Pointed regulates an eye-specific transcriptional enhancer in the Drosophila hedgehog gene, which is required for the movement of the morphogenetic furrow

Edward M. Rogers, Catherine A. Brennan*, Nathan T. Mortimer, Summer Cook, Andrea R. Morris{dagger} and Kevin Moses{ddagger},§

Department of Cell Biology, Emory University School of Medicine, Atlanta GA 30322, USA

§ Author for correspondence (e-mail: mosesk{at}hhmi.org)

Accepted 24 August 2005


    SUMMARY
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Drosophila development depends on stable boundaries between cellular territories, such as the embryonic parasegment boundaries and the compartment boundaries in the imaginal discs. Patterning in the compound eye is fundamentally different: the boundary is not stable, but moves (the morphogenetic furrow). Paradoxically, Hedgehog signaling is essential to both: Hedgehog is expressed in the posterior compartments in the embryo and in imaginal discs, and posterior to the morphogenetic furrow in the eye. Therefore, uniquely in the eye, cells receiving a Hedgehog signal will eventually produce the same protein. We report that the mechanism that underlies this difference is the special regulation of hedgehog (hh) transcription through the dual regulation of an eye specific enhancer. We show that this enhancer requires the Egfr/Ras pathway transcription factor Pointed. Recently, others have shown that this same enhancer also requires the eye determining transcription factor Sine oculis (So). We discuss these data in terms of a model for a combinatorial code of furrow movement.

Key words: Hedgehog, Pointed, Drosophila, Eye, Morphogenetic furrow, Transcription, Enhancer


    Introduction
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
The Drosophila compound eye is comprised of about 750 similar facets or ommatidia, each containing eight photoreceptor neurons and 12 other cells (Wolff and Ready, 1993Go). Patterning in the presumptive eye epithelium begins in the third larval instar when a wave of cell-type specification and patterning passes across the eye, from posterior to anterior: the morphogenetic furrow (Ready et al., 1976Go). A key event in the furrow is the specification of a spaced array of single cells via Notch-mediated lateral inhibition, which become the ommatidial founder cells, later to differentiate as the first photoreceptor neuron, the R8 (Cagan and Ready, 1989Go; Baker et al., 1996Go). The furrow lays down a new column of R8/founder cells roughly every 2 hours (Ready et al., 1976Go; Basler and Hafen, 1989Go).

Posterior to the furrow, after the founder cell is specified, the rest of the ommatidial cells are recruited by successive rounds of Ras pathway induction, beginning with the other seven photoreceptors (Ready et al., 1976Go; Tomlinson, 1985Go; Tomlinson, 1988Go; Wolff and Ready, 1993Go; Voas and Rebay, 2004Go). In all cases, this Ras signal involves MAPK phosphorylation and the activation of the Ets domain transcription factors pointed and anterior open (also known as Yan) (O'Neill et al., 1994Go; Dickson, 1995Go; Rubin et al., 1997Go). An early effect in these receiving cells is the upregulation of Pointed, and later the cells differentiate (Tomlinson and Ready, 1987Go). In contrast to the other photoreceptors, the R8 does not require the Egfr/Ras pathway or Pointed for its initial specification or early neural differentiation (but does require Egfr signaling later for its maintenance) (Kumar et al., 1998Go; Baonza et al., 2001Go; Yang and Baker, 2001Go).

Progression of the morphogenetic furrow depends on hedgehog signaling: if hedgehog function is removed by means of a conditional mutation, mosaic clones or by an eye specific allele, the furrow arrests (Heberlein et al., 1993Go; Ma et al., 1993Go). If, anterior to the furrow, hedgehog is ectopically and locally expressed, or if the negative hedgehog pathway elements patched or Pka are locally removed, an ectopic furrow propagates away from the triggering site in all directions (Heberlein et al., 1995Go; Li et al., 1995Go; Ma and Moses, 1995Go; Strutt et al., 1995Go). From in situ hybridization and the expression of two lacZ enhancer-trap lines, hedgehog is thought to be expressed in all the developing photoreceptor cells posterior to the furrow (Lee et al., 1992Go; Heberlein et al., 1993Go; Ma et al., 1993Go). Thus, hedgehog, expressed posterior to the furrow is necessary and sufficient for furrow progression.

Cells anterior to the furrow respond to the Hedgehog signal via the receptor Smoothened (Smo) and other downstream elements, including the transcription factor Cubitus interruptus (Ci) (Strutt and Mlodzik, 1996Go; Strutt and Mlodzik, 1997Go; Fu and Baker, 2003Go; Lum and Beachy, 2004Go). Cells in and anterior to the furrow respond to the hedgehog signal and activate the expression of several target genes, including hairy, decapentaplegic, patched and atonal (Heberlein et al., 1993Go; Ma et al., 1993Go; Ma and Moses, 1995Go; Baker and Yu, 1997Go; Shyamala and Bhat, 2002Go). In addition to furrow progression, hedgehog signaling from outside the eye field is required for furrow initiation (from the posterior disc margin) (Domínguez and Hafen, 1997Go; Borod and Heberlein, 1998Go; Chen et al., 1999Go; Curtiss and Mlodzik, 2000Go; Pappu et al., 2003Go). On the margins of the eye disc Wingless signals antagonize hedgehog and limit the rate of furrow progression (Ma and Moses, 1995Go; Treisman and Rubin, 1995Go).

Decapentaplegic expressed in the furrow was first thought to act as a second signal to relay the hedgehog signal forward (Blackman et al., 1991Go; Heberlein and Moses, 1995Go). However, decapentaplegic pathway loss of function does not arrest the furrow and the ectopic expression of decapentaplegic anterior to the furrow does not produce an ectopic furrow that propagates away from this source, but rather begins some distance away at the eye disc margin (Burke and Basler, 1996Go; Wiersdorff et al., 1996Go; Chanut and Heberlein, 1997bGo; Pignoni and Zipursky, 1997Go; Fu and Baker, 2003Go). Thus, unlike hedgehog, decapentaplegic is neither necessary nor sufficient for furrow progression at the center of the disc, but may be downstream of and redundant to hedgehog (Greenwood and Struhl, 1999Go). decapentaplegic is also expressed at the eye disc margin and may be more directly involved in furrow initiation and progression there, together with members of the retinal determination gene complex, such as dachshund (Mardon et al., 1994Go; Wiersdorff et al., 1996Go; Chanut and Heberlein, 1997bGo; Chanut and Heberlein, 1997aGo; Pignoni and Zipursky, 1997Go).

Thus, in the developing eye Hedgehog signaling drives a moving wave: the morphogenetic furrow. Cells that once received a Hedgehog signal on the anterior side will later express Hedgehog on the posterior side; essentially a cyclic and progressive phenomenon. By contrast, in the embryonic cuticle and imaginal discs, Hedgehog, Decapentaplegic and Wingless also interact, producing stable (not moving) boundaries, to form segments and/or lines of clonal restriction (Morata and Lawrence, 1977Go; García-Bellido et al., 1979Go; Lawrence, 1981Go; Akam, 1987Go; Ingham and Martinez-Arias, 1992Go; Kornberg and Tabata, 1993Go; DiNardo et al., 1994Go; Perrimon, 1994Go; Hidalgo, 1996Go). Unlike the eye, in these places a cell that receives Hedgehog does not later send it and there is no progressive cyclical process (Burke and Basler, 1997Go).

We suggest that there may be a special mode of hedgehog regulation so that in the eye (and nowhere else) a cell that receives Hedgehog will later express it (after a delay). A mechanism for this may be a dually regulated, eye-specific transcriptional enhancer for the hedgehog gene. This enhancer would require two simultaneous inputs to become active: one that is eye specific and another that is downstream of hedgehog (directly or indirectly). To test this possibility, we took advantage of two alleles of hedgehog that stop the furrow, but that have little or no phenotypic effect outside the eye. Both of these mutations delete DNA from the same 1.9 kb region of the first intron. We therefore reasoned that the regulatory elements responsible for a unique mode of hedgehog expression in the eye may reside in this region.

