1Department of Surgery, Section of Vascular Surgery, 2Department of Pharmacology and Toxicology, Dartmouth Medical School, Lebanon, New Hampshire 03756; and 3Department of Cell Biology, Harvard Medical School, Boston, Massachusetts 02115
Submitted 15 May 2003 ; accepted in final form 20 October 2003
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
rapamycin; contractile proteins; phenotypic modulation; signal transduction; intimal hyperplasia
VSMC do not terminally differentiate but retain plasticity to dedifferentiate toward a proliferative, synthetic phenotype in response to injury. As the primary function of mature VSMC is contraction, the complement of contractile, structural, and regulatory proteins expressed in fully differentiated VSMC provides markers of differentiation status (37). These include smooth muscle (SM) myosin heavy chain (SM-MHC), calponin, and SM -actin. The SM-MHC SM2 isoform is considered the most stringent marker of the differentiated state (19). Expression of these proteins decreases as VSMC dedifferentiate and myofilaments break down. Differentiation is often accompanied by expression of the cyclin/CDK inhibitors p21cip (waf-1) and p27kip (44).
Many factors may contribute to VSMC dedifferentiation after injury, including denudation of the endothelium, altered contacts with ECM and integrins, and exposure to growth factors. Culturing VSMC in vitro mimics this progression, as primary cultures rapidly lose differentiation markers and exhibit a synthetic phenotype (10). Such cell culture models have provided insights into factors that influence VSMC phenotype. Exposure to growth factors including PDGF, EGF, and TGF, or unsaturated lysophosphatidic acid promotes dedifferentiation (10, 12, 37), but G protein-coupled receptor agonists in serum, including thrombin, can induce VSMC differentiation via G
subunits (32). TGF
can also promote SMC differentiation in pluripotent stem cells (14, 35). ECM components influence VSMC phenotype, as culture on laminin, especially in combination with insulin-like growth factor I (IGF-I) (10, 11), promotes a differentiated phenotype. Neighboring cells also provide important inputs, as bilayer coculture of VSMC opposite endothelial cells induces VSMC differentiation (5). Although little is known about the intermediate signaling mechanisms underlying these effects, IGF-I-mediated SMC differentiation is inhibited by wortmannin, suggesting the involvement of phosphatidylinositol 3-kinase (PI 3-K) (10, 11).
Here, we investigate the effects of the macrolide antibiotic rapamycin on VSMC differentiation. Rapamycin has been previously shown to inhibit VSMC proliferation, protein synthesis, and migration in vitro, and intimal hyperplasia in animal models (1, 3, 7, 24, 30, 33, 40) and in human clinical trials (26, 38). Rapamycin binds FKBP12, and this complex inhibits mTOR, the mammalian target of rapamycin (also known as FRAP or RAFT) (21). mTOR is a ubiquitously expressed protein kinase that regulates translation initiation of specific growth-related mRNA subsets through the effectors p70 S6 kinase 1 (S6K1) and 4E-BP1/eIF4E. Other mTOR-regulated effectors included S6K2, PKC, and eIF2 kinase. The mTOR signaling pathway regulates protein synthesis in response to amino acids, and these effectors integrate nutrient sufficiency signals from mTOR with growth factor signals via PI 3-K to coordinately regulate protein synthesis, cell cycle progression, and proliferation (21). No studies of rapamycin in VSMC have addressed differentiation, which is characterized by major changes in gene expression and morphology. We report that the mTOR inhibitor rapamycin induces biochemical differentiation of primary VSMC in culture and that one mTOR effector, S6K1, may play an important role in this process.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
VSMC were treated with vehicle (ethanol) or drug as indicated in the figure legends. For vehicle controls, cells were incubated with ethanol for the maximum duration of the experimental treatment. Rapamycin was purchased from Sigma. LY-294002, SB-203580, and U-0126 were purchased from Calbiochem.
Coculture model. Bovine EC (250,000) were plated on the outer side of Cyclopore membrane tissue culture inserts with 0.4-µm pores in six-well plates (Becton-Dickinson) and grown to confluence for 5 days. Bovine VSMC were then plated (1 x 105 cells) on the inner side of the membrane and cultured for 72 h. For VSMC cultured alone controls, VSMC were plated on the inner membranes of inserts lacking EC (5).
