1 Department of Genetics, University of Pennsylvania School of Medicine, 560 Clinical Research Building, 415 Curie Blvd, Philadelphia, PA 19104-6145, USA
2 Division of Gastroenterology, Department of Medicine, University of Pennsylvania School of Medicine, 600 Clinical Research Building, 415 Curie Blvd, Philadelphia, PA 19104-6144, USA
3 Department of Cell and Developmental Biology, University of Pennsylvania School of Medicine, 1109 BRB II/III, 421 Curie Blvd, Philadelphia, PA 19104-6058, USA
4 Division of Digestive Diseases, Emory University School of Medicine, Room 201 Whitehead Medical Building, 615 Michael Street, Atlanta, GA 30322, USA
*Author for correspondence (e-mail: kaestner{at}mail.med.upenn.edu)
Accepted 19 March 2002
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Klf4, Goblet cell, Cell differentiation, Colon, Mouse
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In the colon, stem cells are located at the base of the crypts, with proliferation occurring in the lower third of these epithelial folds. Epithelial cells migrate in ordered cohorts towards the lumenal surface, differentiating to form one of three cell types: colonocytes, goblet cells and enteroendocrine cells. At the lumenal surface, cells enter a death program characterized by senescence and/or apoptosis, and are sloughed into the lumen (Potten, 1997). More than 80% of all epithelial tissue in the colon comprises colonocytes (Chang and Leblond, 1971
). Colonocytes have both absorptive and secretory functions, absorbing water, sodium and short-chain fatty acids while secreting bicarbonate and potassium. Goblet cells, meanwhile, elaborate mucins, trefoil proteins and other factors that help protect the intestinal mucosa from injury and facilitate tissue repair (Deplancke and Gaskins, 2001
). In the adult mouse descending colon, cells of this lineage form about 16% of the total crypt cell population (Karam, 1999
). Enteroendocrine cells, the least common of the colonic epithelial cells, secrete various gastrointestinal hormones. Enteroendocrine cells normally represent less than 1% of colonic epithelial cells (Tsubouchi and Leblond, 1979
). The three cell lineages of the colon are first evident at the endoderm-intestinal transition, which occurs on embryonic day 15-16 in mice (Traber, 1999
). The epithelium of the colon continues to mature after birth, with the expression of certain genes delayed until the suckling-weaning transition around postnatal day 17 (Traber and Wu, 1995
; Traber, 1999
).
Cell proliferation, differentiation, and death in the gastrointestinal tract are under tight genetic control. In the intestine, complex signals mediate cellular differentiation programs, but up to now these signals have not been well understood. The basic helix-loop-helix (bHLH) protein BETA2 has been suggested to control terminal differentiation of secretin-producing enteroendocrine cells (Mutoh et al., 1998). Hes1 is a general repressor of bHLH factor-controlled endodermal endocrine cell differentiation in the stomach and proximal small intestine, as Hes1-null mice show excessive differentiation of multiple enteroendocrine cell types, as well as more intestinal goblet cells and fewer enterocytes (Jensen et al., 2000
). A constitutively active form of the Rho GTPase Rac1 induces precocious differentiation of Paneth cells and enterocytes in the small intestine, without affecting cell division (Stappenbeck and Gordon, 2000
). Recently, loss of the bHLH-factor Math1 (Atoh1 Mouse Genome Informatics) was shown to deplete intestinal goblet, enteroendocrine and Paneth cells, but not enterocytes (Yang et al., 2001
). Goblet, enteroendocrine and Paneth cells may arise from a progenitor that expresses Math1, while enterocytes arise from a progenitor that is Math1 independent. Taken together, these results suggest a hierarchical regulation of intestinal epithelial cell differentiation. Still, much of the complex regulatory network of differentiation remains to be understood.
The roles of the epithelial cells of the intestine have been studied in vitro and in vivo. Specific markers, such as Tff3 and Muc2 for intestinal goblet cells, have been identified, and targeted ablation of Paneth cells and goblet cells using transgenic mice has yielded insight into the function of these different cell types (Garabedian et al., 1997; Itoh et al., 1999a
; Itoh et al., 1999b
; van Klinken et al., 1999
). Mice deficient in Muc2, the most abundant murine intestinal mucin, display aberrant intestinal crypt morphology, with altered cell maturation and migration (Velcich et al., 2002
). Muc2-null mice develop small intestinal adenomas, which progress to invasive adenocarcinomas, and rectal tumors, linking a specific product of intestinal goblet cells to the suppression of cancer. While keratinocyte growth factor, which induces proliferation of epithelial cells throughout the gastrointestinal tract, promotes goblet cell differentiation in vitro (Housley et al., 1994
; Iwakiri and Podolsky, 2001a
), the identification of differentiation factors specific for the goblet cell lineage in vivo has remained elusive.
