1 Harry S. Truman Memorial Veterans Hospital and Departments of 2 Pharmacology, and 3 Pathology and Anatomical Sciences, School of Medicine, Missouri University, Columbia, Missouri 65212; and 4 Department of Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore 560012, India
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Uroguanylin, guanylin, and lymphoguanylin are small peptides that activate renal and intestinal receptor guanylate cyclases (GC). They are structurally similar to bacterial heat-stable enterotoxins (ST) that cause secretory diarrhea. Uroguanylin, guanylin, and ST elicit natriuresis, kaliuresis, and diuresis by direct actions on kidney GC receptors. A 3,762-bp cDNA characterizing a uroguanylin/guanylin/ST receptor was isolated from opossum kidney (OK) cell RNA/cDNA. This kidney cDNA (OK-GC) encodes a mature protein containing 1,049 residues sharing 72.4-75.8% identity with rat, human, and porcine forms of intestinal GC-C receptors. COS or HEK-293 cells expressing OK-GC receptor protein were activated by uroguanylin, guanylin, or ST13 peptides. The 3.8-kb OK-GC mRNA transcript is most abundant in the kidney cortex and intestinal mucosa, with lower mRNA levels observed in urinary bladder, adrenal gland, and myocardium and with no detectable transcripts in skin or stomach mucosa. We propose that OK-GC receptor GC participates in a renal mechanism of action for uroguanylin and/or guanylin in the physiological regulation of urinary sodium, potassium, and water excretion. This renal tubular receptor GC may be a target for circulating uroguanylin in an endocrine link between the intestine and kidney and/or participate in an intrarenal paracrine mechanism for regulation of kidney function via the intracellular second messenger, cGMP.
guanosine 3',5'-cyclic monophosphate; uroguanylin; OK cells
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
GUANYLIN, UROGUANYLIN, and lymphoguanylin are small, heat-stable peptides that regulate the enzymatic activity of transmembrane guanylate cyclase (GC) signaling molecules. Guanylin was first isolated as a bioactive, 15-amino acid peptide from rat intestine (4). Uroguanylin was also isolated as bioactive, 13-, 14-, and 15-residue peptides from opossum urine and intestinal mucosa (21). Both peptides were purified using a bioassay based on the activation of receptor GCs in human T84 intestinal cells. Lymphoguanylin was identified by homology cloning of a cDNA from opossum spleen, which encodes a 109-amino acid precursor similar to preprouroguanylin and preproguanylin (11). Guanylin and uroguanylin have two intramolecular disulfide bonds, but lymphoguanylin has only one disulfide. A synthetic form of lymphoguanylin also activates T84 and OK cell GCs. This family of guanylin peptides is similar in structure and biological activity to heat-stable enterotoxin (ST) peptides secreted by strains of enteric microorganisms that cause secretory diarrhea (16). The active guanylin peptides are found at COOH termini of longer, biologically inactive prohormones (6, 11, 22, 48).
Guanylin, uroguanylin, and ST peptides stimulate the transepithelial secretion of chloride and bicarbonate anions when administered into the apical (mucosal) reservoirs of Ussing chambers containing mounted segments of intestinal mucosa (4, 18, 25, 31). These peptides also increase the short-circuit current of a model T84 cell epithelium in a luminal pH-dependent fashion by stimulating electrogenic chloride secretion (4, 20, 21). Physiological roles for the endogenous guanylin peptides are postulated to include the regulation of salt and water secretion during digestion, as well as neutralization of HCl in the duodenum and of organic acids derived from enteric bacteria in the large intestine (20, 25). Control of these intestinal functions by guanylin peptides is mediated via intracellular cGMP through activation of cGMP-dependent protein kinase II and/or cAMP-dependent protein kinase II with subsequent phosphorylation of the cystic fibrosis transmembrane conductance regulator (CFTR) protein (15, 25, 40). CFTR and guanylin receptor GCs are localized together in apical plasma membranes of target enterocytes (12, 32). An intestinal receptor GC has been identified by molecular cloning of cDNAs encoding a membrane protein that binds 125I-labeled ST (41), and this protein also is activated by guanylin peptides and Escherichia coli ST (4, 11, 21, 41). When this GC gene is impaired in transgenic mice, a marked reduction in intestinal secretory responses of suckling mice was observed (37, 42). However, ~10% of specific 125I-ST binding to receptor sites on intestinal membranes still remained in GC-C-knockout animals (37). This suggests that an additional gene or multiple genes encoding receptors for guanylin peptides and ST exist in the mouse genome.
Bacterial STs were the first peptides shown to activate receptor-like GC signaling molecules in mammalian models, thus stimulating intestinal secretion via cGMP and causing secretory (i.e., traveler's) diarrhea (9, 23). Our subsequent finding that E. coli ST also stimulates receptor GCs found on OK (opossum kidney) and PTK-2 (potoroo kidney) cell lines as well as in the opossum kidney revealed a broader physiological role for this class of cell surface receptors (13). "ST receptors" also were found in other epithelia in addition to the receptors localized to brush-border membranes (BBM) of epithelial cells lining the intestinal tract and within renal tubules (8, 14, 30, 47). The renal "ST receptor" predicted the existence of endogenous ST-like peptides that activate this enzyme, which led to the isolation of uroguanylin from urine (7, 21, 26). Uroguanylin is the major bioactive peptide found in urine, which contains very small amounts of bioactive guanylin (7, 21, 26, 38). Thus uroguanylin may regulate the enzymatic activity of these tubular receptors in vivo. Uroguanylin or ST stimulates urinary sodium, potassium, and water excretion in both the isolated perfused rat kidney and in the mouse in vivo (10, 17, 35). Guanylin has less natriuretic and diuretic potency compared with either uroguanylin or ST, but guanylin does elicit a marked kaliuresis in the rat kidney in vitro (10). Uroguanylin mRNA is most abundant in the small intestine compared with guanylin mRNA levels, which peak in the large intestine of rats and mice (2, 36, 46). Uroguanylin and prouroguanylin are also found in the circulation, and the gastrointestinal (GI) tract may be a source of these peptides (6, 38). A natriuretic factor such as uroguanylin was postulated to exist in the digestive system as an explanation for the greater natriuresis elicited by oral compared with intravenous loads of NaCl (33). The release of a natriuretic hormone like uroguanylin from the GI tract into the plasma in response to dietary NaCl may help explain the sustained increase in urinary sodium excretion that occurs following a high-salt meal (33).
