Coordinate expression of secretory phospholipase A2 and cyclooxygenase-2 in activated human keratinocytes

Krystyna E. Rys-Sikora1, Raymond L. Konger1, John W. Schoggins1, Rama Malaviya2, and Alice P. Pentland1

1 Department of Dermatology, University of Rochester Medical Center, Rochester, New York 14642; and 2 Drug Discovery Enterprises, Hughes Institute, St. Louis, Missouri 55113


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

PGE2 levels are altered in human epidermis after in vivo wounding; however, mechanisms modulating PGE2 production in activated keratinocytes are unclear. In previous studies, we showed that PGE2 is a growth-promoting autacoid in human primary keratinocyte cultures, and its production is modulated by plating density, suggesting that regulated PGE2 synthesis is an important component of wound healing. Here, we examine the role of phospholipase A2 (PLA2) and cyclooxygenase (COX) enzymes in modulation of PGE2 production. We report that the increased PGE2 production that occurs in keratinocytes grown in nonconfluent conditions is also observed after in vitro wounding, indicating that similar mechanisms are involved. This increase was associated with coordinate upregulation of both COX-2 and secretory PLA2 (sPLA2) proteins. Increased sPLA2 activity was also observed. By RT-PCR, we identified the presence of type IIA and type V sPLA2, along with the M-type sPLA2 receptor. Thus the coordinate expression of sPLA2 and COX-2 may be responsible for the increased prostaglandin synthesis in activated keratinocytes during wound repair.

wound healing; primary human keratinocytes; arachidonic acid; prostaglandin E2; secretory phospholipase A2 receptor


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

AFTER MECHANICAL WOUNDING to the stratified epidermis occurs, both keratinocyte migration and cellular proliferation, followed by differentiation, are necessary to repopulate the wound bed and restore epidermal barrier function (43). For these events to occur, keratinocytes must be activated, that is, undergo a transition from a relatively sedentary and metabolically inactive cell type to a migratory and mitotically active phenotype (23). Keratinocyte activation is complex and involves the spatiotemporal modulation of a vast array of structural and regulatory proteins and signaling molecules (see review, Ref. 13). Previously, it has been reported that changes in fatty acid metabolism and prostaglandin production can modulate keratinocyte proliferation (37, 38, 58). Thus regulation of prostaglandin synthesis may be an important factor in the wound healing response (39, 58). The object of this study is to examine prostaglandin biosynthesis and mechanism(s) involved in the regulation of prostaglandin production in keratinocytes in an in vitro wounding model. This model is intended as a tool to dissect the importance of prostaglandin production in the regulated epithelial wound healing response.

Prostaglandins are produced by the sequential release of arachidonic acid (AA) from membrane phospholipids by cellular phospholipases, followed by the enzymatic peroxidation and cyclooxygenation by PGH synthases, also known as cyclooxygenases (COXs). In human epidermis, AA release can occur via action of phospholipase A2s (PLA2) (2, 22) or indirectly through the action of phospholipase C or D by the sequential hydrolysis of diacylglycerol (DAG) by DAG lipase and monoacylglyceride lipase (7). Mammalian tissues and cells generally contain more than one PLA2 enzyme and a growing superfamily has now been identified and categorized (see review, Ref. 16). Several types of PLA2s have been associated with fatty acid release, including an 85-kDa Ca2+-dependent cytosolic PLA2 (cPLA2) and several subtypes of secretory PLA2s (sPLA2). cPLA2, also called type IV PLA2, is considered to be ubiquitously expressed and has distinct substrate preference for sn2-AA-containing phosphatidylcholine, indicating its critical role in further eicosanoid synthesis (see review, Ref. 33). Modulation of cPLA2 activity is tightly regulated by postreceptor signal-transduction pathways linking its activity to rapid, yet transient, fatty acid release. Overexpression of human cPLA2 protein in HEL-30 cells, a murine keratinocyte cell line, was shown to enhance AA release, PGE2 production, and proliferation capacity (37).

sPLA2s are low-molecular-weight (~14 kDa) proteins that are found both extracellularly and on cellular membranes. They require millimolar Ca2+ levels for catalytic activity and have a broad range of substrate specificity with respect to head group or sn2 fatty acid when assayed in vitro (67). sPLA2s identified to date are distinguished mostly by their molecular sequence, disulfide bonds, and substrate preferences. Type I sPLA2 is abundantly expressed in pancreas, where it functions as a digestive enzyme (48, 53). It is also present, although in small amounts, in several nondigestive tissues (48, 53). Type IIA sPLA2 has been detected in spleen, liver, thymus, and intestine as well as several inflammatory cells, including macrophages and mast cells (see review, Ref. 48). It is also prominent in sites of active inflammation such as the synovial fluid from rheumatoid arthritis patients (65). Therefore, type IIA sPLA2 is thought to play a significant role in inflammatory responses, host defense, and proliferation. Thus it is interesting that transgenic mice expressing human type IIA sPLA2 exhibited chronic epidermal hyperplasia (21).

A recently identified subtype, type V sPLA2, is highly expressed in heart, placenta, and, to a lesser extent, in lung and liver (4, 12). Type V sPLA2 has also been shown to be involved in AA mobilization in mouse immune cells (4, 62), a role previously assigned solely to type IIA. Recent studies have demonstrated that a functional redundancy between type IIA and type V sPLA2 exists with respect to their fatty acid-releasing activity (50, 62). Type X, another recently identified member of the sPLA2 subfamily, has been identified in human immune tissues (14). In addition to their catalytic functions, several subtypes of sPLA2 have been shown to modulate cellular events, including eicosanoid production, cell proliferation, and cell motility via binding to a 180-kDa M-type sPLA2 receptor (48, 53). With this PLA2 superfamily rapidly growing and sPLA2 receptor-mediated pathways being further elucidated, the question of how multiple PLA2 subtypes function and interact within a cell or tissue needs to be addressed.

PLA2 activity has been described in human epidermis and is associated with multiple normal skin functions, including cell growth and differentiation, formation of the permeability barrier, wound repair, and bacterial host defense (8, 19, 22, 41, 44, 72). A variety of agents that cause skin damage, including ultraviolet (UV) irradiation and chemical irritants, induce PLA2-mediated fatty acid release in vitro (22, 28, 29, 36, 37, 42). Also, differences in PLA2 activities have been reported among epidermal layers (8) and between the cytosolic and membrane fractions of mouse keratinocytes (36), suggesting that regulated expression of multiple forms of PLA2s in keratinocytes may influence differentiation and barrier formation.

Keratinocytes are known to express both COX isoenzymes (COX-1 and COX-2) (64). These isoenzymes differ primarily in that COX-1 is generally considered to be constitutively expressed, whereas COX-2 expression is rapidly induced upon stimulation. Mitogens and proinflammatory stimuli have been shown to modulate gene expression, posttranscriptional regulation, and protein synthesis of COX-2 in keratinocytes (38, 46, 56, 64). Functional coupling between PLA2 and COX enzymes is thought to mediate agonist-induced, temporal production of prostaglandins. Several studies reported that coupled activation of cPLA2 and COX-1 are responsible for immediate prostaglandin synthesis, whereas coordinate induction of sPLA2 and COX-2 protein expression is involved in cytokine-induced delayed PGE2 production (3, 5, 9, 49, 51, 66). Other studies suggest that a functional coupling between sPLA2 and COX-1 is responsible for early prostaglandin synthesis (60, 61); this can occur transcellularly (61) and involve the sPLA2 receptor and activation of cPLA2 (24). It is notable that the nature of these cross talk pathways is cell-type dependent and requires more investigation in human keratinocytes.

Previous data from our laboratory have shown an increase in PGE2 synthesis in human primary keratinocytes grown under nonconfluent conditions, which gradually decreased as the density of the cultures increased (55, 58). Endogenous PGE2 is necessary for the high mitotic activity observed during nonconfluent keratinocyte growth (58) and this effect is mediated through activation of PGE receptor subtypes EP2 and/or EP4, coupled to adenylate cyclase activity (32). Persistent high levels of exogenous PGE2 are growth-inhibitory, possibly due to downregulation of EP2 or EP4 receptors. These findings indicate that modulation of PGE2 production in the activated keratinocyte is essential to the growth and migration of keratinocytes during wound healing.

