Division of Endocrinology, Department of Internal Medicine, University of Texas Medical Branch, Galveston, Texas 77555
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
An insulin-like growth factor I (IGF-I) response element (IGFRE) in the porcine P-450 cholesterol side-chain cleavage gene (P450scc) binds two transcription factors, Sp1 and polypyrimidine tract-binding protein-associated splicing factor (PSF). In this study, we investigated expression of these transcription factors in mouse Y1 adrenal cells, a cell line that does not increase P450scc expression in response to IGF-I. Western blot analysis showed a greater expression of PSF in Y1 cells when compared with a mouse fibroblast cell line (NWTb3) in which IGF-I stimulates the P450scc IGFRE. The two cell lines expressed Sp1 equally, and IGF-I did not increase expression of either transcription factor. Chromatin immunoprecipitation analysis with Y1 chromatin confirmed that PSF and Sp1 bound to the IGFRE. When increasing amounts of Sp1 were expressed in Y1 cells, the IGFRE became responsive to IGF-I. Moreover, a mutant oligonucleotide IGFRE reporter construct that lacks PSF binding was responsive to IGF-I. In conclusion, Y1 adrenal cells are a physiological example of PSF repression of growth factor-stimulated (IGF-I) gene expression (P450scc). The dynamic nature of this repression is consistent with PSF functioning as a regulator of growth factor-stimulated gene expression in mammalian cells.
polypyrimidine tract-binding protein-associated splicing factor; P-450 cholesterol side-chain cleavage; insulin-like growth factor I; Y1 adrenal cells; Sp1
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
INSULIN-LIKE GROWTH FACTOR I (IGF-I) is a growth factor with many local paracrine effects in tissues such as the ovary (1, 2). IGF-I increases steroidogenesis in porcine granulosa cells by increasing the expression of P-450 cholesterol side-chain cleavage (P450scc) enzyme (14). IGF-I stimulates P450scc gene expression through a 30-bp guanine cytosine-rich IGF-I response element (IGFRE) located 100 bp upstream of the transcriptional start site in the porcine P450scc gene (16). Two transcription factors bind to this response element, Sp1 (11) and polypyrimidine tract-binding protein (PTB)-associated splicing factor (PSF) (12). Sp1 functions to stimulate IGFRE-mediated transcription, whereas PSF is a repressor of the element in porcine granulosa cells (12).
PSF was isolated and cloned by Patton et al. (9) in 1993. It is a 76-kDa protein that migrates anomalously on SDS gels because it is highly basic. The protein associates with PTB to form spliceosomes for splicing of pre-mRNA. The amino terminus is rich in proline and glutamine residues and was shown in a previous study to contain the amino acid residues that bind the porcine P450scc IGFRE (13).
In human adrenocortical cells, IGF-I does not increase the expression of P450scc (6, 7). Moreover, when the porcine P450scc IGFRE is transfected into Y1 adrenal cells, it does not respond to IGF-I treatment (16), whereas the IGFRE is responsive to IGF-I in transient transfection experiments in a mouse fibroblast cell line (NWTb3) stably transfected with the IGF-I receptor (15). This study investigated the mechanisms responsible for the lack of an IGF-I response of the IGFRE in Y1 cells. Because PSF shows repressor activity in other cellular pathways (8), we wanted to determine whether the cell-specific loss of IGF-I response in Y1 adrenal cells was caused by enhanced PSF repression. Determining functional PSF repression would further expand our limited knowledge of physiological regulation of IGF-I by PSF.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Materials. The mouse fibroblast cell line NWTb3 has been previously described (15) and was obtained from Dr. Charles Roberts, Department of Pediatrics, University of Oregon. The antibody to PSF was made from recombinant PSF (12) by Bio-Molecular Technologies (Frederick, MD). The Sp1 antibody was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Platinum PCR Supermix was purchased from Invitrogen (Carlsbad, CA). Chromatin immunoprecipitation (ChIP) materials used include staph A cells from Roche (Indianapolis, IN) and protease inhibitors from Sigma Chemical (St. Louis, MO). Chemicals for solutions were purchased from Sigma, as were general reagents for the ChIP assay. Reagents purchased elsewhere are indicated in the subsequent sections.
Plasmid constructs.
