1 Laboratory of Molecular Genetics, NICHD, NIH, Bethesda, MD, 20892, USA
2 Institut für Entwicklungsbiologie, Universität zu Köln, 50923 Cologne, Germany
*Author for correspondence (e-mail: bw96w{at}nih.gov)
Accepted July 5, 2001
![]() |
SUMMARY |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Movies available on-line
Key words: Artery, Notch, Vein, Zebrafish
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
A number of signaling pathways have known roles in cell fate determination, including the Notch pathway. Notch is a large transmembrane receptor that is important in a wide array of developmental contexts for specifying cell populations with different fates and for defining the boundaries between them (Irvine, 1999; Muskavitch, 1994). In vertebrates, Notch signaling is required for normal neurogenesis, somite formation and lymphoid cell development (Chitnis et al., 1995; Conlon et al., 1995; Dornseifer et al., 1997; Ellisen et al., 1991; Pui et al., 1999; Takke et al., 1999). A variety of evidence suggests that Notch has an important role during blood vessel development. In the mouse, Notch1, 2 and 4 are expressed within endothelial cells (Del Amo et al., 1992; Uyttendaele et al., 1996; Zimrin et al., 1996). Targeted disruption of Notch4 shows that it is dispensable for vascular development (Krebs et al., 2000), while expression of an activated form of Notch4 within the endothelium disrupts normal vascular development (Uyttendaele et al., 2001) and mice lacking Notch1 display defects in angiogenic remodeling (Krebs et al., 2000). There is also evidence of a role for Notch signaling in vessel homeostasis. CADASIL (Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy), a human disease characterized by early adult onset stroke and dementia, is caused by mutations in Notch3 (Joutel et al., 1996) and its etiology has been ascribed to a vascular defect (Salloway and Hong, 1998).
Notch ligands are also expressed within the endothelium and are required for proper vessel development. Jagged1 is expressed in the developing endothelium and targeted disruption of the Jagged1 gene in mice results in defects in head and yolk sac angiogenesis, although the formation of the major vessels appears normal (Xue et al., 1999). In zebrafish, deltaC is expressed in migrating lateral mesodermal vascular progenitors, and at later stages its expression is restricted to the dorsal aorta (DA) (Smithers et al., 2000), while a recently described novel Notch ligand, Dll4, is expressed in a similar pattern in mouse (Shutter et al., 2000).
Potential downstream targets of Notch signaling have also been identified within the developing vascular system. The recently identified HRT proteins are hairy-related basic helix-loop-helix (bHLH) transcription factors that display vascular-specific expression in mice and humans (Chin et al., 2000; Nakagawa et al., 1999). Recently, mHRT2 was shown to be a direct target of Notch signaling in in vitro cultured cells (Nakagawa et al., 2000). A mutation in the zebrafish homolog of HRT2 was found to be responsible for the gridlock (grl) mutation (Zhong et al., 2000), which causes a localized vascular patterning defect within the DA (Weinstein et al., 1995). Interestingly, grl expression becomes restricted to the DA during blood vessel development (Zhong et al., 2000), suggesting a possible role in arterial-venous differentiation.
