Cardiovascular Research Center, Massachusetts General Hospital, 149 13th Street, Charlestown, MA 02129, USA
* Present address: Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Calgary, Calgary AB, Canada, T2N 4N1
Author for correspondence (e-mail: mcfishman{at}partners.org)
Accepted 1 July 2002
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We mapped and cloned the heartstrings mutation and find it to encode the zebrafish ortholog of the TBX5 gene. The heartstrings mutation causes premature termination at amino acid 316. Homozygous mutant embryos never develop pectoral fin buds and do not express several markers of early fin differentiation. The total absence of any fin bud differentiation distinguishes heartstrings from most other mutations that affect zebrafish fin development, suggesting that Tbx5 functions very early in the pectoral fin induction pathway. Moderate reduction of Tbx5 by morpholino causes fin malformations, revealing an additional early requirement for Tbx5 in coordinating the axes of fin outgrowth. The heart of heartstrings mutant embryos appears to form and function normally through the early heart tube stage, manifesting only a slight bradycardia compared with wild-type siblings. However, the heart fails to loop and then progressively deteriorates, a process affecting the ventricle as well as the atrium.
Relative to mammals, fish require lower levels of Tbx5 to produce malformed appendages and display whole-heart rather than atrial-predominant cardiac defects. However, the syndromic deficiencies of tbx5 mutation are remarkably well retained between fish and mammals.
Key words: Holt-Oram syndrome, Zebrafish, T-box, Tbx5, Heart, Pectoral fin, Limb induction
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The function of tbx5 in the heart appears to be exquisitely sensitive to gene dosage, since either haploinsufficiency or gene duplication can produce the cardiac abnormalities associated with Holt-Oram syndrome (Dixon et al., 1993; Hatcher and Basson, 2001
; McCorquodale et al., 1986
; Melnyk et al., 1981
). The sensitivity to dose may be explained in part by the synergistic interaction of Tbx5 with other transcription factors, including Nkx2.5 (Bruneau et al., 2001
; Hiroi et al., 2001
), and its activation or co-activation of multiple downstream targets including connexin40 and atrial natriuretic factor (Bruneau et al., 2001
; Ghosh et al., 2001
; Hiroi et al., 2001
). Although tbx5 is expressed early in the cardiogenic mesoderm prior to heart tube formation (Bruneau et al., 1999
; Chapman et al., 1996
; Horb and Thomsen, 1999
; Liberatore et al., 2000
), specific functions in heart field specification have not been identified. Several tbx genes may play overlapping functions in early decisions of cardiac cell fate, as suggested by complete elimination of cardiac tissue by dominant negative effects of tbx5-engrailed constructs injected into Xenopus embryos (Horb and Thomsen, 1999
). The earliest described phenotypic effects in mice with a targeted mutation in tbx5 (Tbx5/ mice) include hypoplasia of the inflow tract, atria, and to a lesser extent, the left ventricle (Bruneau et al., 2001
). Dominant effects observed in heterozygous human or Tbx5+/ mice include atrial and ventricular septal defects, and electrophysiological defects, particularly atrioventricular block (Bruneau et al., 2001
; Newbury-Ecob et al., 1996
).
tbx5 is expressed in a dynamic pattern in the developing heart tube. At early stages, human (Hatcher et al., 2000a; Li et al., 1997
), mouse (Bruneau et al., 1999
; Chapman et al., 1996
; Christoffels et al., 2000
; Liberatore et al., 2000
), chicken (Bruneau et al., 1999
; Liberatore et al., 2000
) and frog (Horb and Thomsen, 1999
) show somewhat different patterns of tbx5 expression, but by completion of cardiac looping all express tbx5 in a posterior-to-anterior gradient with highest levels of expression in the atria and absence of expression in the conotruncus or outflow tract. tbx5 is expressed in the heart of zebrafish (Begemann and Ingham, 2000
; Ruvinsky et al., 2000
), but its anteroposterior expression pattern was not described. Anteroposterior localization appears to be important, because engineered persistent expression of mouse tbx5 in the entire heart tube perturbs chamber-specific gene expression and retards ventricular chamber morphogenesis (Liberatore et al., 2000
).
Tbx5 also plays a role in the developing limb (Simon, 1999; Tamura et al., 2001
). tbx5 is expressed in the forelimb, and tbx4 in the hindlimb, suggesting that tbx5 controls forelimb identity, and tbx4 hindlimb identity (Gibson-Brown et al., 1998
; Isaac et al., 1998
; Logan et al., 1998
; Ohuchi et al., 1998
). Ectopic expression of Tbx5 or Tbx4 in chick partially transforms the identity of developing limbs, in accordance with this suggestion (Logan and Tabin, 1999
; Rodriguez-Esteban et al., 1999
; Takeuchi et al., 1999
). The skeletal defects observed in patients with Holt-Oram syndrome, or experimentally, in limbs produced from ectopic buds in chick, indicate that Tbx5 also coordinates later limb outgrowth. Limb deformities in the Holt-Oram syndrome range from mild thumb deformities to a near absence of the arm (phocomelia) (Basson et al., 1994
; Newbury-Ecob et al., 1996
).
