1 Dept of Anatomy and Histology, University of Pennsylvania, Philadelphia 19104; and 3 Medical Genetics, Thomas Jefferson University Hospital, Philadelphia, Pennsylvania 19107; and 2 Albany College of Pharmacy and 4 Stratton Veterans Affairs Medical Center, Albany, New York 12208
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Cysteine-rich protein (Cyr61) and connective tissue growth factor (CTGF) are key immediate early growth factors with functions in cell proliferation, differentiation, and extracellular matrix synthesis. Studies were performed to assess the gene expression profile of Cyr61 and CTGF in rat urinary bladder during growth in response to partial outlet obstruction. The mRNA levels of Cyr61 as determined by ribonuclease protection assay increased sharply after 1 day and remained elevated throughout the time period of the obstruction. This correlates well with increased bladder weight. The CTGF mRNA levels seemed to peak within the second week of the urethral obstruction and correlate well with increased type I collagen mRNA. The expression pattern of either Cyr61 or CTGF proteins corroborated that of their respective mRNAs. Immunohistochemical analyses showed that immunoreactivity of Cyr61 was confined to detrusor smooth muscle and that of CTGF was detected within both detrusor muscle and lamina propria layers. These data strongly indicate the involvement of Cyr61 and CTGF in bladder wall remodeling as a result of the outlet obstruction.
cysteine-rich protein 61; connective tissue growth factor; bladder remodeling
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
OUTLET OBSTRUCTION of the urinary bladder is a symptomatic condition that occurs as a result of either neurogenic or idiopathic factors, including benign prostate hyperplasia, urethral stricture, spina bifida or carcinoma, sclerosis, or fibrosis of the bladder neck (6, 7, 20, 33). Many of the functional and structural changes associated with human bladder pathology can be induced in experimental animal model systems, including rabbit, mouse, and rat. These animal models reproduce several anatomic and functional changes similar to those observed in patients with symptomatic bladder outlet obstruction.
The most prominent histopathologic finding in obstructed bladders is a rapid and marked remodeling of the bladder wall, including compartment-specific cellular hypertrophy, hyperplasia of the detrusor muscle, and changes in the structural relationship between connective tissue and smooth muscle elements (9, 50, 54). Muscle hypertrophy gives rise to trabeculae and folds, and microscopically it is associated with hyperplasia of all cell layers. Functionally, hypertrophy/hyperplasia enable the bladder, during the early stages of the obstruction, to compensate transiently for the extra effort required for it to empty against increased urethral resistance. Such a compensatory hypertrophy commonly occurs, for instance, in the kidney as a result of unilateral nephrectomy or in the heart in response to regular vigorous exercise (16). However, as a result of a sustained increased urethral resistance, an excessive and eccentric hypertrophy arises and results in physiological insufficiency and, ultimately, organ failure.
Many lines of evidence have suggested that overexpression of growth
factors is a major factor in the development of the remodeling of the
bladder wall after urethral obstruction. Baskin and colleagues (3, 4) have reported an increase in transforming growth factor (TGF)-2, TGF-
3, and TGF-
in bladders subjected to
partial urethral outlet obstruction and correlate such increases with excessive deposition of extracellular matrix proteins. Studies in
various animal models and in humans showed that hypertrophied obstructed bladders contain significantly more insulin-like growth factor I (IGF-I) and cyclooxygenase-2 than normal bladders (1, 11, 43). Other studies emphasized the role of the
renin-angiotensin system and inducible nitric oxide synthase in the
early responses of the bladder to the outlet obstruction (5,
12). However, it is not certain which of these factors is
important in the setting of bladder obstructive disease development.
Additionally, pathological remodeling of bladder smooth muscle is
determined by complex interactions of many factors, including growth
factors; mechanical cues such as hydrostatic pressure, tissue stretch,
or distension; electrical currents; and the physicochemical environment.
Evidence has emerged that the effects of numerous physical and chemical stimuli are mediated by immediate early growth factors, such as the cysteine-rich protein 61 (Cyr61/CCN1) and connective tissue growth factor (CTGF/CCN2) (32, 39). Physical and chemical stimuli are thought to activate the expression of Cyr61 and CTGF to augment their own activities and/or to carry out additional functions that may be required to render their biological effects.
The Cyr61 and CTGF are members of the CCN family of proteins, which
also consists of nephroblastoma overexpressed (Nov/CCN3), Elm-1/WISP-1/CCN4, Cop-1/WISP-2/CCN5, and WISP-3/CCN6 (32,
45). The Cyr61 and CTGF proteins, the most extensively studied
proteins in this family, are characterized by a high degree of sequence homology. They are organized into conserved modular domains that share
similarities with insulin-like growth factor-binding proteins, von
Willebrand factor type C repeats, thrombospondin type I repeats, and
growth factor cysteine knots. However, despite their highly conserved
structure, these proteins display nonredundant biological functions.
Both Cyr61 and CTGF are co-induced in fibroblasts by growth factors
involved in tissue repair and in extracellular matrix remodeling, i.e.,
platelet-derived growth factor, bovine fibroblast growth factor, and
TGF-1. Purified Cyr61 mediates cell adhesion and chemotaxis for
fibroblasts and enhances growth factor-stimulated DNA synthesis
(28). Cyr61 also upregulates the expression of matrix
metalloproteinases 1 and 3 and promotes biological processes such as
wound healing, angiogenesis, homeostasis, and thrombosis (22,
44). The CTGF was reported to promote proliferation of
fibroblasts and mediate TGF-
-induced extracellular matrix production
(21). Overall, on the basis of their expression pattern in
development and diseases, it has been suggested that Cyr61 and CTGF are
involved in the development of fibrotic pathologies (renal sclerosis,
systemic scleroderma, hepatic fibrosis, biliary atresia) and in the
pathogenesis of cancer (8, 32, 57).
