knirps-related genes organize development
of the second wing vein in Drosophila. Development
125,4145
-4154.
Luo, G., Hofmann, C., Bronckers, A. L., Sohocki, M., Bradley, A. and Karsenty, G. (1995). BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev. 9,2808 -2820.[Abstract]
Marlin, S., Blanchard, S., Slim, R., Lacombe, D., Denoyelle, F., Alessandri, J. L., Calzolari, E., Drouin-Garraud, V., Ferraz, F. G., Fourmaintraux, A. et al. (1999). Townes-Brocks syndrome: detection of a SALL1 mutation hot spot and evidence for a position effect in one patient. Hum. Mutat. 14,377 -386.[Medline]
Moore, M. W., Klein, R. D., Farinas, I., Sauer, H., Armanini, M., Phillips, H., Reichardt, L. F., Ryan, A. M., Carver-Moore, K. and Rosenthal, A. (1996). Renal and neuronal abnormalities in mice lacking GDNF. Nature 382, 76-79.[Medline]
Moriya, N., Uchiyama, H. and Asashima, M. (1993). Induction of pronephric tubules by activin and retinoic acid in presumptive ectoderm of Xenopus laevis. Dev. Growth Differ. 35,123 -128.
Nellen, D., Burke, R., Struhl, G. and Basler, K. (1996). Direct and long-range action of a DPP morphogen gradient. Cell 85,357 -368.[Medline]
O'Callaghan, M. and Young, I. D. (1995). Townes-Brocks Syndrome (ed. D. Donnai and R. Winter). London: Chapman and Hall.
Onuma, Y., Nishinakamura, R., Takahashi, S., Yokota, T. and Asashima, M. (1999). Molecular cloning of a novel Xenopus spalt gene (Xsal-3). Biochem. Biophys. Res. Commun. 264,151 -156.[Medline]
Ott, T., Kaestner, K. H., Monaghan, A. P. and Schutz, G. (1996). The mouse homolog of the region specific homeotic gene spalt of Drosophila is expressed in the developing nervous system and in mesoderm-derived structures. Mech. Dev. 56,117 -128.[Medline]
Ott, T., Parrish, M., Bond, K., Schwaeger-Nickolenko, A. and Monaghan, A. P. (2001). A new member of the spalt like zinc finger protein family, Msal3, is expressed in the CNS and sites of epithelial/mesenchymal interaction. Mech. Dev. 101,203 -207.[Medline]
Pichel, J. G., Shen, L., Sheng, H. Z., Granholm, A. C., Drago, J., Grinberg, A., Lee, E. J., Huang, S. P., Saarma, M., Hoffer, B. J., Sariola, H. and Westphal, H. (1996). Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382,73 -76.[Medline]
Rossi, D. L., Hardiman, G., Copeland, N. G., Gilbert, D. J., Jenkins, N., Zlotnik, A. and Bazan, J. F. (1998). Cloning and characterization of a new type of mouse chemokine. Genomics 47,163 -170.[Medline]
Sanchez, M. P., Silos-Santiago, I., Frisen, J., He, B., Lira, S. A. and Barbacid, M. (1996). Renal agenesis and the absence of enteric neurons in mice lacking GDNF. Nature 382, 70-73.[Medline]
Sato, A., Asashima, M., Yokota, T. and Nishinakamura, R. (2000). Cloning and expression pattern of a Xenopus pronephros-specific gene, XSMP-30. Mech. Dev. 92,273 -275.[Medline]
Saxen, L. (1987). Organogenesis of the Kidney. Cambridge: Cambridge University Press.
Schuchardt, A., D'Agati, V., Larsson-Blomberg, L., Costantini, F. and Pachnis, V. (1994). Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret. Nature 367,380 -383.[Medline]
Schuchardt, A, D'Agati, V., Pachnis, V. and Costantini, F.
(1996). Renal agenesis and hypodysplasia in ret-k- mutant mice
result from defects in ureteric bud development.
Development 122,1919
-1929.
Stark, K., Vainio, S., Vassileva, G. and McMahon, A. P. (1994). Epithelial transformation of metanephric mesenchyme in the developing kidney regulated by Wnt-4. Nature 372,679 -683.[Medline]
Torres, M., Gomez-Pardo, E., Dressler, G. R. and Gruss, P.
(1995). Pax-2 controls multiple steps of urogenital development.
Development 121,4057
-4065.
Trupp, M., Arenas, E., Fainzilber, M., Nilsson, A. S., Sieber, B. A., Grigoriou, M., Kilkenny, C., Salazar-Grueso, E., Pachnis, V. and Arumae, U. (1996). Functional receptor for GDNF encoded by the c-ret proto-oncogene. Nature 381,785 -789.[Medline]
Uochi, T. and Asashima, M. (1996). Sequential gene expression during pronephric tubule formation in vitro in Xenopus ectoderm. Dev. Growth Differ. 38,625 -635.
Xu, P. X., Adams, J., Peters, H., Brown, M. C., Heaney, S. and Maas, R. (1999). Eya1-deficient mice lack ears and kidneys and show abnormal apoptosis of organ primordia. Nat. Genet. 23,113 -117.[Medline]