We provide evidence that Notch signaling is important for arterial-venous differentiation of blood vessels. We find that zebrafish notch3 is expressed in the DA, but not the posterior cardinal vein (PCV), during embryonic vascular development. Embryos lacking Notch activity fail to induce arterial-specific ephrinB2 (efnb2a) expression, and exhibit ectopic expression of venous markers within the DA. Furthermore, we show that activation of the Notch signaling pathway, either throughout the embryo or targeted to the endothelium, causes loss of venous-specific marker expression. Finally, perturbation of Notch signaling causes defects in vascular morphology similar to those observed in mice lacking ephrin-B2 or EphB4, including abnormal remodeling of the major trunk vessels and aberrant intersomitic vessel projection. Taken together, our results suggest that Notch signaling is required within the vasculature for proper arterial-venous differentiation and repression of venous cell fate.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Plasmids and probes
Plasmids encoding zebrafish tie1and flt4 were kindly provided by Leonard Zon (Childrens Hospital, Boston). A plasmid for zebrafish ephrinB2 was kindly provided by Michael Tsang (NICHD, Bethesda). A plasmid encoding tbx20 was graciously provided by Dae Gwon Ahm and Robert Ho (Princeton University, Princeton). Plasmid pBS 30D1.C, containing a fragment of zebrafish deltaC was provided by Julian Lewis (Imperial Cancer Research Fund, London). A plasmid containing the coding sequence of rtk5 was kindly provided by Julie Cooke (University College, London). A plasmid containing a fragment of the extracellular domain of notch3 (C.-H. K., unpublished data) was linearized with NcoI and transcribed with SP6.
The pCSGreen plasmid was constructed by digesting pEGFP-C1 (Clontech, Palo Alto, CA) with NheI and ligating to oligonucleotide linkers (5'-CTAGGCTTGATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAG and 5'-CTAGCTGCAAAAAGAACAAGTAGCTTGTATTCTATAGTGTCACCTAAATCAAGC) containing the SP6 promoter and 5' leader sequence found in pCS2+ (Rupp et al., 1994). An enhanced green fluorescent protein (EGFP)/XSu(H) DBM fusion construct was made by partially digesting pCS2+XSu(H)DBM (provided by C. Kintner, Salk Institute, San Diego) with EcoRI and XhoI. This fragment was cloned into pCSGreen digested with EcoRI and SalI to yield pCSGSuDN. Plasmids were linearized with MluI and mRNA was synthesized using the mMessage mMaker kit (Ambion, Inc., Austin, TX).
An XbaI fragment of the zebrafish fli1 promoter that includes 1 kb upstream of exon 1 and 6 kb of intron 1 was subcloned into pBluescript from a PAC obtained by hybridization to the 5' end of the fli1 cDNA (Brown et al., 2000). An oligonucleotide linker containing NheI, SrfI, and AscI sites was cloned into an MluI site upstream of the fli1 start codon to give pBS119d10L. A fragment encoding the intracellular domain (ICD) of zebrafish Notch3 was cloned in frame with the myc epitope in pCS3+MT. The cassette containing the myc-tagged Notch3 ICD and the polyA signal sequences was removed from pCS3 MTN3ICD by digesting with DraI and NotI, filled in with Klenow and cloned into pBS119d10L digested with SrfI to give pflimTN3ICD.
In situ hybridization and immunostaining
Whole-mount in situ hybridization was performed as described previously (Hauptmann and Gerster, 1994). Immunostaining was performed as described previously (Westerfield, 1993) using monoclonal antibody 9E10 (Berkeley Antibody Co., Richmond, CA) that recognizes the myc epitope.
Videomicroscopy, microangiography and histological analysis
Embryos were raised at 28.5°C in 30% Danieau buffer containing 0.003% 1-phenyl-2-thiourea to prevent pigmentation. For videomicroscopy and microangiography individual embryos were anesthetized in 0.02% tricaine (Sigma, St. Louis, MO) and mounted in 5% methyl cellulose dissolved in 30% Danieau buffer. Videomicroscopic images were collected directly on videotape using a Zeiss Axioplan microscope equipped with an MTI-DAGE SIT-68 camera. Video clips were assembled, edited, and compressed into Quicktime movies using Adobe Premiere 5.1. Microangiography was performed as described (Weinstein et al., 1995). For histological analysis, embryos were embedded in JB4 plastic resin according to described protocols (Westerfield, 1993). Embedded embryos were sectioned using a Leica microtome and sections were mounted on glass slides. Sections were stained with Hematoxylin and Eosin, coverslipped using Permount, and photographed under water immersion at 630x magnification using a Zeiss Axioplan microscope.