In this study, we examined PGE2 production in proliferating keratinocytes in more detail, evaluating the roles PLA2 and COX enzymes play in the modulation of PGE2 synthesis. Because little information exists about sPLA2 subtypes and sPLA2 receptor in human epidermis, we examined whether both type IIA and type V sPLA2, along with the M-type sPLA2 receptor, were present in human keratinocytes. We found that similarities exist between primary human nonconfluent cultures and keratinocytes wounded in vitro. We report that a coordinate increase of both COX-2 and sPLA2 protein expression occurs in nonconfluent keratinocyte cultures, indicating the importance of both enzymes in modulation of PGE2 production in human keratinocytes.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents. DMEM with high glucose, L-glutamine, and without sodium pyruvate, Hanks' buffered salt solution (HBSS), PBS, and fetal bovine serum (FBS) were obtained from BioWhittaker (Walkersvillle, MD). Sterile PBS, Taq DNA polymerase, TRIzol reagent, RNase H, penicillin, and streptomycin were purchased from GIBCO BRL (Gaithersburg, MD). Collagen (Vitrogen 100) from Collagen (Palo Alto, CA) was used at 1:6 dilution with 1× PBS to coat tissue culture plates (Falcon). Fatty acid-free BSA was obtained from Calbiochem (San Diego, CA). Hexane and glycerol were obtained from EM Science (Gibbstown, NJ). AA was purchased from Nu-Chek Prep (Elysian, MN). Random hexanucleotides mixture, AMV reverse transcriptase, protease inhibitors, Pefabloc SC, and leupeptin were obtained from Boehringer Mannheim (Indianapolis, IN). Reagents for protein assays and SDS-PAGE were purchased from Bio-Rad (Hercules, CA). PGE2 ELISA reagents and deuterated fatty acids were from Cayman Chemicals (Ann Arbor, MI). Pentafluorobenzyl bromide was obtained from Pierce (Rockford, IL). Gas chromatography-HPLC grade methanol and methylene chloride were purchased from Mallinckrodt Chemical (Paris, KY). Tetramethylammonium hydroxide, N,N-dimethyl-acetamide (DMA), aprotinin, pepstatin A, soybean trypsin inhibitor, and most other chemicals were obtained from Sigma (St. Louis, MO) and were of highest commercial grade available. The human embryonic kidney (HEK-293) cell lines overexpressing type IIA (RAS2FB) and type V (H101D) sPLA2s were kind gifts from Jay A. Tischfield and Michelle V. Winstead (Indiana University).

Isolation of primary human keratinocyte and cell cultures. Primary adult human keratinocyte cultures were prepared from human epidermis removed during reductive mammoplasties and panniculectomies, as previously described (58). Cells were plated onto collagen-coated tissue culture dishes at a density of 7.5 × 105 cells/cm2 (confluent) and 1.25 × 105 cell/cm2 (nonconfluent) and maintained in DMEM containing 5% FBS, 1.4 mM calcium chloride, penicillin (100 IU/ml), streptomycin (100 mg/ml), and 25 mM HEPES buffer, pH 7.4 (growth medium) in 95% air-5% CO2 at 37°C for 6 days. Nonpassaged cells were used in experiments when confluent cultures were 2 days postconfluence and nonconfluent cultures were at 15-30% cell density by visual inspection. HaCaTs, a spontaneously immortalized human keratinocyte cell line (10), was grown under the same conditions, but on uncoated plastic. RAS2FB and H101D cells were plated on uncoated dishes in growth medium containing 10% FBS and 200 µg/ml hygromycin B (GIBCO BRL) and maintained under the same conditions as keratinocytes.

Wounding of primary keratinocyte cultures. Confluent cultures grown on six-well plates were thoroughly washed and then scraped with the tip of a sterile glass rod; four wounds (2 × 30 mm) were made over a 96-mm2 surface area. The cells were washed twice with medium to remove debris, and supernatants from wounded and nonwounded cultures were taken at indicated times for PGE2 analysis.

PGE2 measurements and determination of COX activity. Confluent and nonconfluent cultures were thoroughly washed with prewarmed medium before the incubation period. At indicated times, cultures were put on ice to stop reaction and supernatants were removed, centrifuged at 1,000 g at 4°C to pellet cellular debris, and stored at -20°C until PGE2 determinations were performed. On thawing, the levels of PGE2 in supernatants were determined by ELISA using specific anti-PGE2 monoclonal antibody; the limit of detection was 30 pg/ml. COX activity was determined by incubating cultures at 37°C for 15 min with exogenous 30 µM AA, prepared in prewarmed, serum-free DMEM, before removal of supernatants for PGE2 determination (22).

Basal fatty acid release: derivatization and measurement of fatty acids by gas chromatography-mass spectrometry. Confluent and nonconfluent keratinocytes grown in six-well plates were washed three times with HBSS, pH 7.4, containing penicillin, streptomycin, and HEPES in the same concentrations as used in growth medium, together with 0.01% fatty acid-free BSA and incubated in 1 ml HBSS solution for 10 min at 37°C to remove endogenous free fatty acids. Cultures were then incubated with fresh HBSS for 30-60 min. Aliquots of supernatants were taken from triplicate cultures for each condition and pooled. Deuterated D8 AA and D4 linoleic acid (LA) were added to each pooled sample as internal standards. Cell cultures were washed thoroughly with ice-cold PBS and scraped into Eppendorf tubes for protein analysis. Pooled supernatants were acidified to ~pH 3.0 with 1 N HCl and applied to conditioned Baker Bond Spec octadecyl C18 columns (J. T. Baker). The columns were then washed with H2O, followed by a 10% methanol wash. Samples were eluted in 100% methanol, evaporated to dryness, then derivatized using pentafluorobenzyl esterification. This procedure is a modification of one used previously (57). Briefly, the samples were treated with 50 µl tetramethylammonium hydroxide in DMA/methanol solution and 100 µl of a 35% pentafluorobenzyl bromide in DMA for 15 min at room temperature. The reactions were evaporated to dryness and washed twice with H2O/methylene chloride (1:4) and resuspended in hexane. The samples were then evaluated by gas chromatography/mass spectrometry using an HP-1 (cross-linked methyl silicone) column. Monitoring was in the negative ion mode for the fatty acid of interest. Mass spectrometric measurements of free fatty acid were not subjected to the problems of distribution or metabolism of label that occur with prelabeling of cellular lipids, and therefore reflect total released product. These products were normalized to the estimated protein amount present in each culture condition through the use of the Bio-Rad Dc Protein Assay method using known BSA standards.

Western blot analysis of cPLA2, sPLA2, COX-1, and COX-2. Confluent and nonconfluent cultures of human primary keratinocytes grown in 100-mm petri dishes were cooled at 4°C for 10 min and rinsed twice with ice-cold PBS containing the following protease and phosphatase inhibitors: 5 µg/ml leupeptin, 1 µg/ml pepstatin A, 50 µg/ml soybean trypsin inhibitor, 1 mM Pefabloc SC, and 50 µM each of sodium orthovanadate, sodium fluoride, and sodium phosphate. Gel loading buffer (1 × GLB) containing 50 mM Tris · HCl, pH 6.8, 2% SDS, 10% glycerol, and the above-mentioned inhibitors was then added to each culture dish and incubated on ice for 20 min with rocking. Cells were scraped in Eppendorf tubes, sonicated, and centrifuged at 10,000 g for 10 min at 4°C to remove particulates. The soluble portion (total cell lysate) was isolated and stored at -20°C until further assessment. Supernatants from confluent and nonconfluent cultures were collected after 24 h of incubation in fresh medium and centrifuged at 4°C for 5 min at 1,000 g to remove cellular debris. Supernatants were then concentrated by ultrafiltration using Centriprep concentrators (Amicon) and diluted with 3× GLB containing protease and phosphatase inhibitors and stored at -20°C. Protein amounts were estimated as previously mentioned. Equivalent protein amounts of cell lysates and supernatants were electrophoresed on 8% SDS-PAGE gels (15% for sPLA2 detection) and transferred to nitrocellulose membranes (Amersham). The membranes were then blocked overnight at 4°C with 5% nonfat dry milk in Tris-buffered saline (TBS). For Western blotting, recommended manufacturer's procedures for using human anti-cPLA2 antibodies (Santa Cruz) were followed with these alterations. For cPLA2 detection, membranes were incubated with human anti-cPLA2 antibody (1:75) followed by an incubation with rabbit anti-mouse IgG:horseradish peroxidase (Dako) at 1:1,000 dilution. To detect sPLA2, membranes were incubated with human anti-sPLA2 (1:1,000, Cayman) and then treated with goat anti-rabbit IgG:horseradish peroxidase (1:1,000). To detect COX-1 and COX-2, membranes were incubated with human anti-COX-1 (1:100; Oxford) or anti-COX-2 (1:1,000, Oxford); both blots were then treated with protein A-horseradish peroxidase (1:2,000; Amersham). Visualization of proteins was done by enhanced chemiluminescence (Amersham).