Cell area measurement. VSMC grown on Cyclopore membranes were stained with Mayer's hematoxylin and mounted on slides. Five separate high power fields were scanned in the same region of each slide in a blinded manner, and cell area was determined by planimetry, outlining cell dimensions, and computing two-dimensional area using NIH Image software. A student's t-test was used to determine statistical significance.
Immunohistochemistry. VSMC were cultured on glass coverslips. Cells were washed with phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde in PBS. Cells were permeabilized in 0.1% Triton in PBS. For horseradish peroxidase (HRP) staining, cells were treated with 3.0% hydrogen peroxide to quench endogenous peroxidase. Cells were blocked with 1.0% goat serum in PBS and then incubated with primary antibodies (as described in Western blotting) in PBS for 1 h. After washing, anti-mouse biotin-conjugated secondary antibody (for HRP stain) or anti-mouse TRITC conjugate for immunofluorescence, was incubated for 1 h and washed. Coverslips were then processed for immunofluorescent microscopy or treated with a peroxidase conjugate (Sigma) before mounting.
Protein and collagen synthesis. VSMC were treated with 4 µCi/ml [3H]proline (for collagen assay) or 2 µCi/ml [3H]leucine (for total protein) for 24 h, and then medium was replaced with fresh 3H-free medium. After 48 h, cells were subjected to trichloroacetic acid precipitation and scintillation counting. Collagens account for 80% of [3H]Pro incorporation into soluble ECM protein (31), whereas [3H]Leu counts reflect total protein synthesis. DNA content was measured by fluorescence spectroscopy of cell lysates using Hoescht reagent. Data are expressed as cpm (protein) per ng DNA.
Semiquantitative RT-PCR. Total RNA was isolated using the Qiagen RNeasy kit with DNase I and quantitated in duplicate spectro-photometrically. RNA (500 ng) was reverse transcribed using Superscript II (Life Technologies) or MMLV reverse transcriptase (Invitrogen) and oligo dT primer. Titrations using dilutions of the reverse transcribed cDNA were performed to determine the linear range of the PCR using the following primers to specifically amplify the human basic calponin gene transcript: sense 5' TAACCGAGGTCCTGC-CTACG, antisense 5' TGTGGGTGGGCTCACTCAGC. The 5' primer sequence is common among calponin isoforms (nt 187-206 in NCBI nucleotide sequence #NM-001299), but the 3' primer is specific to the unique COOH terminus of basic calponin (nt 1,009-1,028). The COOH-terminal sequences of neutral or acidic calponin are greatly divergent in this region. PCR was performed using 20 pmol each primer, 0.04 mM dNTPs, Red taq (Sigma), and TaqStart antibody (Clontech) for 32 cycles: 94°C for 30 s, 60°C for 45 s, and 72°C for 1 min. The following primers were used to specifically amplify SM-MHC: sense 5' CGCTGAATGACAACGTGACTTCC, antisense 5' CCAGTTCCGCAGCTTGAGGTA. The linear range of the PCR assay was again determined by template titration. PCR was performed as above for 30 cycles: 95°C for 30 s, 62°C for 30 s, and 68°C for 1 min. For each experiment, control reactions with primers to the pyruvate dehydrogenase (PDH) gene were performed for quality control. The linear range of the PDH PCR was similarly verified using template titrations. PCR products were resolved on 2% agarose gels with ethidium bromide and quantitated using a Typhoon Scanner (Molecular Dynamics).
Western blotting. Lysates were harvested for Western analysis as in Ref. 23. Bradford assay was used to determine total protein concentration in lysates. Equal amounts of protein per lane were subjected to SDS polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose membrane, and immunoblotted using antibodies against SM-MHC SM2 (Seikagaku America), SM -actin, calponin (Sigma), p27kip1, or p21cip (Santa Cruz). The calponin antibody does not cross-react with skeletal, cardiac, or nonmuscle tissue calponin and exhibits smooth muscle specificity when used in immunohistochemistry (Sigma catalog no. C2687).