We here report the isolation of a recessive mutation that affects heart and pectoral fin formation in the zebrafish embryo. The pectoral fin is homologous to the tetrapod forelimb (Tamura et al., 2001). heartstrings (hst) is an unusual mutation in that even the earliest molecular evidence of pectoral fin bud generation is absent. The heart in hst mutant embryos forms relatively normally, but deteriorates during looping and later stages. We positionally cloned the hst locus, and show it encodes the zebrafish ortholog of tbx5. The hst mutation appears to eliminate Tbx5 function entirely, but we find Tbx5 function is markedly dose-dependent, especially in fin bud formation.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Meiotic and physical mapping of hst
We mapped the hst locus to the telomere of linkage group 5 using bulked segregant analysis (Michelmore et al., 1991) on a panel of 120 microsatellite markers from the zebrafish genetic map (Knapik et al., 1998
). DNA of homozygous hstm21 embryos (4974 meioses) was tested against individual microsatellite markers (Z markers) to refine the critical interval. BAC clones were identified by screening DNA pools by PCR (Incyte Genomics). We used the QIAGEN plasmid Midi kit to extract BAC DNA. We obtained BAC end sequences by direct sequencing (MWG Biotech). Simple sequence repeats (SSRs), single nucleotide polymorphisms (SNPs) or simple sequence length polymorphisms (SSCPs) were defined in BAC end sequences and used to develop genetic markers for fine mapping. Genetic and physical maps were coordinated using the Goodfellow radiation hybrid (RH) panel (Geisler et al., 1999
).
Identification of the hst mutation
RNA was extracted from wild-type or homozygous hst embryos aged 48 hours post-fertilization (hpf). RT-PCR of the tbx5 gene was performed using the Promega Access kit and primers tbxF4 (TTTTGGTTGTTTAGGGATTCG) and tbxR2 (AGCACAATGTTTGCTGCTTC), followed by nested PCR with primers tbxF3 (GGAATTTAAGGCCTCACGGTA) and tbxR3 (TGATGTGTCCAGTGCTCCTT). PCR products of four independent RNA samples were sequenced on both strands and aligned using the MacVector gene analysis program.
In situ hybridization, antibody, skeletal staining and histology
Whole-mount in situ hybridization and antibody staining was carried out as described previously (Thisse et al., 1993). Antibodies were obtained from Dr Frank Stockdale (MF-20 and S46). For skeletal stains, whole pectoral fins were excised from adults and fixed overnight in 4% paraformaldehyde. Alcian Blue/Alizarin Red staining was performed as described previously (Grandel and Schulte-Merker, 1998
). For sectioning, embryos were mounted in JB-4 plastic medium (Polysciences), sectioned at 5 µm, stained with Methylene Blue/Fuchsin (Grandel and Schulte-Merker, 1998
) and photographed with a Zeiss Axioscope.
Morpholino treatment
The morpholino antisense oligonucleotide "tbx-MO" (5' GAAAGGTGTCTTCACTGTCCGCCAT 3') was designed against the tbx5 translational start site and purchased from Gene Tools, LLC. Wild-type or hst embryos primarily at the 1-cell stage with chorion intact were injected with 2 nl of stocks ranging from 750 to 100 µM (12.4 to 1.7 ng) of morpholino diluted in Danieaus solution.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The morphology of the initial heart tube of hst mutant embryos at 24-26 hpf is indistinguishable from wild type. Both atrium and ventricle are evident and contract normally. The one subtle difference from wild type is heart rate. From the onset of cardiac contraction, hearts of hst mutant embryos beat slower than those of their wild-type siblings (Table 1). Measurements of heart rate (beats/minute) at 25 hpf, the earliest time-point at which regular heart rates could be scored, indicate the heart rate of hst mutant embryos is approximately 84.9% of wild-type siblings. By 2 dpf, the heart rate of hst mutant embryos is 77.6% of the wild-type siblings. Heart rates of heterozygote embryos are not different from wild type.
|
|
|
|
Mutant proteins that retain the ability to dimerize or to bind DNA without concomitant trans-activation have the potential to exert dominant negative activity (Veitia, 2002). Indeed, carboxy-terminal truncations in the T-box protein Brachyury with dominant negative activity have been described (Herrmann, 1991
). However, we do not have genetic evidence for dominant effects of the hst mutation, and hst heterozygotes are phenotypically indistinguishable from wild-type embryos. The number of mutant offspring from hst heterozygote incrosses is 25.8% (379/1396).
Premature nonsense codons can destabilize the transcripts leading to nonsense mediated decay (Nagy and Maquat, 1998). However, hst transcripts are expressed in mutant embryos by in situ hybridization at levels comparable to wild type, suggesting that RNA stability is not markedly reduced by the mutation.
Morpholino-mediated translational inhibition of Tbx5 phenocopies hst
To examine whether hst defects are due to loss of Tbx5 function, we reduced Tbx5 levels by injection of morpholino-modified antisense oligonucleotides. Morpholinos inhibit the translation of specific RNA target molecules and have been shown to phenocopy a number of early zebrafish mutations (Heasman, 2002). We used a morpholino directed against the tbx5 translational start site (tbx5-MO), and find injection of 12.4 ng produces a progression of heart and limb defects indistinguishable from those in hst mutant embryos in 93% (272/292) of injected embryos (Fig. 4). At 25 hpf, the mean heart rate of morphant-injected embryos is 82.6% of uninjected embryos (n=43 morphants, 44 uninjected controls), a rate similar to hst embryos of the same age (Table 1). This progresses to failure of looping and cardiac dysfunction with a string-like heart. Fin buds do not form. We observed a milder version of the hst phenotype (see below) in 2.1% (6/292) of injected embryos. 5.1% (15/292) of embryos displayed defects in trunk and tail development, or necrosis in the CNS, common non-specific defects noted with injection of other morpholinos delivered at high dose (Ekker and Larson, 2001
; Imai and Talbot, 2001
). Lower doses of tbx5-MO (1.7 ng), phenocopy the mutation in 64% (76/118) of embryos, and cause a milder version with slight cardiac dysfunction, little or no pericardial edema, and undersized, delayed pectoral fin buds (Fig. 4E,H) in 30% (33/118) of embryos. Similar effects of tbx5 morpholinos on pectoral fin development were recently described by Ahn et al. (Ahn et al., 2002
).