Klf4 (formerly GKLF) is a zinc-finger transcription factor expressed in the epithelia of the skin, the lungs, the gastrointestinal tract and several other organs (Garrett-Sinha et al., 1996; Shields et al., 1996
; Ton-That et al., 1997
). In vitro studies have suggested a role for Klf4 in cell proliferation and/or differentiation (Bieker, 2001
). In cultured fibroblasts, Klf4 mRNA is found at high levels in growth-arrested cells and is nearly undetectable in cells that are in the exponential phase of proliferation (Shields et al., 1996
). Moreover, DNA synthesis is inhibited in fibroblasts transfected with a Klf4-expressing plasmid construct (Shields et al., 1996
). Constitutive overexpression of Klf4 in a human colonic adenocarcinoma cell line (HT-29) decreases [3H]thymidine incorporation, whereas suppression of the Klf4 gene with antisense cDNA increases DNA synthesis (Shie et al., 2000
). In the human colon cancer cell line RKO, inducible expression of Klf4 leads to a block at the G1/S transition phase of the cell cycle (Chen et al., 2001
). In esophageal squamous epithelial cells, Klf4 transcriptionally activates the promoters for the late differentiation genes keratin 4 and Epstein-Barr virus ED-L2 (Jenkins et al., 1998
).
In the embryo, expression of Klf4 mRNA is seen in the epithelium of the colon by embryonic day 15.5 (Garrett-Sinha et al., 1996). In the adult mouse, Klf4 mRNA localizes to the upper region of the crypt epithelium, a region that consists of cells that have undergone growth arrest and begun to differentiate into mature colonocytes (Shields et al., 1996
). Mice homozygous for a null mutation in Klf4 are born at the expected Mendelian ratio but die within 15 hours of birth and show selective perturbation of the late-stage differentiation structures of the epidermis (Segre et al., 1999
). The early lethality of Klf4-null mice has been attributed to the loss of skin barrier function as no defects in any organ other than skin were noted. To date, nothing has been reported about the function of Klf4 in gastrointestinal epithelial proliferation and differentiation in vivo.
In this study, we provide the first in vivo evidence that Klf4 is a goblet cell-specific differentiation factor in the colon. Using gene targeting, we demonstrate that Klf4 is required for the terminal differentiation of colonic goblet cells. This role of Klf4 in the colon is specific to the goblet cell lineage, as both colonocytes and enteroendocrine cells appear to undergo normal maturation.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
ES cells from a floxed Klf4 clone were injected into blastocysts derived from C57BL/6 mice. Blastocysts were transferred to pseudopregnant females and chimeric offspring were identified by the presence of agouti hair. Chimeric males were mated to C57BL/6 females to obtain ES cell-derived offspring. Mice heterozygous for the floxed Klf4 allele were mated with mice expressing Cre under the control of the CMV promoter to generate the null allele (White et al., 1997). The CMV-Cre transgene was then bred out, and heterozygous mutants (Klf4+/) were mated inter se to generate homozygous mutants (Klf4/). Mice studied were on a mixed genetic background.
Embryos and mice were genotyped by PCR using three primers: Klf4 exon1, CTGGGCCCCCACATTAATGAG; Klf4 exon2, TCAGACTGTACCGACAGTCGC; and Klf4 intron3, TTTTGTCGGTCTTGCCGAGAC. PCR reactions were carried out for 32 cycles (95°C for 40 seconds; 60°C for 40 seconds; 72°C for 60 seconds) in a buffer containing 1.5 mM MgCl2. The wild-type allele produced a band of 172 bp, the floxed allele a band of 296 bp and the null allele a band of 425 bp.
Histology and cell counting
Mice were sacrificed at postnatal day 1 and colons were removed and fixed in 4% paraformaldehyde, embedded in paraffin, and 5 µm sections were applied to Probe-on PlusTM slides (Fisher). Sections were deparaffinized in xylene, then rehydrated in ethanol and stained with either Hematoxylin and Eosin or Alcian Blue and nuclear fast red as previously described (Kaestner et al., 1997). For Hematoxylin and Eosin staining, sections were incubated in Hematoxylin for 2.5 minutes and Eosin for 15 seconds. For Alcian Blue staining, sections were incubated in 1% Alcian Blue in 3% acetic acid, pH 2.5, for 30 minutes and 0.1% nuclear Fast Red for 10 seconds. After staining, sections were dehydrated in ethanol, cleared with xylene and mounted with CytosealTM 60 (Stephens Scientific). Images were captured on a Nikon Microphot FX microscope. The ratio of goblet cells to total epithelial cells was obtained by counting, in a blinded fashion, total epithelial cells and Alcian Blue-positive cells with goblet morphology from ten high-powered fields of well-oriented colonic cross-sections (Itoh et al., 1999a
).
Electron microscopy
Mice were sacrificed at postnatal day 1, and tissues were removed and fixed overnight in 2% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.4, at 4°C. Sections were then prepared for electron microscopy using a standard protocol (Smith et al., 1985). Briefly, tissues were washed with 0.1M sodium cacodylate, post-fixed with 2% osmium tetroxide in 0.1M sodium cacodylate and washed at 4°C. Tissues were stained with 2% aqueous uranyl acetate, dehydrated in graded alcohol and embedded in Embed 812 resin (Electron Microscopy Sciences). Sections 7x108 m thick were cut using a Leica Ultracut S microtome and mounted on 200 mesh thin bar copper grids, stained in 7% aqueous uranyl acetate, and counterstained in bismuth subnitrite. Digital Images were collected on a JEOL JEM 1010 equipped with a Hamamatsu CCD camera and AMT 12-HR imaging software.
