1 Evolutionary Morphology Research Team, Center for Developmental Biology (CDB),
RIKEN, Kobe, Japan
2 Institut de Génétique et de Biologie Moléculaire et
Cellulaire, UMR 7104, CNRS/INSERM/ULP, BP 10142-67404 Illkirch Cedex, CU de
Strasbourg, France
3 Laboratori di Biologia Cellulare e dello Sviluppo, Università di Pisa,
Via G. Carducci 13, Pisa, Italy
4 Department of Medical Technology, School of Health Sciences, Faculty of
Medicine, Niigata University, Niigata 951-8518, Japan
* Author for correspondence (e-mail: bothrops{at}cdb.riken.go.jp)
Accepted 14 November 2003
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Evolution, Hindbrain, Rhombomere, Reticulospinal neuron, Branchiomotor neuron, Lamprey, Hox genes
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Rhombomeres appear as repetitive units of neuronal development and as a
prepattern for the spatial deployment of the neural crest-derived
ectomesenchyme in the craniofacial region
(Lumsden and Keynes, 1989;
Clarke and Lumsden, 1993
;
Kuratani and Eichele, 1993
;
Köntges and Lumsden,
1996
) (reviewed by Santagati
and Rijli, 2003
). The homeobox-containing transcription factors of
the Hox gene family display nested, segmentally restricted, expression
patterns with sharp anterior boundaries mapping to the rhombomeric borders,
and are involved in position-dependent specification of the rhombomeres and
pharyngeal arch derivatives (e.g. Lufkin et al., 1991;
Chisaka et al., 1992
;
Gendron-Maguire et al., 1993
;
Mark et al., 1993
;
Carpenter et al., 1993
;
Rijli et al., 1993
;
Studer et al., 1996
;
Goddard et al., 1996
;
Bell et al., 1999
;
Gavalas et al., 1997
;
Gavalas et al., 1998
;
Rossel and Capecchi, 1999
;
Gaufo et al., 2000
;
Davenne et al., 1999
;
Barrow et al., 2000
;
Grammatopoulos et al., 2000
;
Pasqualetti et al., 2000
;
Hunter and Prince, 2002
). Such
a coordinated pattern of development suggests that a primitive metameric
developmental program was acquired in vertebrate ancestors. However,
amphioxus, the sister group of the vertebrates, lacks neuromere organization
while possessing anteroposterior specification along the neuraxis, which
evident in the anatomical architecture
(Lacalli et al., 1994
) and
partly in the neuronal repertoire
(Fritzsch and Northcutt, 1993
;
Fritzsch, 1996
;
Knight et al., 2000
;
Lacalli, 2001
), as well as in
the expression patterns of developmental genes, including the Hox genes
(Holland et al., 1992
;
Wada et al., 1999
;
Knight et al., 2000
;
Murakami et al., 2001
;
Jackman and Kimmel, 2002
).
Together, these studies indicate that amphioxus embryos may possess a region
homologous to the vertebrate hindbrain, but that the segmental organization
appeared after the divergence of the vertebrate lineage.
Therefore, the evolutionary origin of rhombomeres, and its relationship to
a metameric developmental program of neuronal patterning, poses an intriguing
question for evolutionary developmental biology. In vertebrates, our knowledge
about rhombomeres is restricted to the gnathostomes. Branchiomotor nuclei are
generated in association with specific pairs of rhombomeres and innervate a
single branchial arch (Tello,
1923; Neal, 1896
;
Lumsden and Keynes, 1989
;
Noden, 1991
;
Gilland and Baker, 1993
). The
existence of this 2:1 rhombomere:pharyngeal arch relationship has been
considered the basic developmental unit for patterning of the vertebrate head
(reviewed by Kuratani, 2003
).
As a general rule, the trigeminal motor nucleus is generated in r2 and r3, and
that of the facial nerve in r4 and r5. Hox gene expression patterns
(Hox code) appear to be conserved in the gnathostome hindbrain (Hunt
et al., 1991a; Hunt et al.,
1991b
; Lumsden and Krumlauf,
1996
), with minor modifications in teleosts, which have
experienced additional Hox cluster duplication
(Amores et al., 1998
;
Naruse et al., 2000
;
Schilling and Knight, 2001
;
McClintock et al., 2002
;
Prince, 2002
). Loss- and
gain-of-function experiments indicate that Hox genes are involved in providing
branchiomotor subtype positional identity along the anteroposterior axis
(Studer et al., 1996
;
Goddard et al., 1996
;
Gavalas et al., 1997
;
Gavalas et al., 1998
;
Davenne et al., 1999
;
Jungbluth et al., 1999
;
Gaufo et al., 2000
; Dominguez
del Toro et al., 2001; McClintock et al.,
2002
; Pattyn et al.,
2003
).
Unlike branchiomotor neurons, the spatial patterns of interneurons are less
conserved among gnathostomes. In avians and teleosts, rhombomeres initially
generate similar repeated sets of neurons belonging to distinct classes
(Metcalfe et al., 1986;
Mendelson, 1986a
;
Mendelson, 1986b
;
Kimmel et al., 1988
;
Lee et al., 1993
; Hanneman et
al., 1988; Kimmel, 1993
;
Clarke and Lumsden, 1993
).
Thus, each rhombomere seems to represent in its composition a serial homologue
of a repeated repertoire of reticular neurons. In another divergent group, the
amniotes, such segmental repetition is less obvious, and reticular neurons
assume a rather columnar distribution with modulations or interruptions, so
that each rhombomere is instead identified in terms of the particular
reticular neuron class it produces (e.g. reticulospinal or vestibulospinal)
(Auclair et al., 1999
).
These observations raise the question of whether hindbrain segmentation and metameric neuronal patterning are intimately linked or independently established. To address this question, the developmental patterns of regulatory genes and neuronal specification, as well as neuroepithelial compartmentalization, should be systematically compared along the phylogenetic tree of the chordates. In particular, the lamprey, an agnathan (jawless) vertebrate, may provide useful insights to partly fill the gaps in our knowledge, because it appears to have diverged early in the vertebrate lineage.