This study investigates the renal mechanism of uroguanylin action by characterizing the structure and signaling activity of a membrane GC expressed in OK cells and in the opossum kidney. A 3,762-bp cDNA was isolated by molecular cloning and PCR utilizing OK cells and opossum kidney as sources of kidney mRNA/cDNA. This OK-GC cDNA contains an open-reading frame (ORF) encoding a 1,049-residue mature protein that belongs to a growing family of transmembrane receptor GC signaling molecules. Transfection and expression of the OK-GC cDNA in COS cells (Cercopithecus aethiops kidney) and HEK-293 cells (human embryonic kidney) produced a cell surface receptor GC protein that is activated by either uroguanylin, guanylin, or E. coli ST peptides. The ~3.8-kb mRNA encoding this uroguanylin receptor GC was detected in both the kidney and OK cells as well as in the mucosa of small and large intestine.
![]() |
EXPERIMENTAL PROCEDURE |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
RT-PCR amplification of a kidney uroguanylin receptor GC. Total RNA was extracted from various opossum tissues using the RNEasy Kit (Qiagen, Chatsworth, CA). Total RNA from opossum kidney (3-5 µg) was reverse transcribed with oligo(dT)18 primer using the Superscript II RNase H-Reverse Transcriptase kit (GIBCO-BRL; Life Technologies, Gaithersburg, MD). The cDNAs were then used for PCR reactions employing the protocol recommended in the instructions with the Superscript II kit. The PCR amplification reaction conditions were as follows: denaturation at 93°C for 5 min; then 30 cycles consisting of 93°C for 1 min, 59°C for 1 min and 72°C for 1.5 min, and then an extension period at 72°C for 10 min. A set of primers [GAAACCCTTCCGCCCAGAT and ACG(A)TACTTAAAGGGAAGAGG] was used to amplify a segment of the opossum GC-C kinase-catalytic domain (nucleotides 2155-3130) mRNA/cDNA (8).
RACE-PCR. A 0.9-kb portion of an opossum kidney uroguanylin receptor GC (8) amplified by RT-PCR was extended in the 3' and 5' direction using rapid amplification of cDNA ends (RACE)-PCR. For 3'-RACE-PCR, total RNA was reverse transcribed as described above except that an oligo(dT)17 adapter (GACTCGAGTCGACATCGA) was used as the primer. The cDNAs were then amplified with a gene-specific primer (GAAACCCTTCCGCCCAGAT) and the adapter primer (GACTCGAGTCGACATCGA) using the conditions described above. The PCR product was cloned into pCR II, sequenced, and analyzed as previously described (36). For 5'-RACE-PCR, total RNA was reverse transcribed with a gene-specific primer (CAGTCAAAACAACGAGAGTT or CTGATGGAACCTTTATGGAT), the cDNA was purified with a G-50 spin column, and then it was dA-tailed using terminal deoxyribonucleotidyltransferase (Boehringer Mannheim, Indianapolis, IN). The dA-tailed cDNA was then amplified using a second gene-specific primer (CAACGGATGAAAAGGA or CTATTCAGAGGAATGTTTCTGG) and the oligo(dT)17 adapter and adapter primer. The PCR product was then cloned into pCRII and sequenced.
Northern analysis of receptor mRNA
expression. Total RNA (40 µg) from various opossum
tissues were fractionated on a 1% agarose gel containing formaldehyde
and then transferred to nylon membranes. The membranes were hybridized
with a cDNA representing portions of the ligand-binding domain
(nucleotides 130-631) and ligand-binding and kinase-homology
domains (nucleotides 916-1810), which were labeled with
[-32P]dCTP by the
random priming method (Boehringer Mannheim). A human
-actin cDNA
(HHCI89; American Type Culture Collection, Rockville, MD) was also used
in the hybridization to estimate RNA loading; however, this probe bound
to two sizes of mRNA transcript (36). Total RNA from three different
animals was examined on three separate blots, with the blots being
hybridized twice with each probe.
The membranes were prehybridized for 1-3 h at 68°C with
QuickHyb solution (Stratagene, La Jolla, CA), then hybridized for a
further 14-16 h at 68°C with 1 × 106 cpm of labeled cDNA per
milliliter of QuickHyb solution. The blots were washed twice with
2× SSC/0.1% SDS at room temperature followed by a 5- to 15-min
wash with 0.2× SSC/0.1% SDS at 60°C. Blots were exposed to
film at 80°C with an intensifying screen from 3-72 h.
OK-GC expression. Specific primers were designed to amplify the entire ORF of the opossum kidney uroguanylin receptor and portions of the 3'- and 5'-untranslated regions (UTR) (nucleotides 37-3415). The PCR product was verified as the cDNA encoding the opossum kidney receptor by nucleotide sequence analysis, before ligation into a mammalian expression vector pcDNA3.1/V5/His-TOPO (Invitrogen, San Diego, CA).
For transient transfection, COS-1 cells (1.35 × 106 cells in 150-mm dishes), maintained in DMEM with 10% FBS, 100 U/ml of penicillin, and 100 µg/ml of streptomycin, were transfected with 22.5 µg of the expression construct (pcDNA3.1-OK-GC) or with vector alone (pcDNA3.1) using the Fugene transfection reagent following the manufacturer's instruction (Boehringer Mannheim). The cells were harvested 24 h after transfection and reseeded into 24-well plates (~10,000 cells/well) for cGMP accumulation assay. Cells were allowed to grow a further 72 h before bioassay for cGMP accumulation in response to guanylin (10 µM), uroguanylin (10 µM), and E. coli ST13 (1 µM).