Here, we show that a 1.9 kb region of the first intron of hedgehog is necessary and sufficient to direct reporter lacZ expression posterior to the furrow in the developing eye, but that it is inactive (almost) everywhere else. We find that a minimal sequence of 203 bp confers this regulation and contains three consensus Ets domain transcription factor binding sites. We show that this enhancer drives expression in all the ommatidial cells except the R8: the pattern of Egfr/Ras pathway signaling and Pointed activation. We show that the three Ets sites in the minimal fragment are bound by Pointed in vitro, and that the function of this enhancer genetically requires pointed in vivo. Pointed is a major effector of photoreceptor differentiation and is therefore downstream of the furrow and indirectly downstream of hedgehog function. This fragment also contains one of the two So sites recently shown to be required by others (Pauli et al., 2005Go). We propose that So and Pointed confer eye-specific dual regulation on hedgehog and may explain why the furrow moves, and is not a stationary compartment boundary.


    Materials and methods
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Drosophila stocks and mosaic analysis
hh+ stocks
Canton-S, w1118 and w1118; P{(w, ry)D}3 gl3 e.

hedgehog mutant stocks
w1118; hhbar3, w1118; hhfse, w1118; hh8/TM6 Tb Hu and w1118; hhAC/TM3 Sb.

dpp reporter
dpp:lacZ cn; ry506 (BS3.0 from Blackman et al., 1991Go). For, P-element transformation, ry506 were injected.

Genotype for the bar3:lacZ pointed null clones
y w ey:FLP; bar3:lacZ; P{neoFRT}82B pntdelta88/P{neoFRT}82B P{Ubi-GFP(S65T)nls}3R.

SEM and facet counts
Scanning electron microscopy (SEM) was as described previously (Tio and Moses, 1997Go). Statistical analyses of ommatidium numbers by calculating the mean (µ), standard deviation (s.d.) and 95% confidence interval range (95%CI). For each genotype, one right eye each from three females was counted. hhfse/+: µ=736.0, s.d.=19.61, 95%CI 698-774; hhbar3/+: µ=725.33, s.d.=5.31, 95%CI 715-736; hh8/+: µ=717.67, s.d.=5.79, 95%CI 706-729; wild type: µ=710.0, s.d.=8.98, 95%CI 692-728; hhAC/+: µ=640.67, s.d.=39.38, 95%CI 563-718; hhfse/hh8: µ=511.67, s.d.=9.74, 95%CI 493-531, hhfse/hhfse: µ=498.33, s.d.=18.73, 95%CI 462-535; hhbar3/hh8: µ=340.67, s.d.=15.8, 95%CI 310-372; hhfse/hhbar3: µ=241.0, s.d.=2.94, 95%CI 235-247; hhbar3/hhbar3: µ=232.0, s.d.=23.76, 95%CI 185-279; hhfse/hhAC: µ=159.67, s.d.=8.58, 95%CI 143-176; hhbar3/hhAC: µ=133.67, s.d.=5.44, 95%CI 123-144.

Microscopy, antibodies and immunohistochemistry
Embryos and eye discs were as described previously (Kumar and Moses, 2001Go). Eye discs were mounted in Vectashield (Vector Labs, H-1000), imaged by confocal microscopy (Zeiss LSM510) or by DAB staining with Ni/Co, then DPX (Zeiss). Primary antibodies used were rabbit anti-Hedgehog (1:625, a gift from I. Guererro), mouse anti-Boss for R8 (1:1000, a gift from S. L. Zipursky) (Cagan et al., 1992Go), mouse anti-ß-gal (1:1000, Promega 23783), rabbit anti-ß-gal (1:1,000 Cortex BioChem CA2196), rat monoclonal anti-Elav 7E8A10 (1:1000 from DSHB) (Bier et al., 1988Go), guinea pig anti-Senseless, (1:1000, a gift from G. Mardon) (Nolo et al., 2000Go), mouse anti-Futsch (1:100, also known as 22C10, a gift from S. L. Zipursky) (Fujita et al., 1982Go). Secondary antibodies (Jackson ImmunoResearch): goat anti-mouse HRP (1:40, 115-035-003), goat anti-mouse minX FITC (1:200, 115-095-166), goat anti-rabbit HRP (1:100,111-035-003), goat anti-guinea pig FITC (1:200, 106-095-003), goat anti-rat Cy5 (1:200, 112-175-003) and goat anti-rabbit TRITC (1:250, 111-025-003).

Plasmids
Deletions in hhbar3 (6053-7938) and hhfse (6456-7469) were determined by PCR and sequencing from P{(w, ry)D}3 gl3 e (bases numbered from the site of P30) (Lee et al., 1992Go). Four putative Ets protein binding sites [5'-(C/G)(A/C/G)GGA(A/T)(A/G)-3' (Xu et al., 2000Go)] were found at 6296, 6308, 6330 and 7034. The sequences of transgene constructs, all inserted into NotI site of pDM30hslacZ (Bowtell et al., 1989Go), were amplified by PCR from Canton-S DNA, with engineered NotI sites, to yield pDM30(bar3)hslacZ, pDM30(fse)hslacZ, pDM30(bar3L)hslacZ, pDM30(bar3R)hslacZ, pDM30(bar3L1)hslacZ and pDM30(bar3L2)hslacZ (Fig. 1A). For Ets site deletion construct, pDM30(bar3L2deltaETS)hslacZ, oligonucleotides with substitutions in the three Ets sites (see Fig. 6) were assembled into 203 bp Bar3L2deltaEts fragment (with engineered NotI sites). For pDM30(6xETS)hslacZ, an oligo with six tandem consensus Ets binding sites was synthesized. All constructs were confirmed by DNA sequencing. Positions of constructs was: pDM30(bar3)hslacZ, 6053-7938; pDM30(fse)hslacZ, 6456-7468; pDM30(bar3L)hslacZ, 6053-6455; pDM30(bar3R)hslacZ, 7469-7938; pDM30(bar3L1)hslacZ, 6053-6252; pDM30(bar3L2)hslacZ and pDM30(bar3L2deltaETS)hslacZ, 6253-6455. The oligonucleotide sequences used, with the Not1 sites italicized and mutagenic base changes underlined, were as follows. For pDM30(bar3)hslacZ, 6053AForward (AAAAAAGCGGCCGCAGGGTGGGAAAAAGGCCCGC) and 7938AReverse (AAAAAGCGGCCGCGGATCCGCGACACGAAGATCCTTTTC); for pDM30(fse)hslacZ, 6456Forward (AAGAAAAAAGCGGCCGCTCTAGAAGCTTATATATAAAAAAAGGGGGTGACTCCCC) and 7469Reverse (AAGGAAAAAAGCGGCCGCGAATTCTGCGCTGGACGCGCAATGAAC); for pDM30(bar3L)hslacZ, 6053BForward (CCGCGGCCGCAGGGTGGGAAAAAGGCCCG) and 6456Reverse (CCGCGGCCGCACATATATGTATGTATATATGC-AGC); for pDM30(bar3R)hslacZ, 7469Forward (CCGCGGCCGCTCGATTCGAATTCGAGCTCAATGCA) and 7938BReverse (CCGCGGCGCCTTGCGACACGAAGATCCTTTTCTTC); for pDM30(bar3L1)-hslacZ, 6053BForward (above) and 6253Reverse (CCGCGGCCGCCCCACCTAAACGATTCACACACACA); for pDM30(bar3L2)-hslacZ, 6253Forward (CCGCGGCCGCTGACGTGATTTCTTCAGAGTTTCAACTCG) and 6456Reverse (above); for pDM30(bar3L2deltaETS)hslacZ, 6258MutagenicForward (TGATTTCTTCAGAGTTTCAACTCGTATTTTTTCGACTATCACGTGTGTCGCTGCGCAAGTTGTAAGTTTT), 6363MutagenicReverse (CCTTTGATTCACGGCACTGATTGAGATCGCAGAGCATGCGAAAACTTACAACTTGCGCAGCGACA), 6294Reverse (AGTCGAAAAAATACGAGTTGAAACTCTGA), 6337Forward (TGCGATCTCAATCAGTGCCGTGAATC), 6053BForward (above), 6253Forward (above) and 6456Reverse (above); for pDM30(6xETS)hslacZ, 6XForward (GGCCCAGGAAGCCAGGAAGTCAGGAAGCCAGGAAGTCAGGAAGCCAGGA-AGT) and 6XReverse (GGCCACTTCCTGGCTTCCTGACTTCCTGGCTTCCTGACTTCCTGGCTTCCTG).

