Department of Physiology and Biophysics, Indiana University School of Medicine, Indianapolis, Indiana 46202
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The purpose of this study was to characterize myosin light chain kinase (MLCK) expression in cardiac and skeletal muscle. The only classic MLCK detected in cardiac tissue, purified cardiac myocytes, and in a cardiac myocyte cell line (AT1) was identical to the 130-kDa smooth muscle MLCK (smMLCK). A complex pattern of MLCK expression was observed during differentiation of skeletal muscle in which the 220-kDa-long or "nonmuscle" form of MLCK is expressed in undifferentiated myoblasts. Subsequently, during myoblast differentiation, expression of the 220-kDa MLCK declines and expression of this form is replaced by the 130-kDa smMLCK and a skeletal muscle-specific isoform, skMLCK in adult skeletal muscle. These results demonstrate that the skMLCK is the only tissue-specific MLCK, being expressed in adult skeletal muscle but not in cardiac, smooth, or nonmuscle tissues. In contrast, the 130-kDa smMLCK is ubiquitous in all adult tissues, including skeletal and cardiac muscle, demonstrating that, although the 130-kDa smMLCK is expressed at highest levels in smooth muscle tissues, it is not a smooth muscle-specific protein.
AT1 cells; C2C12 cells; differentiation
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
MYOSIN LIGHT CHAIN KINASES (MLCK) are Ca2+/calmodulin-regulated enzymes that catalyze the phosphorylation of the 20-kDa regulatory light chains of myosin. In smooth muscle, phosphorylation of the myosin regulatory light chain is an obligatory step involved in the initiation of contraction (17). In striated muscle, myosin light chain phosphorylation increases the isometric tension generated at submaximally activating Ca2+ concentrations (22), by decreasing the apparent Michaelis constant (Km) of actin for myosin. At maximally activating Ca2+ concentrations, light chain phosphorylation has no effect on force. In adult striated muscles, myosin light chain phosphorylation thus plays an important regulatory role, although it is not obligatory for muscle contraction. Recent studies have also suggested that phosphorylation of cardiac myosin light chains is important for maintaining normal cardiac function during development. Transgenic mice in which the normal cardiac myosin light was replaced by a form that could not be phosphorylated displayed atrial hypertrophy and chamber enlargement (29).
The molecular identity of the MLCK responsible for light chain phosphorylation in cardiac muscle is unclear. On the basis of the similar molecular masses characterized for purified skeletal and cardiac MLCKs (36, 37), and the amino acid sequence similarity between skeletal and cardiac myosin regulatory light chains, it has been assumed that the cardiac MLCK is similar or identical to the skeletal muscle enzyme. However, Northern blot and RNase protection analysis have failed to detect any of the 3.3-kb rat skeletal muscle MLCK (skMLCK) mRNA in rat cardiac muscle (14, 28). There are two known families of classic myosin light chain kinases, one includes the skeletal muscle isoforms and one includes the smooth muscle/nonmuscle isoforms (reviewed in Ref. 8). skMLCKs from chicken, rat, and rabbit vary greatly in apparent molecular mass determined by SDS-PAGE from 82 kDa in rat to 150 kDa in chicken. However, all have a similar domain structure. An elongated amino-terminal tail region displays very little sequence homology between species and largely accounts for the differences in molecular mass of the skMLCKs (20). A highly conserved catalytic core is located in the center of the molecule, followed by a regulatory region and the calmodulin-binding domain at the carboxy terminus. Within a given species there is a single skMLCK that is expressed in both fast- and slow-twitch muscles (14). Undifferentiated skeletal muscle myoblasts express nonmuscle myosin light chains and have been proposed to contain a unique Ca2+/calmodulin-independent form of MLCK that is distinct from the adult skMLCK (30). The 130-kDa smooth muscle MLCK (smMLCK) is the product of a distinct gene. Overall it has a domain organization similar to that of the skMLCK, except for an extended carboxy-terminal region, which is also expressed as the independent protein, telokin (6). A 210- to 220-kDa-long form of the classic smMLCK has been cloned from chicken embryo fibroblasts and human endothelial cells (10, 19, 31). These long forms of MLCK are identical in sequence to the corresponding smMLCKs but contain additional residues extending the amino terminus of the proteins. Western blotting of adult smooth and nonmuscle tissues demonstrated that the major form of MLCK expressed in these tissues has the same mass as the 130-kDa smMLCK (7). The tissue expression pattern or potential function of the 220-kDa MLCK has not been well characterized. Preliminary evidence in chicken suggest that this may represent an embryonic MLCK isoform (5), although in humans it has been reported to be expressed in adult tissues and endothelial cells (10, 19).