The PSF cDNA clone was obtained from Dr. James Patton, Vanderbilt
University, in a pET-15b expression vector (9). The cDNA was excised and cloned into a cytomegalovirus mammalian expression vector, pcDNA3 (Invitrogen), maintaining the open reading frame as
previously described (12). The Sp1 expression vector
pCMV-Sp1 was obtained from Dr. Robert Tjian, University of California, Berkeley. The porcine P450scc IGFRE reporter gene construct used in
transfection experiments was the 2320-bp P450scc/luc construct that
has been previously described (16). Briefly, this
construct contains the entire sequenced 5' region of P450scc, including the IGFRE cloned into a promoterless luciferase vector
(4). The mutant IGFRE in a reporter gene construct (mM18)
and the normal porcine 450scc IGFRE reporter gene construct have been
previously described (11, 12).
Western gel and immunoblotting. Samples of Y1 and NWTb3 nuclear extract protein collected as previously described (12) were fractionated by discontinuous 10% SDS-PAGE gel under reducing conditions. The gel was then electroblotted onto nitrocellulose (TransBlot, Bio-Rad) by use of electrophoretic transfer buffer for 1 h. The blot was then blocked for 2 h in 5% milk-TBS and then incubated overnight with primary antibody [PSF (1:2,000) or Sp1 (1:1,000)] in 1% milk-TBS. The secondary 0.5-µg antibody, anti-rabbit IgG-horseradish peroxidase conjugate (Sigma) in 1% milk-TBS was added to the blot and incubated for 1 h. After application of the ECL Western blotting detection reagent (Amersham Pharmacia Biotech, Piscataway, NJ), the blot was exposed to film and developed.
ChIP assay.
We used a modification of the technique described by Boyd et al.
(3) and a protocol obtained from the Farnham laboratory website (www.mcardle.oncology.wisc. edu/farnham/). Twenty 15-cm dishes of the Y1 cells were plated at ~2 × 106
cells/dish and incubated for 48 h in media with 2.5% fetal bovine serum. Formaldehyde was added directly to medium at a final
concentration of 1%. Cross-linking was done at room temperature for 10 min and was stopped by the addition of glycine to a final concentration of 0.125 M with a 5-min incubation. The medium was aspirated, and cells
were washed twice with cold 1× PBS. The cells were scraped in PBS on
ice. They were centrifuged and washed once with 1× PBS plus 0.5 mM
PMSF. Cells were then swelled in PIPES (pH 8.0), 85 mM KCl, 0.5%
NP-40, 0.5 mM PMSF, and 100 ng/ml leupeptin and aprotinin, incubated on
ice for 20 min, and then briefly homogenized. Nuclei were collected by
centrifugation and resuspended in nuclei lysis buffer [1% SDS, 10 mM
EDTA, 50 mM Tris · HCl (pH 8.1), 0.5 mM PMSF, and 10 ng/ml
leupeptin and aprotinin] and incubated on ice for 10 min. Samples were
sonicated on ice to an average length of 500-1,000 bp and then
diluted 1:5 with immunoprecipitation (IP) dilution buffer
[0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM
Tris · HCl (ph 8.1), 167 mM NaCl]. The sample was centrifuged for 10 min at 14,000 rpm. Chromatin was precleared with the addition of
staph A cells (Roche) for 15 min at 4°C. Before use, staph A cells
were blocked with 1 µg/µl sheared salmon sperm DNA and 1 µg/µl
of BSA for 4 h at 4°C. Precleared chromatin was aliquoted, mixed
with 1 µg of rabbit polyclonal antibody (Sp1 from Santa Cruz, PSF
from Bio-Molecular Technologies), and incubated overnight on a rotating
platform at 4°C. For typical assays, included as a control was a
chromatin sample without antibody. The next day, 10 µl of blocked
staph A cells were added to each sample and incubated for an additional
10 min. Samples were microfuged and the supernatants saved from the
"no antibody" sample as total input chromatin. Pellets were washed
twice with 1× dialysis buffer [50 mM Tris · HCl, 2 mM EDTA,
0.2% Sarkosyl] and four times with IP wash buffer [100 mM
Tris · HCl (pH 9.0), 500 mM LiCl, 1% NP-40, 1% deoxycholic acid]. Antibody/protein/DNA complexes were eluted twice by addition of
150 µl of elution buffer (50 mM NaHCO3, 1% SDS) and vortexed for 15 min. Eluants were bulked, and 1 µl RNase A (10 mg/ml) and 5 M
NaCl to a final concentration of 0.3 M were added. Samples were
incubated in 67°C waterbath for 4 h to reverse formaldehyde cross-links. Samples were ethanol precipitated and resuspended in 100 µl of Tris-EDTA (50 mM Tris, pH 8, and 2 mM EDTA) and 25 µl
of 5× proteinase K (PK) buffer [50 mM Tris · HCl (pH
7.5), 25 mM EDTA, 1.25% SDS] and 1.5 µl of PK were added to each
sample and incubated at 45°C for 1-2 h. Samples were extracted
once with phenol-chloroform-isoamyl alcohol and once with chloroform.
