1 Laboratory of Developmental Genetics and Imprinting, Developmental Genetics Programme, Babraham Institute, Cambridge CB2 4AT, UK
2 Lawson Health Research Institute, St. Josephs Health Care, 268 Grosvenor Street, London, Ontario N6A4V2, Canada
3 Division of Human Genetics, Department of Integrated Genetics, National Institute of Genetics, Graduate University for Advanced Studies, Mishima, Shizuoka 411-8540, Japan
4 Medical Research Council, Mammalian Genetics Unit, Harwell, Didcot OX11 0RD, UK
* Present address: Gardiner-Caldwell Communications, The Towers, Park Green, Macclesfield SK11 7NG, UK
Author for correspondence (e-mail: wolf.reik{at}bbsrc.ac.uk)
Accepted 26 December 2001
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Key words: Mouse, Igf2, H19, Imprinted genes
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
A large cluster of imprinted genes in the mouse is located on distal chromosome 7 and contains at least 15 imprinted transcripts (Reik and Walter, 2001). Genes in this cluster are particularly important for the control of foetal growth and placental development. The human orthologues of these genes are implicated in growth disorders and cancer (Feinberg, 2000
; Maher and Reik, 2000
; Tycko, 2000
). Within this domain, the paternally expressed Igf2 gene and the closely linked maternally expressed H19 gene provide a well-studied paradigm of imprinting regulation. Igf2 encodes a potent foetal growth factor and mice that lack the gene are only 50-60% of normal size at birth (DeChiara et al., 1991
). H19 encodes an RNA of uncertain function (Hao et al., 1993
; Jones et al., 1998
; Li et al., 1998
). Both genes are expressed coordinately in the majority of foetal tissues that arise from endodermal and mesodermal lineages.
Several elements have been identified that are important for the coordinate regulation of imprinting and expression of Igf2 and H19. A set of two endodermal enhancer elements are located a few kilobases downstream of H19, and are necessary for endodermal expression of both genes (Leighton et al., 1995a). The access of the Igf2 promoters to these enhancers is restricted on the maternal allele by a chromatin boundary element located upstream of H19 (Bell and Felsenfeld, 2000
; Hark et al., 2000
; Kaffer et al., 2000
; Kanduri et al., 2000
; Szabo et al., 2000
; Thorvaldsen et al., 1998
). On the paternal allele, H19 is silenced by promoter methylation (Bartolomei et al., 1993
; Ferguson-Smith et al., 1993
). The intergenic region and the region upstream of Igf2 contain silencer elements that are also crucial for keeping the maternal Igf2 gene silenced (Ainscough et al., 2000a
; Constancia et al., 2000
). The silencer upstream of Igf2, like the chromatin boundary upstream of H19, is epigenetically regulated by DNA methylation (Eden et al., 2001
; Holmgren et al., 2001
).
However, a complete picture of Igf2 and H19 regulation and their phenotypic effects has not emerged, partly because some of the crucial elements have yet to be identified. The Igf2 silencers show specificity for mesodermal tissues (Ainscough et al., 2000a; Constancia et al., 2000
); it is unknown whether there are similar elements for endodermal tissues. What is clear, however, is that several mesodermal enhancers must exist for Igf2 and H19. One of these is located on a YAC transgene that extends to 35 kilobases downstream of H19 (Ainscough et al., 2000b
) and is likely to be downstream of the endoderm enhancers (Kaffer et al., 2000
). Several conserved sequence elements have been detected in this region, some of which can direct expression in some mesodermal tissues in transgenic assays (Ishihara et al., 2000
). Other mesodermal elements are outside the region covered by the YAC transgene (Ainscough et al., 2000b
).
We show that the radiation-induced mouse mutation minute (Mnt) (Cattanach et al., 2000) has lost expression of Igf2 in mesodermal tissues and in the placenta, thus leading to intrauterine growth retardation. The molecular identification of the mutation enabled us to locate mesodermal and extra-embryonic enhancers that are required for Igf2 expression, and has provided a valuable mouse model for complex regulatory mechanisms in imprinted gene clusters.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
| (1) |
where s.d.1 was the s.d. for litter 1 etc. and n was the number of litters.
Mouse strains used
The mice used in most experiments (and controls) were F1 hybrids from C57BL/6J and CBA/Ca inbred strains, which are of Mus musculus domesticus origin.
SD7 is a congenic stock in which the distal region of chromosome 7 is of Mus spretus origin on an otherwise Mus musculus domesticus background. It was produced by backcrossing mice carrying the Mus spretus Igf2-H19 region to the F1 hybrid C57BL/6JxCBA/Ca background over four generations and then intercrossing these to make homozygotes.
