Regulation of sgk by aldosterone and its effects on the epithelial Na+ channel

Alexander Shigaev, Carol Asher, Hedva Latter, Haim Garty, and Eitan Reuveny

Department of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100, Israel


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Aldosterone is the major corticosteroid regulating Na+ absorption in tight epithelia and acts primarily by activating the epithelial Na+ channel (ENaC) through unknown induced proteins. Recently, it has been reported that aldosterone induces the serum- and glucocorticoid-dependent kinase sgk and that coexpressing ENaC with this kinase in Xenopus laevis oocytes increases the amiloride-sensitive Na+ current (Chen SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Proc Natl Acad Sci USA 96: 2514-2519, 1999). The present study was done to further characterize regulation of sgk by aldosterone in native mammalian epithelia and to examine its effect on ENaC. With both in vivo and in vitro protocols, an almost fivefold increase in the abundance of sgk mRNA has been demonstrated in rat kidney and colon but not in lung. Induction of sgk by aldosterone was detected in kidney cortex and medulla, whereas the papilla expressed a constitutively high level of the kinase. The increase in sgk mRNA was detected as early as 30 min after the hormonal application and was independent of de novo protein synthesis. The observed aldosterone dose-response relationships suggest that the response is mediated, at least in part, by occupancy of the mineralocorticoid receptor. Coexpressing sgk and ENaC in Xenopus oocytes evoked a fourfold increase in the amiloride-blockable Na+ channel activity. A point mutation in the beta -subunit known to impair regulation of the channel by Nedd4 (Y618A) had no significant effect on the response to sgk.

epithelial sodium channel; Xenopus laevis oocytes; kidney collecting duct


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE APICAL SURFACE OF MANY tight epithelia expresses a Na+-selective channel primarily characterized by its high affinity to the diuretic inhibitor amiloride (12, 17, 24). This channel, termed ENaC (epithelial Na+ channel), mediates Na+ absorption in kidney collecting duct, distal colon, lung, and exocrine glands. It has been cloned by functional expression and is composed of three homologous subunits denoted alpha , beta , and gamma  ENaC (6). The central role of ENaC in determining extracellular fluid and electrolyte homeostasis has been established by the phenotypic analysis of ENaC-knockout mice and the identification of genetic diseases associated with mutations in ENaC subunits (for review, see Ref. 18). Elucidating the molecular mechanism underlying channel activation by one of these mutations led to the identification of Nedd4 as a key regulator of ENaC (10, 15, 33, 35, 37). These studies have demonstrated specific interactions between PY motifs in the COOH tails of ENaC subunits and WW domains in Nedd4. Such interactions determine the lifetime of ENaC in the apical surface by controlling its ubiquitination and degradation.

ENaC is also a major target to the natriferic action of the mineralocorticoid aldosterone. The hormonal response is mediated by altered gene expression, leading to an increase in ENaC activity, which develops over several hours (11, 40). Many studies have established that this response is only partly mediated by an enhanced transcription of the channel protein (for review, see Refs. 12 and 40). Hence, it is generally believed that the initial response to aldosterone requires the synthesis of regulatory proteins that control ENaC translation, cell surface expression, or single-channel properties (12, 25, 40).

Several mRNA species, the abundance of which in epithelial cells is elevated by aldosterone, have been reported (4, 8, 28, 31, 36). One recently identified aldosterone-induced protein is the serum- and glucocorticoid-dependent serine/threonine kinase (sgk) (8, 26, 43). This kinase is known to be regulated by serum, glucocorticoids, hypertonicity, secretagogs, and other factors (9, 19, 41, 42). Chen et al. (8) have demonstrated that sgk mRNA and protein are strongly and rapidly elevated in amphibian A6 cells and in rat kidney after stimulation by dexamethasone and aldosterone, respectively. More importantly, coexpressing sgk and ENaC in Xenopus laevis oocytes resulted in a marked increase in channel activity. Similar observations have been reported by Naray-Fejes-Toth et al. (26) by using primary cultures from rabbit cortical collecting duct (CCD).

