1 Division of Nephrology, Department of Internal Medicine, University of Michigan Medical School, Ann Arbor 48109-0676, and Ann Arbor Veterans Affairs Hospital, Ann Arbor, Michigan 48108; 2 Molecular Medicine and Renal Units, Beth Israel Deaconess Hospital, Boston 02215, and Departments of Medicine and Cell Biology, Harvard Medical School, Boston, Massachusetts 02115; and 3 Medizinische Universitätsklinik-Innere Medizin III, Abteilung für Kardiologie, Heidelberg D69115, Germany
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Intracellular pH (pHi) is
an important regulator of vascular smooth muscle cell (VSMC) tone,
contractility, and intracellular Ca2+ concentration. Among the
multiple transport processes that regulate VSMC
pHi,
Na+-independent
Cl/
exchange is the major process that acidifies VSMCs in response to an
alkaline load. Here, we characterize, in native and cultured VSMCs, the
expression of the AE family of band 3-related anion exchangers, the
best studied of these Cl
/
exchangers. A 4.2-kb AE2 mRNA was present in aorta and in all cultured
VSMCs tested. Cultured VSMCs and aorta both expressed a ~165-kDa AE2
polypeptide, but a ~115-kDa polypeptide was the major AE2-related
protein in aorta. AE3 mRNA levels in VSMCs and in arterial tissue were
significantly lower than those for AE2, but AE3 or related polypeptides
were readily detected by immunoblot and immunolocalization experiments.
The ~125-kDa AE3 polypeptide was present in an immortalized aortic VSMC line, but the predominant AE3 epitope in aorta and most cultured cells was associated with a polypeptide of
Mr ~80 kDa.
These data demonstrate the expression in native arteries and in VSMCs
of products of the AE2 and AE3 genes, which may contribute to
Na+-independent
Cl
/
exchange activity in these tissues and cells.
chloride; bicarbonate; intracellular hydrogen ion concentration; vascular smooth muscle
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
VASCULAR SMOOTH MUSCLE cells (VSMCs), like many
mammalian cells, possess at least three ion exchange processes that
participate in the control of intracellular pH
(pHi):
Na+/H+
exchange, Na+-dependent
Cl/
exchange, and Na+-independent
Cl
/
exchange (1). Under physiological conditions (in the presence of
CO2 and
),
Na+/H+
exchange and Na+-dependent
Cl
/
exchange serve to alkalinize the cell in response to an acid load. The
more recently described
H+-K+-adenosinetriphosphatase
(H+-K+-ATPase)
(32) and
Ca2+/H+
exchange of VSMCs (9) may also participate in recovery from an acid
load. Among acid extrusion processes yet to be identified in VSMCs are
H+-ATPase and
H+-lactate cotransport activities,
with the latter occurring despite the production and transport of large
amounts of lactate by VSMCs.
In contrast to the above acid extruders,
Na+-independent
Cl/
exchange acidifies the cell in response to an alkaline load (1, 23).
Many contractile agonists applied in the absence of
CO2/
have been shown to alkalinize VSMCs via stimulation of
Na+/H+
exchange. However, when the contractile agonists were also tested in
the presence of
CO2/
,
it was usually noted that pHi did
not change because Na+-independent
Cl
/
exchange was activated in parallel with Na+/H+
exchange (15, 21).
Over the past several years, the primary structures of three
transporters that mediate
Na+-independent
Cl/
exchange have been identified via cloning of their cDNAs (3). The first
such exchanger to be cloned was the
Cl
/
exchanger of the erythrocyte, band 3 or AE1 anion exchanger. Two
related cDNAs subsequently were isolated based on homology to AE1, and
their encoded proteins (AE2 and AE3) have been shown to mediate
Na+-independent
Cl
/
exchange (17, 25, 29, 30). Additional AE isoform polypeptide products
of alternate transcripts of all three mammalian AE genes also have been
identified (6, 27, 31, 40). In addition to the variant AE transcripts
encoding polypeptides that span the lipid bilayer an estimated 12 or 14 times, several AE3 transcripts have also been identified that do not
appear to encode any membrane-spanning region (33) and so cannot
themselves mediate
Cl
/
exchange.
Functional characterization of differences among the various AE polypeptide products of the different AE genes has been initiated. These include differences in regulation by pH (17, 37, 42), by NH+4 (16), and by tonicity (18); differences in contribution to cell volume regulation and in binding of ankyrin (11); and differences in trafficking of transiently overexpressed protein in human erythroleukemia cells (8).