The minute mutation (Mnt) investigated was induced in a male mouse of an F1 (C3H/HeHx101/H) hybrid background. It was subsequently crossed with SD7 and F1 (C57BL/6JxCBA/Ca) hybrid stock to produce SD7/Mnt and F1/Mnt animals respectively, although the region surrounding the Mnt mutation is assumed to retain its C3H/HeH or 101/H genetic identity.
Igf2 RIA
Radioimmunoassay for Igf2 was performed on mouse serum as previously described (Hill, 1990) after extraction of Igf2 binding proteins by separation on Sephadex G50. Cross-reactivity of Igf1 in the Igf2 RIA was less than 2%.
Northern blot analysis
RNA was extracted from tissues using a Qiagen RNeasy Kit according to the protocol of the manufacturer. The concentration and purity of RNA was determined by measuring the absorbance at 260 nm and 280 nm in a spectrophotometer (Cecil 2041). RNA (10 µg) was electrophoresed through 1% formaldehyde gels and subsequently blotted onto nylon membrane according to the protocol supplied (Schleicher and Schuell). The filters were hybridised with DNA probes labelled with [-32P]dCTP using Pharmacias oligolabelling kit and the random priming method (Feinberg and Vogelstein, 1983
). Prehybridisations and hybridisations were performed in hybridisation buffer (0.5 M sodium phosphate, pH 7.2, 1 mM EDTA, 7% SDS) at 65°C. After hybridisation, the filters were washed in 25 mM sodium phosphate, pH 7.2, 1% SDS at 65°C, and exposed to X ray film for an appropriate length of time. The probes used were as follows: a 0.9 kb KpnI/BamHI genomic fragment which detects all Igf2 transcripts, comprising intron 5 and the 5' region of exon 6 (Feil et al., 1994
). A 2.2 kb EcoRI/BamHI fragment that specifically detects the P0 transcript of Igf2 (Moore et al., 1997
). A 1.9 kb EcoRI fragment comprising the entire H19 cDNA sequence, and a 250 bp HindIII/PstI fragment comprising the 5' end of the glyceraldehyde-3-phosphate dehydrogenase gene (Gapdh) for RNA loading control.
RT-PCR
First strand cDNA synthesis from 1 µg of total RNA was performed using GibcoBRL Superscript II Reverse Transcriptase according to the protocol of the manufacturer using random hexamers as primers. Igf2 PCR was performed on the cDNA, using primers GGCCCCGGAGAGACTCTTGC (forward) and TGGGGGTGGGTAAGGAGAAAC (reverse) (60°C annealing temperature, 2.5 mM MgCl2). PCR products were digested with BsaAI in order to determine the allelic origin of the transcript (Dean et al., 1998).
In situ hybridisation
E14 embryos were fixed for 3-4 hours at 4°C in Bouins solution (75 ml picric acid, 25 ml 37% formalin, 5 ml glacial acetic acid), wax embedded and sectioned at 7 µm. Sections were post-fixed in 4% paraformaldehyde (PFA) in PBS and subjected to in situ hybridisation according to published protocol (Braissant and Wahli, 1998). A 426 bp BamHI/SacI fragment from mouse Igf2 cDNA (encompassing exon 5) was used to generate sense and antisense probes to detect the Igf2 transcripts. The probes were labelled by in vitro transcription using the digoxigenin RNA labelling kit (Roche) and NBT/BCIP was used to detect the signal in accordance with the manufacturers protocol.
Genotyping by PCR
Genomic DNA was prepared according to a standard protocol (Laird et al., 1991). PCR using the following primer combinations (56°C annealing temperature) was used to identify wild-type and Mnt samples: GGTTCCTGCCTTGAGTCCTTA (forward) and TTTGGGTGGCTAAGTGCTCAG (reverse) amplify over BP2 on the Mnt chromosome (Fig. 6D); CACAGCCCTCAAACCCACTAA (forward) and GGGCAGTAGAGGAGCAAGCAT (reverse) amplify over BP1 on the wild-type chromosome. PCR primers CGTGTGAAGGCACACCTG (forward) and GAGCATCTGTGTGTGTGCCT (reverse) were used to amplify a polymorphism at MIT marker D7Mit167 to determine the presence of either an SD7 (219 bp product) or Domesticus (189 bp product) allele.