The extant agnathan animals, including the lamprey and hagfish, are thought
to form a monophyletic group (Mallatt and
Sullivan, 1998; Kuraku et al.,
1999
; Kuratani et al.,
2003
) as a sister group of the gnathostomes. Segmentation in the
hindbrain has been identified in agnathan embryos (Kuratani et al., 1998;
Horigome et al., 1999
;
Pombal et al., 2001
;
Kuratani et al., 2001
). In a
series of detailed embryological observations of a Japanese lamprey,
Lethenteron japonicum, conserved topographical relationships between
rhombomeres, cephalic crest cell populations and cranial nerve roots were
identified (Kuratani et al.,
1997
; Horigome et al.,
1999
). The lamprey also has reticulospinal neurons, and their
activity appears to be involved in swimming behavior
(Nieuwenhuys and Nicholson,
1998
). The neuronal patterning sequence of this animal, however,
has not yet been elucidated. In this study, we analyzed the patterns of motor
and reticular neuron development and of regulatory gene expression in relation
to the rhombomere pattern in the lamprey hindbrain. Our data suggest that
registering of rhombomeric segmentation, neuronal patterning, and the Hox code
may have occurred through successive independent evolutionary changes in the
vertebrate lineage.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Retrograde labeling of hindbrain neurons
Rhodamine- or fluorescein-conjugated dextrans (Sigma, St Louis, MO) were
injected into the spinal cord or pharyngeal arches of the embryo to label
reticulospinal or branchial motoneurons, according to the method described by
Glover (Glover, 1995). The
injected embryos were incubated at room temperature for 30 minutes to allow
the dextran to label neurons retrogradely. Embryos were then washed with 10%
Steinberg solution, and fixed in 4% paraformaldehyde and 1% methanol in 0.1 M
phosphate-buffered saline (PFAM/PBS). The fixed specimens were dehydrated, and
clarified with a 1:2 mixture of benzyl alcohol and benzyl benzoate (BABB).
Labeled neurons were then examined using a fluorescence microscope.
Isolation of cDNA clones of lamprey genes
A partial cDNA clone of the lamprey Krox20 gene was isolated from
a L. japonicum stage 24-26 embryo cDNA library, using a previously
described low stringency hybridization protocol
(Pasqualetti et al., 2000). We
used a probe derived from a mouse Krox20 cDNA
polymerase-chain-reaction (PCR) product amplified with the specific mouse
primers: 5'-ATCCGTAATTTTACTCTGGGGGG-3' (sense) and
5'-GTCACAGGCAAAGGGCTTCTC-3' (antisense). Four independent cDNA
clones were isolated, all sharing 100% homology in the regions of overlapping
sequence. We could not distinguish whether these genes are the homologues of
Krox20 or Krox24. However, because the expression of these
genes was restricted to r3 and r5, we designated our clones LjKrox20
(Lethenteron japonicum Krox20). The partial sequences have been
assigned DDBJ/EMBL/GenBank Accession Number AY275715. PCR amplification of a
518 bp LjKrox20 fragment was achieved using the
LjKrox20-specific primers 5'-CTTCTCACGCTCGGACGAGCT-3'
(sense) and 5'-GACGTCACCGACGATGAGGACAT-3' (antisense), for use in
in situ hybridization.
Eph lamprey homologues were isolated by low-temperature PCR using
degenerate primers directed against two conserved regions of the
EphA4 molecule. A sense primer
(5'-ATGATIATCACIGAGTAYATGGARAA-3') and an antisense primer
(5'-TTGATIACITCCTGGTTIIICATRTCCA-3') were used. We isolated
several clones, and these sequences were significantly homologous to lamprey
EphC, which had been cloned previously from the lamprey species
L. reissneri (Suga et al.,
1999). We therefore named our Eph clones LjEphC
(Lethenteron japonicum EphC).
The lamprey Hox3 fragment was PCR amplified from cDNA of L. japonicum using a set of degenerate primers directed against two highly conserved regions of the Hox3 molecule: a sense primer (5'-CGGAATTCYTNGARYTNGARAARGARTT-3') and an antisense primer (5'-CGGGATCCNCKNCKRTTYTNRAACCADATYTT-3'). Underlines indicate restriction enzyme sites. This short Hox3 fragment allowed the design of 3'-RACE primers, as well as appropriate nested primers for marathon cDNA amplification (MarathonTM cDNA Amplification Kit, Clontech, Palo Alto, CA). The primers were: 3'-RACE primer, CCTCTGCCGCCCTCGACGAGTT; and 3'-RACE nested primer, AATGGCCAACCTACTTAACCTC. The PCR led to the isolation of a lamprey Hox3 fragment. This fragment was used as the probe to screen a lamprey cDNA library. Screening was performed under low-stringency conditions and isolated clones were sequenced. The deduced protein sequence was significantly homologous to Hox3, therefore we named our Hox clone LjHox3 (L. japonicum Hox3). The partial sequences have been assigned the DDBJ/EMBL/GenBank Accession Number AB125270.
Neuronal labeling in combination with in situ hybridization
After neuronal labeling, whole-mount in situ hybridizations were performed
as previously described (Murakami et al.,
2001). Stained embryos were fixed in PFAM/PBS, and incubated with
streptavidin-horseradish peroxidase (HRP; Vector) in Tris-buffered saline
(TST; diluted 1:500) at 4°C overnight. The specimens were washed five
times for 60 minutes each in TST at room temperature, then HRP activity was
detected using the peroxidase substrate, 3,3'-diaminobenzidine (DAB, 100
mg/ml), in TST with 0.01% hydrogen peroxide.
Retinoic acid treatment of lamprey embryos
Retinoic acid (RA) treatment was performed according to the protocol
described previously (Kuratani et al.,
1998b). In the present study, embryos from stages 12 through 18
were treated with 0.01 µM, 0.05 µM, or 0.1 µM all-trans RA. As a
negative control, only the dimethyl sulfoxide (DMSO) was applied.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
The expression domain of LjKrox20 corresponded to r3 and r5, as
indicated by the position of the labeled domains relative to the morphological
rhombomere boundaries and the trigeminal and facial nerve roots, which were
stained with anti-acetylated tubulin antibody
(Fig. 2A,B) (see also Kuratani
et al., 1998; Horigome et al.,
1999). The LjEphC domain also seemed to correspond to r3
and r5, because of the relative position of the otic vesicle, which is lateral
to r4 in the lamprey (Kuratani et al., 1998;
Horigome et al., 1999
)
(Fig. 4A,B). Based on this
mapping, the cluster of B cells and the Mth neuron could be positioned in r4
(Fig. 3A,B, Fig. 4C-F). The Mth neuron
appeared in the middle of r4 at stage 26 and corresponded to the domain of
lowest LjPax6 expression and to the rostral limit of LjHox3
expression (Fig. 2D, Fig. 3C,D)
(Murakami et al., 2001
).