Microinjection
Capped mRNA was injected into 1-cell stage wild-type embryos as described (Xu, 1999). Expression was monitored at shield stage using a Leica MZFLII dissection microscope equipped for epifluorescence with an FITC filter set. Embryos not exhibiting EGFP expression at this point were removed and not included in later analyses. For DNA injection, plasmids were linearized by digestion with NotI followed by phenol:chloroform extraction and ethanol precipitation. Approximately 100-200 pg of linearized DNA was injected into early 1-cell stage embryos.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
|
Embryos mutant for mibta52b also exhibited morphologic characteristics similar to embryos injected with EGFPSuDN. While wild-type sibling embryos were normal (Fig. 4E), mibta52b mutant embryos exhibited trunk curvature and lack of posterior trunk pigmentation (Fig. 4F) as has been described previously (Jiang et al., 1996).
Activation of the Notch pathway suppresses venous cell fate
Determining the role of Notch during organogenesis is difficult because of the wide range of cell types responsive to Notch signaling throughout development (Artavanis-Tsakonas et al., 1999). Injection of mRNA encoding an activated form of Notch3 into zebrafish embryos results in defects in somitogenesis and notochord formation as well as the absence of anterior structures (data not shown). Thus, mRNA injection could result in indirect effects on arterial-venous differentiation. To eliminate the early effects of Notch activation, we utilized a system that allows for temporal control of a transgene of interest by placing the yeast transactivator GAL4 downstream of the zebrafish heat shock promoter. Adult hsp70:Gal4 zebrafish (Halloran et al., 2000; Scheer et al., 2001) were crossed with UAS:notch1a-intra fish (Scheer and Campos-Ortega, 1999) and embryos derived from these crosses were heat shocked and processed as described in Materials and Methods. Since the parental lines are hemizygous for each transgene, only one quarter of the embryos will inherit both components of the GAL4-UAS system. Therefore, embryos were stained with an anti-myc antibody following in situ hybridization to confirm expression of Notch1a-intra.
To determine the effect of activated Notch on artery specification, embryos were stained for the DA-specific markers ephrinB2, notch3, deltaC and grl. Surprisingly, there was no observable difference in heat shocked embryos with respect to the expression of any of these arterial markers, including grl, within the vasculature (Fig. 5A,B and data not shown). Earlier induction at the 15-somite stage also failed to result in ectopic expression of any artery markers (data not shown).
|
To confirm that decreased flt4 expression was due to endothelial cell autonomous activation of the Notch signaling pathway, we utilized the zebrafish fli1 promoter to drive expression of a myc-tagged Notch3 ICD (MTN3 ICD). We have isolated a 7 kb fragment of the fli1 promoter that is sufficient to drive transgene expression within the cells of the head and trunk vasculature (unpublished observation). One-cell stage embryos were injected with linearized pfliMTN3ICD and assayed for flt4 and MTN3 ICD expression. An example of an embryo injected with fliMTN3 ICD is seen in Fig. 5G and H. On the left side of the head at approximately the 30-somite stage the MCeV has sprouted to its dorsal-most point and expresses flt4 in the absence of ectopic MTN3 ICD (confirmed by the absence of myc-positive nuclei; Fig. 5G). However, the MCeV on the opposite side of the embryo expresses MTN3 ICD as indicated by a myc-positive nucleus (Fig. 5H, blue arrowhead) and flt4 transcript is undetectable in this cell (Fig. 5H).
