Departments of 1 Toxicology and 2 Veterinary Anatomy, School of Veterinary Medicine, Rakuno Gakuen University, Ebetsu 069-8501; and Laboratories of 3 Anatomy, 4 Environmental Toxicology, 5 Pharmacology, Graduate School of Veterinary Medicine, Hokkaido University, Sapporo 060-0818, Japan
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The duodenal glands have been thought to play an important role in defense against proximal duodenal ulcer; however, the secretory mechanisms of these glands remain to be determined. In isolated duodenal acinar cells of the pig, we investigated the effects of ACh on intracellular Ca2+ concentration ([Ca2+]i) and on membrane currents with fura 2 fluorometry and the patch clamp technique. ACh caused a transient increase in [Ca2+]i, and the increase was markedly inhibited by atropine or 4-diphenylacetoxy-N-methylpiperidine methiodide but not by hexamethonium, pirenzepine, or methoctramine. The expression of mRNA for the M3 subtype far exceeded that for either M1 or M2 as revealed by real-time quantitative PCR and in situ hybridization. The rise in [Ca2+]i evoked by ACh was largely inhibited by thapsigargin but slightly affected by extracellular Ca2+ deprivation. Caffeine had no effect on [Ca2+]i. ACh elicited Ca2+-dependent K+ currents, a finding similar to the response to inositol 1,4,5,-trisphosphate applied intracellularly. These results suggest the presence of M3 receptors linked to Ca2+ release in porcine duodenal glands.
Brunner's gland; calcium-induced calcium release; inositol 1,4,5-trisphosphate-induced calcium release; mucus; secretion
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
THE ALKALINE MUCUS GEL
LAYER is believed to be an important defense mechanism that
protects the proximal duodenum from injury by gastric acid or digestive
pepsin (13). These gel layers are composed of
HCO
When compared with other mucus-secreting cells, information on the mode of mucus secretion by duodenal glands is scarce. It has been reported that vagal stimulation or intravenous infusions of VIP over a long period of time depletes mucus, as revealed by periodic acid-Schiff (PAS) staining in duodenal glands of the cat or rat (23, 44). These studies, however, may not have been performed under physiological conditions, because the stimuli were applied for several hours, and it is possible that these results might have been caused by indirect effects via nervous reflexes or humoral changes. The last report on the mechanisms of mucus secretion from duodenal glands was a report in 1984 (24) on the stimulatory effects of secretin with long-term infusion of secretin into the carotid vein of the rat. Therefore, secretory mechanisms in the duodenal glands are still poorly understood. Furthermore, there has been no report on the mechanism of the intracellular second messenger system in duodenal glands.
It is well established that intracellular Ca2+ concentration ([Ca2+]i), as well as cAMP and protein kinase C, also plays an essential role in the secretory responses in mucus-secreting cells (12). Although there have been few reports on the intracellular mechanism of secretion using normal cells isolated from mucous glands in the intestine, only mucus-secreting cells of the stomach have been studied extensively. ACh has been shown to provoke mucus secretion via Ca2+-dependent and -independent mechanisms in short-cultured rabbit gastric mucosa (37). In the rabbit gastric mucosa, ACh as well as ATP stimulates inositol 1,4,5-trisphosphate (IP3) formation and a transient increase in [Ca2+]i (32, 36). Recently, cancer-derived cell lines from human gastric mucosa or colonic goblet cells, such as JR-1, HT-29, and T84, were established and are being studied extensively as models for mucous cells. Similar to normal gastrointestinal mucus-secreting cells, muscarinic agonists have been shown to cause mucin secretion from these cancer cells with a concomitant increase in [Ca2+]i, and both effects were reduced by extracellular Ca2+ deprivation (4, 14, 17, 18, 27, 43).
In the present study, we investigated the dynamics of [Ca2+]i and membrane currents with the whole cell patch clamp technique by using dispersed acini freshly isolated from duodenal glands of pigs, which have well developed thick tissues of duodenal glands consisting of mucus cells only (38).
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Solutions. For acini isolation and [Ca2+]i measurement with fura 2 fluorometry, modified Krebs solution (KRMG) of the following composition (in mM) was used: 134 NaCl, 4.7 KCl, 1.2 KH2PO4, 25 MOPS (pH 7.2 adjusted with NaOH), 2.5 CaCl2, 1.2 MgSO4, and 10 glucose. For acini isolation, CaCl2 was removed from the above composition. For whole cell patch clamp recording, the composition of the normal external solution (physiological salt solution) was (in mM): 134 NaCl, 6 KCl, 10 HEPES (pH 7.2, adjusted with NaOH), 1.7 CaCl2, 1.2 MgCl2, and 14 glucose. The pipette solution had the following composition (in mM): 140 KCl, 1.2 MgCl2, 1 ATP, 10 HEPES (pH 7.2, adjusted with KOH), 10 glucose, and 0.05 EGTA. In some experiments, KCl was replaced with CsCl.