Samples were then ethanol precipitated overnight with tRNA or glycogen. Samples were microfuged, and the pellet was washed with 70% ethanol. Immunoprecipitated samples were resuspended in 10 µl of water. The
total input sample was resuspended in 100 µl and diluted 100-fold for
PCR reactions. Five microliters of each sample were used for PCR
reaction with Platinum PCR Supermix (Invitrogen). Specific primers were
used to amplify a 186-bp product encompassing the IGFRE response
element. The mouse primers were as follows: sense GCCTGCCAGTGTTTGCCTAAC, anti-sense CCAAACCTCCAGAGCCACAC.
Transient transfection in Y1 adrenal cells. Y1 adrenal cells were cultured as previously described (16). Transient transfection was done by lipofection (Tfx-50 reagent, Promega). Cells were harvested and measured for luminescence 48 h after co-transfection. For expression experiments, an SV40 construct containing 2320 bp of the upstream porcine P450scc (containing the IGFRE) was co-transfected (15).
Statistical analysis. Statistical analysis on transient transfection experiments was done by ANOVA on ranks with Student-Newman-Keuls multiple comparison. Data are presented as means ± SE.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
PSF expression in Y1 adrenal cells.
Previous experiments showed that IGF-I did not stimulate the porcine
P450scc IGFRE in transient transfection experiments in Y1 adrenal cells
(16). By use of a PSF antibody derived from recombinant
protein (12), Western blot analysis was done on nuclear
extract protein from Y1 adrenal and NWTb3 cells treated with and
without IGF-I (Fig. 1). There was a
greater amount of PSF expression in the Y1 cells compared with the
NWTb3 cells. We selected the latter cell type (NWTb3) because IGF-I
stimulates the IGFRE in transient transfection experiments and they are
of mouse origin like the Y1 cells (15). NWTb3 cells are
mouse NIH 3T3 cells stably transfected with the IGF-I receptor
(5). Therefore, altered antibody recognition because of
species variability is not a factor when Y1 and NWTb3 cells are
compared.
|
Sp1 expression in Y1 cells.
Western analysis was also done for Sp1 in Y1 adrenal cells and compared
with Sp1 expression in NWTb3 cells treated with and without IGF-I. As
shown in Fig. 2, Sp1 was expressed at
similar levels in Y1 and NWTb3 cells, and Sp1 expression did not
respond to IGF-I.
|
ChIP assay on Y1 nuclear extract protein.
As shown in Fig. 3, ChIP assay showed
that both PSF and Sp1 were able to bind to the IGFRE. This important
assay shows that the transcription factors associate with chromatin and
occupy the IGFRE. We are unable to successfully perform electromobility shift assays with PSF; therefore the ChIP assay is especially relevant
for the transfection experiments that follow. The assay shows that,
although there is an increased expression of PSF in Y1 adrenal cells,
Sp1 still binds to the IGFRE in a comparable fashion to PSF.
|
Transient transfection of an Sp1 expression vector in Y1 adrenal
cells.
In porcine granulosa cells, expression of PSF repressed basal
transcriptional activity of the porcine P450scc IGFRE, whereas Sp1
expression increased basal transcriptional activity of the element
(12). Transient transfection experiments in Y1 cells with
both expression plasmids determined that Y1 cells responded in a
similar fashion to porcine granulosa cells (Fig.
4), with PSF repressing transcriptional
activity of the IGFRE whereas Sp1 increased transcription.
|
|
Transient transfection experiments with a mutant oligonucleotide
that does not bind PSF.