|
tbx5 expression pattern in the heart and fin buds
tbx5 expression in the heart of hst mutant embryos is identical to wild type, when analyzed by RNA in situ hybridization. tbx5 transcripts appear as bilateral stripes in the lateral plate mesoderm (LPM) beginning at the 6- or 7-somite stage (Begemann and Ingham, 2000; Ruvinsky et al., 2000
; Tamura et al., 1999
; Yelon et al., 2000
). The domain of tbx5 expression expands mediolaterally between the 10- and 15-somite stage. Thereafter, anterior (heart-forming) regions migrate medially, whereas the posterior (fin-forming) regions remain broadly spread across the yolk. At the 20-somite stage, when the heart tube is first assembled as a cone, tbx5 is expressed in the myocardial precursors as well as bilaterally in broad posterior regions that constrict by 26 hpf to form roughly circular fin fields.
Patterns of tbx5 expression in the heart differ among species, and have not previously been described in detail beyond 30 hpf in the zebrafish (Begemann and Ingham, 2000; Ruvinsky et al., 2000
). At 26 hpf, expression in the presumptive atrium is slightly greater than in the presumptive ventricle (Fig. 5A,B). tbx5 expression in the heart tube of hst mutant embryos is identical to wild type at this and later stages, despite incomplete looping in hst mutant embryos. An atrial-enhanced pattern of tbx5 expression is noted in other species (Bruneau et al., 1999
; Chapman et al., 1996
; Christoffels et al., 2000
; Hatcher et al., 2000b
; Horb and Thomsen, 1999
; Li et al., 1997
; Liberatore et al., 2000
). Surprisingly, in zebrafish the tbx5 expression gradient reverses in direction by 48 hpf, when looping is almost complete (Fig. 5C,D). At 48 hpf and beyond, tbx5 expression is strongest in the ventricle, weaker in the atrium, and absent in the inflow tract (Fig. 5C,D). We do not detect tbx5 expression in the outflow tract at any time. Thus, the pattern of tbx5 expression in the heart at later stages has polarity opposite to that of other vertebrate species.
|
|
|
|
|
The bHLH factor hand2 normally is expressed in posterior LPM and developing fin (Fig. 9G-I). hst mutant embryos show normal hand2 expression up to the 20-somite stage, greatly reduced expression at 24 hours (Fig. 9G') and no expression at 32 or 48 hpf (Fig. 9H',I'). The expression of hand2 and tbx5 in the presumptive fin field prior to bud outgrowth suggests that some fin precursor cells differentiate in hst mutant embryos, but the buds fail to grow out. Thus, mutation of the hst gene reveals an early, essential requirement for Tbx5 in the process of fin field determination or fin bud induction.
Pectoral fins anomalies caused by reduction in Tbx5
The haploinsufficient effects of tbx5 mutations in human and mouse suggest that Tbx5 functions in the heart and limb are sensitive to dose. Clearly, the zebrafish is not affected by the same degree of Tbx5 deficiency, since hst heterozygous fish do not display a mutant phenotype. We progressively lowered levels of Tbx5 in the embryo by varying the concentrations of Tbx5 morpholino injected. Upon injection of 1.7 ng, we observe small pectoral fin buds in about 30% of injected embryos by 48 hpf (Fig. 4E). Although bud growth or initiation is delayed for several hours, all embryos that ultimately develop fins have a morphologically observable bud by 48 hpf.
Delayed buds continue to grow but typically produce abnormal embryonic fins that are shorter along the proximal-distal axis (Fig. 4J,K). Some embryos develop a bud on one side only, and subsequently grow a single fin (Fig. 4K). Some fins develop as stubby appendages, while other fins are overtly normal proximally, but the distal half of the fin folds upwards.
To assess the development of cartilaginous elements that support and shape the fin, we examined histological sections through the developing fins (Fig. 10A-D). Fins of hst mutant embryos are shorter, and sometimes severely stunted in growth. Endoskeletal development in fins is often normal proximally, but defective in the distal up-turned portion (Fig. 10B). In stubby appendages, the endoskeletal disc is several cell layers thick (Fig. 10C,D).
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Tbx5 is required for the maturation of cardiac function
Clearly, Tbx5 is essential for normal growth of both chambers of the zebrafish heart. The timing of onset of phenotype well after heart tube formation suggests that the defect does not affect early cardiac progenitors, but rather subsequent growth and differentiation. The specific nature of the cellular pathophysiology remains to be determined.