Isolation of acini from duodenal glands.
Duodenal tissues were provided by a local slaughterhouse from sexually
mature Landrace, Large White, and Hampshire stock crossbreed pigs (~6
mo old). The layers of duodenal glands near the opening of the bile
duct were removed and cut into thin slices, which were incubated with
Ca2+-free KRMG containing type 1 collagenase (0.75 mg/ml)
(Worthington, Freehold, NJ) and type I-S hyaluronidase (500 U/ml) (Sigma, St. Louis, MO) in a shaking bath (150 oscillations/min)
at 37°C for 30 min. Dispersed duodenal gland acini were collected by
low speed centrifugation and resuspended in Ca2+-free KRMG
solution containing 10 mg/ml bovine serum albumin. The obtained acini
had numerous mucus granules with the dense core characteristic for
porcine duodenal glands (Fig. 1)
(38).
|
Measurement of [Ca2+]i. Dispersed acini were loaded with fura 2 by incubation with 5 µM fura 2-AM (Dojindo) and 0.05% cremophor EL (Nakarai) in the presence of 200 U/ml hyaluronidase at 37°C for 30 min. Fura 2-loaded acini were fixed to a coverslip by Cell-Tak (Becton Dickinson) and superfused with KRMG solution at a rate of 1 ml/min at 25°C. The solution in the bath was completely changed within ~30 s. For monitoring the spatial and temporal changes in [Ca2+]i, video images of fura 2 fluorometry (F340/F380) were obtained using an Argus 50 apparatus (Hamamatsu Photonics), as was previously described for adrenal chromaffin cells (39). Fluorescence images were obtained every 1.5 s for spatiotemporal analysis and every 10 s for temporal analysis. To avoid degenerated responses on successive drug challenges, we always changed acini isolated from the same duodenum for every measurement. In this way, almost the same degree of responses could be obtained on the same challenges. For reference, the cytosolic concentrations of Ca2+ were estimated using a Ca2+ calibration buffer kit with Mg2+ (Molecular Probes, Eugene, OR).
Real-time quantitative PCR.
Whole RNA samples were extracted from duodenal glands with Isogen
(Nippon Gene) and reverse transcribed to cDNAs with the use of
SuperScript II RT and oligo(dT)12-18 primer (GIBCO BRL, Gaithersburg, MD). Quantitative PCR reaction was performed using
an automated sequence detection instrument (ABI prism sequence detector
7700) incorporating a dual-label fluorogenic detection system according
to the instructions for TaqMan (PE Applied Biosystems) (42). The following primers/probes were used.
M1 (X044130): forward primer (F),
TGGTGCTCATCTCCTTCAAGGT (577); reverse
primer (R), AAGGTGCCGATGATGAGGTC (654); probe
(P), AACACCGAGCTCAAGACGGTCAACAACTAC (600).
M2 (X04708): F, GACTCATGCACCCCAGCTAATAC (1129-1151); R, TGCGAGCGACAATGTTCTG (1198-1216); P,
TGTGGAGCTTGTTGGTTCTTCAGGTCAG (1155-1182). M3 (X12712):
F, GAGGAGGACATTGGCTCAGAAA (1152-1173); R, TTGGTGGAGTTGAGGATGGTG
(1217-1237); P, AAGAGCCATCTACTCCATCGTGCTCAAGCT (1175-1204).
-Actin (U07786): F, CATCACCATCGGCAACGAG (375); R, GCGTAGAGGTCCTTCCTGATGT (497); P,
CTTCAACTCGATCATGAAGTGCGACGTG (468). Amplification
reactions were performed in MicroAmp optical tubes (PE ABI) containing
TaqMan Universal PCR Master Mix with cDNA, primers, and TaqMan probe
for 50 cycles at 95°C for 15 s and at 60°C for 1 min,
following incubation at 50°C for 2 min (RNA digestion) and at 95°C
for 10 min (degradation of RNA digestive enzyme). Standard lines for
M1-M3 were constructed with the pCR 2.1 vector (Invitrogen) subcloned by PCR products of
M1-M3, and
-actin was used as an
internal standard.
In situ hybridization. In situ hybridization of duodenal tissue for M3 muscarinic receptor subtype was performed with a radioactive oligo DNA probe. The sequence of DNAs used was AGGTTTAACCGCGCAGTCAGCCTCGGGCCAATGGCTGGCCTGGAC (X04413, 2161-2205). The probe was labeled with 35S-dATP using terminal deoxyribonucleotidyl transferase (1.33 × 107 dpm/pmol). The following procedures were carried out as previously described for in situ hybridization for estrogen receptors (29). The hybridized sections were dipped in Kodak NTB2 nuclear track emulsion and exposed for 6 wk. After being developed, they were stained with hematoxylin and eosin for orientation.
