Cigarette smoke induces MUC5AC mucin overproduction via tumor necrosis factor-
-converting enzyme in human airway epithelial (NCI-H292) cells
Matt X. G. Shao,
Takashi Nakanaga, and
Jay A. Nadel
Cardiovascular Research Institute and Departments of Medicine and Physiology, University of California San Francisco, San Francisco, California 94143-0130
Submitted 21 January 2004
; accepted in final form 24 April 2004
 |
ABSTRACT
|
---|
Chronic obstructive pulmonary disease (COPD) is one of the leading causes of death in the U.S. Because cigarette smoking is so importantly implicated in the pathogenesis of COPD and because mucus hypersecretion plays such an important role in COPD, understanding of the mechanisms of smoking-induced mucus hypersecretion could lead to new therapies for COPD. Cigarette smoke causes mucin overproduction via EGF receptor (EGFR) in airway epithelial cells, but the cellular mechanism remains unknown. Airway epithelial cells contain EGFR proligands on their surfaces, which can be cleaved by metalloprotease and subsequently bind to EGFR resulting in mucin production. We hypothesize that TNF-
-converting enzyme (TACE) is activated by cigarette smoke, resulting in increased shedding of EGFR proligand, leading to EGFR phosphorylation and mucin induction in human airway epithelial (NCI-H292) cells. Here we show that cigarette smoke increases MUC5AC production in NCI-H292 cells, an effect that is prevented by an EGFR-neutralizing antibody and by specific knockdown of transforming growth factor-
(TGF-
) using small interfering RNA (siRNA) for TGF-
, implicating TGF-
-dependent EGFR activation in the responses. Cigarette smoke increases TGF-
shedding, EGFR phosphorylation, and mucin production, which are prevented by metalloprotease inhibitors (GM-6001 and TNF-
protease inhibitor-1) and by specific knockdown of TACE with TACE siRNA, implicating TACE in smoking-induced responses. Furthermore, pretreatment with antioxidants prevents smoking-induced TGF-
shedding and mucin production, suggesting that reactive oxygen species is involved in TACE activation. These results implicate TACE in smoking-induced mucin overproduction via the TACE-proligand-EGFR signal pathway in NCI-H292 cells.
chronic obstructive pulmonary disease; ectodomain shedding; epidermal growth factor receptor; protease; transforming growth factor-
IN THE HUMAN RESPIRATORY TRACT, the airway epithelium provides a barrier against various environmental insults. Normal airway epithelium is coated with a mucus layer. Mucins (e.g., MUC5AC) are major components of mucus (10, 11, 29), which assists in clearance of inhaled foreign materials.
Chronic obstructive pulmonary disease (COPD) is a major health problem, which is the fourth leading cause of death in the U.S. (21). Goblet cell hyperplasia and mucus hypersecretion are prominent features of COPD, especially during exacerbations (1, 12, 25, 34, 35). Cigarette smoking is implicated in the pathophysiology of COPD and is closely associated with mucus hypersecretion (18, 32, 35). However, the cellular mechanisms underlying this association remain unknown.
In 1999, Takeyama et al. (31) discovered that when NCI-H292 cells grow in dense cultures, they undergo mucus cell differentiation and produce mucins via activation of EGF receptor (EGFR). Takeyama et al. (32) also found that cigarette smoke causes mucin production via EGFR activation in vitro and in vivo. However, the cellular mechanisms by which cigarette smoke causes EGFR activation are still unknown. Richter et al. (28) reported that cigarette smoke induces the expression and release of EGFR ligands [e.g., transforming growth factor-
(TGF-
), amphiregulin (AR), heparin-binding EGF (HB-EGF)] in airway epithelial cells. These studies raise the possibility that cigarette smoke causes EGFR activation by increasing the availability of soluble EGFR ligands, which then bind to and activate EGFR.
Recently, PMA has been reported to induce EGFR phosphorylation and mucin production via activation of tumor necrosis factor-
-converting enzyme (TACE) and subsequent proteolytic shedding of the EGFR proligand pro-TGF-
in NCI-H292 cells (30). Here we hypothesize that cigarette smoke causes EGFR activation and mucin production via activation of TACE, which cleaves the precursor of an EGFR ligand, resulting in EGFR phosphorylation and mucin induction in NCI-H292 cells.
To examine this hypothesis, first we investigated whether cigarette smoke induces ligand-dependent EGFR phosphorylation and mucin production in NCI-H292 cells and, if so, which specific EGFR ligand is involved in these processes. Next, we examined whether metalloprotease activation is required for the ligand release and subsequent EGFR phosphorylation by cigarette smoke and, if so, which specific metalloprotease is involved. Finally, we examined how cigarette smoke activates the metalloprotease. We show that cigarette smoke activates metalloprotease TACE, cleaving pro-TGF-
, leading to shedding of soluble TGF-
, resulting in EGFR phosphorylation and mucin overproduction in NCI-H292 cells. The study suggests that oxygen free radicals are responsible for the activation of TACE by cigarette smoke.
 |
MATERIALS AND METHODS
|
---|
Materials.