Relatively little is known about the expression pattern and functional
significance of Cyr61 and CTGF gene expression in smooth muscle under
normal and pathological conditions. We have recently demonstrated that
mechanical forces strongly induced the expression of the Cyr61 gene in
cultured bladder smooth muscle cells (52). Both the Cyr61
gene expression pattern and its regulatory mechanism seemed to be
similar to those of prohypertrophic molecules, i.e., serum response
factor or -actin (35, 51). Another study has shown that
overexpression of CTGF promotes vascular smooth muscle cells to express
more extracellular matrix protein collagen I and fibronectin
(14). Therefore, we hypothesized that Cyr61 and CTGF are
potential early molecular signals of smooth muscle cell phenotype
remodeling, involved in the activation of smooth muscle hypertrophic
response in the obstructed bladder.
To address this hypothesis, we investigated the temporospatial expression of both Cyr61 and CTGF in rats with hypertrophied bladder as a result of outlet obstruction. In vitro studies were also performed to determine whether agonists of smooth muscle hypertrophy, such as angiotensin II, endothelin-1, and parathyroid hormone-related peptide (PTHrP), regulate the expression of Cyr61 and CTGF genes as well.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Surgical induction of partial outlet obstruction. Eight-month-old Sprague-Dawley male rats (Charles River Laboratories, Wilmington, MA) were used in these studies. Twentyfour rats were separated into four groups of six rats each. Each rat was sedated with ketamine-xylazine (80-10 mg/kg ip), and surgical anesthesia was maintained with pentobarbital (Nembutal, 25 mg/kg). The bladder was exposed through a midline incision, and a partial outlet obstruction was created by tying a 2-0 silk ligature loosely around a length of PE-20 tubing placed on the urethra (above the pubis). The incision was closed with 3-0 vicryl sutures. In the sham rats, the bladder and urethra were exposed, but no ligature was applied.
Tissue handling.
At the end of the period of obstruction, each rat was anesthetized as
just described, and the bladder was exposed through a midline incision
and excised rapidly. For immunohistochemical analyses, a full-thickness
strip of each bladder was fixed in 10% neutral buffered formalin for
4-8 h, routinely processed, and embedded in a paraffin block to
provide a cross-sectional view of bladder wall after microtome
sectioning. Five-micrometer-thick sections were cut from each block and
mounted on positively charged slides. The remainder of the bladder was
frozen in liquid nitrogen and stored at 70°C for RNA and protein analysis.
RNase protection assay. Total RNA extraction was performed as described by Chomczynski and Sacchi (13). Cyr61 mRNA levels were measured by RNase protection assay relative to those of the GAPDH mRNA. Accordingly, two rat riboprobes were used. One probe is complementary to Cyr61 mRNA and protects a 451-nucleotide fragment. A second probe is complementary to GAPDH RNA and protects a 181-nucleotide fragment. The riboprobes were generated by reverse transcription and PCR amplification by use of the following primers: for Cyr61, 5'caacccaactgtaaacatc3' and 5'gcatcctgctaagtaaatc3' (GenBank accession no. NM0313327); for GAPDH, 5'tccagtatgattccaccc3' and 5'tactcagcaccagcatcacc3' (GenBank accession no. NM023964). The PCR products were cloned into the cloning vector pCRII from Invitrogen and further sequenced to verify their orientation and identity. For the RNase protection assay, the plasmids were linearized and served as a template for in vitro transcription by either SP6 or T7 RNA polymerase to generate [32P]UTP-radiolabeled RNA probes with an in vitro transcription kit (Promega). Total RNA (12 µg) was resuspended in hybridization buffer containing 80% formamide, 1 mM EDTA, 40 mM piperazine-N, N'-bis(2-hexanesulfonic acid), pH 6.4, and 0.2 M sodium acetate, 1 × 106 cpm riboprobe, and denatured at 85°C for 5 min. After 24 h of incubation at 45°C, nonhybridized RNAs were digested with 40 µg/ml ribonuclease A and 100 U/ml ribonuclease T1. The protected hybrids were then precipitated and separated on a 4% polyacrylamide/urea denaturing sequencing gel followed by autoradiography. The protected bands were quantitated by use of a Molecular Dynamics phosphorimager.
Northern blot analysis.
Samples of total RNA (10 µg) were dissolved in 50% formamide, 2.2 M
formaldehyde, 0.1 M MOPS (pH 7.0), 40 mM sodium acetate, and 5 mM EDTA
(pH 8) and were denatured by heating at 65°C for 10 min. RNA was then
fractionated by electrophoresis in 1% agarose/formaldehyde gel for
4 h at 70 V and transferred overnight by capillary blotting in
20× SSC (1× SSC = 0.15 M NaCl, and 0.015 M sodium citrate, pH 7)
to a zeta-probe nylon filter. The nylon filter was then prehybridized
for 24 h at 42°C in 50% formamide, 7% SDS, 0.25 M
Na2HPO4 (pH 7.2), and 0.25 M NaCl. Specific DNA
probes were labeled with -[32P]dCTP with a random
priming DNA labeling kit. After hybridization at 42°C for 24 h,
the filter was washed twice in 2× SSC-0.1% SDS at room temperature
and twice in 0.1× SSC-0.1% SDS at 50°C, and exposed to a
phosphorimager screen. The hybridization signals were quantitated and
normalized to GAPDH mRNA used as a control gene. A rat CTGF DNA probe
was prepared by RT-PCR by use of the primers 5'aggagtgggtgtgtgatgag3'
and 5'cacagcagttaggaacccag3' (GenBank accession no. NM022266). The PCR
product was purified, cloned into the expression vector pCRII
(Invitrogen, Carlsbad, CA), and sequenced before its utilization in
Northern blot analysis. A DNA probe for
2(I) collagen has been
described previously (37).