In situ hybridization
Tissues were fixed in Bouins fixative (for Klf4) or 4% PFA (for Muc2), embedded in paraffin, and 5 µm sections were applied to Probe-on PlusTM slides (Fisher). Sections were deparaffinized in xylene, then rehydrated in ethanol. Digoxigenin-labeled sense and antisense probes were transcribed in vitro from the following plasmids: a 220 bp fragment of the mouse Klf4 full-length cDNA (GenBank Accession Number, U20344) containing the nucleotides 1360-1574 cloned into the pBluescript SK (Stratagene) and a 357 bp fragment of the mouse Muc2 partial cDNA (GenBank Accession Number, AJ010437) containing the nucleotides 337 to 694 cloned into pCRII (Invitrogen). In situ hybridization was performed as described by Wilkinson (Wilkinson, 1992). Anti-digoxigenin antibody (Roche Diagnostics) was used at a dilution of 1:2000. The slides were developed overnight using NBT/BCIP substrate (Roche Diagnostics), counterstained with 0.1% nuclear Fast Red for 5 seconds or less, dehydrated and mounted with CytosealTM 60 (Stephens Scientific). Images were captured on a Nikon Microphot FX microscope.
Immunohistochemistry, cell proliferation and cell death assays
Mice on postnatal day 1 were injected 1 hour before sacrifice with BrdU labeling reagent (Zymed) as per manufacturers protocol. Tissues were removed and fixed in 4% paraformaldehyde, embedded in paraffin and 5 µm sections were applied to Probe-on PlusTM slides (Fisher). The primary antibodies used were mouse monoclonal anti-BrdU (1:500, Roche Diagnostics) and rabbit anti-chromogranin A (1:3000, Diasorin). Apototic cells were detected using the In Situ Death Detection Kit (Roche Diagnostics) as per manufacturers protocol. Anti-BrdU antibody was detected with biotinylated goat anti-mouse secondary antibody (1:200, Vector), alkaline phosphatase-labeled avidin-biotin complex (Biostain Super ABC, Biomeda) and NBT/BCIP substrate (Roche Diagnostics). Anti-chromogranin antibody was detected with biotinylated goat anti-rabbit secondary antibody (1:200, Vector), peroxidase labeled avidin-biotin complex (Vectastain ABC Kit, Vector) and DAB substrate-chromogen solution (Vector).
After wax removal and rehydration, slides were immersed in 0.01M citric acid buffer (pH 6.0) and microwaved to boil for 7 minutes, cooled, and washed twice in phosphate-buffered saline (PBS). Slides for chromogranin detection were incubated for 15 minutes in 1.5% hydrogen peroxide and washed twice in PBS prior to proceeding. Nonspecific binding of avidin-biotin was blocked (Avidin/Biotin Blocking Kit, Vector), and slides were washed once with PBS, then incubated for 15 minutes at room temperature with Protein Blocking Agent (Immunotech). Primary antibody diluted with 0.1% bovine serum albumin, 0.2% Triton X-100 in PBS (PBT) was applied and the tissue incubated overnight at 4°C in a moist chamber. After washing with PBS, secondary antibody diluted with PBT was applied and the tissue incubated for 40 minutes at 37°C in a moist chamber. The slides were developed using the avidin-biotin complex and substrate as per the manufacturers protocols, counterstained with Hematoxylin for 2.5 minutes or 0.1% nuclear fast red for 10 seconds, dehydrated and mounted with CytosealTM 60 (Stephens Scientific). Images were captured on a Nikon Microphot FX microscope.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
The general appearance of the mice homozygous for a null mutation in Klf4 (Klf4/) has been previously noted (Segre et al., 1999). Our results were consistent with the prior report. Klf4/ mice were born at approximately normal Mendelian frequency and were initially indistinguishable from wild-type littermates. However, all Klf4/ mice died on postnatal day 1. No differences were observed between heterozygous and wild-type animals in overall development, histology, growth characteristics or gene expression.
In situ hybridization for Klf4 was performed on colon of wild-type and Klf4/ mice on postnatal day 1. In Fig. 1D, wild-type mice demonstrated epithelial-specific expression of Klf4 mRNA in the colon (arrows). In the colon of adult mice, Klf4 expression is confined to the upper third of the crypt epithelium (Shields et al., 1996). In newborn mice, Klf4 expression was detected diffusely throughout the epithelium. Klf4/ mice showed no expression of Klf4 mRNA in the colon, confirming the successful deletion of Klf4 (Fig. 1E).
Cell proliferation and cell death are normal in the colon of Klf4/ mice
As Klf4 has been suggested to be a negative regulator of cell proliferation in vitro (Chen et al., 2001; Shie et al., 2000
; Shields et al., 1996
), we investigated the role of Klf4 in cell proliferation in vivo using immunohistochemistry for bromodeoxyuridine (BrdU). BrdU injected into the peritoneum reaches the gastrointestinal epithelium within minutes and is incorporated into the DNA of cells in S phase. For our experiments, wild-type and mutant mice were injected with BrdU and sacrificed 1 hour after injection. Staining for BrdU revealed no difference in the number of labeled cells in the colonic epithelium of wild-type mice (Fig. 2A) versus Klf4/ mice (Fig. 2B). Moreover, no spatial differences in BrdU staining were observed. Thus, Klf4/ mice on postnatal day 1 showed no change in the rate of cell proliferation in the colon. Wild-type and Klf4/ mice also showed no changes in the number or location of epithelial cells undergoing apoptosis in the colon (data not shown).
