1Division of Nephrology, Department of Pediatrics, Schneider's Children's Hospital of the North Shore-Long Island Jewish Health System, Long Island Campus for the Albert Einstein College of Medicine, and 2Department of Pathology, Schneider's Children's Hospital, New Hyde Park, New York; and 3Department of Biochemistry and Molecular Biology, Pennsylvania State University College of Medicine, Hershey, Pennsylvania
Submitted 28 January 2005 ; accepted in final form 3 June 2005
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
diabetes; angiotensin-converting enzyme; kidney disease
Meprins are metalloendopeptidases located in the brush-border membrane (BBM) of renal proximal tubule cells (3). Meprins are composed of two distinct subunits, and
, that are encoded by distinct genes on human chromosomes 6 and 18, respectively (4). The mature meprin protein is an oligomer that is composed of varying combinations of
- and
-subunits. Any form of meprin that contains the meprin
-subunit is called meprin A (EC 3.4.24.18
[EC]
). The
-subunit retains a hydrophobic transmembrane domain, whereas this domain is removed by proteolytic processing of the meprin
-subunit (MEP-
) during biosynthesis. Thus homooligomers of MEP-
s are secreted into the urine, while any combination of meprin subunits containing a
-subunit is anchored to the membrane (3).
Alterations in meprin A activity have been described in experimental models of kidney disease. The susceptibility to ischemic and nephrotoxic acute renal failure is decreased in inbred strains of mice with low meprin A activity (29). Meprin A activity in renal homogenates is altered in rats with streptozocin (STZ)-induced diabetes and puromycin aminonucleoside nephropathy (28). The role of meprin A in the pathogenesis of renal damage may depend on the acuity vs. chronicity of the disease process. Injury-induced alterations in cell-surface distribution of the metalloproteinase and alterations in membrane anchoring of meprin- may be critical determinants of the impact of meprin A on the course of kidney disease. Thus, in acute renal injury, high levels of meprin A may be deleterious because of inappropriate localization of the enzyme in disrupted tissue. In chronic forms of nephropathy, low meprin A activity may result in increased fibrosis and progression of glomerulopathies such as DN.
There is an increased susceptibility to develop nephropathy in patients with type 2 diabetes that is linked to chromosome 18, in the vicinity of the gene encoding the meprin- subunit (15, 23a). Meprin-
is associated with ACE within the BBM of proximal tubule cells. In view of the role of the renin-angiotensin system (RAS) as a final common pathway mediating progressive DN, this raises the possibility that the beneficial effects of modulating the RAS in DN may be related, at least in part, to alteration in the expression and activity of membrane-bound meprin A in both type 1 and type 2 diabetes (3).
Therefore, we conducted the following studies to determine whether 1) MEP- and MEP-
gene and protein expression are altered in db/db mice, a model of type 2 diabetes, before the onset of kidney disease; 2) there are changes in renal meprin A expression in chronic DN that develop in db/db mice; 3) long-term administration of an ACE inhibitor or ARB alters the course of DN in db/db mice; and 4) the effect of ACE inhibitor or ARB therapy on DN is related to the modulation of meprin A.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Male C57BLKS/J-m +/+Lepr db/db and C57BLKS/J (lean, nondiabetic littermates) mice (Jackson Laboratories, Bar Harbor, ME) and male Sprague-Dawley rats (Taconic Farms, Germantown, NY) were housed in an animal facility that was maintained at 25°C with a 12:12-h light-dark cycle. Animals had free access to water and standard rodent chow (PMI Nutrition International, Brentwood, MO). The studies were approved by the Institutional Animal Care and Use Committee of Long Island Jewish Medical Center.
Disease Models
The following models of types 1 and 2 diabetes were studied.
db/db Mice. These animals, which lack the hypothalamic leptin receptor, represent a model of type 2 diabetes mellitus (10). They develop hyperglycemia by 47 wk of age with fasting serum glucose levels >250 mg/dl.