For stable expression, HEK-293 cells were transfected with 5 µg of pcDNA3.1-OK-GC per 100-mm dish using the Fugene transfection reagent. The cells were maintained in MEM Earle's base with 10% FBS, 1 mM nonessential amino acid, 1 mM pyruvate, 100 U/ml of penicillin, and 100 µg/ml of streptomycin. On the 4th day, the medium was supplemented with 400 µg/ml of Geneticin (G418, GIBCO-BRL) to select for neomycin-resistant clones. The G418 selection was continued until isolated resistant colonies could be identified and expanded for determining OK-GC expression by cGMP accumulation bioassay (4, 21).
cGMP accumulation bioassay. Transiently transfected COS-1 cells, stably transfected HEK-293 cells or OK-E cells in 24-well plates were stimulated with 1 µM synthetic E. coli ST13 or 10 µM of synthetic opossum guanylin or uroguanylin (4, 21). In brief, these peptides were diluted in 150 µl DMEM containing 20 mM HEPES, pH 7.4, and 1 mM IBMX. The cells were washed with 200 µl DMEM before the addition of the peptides or media alone. The cells were incubated at 37°C for 40 min. After incubation, the media was removed for later radioimmunoassay (RIA), the cells washed with 200 µl PBS, and 200 µl of 3.3% perchloric acid was added to each well to stop the reaction and extract the cGMP from the cells. The extract was adjusted to pH 7 with 10 N KOH before 50 µl of the supernatant was used to measure cGMP by RIA.
Preparation of membranes. BBM
preparations were made from opossum small intestinal mucosa, kidney
medulla, and kidney cortex (1, 14). The tissues were homogenized for 1 min on ice with an Ultra-Turrax (Tekmar, Cincinnati, OH)
in a solution containing 300 mM mannitol, 12 mM
Tris · HCl, pH 7.4, 5 mM EGTA, 1 µM aprotinin, 1 µM leupeptin, 0.1 mM phenylmethylsulfonyl fluoride (PMSF), and 0.1 µM pepstatin A (7.5 ml/g tissue). The homogenate was centrifuged at
2,450 g. To the supernatant, 10.5 ml
of ice-cold 12 mM MgSO4 was added,
and the solution was stirred constantly on ice for 15 min. The
homogenate was centrifuged at 31,000 g, and the pellet was resuspended in
15 ml of medium containing 20% glycerol, 300 mM mannitol, 1 mM
MgSO4, 1 µM aprotinin, 1 µM
leupeptin, 0.1 mM PMSF, 0.1 µM pepstatin A, and 50 mM Tris, pH 7.5, and stored frozen at 80°C.
Membranes were prepared from confluent T84 and OK cells, and from COS
cells at 72 h posttransfection with pcDNA3.1-OK-GC or pcDNA3.1. The
cells were washed four times with 10 ml ice-cold PBS and scraped into 1 ml of ice-cold lysis buffer (50 mM HEPES, pH 7.4, 100 mM NaCl, 5 mM
EDTA, 1 mM dithiothreitol, 2 mM PMSF, 1 µg/ml leupeptin, and 1 µg/ml aprotinin). The cells were disrupted by sonication and
centrifuged for 1 h at 4°C and 15,000 g. The cell pellet was suspended by
homogenization in 250 µl of buffer (50 mM HEPES, pH 7.4, 10 µg/ml
leupeptin, and 10 µg/ml aprotinin) and stored at 80°C.
Western analysis of receptor protein
expression. Membrane protein concentrations were
estimated using the Bradford protein assay (3). Fifty micrograms of
kidney or intestinal BBMs and 150 µg of membranes from cultured cells
were resuspended in sample buffer containing -mercaptoethanol and
boiled for 3 min prior to SDS-PAGE. The solubilized proteins (20 µl)
were separated on a 7.5% acrylamide, 0.65%
N,N'-methylenebisacrylamide
gel and electrophoretically transferred to a polyvinylidene fluoride
membrane (Immobilon; Millipore, Bedford, MD) in 50 mM Tris-glycine
buffer, pH 8.5, containing 20% methanol. The membrane was washed
initially with PBS/0.1% Tween 20, then blocked with blocking reagent
for 1 h (Amersham Life Science, Buckinghamshire, UK). The membrane was rinsed with PBS/0.1% Tween 20 before incubation for 2.5 h at room temperature with the primary antisera GCC-CTD (a polyclonal antibody for the COOH-terminal domain of human GC-C) diluted 1:7,500 in PBS/0.1% Tween 20/0.2% bovine serum albumin. The membrane was washed
three times with PBS/0.1% Tween 20, then incubated with a 1:5,000
dilution of a horseradish peroxidase-conjugated anti-rabbit antibody
for 1 h at room temperature (Amersham). The membrane was washed further
three times with PBS/0.1% Tween 20, and protein bands were detected
using the enhanced chemiluminescence detection system (ECL; Amersham).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We used 3'- and 5'-RACE-PCR to extend the structure of a
previously isolated cDNA that encodes part of the kinase homology and
catalytic domains of a GC expressed in OK cells (8). By PCR, we have
produced and cloned the OK-GC receptor cDNA of 3,762 bp that contains
76 bp of 5'-UTR, 3,195 bp of ORF, and 491 bp of 3'-UTR (Fig.
1). A consensus polyadenylation site,
AATAAA, is found at nucleotides 3734-3739 of this cDNA. The ORF
encodes a 1,065-amino acid precursor protein containing a 16-residue
putative signal peptide. The mature protein (OK-GC) is deduced to be
1,049 amino acids in length. OK-GC is similar to other membrane GC
proteins in having an
NH2-terminal, extracellular
agonist-binding domain, a single lipophilic transmembrane region and
intracellular kinase homology, and GC catalytic domains (41). The
predicted mature protein has 10 potential N-linked glycosylation sites
and 8 cysteine residues in the 409-amino acid long extracellular
domain. There are an additional 8 cysteine residues in the 619-amino
acid long intracellular domain. The OK-GC protein appears to be a new
member of the growing family of membrane receptors for guanylin
peptides. OK-GC shares 72.4, 75.8, and 75.0% identity of primary
structure with the BBM receptors for guanylin peptides expressed in the rat, human, and pig intestine, respectively (Fig.