Consequences of defective Notch signaling on vascular morphogenesis
Since we found that the Notch pathway affects the identity of blood vessels during development, we determined the consequences of these effects on vascular morphogenesis. While wild-type siblings exhibited normal circulation at 60 hpf (Fig. 6A), cranial hemorrhage (Fig. 6B) was evident in mibta52b mutant embryos (80 out of 84 mutant embryos in 3 different clutches). Additionally, more than half of the homozygous mibta52b mutant embryos completely lacked circulation by 48 hpf (50 out of 84 in 3 clutches) and most of those that retained circulation exhibited arterial-venous (A-V) shunts (27 out of 34 mutant embryos with shunts from three clutches). Embryos injected with 800 pg EGFPSuDN also exhibited A-V shunts (47 out 167 in three experiments), while all embryos injected with a comparable amount of EGFP were normal. The location and behavior of arterial-venous shunts were similar in EGFPSuDN-injected embryos (data not shown) and embryos mutant for mibta52b (see below).
|
During videomicroscopic analysis of mibta52b embryos, we also noted improper blood flow patterns in the region of the intersomitic vessels (ISVs). To further investigate the nature of these defects we performed confocal microangiography (Weinstein et al., 1995) on mutant and wild-type sibling embryos at 55 hpf, to directly visualize the patterns of patent vessels. In wild-type embryos, ISVs are completely formed by 55 hpf. These vessels appear regularly at successive vertical myoseptal boundaries, joining together above the neural tube as paired dorsal longitudinal anastomotic vessels (Fig. 6I). No patent vessels are ever observed within somitic tissue in wild-type embryos at this stage. Although the initial sprouting of the ISVs appears normal in mibta52b embryos (data not shown), ectopic sprouts penetrating the somitic tissue are apparent at 55 hpf (Fig. 6J, white arrows in Fig. 6K).
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We determined the effect on vascular development of both loss and gain of Notch activity during embryonic development. We are able to effectively inhibit the Notch pathway using a dominant negative form of Su(H) that fails to bind DNA (Wettstein et al., 1997). In embryos expressing EGFPSuDN we find decreased arterial expression of both ephrin-B2 and notch3. In addition, EGFPSuDN-injected embryos display circulatory shunts between the DA and PCV within the trunk, a phenotype that has been associated with decreased ephrinB2 expression in mice lacking ACRVL-1 (Urness et al., 2000). We have noted identical, yet more severe phenotypes in embryos mutant for the mibta52b locus. Although the identity of the mib gene is unknown, several lines of evidence suggest that it is an important component of the Notch signaling pathway (Jiang et al., 1996). Mib mutant embryos display a severe neurogenic phenotype similar to that described in Drosophila mutants lacking components of the Notch signaling pathway (Jiang et al., 1996; Xu et al., 1990). In addition, zebrafish embryos with a mutation in the gene encoding the Notch ligand deltaA exhibit many of the phenotypes described in mib mutant embryos (Appel et al., 1999; Riley et al., 1999). Our results provide further evidence supporting the importance of mib in Notch signaling, by demonstrating that wild-type embryos expressing EGFPSuDN exhibit many of the molecular and morphologic vascular defects observed in mibta52b mutants. Embryos that are mutant for mibta52b display loss of ephrinB2 and notch3 expression within the DA and exhibit circulatory shunts similar to that seen in wild-type embryos injected with mRNA encoding EGFPSuDN. We have also noted aberrant intersomitic vessel projection and defective remodeling of the major vessels in mibta52b mutant embryos, phenotypes that have been noted in mouse embryos lacking ephrin-B2 (Adams et al., 1999; Gerety et al., 1999; Wang et al., 1998) or EphB4, as well as Xenopus embryos injected with a dominant negative form of EphB4 (Helbling et al., 2000). Although embryos lacking Notch activity display defects in arterial differentiation, expression of other artery-specific markers, such as tbx20 and grl, is not affected in mutant embryos. The proper expression of these markers as well as endothelial markers such as flk1, fli1 and tie1 in mibta52b mutant embryos (unpublished observations) indicates the presence of endothelial cells at the position of the DA. These results suggest that Notch signaling is required for a specific step during arterial differentiation and is dispensable for the initial positioning of the major trunk vessels.