The Na+-independent
Cl/
exchangers in VSMCs have not been identified. In view of their
contributions to pHi regulation,
we investigated the expression of mRNA and protein products of the AE
Cl
/
exchanger gene family in rat aorta, renal microvessels, and in several
lines of cultured rat VSMCs. The results below document expression of
both AE2 and AE3 genes in VSMCs.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cell culture. The different vascular smooth muscle cells lines used in this study [A10, A7r5, WKY50 (Wistar-Kyoto), and neonatal rat smooth muscle cells (NSMC)] were cultured in low-glucose Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (Life Technologies, Gaithersburg, MD). The A10 and A7r5 rat embryonal aortic vascular smooth muscle cell lines were obtained from the American Type Culture Collection. The WKY50 primary VSMCs were grown out from an aortic explant from a 50-day-old WKY rat following the procedure of Hall et al. (14), except that explants were placed into 35-mm Falcon Primaria culture dishes containing 2 ml of culture medium and that collagen was not used as a substratum. When cells were observed growing on the culture dishes, usually within 5-10 days, the aortic explants were removed from the dishes. WKY50 VSMCs expressed smooth muscle actin and were used in this investigation between passages 3 and 5. NSMC from thoracic aorta were immortalized with the recombinant retrovirus pZipSVtsA58 expressing a temperature-sensitive mutant of the large T antigen of SV40 (19). NSMC express vimentin and smooth muscle isoforms of actin and myosin. NSMC were grown at either the permissive temperature of 33°C or at the nonpermissive temperature of 39°C, at which they display a more differentiated phenotype (19).
RNA preparation and transcript
analyses. Kidneys, hearts, aortas, and brains were
removed from freshly killed Sprague-Dawley rats (150-200 g) and
were snap frozen in liquid nitrogen. RNA was prepared from organs or
VSMCs using TRI Reagent (Molecular Research Center, Cincinnati, OH),
and Northern blotting was performed as previously described (6). Blots
were hybridized at 1-2 × 106
counts · min1 · ml
1
(cpm/ml) under high-stringency conditions (50% formamide, 50°C) with full-length, denatured, and uniformly
32P-labeled double-stranded cDNA
probes generated from 100 ng of recombinant full-length murine AE1 or
AE2 cDNAs or from a partial-length rat AE3 cDNA (see
PCR amplifications and sequencing of PCR
products), then washed four times for 15 min in
0.1× standard sodium citrate and 0.1% sodium dodecyl sulfate
(SDS) at 50°C, and exposed to film.
AE3 ribonuclease protection assays were performed following the protocol of Gilman (12), with the following modifications. Partial-length rat AE3 plasmids were constructed by subcloning rat AE3 polymerase chain reaction (PCR) products (see below) into the pCRII vector (Invitrogen, San Diego, CA). From these plasmids, 32P uniformly labeled antisense cRNA probes were transcribed using SP6 polymerase. The probe (5 × 105 cpm) was coprecipitated with 34 µg of yeast tRNA (type III; Sigma, St. Louis, MO), rat heart RNA, or rat aorta RNA. The precipitates were resuspended in hybridization buffer and annealed at 42°C overnight. The annealed mixture was then digested with 8.7 µg/ml ribonuclease A and 435 units/ml ribonuclease T1 at 30°C for 20 min.
Micro-RNA preparation and cDNA synthesis were performed as reported previously (7). Various microvessels (radial artery, interlobular artery, interlobular artery plus afferent arterioles) were isolated from coronal sections of rat kidneys. Each group of vessels was transferred to 100 µl of 4 M guanidinium thiocyanate and frozen in liquid nitrogen. RNA was isolated with micromodifications of standard CsCl cushion methods. The entirety of each RNA microsample was subjected to first-strand cDNA synthesis as described previously (7). Identical methods for cDNA synthesis were used for rat heart, aorta, and brain RNA, except that 0.5-5 µg of total RNA and correspondingly increased amounts of oligo(dT) were used.
PCR amplifications and sequencing of PCR products. To determine the AE mRNA isoforms present in dissected renal microvessels, the cDNA reverse transcribed from these vessels was amplified through 30 cycles with primers specific for each of the three rat AE genes. AE1 primers were 5' primer = AGACCAAGCTGTACTGTGCA [nucleotides (nt) 392-411] and 3' primer = TACAAGTTGGGGTCTGGCTT (reverse complement of nt 877-858) (27). AE2 primers were 5' primer = CAGGTGCAGCTGAAGATGAT (nt 1990-2009) and 3' primer = TGGTTGCTGCCCAAGTCATA (reverse complement of nt 2626-2607) (26). AE3 primers were 5' primer = AGACCAAAGTGGAGATGACC (nt 1919-1938) and 3' primer = GCAGGGCACTACTATTCAGT (reverse complement of nt 2617-2598) (26). One additional primer pair was used to specifically amplify the erythroid (eAE1) but not the kidney isoform of AE1. These eAE1 primers were 5' primer = TAGAGACCTAACCATCCCTG (derived from the murine eAE1 cDNA sequence, nt 93-112) and 3' primer = TGCACAGTACAGCTTGGTCT (reverse complement of rat nt 393-412) (27). Three additional primers were used to to distinguish the brain and heart isoforms of AE3 mRNA: brain 5' primer = ATCAGCCAGCTATGACC (nt 673-692) (26), cardiac 5' primer = AGGTCATGGAGCCCAATGG (nt 20-39) (31), and brain/cardiac 3' primer = GAACTTGATCCAGCGTG [nt 1022-1041 of the brain sequence (26), and nt 431-450 of the cardiac sequence (31)]. Radioactive PCR samples were separated on 5% acrylamide gels, which were dried and subjected to autoradiography. Relative abundance of the templates for PCR amplification was estimated by parallel PCR reactions of dilution series of known numbers of recombinant murine AE2 or AE3 cDNA plasmid molecules as previously reported (7).