STZ-diabetes. Rats, weighing 180280 g at the onset of the experimental protocol, were given a single intraperitoneal injection of STZ, 60 mg/kg body wt (Upjohn, Kalamazoo, MI). This islet cell toxin induces a model of type 1 diabetes mellitus. STZ was dissolved in 0.01 M citrate buffer, pH 4. The diabetic state was confirmed by documentation of hyperglycemia, namely fasting serum glucose concentration >250 mg/dl, within 48 h after injection of STZ.
Experimental Design
The following two studies were performed.
Initial.
db/db Mice (n = 9) and lean littermate controls (n = 17) were killed at 1314 wk of age to assess kidney size and renal expression of MEP- and MEP-
genes and protein before the onset of clinically detectable DN.
Treatment. Twenty db/db mice were randomly assigned to one of the following three groups: 1) DB-C: mice given distilled water to drink, n = 6; 2) DB-EN: mice given drinking water containing the ACE inhibitor enalapril (EN), 50 mg/l, n = 7; and 3) DB-LOS: mice given drinking water containing the ARB losartan (LOS), 500 mg/l, n = 7. Twenty-two lean mice were randomized to the same three groups: 1) C-C: untreated drinking water, n = 7; 2) C-EN: EN-treated water, n = 8; and 3) C-LOS: LOS-treated water, n = 7.
Treatment was started at 8 wk of age when all of the db/db mice were hyperglycemic, and therapy was continued for 52 wk. A sample of mice (n = 3) from each group was killed after 24 wk and the remaining animals were maintained for the full 52-wk treatment period. The number of samples analyzed by the various experimental methods differed depending on the number of animals available in the specific groups at each study time point.
Urine samples and kidney tissue obtained from control, nondiabetic and untreated STZ-diabetic rats after 52 wk of observation were analyzed for urinary meprin- excretion and renal meprin A enzymatic activity and BBM MEP-
content, respectively. These rats were investigated previously in an experimental protocol that was designed to evaluate the effect of antioxidant therapy on the course of chronic DN (27).
Sample Collection
Urine. Urine was obtained from db/db mice at the start of the study and at 4-wk intervals. Mice were placed in metabolic cages for 68 h and deprived of food but provided water ad libitum. Urine was centrifuged to remove debris and stored at 20°C.
Serum. Blood was collected from db/db mice at the start of the study and at 8-wk intervals. Animals were fasted for 24 h before blood sampling. Mice were anesthetized with CO2 inhalation and blood was collected by puncture of the retro-orbital venous plexus. Blood was allowed to clot at room temperature, centrifuged at 13,000 g for 2 min, and the serum was stored at 20°C.
Kidneys. After 24 or 52 wk, mice were killed and both kidneys were rapidly removed. One intact kidney was snap-frozen at 70°C. The second kidney was cut in half longitudinally. One half was frozen and the other half was immersion fixed in 10% formalin.
Biochemical Analysis
Urine creatinine concentration was measured using a Beckman CX3 analyzer (Beckman Instruments, Brea, CA). Serum blood urea nitrogen (BUN), creatinine, triglycerides, total cholesterol, Na+, glucose, and albumin were determined with a Beckman CX3 Biochemistry analyzer.
Urinary MEP-
Urinary MEP- protein quantitation was determined according to the procedure of Beynon et al. (2, 9a). Briefly, urine samples were desalted using mini Quick Spin Oligo Columns (Boerhinger Mannheim, Indianapolis, IN) that were prespun and preequilibrated with 50 µl of 20 mM HEPES, pH 7.6. Desalted urine samples, containing equivalent amounts of protein rather than equivalent amounts of creatinine, were subjected to immunoblotting for MEP-
protein detection. This approach was adopted because differences in meprin-
excretion are a consequence of alterations in proximal tubule structure and function rather than changes in glomerular filtration rate.