Isolation of RNA and detection of type IIA sPLA2, type V sPLA2, and M-type sPLA2 receptor by RT-PCR. Total RNA from RAS2FB, H101D, HaCaT cell cultures, and primary keratinocytes at both nonconfluent and confluent growth densities was isolated using TRIzol reagent (GIBCO BRL) following the manufacturer's protocols with two additional phenol:chloroform (1:1) extractions added before isopropanol precipitation. First-strand RT was performed using ~1 µg of RNA, random hexanucleotide mixture, and AMV reverse transcriptase (Boehringer Mannheim) according to the instructions of the supplier. After the RT reactions, the samples were RNase-treated using 1 unit RNase H (GIBCO BRL) per reaction at 37°C for 20 min; cDNA products were stored at -20°C until used in PCR reactions. For identification of type IIA and type V sPLA2, two rounds of PCR amplification were performed for 30 and 25 cycles, respectively, in a 50-µl reaction containing 1.5 mM MgCl2, 200 µM dNTPs, 20 mM Tris · HCl (pH 8.4), 50 mM KCl, 2.5 units Taq polymerase, and 4 µl of cDNA product. First round PCR products were diluted 1:1,000 before second round amplification reactions. For type IIA sPLA2, the first round forward and reverse primers were 5' GGCCGGGGCAGAAGTTGAGAC 3' and 5' AGGGTAGGGAGGGAGGGTATGAGAG 3'. The conditions used for this PCR reaction were as follows: 94°C for 1 min, 56°C for 1 min, and 72°C for 1 min with an additional 5 min at 72°C after final cycle. Type IIA sPLA2 nested, second round forward and reverse primers were 5' CTTACCATGAAGACCCTCCTACTGTTGGCA 3' and 5'GAGGGGACTCAGCAACGAGGGGTGCT3' and PCR reaction conditions were 94°C for 1 min, 56°C for 20 s, and 72°C for 30 s with an additional 5 min at 72°C after final cycle. For type V sPLA2, the first round forward and reverse primers were 5'CCAGAGATGAAAGGCCTCCTCCCACTGGGCTTG3' and 5'GAGGCCTAGGAGCAGAGGATGTTGGGAA3', and the reaction conditions used were identical to the first round type IIA PCR reactions. Type V sPLA2 nested, second round forward and reverse primers were 5'GTTCCTGGCTTGTAGTGTGC3' and 5'GGATGTTGGGA- AAGTATTGG3'. The conditions were the same as those used for nested type IIA sPLA2 primers except that the annealing temperature was lowered to 47°C. To identify the M-type sPLA2 receptor in human keratinocytes, primers identical to those used to identify the sPLA2 receptor in human gestational tissues were used (45), with some modifications to the published PCR reaction conditions. Briefly, PCR amplifications in the same reaction mixture as mentioned above were done using the following conditions: 95°C for 1 min, 65°C for 1 min, and 72°C for 1 min with an additional 5 min at 72°C after final cycle. PCR products were resolved by 1.5% agarose gel electrophoresis and visualized with Gel Star (FMC BioProducts, Rockland, ME). PCR products were then subjected to restriction analysis to partially confirm their identity. Major and minor PCR product bands were excised from gels and purified using a Qiaex II agarose gel extraction kit (Qiagen) before sequencing, which was performed by the Nucleic Acid Core Facility at the University of Rochester. Sequences of PCR products from keratinocyte and overexpressing cell lines were compared with published sequences for human type IIA SPLA2 (65), type V sPLA2 (12), or M-type sPLA2 receptor (1).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Transient increase in PGE2 levels in wound closure in vitro. As previously reported, PGE2 production in human primary keratinocytes is modulated by their density in cell culture (58). Cells grown at low densities (15-30% confluence) produced 27-fold more PGE2 than in 2-day postconfluent cultures (4.46 ± 1.64 vs. 0.164 ± 0.108 ng · ml-1 · 24 h-1; mean ± SD; n = 3). Elevated PGE2 production was also observed in in vitro wound closure experiments (Fig. 1). After wounding confluent monolayers, dramatic changes in PGE2 levels were observed in wounded cultures compared with unwounded confluent cultures. The rise in PGE2 levels was rapid yet transient. A significant increase in PGE2 accumulation within the 1st h after wounding was observed. PGE2 levels were highest at 10 h after wounding and then gradually decreased as the wound edge closed. No keratinocyte growth into the wounded area was visually observed until 2-3 h after wounding. Although actual PGE2 levels and degree of wound closure at 48 h varied between individual cell preparations (n = 3), the pattern and time course of PGE2 production after wounding was almost identical in each experiment.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Time course of PGE2 production after wounding confluent keratinocyte cultures. Confluent cells were wounded as described in METHODS. At indicated intervals, supernatants were removed for analysis of PGE2 levels by ELISA. Values are means ± SD of cumulative PGE2 production. These results are representative of 3 identical experiments using keratinocyte preparations from 3 different individuals.

Morphology of human primary keratinocytes grown at low densities is similar to that of activated keratinocyte on wounding edge. In morphological studies of full-thickness injury to the skin, it was observed that keratinocytes at the wound edge undergo phenotypic changes during the initial phase of wound healing (13, 52). Migrating keratinocytes, particularly those originating from the early-differentiating compartment of wounded epidermis, are reported to adopt a polarized, elongated appearance, with some cells having ruffled edges and cytoplasmic processes. We observed similar morphological changes in keratinocytes on the wound edge in wounding experiments in vitro (data not shown). Primary human keratinocyte cultures grown at confluent and nonconfluent densities exhibit morphological differences similar to unaffected and activated keratinocytes in a wound, respectively. Keratinocytes at 2 days postconfluence are polygonal in shape, with cytoplasms appearing full of dense, filamentous material (Fig. 2A). In contrast, nonconfluent cultures (15-30% confluent; Fig. 2B) grow clonally with small central areas of stratified cells and outer edges of flattened, elongated cells. These outer cells have ruffled edges and the occasional pseudopodia indicative of motility, which was confirmed by time-lapse videomicroscopy. Long processes similar in appearance to dendrites are a distinct feature of keratinocytes grown in nonconfluent cultures. We have found that the presence of these processes and the flattened, elongated morphology of keratinocytes appears concurrently with increased PGE2 production in nonconfluent cultures. Rhodamine phalloidin immunohistochemical staining of nonconfluent cells showed dense staining for actin within these processes (data not shown). Because other epidermal cell types that form dendritic-like processes (melanocytes and Langerhans cells) are present in small amounts in primary keratinocyte cultures, we costained with melanocyte and Langerhans cell markers (Mel-5 and MHC class II antigen, respectively). We found no correlation between these markers and the processes of interest (data not shown), thus we concluded that these processes are keratinocyte-derived.