Transformation
Embryo injections were as described previously (Rubin and Spradling, 1982Go) with constructs, at 1:1 ratio (500 µg/ml each) with S129A enhanced P-transposase plasmid (Beall et al., 2002Go). Numbers of independent transgenic lines for each construct were as follows: pDM30(bar3)hslacZ, 13; pDM30(fse)hslacZ, 7; pDM30(bar3L)hslacZ, 5; pDM30(bar3R)hslacZ, 4; pDM30(bar3L1)hslacZ, 2; pDM30(bar3L2)hslacZ, 6; pDM30(bar3L2deltaETS)hslacZ, 5; pDM30(6xETS)hslacZ, 3. Some lines have additional, ectopic patterns that we attribute to enhancer trap effects, e.g. 2/13 of the pDM30(bar3)hslacZ lines. In all cases, we studied multiple independent lines.

EMSA (gel shift)
GST-PntP2 protein, expressed in E. coli, purified as described by (Kauffmann et al., 1996Go). The DNA probe was from positions 6234 to 6347, and was end labeled (gamma-32P-ATP, T4 Polynucleotide Kinase, New England Biolabs). The 203 bp wild-type and delta-Ets competitor DNAs were synthesized by PCR from pDM30(bar3L2)hslacZ, pDM30(bar3L2deltaETS)hslacZ. The oligo competitors were the unlabelled annealed sequences given below. The protocol was as described previously (Buratowski and Chodosh, 2002Go), modified as follows: the binding reactions were in 18 µl total volume in `binding buffer' (Xu et al., 2000Go) comprising 13 mM HEPES (pH 7.9), 40 mM KCl, 44 mM NaCl, 4.4 mM Tris (pH 7.5), 0.7 mM EDTA, 0.3 mM DTT and 9% glycerol. Poly dI-dC (1 µg), 5 µg of BSA and double-stranded labeled probe (6 fmol, 8000 CPM) were added to each reaction with unlabeled DNA competitors, as indicated. GST-PntP2 (200 fmol) was added last. Incubations were for 30 minutes at room temperature. Samples analyzed by 4% non-denaturing, poly-acrylamide gel and dried for autoradiography. The oligonucleotide used for wild type was TTTTTCGACTATATCCTGTGTCGCTTCCTCAGTTTAAGTTTTCGCTTCCTCTGCGATCCAA. The oligonucleotide used the Ets sites mutant was TTTTT-CGACTATCACGTGTGTCGCTGCGCAAGTTGTAAGTTTTCGCAGCTCTGCGATCTCAA.


    Results
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
eye-specific hedgehog mutations: lesions and allelic series
There are two known eye-specific hedgehog (hh) mutations: hhbar3 (also known as hh1) and hhfurrow stops early (or hhfse). Both are associated with deletions in the first intron (Fig. 1A) (Lee et al., 1992Go; Ma et al., 1996Go). hhbar3 is a homozygous viable allele with a strong recessive eye phenotype resulting from arrest of the morphogenetic furrow (Ives, 1950Go; Mohler, 1988Go; Heberlein et al., 1993Go). hhfse is a gamma-induced viable allele with a weaker eye phenotype (Ma et al., 1996Go). We used PCR and direct sequencing to determine the precise end-points of the deletions (see Materials and methods). The hhbar3 deletion is 1885 bp and the hhfse deletion lies within the span of hhbar3, but is shorter (1013 bp, Fig. 1A). Both hhbar3 and hhfse are viable and can be maintained as homozygous stocks, although they are not as vigorous as wild type. This is probably not due to second-site recessive lethal mutations, as we derived lines that are isogenic for the X and major autosomes and they are no more vigorous. We examined the cuticles and nervous system (by anti-Elav and anti-Futsch stains) of the isogenic hhbar3 and hhfse embryos, and found no detectable phenotypes (data not shown).

To determine if either of these two eye-specific alleles are null for hedgehog function in the eye, we derived all viable pair-wise combinations of these alleles, wild-type and two zygotic lethal alleles (hhAC and hh8). hhAC is a single gene deletion that removes both the start sites for transcription and translation (Fig. 1A) (Lee et al., 1992Go). hh8 (also known as hh13C) is a chain-terminating mutation in the coding sequence (Fig. 1A) (Lee et al., 1994Go). Both alleles are zygotic lethal with strong cuticle phenotypes. hhAC is thought to be a null because of the strength of its phenotype and the nature of its lesion (Lee et al., 1994Go). On phenotypic grounds and comparison with other alleles, five groups have also reported hh8 to be functionally amorphic (Mohler, 1988Go; Lee et al., 1992Go; Heemskerk and DiNardo, 1994Go; Hooper, 1994Go; Park et al., 1996Go).

We find that these alleles form a series for adult eye phenotype (Fig. 1B-I). We quantified this by counting eye facets in adult females (Fig. 1J) and find that hhfse, hhbar3 and hh8 heterozygotes are not significantly different from wild type. However, hhAC is slightly dominant, with an eye that is about 10% smaller than wild type (although this difference is not statistically significant, see 95% confidence limits in the Materials and methods, and in Fig. 1J).

By facet number, hhbar3 is a strong, eye-specific hypomorph. It is fully recessive in trans to wild type, has a severely reduced eye when homozygous (68% smaller than hhbar3/hh+) and in trans to the null hhAC it is smaller still (82% smaller than hhbar3/hh+). This suggests that hhbar3 is not an amorph for eye size by Muller's test: the phenotype becomes stronger in trans to the null (Muller, 1932Go). hhfse is similar to but weaker than hhbar3: the hhfse homozygous eye is only 32% smaller than hhfse/hh+ and in trans the null (hhAC), it is further reduced to 78%. Thus, by both measures (phenotype as a homozygote and in trans to a null), hhbar3 is a strong hypomorphic allele and hhfse is a weaker hypomorph. From the 95% confidence limits, all these results are statistically significant.

Another way to view these eye specific mutations is by the number of columns of ommatidia produced, a more direct measure of how far the furrow progresses in the larval disc. Wild-type eyes have about 28 to 30 columns, hhfse homozygotes have about 20, hhbar3 homozygotes have about 10 and the strongest mutant genotype we have studied (hhbar3/hhAC) has about six. The furrow may stop early in hhfse, but it stops much earlier in hhbar3.

More interesting are the anomalous phenotypes of both eye-specific alleles when placed in trans to the second purported null (hh8): hhfse/hh8 has significantly larger eyes (512 mean facets, or 30% fewer than hhfse/hh+) than hhfse/hhAC (160 mean facets or 78% fewer than hhfse/hh+), and hhbar3/hh8 has significantly larger eyes (341 mean facets, or 53% fewer than hhbar3/hh+) than hhbar3/hhAC (134 mean facets or 82% fewer than hhbar3/hh+). Thus, although hh8 may be functionally amorphic for non-eye phenotypes it appears to be much weaker than hhAC in this assay. This may be due to transvection (Lewis, 1954Go; Duncan, 2002Go). It could be that hhAC deletes cis-regulatory elements (in addition to the coding sequence), which are also deleted from hhbar3 and hhfse, while hh8 leaves these putative regulatory elements intact. Thus, hh8 may supply some degree of essential regulation in trans when heterozygous to hhbar3 or hhfse, both of which have their coding sequences intact.

Two mechanisms suggest themselves for the apparent eye-specificity of hhbar3 and hhfse.

(1) It is possible that the requirement for hedgehog function is higher in the eye than in the rest of the animal, so that weak mutations which reduce the quantity of hedgehog function uniformly, may affect only the eye. If so, then hhbar3 may simply have less function than hhfse.



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 1. hedgehog mutations form an allelic series. (A) The hedgehog locus and the transgenic reporter constructs used. The lesions of four hedgehog alleles is indicated (see text). Seven transgenic constructs are drawn to a larger scale (indicated). The checks and crosses indicate the constructs that express or do not express lacZ reporter posterior to the morphogenetic furrow. The gray box indicates the minimal region required for eye-specific expression. The white triangles indicate Pointed-binding sites (this paper) and the black triangles indicate Sine oculis (So)-binding sites (Pauli et al., 2005Go). (B-I) Adult eyes, anterior rightwards and dorsal upwards. Genotypes are indicated below the panels. (J) Histogram of female facet counts for different hedgehog genotypes as indicated. Bars show mean facet counts; number of individuals counted indicated in bar. Error bars show the 95% confidence limits. Letters above some bars refer to panels of same genotype. Scale bar: 50 µm in B for B-I.