BBM Isolation
BBM were isolated from kidneys as previously described (28, 29). Briefly, one-quarter of a whole kidney was homogenized manually in 9 vol of a solution containing 2 mM Tris, pH 7, and 10 mM mannitol (homogenization buffer; Fujisawa USA, Deerfield, IL); 1 M MgCl2 was added to achieve a final concentration of 10 mM MgCl2. This mixture was stirred on ice for 15 min and then centrifuged at 1,500 g for 12 min. The sediment was discarded, and the supernatant was recentrifuged at 12,000 g for 12 min. Following the second centrifugation, the supernatant was discarded and the precipitate was suspended in 5 vol of homogenization buffer. These steps were repeated once more and the final precipitate was resuspended in 2 vol of homogenization buffer and stored at 70°C.
Renal Meprin A Activity in BBM
Fifty microliters of BBM samples and a blank solution were brought up to 125 µl with a buffer composed of 20 mM ethanolamine in 0.14 M NaCl, pH 9.5, in a 1.5-ml Eppendorf microcentrifuge tube. One-hundred twenty-five microliters of a solution containing 22 mg/ml azocasein, prepared in the same buffer and prewarmed to 37°C, was added to samples. Tubes were vortexed and incubated with gentle agitation at 37°C for 30 min. The reaction was stopped by adding 1 ml of 5% trichloroacetic acid to each tube. The tubes were vortexed and centrifuged at 13,000 g for 4 min. One milliliter of supernatant was removed and absorbance was measured at 340 nm. Units of activity (U) were calculated as follows: (absorbance x 1,000)/min incubation, and the specific activity was normalized per milligram of BBM protein (28).
Western Immunoblot Analysis
Urine or BBM samples were reduced using a sample buffer containing 125 mM Tris·HCl, 20% glycerol, 4% SDS, 10% -mercaptoethanol, and 0.01% bromophenol blue. Reduced samples were run on a 7.5% polyacrylamide gel and then transferred to a nitrocellulose membrane (Schleicher and Schuell, Keene, NH). Following transfer, membranes were blocked and incubated with one of the following primary antibodies for 1 h: HMC-14 (a polyclonal rabbit antibody against mouse meprin-A), HMC-51/HMC-52 (polyclonal rabbit antibodies against mouse MEP-
), or PSU57 (polyclonal rabbit antibody against mouse MEP-
). Comparable results were obtained with the different anti-MEP-
antibody preparations. Following incubation with the primary antibody, membranes were washed with a solution containing 10 mM Tris, 100 mM NaCl, and 0.1% Tween 20, and then incubated for 1 h with a secondary antibody against rabbit IgG conjugated with horseradish peroxidase (Organon Technika, West Chester, PA). Membranes were washed, exposed to chemiluminescent ECL detection reagent (Amersham Pharmacia Biotech, Buckinghamshire, UK), and radiographic films were developed. Densitometry was performed using an IS-1000 Digital Imaging System (Alpha Innotech, San Leandro, CA) to determine the relative intensities of the bands.
RNA Preparation
At age 13 wk, total RNA was extracted from the left kidneys of db/db and db/m mice (n = 8 for each group) using TRIzol (Invitrogen, Carlsbad, CA). The quantity and integrity of total RNA were determined by A260/A280 and agarose/formaldehyde gel electrophoresis, respectively.
Real-Time PCR
Synthesis of cDNA was performed with 2 µg of each RNA preparation, Superscript III Reverse transcriptase (Invitrogen) and hexanucleotide random primers (Roche, Indianapolis, IN). A reaction without reverse transcriptase was run in parallel for each RNA sample to control for DNA amplification. PCR Primers were designed with Primer express 1.5 software (Applied Biosystems) and the Spidey data mining tool (NCBI) was used to minimize DNA amplification. Primers were as follows: meprin- forward CGCCTCAAGTCTTGTGTGGATT; reverse, ATTTCATGTTCAATGGTGGCCTT (product size, 164 bp); meprin-
forward, AGGATTCAGCCAGGCAAGGA; reverse, CGTGACGATGGTAGACTCTGTCC (product size, 144 bp);
-actin: forward, TGACGTTGACATCCGTAAAGACC; reverse, CTCAGGAGGAGCAATGATCTTGA (product size, 148 bp). Quantitative fluorescent real-time PCR analysis was performed in an ABI 7700 sequence detector (Applied Biosystems) using the QuantiTect SYBR-Green PCR kit and 300 nM gene-specific primers. The cycle profile was 15 min at 95°C followed by 40 cycles of 15 s at 94°C, 30 s at 55°C, and 30 s at 71°C. Analyses of 40 ng cDNA for meprin-
and 16 ng for meprin-
and
-actin were performed in triplicate and reverse transcriptase negative control reactions in duplicate. For determination of standard curves and PCR efficiencies, standards were prepared using dilutions of C57Bl/6 mouse kidney total RNA. Differences between slopes were less than 0.1, and PCR efficiencies were >1.97 for all primer pairs. Data were normalized to
-actin and analyzed by the comparative threshold cycle method. The results are presented as fold expression relative to lean db/m mice.
