Departments of 1 Surgery, 2 Medical Ultrasound, 3 Pathology, and 6 Pediatrics, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei; 4 Institute of Toxicology, National Taiwan University College of Medicine, Taipei; 5 Department of Medical Education and Research, Changhua Christian Hospital, Changhua; 7 Department of Life Science and Institute of Zoology, National Taiwan University, Taipei, Taiwan
* Correspondence to: Dr W. J. Chen, Department of Surgery, National Taiwan University Hospital, 7 Chung-Shan South Road, Taipei 100, Taiwan. Tel: +886-2-23634090; Fax: +886-2-23621877; Email: chenwj{at}ccms.ntu.edu.tw
![]() |
Abstract |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Patients and methods: Sixty-eight NBs were investigated by immunohistochemical staining against CRT, and were divided into positive and negative immunostaining groups. Correlations between calreticulin expression, various clinicopathologic and biologic factors, and patient survival were studied. In seven tumor samples, CRT mRNAs and proteins were evaluated with real-time PCR and western blot, respectively, and correlated with immunohistochemical findings.
Results: Among 68 NBs, 32 (47.1%) showed positive CRT expression. Positive CRT immunostaining strongly correlated with differentiated histologies, as well as known favorable prognostic factors such as detected from mass screening, younger age (1 year) at diagnosis and early clinical stages, but inversely correlated with MYCN amplification. KaplanMeier analysis revealed that NB patients with CRT expression did have better survival. Multivariate analysis demonstrated CRT expression to be an independent prognostic factor. Moreover, CRT expression also predicted better survival in patients with advanced-stage NBs, and its absence predicted poorer survival in patients whose tumor had no MYCN amplification. The amount of CRT mRNAs and proteins in NB tumor samples tested correlated well with the immunohistochemical expressions.
Conclusions: CRT expression correlates with the differentiation of NB and predicts favorable survival, thereby suggesting CRT to be a useful indicator for planning treatment of NB.
Key words: calreticulin, immunohistochemistry, neuroblastoma, prognostic factor
![]() |
Introduction |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Calreticulin (CRT) is an endoplasmic reticulum protein with two major functions: molecular chaperoning and regulation of Ca2+ homeostasis [7]. Furthermore, CRT can also modulate cell adhesion, integrin-dependent Ca2+ signaling and steroid-sensitive gene expression outside the endoplasmic reticulum [7
]. Although CRT has many physiologic functions in the cell, its role in pathologic conditions has been studied infrequently. Evidence suggests that CRT is linked to the biology of NB. CRT has been found on the surface of NB cells and is essential for neurite formation when the cells are induced to differentiate [8
, 9
]. In a NB cell line study, Johnson et al. showed that CRT protein levels increased markedly when the cells were induced to differentiate with dibutyryl c-AMP [10
]. CRT has also been found to affect cell susceptibility to apoptosis and to be overexpressed in highly apoptotic regions of the embryo [11
]. In addition, CRT has been shown to be essential for neural development in mice [12
]. These lines of evidence give rise to the intriguing possibility that CRT may affect the differentiation and apoptosis of NB, and thus may have a role in the tumor behavior of this cancer.
In this study, CRT expression in NB tumors was studied by immunohistochemistry and related to clinicopathologic and biologic parameters to evaluate the importance of CRT in NB, and to analyze the prognostic relevance of CRT expression in this tumor. In addition, the mRNA and protein levels of CRT in tumor tissues were also quantified by real-time PCR and western blot, respectively, to compare with the immunohistochemical findings.
![]() |
Materials and methods |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Immunohistochemical staining
CRT expression was assayed using an avidinbiotin complex immunoperoxidase staining technique on archival paraffin-embedded tissue specimens obtained before chemotherapy. The antibody to CRT gene product was affinity-purified, rabbit polyclonal immunoglobulin Ggenerated by synthetic peptide corresponding to the carboxy-terminal 6 amino acids (412417) of CRT (Upstate, New York, NY, USA). Tissue sections (5 µm) of tumors were deparaffinized and rehydrated in a routine manner. After microwave pretreatment, the CRT antibody was then applied at a dilution of 1:150 overnight at 4°C. The N-Histofine Simple Stain MAXPO (Nichirei, Tokyo, Japan) was then applied for 30 min at room temperature. Diaminobenzidine was used for visualization and nuclei were counterstained with hematoxylin. One ganglioneuroma tumor with consistent CRT expression by immunohistochemistry was used as a positive control in each staining. Non-immunized rabbit serum was used as a negative control. Tumors with various differentiating histologies were included in each staining. The immunoreactivity of CRT was assessed by a single pathologist who was blinded to the clinical background of the patients. The immunoreactivity of CRT was recorded as follows: negative indicated staining was absent throughout the specimen, and positive indicated that brownish granular staining was present in cytoplasm of the NB or ganglion cells. To verify the specificity of the CRT antibody, a blocking peptide corresponding to the carboxy-terminal 17 amino acids (401417) (5x of antibody; Santa Cruz, CA) was added along with the CRT antibody when carrying out the positive control staining to see if the immunostaining could be blocked specifically.