|
FISH
Fluorescent in situ hybridisation (FISH) was performed essentially as described (Croft et al., 1999) on three-dimensionally preserved nuclei using adult spleen cells from a heterozygous Mnt mouse applied to poly-L-lysine slides at a density of approximately 5x104/cm2 and treated before hybridisation as described (Croft et al., 1999
). Cosmid AH (Fig. 5) and a BAC-spanning BP2 were labelled with biotin and digoxigenin, respectively, using the Nick Translation System (Promega). Probes (30-50 ng per slide) were precipitated with 10 µg of CotI DNA and 5 µg of salmon sperm DNA and re-suspended in 10 µl of hybridisation mix (50% deionised formamide, 2xSSC, 1% Tween, 10% dextran sulphate). Before hybridisation, the probe hybridisation mix was denatured at 70°C for 5 minutes and pre-annealed at 37°C for 15 minutes. Hybridisation was performed for 36 hours at 37°C in a dark moistened chamber. After hybridisation, slides were washed four times for 3 minutes in 50% formamide/2xSSC, pH 7.5 at 45°C, four times for 3 minutes in 2xSSC at 45°C, four times for 3 minutes in 0.1xSSC 60°C and transferred to 4xSSC/0.1% Tween 20 (Solution A). Blocking buffer (40 µl 4xSSC/5% Marvel) was applied for 5 minutes prior to application of the first antibody. Each antibody incubation was performed in a dark moistened chamber for 1 hour at 37°C. Slides were washed three time for 3 minutes with Solution A at 37°C in between each antibody incubation. Antibodies were diluted in blocking buffer and applied in the following order: sheep anti-digoxigenin (1:1000), rabbit anti-sheep fluorescein (1:200), goat anti-rabbit fluorescein (1:200) and avidin D-Texas Red (1:250) together, goat anti-avidin D-Biotin (1:250), and D-Texas Red (1:250).
|
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Progeny from paternal transmission of the Mnt mutation [F1 C57BL/6JxCBA/Ca) female x (F1/Mnt) male] and maternal transmission (Mnt/SD7 femalexSD7 male) were collected at various time points and the wet weights were analysed. The statistical significance between the weights of wild-type (+) and Mnt littermates was determined by an unbalanced analysis of variance test, performed using the linear model fitting facilities of the Genstat statistical package (see Materials and Methods for details).
The growth retardation resulting from paternal transmission of Mnt was evident at embryonic (E) day 13 (83% of +), although the difference between + and MntP littermates increased until the day of birth (53% of +) (Fig. 1A, Table 1). Placental weights were also reduced from E13 (78% of +), reaching 56% of + at E18 (Fig. 1B, Table 2). The size difference between + and MntP offspring observed at birth averaged 55%, but can vary depending on the genetic background (the inheritance of an SD7 allele appears to affect birth weights data not shown) and was subsequently maintained into adulthood (Fig. 1A, Table 1). While in E18 litters the expected 50% of MntP offspring was observed, there were immediate postnatal losses of MntP animals so that on the day of birth (P1) only one third of the expected MntP offspring were present (Table 1). The cause of death is currently not known.
|
|
|
Paternal transmission of Mnt thus resembled the phenotype of Igf2-null mice (DeChiara et al., 1991), whereas maternal transmission resembled that of the H19 knockout, which expresses Igf2 biallelically (Leighton et al., 1995b
), although here the degree of overgrowth is not as great. As Mnt was genetically linked to MIT markers D7Mit46 and Mit167 (Cattanach et al., 2000
) located at the Igf2 gene on distal chromosome 7, expression levels of Igf2 were analysed by northern blotting to determine if the growth phenotype was induced through alterations in the control of Igf2. Embryos were obtained from (Mnt/SD7) female x (F1/Mnt) male intercrosses at E14, before the death of homozygous Mnt embryos (Fig. 2A). This cross allowed the distinction of the parental origin of the different alleles and all four classes of embryos were obtained (verified by genotyping PCR see Materials and Methods for details), although homozygous embryos were under-represented (from nine litters + (SD7/F1) n=16; MntM (Mnt/F1), n=18; MntP (SD7/Mnt), n=23; Mnt/Mnt, n=4). Homozygous embryos did not significantly differ in weight from MntP embryos at E14 (data not shown), although their placentae were smaller [homozygous placenta were 60% of + (data not shown) compared with 78% of + for MntP at E14].
|
Additionally, serum levels of Igf2 peptide were determined in MntM and MntP neonates (Fig. 2C). Circulating levels of Igf2 were reduced in MntP mice (54% of +), and were elevated in the MntM mice (129% of +). Thus, there is a correlation between the levels of Igf2 transcripts, the levels of circulating Igf2 peptide, and the growth patterns observed in the two classes of Mnt mutants (maternal and paternal transmission) in comparison to + animals. Thus, the Mnt mutation is highly unusual in that three different classes of phenotype are observed: IUGR following paternal transmission, overgrowth after maternal transmission, and embryonic lethality in the homozygous state.