Immunohistochemistry and immunoblotting. For Western blot analysis, tissue lysates were prepared by harvesting bladder tissue samples in 0.1% Triton X-100 lysis buffer. Protein concentration was determined by using the Bradford protein assay (Bio-Rad). Protein samples (30 µg) were separated by 10% SDS-polyacrylamide gel and transferred to nitrocellulose membrane, and Western blot analysis was performed using either anti-rat Cyr61 antibody (Santa Cruz Biotech, San Diego, CA) or anti-human CTGF antibody (generous gift from Dr. B. Perbal; see Ref. 46). The CTGF antibody was raised against a 28-synthetic amino acid peptide corresponding to human CTGF positions 232-259 (GenBank accession no. XM037056). The latter peptide shares 100% sequence homology with the deduced amino acid sequence of rat CTGF (GenBank accession no. NM022266). Immunodetection was performed using enhanced chemiluminescence (Amersham). For histochemical analyses, 5-µm-thick cryostat sections from obstructed and nonobstructed bladders were mounted on albumin-coated slides, air-dried, and fixed for 5 min in 0.4% formaldehyde-PBS. For qualitative assessments, bladder cross sections were stained with hematoxylin-eosin. Other sections were incubated for 24 h with either anti-Cyr61 antibody at 1:200 dilution or anti-CTGF antibody (1:120 dilution). Immunodetection was performed with an anti-IgG-rhodamine conjugate (1:300 dilution). Sections were washed several times in PBS between incubations. The immunostaining was visualized by confocal microscopy.
Cell culture and molecular analyses.
Primary cultures of smooth muscle cells were prepared from fetal bovine
bladders obtained from mid- to late-gestational fetal calves. Our
previous studies have shown that cells from fetal bovine bladder
maintain several of their differentiated properties in culture even
after multiple passages (up to 8-10 passages) (10,
52). By contrast, Kropp et al. (30) showed that
both cultured human and rat bladder smooth muscle cells are susceptible to variable loss of phenotypic markers of cell differentiation, such as
smooth muscle -actin, smooth muscle myosin, and desmin. However,
primary cultures from the rat maintained a more differentiated profile
than human cells (30). Cells were maintained in modified medium 199 from GIBCO (Grand Island, NY) supplemented with 10% fetal
bovine serum and antibiotics in a humidified atmosphere containing 5%
CO2 in air at 37°C. Cells between their third and eighth
population doubling level were used. Cells were treated with
exogenous growth factors, as indicated in the text. Total RNA
was then extracted from each sample and processed for Northern blot
hybridization (as described in Northern blot analysis). DNA probes for either Cyr61 or CTGF have been previously described (52).
Statistical analysis. A paired two-sample t-test was used to compare the differences between control and test groups. Values are means ± SE. P < 0.05 was considered significant.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In agreement with previously published data, partial obstruction of the rat bladder outlet initiated tissue hypertrophy and induced a progressive increase of bladder wet weight from 121 ± 42 to 152 ± 15 mg within 1 day, to 239 ± 25 mg within 7 days, and to 249 ± 31 mg within 14 days after the outlet obstruction.
We examined a potential temporal correlation between bladder
hypertrophy and Cyr61 and/or CTGF gene expression by measurements of
their respective mRNA levels throughout the time course of the outlet
obstruction. The Cyr61 mRNA levels in the control and the partially
obstructed bladders were determined using the solution hybridization/RNase protection assay, a representative experiment of
which is shown in Fig. 1A.
Hybridization of total RNA to Cyr61 and GAPDH riboprobes yielded the
predicted 451- and 181-bp protected RNA bands, respectively, after
RNase digestion. No protected bands were present when tRNA was used
instead of RNA from tissue samples (data not shown). Phosphorimager
analyses of the Cyr61 hypridization signals indicate that Cyr61 mRNA,
although undetectable in the nonobstructed controls, was markedly
increased in the obstructed bladders. Cyr61 mRNA levels were
significantly elevated (3- to 6-fold) after 1 day postobstruction and
remained increased to a relatively similar extent throughout the time
period of the outlet obstruction (P < 0.01).
|
The mRNA levels of CTGF were measured in control and obstructed bladders by Northern blot hybridization (Fig. 1B). When normalized to GAPDH mRNA, the CTGF mRNA levels were not significantly altered after 1 and 7 days postobstruction compared with controls. In contrast, in the 14-day-obstructed bladders, there was a two- to fourfold increase of CTGF mRNA (P < 0.05).
To determine whether obstruction-induced changes in Cyr61 and CTGF
mRNAs were accompanied by corresponding changes in their protein
levels, we analyzed total proteins from tissue homogenates by Western
blot with specific antibodies raised against Cyr61 and CTGF.
Immunodetection was performed by enhanced chemiluminescence. The
anti-Cyr61 antibody recognized an ~42-kDa protein band in tissue
homogenates from control and partially obstructed bladders (Fig.
2A). As determined by
densitometric scanning of the protein band, there was a nearly 3.5-fold
increase of Cyr61 band intensity throughout the time period of the
partial outlet obstruction. Meanwhile, the ~43-kDa CTGF protein band,
although barely detectable in nonobstructed control
bladders and in 1-day-obstructed bladders, was significantly
upregulated after 14 days of partial obstruction, which corroborates
the mRNA results (Fig. 2B). After 7 days of partial
obstruction, only two of four animals showed an increase of
CTGF protein levels. This underlines the well known individual heterogeneity of the rat model of outlet obstruction.
|
Transverse histological sections of the bladder showed evidence of
bladder wall hypertrophy and a striking thickening of the detrusor
muscle layer after outlet obstruction (Fig. 3, A and B). Previously reported
infiltration of detrusor muscle by extracellular matrix proteins can
also be seen in the 14-day-obstructed bladder (Fig. 3C).