2; see Refs. 41, 43, 45). Consistent with
the high conservation of primary structure between the catalytic
domains of GCs is the similarity between the OK-GC catalytic region and
guanylin receptors of rat, human, and porcine intestine, which share
92.2, 94.1, and 95.2% identity, respectively, with OK-GC (41, 43, 45).
The most highly variable region of membrane receptor GCs occurs within the NH2-terminal ligand-binding
domains of these proteins. The OK-GC protein shares only
55.4-58.6% identity in this domain compared with the intestinal
receptors for guanylin peptides previously identified in other mammals
(41, 43, 45). The intestinal guanylin/uroguanylin receptors of other
mammalian species are more closely related than this, because the
extracellular ligand-binding region of an intestinal receptor of rats
shares 70.1 and 69.9% identity with a corresponding domain in the
intestinal receptors of human and pig intestine,
respectively (41, 43, 45). Thus OK-GC may represent a
distinct subtype of receptor GC within the emerging family of
cell-surface receptor signaling molecules that interact with and are
controlled by the guanylin peptides.
|
|
The expression of OK-GC mRNA was examined in tissues from opossums
using Northern assays with OK-GC cDNAs as the hybridization probes
(Fig. 3). An ~3.8-kb mRNA was observed in
total RNA preparations isolated from the kidney, OK cells, urinary
bladder, adrenal gland, heart, and intestinal mucosa indicating that
the 3,762-bp OK-GC cDNA clone that we isolated represents most of the
OK-GC mRNA. The subclonal cell line, OK-E, and the wild-type OK cell
line both express high levels of OK-GC mRNA, as does the
renal cortex of opossums. Lower levels of OK-GC mRNA were detected in
the corticomedullary junction and medullary regions of kidney. Other
tissues with relatively low levels of OK-GC mRNA are the urinary
bladder, adrenal gland, and both the ventricle and atria of heart. In
the GI tract, high levels of OK-GC mRNA were observed in the mucosa of
duodenum, jejunum, and ileum of small intestine and in the cecum and
colon. OK-GC mRNA was not detected in the stomach mucosa and skin. Thus OK-GC mRNA is highly expressed in the kidney cortex and intestinal mucosa, with mRNA transcripts occurring at lower levels in the other
tissues.
|
The OK-GC cDNA was transfected into COS cells for transient expression
of the OK-GC protein. We observed that COS cells transfected with the
OK-GC cDNA became responsive to stimulation with E. coli ST yielding cGMP accumulation responses to this
peptide agonist (Fig.
4A).
However, COS-1 cells transfected with the plasmid vector alone had no
detectable cGMP responses to ST stimulation (Fig. 4A). Thus we sought to establish an
OK-GC-transfected cell line using HEK-293 cells as a model system. An
HEK-293-C6 clonal subline was subsequently isolated following
transfection with the OK-GC cDNA, and these cells exhibited substantial
cGMP accumulation responses to uroguanylin, guanylin, and
E. coli ST synthetic peptides (Fig.
4B). These agonists increased cGMP
by 3.6- to 4.3-fold, at 10 µM concentration in HEK-293-C6 cells.
There were no significant differences in estimated potencies between
the peptides. However, ST appeared slightly more potent than
uroguanylin and guanylin, as seen previously in T84 and OK cell lines
(8, 21, 26). This level of cGMP response in the HEK-293-C6 cells is
considerably lower than that observed for these peptides in the OK-E
cells (Fig. 4C). Concentrations of
10 µM guanylin and uroguanylin and 1 µM ST increased cGMP levels
in confluent OK-E cells by 460-, 491-, and 421-fold,
respectively. However, the rank order of potencies of ST > uroguanylin guanylin was similar between OK-E and HEK-293-C6 cell
lines expressing the OK-GC receptors. All of these synthetic peptides
are full agonists for activation of OK-GC receptors expressed in
HEK-293-C6 cells or for activation of the native receptor GCs found in
OK-E cells.
|
We further characterized the OK-GC receptor protein using Western blot
assays with a polyclonal antisera that interacts with a conserved
portion (amino acids 1011-1073; Fig. 3) of the human intestinal
receptor for guanylin/uroguanylin/ST (39). Illustrated in Fig.
5 are results obtained with T84 human
intestinal, OK, and transiently transfected COS-1 cells, as well as
protein from opossum kidney BBMs and opossum intestinal BBMs that react
with this antisera. The immunoreactive proteins found in COS-1 cells expressing the OK-GC receptor activity have a 160-kDa band of a size
similar to that found in the opossum kidney and intestinal BBMs and T84
and OK cell membranes. This antisera also reacts with a 140-kDa protein
that is relatively abundant in OK and T84 cell membranes and opossum
small intestinal BBM, with a much lower level seen in kidney BBM. The
160- and 140-kDa bands may represent differentially glycosylated forms
of the OK-GC receptor protein as previously reported for human and rat
membrane receptor GCs (39, 44). The 140-kDa band may be undetectable in
the kidney medulla BBM and COS-1 cells transiently expressing OK-GC,
because the amount of protein present may be below the detection level. The OK-GC protein expressed in COS-1 cells migrates on SDS-PAGE similarly to the mobilities of the native receptor proteins found in
either of the cell culture models or in the guanylin/uroguanylin target
tissues. The apparent protein level for OK-GC in the COS-1 cells is
lower than the expression of OK-GC in either intestine or renal
cortical BBM or the cultured cell models.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Our findings are consistent with the hypothesis that the OK-GC protein is a renal tubular receptor for uroguanylin and/or guanylin peptides, which participates in a cGMP signaling pathway for regulation of the urinary excretion of sodium, potassium, and water (10, 17, 35). OK-GC is the first kidney receptor for the guanylin family peptides to be defined at a molecular level. Prior to the identification of receptor GC signaling molecules for E. coli ST in the OK and PTK-2 cells and in the opossum kidney (13, 14, 30, 47), it was thought that ST-stimulated GCs were restricted to the intestinal mucosa (19). Thus identification of receptor activities for OK-GC in OK cells and opossum kidney (13, 14, 30, 47) opened a new field of inquiry that culminated recently with the discoveries of guanylin, uroguanylin, and lymphoguanylin peptides (4, 11, 21). These peptides activate OK-GC and may serve as endogenous agonists for this membrane receptor GC (11, 21). The OK cell line has functional properties like those of renal proximal tubules, and receptor autoradiography experiments with 125I-ST have clearly shown that specific binding sites for this uroguanylin-like radioligand are found in cells of the convoluted and straight portions of proximal tubules in opossum kidney (8, 14, 30). High levels of these 125I-ST-labeled receptors are also found in BBMs isolated from the kidney and intestine, indicating that this receptor GC is preferentially localized to apical plasma membranes of both kidney and intestinal target cells (14, 47). It is likely that OK-GC serves as a physiological receptor for uroguanylin, which is the major bioactive peptide found in opossum urine (21). However, guanylin was also isolated from opossum urine, indicating that this peptide may influence renal function in vivo via cGMP (21). Active uroguanylin and inactive prouroguanylin peptides circulate in plasma, thus providing a source for the urinary forms of bioactive uroguanylin in opossum, human, and rat urine (7, 21, 26). The kidney also expresses uroguanylin and guanylin mRNAs, which offers the possibility that an intrarenal signaling pathway exists for the guanylin peptides as well as providing another potential source of uroguanylin in the urine (2, 8, 46). Physiologically, uroguanylin may regulate kidney function via an endocrine axis linking the intestine to the kidney and/or through an intrarenal paracrine mechanism. Both possibilities involve the activation of OK-GC as a key signaling molecule in renal tubular target cells that possess the GC-cGMP signal transduction machinery in opossum kidney (13, 14, 30, 47).