To resolve the identity of the MLCKs expressed in cardiac muscle and in skeletal muscle during development, expression of MLCK was examined in cardiac myocytes and during in vitro differentiation of skeletal muscle using immunological and Northern blotting techniques. A MLCK expressed in heart was cloned from an AT2 cardiac myocyte library. The identity of the MLCK expressed in AT1 cardiac muscle cells and adult cardiac muscle tissue was then confirmed by RT-PCR cloning and sequencing. Results demonstrate that the only classical MLCK detectable in cardiac myocytes is indistinguishable from the 130-kDa smMLCK. No skeletal muscle-like MLCK was detected in heart by Western blotting, while both the 130-kDa smMLCK and skMLCK are readily detectable in adult skeletal muscle. Western blotting experiments revealed that undifferentiated skeletal muscle myoblasts express the 220-kDa-long form of MLCK; however, expression of this 220-kDa MLCK was undetectable in adult skeletal muscle tissues.
![]() |
METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Western blot analysis.
Extracts were prepared from cells or tissues by homogenization in a
lysis buffer containing 1% Nonidet P-40, 20 mM MOPS, pH 7, 2 mM ethylene bis(oxyethylenenitrilo) tetra-acetic acid, 50 mM
MgCl2, 300 mM NaCl, 50 mM dithiothreitol, 20 µg/ml
leupeptin, 40 µg/ml aprotinin, 60 µg/ml tosyl-phenylalanyl
chloromethyl ketone, 60 µg/ml
N-p-tosyl-L-lysine chloromethyl ketone, and 100 µg/ml phenylmethylsulfonyl fluoride. Extracts were clarified by brief centrifugation, divided into aliquots, and stored at 70°C until analysis. For analysis of skMLCK, extracts were separated by SDS-PAGE on a 7.5% polyacrylamide gel and transferred to nitrocellulose in 25 mM Tris, 192 mM glycine, 0.5% SDS at 60 mA for 14-16 h. For
analysis of smMLCK and myosin, extracts were separated on 5%
polyacrylamide gels and transferred to nitrocellulose at 80 mA for
16 h. Blots were blocked in 10 mM Tris, pH 7.5, 150 mM NaCl,
0.05% Tween 20 (TBST) containing 2% gelatin for 2 h, and incubated with the antibodies indicated diluted in 2% gelatin-TBST for
a further 2 h. Blots were washed three times for 5 min each in
TBST and then incubated with the appropriate second step antibody conjugated to horseradish peroxidase for 45 min. After extensive washing (total 30 min), blots were developed using chemiluminescence according to the manufacturers directions (ECL; Amersham, Arlington Heights, IL).
Northern blot analysis.
Northern blots were performed as described previously (7).
Northern blots were probed with a 556-bp mouse MLCK cRNA
corresponding to nucleotides 3018-3574 of the rabbit
uterine MLCK cDNA (7). This fragment of mouse smMLCK was
generated by reverse transcription coupled to PCR using mouse uterine
mRNA and oligonucleotide primers complementary to nucleotides
3018- 3042 and 3551-3587 of the rabbit cDNA. Final wash
conditions were 1.25 mM sodium phosphate, pH 7.4, 30 mM NaCl, 0.2 mM
EDTA (0.1× SSPE) and 0.1% SDS at 68°C for 10 min. Blots were
exposed for 2 days at 70°C.
RNase protection analysis. An antisense RNA probe was transcribed from the 335-bp EcoR I-BamH I fragment of the rat skMLCK cDNA (14) subcloned into pGEM 3Z (Promega, Madison, WI), using SP6 polymerase on an EcoR I linearized template. The probe generated contains an additional 38 nucleotides from the pGEM polylinker. RNase protection assays were performed as described previously (14). RNase digestion was performed using 6 µg/ml RNase A and 0.03 µg/ml RNase T1 at 37°C for 1 h.
Cloning of mouse cardiac muscle MLCK. A cDNA probe encoding the mouse smMLCK/telokin region (15) was utilized to screen a mouse AT2 cell cardiac myocyte gt11 cDNA library, generously provided by Dr. Loren Field (Indiana University, IN), and positive isolates were subcloned and sequenced. A full-length cDNA encoding the 1,031 amino acids of the mouse 130-kDa MLCK was identified by sequence comparison to the sequence of clones encoding MLCK from several other species.