Histopathological Analysis
Routine pathology. Renal tissue was formalin fixed and thin sections were stained with hematoxylin-eosin and periodic acid-Schiff reagents. Segmental sclerosis was defined as localized collapse of capillary lumina and replacement with eosinophilic hyalinized material, occasionally accompanied by adhesions to Bowman's capsule. Tubules and interstitium throughout the kidney were examined for dilatation, intratubular casts, tubular atrophy, interstitial infiltration with mononuclear cells, and replacement with fibrosis. The degree of tubulointerstitial alterations was graded on a scale from 0 to +3 as follows: 0, normal kidney; +1, mild abnormalities affecting <25% of the renal parenchyma; +2, moderate, 2550% involvement; and +3, severe, >50% of the kidney involved. The pathologist (EV) was unaware of the group assignment of individual animals.
Immunohistochemical analysis. Paraffin-fixed renal tissue specimens were cut into 4- to 5-µm sections and placed onto polylysine-coated slides. They were air dried briefly and then baked overnight at 56°C. Sections were deparaffinized through graded alcohol and then rinsed in tap water. Relevant antigens were retrieved from sections by rapid heating with microwave irradiation (890 W) in the presence of citrate buffer for 15 min and then rinsed in tap water. Primary antibody was applied using a Ventana automated machine (Ventana Medical Systems, Tucson, AZ), and antibody detection was performed using a Ventana DAB detection kit. Slides were then counterstained in 2% Harris hematoxylin for 1 min, rinsed in tap water, and counterstained blue in 1.5% ammonia in 70% alcohol. Finally, slides were rinsed in tap water, dehydrated, and mounted.
Chemicals
All chemicals and reagents were purchased from Sigma (St. Louis, MO), unless otherwise stated. Losartan was provided by Merck (Rahway, NJ), and the anti-MEP- and anti-MEP-
antibodies were produced in the laboratory of J. S. Bond, PhD.
Statistical Analysis
Results are expressed as means ± SE. To simplify the analysis of the db/db mice studies, some of the data were combined into early (08), middle (2028), and concluding (4452) phases of the 52-wk observation period. Differences between groups were compared using ANOVA and Student's t-test with the Bonferroni correction for multiple comparisons. Relationships between variables were evaluated using a linear regression analysis. The mRNA expression data were assessed by Student's t-test. Differences were considered significant if the P value was <0.05.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Male db/db mice and littermate controls were killed at 1314 wk of age. At this point, the db/db mice weighed 33.7 ± 1.3 vs. 28.9 ± 0.3 g in littermate controls (P 0.05). Similarly, kidney weight was higher in db/db compared with nondiabetic lean mice, 0.236 ± 0.005 and 0.183 ± 0.003 g, respectively (P
0.05). In view of the parallel increases in total body and kidney weights, the kidney:body weight ratio was similar in the two groups of animals (data not shown). The relative abundance of MEP-
and MEP-
mRNA in the kidney was substantially decreased in the db/db mice compared with lean controls (Fig. 1). The changes in MEP-
and MEP-
gene expression were paralleled by similar decreases in renal BBM meprin-
and meprin-
protein content (Fig. 2). The decrease in meprin subunit mRNA abundance and protein levels was greater for the
-chain vs. the
-chain. The amount of meprin-
protein in the BBM is dependent on the amount of meprin-
protein. The more dramatic decrease in meprin-
BBM protein than kidney meprin-
mRNA is most probably due to meprin-
decreases.