AG-1478, GM-6001 (GM), negative control of GM-6001 [GM()], tumor necrosis factor-
proteinase inhibitor-1 (TAPI-1), EGFR monoclonal antibody (Ab-3), EGFR monoclonal antibody (Ab-5), and TGF-
monoclonal antibody (Ab-3) were purchased from Calbiochem (San Diego, CA). BIBX 1522 was generously provided by Boehringer Ingelheim. 1,3-Dimethyl-2-thiourea (DMTU) and n-propyl gallete (nPG) were purchased from Sigma. EGFR (1005) rabbit polyclonal antibody and p-Tyr (PY99) monoclonal antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
Cell culture.
NCI-H292 cells, a human pulmonary mucoepidermoid carcinoma cell line, were plated at 56 x 105 cells in 2 ml in each well of a six-well plate or at 12 x 105 cells in 1 ml in each well of a 24-well plate (both 6-well and 24-well plates were purchased from BD Falcon, Bedford, MA) and were grown in RPMI 1640 medium containing 10% FCS, penicillin (100 U/ml), streptomycin (100 µg/ml), and HEPES (25 mM) at 37°C in a humidified, 5% CO2/95% air, water-jacketed incubator. After the cells reached confluence, they were serum-starved for 24 h before experiments to maintain low basal levels of MUC5AC expression.
Preparation of cigarette smoke solution and treatment of cells with cigarette smoke.
Standard research cigarettes (code 2R1, products from University of Kentucky Tobacco and Health Research Foundation) were used in the study. Cigarette smoke solution was prepared as described previously (5). In brief, smoke of one cigarette was withdrawn into a polypropylene syringe (30 ml) at a rate of 1 puff/min and bubbled slowly into 25 ml of RPMI 1640 containing 50 mM HEPES buffer (hereafter called "cigarette smoke" solution). The cigarette smoke solution was then sterilized by filtration through a 0.22-µm cellulose acetate sterilizing system (Corning, NY), aliquotted, and stored at 20°C. Aliquots of the cigarette smoke solution were thawed at 4°C, and various dilutions were prepared with RPMI 1640 immediately before incubation with cells.
After 24 h of serum starvation, cells were exposed to RPMI 1640 containing various dilutions of the cigarette smoke solution. After 24 h of exposure, cell culture supernatants and cell lysates were collected to measure MUC5AC mucin protein production.
MUC5AC ELISA.
Cells were grown in 24-well plates. Production of MUC5AC protein in cell lysates and in cell culture supernatants were measured by ELISA (31). The amount of MUC5AC protein in each sample was normalized to total protein in cell lysate and was expressed as µg/mg cell protein.
Analysis of effect of cigarette smoke on cleavage and release of soluble TGF-
.
Cells were grown in 24-well plates. After reaching confluence and being serum-starved for 24 h, cells were either incubated with cigarette smoke or maintained in medium alone for 2 h. For inhibition studies, cells were pretreated with the inhibitors for 30 min before exposure to cigarette smoke. In studies designed to prevent soluble TGF-
from binding to EGFR, we added an EGFR-neutralizing antibody (Ab-3, 4 µg/ml) 30 min before adding each stimulus. Cell supernatants were collected, and TGF-
was measured with the TGF-
ELISA kit (Oncogene, San Diego, CA) according to the manufacturer's instructions.
RNA isolation and RT-PCR.
Total RNA was isolated using RNAqueous-4PCR kit (Ambion, Austin, TX), and 1.01.5 µg was primed with Oligo(dT) and reverse transcribed with the RETROscript kit (Ambion) in a final volume of 20 µl (RT reaction), following manual instructions. Two microliters of the RT reaction were PCR-amplified in a 50-µl reaction with SuperTaq DNA polymerase (Ambion). Primers were MUC5AC (forward) 5'-TCCGGCCTCATCTTCTCC-3' and (reverse) 5'-ACTTGG GCACTGGTGCTG-3'; TACE (forward) 5'-ACCTGAAGAGCTTGTTCATCGAG-3' and (reverse) 5'-CCATGAAGTGTTCCGATAGATGTC-3'; pro-TGF-
(forward) 5'-CGCCCTGTTCGCTCTGGGTATTG-3' and (reverse) 5'-AGGAGGTCCGCATGCTCACAGCG-3'; pro-HB-EGF (forward) 5'-TTATCCTCCAAGCCACAAGC-3' and (reverse) 5'-TGACCAGCAGACAGACAGATG-3'; pro-AR (forward) 5'-TGGTGCTGTCGCTCTTGATA-3' and (reverse) 5'-GCCAGGTATTTGTGGTTCGT-3'; proheregulin-
(pro-Hrg-
; forward) 5'-GAGATGTCCGAGCGCAAAGAAGGCAGA-3' and (reverse) 5'-TGAAGACACATATCGTCCTTCAGTTGAGGC-3'. As quantitative controls, primers for Rig/S15 rRNA that encodes a small ribosomal subunit protein, a housekeeping gene that was constitutively expressed (14), were used. They were (forward) 5'-TTCCGCAAGTTCACCTACC-3' and (reverse) 5'-CGGGCCGGCCATGCTTTACG-3'. The PCR reaction mixture was denatured at 94°C for 4 min, followed by 2540 cycles at 94°C for 30 s, 57°C for 45 s, and 72°C for 60 s. After PCR, 10-µl aliquots were subjected to 1.2% agarose gel electrophoresis and stained with ethidium bromide.
Cell lysis, immunoprecipitation, and immunoblotting.