Alternate AE3 PCR products were partly sequenced either by direct sequencing of double-stranded PCR products purified on agarose gels or by conventional double-stranded DNA sequencing of PCR products subcloned into plasmids using the Sequenase II and conditions recommended by the manufacturer (US Biochemical, Cleveland, OH).
Antibodies. The antibody to AE2 was an affinity-purified rabbit polyclonal sera raised against mouse AE2 COOH-terminal amino acids 1224-1237 (39, 42). Two other rabbit polyclonal sera raised against mouse amino acids 426-440 and amino acids 961-974 were used in selected experiments (39). Antibodies to AE3 were affinity-purified rabbit polyclonal sera raised against human brain isoform of AE3 (bAE3) COOH-terminal amino acids 1216-1227 and cardiac isoform of AE3 (cAE3) amino acids 42-53 (41). An additional rabbit polyclonal antibody to human bAE3 amino acids 115-128 was prepared and affinity purified as previously described (41).
Protein preparation and immunoblotting. Aortas from adult Sprague-Dawley rats were removed and immediately homogenized with a glass Teflon homogenizer in Laemmli sample buffer. Lysates from tissue culture cells were prepared by directly scraping cells from 100-mm plates into 0.5 ml of Laemmli sample buffer or into 1.0% Triton X-100. Alternatively, crude microsomes were prepared as described by Stuart-Tilley et al. (39). Lysates or microsomes dissolved suspended in Laemmli sample buffer were placed at 37°C for 5 min, cooled on ice, then separated on 8% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gels, and blotted conventionally onto nitrocellulose filters. Immunoblotting was performed as previously described for the alkaline phosphatase color development method (39) and the enhanced chemiluminescence method (7).
Immunocytochemistry. Cells grown on glass coverslips were fixed with 3 or 3.7% formaldehyde in phosphate-buffered saline (PBS) and quenched with glycine, pH 8. Antibody incubations and coverslip mounting were as previously described (39, 41). Secondary antibody was Cy3-conjugated donkey anti-rabbit immunoglobulin (Jackson Laboratories, Bar Harbor, ME). Epon embedding of rat kidney and stomach and cutting of semithin sections were performed as previously described (39).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
AE transcript expression in vascular smooth muscle. Northern blot analysis was used to analyze AE anion exchanger mRNA expression in native rat vessels and in cultured VSMCs using cDNA probes specific for the three AE anion exchanger transport genes, AE1, AE2, and AE3. AE2 was found to be the predominant anion transporter mRNA in rat aorta and in A10, A7r5, and WKY50 cells (Fig. 1, Table 1). In all vessels and VSMCs examined, a single AE2 4.2-kb mRNA species was observed by Northern blot analysis (Fig. 1). AE2 mRNA levels in the nonimmortalized WKY50 cell line were comparable to those in the established A10 and A7r5 VSMC cell lines. In contrast, AE3 mRNA was not routinely detectable by Northern analysis of total RNA, except in the immortalized NSMC line (Fig. 1, Table 1). However, ribonuclease protection assays using AE3 cRNA probes and reverse transcription (RT)-PCR analysis confirmed the presence of AE3 mRNA in native rat aorta (Fig. 2) and in A10 cells (Fig. 3). AE1 mRNA was undetectable in RNA from any of the vascular tissues or cells, whether by Northern analysis (Fig. 1) or by RT-PCR (Fig. 3).
|
|
|
|
Transcripts encoding AE2 and AE3 also were expressed in isolated renal microvessels, as assessed with RT-PCR analysis (Fig. 3). In the experiment shown, the intensity of the 698-bp AE3 PCR product produced in the PCR reaction was greater than that of the 636-bp AE2 PCR product. However, the band intensities were compared with those of PCR products derived from parallel dilution series of recombinant AE2 and AE3 plasmid cDNAs (7). The efficiency of amplification for the AE3 cDNA plasmid appeared to be at least 10-fold greater than that for AE2 (i.e., the band intensity for amplification products from 3.2 × 102 AE3 molecules was equivalent to that of amplification products of 3.9 × 103 AE2 molecules; not shown). Therefore, the abundance of AE2 cDNA was ~5- to 10-fold greater than that of AE3 cDNA. If we assume similar rates of thermostable reverse transcription from AE2 and AE3 mRNA, then these results suggest qualitatively that the level of AE2 mRNA in rat renal microvessels exceeded that of AE3. As in the cultured VSMCs and aorta, no AE1 mRNA expression was detected in these vascular samples by RT-PCR analysis (not shown).