In addition to defects in arterial differentiation, we find that the venous markers flt4 and rtk5 become ectopically expressed within the DA in mibta52b mutant embryos suggesting that a major role of Notch signaling is to repress the venous fate within the developing arterial primordium. This model is consistent with the expression patterns of both notch3 and flt4. Flt4 is initially expressed in angioblasts beginning at the 12-somite stage (Thompson et al., 1998), at which time notch3 is not apparent in these cells (unpublished observation). As notch3 expression becomes detectable within the DA at the 18-somite stage, flt4 expression decreases in all presumptive arterial vessels and is restricted to veins by the 25-somite stage. The loss of rtk5 expression within the PCV of mibta52b mutant embryos is possibly due to the absence of a positive autoregulatory loop that has been proposed to be responsible for EphB4 expression in the mouse vasculature (Gerety et al., 1999) as mice lacking EphB4 also fail to express a tau-lacZ transgene from the EphB4 locus. Thus, the loss of ephrinB2 expression in mibta52b mutant embryos likely results in the failure to activate the Rtk5 receptor and maintain its own expression within venous vessels.
We find further support for the role of Notch signaling in repressing venous cell fate from the ectopic expression of an activated form of Notch during embryonic development. Activation of Notch signaling in hsp70:Gal4;UAS:notch1a-intra embryos at the 18-somite stage leads to a decrease in flt4 expression in all venous vessels by the 30-somite stage. Expression of tie1 is unaffected in hsp70:Gal4;UAS:notch1a-intra heat-shocked embryos, indicating an effect on flt4 expression rather than the loss of cells within venous vessels. Despite the effects on venous cell fate, activation of the Notch pathway throughout the embryo failed to induce an arterial cell fate ectopically, suggesting that Notch signaling may cooperate with other pathways to mediate arterial differentiation.
The observation that notch3 is expressed within the DA suggests that the Notch pathway is acting at the level of the endothelial cell itself. We confirmed this by expressing Notch3 ICD using the zebrafish fli1 promoter. We find that cells within venous vessels that express a myc-tagged form of Notch3 ICD from the fli1 promoter failed to properly express flt4, confirming a cell-autonomous effect on endothelial cell identity. Thus, notch3 is functioning within the endothelial cells of the DA to repress a venous cell fate
During neurogenesis, activation of the Notch pathway leads to expression of bHLH factors, such as the hairy-like genes of the Enhancer of split complex, that repress the action of proneural genes and inhibit a neural fate (Artavanis-Tsakonas et al., 1999). Interestingly, grl is a hairy-like factor and its mouse homolog, HRT2, has been shown to be a transcriptional repressor that is downstream of Notch signaling in vitro (Nakagawa et al., 2000). Thus, grl would seem to be a strong candidate for a downstream effector of venous repression. However, grl does not appear to be downregulated in EGFPSuDN-injected embryos or mibta52b mutant embryos as would be expected for a Notch target gene. Furthermore, activation of Notch signaling throughout the embryo fails to cause ectopic expression of grl within venous vessels, although flt4 is reduced within these vessels under the same conditions. We have observed increased grl expression in the forebrain and optic tectum and ectopic expression within the lens following heat shock (unpublished ovservation) indicating that, in these tissues, grl can be downstream of Notch signaling in concordance with in vitro studies (Nakagawa et al., 2000). Although grl is clearly important for development of the DA, our data suggest that it does not function by mediating Notch-induced repression of venous fate. Consistent with these observations, expression of flt4, as well as ephrinB2, is unaffected in grlm145 mutant embryos (unpublished observation).
Until recently, the processes by which arterial and venous blood vessels acquire their identity were generally attributed to physiologic cues, but it is now apparent that genetic factors underlie this process. We propose a model in which the Notch pathway acts at a specific step in arterial-venous differentiation to repress a venous cell fate program within the presumptive DA. Notch activity seems to be dispensable for earlier steps of arterial-venous differentiation such as the positioning of the DA and PCV primordia, suggesting that the process of defining arteries and veins is a complex cascade of differentiation governed by signaling pathways that have yet to be identified.