Membrane current recording.
Whole cell membrane currents were measured by the standard whole cell
patch clamp technique (19) with a patch clamp amplifier (Axopatch 200B, Axon Instruments). Heat-polished electrodes with tip
resistance of 2-3 M were used. We used single cells for
measurement to avoid the influence of electrical coupling between cells
in acini. The experiments were started 5-10 min after the
formation of a gigaseal (31). Voltage steps were produced
by a step command generated by a microcomputer in conjunction with an
A/D converter (MacLab 4e; AD Instruments). Data recording was performed
by the same method with a sampling rate of 1-2 kHz. The liquid
junction potential of the external solution with respect to the
internal solution (3 mV) was corrected before the formation of the gigaseal.
Electron microscopy. Isolated acini were fixed with 3.0% glutaraldehyde in 0.1 M phosphate buffer, pH 7.2, for 2 h at 4°C. Fixed pellets were then processed and observed as described previously (38).
Statistics. The statistical data are presented as means ± SE. EC50 values were calculated according to the Probit method.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Effect of ACh on
[Ca2+]i.
In acinar cells of porcine duodenal glands,
[Ca2+]i in the resting state was fairly
constant and spontaneous oscillatory changes in
[Ca2+]i were not seen at 25-37°C. The
resting level of [Ca2+]i was 28.6 ± 1.1 nM (n = 112) at 25°C. Application of ACh evoked significant [Ca2+]i increases in the duodenal
gland acini. [Ca2+]i responses clearly showed
a transient nature with a rapid onset, and
[Ca2+]i returned to the resting level within
2-3 min despite the presence of the drug (Figs.
2 and 3).
ACh-evoked responses were readily desensitized, and the second
responses to ACh were degenerated on successive challenges. The peak of
the [Ca2+]i rise was dependent on ACh with a
half-maximal value (EC50) of 1.1 µM (0.4-2.9;
P = 0.05) (Fig. 3). The duodenal glands failed to
elicit global Ca2+ oscillations as reported in rat
pancreatic acini (16), but miniature Ca2+
oscillations were recorded in duodenal gland acini stimulated by ACh
(Fig. 2). In Fig. 2B, the second or third peaks of miniature Ca2+ oscillations were roughly synchronized for most of the
cells in the acinus, suggesting the existence of cell-to-cell
communications. The peak levels of the
[Ca2+]i raised by ACh at high concentrations
were rather uniform between cells in the acinus, although some cells
did not respond to the application of lower concentrations of ACh (0.1 or 0.5 µM). These ACh-evoked Ca2+ responses were not
affected by 1 µM tetrodotoxin, which abolishes the nervous
excitation, or by 40 mM KCl.
|
|
Effect of muscarinic receptor subtype-selective antagonists on
ACh-evoked Ca2++ dynamics.
Next, we studied the types of cholinergic receptors involved in
ACh-evoked Ca2+ responses in acini of porcine duodenal
glands. Although data are not presented, atropine (1 µM) but not
hexamethonium (10 µM) abolished the Ca2+ response by 10 µM ACh, indicating the involvement of muscarinic ACh receptors. In
support of this, muscarine and methacholine, but not nicotine, caused a
significant increase in [Ca2+]i. It has been
established that muscarinic ACh receptors can be further divided into
M1-M3 subtypes pharmacologically in
endogenous tissues (20). [Ca2+]i
increases by ACh (10 µM) were not affected by pirenzepine (relatively selective for M1 type) or by methoctramine
(relatively selective for M2 type) up to 1 µM (Fig.
4, B and C). On the
other hand, ACh-induced Ca2+ transients were significantly
inhibited by 10 nM and abolished by 100 nM of
4-diphenylacetoxy-N-methylpiperidine methiodide (4-DAMP; relatively selective for M3) (Fig. 4A).
|
|
|
Effects of extracellular Ca2+
deprivation or thapsigargin on ACh-evoked
[Ca2+]i dynamics.