RT-PCR analysis. Total RNA was prepared from adult mouse heart, skeletal and bladder tissues, and AT1 cardiac myocyte cells. Five micrograms of RNA from each source were reverse-transcribed using oligo(dT) and random primers. PCR amplification was performed on an aliquot of the RT mixture for 35 cycles at 94°C for 1 min, 50°C for 1 min, and 72°C for 1 min, using Vent DNA polymerase (New England Biolabs). Oligonucleotide primers corresponding to three overlapping regions spanning the mouse smMLCK cDNA described in this report were employed to amplify the MLCK expressed in these tissues and cells. Negative control PCR reactions were run with mock reverse-transcribed RNA that was not treated with RT. Positive control reactions utilized the full-length mouse smMLCK cDNA as a template as well as RT-PCR from mouse bladder, a smooth muscle tissue. The PCR products from selected reactions were subcloned and sequenced. The three sets of oligonucleotide primers used were: PCR-1F, ATGGATTTCCGCGCC and PCR-1R, CTGCCACATGGACATCCT; PCR-2F, AAGTCTGCTGAGACCTCGAAAC and PCR-2R, GCCGCTCTCGCCATTC; PCR-3F, TGCAAGTCGATCAAGTTC and PCR-3R, ATCATCAGCGAGCATTGCC.
Cell culture. C2C12 myoblasts, obtained form Dr. W. Wright (University of Texas Southwestern, TX), were grown in DMEM/199 (4:1) containing 10% FCS, 10% newborn calf serum, and 50 µg/ml genticin. Myoblasts were induced to differentiate by switching to media containing 2% horse serum for 3-4 days. AT1 and AT2, SV40 large T-antigen transformed cardiac myocytes, were kindly provided by Dr. Loren Field (Indiana University, IN) and grown in DMEM containing 10% FCS. Adult rat cardiac myocytes were a generous gift from Dr. X.-D. Huang (Indiana University, IN), and neonatal day 1 purified rat cardiac myocyte and fibroblast fractions were kindly provided by Dr. M. LaCorbiere and Dr. K. Chien (University of California, San Diego, CA).
Immunofluorescence. For immunofluorescence analysis, AT1 cells were grown on glass coverslips coated with fibronectin under the same conditions as described above. Cells were fixed in 3.7% formaldehyde in PBS for 5 min, washed in 50 mM Tris, pH 7.6, 150 mM NaCl, 0.01% NaN3 (TBS) for 5 min, permeabilized in 0.2% Triton X-100 in TBS for 5 min, washed for 5 min in TBS, and then incubated with the antibodies indicated in the legend for Fig. 3 for 1 h at 37°C. After incubation, the cells were washed in TBS and incubated with either rhodamine or fluorescein-conjugated second antibodies for 1 h at 37°C. Washed cover chips were mounted in gelvatol and stored at 4°C.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Expression of smMLCK in skeletal and cardiac muscle tissues.
Northern blot analysis of RNA isolated from mouse skeletal and cardiac
muscle demonstrated the presence of low levels of the 5.8-kb smMLCK
mRNA (Fig. 1A). To
examine the pattern of MLCK protein expression, Western blot analysis
of mouse skeletal, cardiac, and smooth muscle tissues was performed
using a monoclonal antibody that binds to the amino terminus of the
130-kDa smMLCK (9) (Figs. 1B and
2) and a polyclonal antibody to skMLCK
(25) (Fig. 1C). The 130-kDa smMLCK was readily
detectable in cardiac and skeletal muscle tissues in addition to smooth
muscle tissues. Densitometric analysis of the immunoblot shown in Fig.
1B revealed that the 130-kDa smMLCK was expressed at
approximately three- and fourfold lower levels in mouse cardiac and
skeletal muscle extracts, respectively, compared with mouse aortic
extracts. The 130-kDa smMLCK was detected in embryonic, neonatal, and
adult cardiac tissue (Fig. 2). The 220-kDa MLCK was expressed at low levels in adult uterus, lung, and liver and in neonatal cardiac fibroblasts (Figs. 1 and 2). No expression of the 220-kDa MLCK isoform
was detected in embryonic, neonatal, or adult cardiac muscle or in
adult skeletal muscle (Figs. 1 and 2). In contrast to the 130- and
220-kDa smMLCKs, the 97-kDa skMLCK was only detected in skeletal muscle
tissue and could not be detected in cardiac muscle, smooth muscle or
nonmuscle tissues, even when 50-fold greater amounts of these extracts
were analyzed (Fig. 1C). Similar results were obtained using
a monoclonal antibody (clone 12a; Ref. 24) to skMLCK that
we have previously shown binds to a region of the skMLCK that is
conserved across species (13) (data not shown).
|
|
Smooth muscle MLCK expression in cardiac muscle cells. To further confirm that smMLCK was expressed in cardiac muscle cells, smMLCK expression was examined in isolated adult cardiac myocytes, purified neonatal cardiac myocytes and neonatal cardiac fibroblasts (Fig. 2), and AT1 cardiac myocytes (Fig. 1B). In extracts prepared from each of these cells, 130-kDa smMLCK was readily detectable. No smooth muscle myosin could be detected in the purified neonatal cardiac myocytes or the isolated adult myocytes, indicating that these cells are free from contaminating smooth muscle cells (data not shown). The fibroblast fraction from the neonatal cardiac cell preparation also contained vascular smooth muscle cells, as determined by positive staining for smooth muscle myosin (data not shown). It is likely that the presence of these contaminating cells accounts for the relatively high levels of smMLCK found in the purified fibroblast cell fraction.