Paternal transmission of Mnt leads to repression of Igf2 in mesodermal tissues and placenta
The northern blot analysis of whole foetuses showed that while the level of Igf2 expression was substantially reduced in E14 MntP embryos (Fig. 2), some residual levels of expression remained (18%). Therefore, Igf2 transcripts were analysed in specific tissues from MntP neonates (Fig. 3A). A striking pattern of tissue specificity was found, with complete repression of Igf2 in the heart, lung and kidney, substantially reduced levels of Igf2 in the tongue and skeletal muscle (35% and 62%, of + respectively), and moderately reduced levels in intestine (71%). By contrast, Igf2 expression levels in the neonatal liver (and E14 livers data not shown) were normal, although variations were observed (Fig. 3A,B). Reduction of Igf2 expression was therefore found in all organs with mesodermal tissue contributions.
|
We conclude that the presence of the Mnt mutation on the paternal allele results in a disruption of Igf2 expression specifically in mesodermal tissues. This could occur as a result of the disruption of regulatory elements required for Igf2 expression in mesodermal tissues such as enhancers. The pattern of residual Igf2 expression is indeed largely complementary to that in the knockout of the endodermal enhancers for Igf2 (Leighton et al., 1995a).
Maternal transmission of Mnt leads to methylation and repression of H19
Analysis of the expression patterns of Igf2 and H19 following maternal transmission of the Mnt mutation demonstrated that H19 was repressed in all neonatal tissues analysed (Fig. 4A). This was associated with aberrant DNA methylation of the maternal H19 allele in the DMR upstream of H19 (Fig. 4C) and in the H19 promoter (not shown) in all stages and tissues analysed. (Paternal transmission of Mnt did not lead to altered methylation of the H19 DMR, which remained methylated.) Igf2 transcript levels by contrast were elevated in lung, liver and intestine (Fig. 4A,B) after maternal transmission of the Mnt mutation. As the endodermal enhancers are likely to be intact in MntM (ascertained from the analysis of MntP animals), methylation of the DMR boundary region upstream of H19 might lead to reactivation of the maternal allele of Igf2 in endodermal tissues. Allele specific expression analysis of Igf2 using RT-PCR did indeed reveal that the maternal Igf2 allele was expressed in liver, lung and intestine of MntM animals (Fig. 4D), which thus accounts for the increased levels of expression of Igf2 (Fig. 4A), and the increased Igf2 serum levels (Fig. 2). In addition, the activation of Igf2 from the maternal MntM allele in endodermal tissues can account for the higher levels of Igf2 expression observed in homozygous Mnt embryos compared with MntP heterozygotes (Fig. 2).
|
In order to identify any minor chromosomal change, a 130 kb region encompassing 5' of Igf2 to 3' of H19 was analysed in detail by Southern hybridisation with 3 cosmids (Fig. 5A). The cosmids were hybridised to EcoRI- and BamHI-digested genomic DNA from homozygous Mnt and + embryos. The resulting banding pattern showed that a region covered by cosmid CH had been disrupted in the Mnt mutation (Fig. 5B). The expected 13 kb EcoRI fragment was replaced by two other fragments (8.5 kb and >13 kb), providing evidence that the Mnt mutation was not a deletion (a single fragment has been replaced by two fragments the combined length of which is greater than the original fragment). The appearance of a fragment of a 3 kb was the only abnormality evident in the BamHI digest (Fig. 5B).
The altered 8.5 kb EcoRI fragment identified in Mnt samples was cloned in a lambda library (Stratagene Lambda FIX II) using homozygous Mnt DNA enriched for fragments of approximately 8.5 kb. Clones positive for the expected wild-type sequence 5' to the region disrupted in Mnt were sequenced. The 8.5 kb clone was located approximately 25 kb downstream from the H19 promoter (Fig. 5, BP1), and approximately 200 bp of novel sequence were found fused to the expected sequence. The 200 bp novel sequence was used to probe a 129/SvJ genomic DNA lambda library (Stratagene catalogue number 946313) and a 16 kb lambda clone was identified that provided the sequence of a second endogenous region (BP2) that was disrupted in Mnt (Fig. 5C). This suggested that the Mnt mutation was an inversion between two breakpoints (BP1 and BP2). PCR analysis across the breakpoints in the re-arranged DNA confirmed that this was indeed the case (Primers 1 and 3, and primers 2 and 4, Fig. 5D) and that there was no loss of any DNA (Fig. 5D).
The inversion on the Mnt chromosome was confirmed by fluorescence in situ hybridisation (FISH) analysis using two probes, one specific for each breakpoint region (Fig. 5E), hybridised to nuclei heterozygous for the Mnt mutation (Fig. 5F). Co-localisation of the signal on the Mnt chromosome demonstrated that DNA from the BP2 region was relocated close to H19 on the Mnt chromosome (Fig. 5F).
However, this analysis does not provide any indication of the location of the second breakpoint (BP2) (centromeric or telomeric to the BP1 region?), nor does it provide an indication of the distance between the two breakpoints. Genetic mapping using a panel of [M. m. domesticus x (M. m. domesticus x SD7)] backcross DNAs showed that the BP2 region was approximately 2 cM centromeric of Nttp1 (two recombinants in 106 meioses occurred between Nttp1 and BP2) (Fig. 5E). Nttp1 is located 1.5 cM centromeric of H19 (Paulsen et al., 1998). Thus, the second breakpoint region is located several megabases (Mb) further centromeric of H19.