The present study aims to further characterize effects of aldosterone on sgk mRNA in native mammalian epithelia and explore possible mechanisms by which the kinase activates ENaC. The following two issues were addressed. 1) How does aldosterone affect the abundance of sgk mRNA in different kidney segments, distal colon, and lung? Effects of aldosterone on the expression of ENaC subunits are very different in these tissues (3, 30, 38). 2) What is the time course and steroid specificity of the response in the native epithelia? In addition, we have further characterized effects of sgk on ENaC activity in Xenopus laevis oocytes. The results obtained indicate that aldosterone increases the abundance of sgk mRNA in distal colon and kidney cortex or medulla but not in kidney papilla or lung. The effect is evoked, at least in part, by occupancy of the mineralocorticoid receptor, and its time course fits the early activation of channels by aldosterone. A point mutation in beta rENaC, known to impair the regulation of ENaC by Nedd4, has no effect on the response to sgk.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animal treatment and RNA isolation. Experiments were carried out using 8- to 10-wk-old male Wistar rats. Manipulations of plasma mineralocorticoids were done by the following treatments. 1) Subcutaneous implantation of osmotic minipumps (model 2001, Alza, Palo Alto, CA) was performed and pumps were filled with aldosterone dissolved in polyethylene glycol 300 to a concentration designed to achieve delivery rates of ~10 µg · kg-1 · h-1. They were preincubated in saline for 24 h, to avoid a lag time in aldosterone secretion. 2) Rats were fed a Na+-deficient diet (ration 909902, ICN, Cleveland, OH) for 2 wk. Some of the Na+-deprived rats were resalinated for 24 h by feeding them a normal chow and including 110 mM NaCl in their drinking water. 3) Subcutaneous injections of dexamethasone suspended in corn oil (6 mg/kg) were done.

Animals were killed by cervical dislocation, the lung, kidney, and distal colon were excised, and RNA was isolated by using a Tri-Reagent kit (Molecular Research Center, Cincinnati, OH). Kidneys were dissected on an ice bed into cortex, medulla, and papilla, and the different segments were homogenized in the Tri-Reagent solution by using a Polytron (Kinematica, Lucerne, Switzerland, 30 s at setting 10). The distal colon was cut open, rinsed in PBS, and immersed in the Tri-Reagent solution. The lysed epithelial cell layer was scraped off using a sterile glass slide, suspended in Tri-Reagent, and homogenized. For in vitro incubation with aldosterone, the distal colon was cut into several roughly equal segments and incubated for 2 h on gelatin sponge rafts soaked in PBS with and without aldosterone and other reagents, as previously described (1). Tissue segments from two to three rats exposed to the same treatment were pooled together, and RNA was extracted as above. Blood was drawn shortly after the animals were killed and was used to determine the plasma concentration of aldosterone by a radioimmunoassay (Coat-a-Count Aldosterone kit; DPG, Los Angeles, CA).

Aliquots of 10 µg total RNA were resolved electrophoretically under denaturating conditions (formamide/formaldehyde), transferred to nylon membranes (GeneScreen, NEN Research Products, Boston, MA), and hybridized with a 32P-labeled cDNA probe corresponding to the untranslated 3' region of mouse sgk (see next section). After autoradiography, the bound radioactivity was removed, and membranes were hybridized with a control cDNA probe corresponding to 18S ribosomal RNA. Hybridization was quantified by phosphor imaging (Fujix BAS 1000). Each observation was confirmed by at least three independent RNA preparations.

Plasmids and constructs. An IMAGE Consortium clone, which includes the whole coding region of sgk (mouse embryo, ID 570181, accession number aa389214), was obtained from Research Genetics (Huntsville, AL) and fully sequenced.1 Its deduced amino acid sequence corresponds to a 431-amino acid polypeptide with >90% identity to rat and human sgk. Northern blot hybridizations were done by using an 0.8-kb Nhe I fragment corresponding to the most 3' untranslated region of this cDNA. This area is 88% identical to rat sgk and has no significant homology to any other kinase registered in public databases. For functional expression in Xenopus oocytes, the above insert was subcloned into a modified pBluescript SK+ vector between the 5' and 3' untranslated regions of Xenopus beta -globin (16). cDNAs coding for the alpha -, beta -, and gamma -rENaC in pSPORT-1, were kindly provided by B. C. Rossier, (Institute of Pharmacology, Univ. of Lausanne). 3-Phosphoinositide-dependent protein kinase (PDK1) cDNA was kindly provided by D. R. Alessi (Dept. of Biochemistry, Univ. of Dundee).