 



View larger version (110K):
[in this window]
[in a new window]
 
Fig. 2. hhbar3 phenotypes in the developing eye. Eye-antennal imaginal discs, shown anterior rightwards and dorsal upwards. Black arrowheads indicate the morphogenetic furrow. Genotypes are indicated below each panel. (A-F) Hedgehog antigen (red in C and black in the other panels). Boss is in green in C. (G-I) lacZ driven by the BS3.0 dpp enhancer (Blackman et al., 1991Go). an, antennal disc; oc, ocellar domain. In hhbar3, Hedgehog antigen is undetectable in the presumptive eye field (compare at white arrows in A and D) but is normal in the ocellar region and in the antennal disc (black arrows in A,D). Hedgehog is first expressed in only two cells per ommatidium (white arrowheads in B) and that these are not Boss-expressing R8 cells (white arrows in C). A low level of anti-Hedgehog stain is seen at the posterior margin near the time of furrow initiation (white arrows in E,F). dpp:lacZ expression is reduced in the furrow in hhfse and eliminated from the central furrow in hhbar3. Scale bar in A: 50 µm for A,D,G-I; 10 µm in B; 1 µm in C; in F, 50 µm for E,F.

 
(2) It is possible that hhbar3 and hhfse specifically affect hedgehog expression or function in the eye. If so, then hhbar3 may stop expressing hedgehog earlier than hhfse.

These two possibilities need not be exclusive. Probably, hhbar3 and hhfse affect a transcriptional enhancer and not the protein itself or the gene promoter, because neither lesion directly affects the coding sequence. In sequencing 23 cDNAs from eye-imaginal discs, we found no alternative first exon or start site in the region of the two mutations (Ma et al., 1996Go).

Hedgehog protein expression and function in the eye are affected by hhbar3 and hhfse
We used an antibody to detect Hedgehog antigen in the developing third larval eye-antennal imaginal disc (Fig. 2). We find that Hedgehog antigen is detectable in three territories: posterior to the morphogenetic furrow (white arrow in Fig. 2A), and outside the eye field in the presumptive ocellar domain (`oc' in Fig. 2A) and the anterior compartment of the antenna (`an' in Fig. 2A). The expression in the ocellar domain is consistent with reported hedgehog function in the head vertex (Royet and Finkelstein, 1996Go; Royet and Finkelstein, 1997Go; Amin et al., 1999Go). The expression in the anterior compartment of the antennal disc appears anomalous, as hedgehog functions in the posterior compartments of most imaginal discs, and may be explained by the inversion of the antenna (Struhl, 1981Go).

In the region of the morphogenetic furrow, Hedgehog antigen first appears in two cells (white arrowheads in Fig. 2B). These cells appear to be the R2 and R5, and later antigen is also expressed in R3 and R4. The central cell of the precluster (R8) appears not to express Hedgehog antigen. Similar differences have been observed between the R8 and the other cells, such as later expression of Elav, and independence of the Egfr/Ras pathway (Kumar et al., 1998Go). To confirm this, we doubly stained eye discs for Hedgehog and the R8-specific antigen Boss (Fig. 2C). We first observe Boss antigen slightly later than Hedgehog. In the early clusters there is a gap in the Hedgehog stain (resembling a keyhole), and in the next few columns this gap is filled by Boss (white arrows in Fig. 2C). Soon after this, Hedgehog expression fades. Thus, we suggest that Hedgehog is not expressed in the R8: at least we cannot detect it to the limits of our resolution. It may be that the furrow is driven forwards by expression from all cells except the R8.

In late third instar, hhbar3 homozygous eye discs no Hedgehog antigen is detectable posterior to the morphogenetic furrow, while it remains unaffected in the ocellar region and in the antenna (Fig. 2D). We have also stained other hhbar3 homozygous imaginal discs (wings and legs) and find the Hedgehog antigen pattern is not detectably different from wild type (data not shown). Thus, hhbar3 does specifically affect Hedgehog expression in the eye, which suggests that it is indeed an eye-specific regulatory allele. This argues strongly that the eye specific phenotype of hhbar3 is not only due to a higher requirement for Hedgehog in the eye. We also stained hhfse eye discs and find a reduced but detectable level of Hedgehog antigen in the eye (data not shown).

We deliberately overstained discs and find that the weaker and earlier domain of Hedgehog expression in the posterior margin, previously described by others in wild type, is not abolished in hhbar3 (see white arrows in Fig. 2E,F) (Domínguez and Hafen, 1997Go; Borod and Heberlein, 1998Go). After furrow initiation in hhbar3 homozygous eye discs, we detect no Hedgehog antigen in the first 12 ommatidial columns of photoreceptor cells. Thus, we suggest that in hhbar3 homozygotes the furrow initiates normally under the influence of marginal Hedgehog, and moves for the first 12 columns or so under this or other influences. Then the furrow fails as it has not begun to express Hedgehog locally.

We also tested the function of hedgehog signaling in the developing eye through the activity of a target gene. The BS3.0 element from the decapentaplegic gene (dpp:lacZ) drives strong reporter expression in the furrow, in the eye disc margins and in the compartment boundaries of other discs (Fig. 2G) (Blackman et al., 1991Go). We find that hhfse greatly reduces, but does not eliminate, dpp:lacZ expression in the furrow but not the compartment boundaries of other discs (see furrow and antenna in Fig. 2H). However, as previously reported, hhbar3 has a stronger effect (Fig. 2I) (Heberlein et al., 1993Go), as does the conditional allele hhts2 (Ma et al., 1993Go).

Taken together, these data suggest that hhbar3 is a null for Hedgehog protein expression in the eye field, while hhfse is a weaker allele: we can detect no Hedgehog expression or function (to drive dpp:lacZ) in hhbar3.

How then do hhbar3 homozygotes manage to make 12 columns of ommatidia before the furrow arrests, and how can hhbar3 be enhanced when placed in trans to the null? It is possible that there is a very low level of Hedgehog antigen present in hhbar3. However, we have grossly over stained hhbar3 discs and have never seen any. Alternatively, it could have been that Hedgehog antigen is expressed in hhbar3 for the first 12 columns and then ceases to do so. However, when we stained younger eye discs we saw no such early expression. Thus, we propose that the furrow may be induced and produce the initial columns of ommatidia through a signal from elsewhere. This is likely to involve Decapentaplegic expressed on the posterior margin, perhaps with a contribution from Hedgehog (less affected by hhbar3) and this is why the facet count in hhbar3/hhAC is less than that in hhbar3 homozygotes. We suggest that later, as the furrow moves away from the margin, it becomes an automobile organizer, supplying on its own inducer (Hedgehog) as it moves, and at this point the hhbar3 homozygous furrow arrests, having failed to make any Hedgehog.

The hhbar3 deletion removes an eye-specific transcriptional enhancer
We placed the DNA contained within the hhbar3 deletion before a truncated hsp70 promoter driving lacZ and derived transgenic flies (`bar3:lacZ', see Fig. 1A). We recovered 13 lines and all show strong reporter expression posterior to the furrow, but not in the ocellar domain and the antenna (Fig. 3A). This is strikingly reciprocal to the effect on Hedgehog antigen expression of hhbar3 itself (compare Fig. 2C with Fig. 3A), and demonstrates that this DNA contains elements that are sufficient for this eye-specific regulation. We also stained other imaginal discs and whole embryos (0-24 hour collection) and found only one other consistent expression pattern: three regions of the embryonic gut, of unknown significance (data not shown).

We did a similar experiment using the hhfse deleted DNA (Fig. 1A). We recovered seven lines and only two had barely detectable lacZ expression, and this is in the disc margin (not posterior to the furrow, Fig. 3B). Thus, the hhfse deletion contains elements that contribute to the eye-specific expression pattern, but are not sufficient for it. To further delimit this hedgehog gene eye specific enhancer we constructed a series of smaller fragment transgenes (Fig. 1A, Fig. 3C-F). We find that the minimal sufficient element to function as the hedgehog eye enhancer is a 203 bp fragment (bar3L2:lacZ), which lies to the left of the hhfse deletion and within the hhbar3 deletion (Fig. 3F, bases 6253 to 6455 using previous numbering) (Lee et al., 1992Go). Very recently another group has shown that the hhbar3 deletion has this eye specific function (Pauli et al., 2005Go). For other reasons (see below), they deleted a longer left region of a very similar fragment and showed that it is required, although they have not shown that it is sufficient (Pauli et al., 2005Go). Their data are entirely consistent with ours.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 3. ß-Gal expression from hedgehog enhancer constructs. Third instar eye-antennal imaginal discs, stained for ß-gal antigen, and shown anterior towards the right and dorsal upwards. Arrowheads mark the morphogenetic furrow. Transgenic lacZ lines are named as shown in Fig. 1A and indicated below the panels, see text. Constructs containing the three adjacent Pointed-binding sites have robust ß-gal expression posterior to the morphogenetic furrow (white arrows in A,C,F) but not in the antennal disc or the ocellar region (black arrows in A,C,F). The 203 bp fragment bar3L2 is sufficient to drive expression of lacZ reporter in the eye (F). Mutation for all three Pointed-binding sites eliminates this reporter expression (G). Six tandem Pointed-binding sites are not sufficient to drive expression of ß-gal (H). Scale bar: 50 µm.