The expression of the 130-kDa smMLCK in AT1 cardiac myocytes was further analyzed by indirect immunofluorescence using three antibodies that bind to different regions of smMLCK. A monoclonal antibody (N-T, Fig. 3) that binds to the amino terminus of the kinase, an anti-peptide polyclonal antibody (REP, Fig. 3) directed against the repeated region of amino acids near the amino terminus of the mammalian kinases, and a polyclonal antibody (C-T, Fig. 3) directed against the carboxy terminus of the kinase all stain AT1 cardiac cells. The staining pattern observed for each antibody was identical and is a distinct filamentous pattern consistent with the MLCK being localized to cytoskeletal elements (Fig. 3). The cardiac origin of the AT1 cells was confirmed by costaining with antibodies to sarcomeric
|
Cloning of the cardiac MLCK.
To determine whether the 130-kDa MLCK expressed in cardiac muscle
tissue was identical to the form expressed in smooth muscle cells, a
probe derived from the 3' end of mouse smMLCK cDNA (15) was used to screen a cDNA library prepared from mouse cardiac AT2
cells. Both AT1 and AT2 cells are derived from atrial myocytes that
have been transformed with SV40 large T-antigen. AT1 cells beat
spontaneously in culture, and both AT1 and AT2 express cardiac myosin
isoforms (Ref. 4 and unpublished observations). Twenty-two overlapping clones were isolated and completely sequenced. All of the
clones encoded a protein with high homology to the other characterized
mammalian smMLCKs. The level of amino acid identity between the mouse,
rabbit, bovine, and human MLCKs is 96% in the catalytic domain, 100%
in the calmodulin binding domain, 92% in the carboxy-terminal telokin
region, and 80% in the amino-terminal region (excluding the variable
repeat domain located between residues 87 and 172 of the mouse MLCK).
Two overlapping clones were joined to result in a full-length cDNA
that, when expressed in COS cells, encodes a 130-kDa protein that is
catalytically active and Ca2+/calmodulin dependent (data
not shown). Alignment of the predicted sequence of mouse cardiac MLCK
revealed a high degree of identity between this sequence and the
sequences of the other mammalian smMLCKs (Fig.
4).
|
Molecular identity of the 130-kDa MLCK expressed in adult skeletal
and cardiac muscle and AT1 cardiac myocytes.
To determine whether the 130-kDa MLCK expressed in skeletal and cardiac
muscle tissue and cardiac AT1 cells was identical to the form cloned
from cardiac AT2 cells, RT-PCR analysis was performed. Three pairs of
primers were designed to span the mouse smooth/cardiac muscle MLCK cDNA
as shown in Fig. 4. Reverse transcription of total RNA isolated from
adult mouse heart, skeletal muscle, bladder tissue, and AT1 cardiac
cells was used to generate cDNA. The cDNA was then used to PCR amplify
each of three fragments that span 994 of 1,030 amino acids comprising
the 130-kDa MLCK from mouse heart. The sizes of the amplified PCR
products were directly compared using agarose gel electrophoresis. This
analysis revealed that identical sized fragments were generated from
each of the tissues (Fig. 5). To further
confirm the identity of the amplified products, all of the fragments
amplified from bladder and AT1 cells, together with select fragments
from skeletal and cardiac tissue, were subcloned and sequenced. The
sequence of the fragments obtained from each tissue were found to be
identical to the sequence of the cDNA encoding the mouse 130-kDa MLCK
isolated from AT2 cardiac myocytes, shown in Fig. 4. Control PCR
reactions performed using primer pairs and total RNA without reverse
transcription were negative, suggesting that the products obtained by
RT-PCR did not result from genomic DNA contamination (Fig. 5).
|
MLCK expression during skeletal muscle development in vitro.