Real-time PCR
The mRNAs of CRT in NB tumor tissues were examined by real-time PCR as described previously [18] for comparison with the immunohistochemical expression of CRT. Total RNA from seven tumor samples (three UNBs, two DNBs and two GNBs) was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. After quantifying by O.D., 1 µg of total RNA was reverse-transcribed to cDNA using reverse transcriptase enzyme (NEB, Beverly, MA, USA). Real-time PCR was carried out using the iCycler iQ Real-Time detection system (Bio-Rad, Hercules, CA, USA) with SYBR-Green I (stock solution 10 000x, diluted at 1:25 000) as fluorescent dye enabling real time detection of PCR products according to the manufacturer's protocol. Gene-specific primers were used, and the specificity was tested under normal PCR conditions. Oligonucleotide primers for PCR were designed using Beacon Designer2 software (PREMIER Biosoft International, Palo Alto, CA, USA). The cDNA was subjected to real-time PCR using the primer pairs as follows: forward AAGTTCTACGGTGACGAGGAG, reverse GTCGATGTTCTGCTCATGTTTC for CRT; and forward GTGGTCTCCTCTGACTTCAAC, reverse TCTCTTCCTCTTGTGCTCTTG for glyceraldehyde-3-phosphate-dehydrogenase (GAPDH). Cycling conditions were 95°C for 3 min, followed by 40 cycles of 94°C for 30 s, 62°C for 30 s and 72°C for 60 s. For quantitation, the mRNA of CRT gene was normalized to the mRNA of the internal control gene GAPDH. For each tumor sample, data from three separate experiments were averaged.
Western blot analysis
CRT proteins in NB tumors were also examined by immunoblot analysis to compare with the results obtained by immunohistochemical study. The details of extraction of tumor tissue, electrophoresis and immunoblotting have been described previously [18]. In brief, the tumor tissues were homogenized. Extracts (50 µg of proteins) were subjected to electrophoresis on 10% sodium dodecyl sulfatepolyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was pretreated with 5% skimmed milk and then incubated with the anti-CRT antibody (1:200). The bound antibody was labeled with horseradish peroxidase-conjugated anti-rabbit antibody, and visualized by immersion in a 4-chloro-1-naphthol reagent (4CN Plus, Perkin-Elmer, Boston, MA, USA) as substrate. To test the specificity of anti-CRT antibody used in immunohistochemical study, competition assay was carried out in which the specific blocking peptide (5x of antibody) was added along with the CRT antibody during immunoblotting. Cell lysates from untreated and all-trans retinoic acid-treated NB cell line (Neuro-2A, American Type Culture Collection CCl-131) [19
] were used as positive control for immunoblot analysis of CRT.
Statistics
The statistical analyses were carried out with SPSS 10.0 for Windows software. Associations between pairs of categorical variables were assessed with Pearson's chi-square test. Survival probabilities in various subgroups were estimated using the KaplanMeier method, and analyzed by log-rank tests. The influence of each variable on survival was assessed by the multivariate Cox proportional hazard model. All statistical tests were two-sided and a P value of 0.05 or less was considered to be statistically significant.
![]() |
Results |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
|
|
|
|
|
|
![]() |
Discussion |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Our immunohistochemistry studies showed that the percentage of positive CRT expression was high in NBs of infants and patients in earlier stages of disease, as well as in mass-screened NBs. NB tumors with clinical characteristics of younger age (1 year), early clinical stages, and detected by mass screening have a strong tendency to differentiate or regress spontaneously [1
, 21
]. This evidence indicates that NB tumors with positive CRT expression may be more likely to differentiate or regress spontaneously. In fact, there was a strong correlation between CRT expression and histologic grade of differentiation, yet only CRT expression but not histologic grade of differentiation was demonstrated to be an independent prognostic factor. This result supports the notion that CRT negatively regulates the growth of NB cells by affecting more than cell differentiation alone. In addition, positive CRT immunostaining was seen in normal brain neurons, adrenal medulla and sympathetic ganglia. This finding suggests not only that CRT expression is involved in the differentiation and regression of NB, but also that up-regulation of CRT is required for the normal development of neuronal cells.