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 2.   Morphology of confluent (A) and nonconfluent (B) human primary keratinocytes. A: phase-contrast photographs of 2-day postconfluent human primary keratinocytes grown in culture for 6 days are polygonal, dense, and granular in appearance. B: nonconfluent (15-30% confluent) primary keratinocytes grown under same conditions form epithelial islands of cells connected together by intercellular processes.

Increase in COX activity in nonconfluent human primary keratinocyte cultures. First, we examined whether COX activity was altered in nonconfluent cultures. In Fig. 3, it is shown that nonconfluent keratinocyte cultures synthesized ~25-fold greater basal concentrations of PGE2 than confluent cultures (4.28 ± 0.45 vs. 0.171 ± 0.040 ng · ml-1 · 15 min-1; mean ± SD). However, this 25-fold difference in basal PGE2 synthesis between confluent and nonconfluent keratinocytes could reflect limiting substrate due to differences in phospholipase and/or COX activity. To determine whether the increased production of PGE2 was dependent on increased COX activity, saturating levels of exogenous AA (30 µM) were added at the beginning of the incubation. It was found that nonconfluent keratinocytes still produced ~12-fold greater PGE2 than confluent keratinocytes (Fig. 3; 18.43 ± .77 vs. 1.59 ng · ml-1 · 15 min-1; mean ± SD). These results demonstrated that nonconfluent keratinocytes exhibit markedly increased COX activity when compared with confluent cultures.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3.   Effect on cyclooxygenase (COX) activity by exogenously added arachidonic acid (AA). Confluent and nonconfluent keratinocyte cultures were pulsed with saturating levels of AA (30 µM) or vehicle control (basal) for 15 min. Reactions were then stopped by rapid cooling and removal of supernatants. Aliquots of supernatants were taken for PGE2 analysis. Values reported are means ± SD of the following identical experiments: basal confluent (n = 9); basal nonconfluent (n = 4); AA-stimulated confluent (n = 6); and AA-stimulated nonconfluent (n = 2).

Increased expression of COX-2 protein levels in nonconfluent human primary keratinocyte cultures. We then examined whether the increased COX activity was due to increased expression of COX-2 and/or COX-1 isoforms. In Western blotting of total cellular lysates prepared from paired nonconfluent and confluent primary keratinocyte cultures, COX-1 protein levels were detected in both confluent and nonconfluent culture conditions. It is interesting that COX-1 protein levels varied between individual skin preparations, with some having undetectable levels (Fig. 4A) and others having substantially higher levels. In the latter case, we observed a modest increase in COX-1 levels in nonconfluent conditions (Fig. 4B). In all individual skin samples examined, a substantial amount of COX-2 protein was detected only in nonconfluent conditions (Fig. 4). No COX-2 protein was detected in any confluent cultures. These results indicate a distinct induction of COX-2 protein expression in nonconfluent culture conditions, with some variability in COX-1 protein levels between individuals.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4.   Expression of COX-1 and COX-2 protein levels in confluent and nonconfluent cultures. Equivalent amounts of total cell lysates from confluent and nonconfluent cultures were subjected to SDS-PAGE electrophoresis, transferred to nitrocellulose, and probed with antibody of interest as described in METHODS. Western blot analysis was performed on at least 8 different individual skin samples with identical results for COX-2 protein and variable results for COX-1. Representative results from 2 different individuals are shown.

Increase in fatty acid release in nonconfluent human primary keratinocyte cultures. The availability of substrate is another rate-limiting step in eicosanoid biosynthesis. Because both AA and LA are substrates in this pathway, we measured the basal levels of these fatty acids released from nonconfluent and confluent cultures over a 30-min incubation period by gas chromatography-mass spectrometry (Table 1). Accumulation of free fatty acids in cell supernatants was maximal at 30 min, after which it was at equilibrium with fatty acid reuptake (data not shown). There was tremendous inter-individual variability in absolute concentrations of free fatty acids monitored in each experiment. However, the ratio of nonconfluent-to-confluent (NC/C) fatty acid release clearly showed that basal AA and LA levels were higher in nonconfluent cultures compared with confluent cultures with mean values of 9.7 ± 7.6 and 6.8 ± 3.6 for AA and LA, respectively. Most experiments showed that AA was the prevalent fatty acid released; although in one case (expt 3), the levels of LA were higher in both growth conditions. Thus these data suggest that a non-substrate-specific phospholipase activity commonly associated with sPLA2 is likely to be involved in the increased fatty acid release in nonconfluent cultures.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Free fatty acid release (ng · mg protein-1 · 30 min-1)

Increased expression of sPLA2 but not cPLA2 protein levels in nonconfluent human primary keratinocyte cultures. Because AA is the predominant fatty acid released, we examined whether increased cPLA2 protein expression contributed to increased fatty acid release in nonconfluent cultures. We performed Western blot analysis on total cellular homogenates of both confluent and nonconfluent keratinocytes to examine cPLA2 expression (Fig. 5). The levels of cPLA2 in both conditions were very low but clearly detectable. Nonconfluent keratinocytes showed no increase in total cellular cPLA2 protein compared with confluent keratinocytes, suggesting that the increase in free AA release was not due to upregulation of cPLA2 expression. In contrast, there was a dramatic increase in sPLA2 expression in total cellular homogenates from nonconfluent cultures compared with confluent cultures. Identical results were seen in supernatants, although the levels of sPLA2 protein detected in supernatants were much lower. It should be noted that the sPLA2 antibodies used in these studies can detect both type IIA sPLA2 and type V sPLA2; therefore, we cannot conclude which sPLA2 subtypes were upregulated from this experiment.


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5.   Expression of cytosolic phospholipase A2 (cPLA2) and secretory PLA2 (sPLA2) in total cell lysates and supernatants obtained from confluent and nonconfluent conditions. Total cell lysates and supernatants were prepared from confluent and nonconfluent cultures as discussed in METHODS. For detection of cell-associated cPLA2 and sPLA2, equivalent amounts of total cell lysates were subjected to SDS-PAGE, transferred to nitrocellulose, and probed with antibody of interest. For detecting sPLA2 in supernatants, equal volumes of concentrated supernatants were used. Details are given in METHODS.

Identification of type IIA and type V sPLA2 subtypes in human primary keratinocyte cultures by RT-PCR. With recent reevaluation of the role of sPLA2 subtypes in AA metabolism, we found it important to assess which of these sPLA2s were present in human keratinocytes. We used RT-PCR to detect the presence of both type IIA and V sPLA2 transcripts in nonconfluent and confluent human primary keratinocyte cultures (Fig. 6). RNA from two HEK-293 cell lines, RAS2FB and H101D, which overexpress type IIA sPLA2 and type V sPLA2, respectively, were included as positive controls. Low abundance of message necessitated two rounds of PCR with nested primers to detect products in keratinocytes. Major bands corresponding to the predicted sizes (448 bp for type IIA sPLA2 and 380 bp for type V sPLA2) were detected in nonconfluent and confluent conditions, as well as in the appropriate overexpressing cell line (Fig. 6, A and B). Another band, designated the minor product band (~280 bp), was also observed in type V sPLA2 RT-PCR analysis. This additional band appeared in both nonconfluent and confluent keratinocyte conditions but not in overexpressing cell line. Sequencing analysis for type IIA sPLA2 PCR product showed that the product obtained from both nonconfluent and confluent conditions are identical to the published type IIA sPLA2 cDNA sequence (65). Sequencing analysis of the type V sPLA2 PCR products showed that the major PCR product (380 bp) in nonconfluent and confluent conditions are identical to the published type V sPLA2 cDNA sequence (12). The minor PCR product (~280 bp) present in nonconfluent and confluent conditions also shared 98 and 99% homology with the published sequence and with the 380-bp product, except that it was missing bases 316-422, which encompass the 5' end of exon III as reported by Chen et al. (12).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 6.   Expression of type IIA (A) and type V sPLA2 (B) in human nonconfluent and confluent primary cultures as detected by RT-PCR. One microgram of total RNA obtained from confluent and nonconfluent human primary keratinocyte cultures was used for each RT-PCR reaction. As positive controls, amplifications were performed using 1 µg of total RNA from 2 HEK-293 cell lines, RAS2FB and H101D, which overexpressed type IIA sPLA2 and type V sPLA2, respectively. RT-PCR was performed as described in METHODS. Amplifications using no template and RT reactions using all RNA conditions without RT (data not shown) were included as negative controls. Fragment sizes of ~449 and ~280 bp (major PCR product) obtained were consistent with predicted sizes of type IIA sPLA2 (A) and type V sPLA2 (B) cDNA fragments. An additional fragment at ~380 bp (minor PCR product) was detected in type V sPLA2 (B) amplifications. Confirmation of identity of these fragments was done by sequencing as described in METHODS and discussed in text.