In the rat, two major mRNAs encoding transmembrane forms of the AE3
Cl/
exchanger have been reported: a 3.8-kb AE3 mRNA (cAE3), detected
primarily in cardiac tissue; and a 4.4-kb AE3 mRNA (bAE3) expressed at
high levels in stomach and brain, as well as in the heart (31, 41).
Based on these size differences, the Northern analysis in Fig. 1
suggested that the main AE3 mRNA isoform in NSMC RNA was bAE3. However,
PCR amplification of rat aorta and A10 cell cDNAs using primers
specific for the bAE3 and cAE3 isoforms showed that mRNA encoding for
both of these AE3 isoforms was present in vascular tissue (Fig.
4), whereas only the cAE3 isoform was
detected by this method in NSMC (Fig. 4, Table 1).
|
AE polypeptide expression in vascular smooth muscle as detected by immunoblot. Immunoblotting studies demonstrated the expression of AE2 polypeptide in rat aorta and in all the tested VSMCs. In A10 VSMCs, the anti-AE2 amino acids 1224-1237 antibody detected two bands of Mr ~165 kDa and 145 kDa by SDS-PAGE (Fig. 5). The same two bands were detected by anti-peptide antibodies to AE2 amino acids 426-440 and 961-974 (not shown; Ref. 39). An ~165-kDa AE2 polypeptide was also observed in immunoblots of A7r5 VSMCs and WKY50 VSMCs, and both bands were detected in NSMC (not shown). The two AE2 polypeptides observed in cultured VSMCs were similar in size to the core-glycosylated 145-kDa AE2 polypeptide and the mature glycosylated 165-kDa AE2 polypeptide previously characterized in gastric mucosa (44) and in cells transiently transfected with AE2 cDNA (20, 36). In rat aorta, however, in addition to the ~165-kDa AE2 polypeptide, a more abundant AE2 epitope-containing polypeptide of Mr ~115 kDa was detected (Fig. 5). In all cells and tissues, the AE2 bands detected by the COOH-terminal anti-AE2 amino acids 1224-1237 antibody were abolished by including the specific AE2 peptide immunogen in the antibody incubation mixture, whereas the presence of a nonspecific peptide had no effect on the AE2 immunoblot signal AE2 detection (Fig. 5).
|
An antibody recognizing cAE3 but not bAE3 detected a prominent doublet at 120 and 125 kDa in NSMC lysates (Fig. 6). The upper band corresponds to the size of the cAE3 polypeptide detected in human heart (41). Another immunoreactive polypeptide of apparently lower apparent abundance was detected at ~80 kDa. Both the 120- to 125-kDa doublet and the smaller polypeptide were specifically recognized by the antibody, as both bands were competed in the presence of 12 µg/ml peptide antigen.
|
The same anti-cAE3 antibody detected in aorta a similar band of ~125 kDa (Fig. 7, two right lanes), as well as smaller bands of ~80 and ~71 kDa, each competed by the peptide antigen.1 The antibody to the COOH-terminal AE3 peptide present in both cAE3 and bAE3 also detected the ~80-kDa polypeptide but failed to detect either the 125-kDa polypeptide or the smaller 71-kDa polypeptide. Neither direct homogenization of aorta in SDS-load buffer nor elevated concentrations of protease inhibitors altered the abundance or Mr of the detected polypeptide bands.
|
Although the ~80-kDa AE3-related polypeptide in rat aorta was detected by both NH2-terminal and COOH-terminal AE3 antibodies in an immunospecific manner, the Mr of this polypeptide was considerably smaller than that predicted by the cloned cAE3 cDNA. Therefore, we utilized RT-PCR to search for alternately spliced AE3 transcripts exist in VSMCs or aorta that might encode such a polypeptide containing both epitopes. PCR amplification of rat aorta and A10 cell cDNAs revealed the presence of two additional AE3 cDNAs shorter than the published rat AE3 cDNA sequences encoding putative transmembrane proteins. However, neither utilized consensus splice donor or acceptor sites, and neither was detectable by ribonuclease protection assays in RNA from aorta or from A10 cells (not shown).