Expression of Trk-A, a nerve growth factor (NGF) receptor, has been shown to be associated with the differentiation and death of the NB cells, as well as favorable prognosis of NB patients [22]. Trk-A, after activation by NGF, may promote intracellular signaling cascades, including the Ras/ERK protein kinase pathway, the PI3K/Akt kinase pathway and PLC-
1 [23
]. Activated PLC-
1 acts to hydrolyze phosphatidylinositides to generate diacylglycerol, which may further activate the PKC-
[23
]. PKC-
in turn is required for activation of the ERK cascade and for neurite outgrowth [23
]. Interestingly, it has been shown that CRT is a substrate and binding protein for all PKC isoforms, suggesting that CRT plays an important role in the common PKC activated signaling pathway [24
]. Thus, it is conceivable that CRT may participate in the process of Trk-A-mediated NB cell differentiation and death. It would be interesting to study the association between Trk-A and CRT expression in NB.
It was very interesting to find a specific expression of CRT in the endothelial cells by our immunohistochemistry study. A parallel expression of CRT in both endothelial cells and neuroblastic cells was also observed. More than half of the tumor samples that had positive CRT staining in their neuroblastic cells also had positive staining in their endothelial cells. Three tumors had CRT expression only in endothelial cells but not in neuroblastic cells and were designated as having negative CRT expression in the analysis. Two of these three tumors were GNB, and the remaining one was an UNB detected by mass screening. These findings indicate that CRT expression in the endothelial cells may also be relevant to the differentiation and regression of NB. However, the relationship between the expression of CRT in endothelial cells and neuroblastic cells is not known. CRT has been shown to be an anti-angiogenic factor that may inhibit the growth of endothelial cells [25], and has been used as a target of gene therapy for cancer [26
]. Interestingly, it has also been shown that inhibition of angiogenesis may induce differentiation and apoptosis in NB [27
]. The association of CRT expression in endothelial cells and neuroblastic cells in our studies may suggest that CRT is a potential target for the treatment of NB by both inhibiting endothelial cells and promoting differentiation and regression of NB cells.
CRT is a unique endoplasmic reticulum protein that affects many cellular functions; therefore, it is possible that it is involved in many pathologic conditions, especially in cancers. CRT has been shown to exist in the nuclear matrix of human hepatocellular carcinoma and various carcinoma cell lines [28], and overexpressed in human breast carcinoma [29
]. However, the role and importance of CRT in these cancers are not known. Our study demonstrates for the first time that expression of CRT in NB correlates with a differentiated histology and better outcome. Detection of CRT expression in tumor tissues may be of potential use as a predictive marker for NB. However, due to the limited sample size from one single institute of this cohort, additional studies with larger patient populations are required to further elucidate the prognostic significance of CRT expression in NB.
![]() |
Acknowledgements |
---|
Received for publication June 26, 2004. Revision received August 20, 2004. Accepted for publication October 18, 2004.
![]() |
References |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
2. Castleberry RP. Pediatric update: neuroblastoma. Eur J Cancer 1997; 33: 14301438.[CrossRef][Medline]
3. Hoehner JC, Gestblom C, Hedborg F et al. A developmental model of neuroblastoma: differentiating stroma-poor tumors' progress along an extra-adrenal chromaffin lineage. Lab Invest 1996; 75: 659675.[ISI][Medline]
4. Israel MA. Disordered differentiation as a target for novel approaches to the treatment of neuroblastoma. Cancer 1993; 71: 33103313.[ISI][Medline]
5. Hoehner JC, Gestblom C, Olsen L, Påhlman S. Spatial association of apoptosis-related gene expression and cellular death in clinical neuroblastoma. Br J Cancer 1997; 75: 11851194.[ISI][Medline]
6. Oue T, Fukuzawa M, Kusafuka T et al. In situ detection of DNA fragmentation and expression of bcl-2 in human neuroblastoma: relation to apoptosis and spontaneous regression. J Pediatr Surg 1996; 31: 251257.[CrossRef][ISI][Medline]
7. Michalak M, Corbett EF, Mesaeli N et al. Calreticulin: one protein, one gene, many functions. Biochem J 1999; 344: 281292.[CrossRef][ISI][Medline]
8. Xiao G, Chung TF, Pyun HY et al. KDEL proteins are found on the surface of NG 108-15 cells. Mol Brain Res 1999; 72: 121128.[CrossRef][ISI][Medline]
9. Xiao G, Chung TF, Fine RE, Johnson RJ. Calreticulin is transported to the surface of NG 108-15 cells where it forms surface patches and is partially degraded in an acidic compartment. J Neurosci Res 1999; 58: 652662.[CrossRef][ISI][Medline]
10. Johnson RJ, Liu N, Shanmugaratnam J, Fine RE. Increased calreticulin stability in differentiated NG-108-15 cells correlates with resistance to apoptosis induced by antisense treatment. Mol Brain Res 1998; 53: 104111.[CrossRef][ISI][Medline]
11. Nakamura K, Bossy-Wetzel E, Burns K et al. Changes in endoplasmic reticulum luminal environment affect cell sensitivity to apoptosis. J Cell Biol 2000; 150: 731740.