|
The colonic mucosa of the Klf4/ mice on postnatal day 1 was abnormal when compared with wild-type littermates (Fig. 3A,B). The colons of Klf4/ mice appeared, in general, to have subtle changes in epithelial contour. The most marked change in the Klf4/ mice was a dramatic decrease in the number of mature goblet cells. Goblet cells are specialized epithelial cells that elaborate mucins, trefoil proteins and other factors that help protect the intestinal mucosa from injury and facilitate tissue repair (Deplancke and Gaskins, 2001). Cells of this lineage normally undergo a specific differentiation program, first forming pre-goblet cells, also called oligomucous cells, that are characterized by a few mucous granules, occasionally grouped into a narrow theca (Karam, 1999
). Pre-goblet cells are generally confined to the colonic crypt base or mid-crypt, with some regional variation. Mature goblet cells form from the pre-goblet cells within 1-2 days and are recognized by the large and numerous mucous granules that cause the thecae to swell, giving the typical goblet appearance (Chang and Leblond, 1971
; Chang and Nadler, 1975
).
|
To further characterize the reduction of goblet cells in the colon of Klf4/ mice, we performed Alcian Blue staining. Alcian Blue detects acidic mucins, which are normally restricted to pre-goblet and goblet cells in the colon. At low power, staining of wild-type colons revealed numerous Alcian Blue-positive cells (Fig. 4A). By contrast, very few Alcian Blue-positive cells were seen in colons of the Klf4/ mice, indicating that goblet cell differentiation was dramatically impaired (Fig. 4B). Moreover, at higher power, Alcian Blue staining was seen only in goblet cells (arrows) of wild-type colons (Fig. 4C). By contrast, Klf4/ colons displayed numerous epithelial cells with small amounts of Alcian Blue staining material (arrows) but no normal goblet cell morphology (Fig. 4D). This staining pattern in the Klf4/ mice could represent either ectopic mucin expression or the presence of numerous pre-goblet cells throughout the epithelium. Periodic Acid Schiff (PAS) staining, which detects both neutral and acidic mucins, confirmed the results of the Alcian Blue staining (data not shown), demonstrating that the alterations in colonic goblet cells were not due to changes in expression of acidic mucins alone.
|
Epithelial cells in Klf4/ mice do not show the normal goblet cell morphology by ultrastructural analysis
As the number and appearance of colonic goblet cells was abnormal in Klf4/ mice, we performed electron microscopy to better define the ultrastructure of goblet cells. In the wild-type colon, cells with normal goblet cell morphology were seen (Fig. 5A, arrows). The nucleus of the goblet cell (Fig. 5A, dark arrowhead) is typically dark, dense and squeezed at the base of the goblet (Karam, 1999). The protein components of the intestinal mucins are synthesized by the rough endoplasmic reticulum and passed to the Golgi apparatus where they are combined with carbohydrate and packaged into membrane-bound secretory vacuoles (Burkitt et al., 1993
). The apical portion of the cell was comprised largely of these secretory vacuoles. Normal colonocytes (Fig. 5B, *) are interspersed. In the colons from Klf4/ mice, the normal goblet cell morphology was not seen. Several abnormally shaped or immature cells of the goblet lineage (arrows) emptied their contents into the lumen, and adjacent to these cells were several cells with densely packed nuclei (Fig. 5B, dark arrowheads), suggesting a goblet cell lineage, but lacking the typical secretory vacuoles and normal goblet cell shape. Adjacent to these cells, several colonocytes (Fig. 5B, *), recognized by their paler cytoplasm and less condensed nuclei, appeared normal. The colons from the Klf4/ mice also revealed small clusters of secretory vacuoles scattered throughout the epithelium (Fig. 5C, arrows). The spatial orientation of these mucigen granules was reminiscent of the pattern of Alcian Blue staining described above in Klf4/ mice (Fig. 4D).
|
In situ hybridization for Muc2 in wild-type mice on postnatal day 1 revealed a goblet-cell specific expression pattern (Fig. 6A). Abundant expression of Muc2 mRNA (Fig. 6A, arrows) was seen adjacent to the apical mucigen granules. Staining was prominent only in surface epithelial cells. Klf4/ mice, however, showed expression of Muc2 mRNA in the epithelium, but this expression was not confined to cells with mature goblet morphology (Fig. 6B). Patchy expression was seen in cells throughout the epithelium (Fig. 6B, arrows). The Muc2 mRNA expression in the Klf4/ mice invoked the abnormal pattern of Alcian Blue staining and the mucigen granules detected on electron microscopy.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We confined our studies to the colon as the goblet cell phenotype of the Klf4/ mice appears to be minimal in the small intestine. This is not surprising as Klf4 is more highly expressed in colon than small intestine (Shields et al., 1996). Moreover, while levels of Klf4 transcript approach adult levels in the colon by postnatal day 4, they are markedly reduced relative to the adult in the small intestine until at least postnatal day 12 (Ton-That et al., 1997
). Notably, targeted ablation of goblet cells using a murine Tff3 promoter driving expression of an attenuated diptheria toxin produces a significant reduction in the number of goblet cells in the colon (
60%) but not the small intestine, suggesting distinct goblet cell regulatory programs in each organ (Itoh et al., 1999a
).