|
|
Basic metabolic parameters and drug dosing. At the start of the experiment, db/db mice had a mean weight of 36.6 ± 2.2 g, whereas nondiabetic C57BLKS/J mice weighed 20.3 ± 1.4 g. Tables 1 and 2 summarize the growth, water intake, and urine output during the early (08 wk), middle (2028 wk), and concluding (4452 wk) phases of the study, for diabetic and control mice, respectively. In the db/db mice, there was a decline in body weight from the midpoint until the end of the study that was paralleled by decreased water intake. These changes were not significant because of the small number of animals maintained for the entire 52-wk observation period. Urine output increased slightly over the course of the study without any significant intergroup differences. Nondiabetic mice steadily increased their body weight over the 52-wk period (P < 0.05), and their water intake and urine output were fairly constant. Survival was 100% in both strains, except for one DB-C mouse that died after 51 wk of observation.
|
|
Serum biochemical analysis. Among the db/db mice, there were no significant intergroup differences in serum glucose, creatinine, sodium, cholesterol, or triglycerides concentrations over the course of the experiment (Table 3). However, BUN concentration was higher in DB-LOS mice compared with DB-C or DB-EN animals. This difference was first noted at 816 wk of treatment and persisted until the end of the experiment (P < 0.001; Table 3). Although water intake in the DB-LOS group was lower than in the other two groups during the middle phase of treatment, it was comparable during the concluding period, indicating that dehydration was not the cause of the elevated BUN in DB-LOS mice. Among the nondiabetic mice groups, there were no significant differences in serum glucose, creatinine, sodium, cholesterol, triglycerides, or BUN concentrations over the course of the experiment (data not shown).
|
|
|
|
|
|
|
|
Urinary MEP- levels were increased in STZ-diabetic vs. nondiabetic rats at 52 wk (P < 0.05; Fig. 3C). In addition, in rats with STZ-diabetes for 52 wk, meprin A enzymatic activity in BBM was lower in diabetic animals compared with age-matched controls, 36 ± 10 (n = 3) vs. 110 ± 31 (n = 4) U/mg protein, respectively (P = 0.05). Finally, STZ-diabetic rats also had decreased MEP-
content in the BBM vs. nondiabetic rats after 52 wk of observation (P < 0.025; Fig. 4B).
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The pathogenesis of chronic DN is multifactorial (8, 14). Inflammatory mediators such as monocyte chemoattractant protein-1 and osteopontin, peptide growth factors including transforming growth factor (TGF)- and vascular endothelial growth factor, and hormones such as ANG II are implicated in this process (11, 14, 32). The findings in this report indicate that meprin A in conjunction with the RAS is also involved. In db/db mice, changes in MEP-
and MEP-
gene and protein expression preceded the onset of overt DN. Moreover, in both db/db mice and rats with STZ-diabetes, renal meprin A activity and MEP-
expression and content in BBM were diminished and were inversely related to the extent of renal injury. If diabetes is considered a condition of accelerated aging (31), then the kidney injury associated with chronic DN may be a consequence of an exaggerated decline in renal meprin A activity. In db/db mice, long-term administration of ARB further decreased MEP-
expression and exacerbated renal injury. In contrast, ACE inhibitor treatment attenuated DN and enhanced MEP-
expression. Confirmation of a role for meprin A in DN will require further studies using well-tolerated selective inhibitors of the enzyme or animals that have been genetically manipulated to overexpress or delete the protein.