Reticulospinal neurons, including I and B cells, were found lateral to the
LjPax6-expressing domain along the anteroposterior neuraxis, as seen
from the dorsal view of the same stage embryo
(Fig. 2C). The auxiliary
Mauthner neuron (Mth') developed in r5
(Fig. 3A,B). The I4 neuron was
located in r3 (Fig. 3A,B),
whereas the I3 neuron was positioned anterior to the r2/3 boundary
(Fig. 3B). The topographical
relationships between neuron position and gene expression described above did
not change throughout the later stages analyzed.
|
|
|
|
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Developmental marker genes and rhombomere segmental identities in lamprey
A number of genes have been implicated in the control of hindbrain
segmentation and of odd-even rhombomere segregation in gnathostomes, including
the kleisler/valentino gene
(Frohman et al., 1993;
Moens et al., 1996
;
Moens et al., 1998
), members
of the ephrin/eph gene family
(Xu et al., 1995
;
Wilkinson, 2001
) and
Krox20 (Wilkinson et al.,
1989
; Schneider-Maunoury et
al., 1997
). Of these, Krox20 and EphA4 are
generally regarded as markers for r3 and r5 segmentation in gnathostomes. The
specification of rhombomere segmental identities and of neurons also depends
on the highly organized expression patterns of the Hox genes (Hunt et al.,
1991a; Hunt et al., 1991b
;
Krumlauf, 1993
;
Rijli et al., 1998
;
Schilling and Knight, 2001
).
In gnathostomes, the anterior limits of Hox expression domains precisely map
to rhombomere borders, and Hox patterns are generally used as markers
to identify specific rhombomeres.
In lamprey embryos, the expression patterns of both LjKrox20 and
LjEphC and their localization to r3 and r5 appear to be conserved
relative to their gnathostome cognates (Figs
2,
3). By contrast, the rostral
boundary of the expression of LjHox3 is found between the rostral and
caudal expression domains of both LjKrox20 and LjEphC (Figs
3,
4). Therefore, even though the
precise location of the LjHox3 rostral limit could not be defined in
the present study, it definitely mapped within r4 and did not correspond to a
specific rhombomere boundary (Figs
3,
4). This pattern is apparently
not conserved, as the main transcripts of gnathostome Hox paralogue group 3
genes (e.g. Hoxa3 and Hoxb3) have rostral expression
boundaries that map precisely to the r4/r5 border (reviewed by
Carroll et al., 2001). However,
in the larval zebrafish, the Hoxb3 homologue is expressed in r4
(Prince et al., 1998
).
Moreover, at least three types of Hoxb3 endogenous transcripts were
described in the mouse, differing in size, splicing patterns, and expression
domains (Sham et al., 1992
).
One such transcript displays a rostral expression domain extending into r4 and
even into r3 segments, which is rather a feature of the expression pattern of
the adjacent Hoxb2 than of Hoxb3. Thus, transcriptional
control mechanisms similar to those in gnathostomes may apply to the
regulation of LjHox3 expression in the lamprey hindbrain.
Evolution of the vertebrate reticular neurons
One important question in evolutionary biology concerns the identification
of serial homology, because it implies the presence of metameric developmental
mechanisms (reviewed by Kuratani,
2003). The present analysis allowed us to gain insights into the
evolution and homology of reticular neurons in the vertebrate lineage.
Reticulospinal neurons are arranged corresponding to rhombomeres in several
vertebrate species, including teleosts
(Metcalfe et al., 1986
;
Lee et al., 1993
;
Hanneman et al., 1998
) and the
rat (Auclair et al., 1999
). In
particular, in the aquatic vertebrates studied so far, Mth neurons always
develop in r4 (Metcalfe et al.,
1986
; Lee et al.,
1993
). Based on the r3 and r5 expression of LjKrox20 and
LjEphC (see above), the lamprey Mth neuron was also localized in r4,
suggesting that the developmental program to generate the Mth neuron in r4 has
been conserved through vertebrate evolution.
In teleosts, developing reticulospinal neurons have been classified into
several families based on shared morphological features, and it has been
suggested that each rhombomere develops basically the same set of neurons as
the others. Serial homologies have been recognized in the Mauthner, MiD2 and
MiD3 neurons of zebrafish. The axons of these neurons cross the midline and
descend the spinal cord along the medial longitudinal fascicle (MLF,
Fig. 8) (Metcalfe et al., 1986). In
the lamprey, in addition to the Mth neuron in r4, a similar neuron called the
Mth' neuron develops in r5. The Mth' neuron in the lamprey is
similar to the zebrafish MiD2, as discussed by Kimmel et al.
(Kimmel et al., 1982
). In the
adult animal, the axon of this neuron crosses the midline and descends to the
spinal cord, like the Mth neuron (Swain
et al., 1993
). Thus, the Mth and Mth' neurons possibly
represent serial homologues.
As for the isthmic reticular group, the I4 neuron is located in r3, and the
I3 neuron in r2, as assessed from the LjKrox20 and LjEphC
expression domains. These two neurons are of similar size, both grow axons
along similar pathways, and occupy the same relative dorsoventral position
within the neural tube (Jacobs et al.,
1996) (Fig. 8).
These neurons thus appear to represent another serial homology group. With
respect to its position and axon projection pattern, the I4 neuron in the
lamprey also seems to be homologous to RoM3 of the zebrafish, and I3 to RoM2
(Figs 7,
8)
(Metcalfe et al., 1986
).
From the above discussion, this rhombomere-related serial homology of
selected neuronal subtypes (e.g. the Mauthner neuron) appears to be a shared
feature in the vertebrate lineage. This supports the idea that a metameric
pattern of neuronal development was already present in the `hindbrain region'
of the vertebrate common ancestor. However, some cell types appear to be
present only in the lamprey, as seen in the bulbar neurons with ipsilateral
axons (Jacobs et al., 1996)
(Fig. 8), which are restricted
to r4 and not present in any other vertebrate species. Furthermore, in the
lamprey, a pair of Mth' neurons are observed in r5, whereas in the
zebrafish, two pairs of Mth homologues, MiD2 and MiD3, are located in r5 and
r6, respectively (Fig. 8).
Finally, whereas teleosts and lampreys have large identifiable reticular
neurons, this is not the case in amniotes, whose small reticular neurons are
clustered in each rhombomere. Thus, various forms of diversifications have
arisen independently in each lineage of animal groups.