After various treatments, cells were lysed on ice in PBS lysis buffer containing 1% Triton X-100, 1% deoxycholic acid, 50 mM NaF, 1 mM sodium orthovanadate, and proteinase inhibitors (Complete Mini, Roche). Lysates were precleared by centrifugation at 14,000 rpm in a Denville Micro 260D microcentrifuge (Denville Scientific, Metuchen, NJ) for 15 min at 4°C. Protein concentration was determined with the bicinchoninic acid-based BCA Protein Assay kit (Pierce, Rockford, IL). For immunoprecipitation, aliquots of cell lysates containing equal amounts of protein were immunoprecipitated with 2 µg of anti-EGFR antibody and 40 µl of protein A/G agarose beads (Santa Cruz Biotechnology) for 16 h at 4°C. Precipitates were washed three times with PBS (0.5 ml), suspended in SDS sample buffer, boiled for 5 min, and subjected to electrophoresis on 7.5% SDS-polyacrylamide gel (SDS-PAGE). For Western blotting, 30 µg of protein from each treatment were subjected to 7.5% SDS-PAGE electrophoresis and transferred to a polyvinylidene difluoride membrane (Bio-Rad Laboratories), which was blocked with 5% BSA, probed with specific primary antibodies, washed with PBS, and then probed with secondary antibodies conjugated to horseradish peroxidase. Immunoreactive bands were visualized by chemiluminescence with Western Blotting Luminol Reagent (Santa Cruz Biotechnology).
Small interfering RNA preparation and transfection of cells.
To design gene-specific small interfering RNA (siRNA) duplexes, we selected sequences of the type AAN19 (N, any nucleotide) from the open-reading frame of the gene of interest to obtain a 21-nt sense and 21-nt antisense strand with a GC content <50% (6, 7). A selected siRNA sequence was submitted to a basic local alignment search tool search against the human genome sequence to ensure that only the gene of interest of the human genome was targeted. The highest efficiencies in silencing target genes were obtained with mixtures of siRNA duplexes targeting different regions of the gene of interest. The selected 21-nt sequences are TACE: AAGCTTGATTCTTTGCTCTCA, AGTTTGCTTGGCACACCTTTT, CATAGAGCCACTTTGGAGATT; pro-TGF-
: AATGACTGCCCAGATTCCCAC, AACCTGCAGGTTTTTGGTGCA, AAAACACTGTGAGTGGTGCCG; pro-HB-EGF: AAAGTCCGTGACTTGCAAGAG, AAGGACTTCTGCATCCATGGA, AAAGTGAAGTTGGGCATGACT; pro-AR: AAGAGTATGATAACGAACCAC, AATTTCTGCATTCACGGAGAA, AACATGCAAATGTCAGCAAGA; pro-Hrg: AAAGAGATGAAAAGCCAGGAA, AAACCAGTTCTGAATACTCCT, AACTGAAGGAGCATATGTGTC. As nonspecific siRNA control, a sequence targeting firefly (Photinus pyralis) luciferase gene (X65324
[GenBank]
) 153175 was used (CGTACGCGGAATACTTCGATT). Twenty-one-nucleotide double-stranded RNAs were prepared in vitro by Silencer siRNA Construction kit (Ambion). siRNA transfection into NCI-H292 cells was carried out with the Silencer siRNA Transfection kit (Ambion). Specific silencing of targeted genes was confirmed by RT-PCR analysis at 48 h after transfection.
Statistical analysis.
Data are presented as means ± SD (n = 3). ANOVA was used to determine statistically significant differences (P < 0.01).
 |
RESULTS
|
---|
Cigarette smoke upregulates MUC5AC expression in NCI-H292 cells.
Cigarette smoke induced MUC5AC gene expression (Fig. 1A) and MUC5AC protein production (Fig. 1B) dose dependently. MUC5AC gene expression and protein production were also induced time dependently by cigarette smoke (Fig. 1, C and D). Cigarette smoke (1:10 dilution) caused a significant increase in MUC5AC gene expression: a sixfold increase above control was seen at 8 h after the cells were exposed to cigarette smoke (Fig. 1A). Cigarette smoke also increased MUC5AC protein production: an approximately three- to fourfold increase above control was observed at 24 h after cigarette smoke stimulation (Fig. 1B).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 1. Effect of cigarette smoke on MUC5AC expression. NCI-H292 cells were exposed to cigarette smoke at various dilutions and times. Total RNA was prepared and subjected to RT-PCR; Rig/S15 was used as an internal marker. Effect of various dilutions of cigarette smoke given for 8 h on RT-PCR-amplified MUC5AC mRNA expression (A) and when given for 24 h on total MUC5AC mucin protein production by ELISA (B). Effect of cigarette smoke (1:10 dilution) given for various times on RT-PCR-amplified MUC5AC mRNA expression (C) and on MUC5AC mucin protein production by ELISA (D). Results are typical of the results in 3 separate experiments. Data in B and D are expressed as means ± SD (n = 3). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). Con., control (vehicle treatment). *P < 0.01, compared with vehicle alone.
|
|
Cigarette smoke induces ligand-dependent EGFR phosphorylation and MUC5AC expression.