Adenoviral overexpression of S6K1. We have generated recombinant adenoviruses encoding HA-tagged wild-type or rapamycin-resistant mutant (ED3E) (41) p70 S6K1. These viruses coexpress green fluorescent protein (GFP) to easily assess infection efficiency using the AdEasy system (see www.coloncancer.org/adeasy for methods) (13). Virus encoding GFP alone serves as a control.
VSMC were infected with adenoviral supernatant (at 1:20-1:100 dilutions) in DMEM with 10% calf serum overnight, washed, and treated with 20 nmol/l rapamycin or vehicle for 48 h in 2.5% calf serum medium. Optimal titers have been predetermined for each virus to yield infection of 75% of VSMC. Cells were assayed for infection efficiency (GFP fluorescence), S6K1 expression [Western blotting with anti-HA and anti-S6K1 antibodies (23)], and S6K1 activity.
Immune complex kinase assay. Infected VSMC were lysed (as for Western blotting) and S6K1 immunoprecipitated with an antibody to the HA-epitope tag and protein A-Sepharose. Kinase activity toward recombinant GST-S6 peptide in washed immunoprecipitates was assayed as in Martin et al. (23).
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
|
Rapamycin inhibits VSMC protein and extracellular matrix synthesis. Rapamycin is a known inhibitor of specific translation initiation and thus inhibits protein synthesis in many cell types (8, 21). Enhanced synthesis of collagen and other extracellular matrix proteins is a characteristic of the synthetic, dedifferentiated VSMC phenotype and is a major component of intimal hyperplasia (5). We labeled VSMC with 3H-amino acids to assess total protein and collagen synthesis after rapamycin treatment. As expected, rapamycin inhibited both total protein and collagen synthesis after 24-48 h (Fig. 2A). Notably, rapamycin treatment inhibited total protein synthesis by only 30% after 48 h, whereas cycloheximide treatment inhibited total protein synthesis by 93% at this time point (Fig. 2B). This is consistent with rapamycin inhibition of translation of a subset of highly structured mRNAs, whereas cycloheximide inhibits global protein synthesis.
|
Rapamycin induces protein markers of VSMC differentiation. Given the striking effects on VSMC morphology, we assessed modulation of VSMC-specific contractile protein gene expression, which serves as a biochemical marker of differentiation status. Rapamycin treatment induced a rapid upregulation of the mRNA for basic calponin in human VSMC as determined by semiquantitative RT-PCR (Fig. 3B). This isoform is unique to vascular smooth muscle and is down-regulated upon dedifferentiation (37). A sharp 20-fold induction of the calponin message was observed after 2 h of rapamycin treatment. A maximal 35-fold induction was reached after 6 h of rapamycin treatment. The elevated mRNA levels persisted through 24 h. We similarly evaluated mRNA levels for SM-MHC, the most stringent contractile protein marker of VSMC differentiation (19). Rapamycin also induced SM-MHC mRNA levels, with a maximal sixfold induction after 1 h of treatment (Fig. 3C). These data suggest that rapamycin may promote a differentiated phenotype by inducing a new program of gene expression at the level of transcription, a new role for the mTOR pathway in mammalian cells.
|
Inhibition of mTOR with rapamycin induced expression of contractile protein markers of the differentiated phenotype, including SM -actin, calponin, and the SM-MHC SM2 isoform. Notably, the kinetics of induction of these proteins closely followed those observed for induction of calponin message (Fig. 4A). With all contractile proteins assayed, protein levels continued to accumulate with increasing time of rapamycin treatment.
|
Confirming the effects of rapamycin on contractile protein gene expression observed at early time points, 48 h of rapamycin treatment induced expression of SM -actin, calponin, and SM2-MHC in VSMC in Western blot analyses (Figs. 4, B and C, and 6, D and E). We have also observed this new contractile protein expression by immunofluorescent staining (Figs. 4D and 6, B and C). Enhanced expression of these proteins is consistent with the differentiated morphology observed after 48 h of rapamycin treatment in Fig. 1. Notably, induction of contractile proteins was specific to inhibition of the mTOR pathway, as treatment with pharmacological inhibitors of other signaling pathways, including the PI 3-K, p38, and ERK1/2 pathways, did not induce contractile protein expression (Fig. 4C). Furthermore, rapamycin fold induction of contractile protein expression relative to vehicle was highly reproducible in VSMC from all species tested (Table 1).