In the colon, Klf4 deletion alters the terminal differentiation program of goblet cells. Numbers of mature goblet cells relative to total epithelial cells are reduced by 90% in Klf4/ mice compared with littermate controls. This reduction is even greater than that reported by targeted ablation of intestinal goblet cells with attenuated diptheria toxin (Itoh et al., 1999a), demonstrating that goblet cell differentiation in the colon of Klf4/ mice is severely perturbed. Numerous colonic epithelial cells in the Klf4/ mice contain small amounts of acidic mucins shown by Alcian Blue staining or show expression of the goblet cell specific marker Muc2 by in situ hybridization, but lack normal goblet cell morphology by both histology and ultrastructural analyses. These cells probably represent pre-goblet cells, immature cells of the goblet cell lineage. It is unlikely that they represent colonocytes with ectopic mucin expression as these cells have ultrastructural features characteristic of a goblet cell lineage. Furthermore, this explanation would provide no basis for the decrease in goblet cell numbers. In addition, as epithelial cell differentiation in mice begins at least 5 days earlier and differentiation of colonocytes and enteroendocrine cells is unaffected, the abnormal terminal differentiation of goblet cells in Klf4/ mice is not likely to be due solely to a developmental delay.
Several important questions remain to be answered. If Klf4 is essential for terminal differentiation of goblet cells in the colon, why are rare goblet cells observed in the Klf4/ mice? As Klf4/ mice die universally on postnatal day 1, what is the impact of the loss of Klf4 in the colon at later stages of development? By what mechanism does Klf4 alter the goblet cell differentiation program? Several explanations exist for the first question. Our experiments are performed on mice of a mixed genetic background, and regional differences in gene expression may be seen within the colon and throughout the gastrointestinal tract (Clatworthy and Subramanian, 2001), leading to phenotypic variability. Nonetheless, the goblet cells seen in the Klf4/ mice are smaller and less elongated than their wild-type counterparts, suggesting that even in these cells, differentiation is perturbed. Most of these cells may, in fact, represent pre-goblet cells. In the Klf4/ mice, cells in the goblet lineage appear to be immature with failure to complete the goblet cell differentiation program. Yet Klf4 mRNA is not expressed in a goblet cell-specific manner in the colon, and the cells in Klf4/ mice do undergo cell fate specification and begin a goblet cell differentiation program. Thus, Klf4 is not crucial for initiation of goblet cell differentiation but rather for the terminal differentiation of goblet cells.
The importance of Klf4 later in life can be addressed through the generation of an intestine-specific knockout of Klf4. Klf4/ mice were analyzed at the latest possible stage of intestinal development, as all animals die by postnatal day 1. As all three colonic cell lineages are present in the murine colon by embryonic day 15-16, the role of Klf4 on cellular differentiation has been addressed by this study. However, many other effects cannot be determined in the Klf4-null mice. Targeted ablation of goblet cells results in a paradoxical reduction in susceptibility to colonic injury (Itoh et al., 1999a). By contrast, goblet cell depletion is seen in inflammatory bowel disease and loss of Muc2 in mice leads to the development of small intestinal and rectal tumors (Chutkan, 2001
; Velcich et al., 2002
). Owing to the premature death of the Klf4/ mice, the functional role of the reduction in goblet cell numbers on colonic epithelial injury and repair cannot be fully assessed. Future studies will use our Klf4loxP allele to address these questions.
While Klf4 does not directly impact cellular proliferation in the colon on postnatal day 1, it is possible that Klf4 deletion may result in tumor formation later in life. In humans, Klf4 mRNA levels are significantly decreased in the dysplastic epithelium of the colon, including adenomatous polyps and cancer (Shie et al., 2000). Klf4 is also downregulated in intestinal adenomas from the APCMin mouse, a model of intestinal neoplasia, and colonic adenomas of patients with familial adenomatous polyposis (FAP) (Dang et al., 2000
). Individuals with FAP carry a germline mutation in the adenomatous polyposis coli (APC) gene. Many mouse models of intestinal tumorigenesis, including APCMin, do not develop evidence of epithelial hyperproliferation until at least several months of age (Donehower et al., 1992
; Martin-Caballero et al., 2001
; Shoemaker et al., 1997
). Thus the role of Klf4 in the adult colonic epithelium remains to be explored.
The molecular mechanisms by which Klf4 regulates the terminal differentiation of goblet cells also remain to be elucidated. The phenotype of Muc2-deficient mice, which lack terminally differentiated goblet cells, as assessed by Alcian Blue staining, is reminiscent of the phenotype of the Klf4/ mice (Velcich et al., 2002). The expression of Tff3 in some intestinal cells that lack mature goblet cell morphology from the Muc2/ mice demonstrates that the goblet cell differentiation pathway is not completely ablated. Thus, it is possible that Klf4 directly or indirectly controls Muc2 expression, thereby producing the phenotype observed in Klf4/ mice. Alternatively, Klf4 could control a whole set of genes required for the terminal differentiation of goblet cells. We cannot differentiate among these possibilities here, as Tff3 expression is not seen in the murine colon until postnatal day 3 (Mashimo et al., 1995
), and no other markers exist at present for the terminal differentiation of goblet cells in newborn mice.