 
The hedgehog eye enhancer drives expression in all cells expect the R8
To better define which cells express the hedgehog eye enhancer we stained eye imaginal discs for ß-gal and other cell specific markers (Fig. 4). We find that ß-gal antigen is detected first in R2 and R5, then the other photoreceptor cells and later the accessory cone cells (not shown). By staining simultaneously for the R8-specific protein Senseless (Frankfort et al., 2001Go) we find that the ß-gal reporter is not detectable in the R8, at least in the third instar larva (arrows in Fig. 4). This pattern is driven by both the full bar3:lacZ element and the 203 bp minimal fragment (bar3L2:lacZ).

The ß-gal reporter expression pattern driven by the hedgehog eye enhancer (all the photoreceptors except the R8) is the same as the genetic requirement for Egfr signaling (Kumar et al., 1998Go), and of the expression of the pointed enhancer trap pnt1277 (data not shown) (Brunner et al., 1994Go). This suggests that the Egfr pathway Ets-domain transcription factor Pointed may be a direct regulator of the hedgehog eye enhancer.

The hedgehog eye enhancer is activated by the Egfr pathway transcription factor Pointed
If Pointed directly regulates the hedgehog eye enhancer, then we might expect to find Pointed-binding sites there. We used a published Ets domain binding site consensus (Xu et al., 2000Go), and found four such sites (white arrowheads in Fig. 1A), three of which lie in the minimal 203 bp element, and one of which is outside it but in the hhfse deletion. To test the cis-acting requirement for these sites in vivo, we modified the minimal 203 bp hedgehog eye enhancer by introducing mutations into the three Ets sites [bar3L2(deltaEts):lacZ, see Materials and methods]. We derived transgenic flies and found that these do not express the lacZ reporter in the developing eye (compare Fig. 3G with 3A,C,F). Thus, these are the only three Ets sites in the 203 bp fragment that are required for function in vivo.

To test the function of Pointed-binding sites alone in vivo, we derived a hexamer concatenated construct and tested it in flies (6xEts:lacZ, see Materials and methods). This construct does drive lacZ expression in the embryonic nervous system, as described for the expression of pointed itself (data not shown) (Klämbt, 1993Go). However, it does not drive expression in the developing eye (Fig. 3H). Thus, the cis-acting Ets binding sites appear to be necessary, but not sufficient for the activity of the hedgehog eye enhancer.

To test if pointed is necessary in trans for the hedgehog eye enhancer, we derived retinal mosaic clones for the null allele pntdelta88 (Scholz et al., 1993Go) and stained for a neural marker and for bar3:lacZ expression (Fig. 5). Interestingly, as previously reported (Baonza et al., 2002Go; Yang and Baker, 2003Go), we find that pointed is not required for the neural differentiation or maintenance of the R8 cells (black arrows in Fig. 5B,D), suggesting that the late requirement for Egfr in R8 maintenance (Kumar et al., 1998Go) does not require the Pointed transcription factor. These clones do show, also as previously reported (Baonza et al., 2002Go; Yang and Baker, 2003Go), that pointed function is absolutely required for the differentiation of the other photoreceptor cells. We find that bar3:lacZ expression is undetectable in the clones (Fig. 5B,D). This is consistent with direct regulation of the hedgehog eye enhancer by Pointed.



View larger version (84K):
[in this window]
[in a new window]
 
Fig. 4. The hedgehog eye enhancer drives expression in all photoreceptors except for the R8 photoreceptor. Third instar eye imaginal discs, anterior rightwards. The fields shown are just posterior to the furrow. A-D and E-H are the same fields in the same eye discs. Genotypes are shown on the left; antigens are shown below; colors as indicated. Elav marks all photoreceptor nuclei (A,D,E,H;, Senseless (Sens) marks only the R8 photoreceptor nuclei (B,D,F,H); lacZ reporter (C,D,G,H). Black arrows indicate a Sens positive R8 nucleus in a single ommatidium. White arrows (B-D) mark R8, 2 and 5 as indicated. Both the 1.9 kb full-length bar3:lacZ (A-D) and the minimal 203-bp bar3L2:lacZ (E-H) have indistinguishable lacZ expression patterns. There is no LacZ expression in the R8 photoreceptor. Scale bar: 10 µm.

 
We tested these sites for Pointed protein binding in vitro by EMSA (gel-shift) assays (see Materials and methods). We found that Pointed protein can bind to and shift an oligonucleotide probe containing the three putative sites (Fig. 6, track 2). The 203 bp minimal hedgehog eye enhancer can compete effectively with the labeled probe for Pointed binding (Fig. 6, tracks 3-7). The same 203 bp fragment with the three Pointed sites mutated does not compete at all [as shown in Fig. 6, tracks 8-12, and below the gel, the same site mutations as used in bar3L2(deltaEts):lacZ]. Thus, the 203 bp fragment does contain Pointed-binding sites and the three Ets-binding sites we identified in silico are the only three that function as Pointed-binding sites in vitro.



View larger version (113K):
[in this window]
[in a new window]
 
Fig. 5. pointed regulates the expression of hedgehog from an eye specific enhancer. (A-D) Third instar bar3:lacZ eye imaginal disc. The field shown is several columns posterior to the morphogenetic furrow, anterior towards the right. The disc contains a mosaic clone that is homozygous for the null mutation pntdelta88. (A,D) GFP negatively marks the outlined clone. (B,D) Elav marks all the photoreceptors. (C,D) lacZ reporter. lacZ reporter expression is absent from within the pointed clone (a wild-type example outside the edge of the clone is indicated with a white arrow). The single R8 cells are Elav positive in the clone (black arrow). Scale bar: 5 µm.

 



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 6. Pointed P2 protein binds specifically to the hedgehog eye specific enhancer. Electrophoretic mobility shift assay (EMSA) gel for GST-Pointed binding. Competitor DNA is indicated at the top, with the rising level indicated by ramps. The presence or absence of GST-Pointed is indicated by + or –. Lane numbers are indicated. Lane 1, probe alone; lane 2, no competitor; lanes 3-7, 203 bp Bar3L2 competitor, ranging from 15 to 240 times molar excess; lanes 8-12, 203 bp Bar3L2(deltaETS) competitor, ranging from 15 to 240 times molar excess; lane 13, cold probe as competitor and lane 14 Ets site mutated cold probe as competitor. The probe sequence is shown below gel with the three Ets consensus sites highlighted. The nine mutations made in Bar3L2(deltaETS) are shown in white boxes.

 

    Discussion
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 
We have characterized the expression of Hedgehog at the protein level in the developing eye and confirm the previously published RNA level expression data: Hedgehog is expressed posterior to the furrow in the developing eye (Lee et al., 1992Go; Heberlein et al., 1993Go; Ma et al., 1993Go). We now report that Hedgehog is expressed in other photoreceptor cells, but not the R8. We have characterized two eye-specific alleles of hedgehog and show that they delete elements that are specifically necessary for expression in the developing eye, posterior to the morphogenetic furrow. This hedgehog eye enhancer drives expression in all of the developing ommatidial cells except the R8. We reduced this element to a 203 bp minimal fragment that is sufficient for reporter expression. We have shown that the hedgehog eye enhancer is regulated by pointed in vivo and bound by Pointed in vitro. As Egfr/Ras-driven Pointed activates reporters in all the cells except the R8, we suggest that the hedgehog expression in the developing eye is driven by this enhancer and that Hedgehog is expressed in the developing ommatidial cells excepting the R8.