|
|
Rapamycin induces expression of antiproliferative cyclin-dependent kinase inhibitors. Because proliferation and differentiation are not necessarily mutually exclusive processes in VSMC, we assessed expression levels of cyclin-dependent kinase inhibitory proteins after rapamycin treatment. Rapamycin treatment induced expression of the p27kip and p21cip cyclin-dependent kinase inhibitors in VSMC (Fig. 5), consistent with rapamycin-inhibited proliferation. Notably, the kinetics of rapamycin-induced p27kip and p21cip expression closely parallel the kinetics of contractile protein induction, suggesting a coordinated regulation of proliferation and differentiation. Rapamycin induction of these cyclin-dependent kinase inhibitors was also highly reproducible in VSMC from all species tested (Table 1).
|
The mTOR effector S6K1 opposes rapamycin-induced VSMC differentiation. Our data suggest that activation of the mTOR pathway opposes VSMC differentiation. Rapamycin inhibits the activity of mTOR, which in turn regulates multiple downstream effector proteins. To determine whether S6K1, one of the best-characterized effectors of mTOR, is a critical regulator of VSMC differentiation, we employed an adenovirus strategy to overexpress HA-tagged S6K1 constructs. The virus encodes green fluorescent protein (GFP) driven by the same promoter, such that S6K1-overexpressing cells are positive for GFP under fluorescent microscopy. A negative control virus expresses only GFP. HA-tagged S6K1 was detected by immunoblotting in infected bovine cells, and immune complex kinase assay revealed that a modest S6K1 kinase activity persisted in rapamycin-treated cells overexpressing wild-type S6K1 (Fig. 6A, top). In rat VSMC adenovirally overexpressing wild-type S6K1, 25% of the initial activity persisted in the presence of rapamycin (Fig. 6A, bottom). After 48 h of rapamycin treatment, individual rat cells overexpressing wild-type S6K1 (GFP-positive) were negative for contractile protein expression, whereas uninfected cells in the same field demonstrated strong positive staining for SM2-MHC and SM -actin (Fig. 6, B and C). As a control, GFP expression did not preclude contractile protein staining in rapamycin-treated cells infected with control virus (Fig. 6C), verifying that overexpression of GFP itself is not incompatible with contractile protein expression.
Western blot analysis of similar experiments confirmed that rapamycin induced expression of the contractile proteins SM -actin and calponin and the G1 cyclin inhibitor p21cip in cells infected with control virus but not in cells infected with the HA-S6K1 adenovirus (Fig. 6D). To further enhance S6K1 activity in the presence of rapamycin, we employed an adenovirus encoding an HA-tagged rapamycin-resistant mutant of S6K1 (ED3E) (41). This mutant S6K1 retained 75% of its initial activity in the presence of rapamycin when expressed in rat VSMC (Fig. 6A, bottom). Rapamycin similarly induced expression of SM2-MHC in control infected cells, but not in S6K1-ED3E-infected cells, as determined by Western blotting (Fig. 6E). The difference in SM2-MHC induction between control and S6K1-ED3E-infected cells was statistically significant (P = 0.01). Immunoblots confirmed overexpression of S6K1 (note that mobility shift of ED3E in Fig. 6E is less sensitive to rapamycin than wild-type S6K1 in Fig. 6D), and ERK1/2 blots verified even lane loading (Fig. 6E). These data indicate that overexpression of the mTOR effector S6K1 inhibits rapamycin-induced VSMC differentiation.