Some evidence suggests a mechanism by which Klf4 may regulate the goblet cell differentiation program. The promoter region of Klf4 contains binding sites for the Cdx2 protein (Mahatan et al., 1999), which has been found to regulate sucrase-isomaltase and lactase, markers of intestinal enterocyte differentiation (Fang et al., 2000
; Suh et al., 1994
). Forced expression of Cdx2 results in induction of enterocyte differentiation, and heterozygous deletion of Cdx2 results in colorectal cancer in mice (Chawengsaksophak et al., 1997
; Suh and Traber, 1996
). As a positive regulator of differentiation and a negative regulator of proliferation expressed in the intestinal epithelium, Cdx2 is thus a good candidate to direct Klf4-mediated goblet cell differentiation. In fact, expression of Klf4 in the human colon cancer cell line RKO is dependent upon Cdx2 (Dang et al., 2001
).
Recently, Podolsky and colleagues recognized a goblet cell silencer inhibitor element (GCSI) on DNA and identified a GCSI binding protein (GCSI-BP), which is induced by keratinocyte growth factor and promotes goblet cell differentiation in vitro (Iwakiri and Podolsky, 2001a; Iwakiri and Podolsky, 2001b
). Thus, one can postulate a pathway whereby Cdx2 binds Klf4, which can then transactivate GCSI-BP and/or other genes crucial for terminal differentiation of colonic goblet cells. Investigation of this regulatory relationship will require the cloning of the GCSI-BP, which has not yet been reported.
Klf4 can now be put in the context of the emerging model of hierarchical regulation of intestinal epithelial cell differentiation. Math1 and Hes1 may act in opposing manners to direct cell fate decisions between the absorptive enterocytes and the other three cell lineages (Jensen et al., 2000; Yang et al., 2001
). Rac1 induces differentiation of both enterocytes and Paneth cells in the small intestine (Stappenbeck and Gordon, 2000
). The Notch signaling pathway and several bHLH proteins are crucial for enteroendocrine cell fate decisions (Jensen et al., 2000
; Mutoh et al., 1998
). In the colon, Klf4 is required for the terminal differentiation of goblet cells, which appears to place it downstream of Math1.
In conclusion, we provide here the first evidence that Klf4 is a goblet cell-specific differentiation factor in the colon. We demonstrate that Klf4/ mice display a marked decrease in the number of goblet cells in the colon, altered expression of the goblet cell marker Muc2 and abnormal goblet cell morphology. These effects are specific to the goblet cell lineage, as both colonocytes and enteroendocrine cells appear to undergo normal maturation. No alterations are seen in cell proliferation or cell death. Thus, Klf4 plays a crucial role in colonic epithelial cell differentiation in vivo.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Bach, S. P., Renehan, A. G. and Potten, C. S. (2000). Stem cells: the intestinal stem cell as a paradigm. Carcinogenesis 21, 469-476.
Bieker, J. J. (2001). Krüppel-like factors: three fingers in many pies. J. Biol. Chem. 276, 34355-34358.
Burkitt, H. G., Young, B. and Heath, J. W. (1993). Wheaters Functional Histology: A Text and Color Atlas. New York: Churchill Livingstone.
Chang, W. W. and Leblond, C. P. (1971). Renewal of the epithelium in the descending colon of the mouse. I. Presence of three cell populations: vacuolated-columnar, mucous and argentaffin. Am. J. Anat. 131, 73-99.[Medline]
Chang, W. W. and Nadler, N. J. (1975). Renewal of the epithelium in the descending colon of the mouse. IV. Cell population kinetics of vacuolated-columnar and mucous cells. Am. J. Anat. 144, 39-56.[Medline]
Chawengsaksophak, K., James, R., Hammond, V. E., Kontgen, F. and Beck, F. (1997). Homeosis and intestinal tumours in Cdx2 mutant mice. Nature 386, 84-87.[Medline]
Chen, X., Johns, D. C., Geiman, D. E., Marban, E., Dang, D. T., Hamlin, G., Sun, R. and Yang, V. W. (2001). Krüppel-like factor 4 (gut-enriched Krüppel-like factor) inhibits cell proliferation by blocking G1/S progression of the cell cycle. J. Biol. Chem. 276, 30423-30428.
Chutkan, R. K. (2001). Inflammatory bowel disease. Prim. Care 28, 539-556, vi.[Medline]
Clatworthy, J. P. and Subramanian, V. (2001). Stem cells and the regulation of proliferation, differentiation and patterning in the intestinal epithelium: emerging insights from gene expression patterns, transgenic and gene ablation studies. Mech. Dev. 101, 3-9.[Medline]
Dang, D. T., Bachman, K. E., Mahatan, C. S., Dang, L. H., Giardiello, F. M. and Yang, V. W. (2000). Decreased expression of the gut-enriched Krüppel-like factor gene in intestinal adenomas of multiple intestinal neoplasia mice and in colonic adenomas of familial adenomatous polyposis patients. FEBS Lett. 476, 203-207.[Medline]
Dang, D. T., Mahatan, C. S., Dang, L. H., Agboola, I. A. and Yang, V. W. (2001). Expression of the gut-enriched Krüppel-like factor (Krüppel-like factor 4) gene in the human colon cancer cell line RKO is dependent on Cdx2. Oncogene 20, 4884-4890.[Medline]
Deplancke, B. and Gaskins, H. R. (2001). Microbial modulation of innate defense: goblet cells and the intestinal mucus layer. Am. J. Clin. Nutr. 73, 1131S-1141S.