We propose that hhbar3 is indeed null for hedgehog expression in the developing eye, consistent with the loss of detectable antigen. This appears to contradict our facet count data, which show that hhbar3 is not null for eye size. We suggest that hedgehog functions elsewhere (probably in the eye disc margin), expressed at some lower level, and acts redundantly with Decapentaplegic to drive the early phases of furrow progression. This is consistent with data from others for an early role for hedgehog in the eye margin for furrow initiation (Domínguez and Hafen, 1997Go; Borod and Heberlein, 1998Go), and with a proposed redundancy between hedgehog and dpp in the furrow (Greenwood and Struhl, 1999Go). The enhancement of the hhbar3 phenotype when it is placed in trans to a null (hhAC) suggests that hhbar3 may reduce, but not eliminate this early function.

Several examples of eye-specific transcriptional enhancers have been characterized. A number of these are in genes that act early in retinal determination (eyes absent, dachshund and sine oculis), and are not directly involved in the morphogenetic furrow (Bui et al., 2000Go; Punzo et al., 2002Go; Pauli et al., 2005Go). Some enhancers that function in and posterior to the morphogenetic furrow have also been studied. One example is the atonal gene, which has been shown to have two regulatory enhancers with specific and different activities in the furrow (Sun et al., 1998Go). Interestingly the atonal enhancers produce almost the reciprocal expression pattern of the hedgehog eye enhancer we describe here: hedgehog is expressed in all cells except the R8 and atonal expression is in only the R8, posterior to the furrow. Furthermore, atonal mutations can affect hedgehog signaling, although this may be indirect (White and Jarman, 2000Go), and indeed, hedgehog is also known to regulate atonal (Dominguez, 1999Go). Other enhancers that act posterior to the furrow have been characterized in the rough, sevenless and prospero genes, but none of these appears to show the particular type of regulation which we describe here (Basler et al., 1989Go; Bowtell et al., 1989Go; Heberlein and Rubin, 1990Go; Bowtell et al., 1991Go; Xu et al., 2000Go).

Very recently, others have also reported that a similar DNA fragment from the hhbar3 region confers post-furrow, eye-specific expression on a lacZ reporter (Pauli et al., 2005Go). The authors characterize the consensus binding site for another transcription factor: the retinal determination protein Sine oculis (So). They find two So-binding sites in the hhbar3 region (black arrowheads in Fig. 1A), and, as we did for the Pointed sites, they show that these are necessary for the normal function of the hedgehog eye enhancer. They show that a So site tetramer is sufficient to drive reporter expression in the entire presumptive eye field in the third instar disc, but that one is not. One of their two So sites lies within our 203 bp minimal element.

Taken together, our data and theirs suggest that Pointed and So activation at the minimal element are each necessary, but that neither is sufficient for the specific activation of the hedgehog eye enhancer posterior to the furrow. We propose that they act together to confer this dual regulation. This is consistent with the model we discussed previously (see Introduction): that special dual regulation of hedgehog is the mechanism which makes the morphogenetic furrow move, unlike the stable compartment boundaries. We suggest that this dual regulation depends on one `selector' signal that is eye specific (So), to differentiate the furrow from boundaries in other organs. The second component must act to close a loop such that cells which receives the furrow inducing signal will later send it after a delay, to make the boundary move forward. This `signal' component is Pointed, acting downstream of Egfr/Ras signaling in the assembling ommatidia. This may be a case of `selector' and `signal' transcriptional integration (Affolter and Mann, 2001Go; Mann and Carroll, 2002Go). Indeed, pointed itself has been shown to integrate `selector' factors in muscle development (Halfon et al., 2000Go). We propose that by this dual regulatory mechanism, a system that first evolved to divide the bauplan into metameric parasegments has been co-opted to drive a moving wave of differentiation in the developing eye.


    ACKNOWLEDGMENTS
 
We thank K. Moberg for his helpful comments, and R. Carthew, I. Guerrero, G. Mardon and S. L. Zipursky for their gifts of reagents. E. Rogers was supported by two NIH training grants (T32 GM008489 and T32 EY007092). This work was supported in the Moses laboratory by a grant from the National Eye Institute (EY09299).


    Footnotes
 
* Present address: Department of Microbiology and Immunology, Stanford University, Stanford CA 94305, USA Back

{dagger} Present address: Department of Biology, Haverford College, Haverford PA 19041, USA Back

{ddagger} Present address: Howard Hughes Medical Institute, Janelia Farm Research Campus, Ashburn VA 20147, USA Back


    REFERENCES
 TOP
 SUMMARY
 Introduction
 Materials and methods
 Results
 Discussion
 REFERENCES
 

Affolter, M. and Mann, R. (2001). Development. Legs, eyes, or wings – selectors and signals make the difference. Science 292,1080 -1081.[Free Full Text]

Akam, M. (1987). The molecular basis for metameric pattern in the Drosophila embryo. Development 101,1 -22.[Abstract]

Amin, A., Li, Y. and Finkelstein, R. (1999). Hedgehog activates the EGF receptor pathway during Drosophila head development. Development 126,2623 -2630.[Abstract/Free Full Text]

Baker, N. E. and Yu, S. (1997). Proneural function of neurogenic genes in the developing Drosophila eye. Curr. Biol. 7,122 -132.[CrossRef][Medline]

Baker, N. E., Yu, S. and Han, D. (1996). Evolution of proneural atonal expression during distinct regulatory phases in the developing Drosophila eye. Curr. Biol. 6,1290 -1301.[CrossRef][Medline]

Baonza, A., Casci, T. and Freeman, M. (2001). A primary role for the epidermal growth factor receptor in ommatidial spacing in the Drosophila eye. Curr. Biol. 11,396 -404.[CrossRef][Medline]

Baonza, A., Murawsky, C. M., Travers, A. A. and Freeman, M. (2002). Pointed and Tramtrack69 establish an EGFR-dependent transcriptional switch to regulate mitosis. Nat. Cell Biol. 4,976 -980.[CrossRef][Medline]

Basler, K. and Hafen, E. (1989). Dynamics of Drosophila eye development and temporal requirements of sevenless expression. Development 107,723 -731.[Abstract]

Basler, K., Siegrist, P. and Hafen, E. (1989). The spatial and temporal expression pattern of sevenless is exclusively controlled by gene-internal elements. EMBO J. 8,2381 -2386.[Abstract]

Beall, E. L., Mahoney, M. B. and Rio, D. C. (2002). Identification and analysis of a hyperactive mutant form of Drosophila P-element transposase. Genetics 162,217 -227.[Abstract/Free Full Text]

Bier, E., Ackerman, L., Barbel, S., Jan, L. and Jan, Y. N. (1988). Identification and characterization of a neuron-specific nuclear antigen in Drosophila. Science 240,913 -916.[Medline]

Blackman, R. K., Sanicola, M., Raftery, L. A., Gillevet, T. and Gelbart, W. M. (1991). An extensive 3' cis-regulatory region directs the imaginal disk expression of decapentaplegic, a member of the TGF-ß family in Drosophila.Development 111,657 -665.[Abstract]

Borod, E. R. and Heberlein, U. (1998). Mutual regulation of decapentaplegic and hedgehog during the initiation of differentiation in the Drosophila retina. Dev. Biol. 197,187 -197.[CrossRef][Medline]

Bowtell, D. D. L., Kimmel, B. E., Simon, M. A. and Rubin, G. M. (1989). Regulation of the complex pattern of sevenless expression in the developing Drosophila eye. Proc. Natl. Acad. Sci. USA 86,6245 -6249.[Abstract/Free Full Text]

Bowtell, D. D. L., Lila, T., Michael, W. M., Hackett, D. and Rubin, G. M. (1991). Analysis of the enhancer element that controls expression of sevenless in the developing Drosophila eye. Proc. Natl. Acad. Sci. USA 88,6853 -6857.[Abstract/Free Full Text]

Brunner, D., Ducker, K., Oellers, N., Hafen, E., Scholz, H. and Klambt, C. (1994). The ETS domain protein pointed-P2 is a target of MAP kinase in the sevenless signal transduction pathway. Nature 370,386 -389.[CrossRef][Medline]

Bui, Q. T., Zimmerman, J. E., Liu, H., Gray-Board, G. L. and Bonini, N. M. (2000). Functional analysis of an eye enhancer of the Drosophila eyes absent gene: differential regulation by eye specification genes. Dev. Biol. 221,355 -364.[CrossRef][Medline]

Buratowski, S. and Chodosh, L. A. (2002). The mobility shift DNA binding assay using gel electrophoresis. In Current Protocols in Molecular Biology, Vol.2 (ed. F. M. Ausubel), pp.12.2.1 -12.2.11. New York: J. Wiley and Sons.