Sequence analysis of the BP2 region identified several features such as homology to ESTs and repeat structures (Fig. 5C) disruption of which in Mnt may contribute to the phenotype. However, because this region is several megabases away from Igf2 and H19, it is unlikely that its disruption causes the altered regulation of the two genes. Instead, we focussed on the analysis of the BP1 region. While this work was in progress, several sequence elements were discovered in the BP1 region that were conserved between mice and humans (Fig. 5C, elements 1-10) (Ishihara et al., 2000). Perhaps of greater significance was that some of these elements displayed enhancer activity. In addition to the known endoderm enhancers (elements 3 and 4), enhancer activity was detected in mesodermally derived structures including embryonic myotome and rib primordia (elements 6 and 9), mesenchymal cells (element 7) and the neural tube floor plate and ectoderm of the limb buds (element 5). Furthermore, in vitro transfection assays confirmed that the region covering approximately +22 to +28 kb from the H19 promoter possesses enhancer activity in muscle cell lines (Kaffer et al., 2000
). The combined evidence indicates that the BP1 region is likely to contain at least one of the long sought mesodermal enhancer regions for Igf2 and H19.
Transgenic identification of mesodermal enhancers
In order to confirm that the BP1 breakpoint region contained mesodermal enhancers, and that they were affected by the inversion, two transgenic constructs were made (Fig. 6A). The first construct (+gh) contained 0.8 kb 5' of exon1 of H19 (the H19 promoter) coupled to a lacZ reporter and a further 27 kb of the region downstream of H19. The downstream region contained the 10 regions identified as being conserved between mouse and human. The second construct (gh) was produced by truncating the first construct at a XhoI site located 400 bp upstream of BP1 in Mnt, reducing the downstream region to approximately 21 kb (Fig. 6A).
These two transgenes were microinjected into fertilised oocytes and the expression of lacZ (driven by the H19 promoter under the influence of any enhancer elements present on the transgene) was analysed in E14 embryos (Fig. 6). Embryos positive for the +gh transgene showed expression in the liver, epithelial layer of the intestine but not the smooth muscle layer, the epithelial layer of the lung, but not in other cell types in the lung, the tongue, and the cartilage and intercostal muscles. Expression was also absent in the kidney and heart (Fig. 6B). This shows that the enhancers responsible for controlling Igf2 and H19 expression in muscle and tongue are present in the BP1 region, while those elements required to drive expression in other mesodermal tissues (heart, kidney and lung) are missing.
The gh transgene was designed to mimic the Mnt mutation, isolating conserved regions 9 and 10 from the rest of the region. The most obvious difference between the two constructs was a reduction in expression levels observed in the tongue and intercostal muscles with construct gh (Fig. 6C). Expression with the gh construct continued to be absent in the heart and kidney, and the majority of cell types in the lung (except epithelial cells), while being maintained in the liver and epithelial cells in the intestine (Fig. 6C).
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
The breakpoint proximal to H19 (BP1) is in a cluster of DNA elements that show a high degree of conservation between human and mouse (Ishihara et al., 2000). Some of these elements (6,7,9) showed enhancer activity in some mesodermal tissues in transgenic assays. Our analysis shows that the intact cluster is required for appropriate expression of Igf2 in skeletal muscle and tongue, and suggests cooperation between individual elements is required for full expression in these tissues. Cooperativity of enhancer elements has been shown previously in transgenic mice (Kruse et al., 1995
), but not in an in vivo situation such as this. The residual levels of Igf2 RNA in muscle and tongue may be due to the combination of the remaining elements (5-8). A very recent knockout experiment found that elimination of elements 5-10 resulted in substantial reduction of Igf2 expression in skeletal muscle and tongue, thus confirming our analysis (Kaffer et al., 2001
). The identification of an enhancer for expression in the tongue is of particular relevance to the understanding of the molecular pathology of the human foetal overgrowth syndrome, Beckwith Wiedemannn syndrome, in which overgrowth of the tongue is one of the most consistent symptoms (Maher and Reik, 2000
).
The loss of Igf2 expression in heart, kidney, lung and placenta suggests the additional mesodermal and extra-embryonic enhancer elements are located 3' to the inversion breakpoint. These elements have thus far not been detected by any transgenic approach (Ainscough et al., 2000b; Kaffer et al., 2000
). How far distant they are from the breakpoint is currently not known, but we are sequencing BAC clones covering this area in order to identify conserved segments as candidates for enhancers. Surprisingly, a recent experiment that has placed an additional H19 DMR 3' of the endoderm but 5' of the muscle and tongue enhancers here identified, caused downregulation of Igf2 expression in the heart by 50% (Kaffer et al., 2001
). This may indicate that either the unmethylated chromatin boundary is partially open for the heart enhancers, or that some heart enhancers are not located distal to H19, a possibility that is more difficult to reconcile with our results. In Mnt, the complete loss of expression in the kidney is surprising, as epithelia, particularly in the glomeruli, would be expected to show expression (the endoderm enhancers are known to be intact and functional in Mnt). The endoderm enhancer knockout also showed markedly reduced expression in the kidney (Leighton et al., 1995a
), suggesting perhaps again that co-operation between different enhancer elements is required. Expression was found in bronchial epithelia as expected, but not in those with larger lumina, indicating perhaps that as differentiation into secretory epithelia takes place, regions other than the endoderm enhancers are required but are disrupted in Mnt.