Although more than 10 years have elapsed since the initial report that opossum kidney responds to a uroguanylin-like peptide with increased cGMP (13), the general concept of uroguanylin/cGMP-mediated regulation of kidney function has been slow to be accepted as a physiological mechanism that applies to all mammals. In part, this may be associated with using the North American opossum, Didelphis virginiana, as an animal model and OK cells as a cell model for these studies (8, 13, 14, 30, 47). Following the isolation of cDNAs encoding the intestinal receptors for guanylin family peptides, it was reported that mRNAs encoding these receptors are not detected in rat kidney (41). This suggested that rat kidney was not a target for guanylin peptides. Clearly, the rat, mouse, and opossum kidneys all respond to treatment with either E. coli ST, uroguanylin, or guanylin with marked increases in urinary sodium, potassium, and water excretion indicating that uroguanylin/guanylin receptors are present in the kidneys of both major classes of extant mammals (10, 13, 14, 17, 30, 35, 47). If eutherian (placental, e.g., rat, mouse) and metatherian (marsupial, e.g., opossum) classes of mammals have functional receptors in the kidney that respond to guanylin family peptides, then it is quite clear that genes encoding these guanylin/uroguanylin receptors existed prior to the evolutionary divergence of placental and marsupial mammals from ancestral mammals that lived ~130 million years ago (24). Moreover, the guanylin and uroguanylin genes are also present in the genomes of both metatherian and eutherian mammals (4, 6, 21, 22, 48). Although certain differences between mammalian species may occur in some aspects of the uroguanylin-cGMP signaling pathway in the kidney, it is likely that the broader physiological features of this mechanism occur in the kidneys of all mammals. Thus we propose that the opossum kidney and cultured OK cell lines are useful experimental models that can provide new insights into the renal mechanism of action of uroguanylin and guanylin as novel regulatory peptides that influence kidney function via the intracellular second messenger, cGMP.
OK-GC may be a new member of an emerging family of receptor GCs that interact with guanylin peptides. The primary structure of the ligand-binding domain of OK-GC shares only 55.4-58.6% identity with the corresponding domain in the intestinal form of guanylin receptors in rats, humans, and pigs (41, 43, 45). In contrast, the ligand-binding domains of the intestinal receptors within these eutherian mammals share ~70% identity. This extracellular portion of the membrane GCs is the most highly variable domain, which accounts for the selectivity of these receptors for different peptide agonists. For example, the receptors for guanylin peptides do not interact with atriopeptins, and atriopeptin receptor GCs are not activated by the guanylins (5). OK-GC may be a second member of an emerging family of receptors for the guanylin peptides, in addition to the intestinal guanylin receptors that were identified previously (41, 43, 45). Other evidence supports the hypothesis that multiple genes exist in the mammalian genome that encode additional receptors for guanylin peptides. Transgenic mice with disabled genes for an intestinal receptor GC have no intestinal fluid secretion responses to E. coli ST in vivo, yet intestinal BBMs isolated from these guanylin receptor-knockout animals still retain specific binding sites for 125I-ST, a uroguanylin-like peptide agonist (37). These 125I-ST binding sites associated with intestinal BBMs are likely to represent another membrane receptor GC and physiological target for the guanylin peptides. Other molecular evidence supports the interpretation that at least two genes are present in the mammalian genome that encode receptors for the guanylin peptides. A partial cDNA encoding part of the kinase homology and catalytic domains of a membrane GC that is closely related to an intestinal form of guanylin receptor was isolated from the GI mucosa of rats (36). However, a 53-amino acid deletion in this receptor within the region linking the kinase homology and catalytic domain, along with several other differences in the primary structure of the deduced protein, suggests that this membrane GC expressed in the GI tract is derived from a novel gene. The cloning and molecular identification of OK-GC provides an opportunity to identify the second gene product that serves as a receptor for the guanylin peptides in either eutherian or metatherian species. Two different receptor GCs with different agonist selectivity properties, combined with the heterogeneity exhibited by the presence of guanylin, uroguanylin, and lymphoguanylin genes found in the opossum, provide for a physiologically complex signal transduction pathway for cGMP-mediated control of cell and organ function in this mammalian animal model (4, 11, 21).