In view of the changes in both MEP- and MEP-
observed in the initial study, it is important to explain why the experimental protocol focused on MEP-
in the treatment study. First, well-characterized antibodies were only available against MEP-
at the time of these investigations. Second, it enabled correlations to be made between changes in renal parenchymal expression and urinary excretion of the
-subunit. This would not apply to MEP-
, which is membrane bound and not present in the urine. The parallel changes in MEP-
and MEP-
at 1314 wk suggest that there is a linkage between the two meprin subunits in the pathogenesis of DN. This supposition is buttressed by the decrease in meprin A enzymatic activity, which requires both subunits.
In the treatment study, food and water intake were assessed weekly. Although drug doses were not calculated on a daily basis and animals were not pair fed, water intake and weight gain in each group were fairly steady over the course of the study. This suggests a corresponding stability in dosing of the two test drugs during the 52-wk treatment period. Lack of 24-h urine collections precluded the use of creatinine clearance as a marker of renal function and BUN and serum creatinine concentration and histopathological alterations were utilized as primary evidence of progressive renal disease. Albuminuria was not measured for the following reasons: 1) a dissociation between albumin excretion and histopathological severity of DN has been observed in db/db mice treated with anti-TGF- antibody (34) and 2) chronic experimental diabetes results in urinary excretion of molecular forms of albumin that do not cross react with antibodies used in commercially available assay kits (12).
Blood pressure, plasma renin activity, and plasma aldosterone levels were not measured as part of this study because of technical constraints and the limited availability of plasma from the mice with chronic DN. We suggest that failure to measure blood pressure does not detract from the main conclusions for the following reasons: 1) the doses of the study drugs, EN and LOS, match previous reports in experimental DN and the efficacy is likely to match these earlier studies; 2) experimental DN is not characterized by severe hypertension; 3) intermittent measurements of blood pressure are less critical for analysis of drug effect in a chronic treatment period of 52 wk in which blood pressure is likely to fluctuate widely; and 4) meprin A expression and activity are not known to be affected directly by alterations in blood pressure per se.
There are several important findings that emerged from these studies. First, renal meprin A enzymatic activity and BBM protein content of MEP- were influenced by the diabetic state per se rather than genetically determined variability in meprin A enzyme activity (9). Chronic hyperglycemia in db/db mice resulted in decreased enzymatic activity and decreased amounts of tissue-bound MEP-
in the BBM and diminished immunohistochemical staining for meprin-
protein at 24 and 52 wk. The same pattern was also observed in untreated STZ-diabetic rats after 52 wk. The findings in the 13- to 14-wk-old db/db mice suggest that altered renal MEP-
expression and meprin A activity are secondary to reduced meprin-
and meprin-
gene transcription and protein synthesis. Further studies are needed to exclude abnormal meprin subunit mRNA stability or translation, or processing of newly synthesized protein subunits in DN.
Second, MEP- excretion in the urine was increased in diabetic vs. normoglyclemic animals, in both models of diabetes. This abnormality was manifest in db/db mice at 24 wk, before detectable renal histopathological abnormalities. There was an inverse relationship between tissue MEP-
content and meprin A proteolytic activity on the one hand and urinary excretion of MEP-
. By 14 wk of age, meprin-
gene expression was decreased >75% in db/db mice relative to levels in their lean littermates, while meprin-
had decreased 28%. Because meprin-
depends on meprin-
to attach to the brush border, meprin-
on the brush border would be expected to decrease along with meprin-
in agreement with our observations. Increasing the meprin-
to meprin-
ratio above a certain value will lead to a greater proportion of total meprin-
that will be excreted in urine of the db/db mice. The greater proportion of total meprin-
secreted, combined with only a slight decrease in total meprin-
gene expression, accounts for the observed net increase in meprin-
excretion.
Microalbuminuria has been used as a clinical marker of DN (13, 20). MEP- level may also be elevated in the urine of patients with type 1 and/or type 2 diabetes in the early stages of the disease as well as after the development of overt DN (21). The data from the 13- to 14-wk-old db/db mice indicate that disturbances in meprin subunit metabolism and excretion precede the onset of clinically evident DN. Clinical studies are needed to evaluate the predictive role of urinary MEP-
excretion compared with standard indexes such as microalbuminuria in detecting incipient DN (6).