Cigarette smoke (1:10 dilution) induced EGFR phosphorylation (Fig. 2A), MUC5AC gene expression (Fig. 2B), and mucin protein production (Fig. 2C). These effects were prevented by pretreatment of the cells with AG-1478 (10 µM) or with BIBX (5 µg/ml) (selective inhibitors of EGFR phosphorylation, Fig. 2, AC), implicating EGFR phosphorylation in cigarette smoke-induced MUC5AC mucin expression. Preincubation of the cells with an EGFR-neutralizing antibody (4 µg/ml) inhibited cigarette smoke-induced EGFR phosphorylation (Fig. 2D), MUC5AC gene expression (Fig. 2E), and mucin protein production (Fig. 2F). These results implicate ligand-dependent EGFR phosphorylation in MUC5AC mucin expression by cigarette smoke.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2. Ligand-dependent EGF receptor (EGFR) phosphorylation mediates cigarette smoke-induced MUC5AC expression. A: after being serum-starved for 24 h, the cells were pretreated with or without AG-1478 (10 µM) or BIBX (5 µg/ml) for 30 min and then treated with vehicle or cigarette smoke (1:10) for 15 min. After lysis, EGFR was immunoprecipitated with monoclonal anti-EGFR antibody (Ab-5) followed by immunoblotting with antiphosphorylated tyrosine (anti-p-Tyr) antibody (top) and reprobing with anti-EGFR antibody (1005) (bottom, which showed even loading of total protein in each lane). Cells were treated as described in A for 8 h to examine MUC5AC mRNA expression by RT-PCR (B) or for 24 h to measure MUC5AC mucin protein production by ELISA (C). Cells were pretreated with or without an EGFR-neutralizing antibody (Ab-3) (4 µg/ml) for 30 min and then treated with vehicle or cigarette smoke (1:10) for 15 min to analyze EGFR phosphorylation (D), for 8 h to analyze MUC5AC mRNA expression by RT-PCR (E), or for 24 h to analyze mucin protein production by ELISA (F). Results are typical of the results in 3 separate experiments. Data in C and F are expressed as means ± SD (n = 3). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). *P < 0.01, compared with vehicle alone; **P < 0.01, compared with cigarette smoke alone.
|
|
EGFR ligand TGF-
mediates cigarette smoke-induced EGFR phosphorylation and MUC5AC expression.
Ligands TGF-
, HB-EGF, AR, and Hrg-
are expressed in human airway epithelial cells (26, 33). We examined which ligand was specifically involved in cigarette smoke-induced EGFR phosphorylation and mucin expression by knocking down the expression of pro-TGF-
, pro-HB-EGF, pro-AR, and pro-Hrg-
, respectively, with siRNA for each proligand. The inhibitory effect of siRNA on the expression of each proligand was monitored at the mRNA level by RT-PCR (Fig. 3A). Knockdown of pro-TGF-
prevented cigarette smoke-induced EGFR phosphorylation (Fig. 3B), MUC5AC gene expression (Fig. 3C), and mucin protein production (Fig. 3D). However, knockdown of pro-HB-EGF, pro-AR, and pro-Hrg-
had no significant inhibitory effects on these processes (Fig. 3, BD).
Preincubation of the cells with a TGF-
-neutralizing antibody (4 µg/ml) prevented cigarette smoke-induced EGFR phosphorylation (Fig. 3E) and MUC5AC gene expression (Fig. 3F) and protein production (Fig. 3G), further confirming the involvement of TGF-
in cigarette smoke-induced EGFR phosphorylation and MUC5AC mucin expression.
Cigarette smoke induces shedding of soluble TGF-
via activation of metalloprotease.
Pro-TGF-
is constitutively expressed on the plasma membrane surface of NCI-H292 cells. Exposure of the cells to cigarette smoke (1:10 dilution) for 2 h in the presence of an EGFR-neutralizing antibody (4 µg/ml) increased soluble TGF-
in the supernatant measured by ELISA (Fig. 4A, two left bars). GM (10 µM), a broad-spectrum metalloprotease inhibitor, and TAPI-1 (10 µM), a relatively selective metalloprotease TACE inhibitor, inhibited cigarette smoke-induced TGF-
release (Fig. 4A), EGFR phosphorylation (Fig. 4B), MUC5AC gene expression (Fig. 4C), and mucin protein production (Fig. 4D). GM() (10 µM) had no inhibitory effect on these processes (Fig. 4, AD). These results suggest a critical role of a metalloprotease in cigarette smoke-induced TGF-
shedding, EGFR activation, and MUC5AC mucin expression. The fact that TAPI-1 also prevented all of these effects of cigarette smoke on NCI-H292 cells suggests the possible involvement of TACE in cigarette smoke-induced responses in NCI-H292 cells.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 4. Effect of inhibition of metalloprotease on cigarette smoke-induced TGF- release, EGFR phosphorylation, and MUC5AC expression. A: cells were pretreated with an anti-EGFR-neutralizing antibody (4 µg/ml) for 30 min to block EGFR-ligand binding sites, then treated with TNF- protease inhibiton (TAPI)-1 (10 µM), GM-6001 (GM, 10 µM), or the negative control of GM [GM(), 10 µM] for 30 min and then stimulated with vehicle or cigarette smoke (1:10 dilution) for 2 h. Supernatants were collected for measurement of soluble TGF- by ELISA. After pretreatment with or without TAPI-1 (10 µM), GM (10 µM), or GM() (10 µM), the cells were stimulated with cigarette smoke for 15 min and analyzed for EGFR phosphorylation (B); stimulated for 8 h and analyzed for MUC5AC gene expression (C); or stimulated with vehicle or cigarette smoke for 24 h and analyzed for MUC5AC mucin protein production (D). Findings are typical of the results in 3 separate experiments. Data in A and D are expressed as means ± SD (n = 3). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). *P < 0.01, compared with vehicle alone and GM(); **P < 0.01, compared with cigarette smoke alone and GM().
|
|
TACE mediates cigarette smoke-induced TGF-
release, EGFR phosphorylation, and MUC5AC mucin expression.