Donehower, L. A., Harvey, M., Slagle, B. L., McArthur, M. J., Montgomery, C. A., Jr, Butel, J. S. and Bradley, A. (1992). Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours. Nature 356, 215-221.[Medline]
Falk, P., Roth, K. A. and Gordon, J. I. (1994). Lectins are sensitive tools for defining the differentiation programs of mouse gut epithelial cell lineages. Am. J. Physiol. 266, G987-G1003.
Fang, R., Santiago, N. A., Olds, L. C. and Sibley, E. (2000). The homeodomain protein Cdx2 regulates lactase gene promoter activity during enterocyte differentiation. Gastroenterology 118, 115-127.[Medline]
Garabedian, E. M., Roberts, L. J., McNevin, M. S. and Gordon, J. I. (1997). Examining the role of Paneth cells in the small intestine by lineage ablation in transgenic mice. J. Biol. Chem. 272, 23729-23740.
Garrett-Sinha, L. A., Eberspaecher, H., Seldin, M. F. and de Crombrugghe, B. (1996). A gene for a novel zinc-finger protein expressed in differentiated epithelial cells and transiently in certain mesenchymal cells. J. Biol. Chem. 271, 31384-31390.
Gu, H., Marth, J. D., Orban, P. C., Mossmann, H. and Rajewsky, K. (1994). Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting. Science 265, 103-106.[Medline]
Housley, R. M., Morris, C. F., Boyle, W., Ring, B., Biltz, R., Tarpley, J. E., Aukerman, S. L., Devine, P. L., Whitehead, R. H. and Pierce, G. F. (1994). Keratinocyte growth factor induces proliferation of hepatocytes and epithelial cells throughout the rat gastrointestinal tract. J. Clin. Invest. 94, 1764-1777.[Medline]
Itoh, H., Beck, P. L., Inoue, N., Xavier, R. and Podolsky, D. K. (1999a). A paradoxical reduction in susceptibility to colonic injury upon targeted transgenic ablation of goblet cells. J. Clin. Invest. 104, 1539-1547.
Itoh, H., Inoue, N. and Podolsky, D. K. (1999b). Goblet-cell-specific transcription of mouse intestinal trefoil factor gene results from collaboration of complex series of positive and negative regulatory elements. Biochem. J. 341, 461-472.[Medline]
Iwakiri, D. and Podolsky, D. K. (2001a). Keratinocyte growth factor promotes goblet cell differentiation through regulation of goblet cell silencer inhibitor. Gastroenterology 120, 1372-1380.[Medline]
Iwakiri, D. and Podolsky, D. K. (2001b). A silencer inhibitor confers specific expression of intestinal trefoil factor in goblet-like cell lines. Am. J. Physiol. Gastrointest. Liver Physiol. 280, G1114-G1123.
Jenkins, T. D., Opitz, O. G., Okano, J. and Rustgi, A. K. (1998). Transactivation of the human keratin 4 and Epstein-Barr virus ED-L2 promoters by gut-enriched Krüppel-like factor. J. Biol. Chem. 273, 10747-10754.
Jensen, J., Pedersen, E. E., Galante, P., Hald, J., Heller, R. S., Ishibashi, M., Kageyama, R., Guillemot, F., Serup, P. and Madsen, O. D. (2000). Control of endodermal endocrine development by Hes-1. Nat. Genet. 24, 36-44.[Medline]
Kaestner, K. H., Silberg, D. G., Traber, P. G. and Schütz, G. (1997). The mesenchymal winged helix transcription factor Fkh6 is required for the control of gastrointestinal proliferation and differentiation. Genes Dev. 11, 1583-1595.[Abstract]
Karam, S. M. (1999). Lineage commitment and maturation of epithelial cells in the gut. Front. Biosci. 4, D286-D298.[Medline]
Labosky, P. A., Winnier, G. E., Jetton, T. L., Hargett, L., Ryan, A. K., Rosenfeld, M. G., Parlow, A. F. and Hogan, B. L. (1997). The winged helix gene, Mfh3, is required for normal development of the diencephalon and midbrain, postnatal growth and the milk-ejection reflex. Development 124, 1263-1274.
Mahatan, C. S., Kaestner, K. H., Geiman, D. E. and Yang, V. W. (1999). Characterization of the structure and regulation of the murine gene encoding gut-enriched Krüppel-like factor (Krüppel-like factor 4). Nucleic Acids Res. 27, 4562-4569.
Martin-Caballero, J., Flores, J. M., Garcia-Palencia, P. and Serrano, M. (2001). Tumor susceptibility of p21(Waf1/Cip1)-deficient mice. Cancer Res. 61, 6234-6238.