The Ca2+-mobilizing pathway related to the ACh-induced
[Ca2+]i increase was investigated, and the
results are shown in Fig. 7. Application
of thapsigargin (0.2-1 µM), a selective inhibitor of
sarcoendoplasmic reticulum Ca2+- ATPase of the
endoplasmic reticulum (hypothetical Ca2+ storage sites in
many nonmuscle cells) (40), had no effect on resting
[Ca2+]i. After treatment with thapsigargin (1 µM) for 20 min, the transient increase in
[Ca2+]i induced by ACh was markedly inhibited
(Fig. 7A), although 3 min of preincubation with this drug
had no effect (control 126.2 ± 8.3, n = 7;
thapsigargin 115.4 ± 5.6, n = 8). In the absence of Ca2+ in the medium, ACh increased
[Ca2+]i to only a slightly lesser extent than
that in the normal medium (control 127.8 ± 11.4, n = 13; Ca2+-free 122.7 ± 11.2 n = 15) (Fig. 7B). Even at 3 min after
application of ACh, we did not recognize significant differences
between them (control 7.2 ± 4.1, n = 7;
Ca2+-free 6.0 ± 5.9, n = 8).
Caffeine, a powerful potentiator of the Ca2+-induced
Ca2+ release (CICR) mechanism (9), did not
affect [Ca2+]i in duodenal gland acini at all
(Fig. 7C). ACh-evoked [Ca2+]i
increases were not affected by the presence of either 40 mM KCl or 10 µM methoxyverapamil (D-600, a voltage-dependent Ca2+
channel blocker; data not shown). These results suggest that Ca2+ release from internal stores, but not
voltage-dependent Ca2+ influx, plays a major role in
ACh-induced Ca2+ mobilization in duodenal glands.
|
Effect of other neurotransmitter candidates on [Ca2+]i. We studied the effects of some of the neurotransmitter candidates on [Ca2+]i. None of the substances tested other than ACh showed significant effects on [Ca2+]i in the porcine duodenal glands (7-25 cells in 2-5 experiments for each substance).
Neurotensin (1 µM) or histamine (10 µM) had no effects, even though they have been reported to increase [Ca2+]i and mucus secretion in other gastrointestinal mucous cell lines (4, 18). Several adrenergic agonists, such as noradrenaline, adrenaline, and isoproterenol (all 10 µM ), did not exert any effect, althoughMembrane currents evoked by ACh.
When a CsCl-containing pipette solution was used, voltage steps from a
holding potential of 70 mV up to 0 mV did not activate membrane
currents. In addition, 50 µM ACh failed to produce any current
responses at
70 mV. Therefore, it seems likely that voltage-dependent Na+ and Ca2+ channels, as well as ACh-activated
nonselective cations or Cl
channels, are absent in
porcine duodenal glands. When a KCl-containing pipette solution was
used, however, ACh (50 µM) evoked a prominent outward current at
70
mV or higher. In the course of the experiments, cells were repetitively
stimulated with ramp-voltage stimulation from
100 to +100 mV for 50 ms with 5-s intervals at a holding potential of
70 mV. As shown in
Fig. 8A, membrane current
changes during repetitive voltage ramps were greatly increased by the application of ACh (50 µM) with a small outward change in the holding
current. The ACh-activated current-voltage relationship was evaluated
by subtracting the current by ramp stimulation immediately before the
application of ACh from the maximum change in current during ACh
infusion (Fig. 8B). The current-voltage relationship showed
that the reversal potential for ACh-activated current was
73.2 ± 0.7 mV (n = 7), the value of which almost
corresponds to the K+ equilibrium potential under the
present experimental conditions. This finding was further supported by
the fact that the ACh-induced current reversed near the K+
equilibrium potential when ACh was infused at various holing potentials
(Fig. 8C). When a pipette solution containing a high concentration of EGTA (10 mM) instead of 0.05 mM was used, no current
response was evoked by ACh (data not shown). These results suggest that
the outward current response to ACh is mediated by the activation of
Ca2+-dependent K+ channels as reported in many
types of gastrointestinal mucous cells (2, 18, 28).