Localization of Cyr61 and CTGF proteins was performed by
immunohistochemistry. Transmural sections of the bladder wall were
incubated with either anti-rat Cyr61 or anti-human CTGF antibodies, and
immunodetection was performed with an anti-IgG-Rhodamine conjugate. There was minimal or no detectable immunostaining for Cyr61 in the
control nonobstructed bladders (Fig. 3D). Conversely, in the 7- and 14-day-obstructed bladders, Cyr61 localized prominently in the
detrusor muscle within and surrounding the smooth muscle fascicles
(Fig. 3, E and F). The Cyr61 immunoreactivity was
undetectable in the urothelium lining the lumen of the bladder, and
only a minimal immunostaining was seen within the lamina propria. This immunostaining pattern was noted consistently throughout the duration of the obstruction and was confirmed with another Cyr61 antibody that
was directed against a human epitope of Cyr61 (data not shown) (52). In the 14-day-postobstructed bladders, Cyr61
immunoreactivity was observed around the arteries as well (data not
shown). Meanwhile, as shown in Fig. 3, G-I,
immunostaining for CTGF was not seen in control nonobstructed bladders.
No detectable immunoreactivity was seen for CTGF after 1-day
postobstruction either (data not shown). At day 7, two of
four obstructed bladders showed immunostaining to CTGF within the
detrusor muscle, the lamina propria, and urothelial cells lining the
lumen of the bladder. At day 14, there was a heterogeneous
or patchy immunostaining to CTGF, with pockets of fairly intense
staining interspersed with regions of less intense staining within both
detrusor and lamina propria layers. The areas of intense staining
colocalized with regions between the muscle bundles heavily infiltrated
by extracellular matrix proteins. The CTGF protein changes that had
been quantitated by Western blotting corroborate those seen by
immunofluorescence staining. The staining attributed to either Cyr61 or
CTGF was absent when their respective antibodies were omitted from the
staining protocol (data not shown).
|
Numerous lines of evidence indicate that CTGF is an important player in
fibrosis. In various fibrotic disorders, upregulation of CTGF gene
strongly correlated with that of TGF-1, the principal growth factor
promoter of connective tissue synthesis, and with enhanced
extracellular matrix protein synthesis such as type I collagen.
Therefore, to examine a potential correlation between CTGF gene
expression and that of extracellular matrix proteins in the bladder
wall, we determined the expression profile of type I collagen, the most
abundant extracellular matrix protein in the bladder wall, during the
course of partial outlet obstruction. As shown in Fig.
4, the steady-state levels of type I
collagen mRNA were significantly increased in 7- and 14-day-obstructed bladders compared with control nonobstructed ones. Type I collagen mRNA
pattern seems similar to that of CTGF in the obstructed bladders. By
contrast, we did not observe notable changes in TGF-
1 mRNA in the
bladder wall throughout the time period of the outlet obstruction (data
not shown).
|
Next, we sought to determine whether the changes in Cyr61 and CTGF gene
expression could be initiated as a result of release of trophic
factors, such as angiotensin II, endothelin-1, and PTHrP. The latter
are known to be produced during the early stages of the obstruction and
may be of variable importance as inducers of smooth muscle hypertrophy.
For this purpose, primary cultures of bladder smooth muscle cells were
initiated, as described in MATERIALS AND METHODS. Cells
were then treated in serum-free medium with exogenous angiotensin II,
endothelin-1, or PTHrP. Expression of Cyr61 and CTGF genes was assessed
at the mRNA levels. As shown in Fig. 5,
treatment of the cells with angiotensin II, endothelin-1, or PTHrP
strongly induced the expression of both Cyr61 and CTGF. Cyr61 and CTGF
mRNA levels rapidly increased after 30 min, peaked at 1 h, and
decreased progressively but in a time-dependent manner. These results
indicate that Cyr61 and CTGF are immediate early target genes of
prohypertrophic factors.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
In the rat model, partial outlet obstruction of the urinary bladder results in a significant increase in bladder mass followed by progressive bladder dysfunction associated with alterations in bladder contractility and detrusor muscle instability. Various etiologic factors have been implicated in initiating such a pathological remodeling, including increase in tension and/or strain on the wall of such a hollow organ and reduced blood flow to the bladder musculature (18, 48, 53). Several molecular changes take place in the obstructed bladder, including increase in overall protein synthesis and expression of extracellular matrix protein genes and embryonic genes, i.e., nonmuscle myosin heavy-chain B, and reorganization of the actin cytoskeleton.
Our present study implicates Cyr61 and CTGF as potential key molecules in bladder wall remodeling and dysfunction. We showed that bladder hypertrophy secondary to partial outlet obstruction induced the expression of Cyr61 and CTGF at both the mRNA and the protein levels. The expression of Cyr61 gene occurred with the onset of the obstruction (within 1 day) and remained elevated throughout the time period of the obstruction. The expression pattern of Cyr61 gene is reminiscent of that of gene 33, an immediate early gene that was shown to be expressed at constant levels in rapidly growing and in chronic stress conditions, such as incipient diabetic renal failure (36). In contrast, the steady-state mRNA levels of CTGF gene seemed to peak only after either 7 or 14 days of partial obstruction. In fact, various gene expression patterns for CTGF have been reported mainly in fibrogenic lesions. For instance, Sedlaczek at al. (49) reported increases in CTGF mRNA levels in the rat liver model of acute fibrogenesis only 3 days after a single administration of CCl4. In biliary fibrosis (chronic fibrogenesis), a prominent accumulation of CTGF occurred after 6 wk. Similarly, Lasky et al. (31) showed that CTGF mRNA levels in the lung of bleomycin-sensitive mice were consistently upregulated at 16 and 30 days after bleomycin administration. Taken together, these studies clearly indicate that CTGF gene expression does not occur immediately after either chemical or physical insults and, rather, mimics that of delayed responsive genes, such as those of growth factors. Obstruction-induced increases in Cyr61 and CTGF mRNA could be a result of both increased transcription and/or increased mRNA stability. However, it has been shown that the bulk of the regulation of Cyr61 and CTGF mRNA levels is at the transcriptional level (14, 47).