Mashimo, H., Podolsky, D. K. and Fishman, M. C. (1995). Structure and expression of murine intestinal trefoil factor: high evolutionary conservation and postnatal expression. Biochem. Biophys. Res. Commun. 210, 31-37.[Medline]
Mutoh, H., Naya, F. J., Tsai, M. J. and Leiter, A. B. (1998). The basic helix-loop-helix protein BETA2 interacts with p300 to coordinate differentiation of secretin-expressing enteroendocrine cells. Genes Dev. 12, 820-830.
Nagy, A. (2000). Cre recombinase: the universal reagent for genome tailoring. Genesis 26, 99-109.[Medline]
Potten, C. S. (1997). Epithelial cell growth and differentiation. II. Intestinal apoptosis. Am. J. Physiol. 273, G253-G257.
Segre, J. A., Bauer, C. and Fuchs, E. (1999). Klf4 is a transcription factor required for establishing the barrier function of the skin. Nat. Genet. 22, 356-360.[Medline]
Shie, J. L., Chen, Z. Y., OBrien, M. J., Pestell, R. G., Lee, M. E. and Tseng, C. C. (2000). Role of gut-enriched Krüppel-like factor in colonic cell growth and differentiation. Am. J. Physiol. Gastrointest. Liver Physiol. 279, G806-G814.
Shields, J. M., Christy, R. J. and Yang, V. W. (1996). Identification and characterization of a gene encoding a gut-enriched Krüppel-like factor expressed during growth arrest. J. Biol. Chem. 271, 20009-20017.
Shoemaker, A. R., Gould, K. A., Luongo, C., Moser, A. R. and Dove, W. F. (1997). Studies of neoplasia in the Min mouse. Biochim. Biophys. Acta. 1332, F25-F48.[Medline]
Smith, R. M., Cobb, M. H., Rosen, O. M. and Jarett, L. (1985). Ultrastructural analysis of the organization and distribution of insulin receptors on the surface of 3T3-L1 adipocytes: rapid microaggregation and migration of occupied receptors. J. Cell Physiol. 123, 167-179.[Medline]
Stappenbeck, T. S. and Gordon, J. I. (2000). Rac1 mutations produce aberrant epithelial differentiation in the developing and adult mouse small intestine. Development 127, 2629-2642.
Stappenbeck, T. S., Wong, M. H., Saam, J. R., Mysorekar, I. U. and Gordon, J. I. (1998). Notes from some crypt watchers: regulation of renewal in the mouse intestinal epithelium. Curr. Opin. Cell Biol. 10, 702-709.[Medline]
Strous, G. J. and Dekker, J. (1992). Mucin-type glycoproteins. Crit. Rev. Biochem. Mol. Biol. 27, 57-92.[Abstract]
Suh, E., Chen, L., Taylor, J. and Traber, P. G. (1994). A homeodomain protein related to caudal regulates intestine-specific gene transcription. Mol. Cell. Biol. 14, 7340-7351.[Abstract]
Suh, E. and Traber, P. G. (1996). An intestine-specific homeobox gene regulates proliferation and differentiation. Mol. Cell. Biol. 16, 619-625.[Abstract]
Ton-That, H., Kaestner, K. H., Shields, J. M., Mahatanankoon, C. S. and Yang, V. W. (1997). Expression of the gut-enriched Krüppel-like factor gene during development and intestinal tumorigenesis. FEBS Lett. 419, 239-243.[Medline]
Traber, P. G. (1999). Transcriptional regulation in intestinal development. Implications for colorectal cancer. Adv. Exp. Med. Biol. 470, 1-14.[Medline]
Traber, P. G. and Wu, G. D. (1995). Intestinal development and differentiation. In Gastrointestinal Cancers: Biology, Diagnosis, and Therapy (ed. A. K. Rustgi), pp. 21-33. Philadelphia: Lippencott-Raven.
Tsubouchi, S. and Leblond, C. P. (1979). Migration and turnover of entero-endocrine and caveolated cells in the epithelium of the descending colon, as shown by radioautography after continuous infusion of [3H]-thymidine into mice. Am. J. Anat. 156, 431-451.[Medline]
van Klinken, B. J., Einerhand, A. W., Duits, L. A., Makkink, M. K., Tytgat, K. M., Renes, I. B., Verburg, M., Buller, H. A. and Dekker, J. (1999). Gastrointestinal expression and partial cDNA cloning of murine Muc2. Am. J. Physiol. 276, G115-G124.
Velcich, A., Yang, W., Heyer, J., Fragale, A., Nicholas, C., Viani, S., Kucherlapati, R., Lipkin, M., Yang, K. and Augenlicht, L. (2002). Colorectal cancer in mice genetically deficient in the mucin Muc2. Science 295, 1726-1729.
White, J. K., Auerbach, W., Duyao, M. P., Vonsattel, J. P., Gusella, J. F., Joyner, A. L. and MacDonald, M. E. (1997). Huntingtin is required for neurogenesis and is not impaired by the Huntingtons disease CAG expansion. Nat. Genet. 17, 404-410.[Medline]
Wilkinson, D. G. (1992). In Situ Hybridization: A Practical Approach. New York: Oxford University Press.
Yang, Q., Bermingham, N. A., Finegold, M. J. and Zoghbi, H. Y. (2001). Requirement of Math1 for secretory cell lineage commitment in the mouse intestine. Science 294, 2155-2158.