|
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The results of the experiments showed that: 1) ACh caused concentration-dependent increases in [Ca2+]i in duodenal glands, 2) ACh-induced Ca2+ responses were not affected in the presence of tetrodotoxin or a high concentration of KCl, and 3) ACh-induced Ca2+ responses were not inhibited by hexamethonium but were abolished by atropine. These results provide the first direct evidence of the existence of functional muscarinic receptors coupled to the mechanism of Ca2+ mobilization on the membrane of duodenal gland acini. At the level of mRNA, there are five different molecules (M1, M2, M3, M4, and M5) that are defined as muscarinic receptor subtypes (11). Of these molecules, M1, M2, and M3 are suggested to be respectively correspondent to M1, M2, and M3 receptors, which are pharmacologically characterized in detail. Using Xenopus oocytes, where muscarinic receptor subtypes were expressed by mRNA injection, it has been found that M1, M3, and M5 mediate Ca2+ mobilization via phosphatidylinositol pathways, whereas M2 and M4 negatively couple with adenylate cyclase to reduce the cAMP level (11). Our results showed that ACh-induced Ca2+ transients were markedly inhibited by 4-DAMP but not by pirenzepine or methoctramine. Thus it is likely that ACh-evoked Ca2+ mobilization is mediated by M3 muscarinic receptors in porcine duodenal glands. At the level of mRNA, in fact, the result of real-time quantitative PCR showed that the level of M3 receptor transcript expression was >30 and 12 times greater than that of M1 or M2, respectively. This finding was also supported by the results of in situ hybridization showing significant signals for M3 in duodenal glands. mRNA expressions for M1 and M2 might be contaminations derived from vascular and neuronal tissues, although we cannot prove this. The presence of the M5 receptor has been suggested in some tissues such as rat substantia nigra in the brain or canine iris-ciliary muscle, although the final decision remains to be determined because of the current lack of specific antagonists (8). The muscarinic receptor antagonists we used do not distinguish between M3 and M5, and we could not take a molecular biological approach because porcine M5 receptor has not yet been cloned. Therefore, we cannot deny the possible involvement of M5 receptors in ACh-mediated responses if they are present in our system. It has been suggested, from the results of binding experiments and pharmacological experiments, that the M3 subtype exists in T84 (7), HT-29 (25), and JR-1 (18) cells. Although the cell types are not clear, human and rat duodenocytes (5) and human gastric mucosa (33) express M3 muscarinic receptors almost exclusively.
Porcine duodenal glands showed relatively high selectivity against
various secretagogues, at least at the level of Ca2+
signaling. In mouse intestinal crypts, each of four types of cells
responds to only a few secretagogues in Ca2+ dynamics.
Among these, none of the possible secretagogues tested stimulated
Ca2+ responses in goblet cells, except for carbachol, which
caused a small transient increase in [Ca2+]i
(35). On the other hand, several substances, such as ATP, histamine, and neurotensin, have been reported to cause an increase in
[Ca2+]i in rabbit gastric mucosa, JR-1, or
HT-29 cells, as well as muscarinic agonists (4, 18, 32),
Thus there seems to be variable responsibility among the
mucus-secreting cells against various secretagogues (12).
Recently, it was shown that mucus secretion was evoked by many
secretagogues, such as VIP, peptide YY, bombesin, and IL-, in the
isolated rat perfused colon (34). Of these secretagogues,
VIP was reported to stimulate mucus secretion also from T84 and HT-29
cells, possibly by way of cAMP production (26, 27).
Numerous VIP immunoreactive fibers have been detected in duodenal
glands of the rat (23) and pig (Takehana et al., unpublished observations). Therefore, it is conceivable that other secretagogues, which are coupled to a non-Ca2+-mobilizing
pathway such as cAMP, might also be involved in the regulation of mucus
secretion in duodenal glands.
The results of the present experiments have revealed, for the first
time, the electrophysiological properties of duodenal glands. We found
that ACh evoked an outward current through the activation of
Ca2+-dependent K+ channels, because the
reversal potential of this current corresponded well to K+
equilibrium potential and no current occurred in the case of an
EGTA-containing patch pipette solution. Similar channels have been
reported in JR-1, HT-29-Cl.16E, and T84 cells (2, 28). Depolarizing stimuli from 70 to 0 mV did not produce any inward currents, suggesting that voltage-dependent Na+ and
Ca2+ channels are absent in porcine duodenal gland cells.
Our results suggest that ACh induces [Ca2+]i increases mainly by Ca2+ mobilization from intracellular storage sites, because ACh-evoked Ca2+ responses were hardly affected by extracellular Ca2+ deprivation but were markedly inhibited by pretreatment with thapsigargin. As mentioned above, it was assumed that IP3 is involved in ACh-evoked Ca2+ mobilization in many types of cells (3, 12). Our results are in line with this hypothesis because intracellular IP3 application activated Ca2+-dependent K+ channels with a time course similar to that of [Ca2+]i changes on ACh challenge, as was revealed by recording whole cell membrane currents. Similarly, intracellular application of IP3 activates Ca2+-dependent K+ channels, which are inhibited by heparin (a blocker of IP3-induced Ca2+ release) or by an anti-IP3 receptor monoclonal antibody (mAb 18A10) in the JR-1 human cancer-derived gastric mucosal cell line (18). It was reported that muscarinic receptor activations caused IP3 production followed by mucus secretion in rabbit gastric mucosa and HT-29 cells (4, 36, 37, 43). Furthermore, caffeine, a powerful potentiator of CICR, which is another major Ca2+-mobilizing mechanism (9), had no effect on [Ca2+]i, suggesting that the CICR mechanism does not function in duodenal glands. Caffeine reportedly also failed to induce Ca2+ mobilization and mucus secretion in JR-1 cells, whereas caffeine inhibited Ca2+ mobilization by ACh or histamine (17). Thus it is likely that muscarinic receptor activations are linked to IP3-induced Ca2+ release from intracellular storage sites in duodenal gland acini, although information on IP3 production should be obtained in duodenal glands.