Immunolocalization of AE3 epitopes in vascular smooth muscle. Immunolocalization of AE3 was sought in semithin sections of several vascular tissues (Fig. 8) and in cultured NSMC (Fig. 9). The cAE3-specific amino acids 42-53 epitope (human numbering) was detected in smooth muscle cells in renal afferent arterioles (Fig. 8a) and in large renal arteries (Fig. 8b). This cAE3 epitope was also present in smooth muscle cells in arteries of the gut lamina propria (Fig. 8, c and d), mural smooth muscle cells of the gastric muscularis mucosae (Fig. 8c), and in small cells between gastric glands representing either precapillary arteriolar smooth myocytes or glandular myoepithelial cells (Fig. 8c). The cAE3 immunostaining pattern was not restricted to the cell surface but appeared distributed diffusely throughout the smooth muscle cells. These smooth muscle cell types were not immunostained by the antibody to the bAE3-specific epitope [amino acids 115-128 (human numbering)] or to the shared AE3 COOH-terminal epitope (amino acids 1216-1227) (not shown).
|
|
In contrast to the selective detection of a single AE3 epitope in semithin sections of arterial smooth muscle, three distinct AE3 epitopes were coimmunolocalized in cultured NSMC (Fig. 9). These cells displayed immunospecific staining with the cardiac cAE3-specific and brain bAE3-specific epitopes and the shared AE3 COOH-terminal antibodies to AE3 epitopes. The immunostaining pattern produced by each of the three antibodies was diffuse and particulate, largely but not entirely excluded from the area overlying the nucleus and tending to concentrate in the area of the Golgi apparatus. Golgi staining was most notable with the COOH-terminal AE3 antibody (Fig. 9, C and D). Staining of cell boundaries was present but not prominent, consistent with localization of only a small proportion of AE3 polypeptide at the cell surface.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In this study, we demonstrate that two AE
Cl/
exchanger genes, AE2 and AE3, are expressed in VSMCs in arteries and in
tissue culture. AE2 was the more abundant mRNA in all VSMC preparations
examined. This finding corresponded with detection of AE2 polypeptide
expression in immunoblots of aorta and of cultured VSMCs. Although
aorta exhibited an AE2 polypeptide of ~165 kDa, similar to those
present in A10 cells and NSMC and previously described in other
tissues, the major AE2-related polypeptide in aorta was of
Mr ~115 kDa. An
AE2 polypeptide of similar size has been detected in rat lung and
corresponded with immunostaining of pulmonary vascular smooth muscle
(13). In addition, Kellokumpu et al. (24), using an antibody to the
COOH-terminal peptide of AE1 that cross-reacted with AE2, observed an
immunoreactive polypeptide band of
Mr 115 kDa in an
osteoblastic sarcoma cell line. Immunocytochemical evidence of AE2
polypeptide was not detected in vascular smooth muscle in semithin
sections of kidney, even when sections were subjected to epitope
unmasking protocols.
AE3 mRNA was present at significantly lower levels than those of AE2 in cultured VSMCs and in large and small arteries. However, AE3 peptide epitopes were readily and immunospecifically detectable in immunoblots of cultured VSMCs and vascular tissues. Although a 120- to 125-kDa AE3 doublet was the major cAE3 in cultured NSMCs, a smaller band of Mr ~80 kDa was also present. In contrast, the major polypeptide reactive with the anti-AE3 antibodies in aorta was an ~80-kDa band, and the ~125-kDa cAE3 polypeptide was less abundant. Because bands of ~80 kDa were detected by two anti-AE3 antibodies that recognize amino acids 42-53 and 1216-1227 (human numbering) at opposite ends of the protein, the ~80-kDa band was considered unlikely to arise from proteolysis but might represent the product of an alternative AE3 transcript in which an internal portion of the coding sequence was spliced out. Thus it is possible that the ~80-kDa band includes a polypeptide encoded by a truncated cAE3 product lacking a transmembrane domain, as has been demonstrated in brain (33) and kidney (4), but retaining the COOH-terminal cytoplasmic epitope. However, attempts to clone such an AE3 cDNA derived from a transcript containing both sequences and detectable by ribonuclease protection analysis were unsuccessful. Other potential explanations for the ~80-kDa band, such as accelerated SDS-PAGE mobility of a larger AE3 isoform and detection of a non-AE3 polypeptide by each of the AE3 antisera, seem unlikely. Therefore, the identity of the ~80-kDa cAE3-related polypeptide remains uncertain.
Although cAE3 immunostaining was evident in arterial smooth muscle in tissue sections, it displayed a subcellular distribution in which intracellular staining appeared to predominate over cell surface staining. All three epitopes visualized by immunostaining of NSMC in culture displayed a pattern consistent with localization to Golgi and other intracellular membranes, again with much less prominent cell surface expression.
The pHi dependence and inhibitor
sensitivities of recombinant AE2 and AE3 (17, 29, 42) have similarities
to those previously reported for
Na+-independent
Cl/
exchange in VSMCs (23). The current study demonstrates the expression
of AE2 and AE3 genes in VSMCs in vivo and in cell culture, although
neither AE2 nor AE3 polypeptides appear to accumulate predominantly in
plasma membrane. Nonetheless, data are consistent with the possibility
that some or all of the Cl
/
exchange activity in VSMCs in vivo and in cell culture may be mediated
by AE2 and/or AE3. However, pharmacological agents have yet to
be described that discriminate reliably between AE2 and AE3 and so
might allow determination of the relative contribution of each
transporter to Na+-independent
Cl
/
exchange in VSMCs.