In humans, the atrium is associated with the most severe and most penetrant aspects of TBX5 mutation, although defects associated with the ventricle and other areas of the heart have been described (Bruneau et al., 1999; Bruneau et al., 2001
; Hatcher et al., 2000a
). In mice homozygous for Tbx5 deficiency, sinoatrial structures and the primitive left ventricle are severely hypoplastic (Bruneau et al., 2001
). The inflow tract of hst mutant embryos appears normal, and cardiac defects include both atrium and ventricle. The particular sensitivity of the atrium in human and mouse may reflect, in part, the tbx5 expression gradient, which is higher in atrium than ventricle in those species. In the zebrafish, we find that tbx5 expression extends throughout both chambers, through the initial looping stages. At 48 hpf, the time when deterioration is clearly evident, tbx5 expression is greater in the ventricle than the atrium, i.e., a pattern reversed relative to other vertebrates.
tbx5 is believed to be important for atrial-ventricular patterning of the heart in other species. In mouse, engineered persistent expression of tbx5 in the entire heart tube perturbs chamber-specific gene expression and retards ventricular chamber morphogenesis (Liberatore et al., 2000). Overexpression of tbx5 in cultured human cardiomyocytes inhibits growth and proliferation, suggesting the function of TBX5 is to act as a brake on cellular proliferation (Hatcher and Basson, 2001
). Thus, higher expression of tbx5 in atrial tissues may contribute to their development as thin-walled structures, as opposed to the thick-walled trabecular ventricular chambers (Hatcher and Basson, 2001
). However, the expression patterns of markers of early cardiac mesoderm and chamber-specific markers are normal in hst mutant embryos, suggesting that the heartstrings mutation does not perturb atrial-ventricular patterning in zebrafish. In fact, the predominant cardiac defects of hst mutant embryos become evident well after the development of discrete morphological chambers that express chamber-specific markers and after the onset of circulation.
It is of interest, however, that hst mutant embryos display an early bradycardia. Pacemaking originates in the sinoatrial region, suggesting that it might be affected as in other species. Bradycardia may be an accompaniment to deficiencies throughout the heart (Warren et al., 2001). Alternatively, Tbx5 could affect the adhesive or conductive properties of cardiomyocytes by regulating the expression of downstream genes such as connexins. In mouse, TBX5 interacts with other transcription factors such as Nkx2.5 to regulate downstream targets with important roles in cardiac growth (ANF) and conduction (Cx40) (Bruneau et al., 2001
).
Tbx5 is essential for pectoral fin induction
hst mutant embryos never generate pectoral fin buds, and do not maintain expression of tbx5 or hand2 within the differentiating fin field. hst mutant embryos do not express markers of the apical fold (dlx2, bmp4) or ZPA (shh), suggesting fin bud induction is blocked. Thus, the heartstrings mutant reveals an essential role for Tbx5 in the earliest stages of bud formation, either in fin bud induction itself or in the determination of the fin field as it coalesces within the lateral plate mesoderm. In other species, FGF10 is a strong candidate for the initial mesoderm-inducing signal. Targeted mutation of fgf10 or its receptor FGFR2 in mouse results in a complete or nearly complete elimination of both fore- and hind-limb buds (Min et el., 1998; Xu et al., 1998
; Sekine et al., 1999
). Proposed regulators of fgf10 include wnt-2b and wnt-8c (Kawakami et al., 2001
). Regulatory loops between Tbx5 and the FGF, WNT and BMP signaling pathways have been proposed (Gibson-Brown et al., 1998
; Ohuchi et al., 1998
; Rodriguez-Esteban et al., 1999
) but the precise relationships are not fully resolved. Once fgf10 and the relevant wnts are cloned in zebrafish, the hst mutant can be used to assess the role of Tbx5 in known pathways of limb/fin induction.
Low level inhibition of Tbx5 by morpholino perturbs fin shape, size and endoskeletal development, suggesting an additional role for Tbx5 in coordinating pectoral fin outgrowth. Similarly, in the chick, down-regulation of Tbx5 caused by blockage of FGF signaling in the limb causes loss of the radius and digits (Rodriguez-Esteban et al., 1999). In humans, tbx5 haploinsufficiency results in forelimb (arm) deformities ranging from subtle abnormalities of the thumb or carpel bones to severe shortening of the arm (OMIM#142900) (Newbury-Ecob et al., 1996
). These limb defects in Holt-Oram syndrome are often bilateral but can be asymmetric (Basson et al., 1999
). The defects from Tbx5 reduction in the zebrafish also can be asymmetric in severity, suggesting that there may quite sensitive thresholds for effects, as occurs for certain cell fates in response to morphogens (Gurdon and Bourillot, 2001
). Alternatively, mosaic distribution of morpholino could account for the asymmetry, but this seems less likely because we injected morpholino into one-celled eggs, and there is no clear left-right allocation of blastomeres to left or right sides in the zebrafish, as is the case in the frog (Abdelilah and Driever, 1997
).