It has been thought that duodenal glands are important for prevention
of duodenal ulcers (6). The mechanism of the secretion from duodenal glands, however, has not been determined. One of the main
reasons for this is that the accurate measurements of mucus secreted
from duodenal glands are practically impossible due to the
contamination by mucus from intestinal epithelium. Thus it would be
difficult for the underlying secretory mechanisms to be deduced from
data obtained from in vivo or in situ experiments. We prepared isolated
perfused duodenum by way of the gastroduodenal artery and tried to
detect secretory features by examining morphological changes using
conventional hematoxylin and eosin staining, PAS staining, and electron
microscopy. In spite of vigorous mucus secretion into the lumen, even
infusion of 104 M ACh with physostigmine for 5-30
min did not significantly change these morphological characteristics
(Takehana et al., unpublished observations). Therefore, the secretory
mechanism of mucus in duodenal glands seems to be somewhat different
from that of compound exocytosis in intestinal goblet cells, which has
been easily characterized by conventional histology (30).
Although we do not have any information on the physiological significance of [Ca2+]i, an essential role of [Ca2+]i in mucus secretion has been suggested in most of the other mucus-secreting cells. At present, we do not know of a case in which [Ca2+]i rise does not lead to mucus secretion, at least from gastrointestinal mucus cells (12). In HT-29 and T84 cells, it has been suggested that [Ca2+]i, cAMP, and protein kinase C cooperate synergistically in mucus secretion (4, 14, 26). The development of methods to determine the mucus secretion in duodenal glands is needed (for example, [3H]glucosamine labeling of mucin in explant duodenal glands). Together with this, the application of various cell permeable fluorescent probes, such as 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein for pH or fluorescein-labeled cAMP-dependent protein kinase A for cAMP (41), and the application of electrophysiological techniques to the isolated duodenal glands would be useful for clarifying the mechanisms of mucus secretion in duodenal glands.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Professor Y. Satoh, Department of Histology, Iwate Medical University, for valuable discussion and Dr. N. L. Kennedy, Department of Biomedical English, School of Veterinary Medicine, Rakuno Gakuen University, for critical reading of the manuscript.
![]() |
FOOTNOTES |
---|
This work was supported by grants from the Japanese Ministry of Education, Science, Sports and Culture, Cooperative Research from Rakuno Gakuen University 1997-5, and Gakujutsu-frontier Cooperative Research in Rakuno-gakuen University.
Address for reprint requests and other correspondence: H. Teraoka, Dept. of Toxicology, School of Veterinary Medicine, Rakuno Gakuen Univ., Ebetsu 069-8501, Japan (E-mail: hteraoka{at}rakuno.ac.jp).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 15 November 1999; accepted in final form 20 November 2000.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1.
Ainsworth, MA,
Fenger C,
Svendsen P,
and
Schaffalitzky de Muckadell OB.
Effect of stimulation of mucosal HCO
2.
Baró, I,
Roch B,
Hongre AS,
and
Escande D.
Concomitant activation of Cl and K+ currents by secretory stimulation in human epithelial cells.
J Physiol (Lond)
478:
469-482,
1994[Abstract].
3.
Berridge, MJ.
Inositol trisphosphate and calcium signaling.
Nature
361:
315-325,
1993[ISI][Medline].
4.
Bou-Hanna, C,
Berthon B,
Combettes L,
Claret M,
and
Laboisse CL.
Role of calcium in carbachol- and neurotensin-induced mucin exocytosis in a human colonic goblet cell line and cross-talk with the cyclic AMP pathway.
Biochem J
299:
579-585,
1994[ISI][Medline].
5.
Chew, CS,
Säfsten B,
and
Flemström G.
Calcium signaling in cultured human and rat duodenal enterocytes.
Am J Physiol Gastrointest Liver Physiol
275:
G296-G304,
1998
6.
Cooke, AR.
The glands of Brunner.
In: Handbook of Physiology. The Alimentary Canal. Secretion. Bethesda, MD: Am. Physiol. Soc, 1967, sect. 6, vol. II, chapt. 61, p.1087-1095.
7.
Dickinson, KEJ,
Frizzell RA,
and
Sekar MC.
Activation of T84 cell chloride channels by carbachol involves a phosphoinositide-coupled muscarinic M3 receptor.
Eur J Pharmacol
225:
291-298,
1992[Medline].
8.
Eglen, RM,
and
Nahorski SR.
The muscarinic M5 receptor: a silent or emerging subtype?
Br J Pharmacol
130:
13-21,
2000
9.
Endo, M.
Calcium release from the sarcoplasmic reticulum.