A point mutation in the beta -subunit (Y618A) was introduced by generating two PCR products with overlapping sequences and reamplifying them with the outside primers. The mutating oligonucleotides used were ACGCTGACTCACTGAGGCTGCAGCCGC and CTCAGGGAGTCAGCGTTGGGAGGTG. The resulting construct was verified by sequencing.

Functional expression in Xenopus oocytes. cRNAs coding for the three channel subunits and sgk were transcribed in vitro from linearized plasmids. Stage IV-V Xenopus oocytes were injected with cRNA mixtures containing ~2.5 ng of each construct and maintained at 17°C in a low-Na+ medium composed of (in mM) 10 NaCl, 86 choline chloride, 2 KCl, 1 MgCl2, 1 CaCl2, and 5 HEPES (pH = 7.6), as well as 100 U/ml penicillin and 100 µg/ml streptomycin. Electrophysiological measurements were performed 48-96 h after the injection by means of the two-electrode voltage-clamp technique by using a CA1 Dagan amplifier. The amplified signal was digitized by using the Digidata 1200 (Axon Instruments) and stored and analyzed by using pCLAMP 6 software (Axon Instruments). The external recording solution was composed of (in mM) 96 NaCl, 2 KCl, 1 MgCl2, 1 CaCl2, and 5 HEPES (pH 7.4) ± 5 µM amiloride dissolved in DMSO. Current traces in the presence of amiloride were subtracted from the current traces in the absence of amiloride, and the resulting amiloride-sensitive current traces were used in the analysis. Normalization of current amplitudes was done to traces at -100 mV in oocytes injected with alpha beta gamma or alpha beta (Y618A)gamma without sgk. Data are presented as means ± SE.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Initial experiments have assessed effects of aldosterone on the expression of sgk mRNA in rat distal colon. Under proper conditions, this tissue can be maintained in vitro for at least 2 h, with no significant loss of cell viability or RNA integrity. Hence, it enables the study of regulation of RNA in native cells, exposed to well-defined steroid concentrations. Figure 1 depicts representative Northern blots of sgk cDNA with colonic RNA extracted after different manipulations. Data averaged from several independent RNA preparations are summarized in Fig. 2. In agreement with previous studies in dexamethasone-treated A6 cells (8) and primary CCD cultures (26), aldosterone evoked a marked (~5-fold) increase in the abundance of sgk mRNA. The effect was rapid, and substantial induction was already apparent 30 min after the mineralocorticoid was introduced (Figs. 1A and 2A). Unlike the above-described studies, the message abundance increased monotonously during the incubation period, and no saturation was apparent. More than 50% of the induction in sgk was evoked by 10 nM aldosterone (Fig. 2B). This dose is well within the range of diet-induced variations in plasma aldosterone. It also suggests that at least part of the response is mediated by the mineralocorticoid receptor (see DISCUSSION). Further support for involvement of the mineralocorticoid receptor is provided by the inhibitory action of RU 26752, a specific mineralocorticoid antagonist (22) (Fig. 1C). This figure also demonstrates that the translational inhibitor cycloheximide does not block (and in fact increases) the induction of sgk by aldosterone. Thus the response observed is a primary one, not mediated by other aldosterone-induced transcription factors.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 1.   Effects of aldosterone on the expression of serum- and glucocorticoid-dependent kinase (sgk) in distal colon. Colonic segments pooled from 2-3 rats were incubated in vitro for 2 h under different conditions as described under MATERIALS AND METHODS. The epithelial layer was lysed, RNA isolated, resolved electrophoretically, and hybridized with 32P cDNA probes corresponding to sgk and 18S RNA, respectively. A: 30 nM aldosterone was added at different times after incubation was initiated to achieve indicated stimulation periods. B: tissue segments received indicated concentrations of aldosterone (Aldo) or dexamethasone (Dexa) at t = 0. C: tissue segments were incubated for 2 h with diluent (lane 1), 100 nM aldosterone (lane 2), 100 nM aldosterone+1 µM cycloheximide (lane 3), and 30 nM aldosterone+30 µM RU 26752 (lane 4).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2.   Aldosterone time course (A) and dose-response curve (B). Time course and dose response of in vitro induction of sgk were measured by protocol from Fig. 1. Data were normalized to sgk abundance after 2-h incubation with 1 µM dexamethasone (100%). Values are means ± SE of 5 experiments.