The identity of
Cl/
transporters in VSMCs may be important to the investigation of VSMC
function in the development and maintenance of hypertension, because
changes in pHi have been shown to
affect intracellular calcium concentration, vascular smooth muscle
contractility (1), and VSMC growth (5, 28). However, relatively few
studies have examined
Na+-independent
Cl
/
exchange in tissues from hypertensive animals (2, 34, 35), and none
have studied it in VSMCs from those animals. Altered expression of AE2
and/or AE3 could change the rate of VSMC recovery from alkaline
loads, which could lead to changes in intracellular calcium levels or
other processes that could affect contractility and VSMC growth.
In preliminary studies, we have found that AE2 mRNA is expressed at higher levels (10) and that recovery from an alkaline load is faster (Brosius et al., unpublished observations) in VSMCs of genetically hypertensive, stroke-prone spontaneously hypertensive rats (SHRSP) than in control WKY rats. Moreover, we have determined that the AE2 gene lies in a region of rat chromosome 4 that has been determined to be a quantitative-trait locus for hypertension in SHRSP, whereas the gene for AE3 is in a region of chromosome 10 associated with no detectable effect on rat blood pressure (38). However, whether altered AE2 or AE3 activities play a role in the development of hypertension in these animals with essential hypertension remains unknown. Investigation of the effects of altered AE2 expression in VSMCs should help define the role of this transporter in both normal and pathophysiological conditions.
![]() |
ACKNOWLEDGEMENTS |
---|
We wish to thank Khanh Nguyen for technical assistance, Dr. L. Jahn for providing the transformed neonatal rat cardiac-derived smooth muscle cells, and Dr. Josie Briggs for helpful discussions.
![]() |
FOOTNOTES |
---|
This work was supported by a Merit Review grant from the Department of Veterans Affairs (F. C. Brosius), National Institute of Health Grants HL-18575 (F. C. Brosius), DK-43495 (S. L. Alper), and DK-34854 (Harvard Digestive Diseases Center), and a University of Heidelberg Medical School intramural research grant [project no. 47/94 (C. Haller)]. S. L. Alper is an Established Investigator of the American Heart Association.
1 AE3 bands were detected only in specimens directly solubilized in SDS-PAGE-load buffer. Storage of tissue at 4°C or freeze-thaw of specimens did not permit detection of AE3 in rat aorta.
Address for reprint requests: F. C. Brosius III, Univ. of Michigan, 1150 W. Medical Center Drive, 1560 MSRBII, Ann Arbor, MI 48109-0676.
Received 11 April 1997; accepted in final form 31 July 1997.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1.
Aalkjaer, C.,
and
A. Hughes.
Chloride and bicarbonate transport in rat resistance arteries.
J. Physiol. (Lond.)
436:
57-73,
1991[Abstract].
2.
Alonso, A.,
A. Arrazola,
A. Garciandia,
N. Esparza,
C. G. Gomez-Alamillo,
and
J. Diez.
Erythrocyte anion exchanger activity and intracellular pH in essential hypertension.
Hypertension
22:
348-356,
1993[Abstract].
3.
Alper, S. L.
The band 3-related AE anion exchanger gene family.
Cell. Physiol. Biochem.
4:
265-281,
1994.
4.
Alper, S. L.,
and
B. E. Shmukler.
Tissue-specific alternative splicing of the AE3 anion exchanger gene predicts a novel AE3 polypeptide in rat kidney (Abstract).
J. Am. Soc. Nephrol.
6:
303,
1995[Medline].
5.
Bobik, A.,
A. Grooms,
P. J. Little,
E. J. Cragoe, Jr.,
and
S. Grinpukel.
Ethylisopropilamiloride-sensitive pH control mechanisms modulate vascular smooth muscle cell growth.
Am. J. Physiol.
260 (Cell Physiol. 29):
C581-C588,
1991
6.
Brosius, F. C., III,
S. L. Alper,
A. M. Garcia,
and
H. F. Lodish.
The major kidney band 3 gene transcript predicts an amino-terminal truncated band 3 polypeptide.
J. Biol. Chem.
264:
7784-7787,
1989
7.
Brosius, F. C., III,
K. Nguyen,
A. K. Stuart-Tilley,
C. Haller,
J. P. Briggs,
and
S. L. Alper.
Zonal and segmental localization of AE2 anion exchanger mRNA and protein in rat kidney.
Am. J. Physiol.
269 (Renal Fluid Electrolyte Physiol. 38):
F461-F468,
1995
8.
Cox, K. H.,
T. L. Adair-Kirk,
and
J. V. Cox.
Four variant chicken erythroid AE1 anion exchangers. Role of the alternative N-terminal sequences in intracellular targetting in transfected human erythroleukemia cells.
J. Biol. Chem.
270:
19752-19760,
1995
9.
Daugirdas, J. T.,
and
D. C. Batlle.
Interactions of pHi and Ca2+i in vascular smooth muscle tissue.