On the basis of their gene expression pattern in the obstructed bladder, Cyr61 and CTGF genes appear to be differentially regulated. The early, comparatively selective upregulation of Cyr61 gene may confer specificity in the cellular response. Indeed, our immunohistochemical analyses have indicated that Cyr61 protein was mainly confined to the detrusor muscle layer of the obstructed bladders. Therefore, Cyr61 protein expression seems to be associated with hypertrophic and rapidly proliferating smooth muscle cells, as 50-90% of the cells in the obstructed bladders consist of hypertrophic/hyperplastic smooth muscle cells (1, 55). However, in vitro studies have shown that the purified Cyr61 does not have intrinsic mitogenic activity but enhances growth factor-induced cell proliferation in both fibroblast and endothelial cells (29). It was proposed that Cyr61 action becomes most relevant when the concentration of growth factors in the immediate cell microenvironment is limiting. Cyr61 acts by displacement of growth factors bound to the extracellular matrix, thus increasing their accessibility to their cell receptors. Thus enhanced Cyr61 levels in the obstructed bladder potentially promote smooth muscle cell proliferation in cooperation with other locally produced growth factors.
Meanwhile, we (52) and others (44)
have previously demonstrated that Cyr61 gene expression is strictly
regulated through signaling pathways that have been implicated in the
progression to hypertrophy. In particular, phosphatidylinositol
3-kinase and/or Rho GTPase activation strongly activates the
expression of Cyr61 gene in bladder smooth muscle cells. These
signaling pathways converge downstream to modulate the actin
cytoskeleton, whose rearrangement can solely modulate Cyr61 gene
expression. These signaling cascades have been shown to be critical
mechanisms for the regulation of smooth muscle cell differentiation and
to control the gene expression of several prohypertrophic molecules,
i.e., serum response factor, -actin (2, 34, 51).
Therefore, Cyr61 is a potential early molecular signal of smooth muscle
cell differentiation and potentially activates specific features of the
cells' hypertrophic response to pathological conditions.
Immunolocalization analyses of CTGF protein in the obstructed bladder
showed a heterogeneous and patchy immunostaining either within or
between the muscle bundles, as well as in the lamina propria. No such
change was seen in the control, nonobstructed bladders. Additionally,
overexpression of CTGF correlates well with the upregulation of 2(I)
collagen gene in the obstructed bladders, suggesting that CTGF
potentially promotes extracellular matrix gene expression and
deposition. In fact, previous in vivo studies have associated
overexpression of CTGF with fibrotic disorders such as keloids,
systemic sclerosis, and renal and lung fibrosis (19, 25, 32,
40). CTGF is expressed at very high levels in atherosclerotic
human vessels and localizes predominantly in areas with excessive
deposition of extracellular matrix proteins (41). This
likely reflects, as shown by others (42), the affinity of
this growth factor to abundant matrix proteins such as collagens and
fibronectin. Additionally, our finding that two of four
7-day-obstructed bladders showed immunoreactivity within urothelial
cells, although unexpected, parallels the observation by Sedlaczek et
al. (49) of a prominent expression of CTGF in
proliferating bile duct epithelial cells. However, the biological
significance of CTGF production in epithelial cells in vivo is unknown
and will require further investigation. Overall, our findings seem to
indicate that overexpression of Cyr61 in obstructed bladder is
associated with the initial stage of hypertrophy/hyperplasia of the
detrusor muscle, whereas that of the CTGF occurred at times that
correlate with the onset of extracellular matrix remodeling.
Our study does not identify the chemical and/or physical factors that trigger Cyr61 and CTGF gene induction in the obstructed bladder. However, many lines of evidence suggest that the increased mechanical stress on the cellular component of the bladder wall during the obstruction contributes to changes in Cyr61 and CTGF gene expression and to the pathogenesis of bladder hypertrophy. Indeed, as a result of the anatomic obstruction, both the intravesical pressure and the volume work of the bladder increase, and the cellular components of the bladder wall receive mechanical "cues" that are different or beyond a normally acceptable range. This increased mechanical stress then causes a cascade of cellular and molecular events that promote structural and functional changes in the bladder wall. The importance of the mechanical factors, such as stretch and pressure on Cyr61 and CTGF gene expression, is supported by our previous data showing that mechanical strain alone strongly upregulates the expression of Cyr61 gene in cultured bladder smooth muscle cells (52). Similarly, Hishikawa et al. (23) reported that CTGF gene expression was strongly increased by high static pressure in mesangial cells and contributes to the remodeling of mesangium and glomerulosclerosis (23).
Meanwhile, the local hemodynamic and metabolic changes that accompany the changes in mechanical stimulation induce, in turn, the expression and release of molecules involved in the regulation of muscle tone and contraction, i.e., angiotensin II, endothelin-1, and PTHrP (12, 27, 41, 58). The rapid release of these factors is thought to be a general physiological response of tissues like the bladder wall that undergo continuous or periodic stretching and adjustment of muscle tonicity. Using in vitro primary cultures of bladder smooth muscle cells, we showed that angiotensin II, endothelin-1, or PTHrP strongly induced the expression of both Cyr61 and CTGF genes. Thus Cyr61 and CTGF are downstream effectors of angiotensin II, endothelin-1, and PTHrP.