The location of most known enhancers for Igf2 distal to H19 (Fig. 7) now provides an explanation for reactivation of the silent Igf2 allele in both endodermal and mesodermal tissues when the DMR/boundary region upstream of H19 is deleted (Leighton et al., 1995b; Thorvaldsen et al., 1998
) (Fig. 7). Thus the boundary operates in both tissue types. This leaves unanswered the question of why maternal deletion of silencer elements in the intergenic region or in DMR1 reactivates the silent Igf2 allele (Ainscough et al., 2000a
; Constancia et al., 2000
). It seems most likely now that interaction between these elements might be required for full repression, as previously suggested (Constancia et al., 2000
).
A second effect of the Mnt mutation is the methylation of the H19 DMR and associated silencing of the maternal H19 allele (Fig. 7). This aberrant methlyation leads to reactivation of the maternal Igf2 allele in all tissues for which enhancers are intact (liver and others) showing for the first time in vivo that the DMR/boundary can be opened by DNA methylation (as well as by deletion). H19 methylation on the maternal allele is likely to arise in the female germline, or in the early embryo, as it was present in all tissues analysed. It is possible that sequences 3' to the Mnt breakpoint are necessary to keep the maternal H19 gene unmethylated, although transgenic experiments have shown that sequences further 3' than 8 kb from H19 are not necessary for imprinting (Cranston et al., 2001). Alternatively, sequences from the other end of the inversion which have been moved close to H19 may have a dominant methylating effect. We note particularly in this respect that ovary specific ESTs are located close to the breakpoint with a direction of transcription towards H19 (Fig. 5D). If there are indeed transcripts running antisense to H19 and its DMR, this might lead to methylation of the DMR as suggested (Reik and Walter, 1998
). The maternal H19 DMR has also been found to become methylated in some tumours with biallelic Igf2 transcription (Cui et al., 2001
; Nakagawa et al., 2001
).
Lack of Igf2 in many mesodermal tissues and in the placenta leads to intrauterine growth deficiency as expected. However, the magnitude of the effect (as much as in the Igf2 null) is unexpected as there is normal Igf2 expression in the liver, leading to substantial serum levels of the peptide. The most likely explanation is that absence of Igf2 from the placenta leads to marked growth restriction independent of Igf2 levels in the foetus. Indeed a knockout of the placenta specific Igf2 transcript resulted in IUGR of 70% of normal birthweight (Constancia et al., 2000). By contrast, overexpression of Igf2 in the maternal transmission of Mnt largely limited to endodermal tissues leads to foetal overgrowth, showing that the contribution of these tissues to circulating Igf2 is substantial.
The molecular analysis of the Mnt mutation establishes an important paradigm in genetics in that transmission of the mutation from either parent leads to different phenotypes from wild type, and the homozygous phenotype is different again. A similar (but not identical) pattern of inheritance is seen with the polar overdominance mutation Callipyge in sheep, in which the phenotype is observed with paternal, but not with maternal transmission or in homozygotes (Charlier et al., 2001). The mutation has not been identified but has recently been linked with abnormal expression of the imprinted gene cluster including DLK and GTL2 (Charlier et al., 2001
). We suggest that as in Mnt regulatory sequences such as enhancers or silencers in this region might be mutated.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Ainscough, J. F., John, R. M., Barton, S. C. and Surani, M. A. (2000a). A skeletal muscle-specific mouse Igf2 repressor lies 40 kb downstream of the gene. Development 127, 3923-3930.
Ainscough, J. F., Dandolo, L. and Surani, M. A. (2000b). Appropriate expression of the mouse H19 gene utilises three or more distinct enhancer regions spread over more than 130 kb. Mech. Dev. 91, 365-368.[Medline]
Bartolomei, M. S., Webber, A. L., Brunkow, M. E. and Tilghman, S. M. (1993). Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev. 7, 1663-1673.[Abstract]
Bell, A. C. and Felsenfeld, G. (2000). Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482-485.[Medline]
Braissant, O. and Wahli, W. (1998). A simplified in situ hybridisation protocol using non-radioactively labeled probes to detect abundant and rare mRNAs on tissue sections. Biochemica 1, 10-16.