J. Lab. Clin. Med.
119:
667-675,
1992[Medline].
10.
Deshmukh, G.,
S. L. Alper,
D. W. Wilde,
and
F. C. Brosius III.
Increased expression of anion transporter AE2 mRNA in small cerebral arteries of stroke-prone spontaneously hypertensive rats (SHRSP) (Abstract).
Hypertension.
24:
384,
1994.
11.
Ding, Y.,
S. Kobayashi,
and
R. Kopito.
Mapping of ankyrin binding determinants on the erythroid anion exchanger, AE1.
J. Biol. Chem.
271:
22494-22498,
1996
12.
Gilman, M.
Ribonuclease protection assay.
In: Current Protocols in Molecular Biology, edited by F. M. Ausubel,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
H. A. Smith K.,
and S. Struhl. New York: Wiley, 1992, vol. 1, p. 4.7.1-4.7.8.
13.
Grayck, E. N.,
C. A. Piantodosi,
J. van Adelsberg,
S. L. Alper,
and
Y.-C. T. Huang.
Protection of perfused lung from oxidant injury by inhibitors of anion exchange.
Am. J. Physiol.
273 (Lung Cell. Mol. Physiol. 17):
L296-L304,
1997
14.
Hall, K. I.,
J. W. Hardin,
and
H. L. Hosick.
Isolation and characterization of clonal vascular smooth muscle cell lines from spontaneously hypertensive and normotensive rat aortas.
In Vitro Cell Dev. Biol.
27A:
791-798,
1991.
15.
Hubel, C. A.,
and
R. F. Highsmith.
Endothelin-induced changes in intracellular pH and Ca2+ in coronary smooth muscle: role of Na+/H+ exchange.
Biochem. J.
310:
1013-1020,
1995[Medline].
16.
Humphreys, B. D.,
M. N. Chernova,
L. Jiang,
Y. Zhang,
and
S. L. Alper.
NH4Cl activates AE2 anion exchanger in Xenopus oocytes at acidic pHi.
Am. J. Physiol.
272 (Cell Physiol. 41):
C1232-C1240,
1997
17.
Humphreys, B. D.,
L. Jiang,
M. N. Chernova,
and
S. L. Alper.
Functional characterization and regulation by pH of murine AE2 anion exchanger expressed in Xenopus oocytes.
Am. J. Physiol.
267 (Cell Physiol. 36):
C1295-C1307,
1994
18.
Humphreys, B. D.,
L. Jiang,
M. N. Chernova,
and
S. L. Alper.
Hypertonic activation of AE2 anion exchanger in Xenopus oocytes via NHE-mediated intracellular alkalinization.
Am. J. Physiol.
268 (Cell Physiol. 37):
C201-C209,
1995
19.
Jahn, L.,
J. Sadoshima,
A. Greene,
C. Parker,
K. Morgan,
and
S. Izumo.
Conditional differentiation of heart and smooth muscle-derived cells transformed by a temperature-sensitive mutant of SV40 T antigen.
J. Cell Sci.
109:
397-407,
1996
20.
Jiang, L.,
A. K. Stuart-Tilley,
J. Parkash,
and
S. L. Alper.
AE2-mediated Cl/
exchange in CHOP cells of defined, transient transfection status is regulated by pHi and serum.
Am. J. Physiol.
266 (Cell Physiol. 35):
C845-C856,
1994.
21.
Kahn, A. M.,
M. Bishara,
E. J. Cragoe,
J. C. Allen,
C. L. Seidel,
S. S. Navran,
R. G. O'Neill,
N. A. McCarty,
and
H. Shelat.
Effects of serotonin on intracellular pH and contraction in vascular smooth muscle.
Circ. Res.
71:
1294-1304,
1992[Abstract].
22.
Kahn, A. M.,
E. J. Cragoe, Jr.,
J. C. Allen,
R. D. Halligan,
and
H. Shelat.
Na+-H+ and Na+-dependent Cl/ exchange control of pHi in vascular smooth muscle.
Am. J. Physiol.
259 (Cell Physiol. 28):
C134-C143,
1990
23.
Kahn, A. M.,
E. J. Cragoe, Jr.,
J. C. Allen,
C. L. Seidel,
and
H. Shelat.
Effects of pHi on Na+-H+, Na+-dependent, and Na+-independent Cl/ exchangers in vascular smooth muscle.
Am. J. Physiol.
261 (Cell Physiol. 30):
C837-C844,
1991
24.
Kellokumpu, S.,
L. Neff,
S. Jamsa-Kellokumpu,
R. Kopito,
and
R. Baron.
A 115-kD polypeptide immunologically related to erythrocyte band 3 is present in Golgi membranes.
Science
242:
1308-1311,
1988[Medline].
25.
Kopito, R. R.,
B. S. Lee,
D. M. Simmons,
A. E. Lindsey,
C. W. Morgans,
and
K. Schneider.
Regulation of intracellular pH by a neuronal homolog of the erythrocyte anion exchanger.