Numerous in vivo and in vitro studies have now provided an abundance of evidence that angiotensin II, endothelin-1, or PTHrP acts as a trophic factor that causes smooth muscle cell hypertrophy/hyperplasia and increases collagen production (17, 24). Angiotensin II and endothelin-1 are potent prohypertrophic agonists in the hypertensive heart, the diabetic kidney, and the hypertrophic bladder (12, 24). Locally generated angiotensin II plays autocrine and paracrine regulatory roles, contributing to the development of tissue hypertrophy via its growth-promoting effects as well as indirectly by inducing proliferation of fibroblasts and deposition of extracellular matrix proteins. Angiotensin II also stimulates synthesis of endothelin-1, which, in turn, induces hypertrophy and fibrosis. Blockade of either angiotensin II or endothelin-1 signaling pathways prevents the progression of hypertrophy and decreases tissue remodeling (12, 26, 56). Similarly, PTHrP is expressed in a myriad of tissues, including bladder smooth muscle, and is upregulated by mechanical stretch, by hypertension, by vasoconstrictors such as angiotensin II, and by mechanical injury such as angioplasty (15, 38). PTHrP, in addition to being a smooth muscle vasodilator, is a factor that regulates the growth, development, and/or differentiation in virtually every tissue in which it has been examined. At present, we do not know whether these trophic factors have an actual role in the modulation of bladder wall remodeling through Cyr61 and CTGF. Our in vitro studies showed that angiotensin II, endothelin-1, and PTHrP all upregulate the gene expression of both Cyr61 and CTGF, whereas in the obstructed bladder, upregulation of Cyr61 gene was not concomitant with that of CTGF. Therefore, Cyr61 and CTGF are likely differentially regulated in vivo, possibly because of other factors that negatively regulate CTGF gene expression, hindering or delaying its co-induction with Cyr61 gene at the onset of the obstruction. The variety of stimulatory and inhibitory factors that regulate Cyr61 and CTGF gene expression underscores the complexity of their regulation in vivo and their potential functional role.
In conclusion, the data for the expression profile of Cyr61 and CTGF genes in the obstructed bladder and the analysis of the effects of trophic factors on their gene expression in vitro provide insights into the functions that Cyr61 and CTGF may exert in the hypertrophic bladder. Cyr61 is likely to have a role in the control of smooth muscle cell growth and differentiated phenotype, whereas CTGF is likely to affect bladder cell synthetic phenotype, as well as the extracellular matrix remodeling of the whole bladder wall. Therefore, both Cyr61 and CTGF may serve as specific targets for selective intervention and pharmacological modulation in processes involving smooth muscle hypertrophy and extracellular matrix accumulation, such as bladder obstructive disorders. Further analyses of the potential functions of Cyr61 and CTGF in smooth muscle will be facilitated by the development, in progress, of mice in which the expression of either Cyr61 or CTGF is targeted to smooth muscle tissues.
![]() |
ACKNOWLEDGEMENTS |
---|
We thank Dr. B. Perbal for the generous gift of CTGF antibodies.
![]() |
FOOTNOTES |
---|
This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-02685 and DK-60572 to B. Chaqour and by DK-26508 and DK-53965 to R. Levin.
Address for reprint requests and other correspondence: B. Chaqour, Univ. of Pennsylvania, Dept. of Anatomy and Histology, 416 Levy Research Bldg., 4001 Spruce St., Philadelphia, PA 19104 (E-mail: chaqour{at}biochem.dental.upenn.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
June 18, 2002;10.1152/ajpendo.00131.2002
Received 25 March 2002; accepted in final form 14 June 2002.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1.
Abdel-Gawad, M,
Elhilali MM,
and
Huynh H.
Alteration of the insulin-like growth factor system of mitogens in hyperplastic bladders of paraplegic rats.
J Urol
161:
699-705,
1999[ISI][Medline].
2.
Babic, AM,
Kireeva ML,
Kolesnikova TV,
and
Lau LF.
CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth.
Proc Natl Acad Sci USA
95:
6355-6360,
1998
3.
Baskin, LS,
Hayward SW,
Sutherland RA,
DiSandro MS,
and
Thomson AA.
Cellular signaling in the bladder.
Front Biosci
2:
d592-d595,
1997[Medline].
4.
Baskin, LS,
Sutherland RS,
Thomson AA,
Hayward SW,
and
Cunha GR.
Growth factors and receptors in bladder development and obstruction.
Lab Invest
75:
157-166,
1996[ISI][Medline].
5.
Bassuk, JA,
Grady R,
and
Mitchell M.
Review article: the molecular era of bladder research. Transgenic mice as experimental tools in the study of outlet obstruction.
J Urol
164:
170-179,
2000[ISI][Medline].
6.
Bauer, SB.
The effects and challenges of bladder outlet obstruction.
J Urol
163:
3,
2000[ISI][Medline].
7.
Brading, AF.
Alterations in the physiological properties of urinary bladder smooth muscle caused by bladder emptying against an obstruction.
Scand J Urol Nephrol Suppl
184:
51-58,
1997[Medline].
8.
Brigstock, DR.
The connective tissue growth factor/cysteine-rich 61/nephroblastoma overexpressed (CCN) family.
Endocr Rev
20:
189-206,
1999
9.
Buttyan, R,
Chen MW,
and
Levin RM.
Animal models of bladder outlet obstruction and molecular insights into the basis for the development of bladder dysfunction.
Eur Urol
32, Suppl1:
32-39,
1997[ISI][Medline].
10.
Chaqour, B,
Han JS,
Tamura I,
and
Macarak E.
Mechanical regulation of IGF-I and IGF-binding protein gene transcription in bladder smooth muscle cells.
J Cell Biochem
84:
264-277,
2002[ISI][Medline].
11.
Chen, Y,
Bornfeldt KE,
Arner A,
Jennische E,
Malmqvist U,
Uvelius B,
and
Arnqvist HJ.
Increase in insulin-like growth factor I in hypertrophying smooth muscle.
Am J Physiol Endocrinol Metab
266:
E224-E229,
1994
12.
Cheng, EY,
Decker RS,
and
Lee C.
Role of angiotensin II in bladder smooth muscle growth and function.
Adv Exp Med Biol
462:
183-191,
1999[ISI][Medline].
13.
Chomczynski, P,
and
Sacchi N.
Single-step method for RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[ISI][Medline].
14.
Fan, WH,
and
Karnovsky MJ.
Activation of protein kinase C inhibits the expression of connective tissue growth factor.
Biochem Biophys Res Commun
275:
312-321,
2000[ISI][Medline].
15.
Fiaschi-Taesch, N,
Endlich N,
Massfelder T,
Endlich K,
Stewart AF,
and
Helwig JJ.