Based on these results, we propose an evolutionary scenario in which the vertebrate common ancestor possessed a basic metameric pattern of serially repeated sets of reticular neurons. In the lineage leading to lampreys, specific cell types, such as additional Mauthner neurons, were lost from each metamere, resulting in the anteroposteriorly differentiated neuronal pattern of the present lamprey hindbrain (Figs 8, 9). In amniotes, large identifiable neurons may have been lost secondarily as well, possibly because of the shift to the terrestrial life and related loss of a lateral line-mediated reflex system. An alternative option is that the ancestral hindbrain was already specialized anteroposteriorly as observed in the lamprey. In teleosts, each rhombomere would then have secondarily acquired a similar pattern of interneurons. The latter possibility, however, makes it difficult to explain the origin of such anteroposterior specification in the vertebrate hindbrain. Observation of hindbrain development in the hagfish might therefore provide key information to distinguish among such possibilities.
|
Together, these observations suggest that variations in motoneuron identity
along the anteroposterior axis of vertebrate embryos are not constrained by
hindbrain segmentation. This is particularly apparent from this analysis of
lamprey branchiomotor neuron development, and from accurate comparisons with
the development of the branchiomotor nuclei in gnathostomes
(Fig. 8). Importantly, the
shift between trigeminal and facial motoneuron identities corresponded well
with the anterior boundary of LjHox3 expression, as inferred from
retrograde labeling of motor axons and in situ hybridization. In gnathostomes,
there is mounting evidence that Hox genes control the identity of motoneurons
along the anteroposterior axis. In the developing hindbrain, Hoxa and
Hoxb genes are involved in the specification of cranial motor
neurons, their projections, and migratory properties
(Studer et al., 1996;
Goddard et al., 1996
;
Gavalas et al., 1997
;
Bell et al., 1999
;
Davenne et al., 1999
;
Jungbluth et al., 1999
;
Gaufo et al., 2000
;
McClintock et al., 2002
;
Pattyn et al., 2003
;
Guidato et al., 2003
;
Gaufo et al., 2003
).
Interestingly, Hox genes are also involved in spinal motoneuron positional
specification and innervation, despite the absence of neuromeric compartments
in the developing spinal cord [Hoxa10
(Rijli et al., 1995
),
Hoxc genes (Tiret et al.,
1998
; Dasen et al.,
2003
), Hoxd10 (de la
Cruz et al., 1999
; Lance-Jones
et al., 2001
)]. Therefore, we speculate that the relationship
between Hox gene expression domains and motoneuron identity may be an
ancestral feature conserved throughout the anteroposterior axis of the central
nervous system (hindbrain and spinal cord), and which is evolutionarily as
well as developmentally independent of neuromeric compartments and of the
segmentation process.
Selective effect of retinoic acid on lamprey hindbrain development
It is well established that exogenous RA administration in gnathostomes
causes abnormal development of the brain
(Morriss-Kay et al., 1991;
Conlon and Rossant, 1992
;
Marshall et al., 1992
;
Durston et al., 1989
;
Papalopulu et al., 1991
;
Holder and Hill, 1991
).
Morphological changes correlate with shifts of Hox gene as well as of other
regulatory gene expression patterns
(Kessel, 1992
;
Lopez et al., 1995
;
Marshall et al., 1992
;
Morris-Kay et al., 1991). In the hindbrain, RA treatment results in complete
changes in the segmental developmental program. For example, the r2 segmental
identity is transformed into that of r4, resulting in both the duplication of
the Mth neuron and the switch in fate from trigeminal to facial branchiomotor
neuron (Hill et al., 1995
;
Marshall et al., 1992
).
Similar phenotypes occur with the ectopic expression of the paralogue group 1
genes, Hoxa1 or Hoxb1, in r2
(Bell et al., 1999
;
Alexandre et al., 1996
;
McClintock et al., 2001
;
McClintock et al., 2002
),
demonstrating that RA-induced repatterning is mediated through Hox gene
function. Thus, in the gnathostomes, rhombomere identity, Hox codes, and
neuronal patterning along the anteroposterior axis are intimately linked and
appear to rely on RA-dependent developmental mechanisms.
In the lamprey, RA treatment also affects axial patterning (Kuratani et al., 1998). In this study, we showed that RA causes a rostral shift in the LjHox3 expression domain, concomitant with the rostral shift of branchiomotor neurons (Fig. 7). As in gnathostomes, the positional specification of lamprey branchiomotor neurons seems to be under the control of RA-dependent and Hox-mediated mechanisms. Interestingly, however, lamprey reticulospinal neurons, including the Mth and bulbar cells, did not change their positions along the neuraxis following RA treatment, nor was the apparent segmental organization of the hindbrain itself altered (Fig. 7). Furthermore, we did not observe duplication of the Mth neurons (Fig. 7).
These data support the idea that neuronal patterning and segmental identity may be independently regulated in the lamprey, and that the dependence of these processes on RA signaling could be distinct in agnathans and gnathostomes.
Evolution of the vertebrate hindbrain: a hypothetical scenario
Based on our findings, we speculate that the gnathostome-like hindbrain
organization may have developed through independent mechanisms of
anteroposterior patterning during evolution
(Fig. 9).
As noted above, an ancestral anteroposterior program of neuronal patterning
would have already been present at the pre-vertebrate, amphioxus-like stage,
dependent upon the position-specific expression of regulatory genes. In
addition to this pattern, rhombomere-like compartments of neuroepithelial
cells giving rise to repeated sets of serially homologous reticular neurons
were also established in the common ancestor of vertebrates. Morphological
segmentation of the rhombomeres would have appeared subsequently in the
vertebrate lineage, perhaps to reinforce such a metameric pattern. Partial
support for this idea comes from studies of amphioxus, which also possesses
interneurons similar to vertebrate reticular neurons
(Fritzsch and Northcutt, 1993;
Fritzsch, 1996
) and
anteroposterior molecular regionalization of the neural tube, while lacking a
bona fide segmented hindbrain.
An independent mechanism would have instead involved the anteroposterior
specification of branchiomotor neurons, via a rostrocaudally regulated Hox
code. Indeed, anteroposterior restriction of Hox expression has been
demonstrated in amphioxus (Holland et al.,
1992). Moreover, conservation of cis regulatory mechanisms that
allow Hox expression in the neural tube has been demonstrated between
amphioxus and vertebrates (Manzanares et
al., 2000
). Because the Hox code is generally in register with
rhombomere boundaries in gnathostomes, the rhombomere-dependent and Hox
code-dependent neural specification programs have not been distinguished from
one another. Our present work, however, raises the possibility that these two
distinct developmental programs were not acquired simultaneously, but may have
been established as distinct evolutionary events that were secondarily
integrated in the lineage of gnathostomes after the split from agnathans
[Fig. 9; for the concept of
integration, see Hall (Hall,
1998
)]. Integration and registering of the two mechanisms in the
gnathostome lineage might have relied partly on the elaboration of cis
regulatory elements at Hox loci. Comparison of Hox regulatory sequences in the
lamprey and gnathostomes may help to test this hypothesis further.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Alexandre, D., Clarke, J. D., Oxtoby, E., Yan, Y. L., Jowett, T.
and Holder, N. (1996). Ectopic expression of Hoxa-1 in the
zebrafish alters the fate of the mandibular arch neural crest and phenocopies
a retinoic acid-induced phenotype. Development
122,735
-746.
Amores, A., Force, A., Yan, Y.-L., Amemiya, C., Fritz, A., Ho,
R. K., Joly, L., Langeland, J., Prince, V., Wang, Y.-L. et al.
(1998). Genome duplications in vertebrate evolution: evidence
from zebrafish Hox clusters. Science
282,1711
-1714.