To study the involvement of TACE in cigarette smoke-induced cell responses, we specifically knocked down TACE expression by transfection of the cells with TACE siRNA. TACE siRNA transfection caused suppression of TACE expression at the mRNA level shown by RT-PCR (Fig. 5A). Knockdown of TACE expression inhibited cigarette smoke-induced TGF-
release (Fig. 5B), EGFR phosphorylation (Fig. 5C), MUC5AC gene expression (Fig. 5D), and mucin protein production (Fig. 5E). These results implicate the metalloprotease TACE in cigarette smoke-induced responses in NCI-H292 cells.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 5. Effect of knockdown of TNF- -converting enzyme (TACE) expression on TGF- release, EGFR phosphorylation, and MUC5AC expression by cigarette smoke. A: cells were transfected with or without TACE siRNA (10 nM) or luciferase siRNA (Luc, 10 nM, as negative control), cultured for 48 h, and then analyzed for TACE mRNA expression by RT-PCR. B: cells were transfected with TACE siRNA (10 nM) or Luc siRNA (10 nM) and cultured for 48 h. After preincubation with an EGFR-neutralizing antibody (4 µg/ml) for 30 min to block EGFR-ligand binding sites, cells were stimulated with vehicle or cigarette smoke (1:10) for 2 h. Supernatants were collected for measurement of soluble TGF- by ELISA. TACE siRNA inhibited soluble TGF- release in control states and by cigarette smoke, whereas Luc siRNA had no inhibitory effect. Cells were transfected with TACE siRNA or with Luc siRNA. Forty-eight hours later, cells were treated with cigarette smoke (1:10) for 15 min and analyzed for EGFR phosphorylation (C) or for 8 h and analyzed for MUC5AC gene expression (D) or were treated with vehicle or cigarette smoke (1:10) for 24 h and measured for MUC5AC mucin protein production (E). In nontransfected cells, cigarette smoke increased EGFR phosphorylation, MUC5AC mRNA expression, and mucin protein production. TACE siRNA (10 nM) prevented these processes, whereas Luc siRNA (10 nM) was without inhibitory effect. Results are typical of the results in 3 separate experiments. Data in B and E are expressed as means ± SD (n = 3). Mucins were measured in the cell lysate (dark areas) and in the supernatant (light areas). *P < 0.01, compared with vehicle treatment alone and with Luc transfection. **P < 0.01, compared with cigarette smoke treatment alone and with Luc transfection.
|
|
Cigarette smoke activates TACE and induces EGFR phosphorylation and MUC5AC mucin expression via generation of reactive oxygen species.
TACE can be activated by reactive oxygen species (ROS) (37, 38). We examined whether cigarette smoke activates TACE via ROS produced by cigarette smoke. Pretreatment of the cells with ROS scavengers DMTU (20 mM) and nPG (100 µM) prevented cigarette smoke-induced TGF-
release (Fig. 6A), EGFR phosphorylation (Fig. 6B), MUC5AC gene expression (Fig. 6C), and mucin production (Fig. 6D), implicating ROS in TACE activation, TGF-
release, EGFR activation, and MUC5AC mucin expression in NCI-H292 cells.
 |
DISCUSSION
|
---|
Our previous studies showed that an EGFR cascade is responsible for mucin induction in response to a wide variety of stimuli including cigarette smoke in airway epithelial cells (31, 32). EGFR phosphorylation initiates a signaling pathway of Ras/MEK/ERK/Sp1 (23, 31), which upregulates MUC5AC gene transcription and produces mucin protein. Furthermore, we established that metalloprotease TACE cleaves EGFR proligand pro-TGF-
in a human airway epithelial cell line (NCI-H292 cells), releasing mature soluble TGF-
, which binds to EGFR, leading to EGFR activation and mucin production (30). Thus we identified a new signal pathway: TACE activation-TGF-
shedding-EGFR phosphorylation-Ras/MEK/ERK activation, which induces mucin production in NCI-H292 cells.
COPD is a major cause of death in the U.S. and accounted for 112,584 deaths in 1998 (21). Most patients with COPD have mucus hypersecretion. Overproduced mucus plugs the airways and contributes to exacerbations of COPD. Cigarette smoking is the most important risk factor initiating the development of COPD. The present study shows for the first time that cigarette smoke induces MUC5AC mucin production via activation of TACE and subsequent cleavage of proligand pro-TGF-
in a human airway epithelial cell line (NCI-H292 cells).