Subsequent experiments have studied expression of sgk in rats perfused in vivo with aldosterone, through use of an osmotic minipump. Such treatment enables investigation of the regulation of sgk in kidney and lung, which cannot be done in vitro, as well as the study of more chronic effects of the steroid. In kidney, the highest level of sgk mRNA was detected in the papilla with much lower values in the medulla and cortex (Fig. 3). Perfusing rats with aldosterone evoked an almost threefold increase in the abundance of sgk mRNA in the cortex and medulla but no significant change in the papilla (Fig. 3, Table 1). As in the in vitro experiments the response was rapid, and maximal change was observed 90 min after the perfusion was initiated. The plasma level of aldosterone increased under these conditions from 0.89 nM in the control rats, to 11.8 and 19.5 nM in rats implanted with the pumps for 90 and 180 min, respectively. Other experiments have shown a marked induction of sgk by feeding rats a low-Na+ diet for 2 wk. This effect could be reversed by 24-h resalination (not shown). The lung appeared to express a much lower level of sgk, and no induction by aldosterone could be seen (Figs. 3 and 4). However, a significant elevation of sgk mRNA in lung could be evoked by a maximal dose of dexamethasone. This observation is in agreement with the fact that Na+ transport in this tissue is under the control of glucocorticoids (7, 39). Even under maximal stimulation, expression of sgk in the lung was much lower than in the other epithelia.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3.   In vivo effects of aldosterone on expression of sgk mRNA. Rats were either sham operated or implanted with aldosterone-containing minipumps for either 90 or 180 min. RNA was isolated from different kidney segments, lung, and distal colon and blotted as in Fig. 1. For each tissue, data presented (lanes) refer to sham operated (left), 90-min aldosterone perfusion (middle), and 180-min perfusion (right).


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Aldosterone-induced changes in sgk mRNA



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   Glucocorticoid-dependent regulation of sgk mRNA. Rats were treated in 1 of the following ways: sham operated (hatched bars), perfused with aldosterone for 3 h through osmotic minipumps (filled bars), or received a single injection of dexamethasone 3 h before experiment (open bars). RNA was extracted from kidney, colon, and lung, and assayed for abundance of sgk mRNA. Data were normalized to value of distal colon in sham-operated rats. Values are means ± SE of 3 RNA preparations.

Recent studies have demonstrated that PDK1 can activate sgk by phosphorylating it (21, 27). This enzyme also appears to be involved in the regulation of ENaC by insulin (29). It was therefore of interest to test whether PDK1, too, is under the transcriptional control of aldosterone. Perfusing rats for 3 h with either aldosterone or dexamethasone did not affect abundance of PDK1 mRNA in colon, kidney medulla, or lung (data not shown).