Auclair, F., Marchand, R. and Glover, J. C. (1999). Regional patterning of reticulospinal and vestibulospinal neurons in the hindbrain of mouse and rat embryos. J. Comp. Neurol. 23,288 -300.[CrossRef]
von Baer, K. (1828). Über die Entwickelungsgeschichte der Thiere. Königsberg.
Barrow, J. R., Stadler, H. S. and Capecchi, M. R.
(2000). Roles of Hoxa1 and Hoxa2 in patterning
the early hindbrain of the mouse. Development
127,933
-944.
Bell, E., Wingate, R. J. and Lumsden, A. (1999). Homeotic transformation of rhombomere identity after localized Hoxb1 misexpression. Science 25,2168 -2171.[CrossRef]
Bergquist, H. and Källén, B. (1953). On the development of neuromeres to migration areas in the vertebrate cerebral tube. Acta Anat. 18, 65-73.[Medline]
Bingham, S., Higashijima, S., Okamoto, H. and Chandrasekhar, A. (2002). The zebrafish trilobite gene is essential for tangential migration of branchiomotor neurons. Dev. Biol. 242,149 -160.[CrossRef][Medline]
Carroll, S. B., Grenier, J. K. and Weatherbee, S. D. (2001). Building animals. In From DNA to Diversity, pp. 51-95. Massachusetts: Blackwell Science
Carpenter, E. M., Goddard, J. M., Chisaka, O., Manley, N. R. and
Capecchi, M. R. (1993). Loss of Hox-A1
(Hox-1.6) function results in the reorganization of the murine
hindbrain. Development
118,1063
-1075.
Chandrasekhar, A., Moens, C. B., Warren, J. T. Jr, Kimmel, C. B.
and Kuwada, J. Y. (1997). Development of branchiomotor
neurons in zebrafish. Development
124,2633
-2644.
Chisaka, O., Musci, T. S. and Capecchi, M. R. (1992). Developmental defects of the ear, cranial nerves and hindbrain resulting from targeted disruption of the mouse homeobox gene Hox-1.6. Nature 355,516 -520.[CrossRef][Medline]
Clarke, J. D. and Lumsden, A. (1993). Segmental
repetition of neuronal phenotype sets in the chick embryo hindbrain.
Development 118,151
-162.
Conlon, R. A. and Rossant, J. (1992). Exogenous
retinoic acid rapidly induces anterior ectopic expression of murine
Hox-2 genes in vivo. Development
116,357
-368.
de la Cruz, C. C., Der-Avakian, A., Spyropoulos, D. D., Tieu, D. D. and Carpenter, E. M. (1999). Targeted disruption of Hoxd9 and Hoxd10 alters locomotor behavior, vertebral identity, and peripheral nervous system development Dev. Biol. 216,595 -610.[CrossRef][Medline]
Dasen, J. S., Liu, J. P. and Jessell, T. M. (2003). Motor neuron columnar fate imposed by sequential phases of Hox-c activity. Nature 425,926 -933.[CrossRef][Medline]
Davenne, M., Maconochie, M. K., Neun, R., Pattyn, A., Chambon, P., Krumlauf, R. and Rijli, F. M. (1999). Hoxa2 and Hoxb2 control dorsoventral patterns of neuronal development in the rostral hindbrain. Neuron 22,677 -691.[Medline]
Dupé, V. and Lumsden, A. (2001). Hindbrain patterning involves graded responses to retinoic acid signalling. Development 128,2199 -2208.[Medline]
Durston, A. J., Timmermans, J. P., Hage, W. J., Hendriks, H. F., de Vries, N. J., Heideveld, M. and Nieuwkoop, P. D. (1989). Retinoic acid causes an anteroposterior transformation in the developing central nervous system. Nature 13,140 -144.
Figdor, M. C. and Stern, C. D. (1993). Segmental organization of embryonic diencephalon. Nature 363,630 -634.[CrossRef][Medline]
Fraser, S., Keynes, R. and Lumsden, A. (1990). Segmentation in the chick embryo hindbrain is defined by cell lineage restriction. Nature 344,431 -435.[CrossRef][Medline]
Fritzsch, B. (1998). Of mice and genes: evolution of vertebrate brain development. Brain Behav. Evol. 52,207 -217.[CrossRef][Medline]
Fritzsch, B. (1996). Similarities and differences in lancelet and craniate nervous systems. Isr. J. Zool. 42,147 -160.
Fritzsch, B. and Northcutt, R. G. (1993). Cranial and spinal nerve organization in amphioxus and lampreys: evidence for an ancestral craniate pattern. Acta Anat. 148,96 -109.[Medline]
Frohman, M. A., Martin, G. R., Cordes, S. P., Halamed, L. P. and
Barsh, G. S. (1993). Altered rhombomere-specific gene
expression and hyoid bone differentiation in the mouse segmentation mutant,
kleisler. Development
117,925
-936.
Gaufo, G. O., Flodby, P. and Capecchi, M. R.
(2000). Hoxb1 controls effectors of sonic hedgehog and
Mash1 signaling pathways. Development
127,5343
-5354.
Gaufo, G. O., Thomas, K. R. and Capecchi, M. R.
(2003). Hox3 genes coordinate mechanisms of genetic
suppression and activation in the generation of branchial and somatic
motorneurons. Development
130,5191
-5201.
Gavalas, A., Davenne, M., Lumsden, A., Chambon, P. and Rijli, F.
M. (1997). Role of Hoxa-2 in axon pathfinding and
rostral hindbrain patterning. Development
124,3693
-3702.
Gavalas, A., Studer, M., Lumsden, A., Rijli, F. M., Krumlauf, R.
and Chambon, P. (1998). Hoxa1 and Hoxb1
synergize in patterning the hindbrain, cranial nerves and second pharyngeal
arch. Development 125,1123
-1136.
Gavalas, A. and Krumlauf, R. (2000). Retinoid signalling and hindbrain patterning. Curr. Opin. Genet. Dev. 10,380 -386.[CrossRef][Medline]
Gendron-Maguire, M., Mallo, M., Zhang, M. and Gridley, T. (1993). Hoxa-2 mutant mice exhibit homeotic transformation of skeletal elements derived from cranial neural crest. Cell 75,1317 -1331.[Medline]
Gilland, E. and Baker, R. (1993). Conservation of neuroepithelial and mesodermal segments in the embryonic vertebrate head. Acta Anat. 148,110 -123.[Medline]
Glover, J. C. (1995). Retrograde and anterograde axonal tracing with fluorescent dextran amines in the embryonic nervous system. Neurosci. Protocols 30, 1-13.
Goddard, J. M., Rossel, M., Manley, N. R. and Capecchi, M.