Identification of M-type sPLA2 receptor in human primary keratinocyte cultures by RT-PCR. Because the M-type sPLA2 receptor also may play a role in mediating AA metabolism and other physiological responses such as proliferation and migration, we sought to establish whether this receptor type was present in human epidermis. Using primers that identified the presence of sPLA2 receptor in human gestational tissues (45), we performed RT-PCR on RNA obtained from nonconfluent and confluent keratinocytes, as described in METHODS, through the use of the appropriate negative controls. A band corresponding to the predicted size of 399 bp was detected in both nonconfluent and confluent conditions (Fig. 7). The PCR product from confluent keratinocyte conditions was sequenced and found to share 99% homology with the reported human M-type SPLA2 receptor sequence (1). In both HEK-overexpressing cell lines, no PCR product was detected (data not shown). However, a PCR product of the same size was observed in RT-PCR reactions using RNA from HaCaT cultures (data not shown), suggesting that the sPLA2 receptor is keratinocyte-associated.


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 7.   Expression of M-type sPLA2 receptor in human nonconfluent and confluent primary cultures as assessed by RT-PCR. Identical amounts of total RNA and negative controls as mentioned in Fig. 6 were used. Fragment size of ~399 bp detected was consistent with predicted size of type M-sPLA2 receptor cDNA fragments. Confirmation of identify of this fragment was also done by sequencing.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Physical separation of keratinocytes from normal skin and transfer to tissue culture constitutes an activation, or wound signal for keratinocytes (23). In subconfluent cultures, keratinocytes tend to grow in colonies and require cell migration to sustain clonal growth (6). On reaching confluence, the activated phenotype is lost and the cells begin to stratify and express various markers of keratinocyte differentiation (59). In previous studies, we have shown an inverse relationship between the level of basal PGE2 production and state of confluence in human primary keratinocyte cultures (55, 58). In this study, we observed a similar pattern of PGE2 synthesis in an in vitro wound model (Fig. 1). After the wounding of confluent cultures, PGE2 levels increased rapidly but transiently; as the wound closed and confluence was restored, the levels of PGE2 declined. Although there was some sample variability in the actual levels of PGE2 measured and in extent of wound closure by 48 h, the time course of change in PGE2 levels remained consistent (n = 3). This result was indicative of distinct modulation of the enzymes involved in PGE2 synthesis after in vitro wounding, and validated the use of the nonconfluent culture system as an injury model.

Keratinocytes grown at nonconfluent densities (15-30% confluent) adopt a distinct morphology (Fig. 2). The phenotypes of keratinocytes grown at low densities and in wounds in vitro and in vivo (52) are all strikingly similar. Moreover, these morphological similarities concur with increased PGE2 synthesis observed in nonconfluent cultures and in in vitro wounding as reported in this study and in in vivo wounds (39). Thus we consider the small clonal island of keratinocytes found in nonconfluent cultures to be akin to a 360° wound with outer cells analogous to the wound edge. We postulated that nonconfluent cultures are a good model in which to examine the modulation of enzymes involved in increased PGE2 biosynthesis in activated keratinocytes.

PGE2 biosynthesis in intact cells is modulated by the level of COX proteins present, the amount of substrate available, and the level of phospholipases present. In this study, we found that in nonconfluent keratinocyte cultures, COX-2 protein expression together with nonspecific fatty acid release and sPLA2 protein expression was increased and is most likely responsible for the increase in PGE2 production in this culture condition. First, we established that nonconfluent cultures exhibit increased COX activity compared with confluent cultures (Fig. 3). The addition of saturating levels of exogenous AA (30 µM) is a direct way of assessing COX activity in intact cells. Here, we observed that COX activity in nonconfluent cultures was still considerably higher, suggesting that COX protein levels are elevated in nonconfluent cultures. It was shown by Western blot analysis that COX-2 protein expression was induced in only nonconfluent cultures, whereas there was often little to no change in COX-1 expression between the two culture conditions. Similar results were observed in mouse epidermis after in vivo mechanical injury (64), in which the induction of COX-2 expression was time dependent. Also, regulation of COX-2 gene expression, at the transcriptional (71) and posttranscriptional levels (20, 63), can influence the COX-2 protein expression; however, these regulatory pathways have not been well examined in human keratinocytes.

The fact that the level of COX-1 expression varied between individuals was of interest because it may be related to the level of COX-2 induction. This observation was consistent with a recent report examining the compensatory PGE2 biosynthesis in lung fibroblast cells from COX-1- or COX-2-deficient mice in which the expression of remaining functional COX gene was upregulated to compensate for the lack of the other isoform (30). Therefore, additional studies of the difference in the ratio of COX-1 to inducible COX-2 between individuals are required to assess its role in individual variability in wound healing.

Second, we found that basal AA release was elevated in nonconfluent cultures compared with confluent conditions (Table 1). Thus there is more substrate available for COX enzyme metabolism in nonconfluent conditions. The finding that basal LA levels are also higher in nonconfluent cultures indicated that nonsubstrate-specific PLA2 activity is elevated in nonconfluent keratinocyte cultures. Although increased LA release has little influence on PGE2 biosynthesis in nonconfluent cultures, LA plays a direct role for establishment and maintenance of the epidermal permeability barrier (17). In addition, a 15-lipoxygenase product of LA, 13-hydroxyoctadecadienoic acid, has a potentiating effect on epidermal growth factor-dependent mitogenesis in rodent fibroblasts (18). Also, 12-hydroxyeicosatetraenoic acid, a 12-lipoxygenase product of AA, has stimulatory effects including activation of protein kinase C and cell motility in tumor cells (26, 40). Together, these reports suggest that linoleic and arachidonic lipoxygenase metabolites may also be important in the migration and/or proliferation of keratinocytes during wound healing.

In an examination of cPLA2 and sPLA2 protein expression in confluent and nonconfluent keratinocyte cultures, we found that cPLA2 levels, although low, were unchanged. In contrast, there was an increase in sPLA2 (type IIA and/or type V) protein levels in nonconfluent conditions. We observed that most of the sPLA2 protein was cell-associated rather than secreted, although a small amount was detected in supernatants from nonconfluent conditions. This is consistent with other reports in which membrane-associated sPLA2 was the predominant form in other cell types (49, 66). Therefore, upregulation of sPLA2 protein expression in coordination with induction of COX-2 expression appears to be the dominant pathway by which keratinocytes increase PGE2 production in nonconfluent cultures.

Despite the clear coordinate induction of sPLA2 and COX-2, increased activation of cPLA2 may also contribute to elevated AA release. Studies in human astrocytes (24) and rat mesangial cells (27) show that type IIA-sPLA2 caused posttranslational modification of cPLA2, probably through either a sPLA2 receptor-mediated process (24) or production of lipid metabolites (27). Finally, indirect production of AA by phospholipase C and/or D pathways may also be involved because both phospholipases are present in human keratinocytes and are activated by UV damage (11). However, AA release studies using bovine endothelial cells found no changes in phospholipase C activity from the progression of cells from the nonconfluent to confluent state (70).