Third, our findings confirm the renoprotective effect of ACE inhibitor therapy against the progression of DN in db/db mice (8, 14, 23). In contrast, ARB therapy with LOS did not protect against DN. The EN and LOS doses were comparable to those used in previous studies. Dose-response studies were not performed because of the high cost and the difficulty in maintaining animals with chronic untreated diabetes. However, the difference in efficacy of EN vs. LOS was observed in two separate protocols and it was associated with divergent effects of the two drugs on meprin A activity and MEP- expression in db/db mice. Treatment with an ACE inhibitor or ARB amplified the inverse relationship between meprin A enzymatic activity and MEP-
content in the renal BBM and the severity of DN but in opposite directions. Moreover, use of these two drugs was associated with alterations in urinary MEP-
excretion that paralleled the degree of kidney damage.
It is important to emphasize that a 1-yr treatment period is highly unusual in studies of DN. In a recent review of nephropathy in db/db mice, none of the cited investigations about renal function or histopathology involved observation periods longer than 25 wk (26). The extended 52-wk treatment phase in this report is unique for this model of diabetes and enables valuable inferences to be made vis-à-vis human disease, which develops after a lengthy latency period. Our findings suggest that in chronic DN, it may be harmful to block the angiotensin type 1 (AT-1) receptor with agents such as LOS, while leaving the type 2 receptor unoccupied (6). The beneficial effect of ACE inhibitors in slowing the progression of DN may involve reduction in the circulating levels of ANG II and potentiation of intrarenal bradykinin levels (30). Most clinical trials comparing ACE inhibitors and ARB in patients with diabetes have demonstrated comparable efficacy (19, 23). In fact, ARB may be as effective as and better tolerated than ACE inhibitors (17). However, these studies were relatively short term and examined changes in blood pressure and urinary protein excretion. The treatment was not started early enough in the course of type 2 diabetes or maintained for sufficient duration to ascertain a difference between ACE inhibitors and ARB on the long-term progression of DN (22). In recent clinical trials that documented a beneficial effect of ARB therapy in patients with type 2 diabetes, the length of treatment was relatively short compared with experimental studies with db/db mice (5, 18). Our findings are applicable to chronic administration of ACE inhibitors and ARB to patients with type 1 or type 2 diabetes and raise a cautionary note about the impact of routine early initiation of the latter class of drugs or combined use ACE inhibitors and ARB therapy (1, 25).
We propose the following scheme to explain the observations in this report (Fig. 7). As a first step, ANG II, which is increased in diabetes, downregulates MEP- synthesis and reduces enzyme expression in the kidney via the AT2 receptor. Lower levels of MEP-
in renal BBM result in decreased anchoring of MEP-
to the apical membrane and lower meprin A enzymatic activity. This would lead to higher urinary excretion of MEP-
in diabetic animals. In addition, it would be consistent with the linkage between polymorphism in the MEP-
gene and susceptibility to nephropathy in type 2 diabetes. ACE inhibition leads to upregulation of MEP-
, which, in turn, results in the normalization of MEP-
content in the BBM and urinary MEP-
excretion. Changes in the metabolism of the meprin subunits may contribute to the development of DN by two distinct mechanisms. First, alterations in meprin A activity may modify the proteolysis of profibrotic agents such as TGF-
and osteopontin (11, 14). Decreased meprin A activity in diabetes may also exacerbate nephropathy by interfering with digestion of extracellular matrix proteins such as laminin and nidogen (16, 33), leading to glomerulosclerosis and tubulointerstitial fibrosis. Second, increased urinary excretion of MEP-
may directly injure renal tubule cells and promote tubulointerstitial fibrosis in DN. This is supported by the demonstration of MEP-
-induced cytotoxicity to renal tubular epithelial cells (LLC-PK1 and Madin-Darby canine kidney cells) in vitro (7).
|
![]() |
GRANTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
FOOTNOTES |
---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Visit Other APS Journals Online |