EGFR activation plays a key role in mucin induction by various stimuli (22). Two different processes may be involved in EGFR activation: 1) ligand-dependent EGFR phosphorylation and 2) ligand-independent EGFR phosphorylation. An increasing body of evidence indicates that EGFR can be transactivated by G protein-coupled receptors via metalloprotease-dependent shedding of EGFR ligands (20, 27, 36). These results suggested that some of the EGFR activation previously thought to involve ligand-independent EGFR phosphorylation is mediated via ligand binding to EGFR. To investigate whether ligand binding is required for EGFR phosphorylation by cigarette smoke, we preincubated cells with a neutralizing anti-EGFR antibody to block the EGFR ligand binding sites on the cell surface. This pretreatment prevented EGFR phosphorylation (Fig. 2D) and mucin production (Fig. 2, E and F) by cigarette smoke, implicating ligand-dependent EGFR activation in mucin production by cigarette smoke.
EGFR ligand TGF-
is constitutively expressed in airway epithelial cells. TGF-
is synthesized as a 20- to 22-kDa transmembrane precursor, pro-TGF-
. Newly synthesized pro-TGF-
is cleaved by metalloproteases at the Ala39-Val40 and Ala89-Val90 sequences, releasing 6-kDa mature soluble TGF-
(4, 15, 19). To examine whether a metalloprotease is involved in the ectodomain shedding of pro-TGF-
by cigarette smoke in NCI-H292 cells, we utilized metalloprotease inhibitors, GM and TAPI-1. Both inhibitors prevented cigarette smoke-induced TGF-
release (Fig. 4A), EGFR phosphorylation (Fig. 4B), and MUC5AC gene expression (Fig. 4C) and protein production (Fig. 4D), implicating metalloprotease activity in these processes.
Two members of a disintegrin and metalloprotease (ADAM) family proteases, ADAM10 and TACE (ADAM17), are constitutively expressed in NCI-H292 cells (16, 30). Although ADAM10 cleaves both pro-TGF-
and pro-HB-EGF and has been reported to mediate MUC2 mucin induction by gram-positive bacteria (16, 36), the facts that 1) HB-EGF siRNA did not prevent cigarette smoke-induced EGFR phosphorylation and MUC5AC mucin production (Fig. 3, BD) and 2) the efficiency of cleavage of pro-TGF-
by ADAM10 is 90-fold less than TACE in vitro (9) mitigate against involvement of ADAM10 in EGFR phosphorylation and mucin production by cigarette smoke in NCI-H292 cells. TACE has recently been reported to be responsible for the ectodomain shedding of TGF-
in various epithelial tissues (24, 30, 39). To examine a possible role of TACE in cigarette smoke-induced TGF-
release, EGFR activation, and mucin induction in NCI-H292 cells, we specifically knocked down TACE expression using TACE siRNA (Fig. 5A). The TACE siRNA used in this study has been reported to inhibit TACE expression efficiently in both NCI-H292 cells (30) and SCC-9 (a squamous carcinoma cell line) cells (8). Knockdown of TACE expression inhibited TGF-
shedding (Fig. 5B), EGFR phosphorylation (Fig. 5C), and mucin expression (Fig. 5, DE) by cigarette smoke, showing that TACE is responsible for these effects in NCI-H292 cells.
TACE is synthesized in a latent form (2). A thiol group from a cysteine residue in the prodomain interacts with zinc in the catalytic domain and thereby inactivates TACE (2, 3, 37, 38). The mechanisms that activate TACE are not yet clear. Our finding that antioxidants (e.g., DMTU, nPG) prevent cigarette smoke-induced TGF-
shedding (Fig. 6A), EGFR phosphorylation (Fig. 6B), and mucin production (Fig. 6, C and D) implicates ROS in TACE activation by cigarette smoke in NCI-H292 cells.
Cigarette smoke has multiple effects on airway epithelial cells. In sparse cell cultures, cigarette smoke is reported to predominantly enhance cell proliferation via shedding of EGFR ligand AR and subsequent EGFR activation (17). However, in dense cell cultures, cigarette smoke induces mucus cell differentiation and mucin production via activation of TACE, shedding of soluble TGF-
, and EGFR phosphorylation (present study). The mechanisms by which cigarette smoke has differential effects on NCI-H292 cells in different microenvironments have not yet been fully explored. Kim et al. (13) reported that in dense cultures NCI-H292 cells undergo contact-dependent growth inhibition, and TGF-
increases MUC5AC protein production markedly in dense, but not in sparse, cultures, suggesting that cell-contacts modulate cell responses to stimuli. Lemjabbar et al. (17) reported that cigarette smoke causes significant AR release, rather than TGF-
, in NCI-H292 cell cultures. We suggest that the level of TGF-
in cell culture supernatant could have been underestimated by the authors, because they did not block the EGFR ligand binding sites on the cell surface before exposing the cells to the stimulus (17). Richter et al. (28) reported that in the presence of an EGFR-neutralizing antibody that prevented ligand binding and internalization of the receptor-bound ligand, there was a marked accumulation of TGF-
, but not AR, in the supernatant of NCI-H292 cell cultures after exposure to cigarette smoke, suggesting that, in the absence of the antibody, TGF-
was rapidly utilized by the cells and that TGF-
is a primary mediator of the cigarette smoke-induced responses in NCI-H292 cells. This is in agreement with our previous report (30) and current studies. All of these results were from studies performed in a cancer cell line (NCI-H292 cells), which may express different phenotypes from those expressed in primary cultures of airway epithelia. Even primary cell cultures may differ from the in vivo state.