Physiol Rev
57:
71-108,
1977
10.
Fawcett, DW.
Intestines.
In: A Textbook of Histology (12th ed.). New York: Chapman & Hall, 1994, p. 617-651.
11.
Felder, CC.
Muscarinic acetylcholine receptors: signal transduction through multiple effectors.
FASEB J
9:
619-625,
1995
12.
Forstner, G.
Signal transduction, packaging and secretion of mucins.
Annu Rev Physiol
57:
585-605,
1995[ISI][Medline].
13.
Forstner, JF,
and
Forstner GG.
Gastrointestinal mucus.
In: Physiology of the Gastrointestinal Tract (3rd ed.), edited by Johnson LR.. New York: Raven, 1994, vol. 2, p. 1255-1283.
14.
Forstner, G,
Zhang Y,
McCool D,
and
Forstner J.
Mucin secretion by T84 cells: stimulation by PKC, Ca2+, and a protein kinase activated by Ca2+ ionophore.
Am J Physiol Gastrointest Liver Physiol
264:
G1096-G1102,
1993
15.
Granstam, SO,
Flemström G,
and
Nylander O.
Bicarbonate secretion by the rabbit duodenum in vivo: effects of prostaglandins, vagal stimulation and some drugs.
Acta Physiol Scand
131:
377-385,
1987[ISI][Medline].
16.
Habara, Y,
and
Kanno T.
Dose-dependency in spatial dynamics of [Ca2+]c in pancreatic acinar cells.
Cell Calcium
12:
533-542,
1991[ISI][Medline].
17.
Hamada, E,
Nakajima T,
Hata Y,
Hazama H,
Iwasawa K,
Takahashi M,
Ota S,
and
Omata M.
Effect of caffeine on mucus secretion and agonist-dependent Ca2+ mobilization in human gastric mucus secreting cells.
Biochim Biophys Acta
1356:
198-206,
1997[ISI][Medline].
18.
Hamada, E,
Nakajima T,
Ota S,
Terano A,
Omata M,
Nakade S,
Mikoshiba K,
and
Kurachi Y.
Activation of Ca2+-dependent K+ current by acetylcholine and histamine in a human gastric epithelial cell line.
J Gen Physiol
102:
667-692,
1993[Abstract].
19.
Hamill, OP,
Marty A,
Neher E,
Sakmann B,
and
Sigworth FJ.
Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches.
Pflügers Arch
391:
85-100,
1981[ISI][Medline].
20.
Hulme, EC,
Birdsall NJM,
and
Buckley NJ.
Muscarinic receptor subtypes.
Annu Rev Pharmacol Toxicol
30:
633-673,
1990[ISI][Medline].
21.
Isenberg, JI,
Hogan DL,
Koss MA,
and
Selling JA.
Human duodenal mucosal bicarbonate secretion.
Gastroenterology
91:
370-378,
1986[ISI][Medline].
22.
Keates, AC,
and
Hanson PJ.
Regulation of mucus secretion by cells isolated from the rat gastric mucosa.
J Physiol (Lond)
423:
397-409,
1990[Abstract].
23.
Kirkegaard, P,
Lundberg JM,
Poulsen SS,
Olsen PS,
Fahrenkrug J,
Hökfelt T,
and
Christiansen J.
Vasoactive intestinal polypeptidergic nerves and Brunner's gland secretion in the rat.
Gastroenterology
81:
872-878,
1981[ISI][Medline].
24.
Kirkegaard, P,
Olsen PS,
Poulsen SS,
Holst JJ,
Schaffalitzky de Muckadell OB,
and
Christiansen J.
Effect of secretin and glucagon on Brunner's gland secretion in the rat.
Gut
25:
264-268,
1984[Abstract].
25.
Kopp, R,
Lambrecht G,
Mutschler E,
Moser U,
Tacke R,
and
Pfeiffer A.
Human HT-29 colon carcinoma cells contain muscarinic M3 receptors coupled to phosphoinositide metabolism.
Eur J Pharmacol
172:
397-405,
1989[Medline].
26.
Laburthe, M,
Augeron C,
Rouyer-Fessard C,
Roumagnac I,
Maoret JJ,
Grasset E,
and
Laboisse C.
Functional VIP receptors in the human mucus-secreting colonic epithelial cell line CL.16E.
Am J Physiol Gastrointest Liver Physiol
256:
G443-G450,
1989
27.
McCool, DJ,
Marcon MA,
Forstner JF,
and
Forstner GG.
The T84 human colonic adenocarcinoma cell line produces mucin in culture and releases it in response to various secretagogues.
Biochem J
267:
491-500,
1990[ISI][Medline].
28.
Merlin, D,
Guo X,
Laboisse CL,
and
Hopfer U.