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Adams, R. H., Wilkinson, G. A., Weiss, C., Diella, F., Gale, N. W., Deutsch, U., Risau, W. and Klein, R. (1999). Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis. Genes Dev. 13, 295-306.
Ahn, D. G., Ruvinsky, I., Oates, A. C., Silver, L. M. and Ho, R. K. (2000). tbx20, a new vertebrate T-box gene expressed in the cranial motor neurons and developing cardiovascular structures in zebrafish. Mech. Dev. 95, 253-258.[Medline]
Appel, B., Fritz, A., Westerfield, M., Grunwald, D. J., Eisen, J. S. and Riley, B. B. (1999). Delta-mediated specification of midline cell fates in zebrafish embryos. Curr. Biol. 9, 247-256.[Medline]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999). Notch signaling: cell fate control and signal integration in development. Science 284, 770-776.
Brown, L. A., Rodaway, A. R., Schilling, T. F., Jowett, T., Ingham, P. W., Patient, R. K. and Sharrocks, A. D. (2000). Insights into early vasculogenesis revealed by expression of the ETS- domain transcription factor Fli-1 in wild-type and mutant zebrafish embryos. Mech. Dev. 90, 237-252.[Medline]
Chin, M. T., Maemura, K., Fukumoto, S., Jain, M. K., Layne, M. D., Watanabe, M., Hsieh, C. M. and Lee, M. E. (2000). Cardiovascular basic helix loop helix factor 1, a novel transcriptional repressor expressed preferentially in the developing and adult cardiovascular system. J. Biol. Chem. 275, 6381-6387.
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and Kintner, C. (1995). Primary neurogenesis in Xenopus embryos regulated by a homologue of the Drosophila neurogenic gene Delta. Nature 375, 761-766.[Medline]
Cleaver, O. and Krieg, P. A. (1998). VEGF mediates angioblast migration during development of the dorsal aorta in Xenopus. Development 125, 3905-3914.
Conlon, R. A., Reaume, A. G. and Rossant, J. (1995). Notch1 is required for the coordinate segmentation of somites. Development 121, 1533-1545.
Cooke, J. E., Xu, Q., Wilson, S. W. and Holder, N. (1997). Characerisation of five novel zebrafish Eph-related receptor tyrosine kinases suggests roles in patterning the neural plate. Dev. Genes Evol. 206, 515-531.
Del Amo, F. F., Smith, D. E., Swiatek, P. J., Gendron-Maguire, M., Greenspan, R. J., McMahon, A. P. and Gridley, T. (1992). Expression pattern of Motch, a mouse homolog of Drosophila Notch, suggests an important role in early postimplantation mouse development. Development 115, 737-744.
Dornseifer, P., Takke, C. and Campos-Ortega, J. A. (1997). Overexpression of a zebrafish homologue of the Drosophila neurogenic gene Delta perturbs differentiation of primary neurons and somite development. Mech. Dev. 63, 159-171.[Medline]
Durbin, L., Brennan, C., Shiomi, K., Cooke, J., Barrios, A., Shanmugalingam, S., Guthrie, B., Lindberg, R. and Holder, N. (1998). Eph signaling is required for segmentation and differentiation of the somites. Genes Dev. 12, 3096-3109.
Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C., Smith, S. D. and Sklar, J. (1991). TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661.[Medline]
Gerety, S. S., Wang, H. U., Chen, Z. F. and Anderson, D. J. (1999). Symmetrical mutant phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in cardiovascular development. Mol. Cell 4, 403-414.[Medline]
Griffin, K. J., Stoller, J., Gibson, M., Chen, S., Yelon, D., Stainier, D. Y. and Kimelman, D. (2000). A conserved role for H15-related T-box transcription factors in zebrafish and Drosophila heart formation. Dev. Biol. 218, 235-247.[Medline]
Halloran, M. C., Sato-Maeda, M., Warren, J. T., Su, F., Lele, Z., Krone, P. H., Kuwada, J. Y. and Shoji, W. (2000). Laser-induced gene expression in specific cells of transgenic zebrafish. Development 127, 1953-1960.