Transient transfection experiments were done in Y1 adrenal cells with a
mutant oligonucleotide construct (mM18, see METHODS) that
lacks PSF binding (12). As shown in Fig.
6, transient transfection experiments
with this mutant oligonucleotide construct showed that IGF-I would
significantly stimulate the P450scc IGFRE in the absence of PSF
binding. The wild-type IGFRE (mWT) served as a positive control for
this experiment.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We investigated the mechanisms responsible for the inability of IGF-I to stimulate P450scc gene expression in Y1 adrenal cells. Previous studies found that cultures of human adrenocortical cells do not increase mRNA concentrations of P450scc when treated with IGF-I (6, 7). Moreover, transient transfection studies in Y1 adrenal cells with the porcine P450scc IGFRE showed no response to IGF-I treatment (16). In this study, we investigated the expression and binding of PSF and Sp1 to the P450scc IGFRE in Y1 cells. Both of these transcription factors bind to the IGFRE, with Sp1 stimulating promoter activity and PSF functioning as a repressor of transcription (12).
In Y1 cells, PSF expression under basal conditions appeared higher compared with another mouse cell line, NWTb3, which is fibroblast in origin, is stably transfected with the IGF-I receptor, and shows an increase in the transcriptional activity of the IGFRE when treated with IGF-I (15). There was no difference in expression of Sp1 in either cell line, and neither increased its expression in response to IGF-I treatment. Transient transfection protein expression studies confirmed that PSF also functioned as a repressor in Y1 cells, indicating that the lack of response of P450scc expression in response to IGF-I cells could be the increased expression of the repressor PSF. Our findings are consistent with the developing literature that PSF is a repressor of transcription. Mathur et al. (8) identified PSF as a corepressor of the type II nuclear hormone receptors thyroid hormone receptor and retinoid X receptor. PSF bound to the DNA binding domain of these receptors and associated with Sin3A, a protein known to mediate transcriptional repression by recruitment of class I histone deacetylases (8). To add another level of complexity to PSF, a recent study found that, during apoptosis in bone marrow cells, PSF is hyperphosphorylated, dissociates from PTB, associates with new protein partners, and becomes insensitive to proteolysis (10). Therefore, PSF is a highly complex protein that may be an important component of transcriptional repression for many different genes by different mechanisms.
The present study also expands our understanding of the interactions of PSF and Sp1 on the P450scc IGFRE. From the ChIP assay, even though there was a greater expression of PSF in Y1 cells and the IGFRE was not responsive to IGF-I, there was still binding of Sp1 to the chromatin. Therefore, the repressor actions of PSF would seem to involve more than just a competition with Sp1 for occupancy of the IGFRE. However, when additional Sp1 is expressed in Y1 cells or when a reporter construct of the IGFRE that does not bind PSF is transfected in Y1 cells, the IGFRE is responsive to IGF-I treatment. This implies that binding of PSF is essential for repression of the IGFRE and that nuclear concentrations of the transcription factors are important in facilitating the IGF-I response. Such a complex interaction between these transcription factors could be regulated by their phosphorylation state.
In conclusion, Y1 adrenal cells do not increase expression of P450scc in response to IGF-I, because they have increased levels of the repressor, PSF. Although both PSF and Sp1 bind to the P450scc IGFRE in Y1 cells, increasing Sp1 levels or impairing PSF binding to the IGFRE will restore a response of the IGFRE to IGF-I. Y1 cells are a physiological model of PSF regulation of growth factor-stimulated gene expression. This model may be of physiological relevance in growth factor-mediated clinical syndromes.
![]() |
ACKNOWLEDGEMENTS |
---|
This study was supported by National Institutes of Health Grant HD-36092 (R. J. Urban).
![]() |
FOOTNOTES |
---|
Address for reprint requests and other correspondence: R. J. Urban, 8.138 MRB, 1060, Division of Endocrinology, Univ. of Texas Medical Branch, Galveston, TX 77555-1060 (E-mail: rurban{at}utmb.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
June 25, 2002;10.1152/ajpendo.00174.2002
Received 25 February 2002; accepted in final form 19 June 2002.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1.
Adashi, EY.
Intraovarian peptides: stimulators and inhibitors of follicular growth and differentiation.