In summary, we show that stimulation with cigarette smoke activates TACE, which cleaves pro-TGF-
and releases mature soluble TGF-
that binds to and activates EGFR, resulting in mucin production in human airway epithelial NCI-H292 cells. These findings are especially important because cigarette smoking is so closely linked to COPD. The discovery that cigarette smoke-induced mucin overproduction is mediated by TACE activation suggests new therapies for COPD.
 |
GRANTS
|
---|
The work was supported by private funding.
 |
ACKNOWLEDGMENTS
|
---|
The authors thank I. F. Ueki for technical assistance and helpful discussions.
 |
FOOTNOTES
|
---|
Address for reprint requests and other correspondence: J. A. Nadel, Cardiovascular Research Inst., Box 0130, Univ. of California San Francisco, San Francisco, CA 94143-0130 (E-mail: janadel{at}itsa.ucsf.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
---|
- American Thoracic Society. Standards for the diagnosis and care of patients with chronic obstructive pulmonary disease (COPD) and asthma. Am Rev Respir Dis 136: 225244, 1987.[ISI][Medline]
- Black RA. Tumor necrosis factor-alpha converting enzyme. Int J Biochem Cell Biol 34: 15, 2002.[CrossRef][ISI][Medline]
- Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, and Cerretti DP. A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385: 729733, 1997.[CrossRef][ISI][Medline]
- Derynck R, Roberts AB, Winkler ME, Chen EY, and Goeddel DV. Human transforming growth factor-alpha: precursor structure and expression in E. coli. Cell 38: 287297, 1984.
- Dusser DJ, Djokic TD, Borson DB, and Nadel JA. Cigarette smoke induces bronchoconstrictor hyperresponsiveness to substance P and inactivates airway neutral endopeptidase in the guinea pig. Possible role of free radicals. J Clin Invest 84: 900906, 1989.[ISI][Medline]
- Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, and Tuschl T. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494498, 2001.[CrossRef][ISI][Medline]
- Elbashir SM, Lendeckel W, and Tuschl T. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev 15: 188200, 2001.[Abstract/Free Full Text]
- Gschwind A, Hart S, Fischer OM, and Ullrich A. TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells. EMBO J 22: 24112421, 2003.[Abstract/Free Full Text]
- Hinkle CL, Mohan MJ, Lin P, Yeung N, Rasmussen F, Milla ME, and Moss ML. Multiple metalloproteinases process protransforming growth factor-alpha (proTGF-alpha). Biochemistry 42: 21272136, 2003.[CrossRef][ISI][Medline]
- Hovenberg HW, Davies JR, and Carlstedt I. Different mucins are produced by the surface epithelium and the submucosa in human trachea: identification of MUC5AC as a major mucin from the goblet cells. Biochem J 318: 319324, 1996.[ISI][Medline]
- Hovenberg HW, Davies JR, Herrmann A, Linden CJ, and Carlstedt I. MUC5AC, but not MUC2, is a prominent mucin in respiratory secretions. Glycoconj J 13: 839847, 1996.[ISI][Medline]
- Jeffery PK. Histological features of the airways in asthma and COPD. Respiration 59, Suppl 1: 1316, 1992.[ISI][Medline]
- Kim S, Ueki IF, and Nadel JA. E-cadherin promotes EGFR-mediated cell differentiation and MUC5AC expression in NCI-H292 airway epithelial cells (Abstract). Mol Biol Cell 14 Suppl: 11a, 2003.[CrossRef]
- Kitagawa M, Takasawa S, Kikuchi N, Itoh T, Teraoka H, Yamamoto H, and Okamoto H. rig encodes ribosomal protein S15. The primary structure of mammalian ribosomal protein S15. FEBS Lett 283: 210214, 1991.[CrossRef][ISI][Medline]
- Lee DC, Fenton SE, Berkowitz EA, and Hissong MA. Transforming growth factor alpha: expression, regulation, and biological activities. Pharmacol Rev 47: 5185, 1995.[ISI][Medline]
- Lemjabbar H and Basbaum C. Platelet-activating factor receptor and ADAM10 mediate responses to Staphylococcus aureus in epithelial cells. Nat Med 8: 4146, 2002.[CrossRef][ISI][Medline]
- Lemjabbar H, Li D, Gallup M, Sidhu S, Drori E, and Basbaum C. Tobacco smoke-induced lung cell proliferation mediated by tumor necrosis factor alpha-converting enzyme and amphiregulin. J Biol Chem 278: 2620226207, 2003.[Abstract/Free Full Text]
- Markewitz BA, Owens MW, and Payne DK. The pathogenesis of chronic obstructive pulmonary disease. Am J Med Sci 318: 7478, 1999.[CrossRef][ISI][Medline]
- Marquardt H, Hunkapiller MW, Hood LE, and Todaro GJ. Rat transforming growth factor type 1: structure and relation to epidermal growth factor. Science 223: 10791082, 1984.[ISI][Medline]