Brannan, C. I. and Bartolomei, M. S. (1999). Mechanisms of genomic imprinting. Curr. Opin. Genet. Dev. 9, 164-170.[Medline]
Cattanach, B. M., Burtenshaw, M. D., Rasberry, C. and Evans, E. P. (1993). Large deletions and other gross forms of chromosome imbalance compatible with viability and fertility in the mouse. Nat. Genet. 3, 56-61.[Medline]
Cattanach, B. M., Peters, J., Ball, S. and Rasberry, C. (2000). Two imprinted gene mutations: three phenotypes. Hum. Mol. Genet. 9, 2263-2273.
Charlier, C., Segers, K., Karim, L., Shay, T., Gyapay, G., Cockett, N. and Georges, M. (2001). The callipyge mutation enhances the expression of coregulated imprinted genes in cis without affecting their imprinting status. Nat. Genet. 27, 367-369.[Medline]
Constancia, M., Dean, W., Lopes, S., Moore, T., Kelsey, G. and Reik, W. (2000). Deletion of a silencer element in Igf2 results in loss of imprinting independent of H19. Nat. Genet. 26, 203-206.[Medline]
Cranston, M. J., Spinka, T. L., Elson, D. A. and Bartolomei, M. S. (2001). Elucidation of the minimal sequence required to imprint H19 transgenes. Genomics 73, 98-107.[Medline]
Croft, J. A., Bridger, J. M., Boyle, S., Perry, P., Teague, P. and Bickmore, W. A. (1999). Differences in the localization and morphology of chromosomes in the human nucleus. J. Cell Biol. 145, 1119-1131.
Cui, H., Niemitz, E. L., Ravenel, J. D., Onyango, P., Brandenburg, S. A., Lobanenkov, V. V. and Feinberg, A. P. (2001). Loss of imprinting of insulin-like growth factor-II in Wilms tumor commonly involves altered methylation but not mutations of CTCF or its binding site. Cancer Res. 61, 4947-4950.
Dean, W., Bowden, L., Aitchison, A., Klose, J., Moore, T., Meneses, J. J., Reik, W. and Feil, R. (1998). Altered imprinted gene methylation and expression in completely ES cell- derived mouse fetuses: association with aberrant phenotypes. Development 125, 2273-2282.
DeChiara, T. M., Robertson, E. J. and Efstratiadis, A. (1991). Parental imprinting of the mouse insulin-like growth factor II gene. Cell 64, 849-859.[Medline]
Eden, S., Constancia, M., Hashimshony, T., Dean, W., Goldstein, B., Johnson, A. C., Keshet, I., Reik, W. and Cedar, H. (2001). An upstream repressor element plays a role in Igf2 imprinting. EMBO J. 20, 3518-3525.
Feil, R., Walter, J., Allen, N. D. and Reik, W. (1994). Developmental control of allelic methylation in the imprinted mouse Igf2 and H19 genes. Development 120, 2933-2943.
Feinberg, A. P. (2000). The two-domain hypothesis in Beckwith-Wiedemann syndrome. J. Clin. Invest. 106, 739-740.
Feinberg, A. P. and Vogelstein, B. (1983). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13.[Medline]
Ferguson-Smith, A. C., Sasaki, H., Cattanach, B. M. and Surani, M. A. (1993). Parental-origin-specific epigenetic modification of the mouse H19 gene. Nature 362, 751-755.[Medline]
Ferguson-Smith, A. C. and Surani, M. A. (2001). Imprinting and the epigenetic asymmetry between parental genomes. Science 293, 1086-1089.
Hao, Y., Crenshaw, T., Moulton, T., Newcomb, E. and Tycko, B. (1993). Tumour-suppressor activity of H19 RNA. Nature 365, 764-767.[Medline]
Hark, A. T., Schoenherr, C. J., Katz, D. J., Ingram, R. S., Levorse, J. M. and Tilghman, S. M. (2000). CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 405, 486-489.[Medline]
Hill, D. J. (1990). Relative abundance and molecular size of immunoreactive insulin-like growth factors I and II in human fetal tissues. Early Hum. Dev. 21, 49-58.[Medline]
Hogan, B., Beddington, R., Costantini, F. and Lacy, E. (1994). Staining for ß-galactosidase (lacZ) Activity. New York: CSHL Press.
Holmgren, C., Kanduri, C., Dell, G., Ward, A., Mukhopadhya, R., Kanduri, M., Lobanenkov, V. and Ohlsson, R. (2001). CpG methylation regulates the Igf2/H19 insulator. Curr. Biol. 11, 1128-1130.[Medline]
Ishihara, K., Hatano, N., Furuumi, H., Kato, R., Iwaki, T., Miura, K., Jinno, Y. and Sasaki, H. (2000). Comparative genomic sequencing identifies novel tissue-specific enhancers and sequence elements for methylation-sensitive factors implicated in Igf2/H19 imprinting. Genome Res. 10, 664-671.