Renovascular parathyroid hormone-related protein in spontaneously hypertensive rats: dilator or trophic factor?
Kidney Int Suppl
67:
S207-S210,
1998[Medline].
16.
Fine, LG,
and
Bradley T.
Adaptation of proximal tubular structure and function: insights into compensatory renal hypertrophy.
Fed Proc
44:
2723-2727,
1985[ISI][Medline].
17.
Fine, LG,
Hammerman MR,
and
Abboud HE.
Evolving role of growth factors in the renal response to acute and chronic disease.
J Am Soc Nephrol
2:
1163-1170,
1992[Abstract].
18.
Ghafar, MA,
Shabsigh A,
Chichester P,
Anastasiadis AG,
Borow A,
Levin RM,
and
Buttyan R.
Effects of chronic partial outlet obstruction on blood flow and oxygenation of the rat bladder.
J Urol
167:
1508-1512,
2002[ISI][Medline].
19.
Goldschmeding, R,
Aten J,
Ito Y,
Blom I,
Rabelink T,
and
Weening JJ.
Connective tissue growth factor: just another factor in renal fibrosis?
Nephrol Dial Transplant
15:
296-299,
2000
20.
Gosling, JA.
The structure of the bladder neck, urethra and pelvic floor in relation to female urinary continence.
Int Urogynecol J Pelvic Floor Dysfunct
7:
177-178,
1996[Medline].
21.
Grotendorst, GR.
Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts.
Cytokine Growth Factor Rev
8:
171-179,
1997[Medline].
22.
Grzeszkiewicz, TM,
Kirschling DJ,
Chen N,
and
Lau LF.
CYR61 stimulates human skin fibroblast migration through integrin alpha vbeta 5 and enhances mitogenesis through integrin alpha vbeta 3, independent of its carboxyl-terminal domain.
J Biol Chem
276:
21943-21950,
2001
23.
Hishikawa, K,
Oemar BS,
and
Nakaki T.
Static pressure regulates connective tissue growth factor expression in human mesangial cells.
J Biol Chem
276:
16797-16803,
2001
24.
Hunter, JJ,
and
Chien KR.
Signaling pathways for cardiac hypertrophy and failure.
N Engl J Med
341:
1276-1283,
1999
25.
Igarashi, A,
Nashiro K,
Kikuchi K,
Sato S,
Ihn H,
Fujimoto M,
Grotendorst GR,
and
Takehara K.
Connective tissue growth factor gene expression in tissue sections from localized scleroderma, keloid, and other fibrotic skin disorders.
J Invest Dermatol
106:
729-733,
1996[Abstract].
26.
Khan, MA,
Shukla N,
Auld J,
Thompson CS,
Mumtaz FH,
Stansby GP,
Morgan RJ,
and
Mikhailidis DP.
Possible role of endothelin-1 in the rabbit urinary bladder hyperplasia secondary to partial bladder outlet obstruction.
Scand J Urol Nephrol
34:
15-20,
2000[ISI][Medline].
27.
Khan, MA,
Shukla N,
Thompson CS,
Mumtaz FH,
Mikhailidis DP,
and
Morgan RJ.
Endothelin-1 and urinary bladder hyperplasia following partial bladder outlet obstruction.
J Cardiovasc Pharmacol
36:
S262-S263,
2000[ISI][Medline].
28.
Kireeva, ML,
Latinkic BV,
Kolesnikova TV,
Chen CC,
Yang GP,
Abler AS,
and
Lau LF.
Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism, and localization during development.
Exp Cell Res
233:
63-77,
1997[ISI][Medline].
29.
Kolesnikova, TV,
and
Lau LF.
Human CYR61-mediated enhancement of bFGF-induced DNA synthesis in human umbilical vein endothelial cells.
Oncogene
16:
747-754,
1998[ISI][Medline].
30.
Kropp, BP,
Zhang Y,
Tomasek JJ,
Cowan R,
Furness PD,
Vaughan MB, III,
Parizi M,
and
Cheng EY.
Characterization of cultured bladder smooth muscle cells: assessment of in vitro contractility.
J Urol
162:
1779-1784,
1999[ISI][Medline].
31.
Lasky, JA,
Ortiz LA,
Tonthat B,
Hoyle GW,
Corti M,
Athas G,
Lungarella G,
Brody A,
and
Friedman M.
Connective tissue growth factor mRNA expression is upregulated in bleomycin-induced lung fibrosis.
Am J Physiol Lung Cell Mol Physiol
275:
L365-L371,
1998
32.
Lau, LF,
and
Lam SC.
The CCN family of angiogenic regulators: the integrin connection.
Exp Cell Res
248:
44-57,
1999[ISI][Medline].
33.
Levin, RM,
Haugaard N,
O'Connor L,
Buttyan R,
Das A,
Dixon JS,
and
Gosling JA.
Obstructive response of human bladder to BPH vs. rabbit bladder response to partial outlet obstruction: a direct comparison.
Neurourol Urodyn
19:
609-629,
2000[ISI][Medline].
34.
Mack, CP,
and
Owens GK.
Regulation of smooth muscle alpha-actin expression in vivo is dependent on CArG elements within the 5' and first intron promoter regions.
Circ Res
84:
852-861,
1999
35.
Mack, CP,
Somlyo AV,
Hautmann M,
Somlyo AP,
and
Owens GK.
Smooth muscle differentiation marker gene expression is regulated by RhoA-mediated actin polymerization.
J Biol Chem
276:
341-347,
2001
36.
Makkinje, A,
Quinn DA,
Chen A,
Cadilla CL,
Force T,
Bonventre JV,
and
Kyriakis JM.
Gene 33/Mig-6, a transcriptionally inducible adapter protein that binds GTP-Cdc42 and activates SAPK/JNK. A potential marker transcript for chronic pathologic conditions, such as diabetic nephropathy. Possible role in the response to persistent stress.
J Biol Chem
275:
17838-17847,
2000
37.