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
The mTOR inhibitor rapamycin has previously been shown to inhibit VSMC proliferation. However, proliferation and differentiation are not mutually exclusive processes in VSMC (5). VSMC differentiation is characterized by induction of a novel program of gene expression resulting in new protein expression and morphology (37). Therefore, the finding that rapamycin promotes a differentiated phenotype is compelling. Rapamycin induced expression of the differentiation marker contractile proteins, including -actin, calponin, and myosin heavy chain. Notably, rapamycin also induced expression of the cyclin-dependent kinase inhibitors p27kip and p21cip with similar kinetics. Thus mTOR inhibition promotes coordinated regulation of inhibitors of cell cycle progression and contractile proteins to induce the differentiated VSMC phenotype.
The most intriguing aspect of this work was the finding that inhibition of mTOR by rapamycin induces mRNAs encoding contractile proteins. Because calponin mRNA was undetectable in the vehicle treated dedifferentiated VSMC and was rapidly induced 20-fold after 2 h of rapamycin treatment, this induction is likely due to new transcription. We are investigating the possibility that rapamycin may additionally regulate message stability. Similar induction of SM-MHC mRNA suggests that mTOR-dependent transcriptional regulation may be a common mechanism among VSMC differentiation marker proteins. Notably, the kinetics of contractile protein expression closely follow the induction of these messages.
Although the TOR pathway is known to regulate nutrient-sensitive transcription factors in yeast (15), very little is known regarding transcriptional control by mTOR in mammalian cells. However, several studies have reported that rapamycin induces hematopoietic differentiation (11, 16, 43) but inhibits adipocyte differentiation (6) and chondrogenesis (27). Differential effects of rapamycin on differentiation in other cell lines suggests that mTOR may indeed be an important regulator of cell type-specific transcriptional processes. We are currently evaluating mTOR-regulated VSMC-specific transcription factor candidates (manuscript in preparation).
To address potential mechanisms of rapamycin-induced biochemical differentiation, we evaluated the role of S6K1, a key mTOR target, in VSMC differentiation. S6K1 promotes cell growth and proliferation, in addition to protein synthesis via 5'TOP mRNA regulation (21). As these processes are characteristic of dedifferentiated VSMC, S6K1 activation may antagonize differentiation. However, because there are multiple effector proteins, including 4E-BP1 (8) and S6K2 (23), down-stream of mTOR subject to rapamycin inhibition, one cannot immediately attribute any and all effects of rapamycin to S6K1. We overexpressed S6K1 to determine whether the effects of rapamycin on VSMC differentiation are mediated by this kinase. Although wild-type S6K1 retains rapamycin-sensitivity, high-level overexpression confers a degree of rapamycin-resistant activity (Fig. 6A), perhaps by exceeding limiting quantities of an mTOR-regulated inhibitor (29). The persistence of S6K1 activity in the presence of rapamycin, when other mTOR target proteins are inhibited, or overexpression of a rapamycin-resistant S6K1 mutant, allows us to assign a role specifically to S6K1. In these studies, overexpression of S6K1 was mutually exclusive with rapamycin-induced contractile protein and p21cip expression. These data suggest that mTOR normally opposes VSMC differentiation through activation of S6K1 and that rapamycin inhibition of this kinase promotes differentiation.
The effect of S6K1 overexpression on basal levels of differentiation markers varied somewhat in that basal expression of SM2-MHC and calponin, but not SM -actin and p21cip, was inhibited by S6K1. We attribute this variation to two factors. It is likely that the enhanced kinase activity of the ED3E mutant as opposed to wild-type S6K1 contributed to inhibition of basal SM2-MHC expression (Fig. 6E, left). It is also likely that the effect correlates with the temporal expression of contractile proteins during the differentiation process. SM
-actin is the earliest marker of the VSMC lineage, and its expression is reduced, but not completely inhibited, even in the synthetic phenotype (Figs. 4D and 6C). Thus it is perhaps not surprising that (wild-type) S6K1 failed to inhibit basal expression of this protein but did inhibit that of calponin, an intermediate stage marker, and of SM2-MHC, the most stringent late-stage differentiation marker.