Andersen et al. (2) reported that a nonpancreatic type II sPLA2 mRNA transcript and protein is present in human epidermis, with low amounts found in normal epidermis and increased levels in involved skin from patients with psoriasis. Recently, Li-Stiles et al. (36) identified a type IIA sPLA2 in mouse keratinocytes by RT-PCR, but the presence of type V sPLA2 was not evaluated. We found that both type IIA and type V sPLA2 messages were expressed in human keratinocytes. Expression of both sPLA2 transcripts appeared to be very low. Given the low abundance of messages, a more quantitative measure of differences in mRNA expression levels by Northern blot analysis was not attempted. Reports indicated that it is type V sPLA2, not type IIA sPLA2, that is involved in the AA mobilization and PGE2 production triggered by inflammatory stimuli (4, 62). To determine whether one of these sPLA2s is selectively responsible for increased fatty acid release observed in nonconfluent culture conditions is currently being investigated. Recently, Murakami et al. (50) demonstrated that these sPLA2s are functionally redundant in terms of AA release and membrane binding using overexpressing cell lines. Therefore, specific preference for different fatty acid pools, the localization of action, and modes of regulation involved may be the important determinants for distinguishing the function of various sPLA2s expressed in a cell or tissue. This needs to be further elucidated by using in vivo models.

We also identified that message for an M-type sPLA2 receptor was expressed in both nonconfluent and confluent primary keratinocyte cultures. The presence of the sPLA2 receptor may be of particular importance to the mechanism of keratinocyte activation because the receptor has been shown to mediate cell proliferation and chemotactic cell migration, as well as endotoxic shock and eicosanoid biosynthesis in other cell types (24, 48, 53, 66). The 180-kDa M-type sPLA2 receptor, originally identified in rabbit skeletal muscle (35), has been cloned and characterized from many sources (1, 25). Previously, human sPLA2 receptor has been found to be expressed in kidney, placenta, pancreas, lung, and skeletal muscle. However, a high-affinity ligand for the human receptor has not yet been identified; binding studies using recombinantly expressed human type IB and type IIA sPLA2 have shown only low-affinity binding for a cloned human sPLA2 receptor (15). Binding properties for type V and type X sPLA2s have yet to be reported. Studies showing rapid internalization of sPLA2 on binding to its receptor suggest a possible regulatory role of the sPLA2 receptor in the clearance of sPLA2 from the extracellular environment (73). In addition, sPLA2 receptor may mediate cross talk between different PLA2s. For example, several studies found that exogenous addition of a type I sPLA2 induced production and secretion of type IIA sPLA2 on receptor binding and, in turn, increased PGE2 production in rat mesangial cells (31, 47). Another study showed activation of a mitogen-activated protein kinase cascade and cPLA2 on addition of type IIA sPLA2 (24). The role of the sPLA2 receptor in keratinocytes remains to be elucidated.

Several groups have reported that a functional coupling between sPLA2 and COX-2 was responsible for the delayed, sustained prostaglandin synthesis on agonist stimulation in several cell types (5, 9, 34, 49, 51, 66). The time course of PGE2 production shown in our in vitro wounding experiments was strikingly similar to the time courses shown in the above-mentioned studies, indicating that functional coupling between COXs and PLA2 may also occur during in vitro wounding. In human keratinocytes grown at nonconfluent cell densities, our results suggested that sPLA2 and COX-2 are functionally coupled because both sPLA2 and COX-2 protein expression were coinduced under these conditions. It is not clear what mediates the coordinated induction of sPLA2 and COX-2 protein expression and what continually maintains their expression in nonconfluent cultures. Keratinocytes in nonconfluent conditions may be responding to the lack of neighboring cells and/or the mechanical stress induced by motility (54). Mechanical stress has been shown to cause the upregulation of genes, including COX-2 in human vascular endothelial cells (69).

In conclusion, nonconfluent primary keratinocyte cultures are a good model for studying keratinocyte activation because they appear to mimic functional and morphological characteristics observed during wound healing. Increased production of fatty acids and prostaglandins in nonconfluent keratinocytes appears to involve the coordinate induction of sPLA2s and COX-2 expression. With our identification of type V sPLA2 and an M-type sPLA2 receptor, another level of complexity must be considered. In doing so, we hope to further understand the mechanisms that regulate fatty acid metabolism during keratinocyte activation and in turn, affect the proliferation and migration of keratinocytes necessary for wound healing.


    ACKNOWLEDGEMENTS

We thank Jay A. Tischfield and Michelle V. Winstead for their kind gift of sPLA2 overexpressing cell lines and primer recommendations.


    FOOTNOTES

This work was supported by National Institutes of Health (NIH) Grant RO1AR-40574. K. E. Rys-Sikora is supported by NIH Individual National Research Service Award Grant ARO85020. R. L. Konger is a Wilmont Cancer Research Fellow.

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: A. P. Pentland, Dept. of Dermatology, Univ. of Rochester Medical Center, Box 697, 601 Elmwood Ave., Rochester, NY 14642 (E-mail: Alice_Pentland{at}urmc.rochester.edu).

Received 15 July 1999; accepted in final form 1 November 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Ancian, P, Lambeau G, Mattei M-G, and Lazdunski M. The human 180-kDa receptor for secretory phospholipase A2. J Biol Chem 270: 8963-8970, 1995[Abstract/Free Full Text].

2.   Andersen, S, Sjursen W, Lægreid A, Volden G, and Johansen B. Elevated expression of human nonpancreatic phospholipase A2 in psoriatic tisssue. Inflammation 18: 1-12, 1994[ISI][Medline].

3.   Ashrah, M, Murakami M, Shimbara S, Amakasu Y, Atsumi GI, and Kudo I. Type II phospholipase A2 is linked to cyclooxygenase-2-mediated delayed prostaglandin D2 generated by cultured mouse mast cells following FCepsilon RI-and cytokine-dependent activation. Biochem Biophys Res Commun 229: 726-732, 1996[ISI][Medline].

4.   Balboa, MA, Balsinde J, Winstead MV, Tischfield JA, and Dennis EA. Novel group V phospholipase A2 involved in arachidonic acid mobilizattion in murine P388D1 macrophages. J Biol Chem 271: 32281-32384, 1996[Abstract/Free Full Text].

5.   Balsinde, J, Balboa MA, and Dennis EA. Functional coupling between secretory phospholipase A2 and cyclooxygenase-2 and its regulation by cytosolic group IV phospholipase A2. Proc Natl Acad Sci USA 95: 7951-7956, 1998[Abstract/Free Full Text].

6.   Barrandon, Y, and Green H. Cell migration is essential for sustained growth of keratinocyte colonies: the roles of transforming growth factor-alpha and epidermal growth factor. Cell 50: 1131-1137, 1987[ISI][Medline].

7.   Bartel, RL, Marcelo CL, and Voorhees JJ. Partial characterization of phospholipase C activity in normal, psoriatic uninvolved and lesional epidermis. J Invest Dermatol 1987: 447-451, 1987.

8.   Bergers, M, Verhagen DR, Jongerius M, van de Kerkof PCM, and Mier PD. A unique phospholipase A2 in human epidermis: its physiological function and its level in certain dermatoses. J Invest Dermatol 90: 23-25, 1988[Abstract].

9.   Bingham, CO, III, Murakami M, Fujishima H, Hunt JE, Austen KF, and Arm JP. A heparin-sensitive phospholipase A2 and prostaglandin endoperoxide synthase-2 are functionally linked in the delayed phase of prostaglandin D2 generation in mouse bone marrow-derived mast cells. J Biol Chem 1998: 25936-25944, 1998.

10.   Boukamp, P, Petrussevska RT, Breitkreutz D, Hornung J, Markman A, and Fusenig NE. Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J Cell Biol 106: 761-771, 1988[Abstract].

11.   Carsberg, CJ, Ohanian J, and Friedmann PS. Ultraviolet radiation stimulates a biphasic pattern of 1,2-diacylglycerol formation in cultured human melanocytes and keratinocytes by activation of phospholipase C and D. Biochem J 305: 471-477, 1995[ISI][Medline].

12.   Chen, J, Engle SJ, Seilhammer JJ, and Tischfield JA. Cloning and recombinant expression of a novel human low molecular weight Ca2+-dependent phospholipase A2. J Biol Chem 269: 2365-2368, 1994[Abstract/Free Full Text].

13.   Coulombe, PA. Towards a molecular definition of keratinocyte activation after acute injury to stratified epithelia. Biochem Biophys Res Commun 236: 231-238, 1997[ISI][Medline].