The essential elements of many organs, including heart (Kupperman et al., 2000; Rottbauer et al., 2001
; Sehnert et al., 2002
; Walsh and Stainier, 2001
; Xu et al., 2002
), blood (Childs et al., 2000
; Liao et al., 2002
; Lyons et al., 2002
), eye (Hutson and Chien, 2002
; Malicki et al., 2002
; Vihtelic and Hyde, 2002
), gut (Allende et al., 1996
), kidney (Serluca et al., 2002
; Sun and Hopkins, 2001
) and bone (Popperl et al., 2000
; Schilling et al., 1996
) have proved decipherable by zebrafish mutational analysis. The essential genes and their mode of action for normal organ formation clearly are conserved through vertebrate evolution. Similarly, the organotypic elements perturbed in human genetic syndromes are mirrored in the fish with great fidelity.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Abdelilah, S. and Driever, W. (1997). Pattern formation in janus-mutant zebrafish embryos. Dev. Biol. 184, 70-84.[Medline]
Ahn, D., Kourakis, M. J., Rohde, L. A., Silver, L. M. and Ho, R. K. (2002). T-box gene tbx5 is essential for formation of the pectoral limb bud. Nature 417, 754-758.[Medline]
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield, M. (1994). Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14, 3475-3486.[Abstract]
Allende, M. L., Amsterdam, A., Becker, T., Kawakami, K., Gaiano, N. and Hopkins, N. (1996). Insertional mutagenesis in zebrafish identifies two novel genes, pescadillo and dead eye, essential for embryonic development. Genes Dev. 10, 3141-3155.[Abstract]
Bamshad, M., Le, T., Watkins, W. S., Dixon, M. E., Kramer, B. E., Roeder, A. D., Carey, J. C., Root, S., Schinzel, A., Van Maldergem, L. et al. (1999). The spectrum of mutations in TBX3: Genotype/Phenotype relationship in ulnar-mammary syndrome. Am. J. Hum. Genet. 64, 1550-1562.[Medline]
Bamshad, M., Lin, R. C., Law, D. J., Watkins, W. C., Krakowiak, P. A., Moore, M. E., Franceschini, P., Lala, R., Holmes, L. B., Gebuhr, T. C. et al. (1997). Mutations in human TBX3 alter limb, apocrine and genital development in ulnar-mammary syndrome. Nat. Genet. 16, 311-315.[Medline]
Barresi, M. J., Stickney, H. L. and Devoto, S. H. (2000). The zebrafish slow-muscle-omitted gene product is required for Hedgehog signal transduction and the development of slow muscle identity. Development 127, 2189-2199.
Basson, C. T., Bachinsky, D. R., Lin, R. C., Levi, T., Elkins, J. A., Soults, J., Grayzel, D., Kroumpouzou, E., Traill, T. A., Leblanc-Straceski, J. et al. (1997). Mutations in human TBX5 cause limb and cardiac malformation in Holt-Oram syndrome. Nat. Genet. 15, 30-35.[Medline]
Basson, C. T., Cowley, G. S., Solomon, S. D., Weissman, B., Poznanski, A. K., Traill, T. A., Seidman, J. G. and Seidman, C. E. (1994). The clinical and genetic spectrum of the Holt-Oram syndrome (heart-hand syndrome). New Engl. J. Med. 330, 885-891.
Basson, C. T., Huang, T., Lin, R. C., Bachinsky, D. R., Weremowicz, S., Vaglio, A., Bruzzone, R., Quadrelli, R., Lerone, M., Romeo, G. et al. (1999). Different TBX5 interactions in heart and limb defined by Holt-Oram syndrome mutations. Proc. Natl. Acad. Sci. USA 96, 2919-2924.
Begemann, G. and Ingham, P. W. (2000). Developmental regulation of Tbx5 in zebrafish embryogenesis. Mech. Dev. 90, 299-304.[Medline]
Begemann, G., Schilling, T. F., Rauch, G. J., Geisler, R. and Ingham, P. W. (2001). The zebrafish neckless mutation reveals a requirement for raldh2 in mesodermal signals that pattern the hindbrain. Development 128, 3081-3094.
Braybrook, C., Doudney, K., Marcano, A. C., Arnason, A., Bjornsson, A., Patton, M. A., Goodfellow, P. J., Moore, G. E. and Stanier, P. (2001). The T-box transcription factor gene TBX22 is mutated in X-linked cleft palate and ankyloglossia. Nat. Genet. 29, 179-183.[Medline]
Bruneau, B. G., Logan, M., Davis, N., Levi, T., Tabin, C. J., Seidman, J. G. and Seidman, C. E. (1999). Chamber-specific cardiac expression of Tbx5 and heart defects in Holt-Oram syndrome. Dev. Biol. 211, 100-108.[Medline]
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F., Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C. E. et al. (2001). A murine model of Holt-Oram syndrome defines roles of the T-box transcription factor Tbx5 in cardiogenesis and disease. Cell 106, 709-721.[Medline]
Chapman, D. L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S. I., Gibson-Brown, J. J., Cebra-Thomas, J., Bollag, R. J., Silver, L. M. and Papaioannou, V. E. (1996). Expression of the T-box family genes, Tbx1-Tbx5, during early mouse development. Dev. Dyn. 206, 379-390.[Medline]
Chen, J. N., van Bebber, F., Goldstein, A. M., Serluca, F. C., Jackson, D., Childs, S., Serbedzija, G. N., Warren, K. S., Mably, J. D., Garrity, D. M. et al. (2001). Genetic steps to organ laterality in zebrafish. Comp. Funct. Genomics 2, 60-68.
Chen, J. N., van Eeden, F. J., Warren, K. S., Chin, A., Nusslein-Volhard, C., Haffter, P. and Fishman, M. C. (1997). Left-right pattern of cardiac BMP4 may drive asymmetry of the heart in zebrafish. Development 124, 4373-4382.