Cell
59:
927-937,
1989[Medline].
26.
Kudrycki, K. E.,
P. R. Newman,
and
G. E. Shull.
cDNA cloning and tissue distribution of mRNA for two proteins that are related to the band 3 Cl/
exchanger.
J. Biol. Chem.
265:
462-471,
1990
27.
Kudrycki, K. E.,
and
G. E. Shull.
Primary structure of the rat kidney band 3 anion exchange protein deduced from a cDNA.
J. Biol. Chem.
264:
8185-8192,
1989
28.
Lagarde, A. E.,
A. J. Franchi,
S. Paris,
and
J. M. Pouyssegur.
Effect of mutations affecting Na+:H+ antiport activity on tumorigenic potential of hamster lung fibroblasts.
J. Cell. Biochem.
36:
249-260,
1988[Medline].
29.
Lee, B. S.,
R. B. Gunn,
and
R. R. Kopito.
Functional differences among nonerythroid anion exchangers expressed in a transfected human cell line.
J. Biol. Chem.
266:
11448-11454,
1991
30.
Lindsey, A. E.,
K. Schneider,
D. M. Simmons,
R. Baron,
B. S. Lee,
and
R. R. Kopito.
Functional expression and subcellular localization of an anion exchanger cloned from choroid plexus.
Proc. Natl. Acad. Sci. USA
87:
5278-5282,
1990[Abstract].
31.
Linn, S. C.,
K. E. Kudrycki,
and
G. E. Shull.
The predicted translation product of a cardiac AE3 mRNA contains an N terminus distinct from that of the brain AE3 Cl/
exchanger.
J. Biol. Chem.
267:
7927-7936,
1992
32.
McCabe, R. D.,
and
D. B. Young.
Evidence of a H+-K+-ATPase in vascular smooth muscle cells.
Am. J. Physiol.
262 (Heart Circ. Physiol. 31):
H1955-H1958,
1992
33.
Morgans, C. W.,
and
R. R. Kopito.
Association of the brain anion exchanger, AE3, with the repeat domain of ankyrin.
J Cell Sci.
105:
1137-1142,
1993
34.
Perez, N. G.,
B. V. Alvarez,
M. C. Camilion de Hurtado,
and
H. E. Cingolani.
pHi regulation in myocardium of the spontaneously hypertensive rat. Compensated enhanced activity of the Na+-H+ exchanger.
Circ. Res.
77:
1192-1200,
1995
35.
Redon, J.,
and
D. Batlle.
Regulation of intracellular pH in the spontaneously hypertensive rat. Role of bicarbonate-dependent transporters.
Hypertension
23:
503-512,
1993[Abstract].
36.
Ruetz, S.,
A. E. Lindsey,
C. L. Ward,
and
R. R. Kopito.
Functional activation of plasma membrane anion exchangers occurs in a pre-Golgi compartment.
J. Cell Biol.
121:
37-48,
1993[Abstract].
37.
Sekler, I.,
S. Kobayashi,
and
R. R. Kopito.
A cluster of cytoplasmic histidine residues specifies pH dependence of the AE2 plasma membrane anion exchanger.
Cell
86:
929-935,
1996[Medline].
38.
Simon, J. S.,
G. Deshmukh,
F. J. Couch,
B. L. Weber,
E. S. Winer,
C. Spzirer,
S. L. Alper,
H. J. Jacob,
and
F. C. Brosius III.
Chromosomal mapping of the rat Slc4a family of anion exchanger genes, AE1, AE2 and AE3.
Mamm. Genome
7:
380-382,
1996[Medline].
39.
Stuart-Tilley, A.,
C. Sardet,
J. Pouyssegur,
M. A. Schwartz,
D. Brown,
and
S. L. Alper.
Immunolocalization of anion exchanger AE2 and cation exchanger NHE1 in distinct adjacent cells of gastric mucosa.
Am. J. Physiol.
266 (Cell Physiol. 35):
C559-C568,
1994
40.
Wang, Z.,
P. J. Schultheis,
and
G. E. Shull.
Three N-terminal variants of the AE2 Cl/
exchanger are encoded by mRNAs transcribed from alternative promoters.
J. Biol. Chem.
271:
7835-7843,
1996
41.
Yannoukakos, D.,
A. Stuart-Tilley,
H. A. Fernandez,
P. Fey,
G. Duyk,
and
S. L. Alper.
Molecular cloning, expression, and chromosomal localization of two isoforms of the AE3 anion exchanger from human heart.
Circ. Res.
75:
603-614,
1994[Abstract].
42.
Zhang, Y.,
M. N. Chernova,
A. K. Stuart-Tilley,
and
S. L. Alper.
The cytoplasmic and transmembrane domains of AE2 both contribute to regulation of anion exchange by pH.
J. Biol. Chem.
271:
5741-5749,
1996