Hauptmann, G. and Gerster, T. (1994). Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 10, 266.[Medline]
Helbling, P. M., Saulnier, D. M. and Brandli, A. W. (2000). The receptor tyrosine kinase EphB4 and ephrin-B ligands restrict angiogenic growth of embryonic veins in Xenopus laevis. Development 127, 269-278.
Irvine, K. D. (1999). Fringe, Notch, and making developmental boundaries. Curr. Opin. Genet. Dev. 9, 434-441.[Medline]
Jiang, Y. J., Brand, M., Heisenberg, C. P., Beuchle, D., Furutani-Seiki, M., Kelsh, R. N., Warga, R. M., Granato, M., Haffter, P., Hammerschmidt, M. et al. (1996). Mutations affecting neurogenesis and brain morphology in the zebrafish, Danio rerio. Development 123, 205-216.
Joutel, A., Corpechot, C., Ducros, A., Vahedi, K., Chabriat, H., Mouton, P., Alamowitch, S., Domenga, V., Cecillion, M., Marechal, E. et al. (1996). Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature 383, 707-710.[Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. K., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203, 253-310.[Medline]
Krebs, L. T., Xue, Y., Norton, C. R., Shutter, J. R., Maguire, M., Sundberg, J. P., Gallahan, D., Closson, V., Kitajewski, J., Callahan, R. et al. (2000). Notch signaling is essential for vascular morphogenesis in mice. Genes Dev. 14, 1343-1352.
Muskavitch, M. A. (1994). Delta-notch signaling and Drosophila cell fate choice. Dev. Biol. 166, 415-430.[Medline]
Nakagawa, O., McFadden, D. G., Nakagawa, M., Yanagisawa, H., Hu, T., Srivastava, D. and Olson, E. N. (2000). Members of the HRT family of basic helix-loop-helix proteins act as transcriptional repressors downstream of notch signaling. Proc. Natl. Acad. Sci. USA 97, 13655-13660.
Nakagawa, O., Nakagawa, M., Richardson, J. A., Olson, E. N. and Srivastava, D. (1999). HRT1, HRT2, and HRT3: a new subclass of bHLH transcription factors marking specific cardiac, somitic, and pharyngeal arch segments. Dev. Biol. 216, 72-84.[Medline]
Pui, J. C., Allman, D., Xu, L., DeRocco, S., Karnell, F. G., Bakkour, S., Lee, J. Y., Kadesch, T., Hardy, R. R., Aster, J. C. et al. (1999). Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11, 299-308.[Medline]
Riley, B. B., Chiang, M., Farmer, L. and Heck, R. (1999). The deltaA gene of zebrafish mediates lateral inhibition of hair cells in the inner ear and is regulated by pax2.1. Development 126, 5669-5678.
Rupp, R. A., Snider, L. and Weintraub, H. (1994). Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev 8, 1311-1323.[Abstract]
Salloway, S. and Hong, J. (1998). CADASIL syndrome: a genetic form of vascular dementia. J. Geriatr. Psychiatry Neurol. 11, 71-77.[Medline]
Scheer, N. and Campos-Ortega, J. A. (1999). Use of the Gal4-UAS technique for targeted gene expression in the zebrafish. Mech. Dev. 80, 153-158.[Medline]
Scheer, N., Groth, A., Hans, S. and Campos-Ortega, J. A. (2001). An instructive function for Notch in promoting gliogenesis in the zebrafish retina. Development 128, 1099-1107.
Shutter, J. R., Scully, S., Fan, W., Richards, W. G., Kitajewski, J., Deblandre, G. A., Kintner, C. R. and Stark, K. L. (2000). Dll4, a novel Notch ligand expressed in arterial endothelium. Genes Dev. 14, 1313-1318.