Childs, S., Weinstein, B. M., Mohideen, M. A., Donohue, S., Bonkovsky, H. and Fishman, M. C. (2000). Zebrafish dracula encodes ferrochelatase and its mutation provides a model for erythropoietic protoporphyria. Curr. Biol. 10, 1001-1004.[Medline]
Christoffels, V. M., Habets, P. E., Franco, D., Campione, M., de Jong, F., Lamers, W. H., Bao, Z. Z., Palmer, S., Biben, C., Harvey, R. P. et al. (2000). Chamber formation and morphogenesis in the developing mammalian heart. Dev. Biol. 223, 266-278.[Medline]
Dixon, J. W., Costa, T. and Teshima, I. E. (1993). Mosaicism for duplication 12q (12q13q24.2) in a dysmorphic male infant. J. Med. Genet. 30, 70-72.[Abstract]
Ekker, S. C. and Larson, J. D. (2001). Morphant technology in model developmental systems. Genesis 30, 89-93.[Medline]
Geisler, R., Rauch, G. J., Baier, H., van Bebber, F., Brobeta, L., Dekens, M. P., Finger, K., Fricke, C., Gates, M. A., Geiger, H. et al. (1999). A radiation hybrid map of the zebrafish genome. Nat. Genet. 23, 86-89.[Medline]
Ghosh, T. K., Packham, E. A., Bonser, A. J., Robinson, T. E., Cross, S. J. and Brook, J. D. (2001). Characterization of the TBX5 binding site and analysis of mutations that cause Holt-Oram syndrome. Hum. Mol. Genet. 10, 1983-1994.
Gibson-Brown, J. J., Agulnik, S. I., Silver, L. M., Niswander, L. and Papaioannou, V. E. (1998). Involvement of T-box genes Tbx2-Tbx5 in vertebrate limb specification and development. Development 125, 2499-2509.
Grandel, H. and Schulte-Merker, S. (1998). The development of the paired fins in the zebrafish (Danio rerio). Mech. Dev. 79, 99-120.[Medline]
Gurdon, J. B. and Bourillot, P. Y. (2001). Morphogen gradient interpretation. Nature 413, 797-803.[Medline]
Hatcher, C. J. and Basson, C. T. (2001). Getting the T-box dose right. Nat. Med. 7, 1185-1186.[Medline]
Hatcher, C. J., Goldstein, M. M., Mah, C. S., Delia, C. S. and Basson, C. T. (2000a). Identification and localization of TBX5 transcription factor during human cardiac morphogenesis. Dev. Dyn. 219, 90-95.[Medline]
Hatcher, C. J., Kim, M. S. and Basson, C. T. (2000b). Atrial form and function: lessons from human molecular genetics. Trends Cardiovasc. Med. 10, 93-101.[Medline]
Heasman, J. (2002). Morpholino oligos: making sense of antisense? Dev. Biol. 243, 209-214.[Medline]
Herrmann, B. G. (1991). Expression pattern of the Brachyury gene in whole-mount TWis/TWis mutant embryos. Development 113, 913-917.[Abstract]
Hiroi, Y., Kudoh, S., Monzen, K., Ikeda, Y., Yazaki, Y., Nagai, R. and Komuro, I. (2001). Tbx5 associates with Nkx2-5 and synergistically promotes cardiomyocyte differentiation. Nat. Genet. 28, 276-280.[Medline]
Horb, M. E. and Thomsen, G. H. (1999). Tbx5 is essential for heart development. Development 126, 1739-1751.
Hutson, L. D. and Chien, C. B. (2002). Pathfinding and error correction by retinal axons: the role of astray/robo2. Neuron 33, 205-217.[Medline]
Imai, Y. and Talbot, W. S. (2001). Morpholino phenocopies of the bmp2b/swirl and bmp7/snailhouse mutations. Genesis 30, 160-163.[Medline]
Isaac, A., Rodriguez-Esteban, C., Ryan, A., Altabef, M., Tsukui, T., Patel, K., Tickle, C. and Izpisua-Belmonte, J. C. (1998). Tbx genes and limb identity in chick embryo development. Development 125, 1867-1875.
Kawakami, Y., Capdevila, J., Buscher, D., Itoh, T., Rodriguez Esteban, C. and Izpisua Belmonte, J. C. (2001). WNT signals control FGF-dependent limb initiation and AER induction in the chick embryo. Cell 104, 891-900.[Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310.[Medline]
Knapik, E. W., Goodman, A., Ekker, M., Chevrette, M., Delgado, J., Neuhauss, S., Shimoda, N., Driever, W., Fishman, M. C. and Jacob, H. J. (1998). A microsatellite genetic linkage map for zebrafish (Danio rerio). Nat. Genet. 18, 338-343.[Medline]
Krauss, S., Concordet, J. P. and Ingham, P. W. (1993). A functionally conserved homolog of the Drosophila segment polarity gene hh is expressed in tissues with polarizing activity in zebrafish embryos. Cell 75, 1431-1444.[Medline]
Kupperman, E., An, S., Osborne, N., Waldron, S. and Stainier, D. Y. (2000). A sphingosine-1-phosphate receptor regulates cell migration during vertebrate heart development. Nature 406, 192-195.[Medline]
Li, Q. Y., Newbury-Ecob, R. A., Terrett, J. A., Wilson, D. I., Curtis, A. R., Yi, C. H., Gebuhr, T., Bullen, P. J., Robson, S. C., Strachan, T. et al. (1997). Holt-Oram syndrome is caused by mutations in TBX5, a member of the Brachyury (T) gene family. Nat. Genet. 15, 21-29.[Medline]
Liao, E. C., Trede, N. S., Ransom, D., Zapata, A., Kieran, M. and Zon, L. I. (2002). Non-cell autonomous requirement for the bloodless gene in primitive hematopoiesis of zebrafish. Development 129, 649-659.