A mediating role for sgk in the natriferic action of aldosterone is inferred from the finding that coexpressing amphibian ENaC and sgk in Xenopus oocytes elevates the macroscopic amiloride-blockable current (8, 26). A similar response was observed in the present study, with the mouse sgk clone used in the above hybridizations (Fig. 5). A major pathway that controls cell surface expression (and activity) of ENaC in Xenopus oocytes involves interactions between its PY motifs and Nedd4 (15, 33, 35, 37). Mutating the corresponding tyrosine on the beta -subunit into alanine was shown to increase channel activity and also block its downregulation by cell Na+ (20). To test for a possible role of the above mechanism in the response to sgk, we have compared the sgk-induced activation of the wild-type channel and the beta Y618A mutant (Fig. 5). In both cases a similar sgk-dependent potentiation of the current was apparent, arguing against an involvement of the above mechanism in the response to sgk.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of sgk on channel activity in Xenopus laevis oocytes. Xenopus oocytes were injected with alpha -, beta -, and gamma -rat epithelial Na+ channel (rENaC) ± sgk cRNA (~2.5 ng of each construct). A and B: amiloride-blockable current-voltage relationships of alpha beta gamma ENaC and alpha beta (Y618A)gamma expressed with () and without (open circle ) sgk. Currents were elicited by step depolarization from holding potential of -80 mV to various test potentials in 10-mV decrements (from +50 to -100 mV) for 160 ms. Data points are means ± SE of 6 oocytes (error bars are smaller than symbols). C: means ± SE normalized currents at -100 mV. Currents were recorded for 8-11 oocytes from 2 different batches and normalized to mean value in the absence of sgk. Currents in oocytes injected with mutated channel were higher by 43.5 ± 0.08% (n = 14-16) from those recorded in oocytes injected with wild-type ENaC. Statistically significant response to sgk: * P < 0.005 for alpha beta gamma ; * P < 0.01 for alpha beta (Y618A)gamma .


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Sgk has been recently identified as an aldosterone-induced mRNA and protein in amphibian A6 cells and mammalian kidney. Its putative mediating role in the hormonal stimulation of Na+ transport is strongly supported by the observation that coexpressing ENaC and sgk in Xenopus oocytes elevates the macroscopic amiloride-blockable current (8, 26). The present study further explored regulation of sgk mRNA by aldosterone and its possible interaction with ENaC. One purpose was to explore the steroid specificity and time course in mammalian native epithelia. Previous work has been done either in amphibian A6 cells by using the synthetic glucocorticoid dexamethasone or in primary collecting duct culture (8, 26). Demonstration of a mineralocorticoid response is important in establishing a role for sgk in Na+ homeostasis, in particular because its induction by glucocorticoid is well established and not specific to epithelial tissues (5, 23, 43).

One set of measurements was done by in vitro incubation of distal colon with defined amounts of corticosteroids and for specific periods of time. These experiments have established that, as in A6 cells and primary CCD cultures, induction of sgk in distal colon is apparent within 30 min; i.e., it precedes the initial increase in Na+ transport. Previous studies by several groups have identified different phases in the response to aldosterone (for review, see Ref. 40). In particular, the increase in apical Na+ permeability involves an acute activation of preexisting channels, and a chronic induction of ENaC mRNA and presumably protein (1-3, 13). Thus the time course depicted in Fig. 2A suggests a mediating role of sgk in the "early" activation of Na+ channels.

Aldosterone can bind to both mineralocorticoid (high-affinity) and glucocorticoid (low-affinity) receptors. Maximal stimulation of Na+ transport may require at least a partial occupancy of the glucocorticoid receptor or glucocorticoid/mineralocorticoid heterodimers (13, 14). As shown in Fig. 2B about one-half of the response was evoked by 10 nM aldosterone. At this concentration the mineralocorticoid receptor is mostly occupied [diffusion coefficient (Kd) = 4.1 nM (34)] whereas population of the glucocorticoid receptor is low [Kd = 25-60 nM (32)]. Maximal induction of sgk was seen for >100 nM aldosterone. At this concentration substantial occupancy of the glucocorticoid receptor will take place.

Experiments in which rats were perfused in vivo with aldosterone through osmotic minipumps confirmed the rapid induction of sgk; i.e., stimulation after 90 min was equal to or greater than the response at 180 min. The increase in sgk mRNA was apparent even after a chronic hyperaldosteronism (i.e., 2-wk salt deprivation), but its magnitude was considerably lower than in the acute response. In vivo experiments have also established induction of sgk by aldosterone in kidney cortex and medulla but not in papilla or lung (Fig. 3). The response seen in cortex and medulla was somewhat smaller than in the distal colon (cf. Table 1). This quantitative difference may stem from the heterogeneity of the segmental kidney preparations that also pool nephron segments in which sgk is constitutively expressed. Indeed, we have observed high, aldosterone-independent abundance of sgk in the papilla. It may reflect a role of this kinase in the osmotic adaptation of the inner medullary collecting duct (41, 42).