R. (1996). Mice with targeted disruption of Hoxb-1
fail to form the motor nucleus of the VIIth nerve.
Development 122,3217
-3228.
Grammatopoulos, G. A., Bell, E., Toole, L., Lumsden, A. and
Tucker, A. S. (2000). Homeotic transformation of branchial
arch identity after Hoxa2 overexpression.
Development 127,5355
-5365.
Guidato, S., Prin, F. and Guthrie, S. (2003).
Somatic motorneurone specification in the hindbrain: the influence of
somite-derived signals, retinoic acid, and Hoxa3.
Development 130,2981
-2996.
Hall, B. K. (1998). Evolutionary Developmental Biology, 2nd edn, London: Chapman & Hall.
Hanneman, E., Trevarrow, B., Metcalfe, W. K., Kimmel, C. B. and Westerfield, M. (1998). Segmental pattern of development of the hindbrain and spinal cord of the zebrafish embryo. Development 103,49 -58.
Higashijima, S., Hotta, Y. and Okamoto, H.
(2000). Visualization of cranial motor neurons in live transgenic
zebrafish expressing green fluorescent protein under the control of the
Islet-1 promoter/enhancer. J. Neurosci.
20,206
-218.
Hill, J., Clarke, J. D., Vargesson, N., Jowett, T. and Holder, N. (1995). Exogenous retinoic acid causes specific alterations in the development of the midbrain and hindbrain of the zebrafish embryo including positional respecification of the Mauthner neuron. Mech. Dev. 50,3 -16.[CrossRef][Medline]
Holder, N. and Hill, J. (1991). Retinoic acid modifies development of the midbrain-hindbrain border and affects cranial ganglion formation in zebrafish embryos. Development 113,1159 -1170.[Abstract]
Holland, P. W. H., Holland, L. Z., Williams, N. A. and Holland,
N. D. (1992). An amphioxus homeobox gene: Sequence
conservation, spatial expression during development and insights into
vertebrate evolution. Development
116,653
-661.
Horigome, N., Myojin, M., Hirano, S., Ueki, T., Aizawa, S. and Kuratani, S. (1999). Development of cephalic neural crest cells in embryos of Lampetra japonica, with special reference to the evolution of the jaw. Dev. Biol. 207,287 -308.[CrossRef][Medline]
Hunt, P. and Krumlauf, R. (1991a). Deciphering the Hox code: clues to patterning branchial regions of the head. Cell 20,1075 -1078.
Hunt, P., Gulisano, M., Cook, M., Sham, M. H., Faiella, A., Wilkinson, D., Boncinelli, E. and Krumlauf, R. (1991b). A distinct Hox code for the branchial region of the vertebrate head. Nature 353,861 -864.[CrossRef][Medline]
Hunter, M. P. and Prince, V. E. (2002). Zebrafish hox paralogue group 2 genes function redundantly as selector genes to pattern the second pharyngeal arch. Dev. Biol. 247,367 -389.[CrossRef][Medline]
Jackman, W. R. and Kimmel, C. B. (2002). Coincident iterated gene expression in the amphioxus neural tube. Evol. Dev. 4,366 -374.[CrossRef][Medline]
Jacobs, A. J., Swain, G. P. and Selzer, M. E. (1996). Developmental increases in expression of neurofilament mRNA selectively in projection neurons of the lamprey CNS. J. Comp. Neurol. 364,383 -401.[CrossRef][Medline]
Jungbluth, S., Bell, E. and Lumsden, A. (1999).
Specification of distinct motor neuron identities by the singular activities
of individual Hox genes. Development
126,2751
-2758.
Kessel, M. (1992). Respecification of vertebral identities by retinoic acid. Development 115,487 -501.[Abstract]
Kimmel, C. B., Powell, S. L. and Metcalfe, W. K. (1982). Brain neurons which project to the spinal cord in young larvae of the zebrafish. J. Comp. Neurol. 205,112 -127.[Medline]
Kimmel, C. B., Sepich, D. S. and Trevarrow, B. (1988). Development of segmentation in zebrafish. Development Suppl.,197 -207.
Kimmel, C. B. (1993). Patterning the brain of the zebrafish embryo. Annu. Rev. Neurosci. 16,707 -732.[Medline]
Knight, R. D., Panopoulou, G. D., Holland, P. W. H. and Shimeld, S. M. (2000). An amphioxus Krox gene: Insights into vertebrate hindbrain evolution. Dev. Genes Evol. 210,518 -521.[CrossRef][Medline]
Köntges, G. and Lumsden, A. (1996).
Rhombencephalic neural crest segmentation is preserved throughout craniofacial
ontogeny. Development
122,3229
-3242.
Krumlauf, R. (1993). Hox genes and pattern formation in the branchial region of the vertebrate head. Trends Genet. 9,106 -112.[CrossRef][Medline]
Kuraku, S., Hoshiiyama, D., Katoh, K., Suga, H. and Murata, T. (1999). Monophyly of lampreys and hagfishes supported by nuclear DNA-coded genes. J. Mol. Evol. 49,729 -735.[Medline]
Kuratani, S. C. (1991). Alternate expression of the HNK-1 epitope in rhombomeres of the chick embryo. Dev. Biol. 144,215 -219.[Medline]
Kuratani, S. (2003). Evolutionary developmental biology and vertebrate head segmentation: a perspective from developmental constraint. Theory Biosci. 122,230 -251.
Kuratani, S. C. and Eichele, G. (1993).
Rhombomere transplantation repatterns the segmental organization of cranial
nerves and reveals cell-autonomous expression of a homeodomain protein.
Development 117,105
-117.
Kuratani, S., Ueki, T., Aizawa, S. and Hirano, S. (1997). Peripheral development of the cranial nerves in a cyclostome, Lampetra japonica: morphological distribution of nerve branches and the vertebrate body plan. J. Comp. Neurol. 384,483 -500.[CrossRef][Medline]
Kuratani, S., Horigome, N., Ueki, T., Aizawa, S. and Hirano, S. (1998a). Stereotyped axonal bundle formation and neuromeric patterns in embryos of a cyclostome, Lampetra japonica. J. Comp. Neurol. 391,99 -114.[CrossRef][Medline]
Kuratani, S., Ueki, T., Hirano, S. and Aizawa, S. (1998b). Rostral truncation of a cyclostome, Lampetra japonica, induced by all-trans retinoic acid defines the head/trunk interface of the vertebrate body. Dev. Dyn. 211, 35-51.[CrossRef][Medline]
Kuratani, S., Nobusada, Y., Horigome, N. and Shigetani, Y. (2001). Embryology of the lamprey and evolution of the vertebrate jaw: insights from molecular and developmental perspectives. Philos. Trans. R. Soc. Lond. B Biol. Sci. 356,1615 -1632.[CrossRef][Medline]
Kuratani, S., Kuraku, S. and Murakami, Y. (2003). Lamprey as an evo-devo model: lessons from comparative embryology and molecular phylogenetics. Genesis 34,175 -183.