14.   Cupillard, L, Koumanov K, Mattei M-G, Lazdunski M, and Lambeau G. Cloning, chromosomal mapping, and expression of a novel human secretory phospholipase A2. J Biol Chem 272: 15745-15752, 1997[Abstract/Free Full Text].

15.   Cupillard, L, Mulherkar R, Gomez N, Kadam S, Valentin E, Lazdunski M, and Lambeau G. Both group IB and group IIA secreted phospholipase A2 are natural ligands of the mouse 180-kDa M-type receptor. J Biol Chem 274: 7043-7051, 1999[Abstract/Free Full Text].

16.   Dennis, EA. The growing phospholipase A2 superfamily of signal transduction enzymes. Trends Biol Sci 22: 470-471, 1997.

17.   Elias, PM. The permeability barrier in essential fatty acid deficiency: evidence for a direct role for linoleic acid in barrier function. J Invest Dermatol 74: 230-233, 1980[Abstract].

18.   Eling, TE, Everhart AL, Angerman-Stewart J, Hui R, and Glasgow WC. Modulation of epidermal growth factor signal transduction by linoleic acid metabolites. In: Eicosanoids and Other Bioactive Lipids in Cancer Inflammation and Radiation Injury, edited by Honn KV, et al. New York: Plenum, 1997, p. 319-322.

19.   Ganz, T, and Weiss J. Antimicrobial peptides of phagocytes and epithelia. Semin Hematol 34: 343-354, 1997[ISI][Medline].

20.   Gou, Q, Lui CH, Ben-Av P, and Hla T. Dissociation of basal turnover and cytokine-induced transcript stabilization of the human cyclooxygenase-2 mRNA by mutagenesis of the 3'-untranslated region. Biochem Biophys Res Commun 242: 508-512, 1998[ISI][Medline].

21.   Grass, DS, Felkner RH, Chiang M-Y, Wallace RE, Nevalainen TJ, and Bennett CF. Expression of human group II PLA2 in transgenic mice results in epidermal hyperplasia in the absence of inflammatory infiltrate. J Clin Invest 97: 2233-2241, 1996[Abstract/Free Full Text].

22.   Gresham, A, Masferrer J, Chen X, Leal-Khouri S, and Pentland AP. Increased synthesis of high-molecular-weight cPLA2 mediates early UV-induced PGE2 in human skin. Am J Physiol Cell Physiol 270: C1037-C1050, 1996[Abstract/Free Full Text].

23.   Grinnell, F. Wound repair, keratinocyte activation and integrin modulation. J Cell Sci 101: 1-5, 1992[ISI][Medline].

24.   Hernandez, M, Burrillo SL, Crespo MS, and Nieto ML. Secretory phospholipase A2 activates the cascade of mitogen-activated protein kinases and cytosolic phopholipase A2 in the human astrocytoma cell line 1321N1. J Biol Chem 273: 606-612, 1998[Abstract/Free Full Text].

25.   Higashino, K, Ishizaki J, Kishino J, Ohara O, and Arita H. Structural comparison of phospholipase A2-binding regions in phospholipase A2 receptors from various mammals. Eur J Biochem 225: 375-382, 1994[Abstract].

26.   Honn, KV, Tang DG, Gao X, Butovich IA, Liu B, Timar J, and Hagmann W. 12-Lipoxgenases and 12(S)-HETE: role in cancer metastasis. Cancer Metastasis Rev 13: 365-396, 1994[ISI][Medline].

27.   Huwiler, A, Staudt G, Kramer RM, and Pfeilschifter J. Cross-talk between secretory phospholipase A2 and cytosolic phospholipase A2 in rat renal mesangial cells. Biochim Biophys Acta 1348: 257-272, 1997[ISI][Medline].

28.   Kang-Rotondo, CH, Miller CC, Morrison AR, and Pentland AP. Enhanced keratinocyte prostaglandin synthesis after UV injury is due to increased phospholipase activity. Am J Physiol Cell Physiol 264: C396-C401, 1993[Abstract/Free Full Text].

29.   Kast, R, Furstenberger G, and Marks F. Phorbol ester TPA- and bradykinin-induced arachidonic acid release from keratinocytes is catalyzed by a cytosolic phospholipase A2 (cPLA2). J Invest Dermatol 101: 567-572, 1993[Abstract].

30.   Kirtikara, K, Morham SG, Raghow R, Laulederkind SJF, Kanekura T, Goorha S, and Ballou LR. Compensatory prostaglandin E2 biosynthesis in cyclooxygenase 1 or 2 null cells. J Exp Med 187: 517-523, 1998[Abstract/Free Full Text].

31.   Kishino, J, Ohara O, Nomura K, Kramer R, and Arita H. Pancreatic-type phospholipase A2 induces group II phospholipase A2 expression and prostaglandin biosynthesis in rat mesangial cells. J Biol Chem 269: 5092-5098, 1994[Abstract/Free Full Text].

32.   Konger, RL, Malaviya R, and Pentland AP. Growth regulation of primary human keratinocytes by prostanglandin E receptor EP2 and EP3 subtypes. Biochim Biophys Acta 1401: 221-234, 1998[ISI][Medline].

33.   Kramer, RM, and Sharp JD. Structure, function and regulation of Ca2+-sensitive cytosolic phospholipase A2 (cPLA2). FEBS Lett 410: 49-53, 1997[ISI][Medline].

34.   Kuwata, H, Nakatani Y, Murakami M, and Kudo I. Cytosolic phospholipase A2 is required for the cytokine-induced expression of type IIA secretory phospholipase A2 that mediates optimal cyclooxygenases-2-dependent delayed prostaglandin E2 generation in rat 3Y1 fibroblasts. J Biol Chem 273: 1733-1740, 1998[Abstract/Free Full Text].

35.   Lambeau, G, Ancian P, Barhanin J, and Lazdunski M. Cloning and expression of a membrane receptor for secretory phospholipase A2. J Biol Chem 269: 1575-1578, 1994[Abstract/Free Full Text].

36.   Li-Stiles, B, Lo H-H, and Fischer SM. Identification and characterization of several forms of phospholipase A2 in mouse epidermal keratinocytes. J Lipid Res 39: 569-582, 1998[Abstract/Free Full Text].

37.   Lo, H-H, Teichmann P, Furstenberger G, Gimerez-Conti I, and Fischer SM. Suppression or elevation of cytosolic phospholipase A2 alters keratinocyte prostaglandin synthesis, growth and apoptosis. Cancer Res 58: 4624-4631, 1998[Abstract].

38.   Loftin, CD, and Eling TE. Prostaglandin synthase-2 expression in epidermal growth factor-dependent proliferation of mouse keratinocytes. Arch Biochem Biophys 330: 419-429, 1996[ISI][Medline].

39.   Lord, JT, Ziboh VA, Cagle WD, Kursunoglu S, and Redmond G. Prostaglandins in wound healing: possible regulation of granulation. In: Advances in Prostanglandins and Thromboxane Research, edited by Samuelsson B, Ramwell PW, and Paoletti R.. New York: Raven, 1980, p. 865-869.

40.   Lui, B, Maher RJ, De Jonckheere JP, Popat RU, Stojakovic S, Hannun YA, and Porter AT. 12(S)-HETE increases the motility of prostate tumor cells through selective activation of PKCalpha . In: Eicosanoids and Other Bioactive Lipids in Cancer, Inflammation, and Radiation Injury 2, edited by Honn KV.. New York: Plenum, 1997, p. 707-718.

41.   Mao-Qiang, M, Jain M, Feingold KR, and Elias PM. Secretory phospholipase A2 activity is required for permeability barrier homeostasis. J Invest Dermatol 106: 57-63, 1995[Abstract].

42.   Marks, F, Hanke B, Thastrup O, and Furstenberger G. Stimulatory effect of thapsigargin, a non-TPA-type tumor promoter, on arachidonic acid metabolism in the murine keratinocyte line HEL30 and on epidermal cell proliferation in vivo compared with the effects of phorbol ester TPA. Carcinogenesis 12: 1491-1497, 1991[Abstract].