To further analyze the developmental expression of MLCK in skeletal
muscle, MLCK expression was examined during the in vitro differentiation of mouse C2C12 skeletal muscle
myoblasts. Differentiation was induced by switching confluent cultures
of myoblasts from media containing 20% serum to media containing 2%
horse serum. skMLCK protein and mRNA expression were first detectable
1-2 days following the induction of differentiation and continued
to increase up to 4 days (Figs. 6 and
7). Skeletal muscle myosin was induced over a similar time period. In contrast, the 130-kDa smMLCK was first
detected in confluent myoblast cultures before serum deprivation and
continued to be expressed at similar levels in differentiated myotubes
(Fig. 6). The predominant classic MLCK seen in
C2C12 myoblasts was the 220-kDa long form of
smMLCK. Expression of the 220-kDa MLCK was further induced during
C2C12 cell differentiation, although it was not
detectable in adult skeletal muscle tissue (Figs. 1A, 2, and
6).
|
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
This study shows that the only classic MLCK detectable in adult cardiac muscle and in AT1 cardiac myocytes is indistinguishable from the previously described 130-kDa smMLCKs (reviewed in Ref. 8). Additionally, a complex pattern of MLCK expression was observed during differentiation of skeletal muscle in which the 220-kDa-long form of smMLCK is expressed in undifferentiated myoblasts. Subsequently, during myoblast differentiation, expression of the 220-kDa MLCK declines, and expression of this form is replaced by the 130-kDa smMLCK and skMLCK in adult skeletal muscle.
Western blot analysis in this study, together with previously reported RNase protection experiments (14), have failed to detect a skeletal muscle isoform of MLCK in cardiac muscle even when excessive amounts of cardiac tissue are analyzed. Previously, by Northern blotting, we detected a 2.2-kb mRNA present in cardiac muscle that weakly hybridized to a probe derived from rat skeletal muscle MLCK (14). This cross-hybridizing mRNA was only detected when 50 µg of cardiac poly(A)+ mRNA were analyzed. However, when the same probe was used for RNase protection analysis, no signal was detected in 60 µg of cardiac poly(A)+ mRNA. In contrast, in the current study we were able to detect an mRNA, that hybridized to a probe derived from the mouse 130-kDa MLCK, in as little as 15 µg of total RNA from heart (Fig. 1A). These results suggest that the 2.2-kb mRNA reported previously is either present at very low levels or that it represented nonspecific hybridization resulting from the large amount of mRNA analyzed.
As a result of the highly vascular nature of cardiac muscle, it is
possible that the smMLCK detected in adult heart is derived from
vascular smooth muscle cells. However, several experimental results
suggest that this possibility is unlikely. These results include the
finding that antibodies to the 130-kDa smMLCK detect a corresponding
protein in highly purified neonatal rat cardiomyocytes and in adult
cardiomyocytes (Fig. 2). Second, the level of 130-kDa MLCK expression
in cardiac tissue cannot be accounted for by vascular smooth muscle as
judged by a comparison of the relative amounts of the kinase and smooth
muscle -actin (Fig. 1). Finally, the sequence of the MLCK expressed
in AT1 cardiac cells is identical to the nucleotide sequence of RT-PCR
clones obtained from mouse bladder smooth muscle and to cDNA clones
representing the 130-kDa smMLCK, obtained from AT2 cardiac cells (Figs.
4 and 5). In support of these results, immunolocalization experiments
also confirm that the 130-kDa smMLCK as well as cardiac muscle markers
are both coexpressed in beating AT1 cardiac myocytes (Fig. 3). Although smMLCK is the major, classic MLCK that is detectable in cardiac muscle,
our results do not exclude the possibility that other nonclassic MLCKs
such as Rho kinase or PAK-2 (p21 activated kinase) may also contribute
to cardiac myosin regulatory light chain phosphorylation (1,
3). However, the low levels of 130-kDa MLCK detected in heart,
together with its poor kinetics using cardiac light chains as a
substrate (33), are consistent with the low rates of light
chain phosphorylation observed in vivo, in cardiac muscle (12).