Burke, R. and Basler, K. (1996). Hedgehog-dependent patterning in the Drosophila eye can occur in the absence of Dpp signaling. Dev. Biol. 179,360 -368.[CrossRef][Medline]

Burke, R. and Basler, K. (1997). Hedgehog signaling in Drosophila eye and limb development – conserved machinery, divergent roles? Curr. Opin. Neurobiol. 7, 55-61.[CrossRef][Medline]

Cagan, R. L. and Ready, D. F. (1989). Notch is required for successive cell decisions in the developing Drosophila retina. Genes Dev. 3,1099 -1112.[Abstract]

Cagan, R. L., Krämer, H., Hart, A. C. and Zipursky, S. L. (1992). The Bride of Sevenless and Sevenless interaction: internalization of a transmembrane ligand. Cell 69,393 -399.[CrossRef][Medline]

Chanut, F. and Heberlein, U. (1997a). Retinal morphogenesis in Drosophila: hints from an eye-specific decapentaplegic allele. Dev. Genet. 20,197 -207.[CrossRef][Medline]

Chanut, F. and Heberlein, U. (1997b). Role of decapentaplegic in initiation and progression of the morphogenetic furrow in the developing Drosophila retina. Development 124,559 -567.[Abstract/Free Full Text]

Chen, R., Halder, G., Zhang, Z. and Mardon, G. (1999). Signaling by the TGF-ß homolog decapentaplegic functions reiteratively within the network of genes controlling retinal cell fate determination in Drosophila.Development 126,935 -943.[Abstract/Free Full Text]

Curtiss, J. and Mlodzik, M. (2000). Morphogenetic furrow initiation and progression during eye development in Drosophila: the roles of decapentaplegic, hedgehog and eyes absent. Development 127,1325 -1336.[Abstract/Free Full Text]

Dickson, B. (1995). Nuclear factors in Sevenless signaling. Trends Genet. 11,106 -111.[CrossRef][Medline]

DiNardo, S., Heemskerk, J., Dougan, S. and O'Farrell, P. H. (1994). The making of a maggot: patterning the Drosophila embryonic epidermis. Curr. Opin. Genet. Dev. 4, 529-534.[CrossRef][Medline]

Dominguez, M. (1999). Dual role for Hedgehog in the regulation of the proneural gene atonal during ommatidia development. Development 126,2345 -2553.[Abstract/Free Full Text]

Domínguez, M. and Hafen, E. (1997). Hedgehog directly controls initiation and propagation of retinal differentiation in the Drosophila eye. Genes Dev. 11,3254 -3264.[Abstract/Free Full Text]

Duncan, I. W. (2002). Transvection effects in Drosophila. Annu. Rev. Genet. 36,521 -556.[CrossRef][Medline]

Frankfort, B. J., Nolo, R., Zhang, Z., Bellen, H. and Mardon, G. (2001). senseless repression of rough is required for R8 photoreceptor differentiation in the developing Drosophila eye. Neuron 32,403 -414.[CrossRef][Medline]

Fu, W. and Baker, N. E. (2003). Deciphering synergistic and redundant roles of Hedgehog, Decapentaplegic and Delta that drive the wave of differentiation in Drosophila eye development. Development 130,5229 -5239.[Abstract/Free Full Text]

Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrús, A. and Shotwell, S. L. (1982). Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. USA 79,7929 -7933.[Abstract/Free Full Text]

García-Bellido, A., Lawrence, P. A. and Morata, G. (1979). Compartments in animal development. Sci. Am. 241,102 -110.

Greenwood, S. and Struhl, G. (1999). Progression of the morphogenetic furrow in the Drosophila eye: the roles of Hedgehog, Decapentaplegic and the Raf pathway. Development 126,5795 -5808.[Abstract/Free Full Text]

Halfon, M. S., Carmena, A., Gisselbrecht, S., Sackerson, C. M., Jimenez, F., Baylies, M. K. and Michelson, A. M. (2000). Ras pathway specificity is determined by the integration of multiple signal-activated and tissue-restricted transcription factors. Cell 103,63 -74.[CrossRef][Medline]

Heberlein, U. and Rubin, G. M. (1990). Structural and functional comparisons of the Drosophila virilis and Drosophila melanogaster rough genes. Proc. Natl. Acad. Sci. USA 87,5916 -5920.[Abstract/Free Full Text]

Heberlein, U. and Moses, K. (1995). Mechanisms of Drosophila retinal morphogenesis: the virtues of being progressive. Cell 81,987 -990.[CrossRef][Medline]

Heberlein, U., Wolff, T. and Rubin, G. M. (1993). The TGFß homolog dpp and the segment polarity gene hedgehog are required for propagation of a morphogenetic wave in the Drosophila retina. Cell 75,913 -926.[CrossRef][Medline]

Heberlein, U., Singh, C. M., Luk, A. Y. and Donohoe, T. J. (1995). Growth and differentiation in the Drosophila eye coordinated by hedgehog. Nature 373,709 -711.[CrossRef][Medline]

Heemskerk, J. and DiNardo, S. (1994). Drosophila hedgehog acts as a morphogen in cellular patterning. Cell 76,449 -460.[CrossRef][Medline]

Hidalgo, A. (1996). The roles of engrailed.Trends Genet. 12,1 -4.[CrossRef][Medline]

Hooper, J. E. (1994). Distinct pathways for autocrine and paracrine Wingless signalling in Drosophila embryos. Nature 372,461 -464.[CrossRef][Medline]

Ingham, P. W. and Martinez-Arias, A. (1992). Boundaries and fields in early embryos. Cell 68,221 -235.[CrossRef][Medline]

Ives, P. (1950). New mutants report: bar-3. Dros. Inf. Serv. 24,58 .

Kauffmann, R. C., Li, S., Gallagher, P. A., Zhang, J. and Carthew, R. W. (1996). Ras1 signaling and transcriptional competence in the R7 cell of Drosophila. Genes Dev. 10,2167 -2178.[Abstract]

Klämbt, C. (1993). The Drosophila gene pointed encodes two ETS-like proteins which are involved in the development of the midline glial cells. Development 117,163 -176.[Abstract/Free Full Text]

Kornberg, T. B. and Tabata, T. (1993). Segmentation of the Drosophila embryo. Curr. Opin. Genet. Dev. 3,585 -594.[CrossRef][Medline]

Kumar, J. P. and Moses, K. (2001). Expression of evolutionarily conserved eye specification genes during Drosophila embryogenesis. Genes Dev. Evol. 211,406 -414.[CrossRef]

Kumar, J. P., Tio, M., Hsiung, F., Akopyan, S., Gabay, L., Seger, R., Shilo, B.-Z. and Moses, K. (1998). Dissecting the roles of the Drosophila EGF receptor in eye development and MAP kinase activation. Development 125,3875 -3885.[Abstract/Free Full Text]

Lawrence, P. A. (1981). The cellular basis of segmentation in insects. Cell 26, 3-10.[CrossRef][Medline]

Lee, J. J., von Kessler, D. P., Parks, S. and Beachy, P. A. (1992). Secretion and localized transcription suggest a role in positional signaling for products of the segmentation gene hedgehog.Cell 71,33 -50.[CrossRef][Medline]

Lee, J. J., Ekker, S. C., von Kessler, D. P., Porter, J. A., Sun, B. I. and Beachy, P. A. (1994). Autoproteolysis in Hedgehog protein biogenesis. Science 266,1528 -1537.[Medline]

Lewis, E. B. (1954). The theory and application of a new method of detecting chromosomal rearrangements in Drosophila.Am. Nat. 88,225 -239.[CrossRef]

Li, W., Ohlmeyer, J. T., Lane, M. E. and Kalderon, D. (1995). Function of protein kinase A in Hedgehog signal transduction and Drosophila imaginal disc development. Cell 80,553 -562.[CrossRef][Medline]

Lum, L. and Beachy, P. A. (2004). The Hedgehog response network: sensors, switches, and routers. Science 304,1755 -1759.[Abstract/Free Full Text]

Ma, C. and Moses, K. (1995). wingless and patched are negative regulators of the morphogenetic furrow and can affect tissue polarity in the developing Drosophila compound eye. Development 121,2279 -2289.[Abstract/Free Full Text]

Ma, C., Zhou, Y., Beachy, P. A. and Moses, K. (1993). The segment polarity gene hedgehog is required for progression of the morphogenetic furrow in the developing Drosophila eye. Cell 75,927 -938.[CrossRef][Medline]

Ma, C., Liu, H., Zhou, Y. and Moses, K. (1996). Identification and characterization of autosomal genes that interact with glass in the developing Drosophila eye. Genetics 142,1199 -1213.[Abstract/Free Full Text]

Mann, R. S. and Carroll, S. B. (2002). Molecular mechanisms of selector gene function and evolution. Curr. Opin. Genet. Dev. 12,592 -600.[CrossRef][Medline]

Mardon, G., Solomon, N. M. and Rubin, G. M. (1994). dachshund encodes a nuclear protein required for normal eye and leg development in Drosophila.Development 120,3473 -3486.[Abstract/Free Full Text]

Mohler, J. (1988). Requirements for hedgehog, a segmental polarity gene, in patterning larval and adult cuticle of Drosophila. Genetics 120,1061 -1072.[Abstract/Free Full Text]

Morata, G. and Lawrence, P. A. (1977). Homoeotic genes, compartments and cell determination in Drosophila.Nature 265,211 -216.[CrossRef][Medline]

Muller, H. J. (1932). Further studies on the nature and causes of gene mutations. In Intern. Congress Genet., vol. 1 (ed. D. F. Jones), pp.213 -255. Brooklyn, NY: Brooklyn Botanic Garden.