Lacalli, T. C., Holland, N. D. and West, J. E. (1994). Landmarks in the anterior central nervous system of amphioxus larvae. Philos. Trans. R. Soc. Lond. B Biol. Sci. 344,165 -185.
Lacalli, T. C. (2001). New perspectives on the evolution of protochordate sensory and locomotory systems, and the origin of brains and heads. Philos. Trans. R. Soc. Lond. B Biol. Sci. 356,1565 -1572.[CrossRef][Medline]
Lance-Jones, C., Omelchenko, N., Bailis, A., Lynch, S. and Sharma, K. (2001). Hoxd10 induction and regionalization in the developing lumbosacral spinal cord. Development 128,2255 -2268.[Medline]
Lee, R. K. K., Eaton, R. C. and Zottoli, S. J. (1993). Segmental arrangement of reticulospinal neurons in the goldfish hindbrain. J. Comp. Neurol. 329,539 -556.[Medline]
Lopez, S. L., Dono, R., Zeller, R. and Carrasco, A. E. (1995). Differential effects of retinoic acid and a retinoid antagonist on the spatial distribution of the homeoprotein Hoxb-7 in vertebrate embryos. Dev. Dyn. 204,457 -471.[Medline]
Lufkin, R. B. (1991). MR-guided needle biopsy with a high-field-strength MR system. Am. J. Neuroradiol. 12,1268 .
Lumsden, A. and Keynes, R. (1989). Segmental patterns of neuronal development in the chick hindbrain. Nature 337,424 -428.[CrossRef][Medline]
Lumsden, A. and Krumlauf, R. (1996). Patterning
the vertebrate neuraxis. Science
274,1109
-1115.
Maden, M. (2002). Retinoid signalling in the development of the central nervous system. Nat. Rev. Neurosci. 3,843 -853.[CrossRef][Medline]
Mallatt, J. and Sullivan, J. (1998). 28S and
18S rRNA sequences support the monophyly of lampreys and hagfishes.
Mol. Biol. Evol. 15,1706
-1718.
Manzanares, M., Wada, H., Itasaki, N., Trainor, P. A., Krumlauf, R. and Holland, P. W. (2000). Conservation and elaboration of Hox gene regulation during evolution of the vertebrate head. Nature 408,854 -857.[CrossRef][Medline]
Mark, M., Lufkin, T., Dolle, P., Dierich, A., LeMeur, M. and Chambon, P. (1993). Roles of Hox genes: what we have learnt from gain of function and loss of function mutations in the mouse. C. R. Acad. Sci. III. 316,995 -1008.[Medline]
Marshall, H., Nonchev, S., Sham, M. H., Muchamore, I., Lumsden, A. and Krumlauf, R. (1992). Retinoic acid alters hindbrain Hox code and induces transformation of rhombomeres 2/3 into a 4/5 identity. Nature 360,737 -741.[CrossRef][Medline]
McClintock, J. M., Carlson, R., Mann, D. M. and Prince, V.
E. (2001). Consequences of Hox gene duplication in
the vertebrates: an investigation of the zebrafish Hox paralogue group 1
genes. Development 128,2471
-2484.
McClintock, J. M., Kheirbek, M. A. and Prince, V. E. (2002). Knockdown of duplicated zebrafish hoxb1 genes reveals distinct roles in hindbrain patterning and a novel mechanism of duplicate gene retention. Development 129,2339 -2354.[Medline]
Mendelson, B. (1986a). Development of reticulospinal neurons of the zebrafish. I. Time of origin. J. Comp. Neurol. 251,160 -171.[Medline]
Mendelson, B. (1986b). Development of reticulospinal neurons of the zebrafish. II. Early axonal growth and cell body position. J. Comp. Neurol. 251,172 -184.[Medline]
Metcalfe, W. K., Mendelson, B. and Kimmel, C. B. (1986). Segmental homologies among reticulospinal neurons in the hindbrain of the zebrafish larva. J. Comp. Neurol. 251,147 -159.[Medline]
Moens, C. B., Yan, Y-L., Appel, B., Force, A. G. and Kimmel, C.
B. (1996). Valentino: a zebrafish gene required for normal
hindbrain segmentation. Development
122,3981
-3990.
Morriss-Kay, G. M., Murphy, P., Hill, R. E. and Davidson, D. R. (1991). Effects of retinoic acid excess on expression of Hox-2.9 and Krox-20 and on morphological segmentation in the hindbrain of mouse embryos. EMBO J. 10,2985 -2995.[Abstract]
Moens, C. B., Cordes, S. P., Goirgiani, M. W., Barsh, G. S. and
Kimmel, C. B. (1998). Equivalence in the genetic control of
hindbrain segmentation in fish and mouse. Development
125,381
-391.
Murakami, Y., Ogasawara, M., Sugahara, F., Hirano, S., Satoh, N. and Kuratani, S. (2001). Identification and expression of the lamprey Pax6 gene: evolutionary origin of the segmented brain of vertebrates. Development 128,3521 -3531.[Medline]
Naruse, K., Fukamachi, S., Mitani, H., Kondo, M., Matsuoka, T.,
Kondo, S., Hanamura, N., Morita, Y., Hasegawa, K., Nishigaki, R. et al.
(2000). A detailed linkage map of medaka, Oryzias
latipes. Comparative genomics and genome evolution.
Genetics 154,1773
-1784.
Neal, H. V. (1896). A summary of studies on the segmentation of the nervous system in Squalus acanthias. Anat. Anz. 12,377 -391.
Nieuwenhuys, R. and Nicholson, C. (1998). Lampreys, Petromyzontoidea. In The Central Nervous System of Vertebrates (ed. R. Nieuwenhuys, H. J. Ten Donkelaar and C. Nicholson), pp. 397-495. Berlin, Springer-Verlag.
Noden, D. M. (1991). Vertebrate craniofacial development: the relation between ontogenetic process and morphological outcome. Brain Behav. Evol. 38,190 -225.[Medline]
Orr, H. (1887). Contribution to the embryology of the lizard. J. Morphol. 1, 311-372.
Papalopulu, N., Clarke, J. D., Bradley, L., Wilkinson, D., Krumlauf, R. and Holder, N. (1991). Retinoic acid causes abnormal development and segmental patterning of the anterior hindbrain in Xenopus embryos. Development 113,1145 -1158.[Abstract]
Pasqualetti, M., Ori, M., Nardi, I. and Rijli, F. M.
(2000). Ectopic Hoxa2 induction after neural crest
migration results in homeosis of jaw elements in Xenopus.