The 130-kDa smMLCK is also expressed in adult skeletal muscle tissue and in differentiated skeletal muscle cells (Figs. 1, 2, and 6). However, in contrast to cardiac muscle, skeletal muscle tissue and differentiated C2C12 cells also express the tissue-specific skMLCK. During differentiation of skeletal muscle, expression of 130-kDa smMLCK was induced before the expression of the skMLCK or skeletal muscle myosin; however, the 130-kDa smMLCK isoform continues to be expressed at low levels in adult skeletal muscle tissue. The high levels of expression of the skMLCK, as opposed to the 130-kDa smMLCK, in adult skeletal muscle and its lower Km and higher maximum velocity for skeletal myosin light chains suggest that it is likely that the skMLCK mediates the leftward shift in the force-pCa relationship and posttetanic twitch potentiation in skeletal muscle (34). Although the functional significance of the expression of the 130-kDa smMLCK in adult skeletal muscle is not yet clear, it is possible that 130-kDa smMLCK may be required to regulate cytoplasmic nonmuscle actomyosin interactions in skeletal muscle cells. Consistent with this proposal, studies have demonstrated that nonmuscle myosin heavy chain II-B is expressed in both fetal, neonatal, and to a lesser extent adult skeletal muscle tissues (23, 32, 35). The finding that the 130-kDa smMLCK is induced during C2C12 cell differentiation before the expression of skeletal muscle specific proteins may explain the previous observation of coexpression of the smMLCK and skeletal muscle differentiation markers in the developing mouse esophagus (26). The presence of cells expressing the 130-kDa smMLCK and skeletal muscle differentiation markers has been used to suggest that the striated muscle cells of the esophagus transdifferentiate from smooth muscle cells. Although our results do not preclude this possibility, they do demonstrate that the 130-kDa smMLCK is not an exclusive marker of differentiated smooth muscle cells and that it is normally induced during the differentiation of skeletal muscle.
The 220-kDa MLCK was the most abundant of the classic MLCKs detected in undifferentiated skeletal muscle myoblasts (Fig. 6); however, consistent with expression in human tissues (19), this isoform was not detected in adult mouse or rat skeletal muscle (Figs. 1 and 2). The functional significance of expression of the 220-kDa MLCK isoform compared with the 130-kDa smMLCK in myoblasts is uncertain. Both enzymes have identical catalytic domains and are regulated by Ca2+/calmodulin. It is likely that the intracellular localization of the enzymes differ as the amino-terminal region of the kinases appear to play a role in the cytoskeletal localization of the proteins (2, 9, 11, 21). Presumably, the 220-kDa MLCK plays a specific role in myoblasts, perhaps to phosphorylate either fetal skeletal myosin or nonmuscle myosin and regulate its activity during cell division and migration in a manner that cannot be mimicked by the 130-kDa smMLCK.
In summary, Western and Northern blotting, RNase protection, and cDNA cloning and RT-PCR analysis of classic MLCK expression in various mouse tissues demonstrate that only the skMLCK isoform is expressed in a tissue-specific manner. The 130-kDa smMLCK is ubiquitous in all adult tissues, including skeletal and cardiac muscle, and represents the major classic MLCK detectable in cardiac muscle. Together these results demonstrate that smMLCK is not a tissue-specific MLCK, and, although it is expressed at highest levels in smooth muscle tissues, it is not a smooth muscle-specific protein. Expression of the 130-kDa smMLCK in striated muscle tissues likely regulates the motor activity of nonmuscle myosin II expressed in these tissues in addition to regulating the activity of cardiac myosin. These data imply that the smMLCK is likely to play a critical role in regulating myosin motor activities during heart development.
![]() |
ACKNOWLEDGEMENTS |
---|
We are indebted to the following people for supplying cells used in this study: Dr. W. Wright (University of Texas Southwestern Medical Center at Dallas, TX) for C2C12 cells, Dr. L. Field (Indiana University, IN) for AT1 and AT2 cells, X-D. Huang (Krannert Institute of Cardiology, Indianapolis, IN) for adult rat cardiac myocytes, and Drs. M. La Corbiere and K. Chien (University of California, San Diego, CA) for the purified cardiac myocytes and fibroblasts. We thank Dr. Loren Field for the AT2 cDNA library and Dr. Aiping Smith for expert technical assistance.
![]() |
FOOTNOTES |
---|
* B. P. Herring and P. J. Gallagher contributed equally to this work.
This work was supported in part by Grant-in-Aid GA4 from the American Heart Association, Indiana Affiliate (to B. P. Herring), and National Heart, Lung, and Blood Institute Grants HL-58571 (to B. P. Herring) and HL-54118 (to P. J. Gallagher).
Address for reprint requests and other correspondence: B. P. Herring, Dept. of Physiology and Biophysics, Indiana Univ. School of Medicine, 635 Barnhill Dr., Indianapolis, IN 46202-5120 (E-mail pherring{at}iupui.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 27 January 2000; accepted in final form 18 May 2000.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1.
Amano, M,
Ito M,
Kimura K,
Fukata Y,
Chihara K,
Nakano T,
Matsuura Y,
and
Kaibuchi K.
Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase).
J Biol Chem
271:
20246-20249,
1996
2.
Cavadore, JC,
Molla A,
Harricane MC,
Gabrion J,
Benyamin Y,
and
Demaille JG.
Subcellular localization of myosin light chain kinase in skeletal, cardiac, and smooth muscles.