In the last set of experiments sgk was coexpressed with the three ENaC subunits in Xenopus oocytes. These experiments have confirmed recent findings (8, 26) and provided initial insight into the underlying mechanism. We observed that mutating Y618 in the beta -subunit to alanine does not prevent the sgk-induced increase in channel activity. This point mutation has been shown to increase ENaC cell surface expression by preventing its binding to Nedd4 and ubiquitination (33, 35, 37). It also prevents feedback inhibition of channels by high cell Na+ (20). The fact that this mutation does not prevent the response to sgk argues against a mediating role of the above mechanisms. However, it is still possible that Nedd4 is involved in the sgk-dependent activation of channels, through the alpha - or gamma -subunits. It is also interesting to note that the sgk-induced increase in channel activity reported in this study has been measured in oocytes maintained for >= 48 h at 10 mM Na+. Under these conditions, downregulation of ENaC cell surface expression by interaction with Nedd4 and cell Na+ is minimal (20).

In conclusion, the present study establishes that sgk is an early aldosterone-induced gene in rat kidney and colon and provides some information on the mechanism by which the kinase activates the Na+ channel.


    ACKNOWLEDGEMENTS

This study was supported by research grants from the MINERVA foundation, Germany (to H. Garty), The Israel Science Foundation (to H. Garty and E. Reuveny), and the Ebner Family Biomedical Research Foundation (to E. Reuveny).


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

1 This sequence is available under accession number AF205855.

Address for reprint requests and other correspondence: H. Garty, Dept. of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100, Israel (E-mail: h.garty{at}weizmann.ac.il).

Received 30 July 1999; accepted in final form 11 November 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Asher, C, Eren R, Kahn L, Yeger O, and Garty H. Expression of the amiloride-blockable Na+ channel by RNA from control versus aldosterone-stimulated tissue. J Biol Chem 267: 16061-16065, 1992[Abstract/Free Full Text].

2.   Asher, C, and Garty H. Aldosterone increases the apical Na+ permeability of toad bladder by two different mechanisms. Proc Natl Acad Sci USA 85: 7413-7417, 1988[Abstract].

3.   Asher, C, Wald H, Rossier BC, and Garty H. Aldosterone-induced increase in the abundance of Na+ channel subunits. Am J Physiol Cell Physiol 271: C605-C611, 1996[Abstract/Free Full Text].

4.   Attali, B, Latter H, Rachamim N, and Garty H. A corticosteroid-induced gene expressing an "IsK-like" K+ channel activity in Xenopus oocytes. Proc Natl Acad Sci USA 92: 6092-6096, 1995[Abstract/Free Full Text].

5.   Buse, P, Tran SH, Luther E, Phu PT, Aponte GW, and Firestone GL. Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, sgk, in mammary tumor cells. A novel convergence point of anti-proliferative and proliferative cell signaling pathways. J Biol Chem 274: 7253-7263, 1999[Abstract/Free Full Text].

6.   Canessa, CM, Schild L, Buell G, Thorens B, Gautschi I, Horisberger J-D, and Rossier BC. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 367: 463-467, 1994[ISI][Medline].

7.   Champigny, G, Voilley N, Lingueglia E, Friend V, Barbry P, and Lazdunski M. Regulation of expression of the lung amiloride-sensitive Na+ channel by steroid hormones. EMBO J 13: 2177-2181, 1994[Abstract].

8.   Chen, SY, Bhargava A, Mastroberardino L, Meijer OC, Wang J, Buse P, Firestone GL, Verrey F, and Pearce D. Epithelial sodium channel regulated by aldosterone-induced protein sgk. Proc Natl Acad Sci USA 96: 2514-2519, 1999[Abstract/Free Full Text].

9.   Delmolino, LM, and Castellot JJJ Heparin suppresses sgk, an early response gene in proliferating vascular smooth muscle cells. J Cell Physiol 173: 371-379, 1997[ISI][Medline].

10.   Dinudom, A, Harvey KF, Komwatana P, Young JA, Kumar S, and Cook DI. Nedd4 mediates control of an epithelial Na+ channel in salivary duct cells by cytosolic Na+. Proc Natl Acad Sci USA 95: 7169-7173, 1998[Abstract/Free Full Text].