12. Rauch F, Prud'homme J, Arabian A et al. Heart, brain, and body wall defects in mice lacking calreticulin. Exp Cell Res 2000; 256: 105111.[CrossRef][ISI][Medline]
13. Shimada H, Ambros IM, Dehner LP et al. Terminology and morphologic criteria of neuroblastic tumors. Cancer 1999; 86: 349363.[CrossRef][ISI][Medline]
14. Shimada H, Ambros IM, Dehner LP et al. The international neuroblastoma pathology classification (the Shimada system). Cancer 1999; 86: 364372.[CrossRef][ISI][Medline]
15. Brodeur GM, Prichard J, Berthold F et al. Revision of the international criteria for neuroblastoma diagnosis, staging, and response to treatment. J Clin Oncol 1993; 11: 14661477.[Abstract]
16. Köpf I, Hanson C, Delle U et al. A rapid and simplified technique for analysis of archival formalin-fixed, paraffin-embedded tissue by fluorescence in situ hybridization (FISH). Anticancer Res 1996; 16: 25332536.[ISI][Medline]
17. Tajiri T, Shono K, Fujii Y et al. Highly sensitive analysis for N-myc amplification in neuroblastoma based on fluorescence in situ hybridization. J Pediatr Surg 1999; 34: 16151619.[CrossRef][ISI][Medline]
18. Taguchi J, Fujii A, Fujino Y et al. Different expression of calreticulin and immunoglobulin binding protein in Alzheimer's disease brain. Acta Neuropathol 2000; 100: 153160.[CrossRef][ISI][Medline]
19. Påhlman S, Ruusala AI, Abrahamsson L et al. Retinoic acid-induced differentiation of cultured human neuroblastoma cells: a comparison with phorbolester-induced differentiation. Cell Differ 1984; 14: 135144.[CrossRef][ISI][Medline]
20. Brodeur GM. Neuroblastoma: biologic insights into a clinical enigma. Nat Rev Cancer 2003; 3: 203216.[CrossRef][ISI][Medline]
21. Woods WG, Lemieux B, Tuchman M. Neuroblastoma represents distinct clinical-biologic entities: a review and perspective from the Quebec Neuroblastoma Screening Project. Pediatrics 1992; 89: 114118.[Abstract]
22. Nakagawara A, Arima-Nakagawara M, Scavarda NJ et al. Association between high levels of expression of the TRK gene and favorable outcome in human neuroblastoma. N Engl J Med 1993; 328: 847854.
23. Patapoutian A, Reichardt LF. Trk receptors: mediators of neurotrophin action. Curr Opin Neurobiol 2001; 11: 272280.[CrossRef][ISI][Medline]
24. Rendón-Huerta E, Mendoza-Hernández G, Robles-Flores M. Characterization of calreticulin as a protein interacting with protein kinase C. Biochem J 1999; 344: 469475.[CrossRef][ISI][Medline]
25. Pike SE, Yao L, Setsuda J et al. Calreticulin and calreticulin fragments are endothelial cell inhibitors that suppress tumor growth. Blood 1999; 94: 24612468.
26. Xiao F, Wei Y, Yang L et al. A gene therapy for cancer based on the angiogenesis inhibitor, vasostatin. Gene Ther 2002; 9: 12071213.[CrossRef][ISI][Medline]
27. Wassberg E, Hedborg F, Sköldenberg E et al. Inhibition of angiogenesis induces chromaffin differentiation and apoptosis in neuroblastoma. Am J Pathol 1999; 154: 395403.
28. Yoon GS, Lee H, Jung Y et al. Nuclear matrix of calreticulin in hepatocellular carcinoma. Cancer Res 2000; 60: 11171120.
29. Franzén B, Linder S, Alaiya AA et al. Analysis of polypeptide expression in benign and malignant human breast lesions. Electrophoresis 1997; 18: 582587.[ISI][Medline]