- McCole DF, Keely SJ, Coffey RJ, and Barrett KE. Transactivation of the epidermal growth factor receptor in colonic epithelial cells by carbachol requires extracellular release of transforming growth factor-alpha. J Biol Chem 277: 4260342612, 2002.[Abstract/Free Full Text]
- Murphy SL. Deaths: final data for 1998. Natl Vital Stat Rep 48: 1105, 2000.[Medline]
- Nadel JA. Role of epidermal growth factor receptor activation in regulating mucin synthesis. Respir Res 2: 8589, 2001.[CrossRef][ISI][Medline]
- Perrais M, Pigny P, Copin MC, Aubert JP, and Van Seuningen I. Induction of MUC2 and MUC5AC mucins by factors of the epidermal growth factor (EGF) family is mediated by EGF receptor/Ras/Raf/extracellular signal-regulated kinase cascade and Sp1. J Biol Chem 277: 3225832267, 2002.[Abstract/Free Full Text]
- Peschon JJ, Slack JL, Reddy P, Stocking KL, Sunnarborg SW, Lee DC, Russell WE, Castner BJ, Johnson RS, Fitzner JN, Boyce RW, Nelson N, Kozlosky CJ, Wolfson MF, Rauch CT, Cerretti DP, Paxton RJ, March CJ, and Black RA. An essential role for ectodomain shedding in mammalian development. Science 282: 12811284, 1998.[Abstract/Free Full Text]
- Pistelli R, Lange P, and Miller DL. Determinants of prognosis of COPD in the elderly: mucus hypersecretion, infections, cardiovascular comorbidity. Eur Respir J Suppl 40: 10s14s, 2003.[Medline]
- Polosa R, Prosperini G, Leir SH, Holgate ST, Lackie PM, and Davies DE. Expression of c-erbB receptors and ligands in human bronchial mucosa. Am J Respir Cell Mol Biol 20: 914923, 1999.[Abstract/Free Full Text]
- Prenzel N, Zwick E, Daub H, Leserer M, Abraham R, Wallasch C, and Ullrich A. EGF receptor transactivation by G-protein-coupled receptors requires metalloproteinase cleavage of proHB-EGF. Nature 402: 884888, 1999.[CrossRef][ISI][Medline]
- Richter A, O'Donnell RA, Powell RM, Sanders MW, Holgate ST, Djukanovic R, and Davies DE. Autocrine ligands for the epidermal growth factor receptor mediate interleukin-8 release from bronchial epithelial cells in response to cigarette smoke. Am J Respir Cell Mol Biol 27: 8590, 2002.[Abstract/Free Full Text]
- Rose MC, Kaufman B, and Martin BM. Proteolytic fragmentation and peptide mapping of human carboxyamidomethylated tracheobronchial mucin. J Biol Chem 264: 81938199, 1989.[Abstract/Free Full Text]
- Shao MX, Ueki IF, and Nadel JA. Tumor necrosis factor alpha-converting enzyme mediates MUC5AC mucin expression in cultured human airway epithelial cells. Proc Natl Acad Sci USA 100: 1161811623, 2003.[Abstract/Free Full Text]
- Takeyama K, Dabbagh K, Lee HM, Agusti C, Lausier JA, Ueki IF, Grattan KM, and Nadel JA. Epidermal growth factor system regulates mucin production in airways. Proc Natl Acad Sci USA 96: 30813086, 1999.[Abstract/Free Full Text]
- Takeyama K, Jung B, Shim JJ, Burgel PR, Dao-Pick T, Ueki IF, Protin U, Kroschel P, and Nadel JA. Activation of epidermal growth factor receptors is responsible for mucin synthesis induced by cigarette smoke. Am J Physiol Lung Cell Mol Physiol 280: L165L172, 2001.[Abstract/Free Full Text]
- Vermeer PD, Einwalter LA, Moninger TO, Rokhlina T, Kern JA, Zabner J, and Welsh MJ. Segregation of receptor and ligand regulates activation of epithelial growth factor receptor. Nature 422: 322326, 2003.[CrossRef][ISI][Medline]
- Vestbo J, Prescott E, and Lange P. Association of chronic mucus hypersecretion with FEV1 decline and chronic obstructive pulmonary disease morbidity. Copenhagen City Heart Study Group. Am J Respir Crit Care Med 153: 15301535, 1996.[Abstract]
- Wanner A. The role of mucus in chronic obstructive pulmonary disease. Chest 97: 11S-15S, 1990.[Abstract]
- Yan Y, Shirakabe K, and Werb Z. The metalloprotease Kuzbanian (ADAM10) mediates the transactivation of EGF receptor by G protein-coupled receptors. J Cell Biol 158: 221226, 2002.[Abstract/Free Full Text]
- Zhang Z, Kolls JK, Oliver P, Good D, Schwarzenberger PO, Joshi MS, Ponthier JL, and Lancaster JR Jr. Activation of tumor necrosis factor-alpha-converting enzyme-mediated ectodomain shedding by nitric oxide. J Biol Chem 275: 1583915844, 2000.[Abstract/Free Full Text]
- Zhang Z, Oliver P, Lancaster JJ, Schwarzenberger PO, Joshi MS, Cork J, and Kolls JK. Reactive oxygen species mediate tumor necrosis factor alpha-converting, enzyme-dependent ectodomain shedding induced by phorbol myristate acetate. FASEB J 15: 303305, 2001.[Abstract/Free Full Text]
- Zhao J, Chen H, Wang YL, and Warburton D. Abrogation of tumor necrosis factor-alpha converting enzyme inhibits embryonic lung morphogenesis in culture. Int J Dev Biol 45: 623631, 2001.[ISI][Medline]