Other than the ribosomal S6 protein, few substrates for S6K1 have been identified. Notably, the testis-specific transcription factor CREM has been identified as an S6K1 substrate with rapamycin-sensitive transactivation function in vivo (4). An attractive hypothesis that we aim to pursue is that S6K1 may oppose VSMC differentiation by negatively regulating cell type-specific transcription factors through its kinase activity. Alternately, S6K1-mediated modulation of proliferation and protein synthesis may contribute to the differentiation program and indirectly regulate transcription factors. An additional possibility is that altered translation of 5'TOP-containing mRNAs may contribute to the differentiated phenotype, as rapamycin-inhibited induction of G1 cyclins and Cdks in coronary VSMC was found to occur through a posttranscriptional mechanism (1). Interestingly, a 5' UTR stem-loop structure has recently been implicated in regulation of collagen I translation (39), suggesting that mTOR-dependent translational regulation may contribute to rapamycin inhibition of collagen synthesis. However, the contractile proteins that undergo dramatic upregulation in differentiated VSMC are not known to be 5'TOP-containing messages.
S6 kinases are found in several cellular locations. p70 S6K1 is found in both the nucleus and the cytoplasm, whereas the p85 S6K1 isoform is nuclear (17). Both isoforms of the related kinase S6K2 are nuclear (9, 18). The roles of the nuclear S6 kinases are largely unknown, but we speculate that S6Ks could potentially regulate differentiation through as yet undetermined nuclear targets.
Our data demonstrate that S6K1 opposes VSMC differentiation, and previous studies have reported rapid activation of S6K1 after vascular injury (1). However, it is likely that inhibition of S6K1 alone is not sufficient for VSMC differentiation: we found that PI 3-K inhibition with LY-294002, which, in turn, leads to S6K1 inhibition (21), did not promote VSMC differentiation (Fig. 4C). We postulate that whereas S6K1 may oppose differentiation, promotion of differentiation also requires PI 3-K-dependent prodifferentiation signals. This is supported by work from Sobue and coworkers, who have demonstrated that IGF-I-induced VSMC differentiation requires PI 3-K (11) and that Akt is an important mediator of visceral SMC differentiation (28). It is likely that the full complement of signaling effectors activated downstream of IGF-I and PI 3-K results in a prodifferentiative signal, despite activation of S6K1.
Using inhibitors of multiple signaling pathways, we found that only inhibition of the mTOR pathway induced VSMC differentiation. Previous studies suggest that the ERK MAPK pathway is proproliferative in VSMC (11). Although inhibition of this pathway could conceivably contribute to differentiation, we did not observe such an effect. It may be that ERK signals are required for proper function of the CArG DNA regulatory elements common to most muscle-specific promoters, including those of the VSMC contractile protein genes (20, 34, 42).
In response to vessel injury, VSMC dedifferentiate to a "synthetic" phenotype, which is named for the copious extracellular matrix synthesis and secretion characteristic of these cells. Because the major known function of the mTOR pathway is regulation of protein synthesis, rapamycin might be expected to inhibit the synthetic phenotype primarily at the level of inhibition of translation initiation. We found that rapamycin indeed inhibited total protein synthesis, including the major secreted extracellular matrix component collagen. However, despite attenuated protein synthesis, rapamycin promoted a new program of gene expression characteristic of the differentiated phenotype. Because rapamycin initially inhibits only translation of a subset of 5' structured mRNAs, sufficient translational activity persists to synthesize the new proteins.
The plasticity of VSMC phenotype is important in clinical conditions such as intimal hyperplasia, in which dedifferentiated VSMC migrate, proliferate, and secrete extracellular matrix protein in response to vessel injury. Rapamycin was first investigated as a potential antirestenotic drug due to its known antiproliferative and protein synthesis effects. However, our study suggests that rapamycin may be a particularly effective therapeutic because, in addition to inhibiting these components of intimal hyperplasia, it also promotes a differentiated, contractile phenotype. This is in contrast to other drugs that act as cytotoxic agents, which inhibit proliferation but result in the death of the cells, as opposed to maintenance of functional contractile quiescent VSMC at the site of injury. Recent clinical trials of rapamycin-coated stents have demonstrated promise for prevention of restenosis (26, 38). Our finding that mTOR inhibition promotes VSMC differentiation furthers our understanding of the basic signaling mechanisms regulating VSMC phenotype and suggests new avenues for discovery of cardiovascular therapeutics.