Development 127,5367
-5378.
Pattyn, A., Vallstedt, A., Dias, J. M., Samad, O. A., Krumlauf,
R., Rijli, F. M., Brunet, J. F. and Ericson, J. (2003).
Coordinated temporal and spatial control of motor neuron and serotonergic
neuron generation from a common pool of CNS progenitors. Genes
Dev. 17,729
-737.
Pombal, M. A., Martin, O. and Gonzalez. A. (2001). Distribution of choline acetyltransferase-immunoreactive structures in the lamprey brain. J. Comp. Neurol. 431,105 -106.[CrossRef][Medline]
Prince, V. E., Joly, L., Ekker, M. and Ho, R. K.
(1998). Zebrafish hox genes: genomic organization and modified
colinear expression patterns in the trunk. Development
125,407
-420.
Prince, V. (2002). The Hox paradox: More complex(es) than imagined. Dev. Biol. 249, 1-15.[CrossRef][Medline]
Puelles, L. and Rubenstein, J. L. R. (1993). Expression patterns of homeobox and other putative regulatory genes in the embryonic mouse forebrain suggest a neuromeric organization. Trends Neurosci. 16,472 -479.[CrossRef][Medline]
Rijli, F. M., Mark, M., Lakkaraju, S., Dierich, A., Dolle, P. and Chambon, P. (1993). A homeotic transformation is generated in the rostral branchial region of the head by disruption of Hoxa-2, which acts as a selector gene. Cell 75,1333 -1349.[Medline]
Rijli, F. M., Matyas, R., Pellegrini, M., Dierich, A., Gruss, P., Dolle, P. and Chambon, P. (1995). Cryptorchidism and homeotic transformations of spinal nerves and vertebrae in Hoxa-10 mutant mice. Proc. Natl. Acad. Sci. USA 92,8185 -8189.[Abstract]
Rijli, F. M., Gavalas, A. and Chambon, P. (1998). Segmentation and specification in the branchial region of the head: the role of the Hox selector genes. Int. J. Dev. Biol. 42,393 -401.[Medline]
Rossel, M. and Capecchi, M. R. (1999). Mice
mutant for both Hoxa1 and Hoxb1 show extensive remodeling of
the hindbrain and defects in craniofacial development.
Development 126,5027
-5040.
Santagati, F. and Rijli, F. M. (2003). Cranial neural crest and the building of the vertebrate head. Nat. Rev. Neurosci. 4,806 -818.[CrossRef][Medline]
Schilling, T. F. and Knight, R. D. (2001). Origins of anteroposterior patterning and Hox gene regulation during chordate evolution. Philos. Trans. R. Soc. Lond. B Biol. Sci. 356,1599 -1613.[CrossRef][Medline]
Schneider-Maunoury, S., Seitanidou, T., Charnay, P. and Lumsden,
A. (1997). Segmental and neuronal architecture of the
hindbrain of Krox-20 mouse mutants.
Development 124,1215
-1226.
Sham, M. H., Hunt, P., Nonchev, S., Papalopulu, N., Graham, A., Boncinelli, E. and Krumlauf, R. (1992). Analysis of the murine Hox-2.7 gene: conserved alternative transcripts with differential distributions in the nervous system and the potential for shared regulatory regions. EMBO J. 11,1825 -1836.[Abstract]
Shigetani, Y., Sugahara, F., Kawakami, Y., Murakami, Y., Hirano,
S. and Kuratani, S. (2002). Heterotopic shift of
epithelial-mesenchymal interactions for vertebrate jaw evolution.
Science 296,1319
-1321.
Song, J. and Boord, R. L. (1993). Motor components of the trigeminal nerve and organization of the mandibular arch muscles in vertebrates. Phylogenetically conservative patterns and their ontogenetic basis. Acta Anat. 148,139 -149.[Medline]
Steinberg, M. (1957). A nonnutrient culture medium for amphibian embryonic tissues. Carnegie Institution of Washington Year Book 56,347 -348.
Studer, M., Lumsden, A., Ariza-McNaughton, L., Bradley, L. and Krumlauf, A. (1996). Altered segmental identity and abnormal migration of motor neurons in mice lacking Hoxb-1. Nature 384,630 -634.[CrossRef][Medline]
Studer, M. (2001). Initiation of facial
motorneurone migration is dependent on rhombomeres 5 and 6.
Development 128,3707
-3716.
Suga, H., Hoshiyama, D., Kuraku, S., Katoh, K., Kubokawa, K. and Miyata, T. (1999). Protein tyrosine kinase cDNAs from amphioxus, hagfish, and lamprey: isoform duplications around the divergence of cyclostomes and gnathostomes. J. Mol. Biol. 49,601 -608.[CrossRef]
Swain, G. P., Snedeker, J. A., Ayers, J. and Selzer, E. (1993). Cytoarchitecture of spinal-projecting neurons in the brain of the larval sea lamprey. J. Comp. Neurol. 336,194 -210.[Medline]
Tahara, Y. (1988). Normal stages of development in the lamprey, Lampetra reissneri (Dybowski). Zool. Sci. 5,109 -118.
Tello, J. F. (1923). Les différenciations neuronales dans l'embryon du poulet pendent les premiers jours de l'incubation. Trav. Lab. Invest. Biol. Univ. Madrid 21,1 -93.
Tiret, L., le Mouellic, H., Maury, M. and Brulet, P.
(1998). Increased apoptosis of motorneurons and altered
somatotopic maps in the brachial spinal cord of Hoxc-8-deficient
mice. Development 125,279
-291.
Vaage, S. (1969). The segmentation of the primitive neural tube in chick embryos (Gallus domesticus). Ergeb. Anat. Entw. Gesch. 4, 1-88.
Wada, H., Garcia-Fernandez, J. and Holland, P. W. (1999). Colinear and segmental expression of amphioxus Hox genes. Dev. Biol. 213,131 -141.[CrossRef][Medline]
Wada, H. and Satoh, N. (2001). Patterning the protochordate neural tube. Curr. Opin. Neurobiol. 11, 16-21.[CrossRef][Medline]
Wilkinson, D., Bhatt, S., Chavrier, P., Bravo, R. and Charnay, P. (1989). Segment-specific expression of a zinc-finger gene in the developing nervous system of the mouse. Nature 337,461 -464.[CrossRef][Medline]
Wilkinson, D. G. (2001). Multiple roles of EPH receptors and ephrins in neural development. Nat. Rev. Neurosci. 2,155 -164.[CrossRef][Medline]
Xu, Q., Alldus, G., Holder, N. and Wilkinson, D. G.
(1995). Expression of truncated Sek-1 receptor tyrosine kinase
disrupts the segmental restriction of gene expression in the Xenopus
and zebrafish hindbrain. Development
121,4005
-4016.