Jones, B. K., Levorse, J. M. and Tilghman, S. M. (1998). Igf2 imprinting does not require its own DNA methylation or H19 RNA. Genes Dev. 12, 2200-2207.
Kaffer, C. R., Srivastava, M., Park, K. Y., Ives, E., Hsieh, S., Batlle, J., Grinberg, A., Huang, S. P. and Pfeifer, K. (2000). A transcriptional insulator at the imprinted H19/Igf2 locus. Genes Dev. 14, 1908-1919.
Kaffer, C. R., Grinberg, A. and Pfeifer, K. (2001). Regulatory mechanisms at the mouse igf2/h19 locus. Mol. Cell. Biol. 21, 8189-8196.
Kanduri, C., Pant, V., Loukinov, D., Pugacheva, E., Qi, C. F., Wolffe, A., Ohlsson, R. and Lobanenkov, V. V. (2000). Functional association of CTCF with the insulator upstream of the H19 gene is parent of origin-specific and methylation-sensitive. Curr. Biol. 10, 853-856.[Medline]
Kruse, F., Rose, S. D., Swift, G. H., Hammer, R. E. and MacDonald, R. J. (1995). Cooperation between elements of an organ-specific transcriptional enhancer in animals. Mol. Cell. Biol. 15, 4385-4394.[Abstract]
Laird, P. W., Zijderveld, A., Linders, K., Rudnicki, M. A., Jaenisch, R. and Berns, A. (1991). Simplified mammalian DNA isolation procedure. Nucleic Acids Res. 19, 4293.[Medline]
Leighton, P. A., Saam, J. R., Ingram, R. S., Stewart, C. L. and Tilghman, S. M. (1995a). An enhancer deletion affects both H19 and Igf2 expression. Genes Dev. 9, 2079-2089.[Abstract]
Leighton, P. A., Ingram, R. S., Eggenschwiler, J., Efstratiadis, A. and Tilghman, S. M. (1995b). Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 375, 34-39.[Medline]
Li, Y. M., Franklin, G., Cui, H. M., Svensson, K., He, X. B., Adam, G., Ohlsson, R. and Pfeifer, S. (1998). The H19 transcript is associated with polysomes and may regulate IGF2 expression in trans. J. Biol. Chem. 273, 28247-28252.
Maher, E. R. and Reik, W. (2000). Beckwith-Wiedemann syndrome: imprinting in clusters revisited. J. Clin. Invest. 105, 247-252.
Moore, T., Constancia, M., Zubair, M., Bailleul, B., Feil, R., Sasaki, H. and Reik, W. (1997). Multiple imprinted sense and antisense transcripts, differential methylation and tandem repeats in a putative imprinting control region upstream of mouse Igf2. Proc. Natl. Acad. Sci. USA 94, 12509-12514.
Nakagawa, H., Chadwick, R. B., Peltomaki, P., Plass, C., Nakamura, Y. and de La Chapelle, A. (2001). Loss of imprinting of the insulin-like growth factor II gene occurs by biallelic methylation in a core region of H19-associated CTCF-binding sites in colorectal cancer. Proc. Natl. Acad. Sci. USA 98, 591-596.
Paulsen, M., Davies, K. R., Bowden, L. M., Villar, A. J., Franck, O., Fuermann, M., Dean, W. L., Moore, T. F., Rodrigues, N., Davies, K. E. et al. (1998). Syntenic organization of the mouse distal chromosome 7 imprinting cluster and the Beckwith-Wiedemann syndrome region in chromosome 11p15.5. Hum. Mol. Genet. 7, 1149-1159.
Reik, W. and Walter, J. (1998). Imprinting mechanisms in mammals. Curr. Opin. Genet. Dev. 8, 154-164.[Medline]
Reik, W. and Walter, J. (2001). Genomic imprinting: parental influence on the genome. Nat. Rev. Genet. 2, 21-32.[Medline]
Szabo, P., Tang, S. H., Rentsendorj, A., Pfeifer, G. P. and Mann, J. R. (2000). Maternal-specific footprints at putative CTCF sites in the H19 imprinting control region give evidence for insulator function. Curr. Biol. 10, 607-610.[Medline]
Thorvaldsen, J. L., Duran, K. L. and Bartolomei, M. S. (1998). Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev. 12, 3693-3702.
Tilghman, S. M. (1999). The sins of the fathers and mothers: genomic imprinting in mammalian development. Cell 96, 185-193.[Medline]
Tremblay, K. D., Saam, J. R., Ingram, R. S., Tilghman, S. M. and Bartolomei, M. S. (1995). A paternal-specific methylation imprint marks the alleles of the mouse H19 gene. Nat. Genet. 9, 407-413.[Medline]
Tycko, B. (2000). Epigenetic gene silencing in cancer. J. Clin. Invest. 105, 401-407.