![]() |
ACKNOWLEDGMENTS |
---|
GRANTS
Supported by a grant from the National Heart, Lung, and Blood Institute (R-01-HL-59590), a Wylie Scholar in Academic Surgery Award from the Pacific Vascular Research Foundation to R. J. Powell, and a Hitchcock Foundation Award and an American Heart Association Scientist Development Grant to K. A. Martin.
![]() |
FOOTNOTES |
---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* K. A. Martin and E. M. Rzucidlo contributed equally to this work.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() |
---|
2. Campbell GR, Campbell JH, Manderson JA, Horrigan S, and Rennick RE. Arterial smooth muscle. A multifunctional mesenchymal cell. Arch Pathol Lab Med 112: 977-986, 1988.[ISI][Medline]
3. Cao W, Mohacsi P, Shorthouse R, Pratt R, and Morris RE. Effects of rapamycin on growth factor-stimulated vascular smooth muscle cell DNA synthesis. Inhibition of basic fibroblast growth factor and platelet-derived growth factor action and antagonism of rapamycin by FK506. Transplantation 59: 390-395, 1995.[ISI][Medline]
4. De Groot RP, Ballou LM, and Sasssone-Corsi P. Positive regulation of the cAMP-responsive activator CREM by the p70 S6 kinase: an alternative route to mitogen-induced gene expression. Cell 79: 81-91, 1994.[ISI][Medline]
5. Fillinger MF, Sampson LN, Cronenwett JL, Powell RJ, and Wagner RJ. Co-culture of endothelial cells and smooth muscle cells in bilayer and conditioned media models. J Surg Res 67: 169-178, 1997.[CrossRef][ISI][Medline]
6. Gagnon A, Lau S, and Sorisky A. Rapamycin-sensitive phase of 3T3-L1 preadipocyte differentiation after clonal expansion. J Cell Physiol 189: 14-22, 2001.[CrossRef][ISI][Medline]
7. Gallo R, Padurean A, Jayaraman T, Marx S, Roque M, Adelman S, Chesebro J, Fallon J, Fuster V, Marks A, and Badimon JJ. Inhibition of intimal thickening after balloon angioplasty in porcine coronary arteries by targeting regulators of the cell cycle. Circulation 99: 2164-2170, 1999.
8. Gingras AC, Raught B, and Sonenberg N. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68: 913-963, 1999.[CrossRef][ISI][Medline]
9. Gout I, Minami T, Hara K, Tsujishita Y, Filonenko V, Waterfirld MD, and Yonezawa K. Molecular cloning and characterization of a novel S6 kinase, p70 S6 kinase beta containing a proline-rich region. J Biol Chem 273: 30061-30064, 1998.
10. Hayashi K, Saga H, Chimori Y, Kimura K, Yamanaka Y, and Sobue K. Differentiated phenotype of smooth muscle cells depends on signaling pathways through insulin-like growth factors and phosphatidylinositol 3-kinase. J Biol Chem 273: 28860-28867, 1998.
11. Hayashi K, Takahashi M, Kimura K, Nishida W, Saga H, and Sobue K. Changes in the balance of phosphoinositide 3-kinase/protein kinase B (Akt) and the mitogen-activated protein kinases (ERK/p38MAPK) determine a phenotype of visceral and vascular smooth muscle cells. J Cell Biol 145: 727-740, 1999.
12. Hayashi K, Takahashi M, Nishida W, Yoshida K, Ohkawa Y, Kitabatake A, Aoki J, Arai H, and Sobue K. Phenotypic modulation of vascular smooth muscle cells induced by unsaturated lysophosphatidic acids. Circ Res 89: 251-258, 2001.
13. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, and Vogelstein B. A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95: 2509-2514, 1998.
14. Hirschi KK, Rohovsky SA, and D'Amore PA. PDGF, TGF-beta, and heterotypic cell-cell interactions mediate endothelial cell-induced recruitment of 10T1/2 cells and their differentiation to a smooth muscle fate. J Cell Biol 141: 805-814, 1998.