Nolo, R., Abbott, L. A. and Bellen, H. J. (2000). Senseless, a Zn finger transcription factor, is necessary and sufficient for sensory organ development in Drosophila.Cell 102,349 -362.[CrossRef][Medline]

O'Neill, E. M., Rebay, I., Tjian, R. and Rubin, G. M. (1994). The activities of two Ets-related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell 78,137 -147.[CrossRef][Medline]

Pappu, K. S., Chen, R., Middlebrooks, B. W., Woo, C., Heberlein, U. and Mardon, G. (2003). Mechanism of hedgehog signaling during Drosophila eye development. Development 130,3053 -3062.[Abstract/Free Full Text]

Park, M., Wu, X., Golden, K., Axelrod, J. D. and Bodmer, R. (1996). The wingless signaling pathway is directly involved in Drosophila heart development. Dev. Biol. 177,104 -116.[CrossRef][Medline]

Pauli, T., Seimiya, M., Blanco, J. and Gehring, W. J. (2005). Identification of functional sine oculis motifs in the autoregulatory element of its own gene, in the eyeless enhancer and in the signalling gene hedgehog. Development 132,2771 -2782.[Abstract/Free Full Text]

Perrimon, N. (1994). The genetic basis of patterned baldness in Drosophila. Cell 76,781 -784.[CrossRef][Medline]

Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye development by Decapentaplegic. Development 124,271 -278.[Abstract/Free Full Text]

Punzo, C., Seimiya, M., Flister, S., Gehring, W. J. and Plaza, S. (2002). Differential interactions of eyeless and twin of eyeless with the sine oculis enhancer. Development 129,625 -634.[Abstract/Free Full Text]

Ready, D. F., Hanson, T. E. and Benzer, S. (1976). Development of the Drosophila retina, a neurocrystalline lattice. Dev. Biol. 53,217 -240.[CrossRef][Medline]

Royet, J. and Finkelstein, R. (1996). hedgehog, wingless and orthodenticle specify adult head development in Drosophila. Development 122,1849 -1858.[Abstract/Free Full Text]

Royet, J. and Finkelstein, R. (1997). Establishing primordia in the Drosophila eye-antennal imaginal disc: the roles of decapentaplegic, wingless and hedgehog.Development 124,4793 -4800.[Abstract/Free Full Text]

Rubin, G. M. and Spradling, A. C. (1982). Genetic transformation of Drosophila with transposable element vectors. Science 218,348 -353.[Medline]

Rubin, G. M., Chang, H. C., Karim, F., Laverty, T., Michaud, N. R., Morrison, D. K., Rebay, I., Tang, A., Therrien, M. and Wassarman, D. A. (1997). Signal transduction downstream from Ras in Drosophila. Cold Spring Harb. Symp. Quant. Biol. 62,347 -352.[Medline]

Scholz, H., Deatrick, J., Klaes, A. and Klambt, C. (1993). Genetic dissection of pointed, a Drosophila gene encoding two ETS-related proteins. Genetics 135,455 -468.[Abstract/Free Full Text]

Shyamala, B. V. and Bhat, K. M. (2002). A positive role for patched-smoothened signaling in promoting cell proliferation during normal head development in Drosophila.Development 129,1839 -1847.[Medline]

Struhl, G. (1981). A blastoderm fate map of compartments and segments of the Drosophila head. Dev. Biol. 84,386 -396.[CrossRef]

Strutt, D. I. and Mlodzik, M. (1996). The regulation of hedgehog and decapentaplegic during Drosophila eye imaginal disc development. Mech. Dev. 58,39 -50.[CrossRef][Medline]

Strutt, D. I. and Mlodzik, M. (1997). Hedgehog is an indirect regulator of morphogenetic furrow progression in the Drosophila eye disc. Development 124,3233 -3240.[Abstract/Free Full Text]

Strutt, D. I., Wiersdorff, V. and Mlodzik, M. (1995). Regulation of furrow progression in the Drosophila eye by cAMP-dependent protein kinase A. Nature 373,705 -709.[CrossRef][Medline]

Sun, Y., Jan, L. Y. and Jan, Y. N. (1998). Transcriptional regulation of atonal during development of the Drosophila peripheral nervous system. Development 125,3731 -3740.[Abstract/Free Full Text]

Tio, M. and Moses, K. (1997). The Drosophila TGF{alpha} homolog Spitz acts in photoreceptor recruitment in the developing retina. Development 124,343 -351.[Abstract/Free Full Text]

Tomlinson, A. (1985). The cellular dynamics of pattern formation in the eye of Drosophila. J. Embryol. Exp. Morph. 89,313 -331.[Medline]

Tomlinson, A. (1988). Cellular interactions in the developing Drosophila eye. Development 104,183 -193.[Medline]

Tomlinson, A. and Ready, D. F. (1987). Neuronal differentiation in the Drosophila ommatidium. Dev. Biol. 120,366 -376.[CrossRef]

Treisman, J. E. and Rubin, G. M. (1995). wingless inhibits morphogenetic furrow movement in the Drosophila eye disc. Development 121,3519 -3527.[Abstract/Free Full Text]

Voas, M. G. and Rebay, I. (2004). Signal integration during development: Insights from the Drosophila eye. Dev. Dyn. 229,162 -175.[CrossRef][Medline]

White, N. M. and Jarman, A. P. (2000). Drosophila atonal controls photoreceptor R8-specific properties and modulates both Receptor Tyrosine Kinase and Hedgehog signalling. Development 127,1681 -1689.[Abstract/Free Full Text]

Wiersdorff, V., Lecuit, T., Cohen, S. M. and Mlodzik, M. (1996). Mad acts downstream of Dpp receptors, revealing a differential requirement for dpp signaling in initiation and propagation of morphogenesis in the Drosophila eye. Development 122,2153 -2162.[Abstract/Free Full Text]

Wolff, T. and Ready, D. F. (1993). Chapter 22, Pattern formation in the Drosophila retina. In The development of Drosophila melanogaster, vol.2 (ed. M. Bate and A. Martinez-Arias), pp.1277 -1325, New York: Cold Spring Harbor Laboratory Press.

Xu, C., Kauffmann, R. C., Zhang, J., Kladny, S. and Carthew, R. W. (2000). Overlapping activators and repressors delimit transcriptional response to receptor tyrosine kinase signals in the Drosophila eye. Cell 103, 87-97.[CrossRef][Medline]

Yang, L. and Baker, N. E. (2001). Role of the EGFR/Ras/Raf pathway in specification of photoreceptor cells in the Drosophila retina. Development 128,1183 -1191.[Abstract/Free Full Text]

Yang, L. and Baker, N. E. (2003). Cell cycle withdrawal, progression, and cell survival regulation by Egfr and its effectors in the differentiating Drosophila eye. Dev. Cell 4,359 -369.[CrossRef][Medline]





This Article
Summary
Figures Only
Full Text (PDF)
All Versions of this Article:
dev.02061v1
132/21/4833    most recent
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in PubMed
Alert me to new issues of the journal
Download to citation manager
Google Scholar
Articles by Rogers, E. M.
Articles by Moses, K.
PubMed
PubMed Citation
Articles by Rogers, E. M.
Articles by Moses, K.