Proc Natl Acad Sci USA
79:
3475-3479,
1982[Abstract].
3.
Chew, TL,
Masaracchia RA,
Goeckeler ZM,
and
Wysolmerski RB.
Phosphorylation of nonmuscle myosin II regulatory light chain by p21-activated kinase (gamma-PAK).
J Muscle Res Cell Motil
19:
839-854,
1998[ISI][Medline].
4.
Field, LJ.
Atrial natriuretic factor-SV40 T antigen transgenes produce cardiac tumors and cardiac arrhythmias in mice.
Science
239:
1029-1033,
1988[ISI][Medline].
5.
Fisher, SA,
and
Ikebe M.
Developmental and tissue distribution of expression of nonmuscle and smooth muscle isoforms of myosin light chain kinase.
Biochem Biophys Res Commun
217:
696-703,
1995[ISI][Medline].
6.
Gallagher, PJ,
and
Herring BP.
The carboxyl terminus of the smooth muscle myosin light chain kinase is expressed as an independent protein, telokin.
J Biol Chem
266:
23945-23952,
1991
7.
Gallagher, PJ,
Herring BP,
Griffin SA,
and
Stull JT.
Molecular characterization of a mammalian smooth muscle myosin light chain kinase.
J Biol Chem
266:
23936-23944,
1991
8.
Gallagher, PJ,
Herring BP,
and
Stull JT.
Myosin light chain kinases.
J Muscle Res Cell Motil
18:
1-16,
1997[ISI][Medline].
9.
Gallagher, PJ,
and
Stull JT.
Localization of an actin binding domain in smooth muscle myosin light chain kinase.
Mol Cell Biochem
173:
51-57,
1997[ISI][Medline].
10.
Garcia, JG,
Lazar V,
Gilbert-McClain LI,
Gallagher PJ,
and
Verin AD.
Myosin light chain kinase in endothelium: molecular cloning and regulation.
Am J Respir Cell Mol Biol
16:
489-494,
1997[Abstract].
11.
Guerriero, V, Jr,
Rowley DR,
and
Means AR.
Production and characterization of an antibody to myosin light chain kinase and intracellular localization of the enzyme.
Cell
27:
449-458,
1981[ISI][Medline].
12.
Herring, BP,
and
England PJ.
The turnover of phosphate bound to myosin light chain-2 in perfused rat heart.
Biochem J
240:
205-214,
1986[ISI][Medline].
13.
Herring, BP,
Fitzsimons DP,
Stull JT,
and
Gallagher PJ.
Acidic residues comprise part of the myosin light chain-binding site on skeletal muscle myosin light chain kinase.
J Biol Chem
265:
16588-16591,
1990
14.
Herring, BP,
Nunnally MH,
Gallagher PJ,
and
Stull JT.
Molecular characterization of rat skeletal muscle myosin light chain kinase.
Am J Physiol Cell Physiol
256:
C399-C404,
1989
15.
Herring, BP,
and
Smith AF.
Telokin expression is mediated by a smooth muscle cell-specific promoter.
Am J Physiol Cell Physiol
270:
C1656-C1665,
1996
16.
Iwaki, K,
Sukhatme VP,
Shubeita HE,
and
Chien KR.
Alpha- and beta-adrenergic stimulation induces distinct patterns of immediate early gene expression in neonatal rat myocardial cells: fos/jun expression is associated with sarcomere assembly; Egr-1 induction is primarily an alpha 1-mediated response.
J Biol Chem
265:
13809-13817,
1990
17.
Kamm, KE,
and
Stull JT.
The function of myosin and myosin light chain kinase phosphorylation in smooth muscle.
Annu Rev Pharmacol Toxicol
25:
593-620,
1985[ISI][Medline].
18.
Kobayashi, H,
Inoue A,
Mikawa T,
Kuwayama H,
Hotta Y,
Masaka T,
and
Ebashi S.
Isolation of cDNA for bovine stomach 155kDa protein exhibiting myosin light chain kinase activity.
J Biochem (Tokyo)
112:
786-791,
1992[Abstract].
19.
Lazar, V,
and
Garcia JG.
A single human myosin light chain kinase gene (MLCK; MYLK).
Genomics
57:
256-267,
1999[ISI][Medline].
20.
Leachman, SA,
Gallagher PJ,
Herring BP,
McPhaul MJ,
and
Stull JT.
Biochemical properties of chimeric skeletal and smooth muscle myosin light chain kinases.
J Biol Chem
267:
4930-4938,
1992
21.
Lin, P,
Luby-Phelps K,
and
Stull JT.