Expression of the OK-GC mRNA in the intestinal mucosa at levels equivalent to those found in renal cortex suggests that this signaling protein may be the major receptor GC of both small and large intestine of opossums. Studies using receptor autoradiography and in vitro cGMP responses of isolated mucosa to the guanylin peptides with opossums as well as other mammals, and in birds and reptiles, has revealed that the guanylin/uroguanylin/ST receptors have their greatest concentration in the proximal small intestine, and receptor levels then decrease progressively along the longitudinal axis of the small and large intestine (27-29). Receptor autoradiography, in situ hybridization, and immunohistochemistry experiments are in general agreement that the guanylin peptide receptors also exhibit a gradient of concentration along the crypt-villus axis (27-29, 34, 39). The highest apparent level of receptors appears to be on the lower one-third of the villi of small intestinal cells and within the crypts of large intestine. It is likely that these receptors are involved in the tissue responses to this family of enteric peptides resulting in a paracrine influence of guanylins on the transepithelial secretion of chloride and bicarbonate anions during digestion (18, 25, 31). Thus OK-GC in the opossum may be a physiological counterpart to the receptor GC, GC-C, that has been identified by molecular cloning in the rat, human, and porcine intestine (41, 43, 45). Regulation of intestinal fluid secretion together with bicarbonate secretion-dependent neutralization of the highly acidic contents within the lumen of the duodenum and cecum are prominent physiological actions of this enteric paracrine mechanism and intracellular cGMP signaling pathway in the intestinal tract.
Cell-specific expression of the receptors for guanylin family peptides is also observed in the opossum kidney and testis with the highest levels found in cells comprising the pars recta and convoluted portions of the renal proximal tubules and in seminiferous tubules of testis (8, 14, 30). These high-density receptor sites in the nephron of the opossum kidney, as detected by receptor autoradiography and tissue cGMP response assays, are consistent with the high levels of OK-GC mRNA detected in the renal cortex compared with the mRNA abundance found in corticomedullary and medullary regions of the kidney. These studies do not rule out the possibility of the existence of a separate and distinct receptor for the guanylin peptides that may also be expressed in renal tubules. Receptor autoradiography reveals a relatively high density of 125I-ST binding sites in the cells of the pars recta, which reside in the corticomedullary region of the kidney (8, 14, 30). The relatively low levels of OK-GC mRNA compared with the putative high receptor activity in this anatomical region is of interest. This apparent paradox could be explained by the expression of a receptor gene different from that of OK-GC in the corticomedullary region of the opossum kidney. Additional studies will be required to determine whether the receptor sites labeled by 125I-ST in vitro in various regions of the nephron can be quantitatively accounted for by the expression of the OK-GC receptor GC in opossum kidney.
In conclusion, OK-GC is the first kidney receptor GC that serves as a cell-surface receptor for guanylin peptides to be identified at a molecular level. Its expression in the kidney provides a key signaling molecule and physiological target for uroguanylin and/or guanylin acting as renal hormones in vivo. Uroguanylin and guanylin may serve to regulate the renal excretion of NaCl and water as a physiological means of maintaining salt and fluid balance in the body secondary to the consumption of meals containing excess salt. This postulated mechanism could have both an intestinal-to-kidney endocrine axis and/or an intrarenal paracrine signaling pathway, which ultimately influences the urinary excretion of sodium, potassium, and water via the intracellular second messenger, cGMP.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Linda M. Rowland for technical support.
![]() |
FOOTNOTES |
---|
We acknowledge financial support from a University of Missouri Research Board Grant and a Short Term Associateship from the Department of Biotechnology, Government of India, to S. S. Visweswariah.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: R. M. London, Dept. of Pharmacology, School of Medicine, Missouri Univ., Columbia, MO 65212 (E-mail: LondonR{at}health.missouri.edu).
Received 23 October 1998; accepted in final form 9 March 1999.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1.
Biber, J.,
B. Stieger,
W. Haase,
and
H. Murer.
A high yield preparation for rat kidney brush border membranes. Different behaviour of lysosomal markers.
Biochim. Biophys. Acta
647:
169-176,
1981[Medline].
2.
Blanchard, R. K.,
and
R. J. Cousins.
Upregulation of rat intestinal uroguanylin mRNA by dietary zinc restriction.
Am. J. Physiol.
272 (Gastrointest. Liver Physiol. 35):
G972-G978,
1997
3.
Bradford, M. M.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principles of protein-dye binding.
Anal. Biochem.
72:
248-254,
1976[Medline].
4.
Currie, M. G.,
K. F. Fok,
J. Kato,
R. J. Moore,
F. K. Hamra,
K. L. Duffin,
and
C. E. Smith.
Guanylin: an endogenous activator of intestinal guanylate cyclase.
Proc. Natl. Acad. Sci. USA
89:
947-951,
1992[Abstract].
5.
Drewett, J. G.,
and
D. L. Garbers.
The family of guanylyl cyclase receptors and their ligands.
Endocr. Rev.
15:
135-162,
1994[Medline].
6.
Fan, X.,
F. K. Hamra,
R. H. Freeman,
S. L. Eber,
W. J. Krause,
R. W. Lim,
V. M. Pace,
M. G. Currie,
and
L. R. Forte.
Uroguanylin: cloning of preprouroguanylin cDNA, mRNA expression in the intestine and heart and isolation of uroguanylin and prouroguanylin from plasma.
Biochem. Biophys. Res. Commun.
219:
457-462,
1996[Medline].
7.
Fan, X.,
F. K. Hamra,
R. M. London,
S. L. Eber,
W. J. Krause,
R. H. Freeman,
C. E. Smith,
M. G. Currie,
and
L. R. Forte.
Structure and activity of uroguanylin isolated from urine and intestine of rats.
Am. J. Physiol.
273 (Endocrinol. Metab. 36):
E957-E964,
1997
8.
Fan, X.,
Y. Wang,
R. M. London,
S. L. Eber,
W. J. Krause,
R. H. Freeman,
and
L. R. Forte.
Signaling pathways for guanylin and uroguanylin in the digestive, renal, central nervous, reproductive and lymphoid systems.
Endocrinology
138:
4636-4648,
1997
9.
Field, M.,
L. H. Graf, Jr.,
W. J. Laird,
and
P. L. Smith.
Heat-stable enterotoxin of Escherichia coli: in vitro effects on guanylate cyclase activity, cyclic GMP concentration, and ion transport in small intestine.
Proc. Natl. Acad. Sci. USA
75:
2800-2804,
1978[Abstract].
10.