Smithers, L., Haddon, C., Jiang, Y. and Lewis, J. (2000). Sequence and embryonic expression of deltaC in the zebrafish. Mech. Dev. 90, 119-123.[Medline]
Takke, C., Dornseifer, P., v. Weizsacker, E. and Campos-Ortega, J. A. (1999). her4, a zebrafish homologue of the Drosophila neurogenic gene E(spl), is a target of NOTCH signalling. Development 126, 1811-1821.
Thompson, M. A., Ransom, D. G., Pratt, S. J., MacLennan, H., Kieran, M. W., Detrich, H. W., 3rd, Vail, B., Huber, T. L., Paw, B., Brownlie, A. J. et al. (1998). The cloche and spadetail genes differentially affect hematopoiesis and vasculogenesis. Dev. Biol. 197, 248-269.[Medline]
Urness, L. D., Sorensen, L. K. and Li, D. Y. (2000). Arteriovenous malformations in mice lacking activin receptor-like kinase-1. Nat. Genet. 26, 328-331.[Medline]
Uyttendaele, H., Ho, J., Rossant, J. and Kitajewski, J. (2001). Vascular patterning defects associated with expression of activated Notch4 in embryonic endothelium. Proc. Natl. Acad. Sci. USA 98, 5643-5648.
Uyttendaele, H., Marazzi, G., Wu, G., Yan, Q., Sassoon, D. and Kitajewski, J. (1996). Notch4/int-3, a mammary proto-oncogene, is an endothelial cell-specific mammalian Notch gene. Development 122, 2251-2259.
Wang, H. U., Chen, Z. F. and Anderson, D. J. (1998). Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell 93, 741-753.[Medline]
Weinstein, B. M., Stemple, D. L., Driever, W. and Fishman, M. C. (1995). Gridlock, a localized heritable vascular patterning defect in the zebrafish. Nat. Med. 1, 1143-1147.[Medline]
Westerfield, M. (1993). The Zebrafish Book. Eugene, OR: University of Oregon Press.
Westin, J. and Lardelli, M. (1997). Three novel Notch genes in zebrafish: implications for vertebrate Notch gene evolution and function. Dev. Genes Evol. 207, 51-63.
Wettstein, D. A., Turner, D. L. and Kintner, C. (1997). The Xenopus homolog of Drosophila Suppressor of Hairless mediates Notch signaling during primary neurogenesis. Development 124, 693-702.
Xu, Q. (1999). Microinjection into zebrafish embryos. In Molecular Methods in Developmental Biology. Vol. 127 (ed. M. Guille), pp. 125-132. Totowa, NJ: Humana Press.
Xu, T., Rebay, I., Fleming, R. J., Scottgale, T. N. and Artavanis-Tsakonas, S. (1990). The Notch locus and the genetic circuitry involved in early Drosophila neurogenesis. Genes Dev. 4, 464-475.[Abstract]
Xue, Y., Gao, X., Lindsell, C. E., Norton, C. R., Chang, B., Hicks, C., Gendron-Maguire, M., Rand, E. B., Weinmaster, G. and Gridley, T. (1999). Embryonic lethality and vascular defects in mice lacking the Notch ligand Jagged1. Hum. Mol. Genet. 8, 723-730.
Zhong, T. P., Rosenberg, M., Mohideen, M. A., Weinstein, B. and Fishman, M. C. (2000). gridlock, an HLH gene required for assembly of the aorta in zebrafish. Science 287, 1820-1824.
Zimrin, A. B., Pepper, M. S., McMahon, G. A., Nguyen, F., Montesano, R. and Maciag, T. (1996). An antisense oligonucleotide to the notch ligand jagged enhances fibroblast growth factor-induced angiogenesis in vitro. J. Biol. Chem. 271, 32499-32502.