11.   Garty, H. Regulation of Na+ permeability by aldosterone. Semin Nephrol 12: 24-29, 1992[ISI][Medline].

12.   Garty, H, and Palmer LG. Epithelial Na+ channels: function, structure, and regulation. Physiol Rev 77: 359-396, 1997[Abstract/Free Full Text].

13.   Garty, H, Peterson-Yantorno K, Asher C, and Civan MM. Effects of corticoid agonists and antagonists on the apical Na+ permeability of toad urinary bladder. Am J Physiol Renal Fluid Electrolyte Physiol 266: F108-F116, 1994[Abstract/Free Full Text].

14.   Geering, K, Claire M, Gaeggeler H-P, and Rossier BC. Receptor occupancy vs. induction of Na-K-ATPase and Na transport by aldosterone. Am J Physiol Cell Physiol 248: C102-C108, 1985[Abstract/Free Full Text].

15.   Goulet, CC, Volk KA, Adams CM, Prince LS, Stokes JB, and Snyder PM. Inhibition of the epithelial Na+ channel by interaction of Nedd4 with a PY motif deleted in Liddle's syndrome. J Biol Chem 273: 30012-30017, 1998[Abstract/Free Full Text].

16.   Guillemare, E, Honoré E, Pradier L, Lesage F, Schweitz H, Attali B, Barhanin J, and Lazdunski M. Effects of the level of mRNA expression on biophysical properties, sensitivity to neurotoxins, and regulation of the brain delayed-rectifier K+ channel Kv1.2. Biochemistry 31: 12463-12468, 1992[ISI][Medline].

17.   Horisberger, JD. Amiloride-sensitive Na channels. Current Opin Cell Biol 10: 443-449, 1998[ISI][Medline].

18.   Hummler, E, and Horisberger JD. Genetic disorders of membrane transport. V. The epithelial sodium channel and its implication in human diseases. Am J Physiol Gastrointest Liver Physiol 276: G567-G571, 1999[Abstract/Free Full Text].

19.   Imaizumi, K, Tsuda M, Wanaka A, Tohyama M, and Takagi T. Differential expression of sgk mRNA, a member of the Ser/Thr protein kinase gene family, in rat brain after CNS injury. Brain Res Mol Brain Res 26: 189-196, 1994[ISI][Medline].

20.   Kellenberger, S, Gautschi I, Rossier BC, and Schild L. Mutations causing Liddle syndrome reduce sodium-dependent downregulation of the epithelial sodium channel in the Xenopus oocyte expression system. J Clin Invest 101: 2741-2750, 1998[Abstract/Free Full Text].

21.   Kobayashi, T, and Cohen P. Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339: 319-328, 1999[ISI][Medline].

22.   Lazar, G, and Agarval M. Evidence for an antagonist specific receptor that does not bind mineralocorticoid agonists. Biochem Biophys Res Commun 134: 261-265, 1986[ISI][Medline].

23.   Maiyar, AC, Phu PT, Huang AJ, and Firestone GL. Repression of glucocorticoid receptor transactivation and DNA binding of a glucocorticoid response element within the serum/glucocorticoid- inducible protein kinase (sgk) gene promoter by the p53 tumor suppressor protein. Mol Endocrinol 11: 312-329, 1997[Abstract/Free Full Text].

24.   Matalon, S, and Brodovich HO. Sodium channels in alveolar epithelial cells: molecular characterization, biophysical properties, and physiological significance. Ann Rev Physiol 61: 627-661, 1999[ISI][Medline].

25.   May, A, Puoti A, Gaeggeler HP, Horisberger JD, and Rossier BC. Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel alpha subunit in A6 renal cells. J Am Soc Nephrol 8: 1813-1822, 1997[Abstract].

26.   Naray-Fejes-Toth, A., Canessa C, Cleaveland ES, Aldrich G, and Fejes-Toth G. sgk is an aldosterone-induced kinase in the renal collecting duct. Effects on epithelial Na+ channels. J Biol Chem 274: 16973-16978, 1999[Abstract/Free Full Text].

27.   Park, J, Leong ML, Buse P, Maiyar AC, Firestone GL, and Hemmings BA. Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18: 3024-3033, 1999[Abstract/Free Full Text].