Endocrinol Metab Clin North Am
21:
1-17,
1992[ISI][Medline].
2.
Adashi, EY.
Intraovarian regulation: the proposed role of insulin-like growth factors.
Ann NY Acad Sci
687:
10-12,
1993[ISI][Medline].
3.
Boyd, KE,
Wells J,
Gutman J,
Bartley SM,
and
Farmham PJ.
c-MYC target gene specificity is determined by a post-DNA binding mechanism.
Proc Natl Acad Sci USA
95:
13887-13892,
1998
4.
Brasier, AR,
Tate JE,
and
Habener JF.
Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines.
Biotechniques
7:
1116-1122,
1989[ISI][Medline].
5.
Dupont, J,
Khan J,
Qu BH,
Metzler P,
Helman L,
and
LeRoith D.
Insulin and IGF-1 induce different patterns of gene expression in mouse fibroblast NIH-3T3 cells: identification by cDNA microarray analysis.
Endocrinology
142:
4969-4975,
2001
6.
Kristiansen, SB,
Endoh A,
Casson PR,
Buster JE,
and
Hornsby PJ.
Induction of steroidogenic enzyme genes by insulin and IGF-I in cultured adult human adrenocortical cells.
Steroids
62:
258-265,
1997[ISI][Medline].
7.
L'Allemand, D,
Penhoat A,
Lebrethon MC,
Ardèvol R,
Baehr V,
Oelkers W,
and
Saez JM.
Insulin-like growth factors enhance steroidogenic enzyme and corticotropin receptor messenger ribonucleic acid levels and corticotropin steroidogenic responsiveness in cultured human adrenocortical cells.
J Clin Endocrinol Metab
81:
3892-3897,
1996[Abstract].
8.
Mathur, M,
Tucker PW,
and
Samuels HH.
PSF is a novel corepressor that mediates its effect through Sin3A and the DNA binding domain of nuclear hormone receptors.
Mol Cell Biol
21:
2298-2311,
2001
9.
Patton, JG,
Porro EB,
Galceran J,
Tempst P,
and
Nadal-Ginard B.
Cloning and characterization of PSF, a novel pre-mRNA splicing factor.
Genes Dev
7:
393-406,
1993[Abstract].
10.
Shav-Tal, Y,
Cohen M,
Lapter S,
Dye B,
Patton JG,
Vandekerchhove J,
and
Zipori D.
Nuclear relocalization of the pre-mRNA splicing factor PSF during apoptosis involves hyperphosphorylation, masking of antigenic epitopes, and changes in protein interactions.
Mol Biol Cell
12:
2328-2340,
2001
11.
Urban, RJ,
and
Bodenburg YH.
Transcriptional activation of the porcine P-450 11A insulin-like growth factor response element in MCF-7 breast cancer cells.
J Biol Chem
271:
31695-31698,
1996
12.
Urban, RJ,
Bodenburg YH,
Kurosky A,
Wood TG,
and
Gasic S.
PTB-associated splicing factor is a negative regulator of transcriptional activity of the porcine P450scc insulin-like growth factor response element.
Mol Endocrinol
14:
774-782,
2000
13.
Urban, RJ,
Bodenburg Y,
and
Wood TG.
NH2 terminus of PTB-associated splicing factor binds to the porcine P450scc IGF-I response element.
Am J Physiol Endocrinol Metab
283:
E423-E427,
2002
14.
Urban, RJ,
Garmey JC,
Shupnik MA,
and
Veldhuis JD.
Insulin-like growth factor type I increases concentrations of messenger RNA encoding cytochrome P450 cholesterol side chain cleavage enzyme in primary cultures of porcine granulosa cells.
Endocrinology
127:
2481-2488,
1990[Abstract].
15.
Urban, RJ,
Nagamani M,
and
Bodenburg YH.
Tumor necrosis factor alpha inhibits transcriptional activity of the porcine P-450 11A insulin-like growth factor response element.
J Biol Chem
271:
31699-31703,
1996
16.
Urban, RJ,
Shupnik MA,
and
Bodenburg YH.
Insulin-like growth factor I increases expression of porcine P-450 cholesterol side-chain cleavage gene through a GC-rich domain.
J Biol Chem
269:
25761-25769,
1994