Fonteles, M. C.,
R. N. Greenberg,
H. S. A. Monteiro,
M. G. Currie,
and
L. R. Forte.
Natriuretic and kaliuretic activities of guanylin and uroguanylin in the isolated perfused rat kidney.
Am. J. Physiol.
275 (Renal Physiol. 44):
F191-F197,
1998
11.
Forte, L. R.,
S. L. Eber,
X. Fan,
R. M. London,
Y. Wang,
L. M. Rowland,
D. T. Chin,
R. H. Freeman,
and
W. J. Krause.
Lymphoguanylin: cloning and characterization of a unique member of the guanylin peptide family.
Endocrinology
140:
1800-1806,
1999
12.
Forte, L. R.,
and
F. K. Hamra.
Guanylin and uroguanylin: intestinal peptide hormones that regulate epithelial transport.
News Physiol. Sci.
11:
17-24,
1996.
13.
Forte, L. R.,
W. J. Krause,
and
R. H. Freeman.
Receptors and cGMP signaling mechanism for E. coli enterotoxin in opossum kidney.
Am. J. Physiol.
255 (Renal Fluid Electrolyte Physiol. 24):
F1040-F1046,
1988
14.
Forte, L. R.,
W. J. Krause,
and
R. H. Freeman.
Escherichia coli enterotoxin receptors: localization in opossum kidney, intestine and testis.
Am. J. Physiol.
257 (Renal Fluid Electrolyte Physiol. 26):
F874-F881,
1989
15.
Forte, L. R.,
P. K. Thorne,
S. L. Eber,
W. J. Krause,
R. H. Freeman,
S. H. Francis,
and
J. D. Corbin.
Stimulation of intestinal Cl transport by heat-stable enterotoxin: activation of cAMP-dependent protein kinase by cGMP.
Am. J. Physiol.
263 (Cell Physiol. 32):
C607-C615,
1992
16.
Giannella, R. A.
Escherichia coli heat-stable enterotoxin, guanylins, and their receptors: What are they and what do they do?
J. Lab. Clin. Med.
125:
173-181,
1995[Medline].
17.
Greenberg, R. N.,
M. Hill,
J. Crytzer,
W. J. Krause,
S. L. Eber,
F. K. Hamra,
and
L. R. Forte.
Comparison of effects of uroguanylin, guanylin, Escherichia coli heat-stable enterotoxin STa in mouse intestine and kidney: evidence that uroguanylin is an intestinal natriuretic hormone.
J. Investig. Med.
45:
276-282,
1997[Medline].
18.
Guba, M.,
M. Kuhn,
W.-G. Forssmann,
M. Classen,
M. Gregor,
and
U. Seidler.
Guanylin strongly stimulates rat duodenal HCO3 secretion: proposed mechanism and comparison with other secretagogues.
Gastroenterology
111:
1558-1568,
1996[Medline].
19.
Guerrant, R. L.,
J. M. Hughes,
B. Chang,
D. C. Robertson,
and
F. Murad.
Activation of intestinal guanylate cyclase by heat-stable enterotoxin of Escherichia coli: studies of tissue specificity, potential receptors, and intermediates.
J. Infect. Dis.
142:
220-228,
1980[Medline].
20.
Hamra, F. K.,
S. L. Eber,
D. T. Chin,
M. G. Currie,
and
L. R. Forte.
Regulation of intestinal uroguanylin/guanylin receptor-mediated responses by mucosal acidity.
Proc. Natl. Acad. Sci. USA
94:
2705-2710,
1997
21.
Hamra, F. K.,
L. R. Forte,
S. L. Eber,
N. V. Pidhorodeckyj,
W. J. Krause,
R. H. Freeman,
D. T. Chin,
J. A. Tompkins,
K. F. Fok,
C. E. Smith,
K. L. Duffin,
N. R. Siegel,
and
M. G. Currie.
Uroguanylin: structure and activity of a second endogenous peptide that stimulates intestinal guanylate cyclase.
Proc. Natl. Acad. Sci. USA
90:
10464-10468,
1993[Abstract].
22.
Hill, O.,
Y. Cetin,
A. Cieslak,
H.-J. Magert,
and
W.-G. Forssmann.
A new human guanylate cyclase-activating peptide (uroguanylin): precursor cDNA and colonic expression.
Biochim. Biophys. Acta
1253:
146-149,
1995[Medline].
23.
Hughes, J. M.,
F. Murad,
B. Chang,
and
R. L. Guerrant.
Role of cyclic GMP in the action of heat-stable enterotoxin of Escherichia coli.
Nature
271:
755-756,
1978[Medline].
24.
Janke, A.,
X. Xu,
and
U. Arnason.
The complete mitochondrial genome of the walaroo (Macropus robustus) and the phylogenetic relationship among Monotremata, Marsupialia, and Eutheria.
Proc. Natl. Acad. Sci. USA
94:
1276-1281,
1997
25.
Joo, N. S.,
R. M. London,
H. D. Kim,
L. R. Forte,
and
L. L. Clarke.
Regulation of intestinal Cl and HCO
3 secretion by uroguanylin.
Am. J. Physiol.
274 (Gastrointest. Liver Physiol. 37):
G633-G644,
1998
26.
Kita, T.,
C. E. Smith,
K. F. Fok,
K. L. Duffin,
W. M. Moore,
P. J. Karabatsos,
J. F. Kachur,
F. K. Hamra,
N. V. Pidhorodeckyj,
L. R. Forte,
and
M. G. Currie.
Characterization of human uroguanylin: member of the guanylin peptide family.
Am. J. Physiol.
266 (Renal Fluid Electrolyte Physiol. 35):
F342-F348,
1994
27.
Krause, W. J.,
G. L. Cullingford,
R. H. Freeman,
S. L. Eber,
K. C. Richardson,
K. F. Fok,
M. G. Currie,
and
L. R. Forte.
Distribution of heat-stable enterotoxin/guanylin receptors in the intestinal tract of man and other mammals.
J. Anat.
184:
407-417,
1994[Medline].
28.
Krause, W. J.,
R. H. Freeman,
S. L. Eber,
F. K. Hamra,
M. G. Currie,
and
L. R. Forte.
Guanylyl cyclase receptors and guanylin-like peptides in reptilian intestine.