43.   Martin, P. Wound healing-aiming for perfect skin regeneration. Science 276: 75-81, 1997[Abstract/Free Full Text].

44.   McCord, M, Chabot-Fletcher M, Breton J, and Marshall LA. Human keratinocytes possess an sn-2 acylhydrolase that is biochemically similar to the U937-derived 85-kDa phospholipase A2. J Invest Dermatol 102: 980-986, 1994[Abstract].

45.   Moses, EK, Freed KA, Brennecke SP, and Rice GE. Distribution of the phospholipase A2 receptor messenger RNA in human gestational tissues. Placenta 19: 35-40, 1998[ISI][Medline].

46.   Muller-Decker, K, Scholz K, Neufang G, Marks F, and Furstenberger G. Localization of prostagladin-H synthase-1 and -2 in mouse skin: implications for cutaneous function. Exp Cell Res 242: 84-91, 1998[ISI][Medline].

47.   Murakami, M, Kuwata H, Amakasu Y, Shimbara S, Nakatani Y, Atsumi G-I, and Kudo I. Prostaglandin E2 amplifies cytosolic phospholipase A2- and cyclooxygenase-2-dependent delayed prostaglandin E2 generation in mouse osteoblastic cells. J Biol Chem 272: 19891-19897, 1997[Abstract/Free Full Text].

48.   Murakami, M, Nakatani Y, Atsumi G, Inoue K, and Kudo I. Regulatory functions of phospholipase A2. Crit Rev Immunol 17: 225-283, 1997[ISI][Medline].

49.   Murakami, M, Nakatani Y, and Kudo I. Type II secretory phospholipase A2 associated with cell surfaces via C-terminal heparin-binding lysine residues augments stimulus-initiated delayed prostaglandin generation. J Biol Chem 271: 30041-30051, 1996[Abstract/Free Full Text].

50.   Murakami, M, Shimbara S, Kambe T, Kuwata H, Winstead MV, Tischfield JA, and Kudo I. The functions of five distinct mammalian phospholipase A2s in regulating arachidonic acid release. J Biol Chem 273: 14411-14423, 1998[Abstract/Free Full Text].

51.   Murakami, M, Tada K, Nakajima K, and Kudo I. Cyclooxygenase-2-dependent delayed prostaglandin D2 generation is initiated by nerve growth factor in rat peritoneal mast cells. J Immunol 159: 439-446, 1997[Abstract].

52.   Odland, G, and Ross R. Human wound repair: I. Epidermal regeneration. J Cell Biol 39: 135-151, 1968[Abstract/Free Full Text].

53.   Ohara, O, Ishizaki J, and Arita H. Structure and function of phospholipase A2 receptor. Prog Lipid Res 34: 117-138, 1995[ISI][Medline].

54.   Pelham, RJ, Jr, and Wang Y-L. High resolution detection of mechanical forces exerted by locomoting fibroblasts on the substrate. Mol Biol Cell 10: 935-945, 1999[Abstract/Free Full Text].

55.   Pentland, AP, George J, Moran C, and Needleman P. Cellular confluence determines injury-induced prostaglandin E2 synthesis by human keratinocyte cultures. Biochim Biophys Acta 919: 71-78, 1987[ISI][Medline].

56.   Pentland, AP, and Mahoney MG. Keratinocyte prostaglandin synthesis is enhanced by IL-1. J Invest Dermatol 94: 43-46, 1990[Abstract].

57.   Pentland, AP, Morrison AR, Jacobs SC, Hruza LL, Hebert JS, and Packer L. Tocopherol analogs suppress arachidonic acid metabolism via phospholipase inhibition. J Biol Chem 267: 15578-15584, 1992[Abstract/Free Full Text].

58.   Pentland, AP, and Needleman P. Modulation of keratinocyte proliferation in vitro by endogenous prostaglandin synthesis. J Clin Invest 77: 246-251, 1986[ISI][Medline].

59.   Poumay, Y, and Pittelow MR. Cell density and culture factors regulate keratinocyte commitment to differentiation and expression of suprabasal K1/K10. J Invest Dermatol 104: 271-276, 1995[Abstract].

60.   Reddy, ST, and Herschman HR. Prostaglandin synthase-1 and prostaglandin synthase-2 are coupled to distinct phospholipases for the generation of prostaglandin D2 in activated mast cells. J Biol Chem 272: 3231-3237, 1997[Abstract/Free Full Text].

61.   Reddy, ST, and Herschman HR. Transcellular prostaglandin production following mast cell activation is mediated by proximal secretory phospholipase A2 and distal prostaglandin synthase 1. J Biol Chem 271: 186-191, 1996[Abstract/Free Full Text].

62.   Reddy, ST, Winstead MV, Tischfield JA, and Herschman HR. Analysis of the secretory phospholipase A2 that mediates prostaglandin production in mast cells. J Biol Chem 272: 13591-13596, 1997[Abstract/Free Full Text].

63.   Ristimaki, A, Garfinkel S, Wessendorf J, Maciag T, and Hla T. Induction of cycloxgenase-2 by interleukin-1alpha : evidence for post-transcriptional regulation. J Biol Chem 269: 11769-11775, 1994[Abstract/Free Full Text].

64.   Scholz, K, Furstenberger G, Muller-Decker K, and Marks F. Differential expression of prostaglandin-H synthase isoenzymes in normal and activated keratinocytes in vivo and in vitro. Biochem J 309: 263-269, 1995[ISI][Medline].

65.   Seilhamer, JJ, Pruzanski W, Vadas P, Plant S, Miller JA, Kloss J, and Johnson LK. Cloning and recombinant expression of phospholipase A2 present in rheumatoid arthritic synovial fluid. J Biol Chem 264: 5335-5338, 1989[Abstract/Free Full Text].

66.   Tada, K, Murakami M, Kambe T, and Kudo I. Induction of cyclooxgenase-2 by secretory phospholipase A2 in nerve growth factor-stimulated rat serosal mast cells is facilitated by interaction with fibroblasts and mediated by a mechanism independent of their enzymatic functions. J Immunol 161: 5008-5015, 1998[Abstract/Free Full Text].

67.   Tischfield, JA. A reassessment of the low molecular weight phospholipases gene family in mammals. J Biol Chem 272: 17247-17250, 1997[Free Full Text].

68.   Tischfield, JA, Xia Y-R, Shih DM, Klisak I, Chen J, Engle SJ, Siakotos AN, Winstead MV, Seilhammer JJ, Allamand V, Gyapay G, and Lusis A. Low molecular, calcium-dependent phospholipase A2 genes are linked and map to homologous chromosome regions in mouse and human. Genomics 32: 328-333, 1996[ISI][Medline].

69.   Topper, JN, Cai J, Falb D, and Gimbrone MA. Identification of vascular endothelial genes differentially responsive to fluid mechanical stimuli: cyclooxygenase-2, manganese superoxide dismutase, and endothelial cell nitric oxide synthase are selectively up-regulated by steady laminar shear stress. Proc Natl Acad Sci USA 93: 10417-10422, 1996[Abstract/Free Full Text].

70.   Whatley, RE, Satoh K, Zimmerman GA, McIntyre TM, and Prescott SM. Proliferation-dependent changes in release of arachidonic acid from endothelial cells. J Clin Invest 94: 1889-1900, 1994[ISI][Medline].

71.   Wu, KK. Cyclooxygenase 2 induction: molecular mechanism and pathophysiolic roles. J Lab Clin Med 128: 242-245, 1996[ISI][Medline].

72.   Ziboh, VA. Phospholipase activity in the skin: modulators of arachidonic release from phosphatidylcholine. Biochem J 184: 283-290, 1979[ISI][Medline].

73.   Zvaritch, E, Lambeau G, and Lazdunski M. Endocytic properties of the M-type 180-kDa receptor for secretory phospholipase A2. J Biol Chem 271: 250-257, 1996[Abstract/Free Full Text].


Am J Physiol Cell Physiol 278(4):C822-C833
0363-6143/00 $5.00 Copyright © 2000 the American Physiological Society