Liberatore, C. M., Searcy-Schrick, R. D. and Yutzey, K. E. (2000). Ventricular expression of tbx5 inhibits normal heart chamber development. Dev. Biol. 223, 169-180.[Medline]
Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et al. (2001). Tbx1 haploinsufficieny in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410, 97-101.[Medline]
Logan, M., Simon, H. G. and Tabin, C. (1998). Differential regulation of T-box and homeobox transcription factors suggests roles in controlling chick limb-type identity. Development 125, 2825-2835.
Logan, M. and Tabin, C. J. (1999). Role of Pitx1 upstream of Tbx4 in specification of hindlimb identity. Science 283, 1736-1739.
Lyons, S. E., Lawson, N. D., Lei, L., Bennett, P. E., Weinstein, B. M. and Liu, P. P. (2002). A nonsense mutation in zebrafish gata1 causes the bloodless phenotype in vlad tepes. Proc. Natl. Acad. Sci. USA 99, 5454-5459.
Malicki, J. J., Pujic, Z., Thisse, C., Thisse, B. and Wei, X. (2002). Forward and reverse genetic approaches to the analysis of eye development in zebrafish. Vision Res. 42, 527-533.[Medline]
Martinez-Barbera, J. P., Toresson, H., Da Rocha, S. and Krauss, S. (1997). Cloning and expression of three members of the zebrafish Bmp family: Bmp2a, Bmp2b and Bmp4. Gene 198, 53-59.[Medline]
McCorquodale, M. M., Rolf, J., Ruppert, E. S., Kurczynski, T. W. and Kolacki, P. (1986). Duplication (12q) syndrome in female cousins, resulting from maternal (11;12) (p15.5;q24.2) translocations. Am. J. Med. Genet. 24, 613-622.[Medline]
Melnyk, A. R., Weiss, L., Van Dyke, D. L. and Jarvi, P. (1981). Malformation syndrome of duplication 12q24.1 leads to qter. Am. J. Med. Genet. 10, 357-365.[Medline]
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al. (2001). TBX1 is responsible for cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell 104, 619-629.[Medline]
Michelmore, R. W., Paran, I. and Kesseli, R. V. (1991). Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA 88, 9828-9832.[Abstract]
Min, H., Danilenko, D. M., Scully, S. A., Bolon, B., Ring, B. D., Tarpley, J. E., DeRose, M. and Simonet, W. S. (1998). Fgf-10 is required for both limb and lung development and exhibits striking functional similarity to Drosophila branchless. Genes Dev. 12, 3156-3161.
Mowbray, C., Hammerschmidt, M. and Whitfield, T. T. (2001). Expression of BMP signalling pathway members in the developing zebrafish inner ear and lateral line. Mech. Dev. 108, 179-184.[Medline]
Murray, J. C. (2001). Time for T. Nat. Genet. 29, 107-109.[Medline]
Nagy, E. and Maquat, L. E. (1998). A rule for termination-codon position within intron-containing genes: when nonsense affects RNA abundance. Trends Biochem. Sci. 23, 198-199.[Medline]
Neumann, C. J., Grandel, H., Gaffield, W., Schulte-Merker, S. and Nusslein-Volhard, C. (1999). Transient establishment of anteroposterior polarity in the zebrafish pectoral fin bud in the absence of sonic hedgehog activity. Development 126, 4817-4826.
Newbury-Ecob, R. A., Leanage, R., Raeburn, J. A. and Young, I. D. (1996). Holt-Oram syndrome: a clinical genetic study. J. Med. Genet. 33, 300-307.[Abstract]
Ohuchi, H., Takeuchi, J., Yoshioka, H., Ishimaru, Y., Ogura, K., Takahashi, N., Ogura, T. and Noji, S. (1998). Correlation of wing-leg identity in ectopic FGF-induced chimeric limbs with the differential expression of chick Tbx5 and Tbx4. Development 125, 51-60.
Popperl, H., Rikhof, H., Chang, H., Haffter, P., Kimmel, C. B. and Moens, C. B. (2000). lazarus is a novel pbx gene that globally mediates hox gene function in zebrafish. Mol. Cell 6, 255-267.[Medline]
Rodriguez-Esteban, C., Tsukui, T., Yonei, S., Magallon, J., Tamura, K. and Izpisua Belmonte, J. C. (1999). The T-box genes Tbx4 and Tbx5 regulate limb outgrowth and identity. Nature 398, 814-818.[Medline]
Rottbauer, W., Baker, K., Wo, Z. G., Mohideen, M. A., Cantiello, H. F. and Fishman, M. C. (2001). Growth and function of the embryonic heart depend upon the cardiac-specific L-type calcium channel alpha1 subunit. Dev. Cell 1, 265-275.[Medline]
Ruvinsky, I., Oates, A. C., Silver, L. M. and Ho, R. K. (2000). The evolution of paired appendages in vertebrates: T-box genes in the zebrafish. Dev. Genes Evol. 210, 82-91.[Medline]
Schilling, T. F., Walker, C. and Kimmel, C. B. (1996). The chinless mutation and neural crest cell interactions in zebrafish jaw development. Development 122, 1417-1426.