Gen. Comp. Endocrinol.
107:
229-239,
1997[Medline].
29.
Krause, W. J.,
R. H. Freeman,
S. L. Eber,
F. K. Hamra,
K. F. Fok,
M. G. Currie,
and
L. R. Forte.
Distribution of Escherichia coli heat-stable enterotoxin/guanylin/uroguanylin receptors in the avian intestinal tract.
Acta Anat. (Basel)
153:
210-219,
1995[Medline].
30.
Krause, W. J.,
R. H. Freeman,
and
L. R. Forte.
Autoradiographic demonstration of specific binding sites for E. coli enterotoxin in various epithelia of the North American opossum.
Cell Tissue Res.
260:
387-394,
1990[Medline].
31.
Kuhn, M.,
K. Adermann,
J. Jahne,
W. G. Forssmann,
and
G. Rechkemmer.
Segmental differences in the effects of guanylin and Escherichia coli heat-stable enterotoxin on Cl secretion in human gut.
J. Physiol. (Lond.)
479:
433-440,
1994[Abstract].
32.
Kuno, T.,
Y. Kamisaki,
S. A. Waldman,
J. Gariepy,
G. Schoolnik,
and
F. Murad.
Characterization of the receptor for heat-stable enterotoxin from Escherichia coli in rat intestine.
J. Biol. Chem.
261:
1470-1476,
1986
33.
Lennane, R. J.,
W. S. Peart,
R. M. Carey,
and
J. A. Shaw.
Comparison of natriuresis after oral and intravenous sodium loading in sodium-depleted rabbits: evidence for a gastrointestinal or portal monitor of sodium intake.
Clin. Sci. Mol. Med.
49:
433-436,
1975[Medline].
34.
Li, Z.,
and
M. F. Goy.
Peptide-regulated guanylate cyclase pathways in rat colon: in situ localization of GCA, GCC, and guanylin mRNA.
Am. J. Physiol.
265 (Gastrointest. Liver Physiol. 28):
G394-G402,
1993
35.
Lima, A. A. M.,
H. S. A. Monteiro,
and
M. C. Fonteles.
The effects of Escherichia coli heat-stable enterotoxin in renal sodium tubular transport.
Pharmacol. Toxicol.
70:
163-167,
1992[Medline].
36.
London, R. M.,
W. J. Krause,
X. Fan,
S. L. Eber,
and
L. R. Forte.
Signal transduction pathways via guanylin and uroguanylin in the stomach and intestine.
Am. J. Physiol.
273 (Gastrointest. Liver Physiol. 36):
G93-G105,
1997
37.
Mann, E. A.,
M. L. Jump,
J. Wu,
E. Yee,
and
R. A. Giannella.
Mice lacking the guanylyl cyclase C receptor are resistant to STa-induced intestinal secretion.
Biochem. Biophys. Res. Commun.
239:
463-466,
1997[Medline].
38.
Nakazato, M.,
H. Yamaguchi,
H. Kinoshita,
K. Kangawa,
H. Matsuo,
N. Chino,
and
S. Matsukura.
Identification of biologically active and inactive human uroguanylins in plasma and urine and their increases in renal insufficiency.
Biochem. Biophys. Res. Commun.
220:
586-593,
1996[Medline].
39.
Nandi, A.,
R. Bhandari,
and
S. S. Visweswariah.
Epitope conservation and immunohistochemical localization of the guanylin/stable toxin peptide receptor, guanylyl cyclase C.
J. Cell. Biochem.
66:
500-511,
1997[Medline].
40.
Pfeifer, A.,
A. Aszodi,
U. Seidler,
P. Ruth,
F. Hofmann,
and
R. Fassler.
Intestinal secretory defects and dwarfism in mice lacking cGMP-dependent protein kinase II.
Science
274:
2082-2086,
1996
41.
Schulz, S.,
C. K. Green,
P. S. T. Yuen,
and
D. L. Garbers.
Guanylyl cyclase is a heat-stable enterotoxin receptor.
Cell
63:
941-948,
1990[Medline].
42.
Schulz, S.,
M. J. Lopez,
M. Kuhn,
and
D. L. Garbers.
Disruption of the guanylyl cyclase-C gene leads to a paradoxical phenotype of viable but heat-stable enterotoxin-resistant mice.
J. Clin. Invest.
100:
1590-1595,
1997
43.
Singh, S.,
G. Singh,
J. M. Helm,
and
R. Gerzer.
Isolation and expression of a guanylate cyclase-coupled heat stable enterotoxin receptor cDNA from a human colonic cell line.
Biochem. Biophys. Res. Commun.
179:
1455-1463,
1991[Medline].
44.
Vaandrager, A. B.,
S. Schulz,
H. R. De Jonge,
and
D. Garbers.
Guanylyl cyclase C is an N-linked glycoprotein receptor that accounts for multiple heat-stable enterotoxin-binding proteins in the intestine.
J. Biol. Chem.
268:
2174-2179,
1993
45.
Wada, A.,
T. Hirayama,
S. Kitao,
J. Fujisawa,
Y. Hidaka,
and
Y. Shimonishi.
Pig intestinal membrane-bound receptor (guanylyl cyclase) for heat-stable enterotoxin: cDNA cloning, functional expression, and characterization.
Microbiol. Immunol.
38:
535-541,
1994[Medline].
46.
Whitaker, T. L.,
D. P. Witte,
M. C. Scott,
and
M. B. Cohen.
Uroguanylin and guanylin: distinct but overlapping patterns of messenger RNA expression in mouse intestine.
Gastroenterology
113:
1000-1006,
1997[Medline].
47.
White, A. A.,
W. J. Krause,
J. T. Turner,
and
L. R. Forte.
Opossum kidney contains a functional receptor for the Escherichia coli heat-stable enterotoxin.
Biochem. Biophys. Res. Commun.
159:
363-367,
1989[Medline].
48.
Wiegand, R. C.,
J. Kato,
and
M. G. Currie.
Rat guanylin cDNA: characterization of the precursor of the endogenous activator of intestinal guanylate cyclase.
Biochem. Biophys. Res. Commun.
185:
812-817,
1992[Medline].