Ca2+ and cAMP activate different K+ conductances in the human intestinal goblet cell line HT29-Cl.16E.
Am J Physiol Cell Physiol
268:
C1503-C1511,
1995
29.
Mowa, CN,
and
Iwanaga T.
Differential distribution of oestrogen receptor- and -
mRNAs in the female reproductive organ of rats as revealed by in situ hybridization.
J Endocrinol
165:
59-66,
2000
30.
Neutra, MR,
O'Malley LJ,
and
Specian RD.
Regulation of intestinal goblet cell secretion. II. A survey of potential secretagogues.
Am J Physiol Gastrointest Liver Physiol
242:
G380-G387,
1982
31.
Ohta, T,
Ito S,
and
Nakazato Y.
Ca2+-dependent K+ currents induced by muscarinic receptor activation in guinea pig adrenal chromaffin cells.
J Neurochem
70:
1280-1288,
1998[ISI][Medline].
32.
Ota, S,
Yoshiura K,
Takahashi M,
Hata Y,
Kohmoto O,
Kawabe K,
Shimada T,
Hiraishi H,
Mutoh H,
Terano A,
Sugimoto T,
and
Omata M.
P2 purinergic receptor regulation of mucus glycoprotein secretion by rabbit gastric mucous cells in a primary culture.
Gastroenterology
106:
1485-1492,
1994[ISI][Medline].
33.
Pfeiffer, A,
Kromer W,
Friemann J,
Ruge M,
Herawi M,
Schatzl M,
Schwegler U,
May B,
and
Schatz H.
Muscarinic receptors in gastric mucosa are increased in peptic ulcer disease.
Gut
36:
813-818,
1995[Abstract].
34.
Plaisancié, P,
Barcelo A,
Moro F,
Claustre J,
Chayvialle JA,
and
Cuber JC.
Effects of neurotransmitters, gut hormones, and inflammatory mediators on mucus discharge in rat colon.
Am J Physiol Gastrointest Liver Physiol
275:
G1073-G1084,
1998
35.
Satoh, Y,
Habara Y,
Ono K,
and
Kanno T.
Carbamylcholine- and catecholamine-induced intracellular calcium dynamics of epithelial cells in mouse ileal crypts.
Gastroenterology
108:
1345-1356,
1995[ISI][Medline].
36.
Seidler, U,
and
Pfeiffer A.
Inositol phosphate formation and [Ca2+]i in secretagogue-stimulated rabbit gastric mucous cells.
Am J Physiol Gastrointest Liver Physiol
260:
G133-G141,
1991
37.
Seidler, U,
and
Sewing KFR
Ca2+-dependent and -independent secretagogue action on gastric mucus secretion in rabbit mucosal explants.
Am J Physiol Gastrointest Liver Physiol
256:
G739-G746,
1989
38.
Takehana, K,
Abe M,
Yamaguchi M,
Iwasa K,
Hiraga T,
Masty J,
Miyata H,
and
Yamada O.
Ultracytochemistry of glycoconjugates in pig duodenal gland.
Ann Anat
176:
565-570,
1994[ISI].
39.
Teraoka, H,
Matsuzawa R,
Maruyama Y,
Hiraga T,
and
Ohga A.
Nicotinic receptor-mediated Ca2+ mobilization and catecholamine secretion in chick adrenal chromaffin cells.
Proc Jpn Acad
72:
52-55,
1996.
40.
Thastrup, O,
Cullen PJ,
Drobak BK,
Hanley MR,
and
Dawson AP.
Thapsigargin, a tumor promoter, discharges intracellular Ca2+ stores by specific inhibition of the endoplasmic reticulum Ca2+-ATPase.
Proc Natl Acad Sci USA
87:
2466-2470,
1990[Abstract].
41.
Tsien, RY.
Intracellular signal transduction in four dimensions: from molecular design to physiology.
Am J Physiol Cell Physiol
263:
C723-C728,
1992
42.
Wang, T,
and
Brown MJ.
mRNA quantification by real time TaqMan polymerase chain reaction: validation and comparison with RNase protection.
Anal Biochem
269:
198-201,
1999[ISI][Medline].
43.
Warhurst, G,
Fogg KE,
Higgs NB,
Tonge A,
and
Grundy J.
Ca2+-mobilising agonists potentiate forskolin- and VIP-stimulated cAMP production in human colonic cell line, HT29-cl.19A: role of [Ca2+]i and protein kinase C.
Cell Calcium
15:
162-174,
1994[ISI][Medline].
44.
Wright, RD,
Jennings MA,
Florey HW,
and
Lium R.
The influence of nerves and drugs on secretion by the small intestine and an investigation of the enzymes in intestinal juice.
Q J Exp Physiol
30:
73-120,
1940.