Binding of myosin light chain kinase to cellular actin-myosin filaments.
J Biol Chem
272:
7412-7420,
1997
22.
Morano, I,
Hofmann F,
Zimmer M,
and
Ruegg JC.
The influence of P-light chain phosphorylation by myosin light chain kinase on the calcium sensitivity of chemically skinned heart fibres.
FEBS Lett
189:
221-224,
1985[ISI][Medline].
23.
Murakami, N,
Trenkner E,
and
Elzinga M.
Changes in expression of nonmuscle myosin heavy chain isoforms during muscle and nonmuscle tissue development.
Dev Biol
157:
19-27,
1993[ISI][Medline].
24.
Nunnally, MH,
Hsu LC,
Mumby MC,
and
Stull JT.
Structural studies of rabbit skeletal muscle myosin light chain kinase with monoclonal antibodies.
J Biol Chem
262:
3833-3838,
1987
25.
Nunnally, MH,
and
Stull JT.
Mammalian skeletal muscle myosin light chain kinases: a comparison by antiserum cross-reactivity.
J Biol Chem
259:
1776-1780,
1984
26.
Patapoutian, A,
Wold BJ,
and
Wagner RA.
Evidence for developmentally programmed transdifferentiation in mouse esophageal muscle.
Science
270:
1818-1821,
1995[Abstract].
27.
Potier, MC,
Chelot E,
Pekarsky Y,
Gardiner K,
Rossier J,
and
Turnell WG.
The human myosin light chain kinase (MLCK) from hippocampus: cloning, sequencing, expression, and localization to 3qcen-q21.
Genomics
29:
562-570,
1995[ISI][Medline].
28.
Roush, CL,
Kennelly PJ,
Glaccum MB,
Helfman DM,
Scott JD,
and
Krebs EG.
Isolation of the cDNA encoding rat skeletal muscle myosin light chain kinase: sequence and tissue distribution.
J Biol Chem
263:
10510-10516,
1988
29.
Sanbe, A,
Fewell JG,
Gulick J,
Osinska H,
Lorenz J,
Hall DG,
Murray LA,
Kimball TR,
Witt SA,
and
Robbins J.
Abnormal cardiac structure and function in mice expressing nonphosphorylatable cardiac regulatory myosin light chain 2.
J Biol Chem
274:
21085-21094,
1999
30.
Scordilis, SP,
Uhlendorf BW,
Scarpa S,
Cantoni GL,
Miles JM,
and
Adelstein RS.
Changes in myosin and myosin light chain kinase during myogenesis.
Biochemistry
20:
3511-3516,
1981[ISI][Medline].
31.
Shoemaker, MO,
Lau W,
Shattuck RL,
Kwiatkowski AP,
Matrisian PE,
Guerra-Santos L,
Wilson E,
Lukas TJ,
Van Eldik LJ,
and
Watterson DM.
Use of DNA sequence and mutant analyses and antisense oligodeoxynucleotides to examine the molecular basis of nonmuscle myosin light chain kinase autoinhibition, calmodulin recognition, and activity.
J Cell Biol
111:
1107-1125,
1990[Abstract].
32.
Simons, M,
Wang M,
McBride OW,
Kawamoto S,
Yamakawa K,
Gdula D,
Adelstein RS,
and
Weir L.
Human nonmuscle myosin heavy chains are encoded by two genes located on different chromosomes.
Circ Res
69:
530-539,
1991[Abstract].
33.
Stull, JT,
Blumenthal DK,
Miller JR,
and
DiSalvo J.
Regulation of myosin phosphorylation.
J Mol Cell Cardiol
14, Suppl3:
105-110,
1982[ISI][Medline].
34.
Sweeney, HL,
Bowman BF,
and
Stull JT.
Myosin light chain phosphorylation in vertebrate striated muscle: regulation and function.
Am J Physiol Cell Physiol
264:
C1085-C1095,
1993
35.
Takeda, K,
Yu ZX,
Qian S,
Chin TK,
Adelstein RL,
and
Ferrans VJ.
Nonmuscle myogin II localizes to the Z-lines and intercalated discs of cardiac muscle and to the Z-lines of skeletal muscle.
Cell Motil Cytoskeleton
46:
54-68,
2000.
36.
Walsh, MP,
Vallet B,
Autric F,
and
Demaille JG.
Purification and characterization of bovine cardiac calmodulin-dependent myosin light chain kinase.
J Biol Chem
254:
12136-12144,
1979[Abstract].
37.
Wolf, H,
and
Hofmann F.
Purification of myosin light chain kinase from bovine cardiac muscle.
Proc Natl Acad Sci USA
77:
5852-5855,
1980[Abstract].