Sehnert, A. J., Huq, A., Weinstein, B. M., Walker, C., Fishman, M. and Stainier, D. Y. (2002). Cardiac troponin T is essential in sarcomere assembly and cardiac contractility. Nat. Genet. 31, 106-110.[Medline]
Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato, T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N. et al. (1999). Fgf10 is essential for limb and lung formation. Nat. Genet. 21, 138-141.[Medline]
Serbedzija, G. N., Chen, J. N. and Fishman, M. C. (1998). Regulation in the heart field of zebrafish. Development 125, 1095-1101.
Serluca, F. C., Drummond, I. A. and Fishman, M. C. (2002). Endothelial signaling in kidney morphogenesis. A role for hemodynamic forces. Curr. Biol. 12, 492-497.[Medline]
Simon, H. (1999). T-box genes and the formation of vertebrate forelimb- and hindlimb specific pattern. Cell Tissue Res. 296, 57-66.[Medline]
Smith, J. (1999). T-box genes: what they do and how they do it. Trends Genet. 15, 154-158.[Medline]
Sordino, P., van der Hoeven, F. and Duboule, D. (1995). Hox gene expression in teleost fins and the origin of vertebrate digits. Nature 375, 678-681.[Medline]
Stainier, D. Y. and Fishman, M. C. (1992). Patterning the zebrafish heart tube: acquisition of anteroposterior polarity. Dev. Biol. 153, 91-101.[Medline]
Sun, Z. and Hopkins, N. (2001). vhnf1, the MODY5 and familial GCKD-associated gene, regulates regional specification of the zebrafish gut, pronephros, and hindbrain. Genes Dev. 15, 3217-3229.
Tada, M. and Smith, J. C. (2001). T-targets: clues to understanding the functions of T-box proteins. Dev. Growth Differ. 43, 1-11.[Medline]
Takeuchi, J. K., Koshiba-Takeuchi, K., Matsumoto, K., Vogel-Hopker, A., Naitoh-Matsuo, M., Ogura, K., Takahashi, N., Yasuda, K. and Ogura, T. (1999). Tbx5 and Tbx4 genes determine the wing/leg identity of limb buds. Nature 398, 810-814.[Medline]
Tamura, K., Kuraishi, R., Saito, D., Masaki, H., Ide, H. and Yonei-Tamura, S. (2001). Evolutionary aspects of positioning and identification of vertebrate limbs. J. Anat. 199, 195-204.[Medline]
Tamura, K., Yonei-Tamura, S. and Belmonte, J. C. (1999). Differential expression of Tbx4 and Tbx5 in zebrafish fin buds. Mech. Dev. 87, 181-184.[Medline]
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos. Development 119, 1203-1215.
van Eeden, F. J., Granato, M., Schach, U., Brand, M., Furutani-Seiki, M., Haffter, P., Hammerschmidt, M., Heisenberg, C. P., Jiang, Y. J., Kane, D. A. et al. (1996). Genetic analysis of fin formation in the zebrafish, Danio rerio. Development 123, 255-262.
Veitia, R. A. (2002). Exploring the etiology of haploinsufficiency. BioEssays 24, 175-184.[Medline]
Vihtelic, T. S. and Hyde, D. R. (2002). Zebrafish mutagenesis yields eye morphological mutants with retinal and lens defects. Vision Res. 42, 535-540.[Medline]
Walsh, E. C. and Stainier, D. Y. (2001). UDP-glucose dehydrogenase required for cardiac valve formation in zebrafish. Science 293, 1670-1673.
Warren, K. S., Baker, K. and Fishman, M. C. (2001). The slow mo mutation reduces pacemaker current and heart rate in adult zebrafish. Am. J. Physiol. Heart Circ. Physiol. 281, H1711-1719.
Xu, X., Meiler, S. E., Zhong, T. P., Mohideen, M., Crossley, D. A., Burggren, W. W. and Fishman, M. C. (2002). Cardiomyopathy in zebrafish due to mutation in an alternatively spliced exon of titin. Nat. Genet. 30, 205-209.[Medline]
Xu, X., Weinstein, M., Li, C., Naski, M., Cohen, R. I., Ornitz, D. M., Leder, P. and Deng, C. (1998). Fibroblast growth factor receptor 2 (FGFR2)-mediated reciprocal regulation loop between FGF8 and FGF10 is essential for limb induction. Development 125, 753-765.
Yelon, D., Horne, S. A. and Stainier, D. Y. (1999). Restricted expression of cardiac myosin genes reveals regulated aspects of heart tube assembly in zebrafish. Dev. Biol. 214, 23-37.[Medline]
Yelon, D. and Stainier, D. Y. (1999). Patterning during organogenesis: genetic analysis of cardiac chamber formation. Semin. Cell Dev. Biol. 10, 93-98.[Medline]
Yelon, D., Ticho, B., Halpern, M. E., Ruvinsky, I., Ho, R. K., Silver, L. M. and Stainier, D. Y. (2000). The bHLH transcription factor Hand2 plays parallel roles in zebrafish heart and pectoral fin development. Development 127, 2573-2582.