Maquart, FX,
Bellon G,
Chaqour B,
Wegrowski J,
Patt LM,
Trachy RE,
Monboisse JC,
Chastang F,
Birembaut P,
Gillery P,
and
Borel JP.
In vivo stimulation of connective tissue accumulation by the tripeptide-copper complex glycyl-L-histidyl-L-lysine-Cu2+ in rat experimental wounds.
J Clin Invest
92:
2368-2376,
1993[ISI][Medline].
38.
Massfelder, T,
Dann P,
Wu TL,
Vasavada R,
Helwig JJ,
and
Stewart AF.
Opposing mitogenic and anti-mitogenic actions of parathyroid hormone-related protein in vascular smooth muscle cells: a critical role for nuclear targeting.
Proc Natl Acad Sci USA
94:
13630-13635,
1997
39.
Moussad, EE,
and
Brigstock DR.
Connective tissue growth factor: what's in a name?
Mol Genet Metab
71:
276-292,
2000[ISI][Medline].
40.
Oemar, BS,
and
Luscher TF.
Connective tissue growth factor. Friend or foe?
Arterioscler Thromb Vasc Biol
17:
1483-1489,
1997
41.
Oemar, BS,
Werner A,
Garnier JM,
Do DD,
Godoy N,
Nauck M,
Marz W,
Rupp J,
Pech M,
and
Luscher TF.
Human connective tissue growth factor is expressed in advanced atherosclerotic lesions.
Circulation
95:
831-839,
1997
42.
Paradis, V,
Dargere D,
Vidaud M,
De Gouville AC,
Huet S,
Martinez V,
Gauthier JM,
Ba N,
Sobesky R,
Ratziu V,
and
Bedossa P.
Expression of connective tissue growth factor in experimental rat and human liver fibrosis.
Hepatology
30:
968-976,
1999[ISI][Medline].
43.
Park, JM,
Yang T,
Arend LJ,
Schnermann JB,
Peters CA,
Freeman MR,
and
Briggs JP.
Obstruction stimulates COX-2 expression in bladder smooth muscle cells via increased mechanical stretch.
Am J Physiol Renal Physiol
276:
F129-F136,
1999
44.
Pendurthi, UR,
Allen KE,
Ezban M,
and
Rao LV.
Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa × tissue factor-induced signal transduction.
J Biol Chem
275:
14632-14641,
2000
45.
Perbal, B.
NOV (nephroblastoma overexpressed) and the CCN family of genes: structural and functional issues.
Mol Pathol
54:
57-79,
2001
46.
Perbal, B,
Martinerie C,
Sainson R,
Werner M,
He B,
and
Roizman B.
The C-terminal domain of the regulatory protein NOVH is sufficient to promote interaction with fibulin 1C: a clue for a role of NOVH in cell-adhesion signaling.
Proc Natl Acad Sci USA
96:
869-874,
1999
47.
Pereira, RC,
Durant D,
and
Canalis E.
Transcriptional regulation of connective tissue growth factor by cortisol in osteoblasts.
Am J Physiol Endocrinol Metab
279:
E570-E576,
2000
48.
Schwinn, DA.
The role of alpha1-adrenergic receptor subtypes in lower urinary tract symptoms.
BJU Int
88, Suppl2:
27-34,
2001[ISI][Medline].
49.
Sedlaczek, N,
Jia JD,
Bauer M,
Herbst H,
Ruehl M,
Hahn EG,
and
Schuppan D.
Proliferating bile duct epithelial cells are a major source of connective tissue growth factor in rat biliary fibrosis.
Am J Pathol
158:
1239-1244,
2001
50.
Shabsigh, A,
Hayek OR,
Weiner D,
Saidi J,
Kaplan SA,
Kiss A,
Burchardt M,
Buttyan R,
and
Levin RM.
Acute increase in blood flow to the rat bladder subsequent to partial bladder outlet obstruction.
Neurourol Urodyn
19:
195-206,
2000[ISI][Medline].
51.
Sotiropoulos, A,
Gineitis D,
Copeland J,
and
Treisman R.
Signal-regulated activation of serum response factor is mediated by changes in actin dynamics.
Cell
98:
159-169,
1999[ISI][Medline].
52.
Tamura, I,
Rosenbloom J,
Macarak E,
and
Chaqour B.
Regulation of Cyr61 gene expression by mechanical stretch through multiple signaling pathways.
Am J Physiol Cell Physiol
281:
C1524-C1532,
2001
53.
Uvelius, B,
and
Arner A.
Metabolism of detrusor smooth muscle in normal and obstructed urinary bladder.
Adv Exp Med Biol
385:
29-39,
1995[Medline].
54.
Uvelius, B,
and
Arner A.
Changed metabolism of detrusor muscle cells from obstructed rat urinary bladder.
Scand J Urol Nephrol Suppl
184:
59-65,
1997[Medline].
55.
Uvelius, B,
Persson L,
and
Mattiasson A.
Smooth muscle cell hypertrophy and hyperplasia in the rat detrusor after short-time infravesical outflow obstruction.
J Urol
131:
173-176,
1984[ISI][Medline].
56.
Weber, KT.
Angiotensin II and connective tissue: homeostasis and reciprocal regulation.
Regul Pept
82:
1-17,
1999[ISI][Medline].
57.
Xie, D,
Miller CW,
O'Kelly J,
Nakachi K,
Sakashita A,
Said JW,
Gornbein J,
and
Koeffler HP.
Breast cancer. Cyr61 is overexpressed, estrogen-inducible, and associated with more advanced disease.
J Biol Chem
276:
14187-14194,
2001
58.
Yamamoto, M,
Harm SC,
Grasser WA,
and
Thiede MA.
Parathyroid hormone-related protein in the rat urinary bladder: a smooth muscle relaxant produced locally in response to mechanical stretch.
Proc Natl Acad Sci USA
89:
5326-5330,
1992[Abstract].