28.   Rachamim, N, Latter H, Asher C, Wald H, and Garty H. Dexamethasone enhances expression of mitochondrial oxidative-phosphorylation genes in rat distal colon. Am J Physiol Cell Physiol 269: C1305-C1310, 1995[Abstract/Free Full Text].

29.   Record, RD, Froelich LL, Vlahos CJ, and Blazer-Yost BL. Phosphatidylinositol 3-kinase activation is required for insulin-stimulated sodium transport in A6 cells. Am J Physiol Endocrinol Metab 274: E611-E617, 1998[Abstract/Free Full Text].

30.   Renard, S, Voillet N, Bassilana F, Lazdunski M, and Barbry P. Localization and regulation by steroids of the alpha , beta  and gamma  subunits of the amiloride-sensitive Na+ channel in colon, lung and kidney. Pflügers Arch 430: 299-307, 1995[ISI][Medline].

31.   Rokaw, MD, Benos DJ, Palevsky PM, Cunningham SA, West ME, and Johnson JP. Regulation of a sodium channel-associated G-protein by aldosterone. J Biol Chem 271: 4491-4496, 1996[Abstract/Free Full Text].

32.   Rossier, BC, Geering K, Atkinson J, and Roch-Ramel F. Renal receptors. In: The Kidney: Physiology and Pathophysiology, edited by Seldin D. W., and Giebisch G.. New York: Raven, 1985, p. 775-806.

33.   Schild, L, Lu Y, Gautschi I, Schneeberger E, Lifton RP, and Rossier BC. Identification of a PY motif in the epithelial Na channel subunits as a target sequence for mutations causing channel activation found in Liddle's syndrome. EMBO J 15: 2381-2387, 1996[Abstract].

34.   Schulman, G, Miller-Diener A, Litwack G, and Bastl CP. Characterization of the rat colonic aldosterone receptor and its activation process. J Biol Chem 261: 12102-12108, 1986[Abstract/Free Full Text].

35.   Snyder, PM, Price MP, Mcdonald FJ, Adams CM, Volk KA, Zeiher BG, Stokes JB, and Welsh MJ. Mechanism by which Liddle's syndrome mutations increase activity of a human epithelial Na+ channel. Cell 83: 969-978, 1995[ISI][Medline].

36.   Spindler, B, Mastroberardino L, Custer M, and Verrey F. Characterization of early aldosterone-induced RNAs identified in A6 kidney epithelia. Pflügers Arch 434: 323-331, 1997[ISI][Medline].

37.   Staub, O, Dho S, Henry PC, Correa J, Ishikawa T, Mcglade J, and Rotin D. WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelial Na+ channel deleted in Liddle's syndrome. EMBO J 15: 2371-2380, 1996[Abstract].

38.   Stokes, JB, and Sigmund RD. Regulation of rENaC mRNA by dietary NaCl and steroids: organ, tissue, and steroid heterogeneity. Am J Physiol Cell Physiol 274: C1699-C1707, 1998[Abstract/Free Full Text].

39.   Tchepichev, S, Ueda J, Canessa C, Rossier BC, and O'brodovich H. Lung epithelial Na channel subunits are differentially regulated during development and by steroids. Am J Physiol Cell Physiol 269: C805-C812, 1995[Abstract].

40.   Verrey, F. Transcriptional control of sodium transport in tight epithelia by adrenal steroids. J Memb Biol 144: 93-110, 1995[ISI][Medline].

41.   Waldegger, S, Barth P, Forrest JNJ, Greger R, and Lang F. Cloning of sgk serine-threonine protein kinase from shark rectal gland---a gene induced by hypertonicity and secretagogues. Pflügers Arch 436: 575-580, 1998[ISI][Medline].

42.   Waldegger, S, Barth P, Raber G, and Lang F. Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci USA 94: 4440-4445, 1997[Abstract/Free Full Text].

43.   Webster, MK, Goya L, Ge Y, Maiyar AC, and Firestone GL. Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13: 2031-2040, 1993[Abstract].


Am J Physiol Renal Fluid Electrolyte Physiol 278(4):F613-F619
0363-6127/00 $5.00 Copyright © 2000 the American Physiological Society