15. Jacinto E and Hall MN. Tor signalling in bugs, brain and brawn. Nat Rev Mol Cell Biol 4: 117-126, 2003.[CrossRef][ISI][Medline]
16. Kanayasu-Toyoda T, Yamaguchi T, Uchida E, and Hayakawa T. Commitment of neutrophilic differentiation and proliferation of HL-60 cells coincides with expression of transferrin receptor. Effect of granulocyte colony stimulating factor on differentiation and proliferation. J Biol Chem 274: 25471-25480, 1999.
17. Kim JE and Chen J. Cytoplasmic-nuclear shuttling of FKBP12-rapamycin-associated protein is involved in rapamycin-sensitive signaling and translation initiation. Proc Natl Acad Sci USA 97: 14340-14345, 2000.
18. Koh H, Jee K, Lee B, Kim J, Kim D, Yun YH, Kim JW, Choi HS, and Chung J. Cloning and characterization of a nuclear S6 kinase, S6 kinase-related kinase (SRK); a novel nuclear target of Akt. Oncogene 18: 5115-5119, 1999.[CrossRef][ISI][Medline]
19. Kuro-o M, Nagai R, Tsuchimochi H, Katoh H, Yazaki Y, Ohkubo A, and Takaku F. Developmentally regulated expression of vascular smooth muscle myosin heavy chain isoforms. J Biol Chem 264: 18272-18275, 1989.
20. Manabe I and Owens GK. CArG elements control smooth muscle subtype-specific expression of smooth muscle myosin in vivo. J Clin Invest 107: 823-834, 2001.
21. Martin KA and Blenis J. Coordinate regulation of translation by the PI 3-kinase and mTOR pathways. In: Advances in Cancer Research, edited by Van de Woude GF and Klein G. San Diego, CA: Academic, 2002, p. 1-39.
23. Martin KA, Schalm SS, Romanelli A, Keon KL, and Blenis J. Ribosomal S6 kinase 2 inhibition by a potent C-terminal repressor domain is relieved by mitogen-activated protein-extracellular signal-regulated kinase kinase-regulated phosphorylation. J Biol Chem 276: 7892-7898, 2001.
24. Marx SO, Jayaraman T, Go LO, and Marks AR. Rapamycin-FKBP inhibits cell cycle regulators of proliferation in vascular smooth muscle cells. Circ Res 76: 412-417, 1995.
25. McCaffrey TA. TGF-betas and TGF-beta receptors in atherosclerosis. Cytokine Growth Factor Rev 11: 103-114, 2000.[CrossRef][ISI][Medline]
26. Morice MC, Serruys PW, Sousa JE, Fajadet J, Ban Hayashi E, Perin M, Colombo A, Schuler G, Barragan P, Guagliumi G, Molnar F, and Falotico R. A randomized comparison of a sirolimus-eluting stent with a standard stent for coronary revascularization. N Engl J Med 346: 1773-1780, 2002.
27. Oh C, Kim S, Ju J, Song WK, Kim J, Yoo YJ, and Chun J. Immunosuppressant rapamycin inhibits protein kinase C alpha and p38 mitogen-activated protein kinase leading to the inhibition of chondrogenesis. Eur J Pharmacol 427: 175-185, 2001.[CrossRef][ISI][Medline]
28. Ohkawa Y, Hayashi K, and Sobue K. Calcineurin-mediated pathway involved in the differentiated phenotype of smooth muscle cells. Biochem Biophys Res Commun 301: 78-83, 2003.[CrossRef][ISI][Medline]
29. Peterson RT, Desai BN, Hardwick JS, and Schreiber SL. Protein phosphatase 2A interacts with the 70-kDa S6 kinase and is activated by inhibition of FKBP12-rapamycin associated protein. Proc Natl Acad Sci USA 96: 4438-4442, 1999.
30. Poon M, Marx SO, Gallo R, Badimon JJ, Taubman MB, and Marks AR. Rapamycin inhibits vascular smooth muscle cell migration. J Clin Invest 98: 2277-2283, 1996.
31. Powell RJ, Hydowski J, Frank O, Bhargava J, and Sumpio BE. Endothelial cell effect on smooth muscle cell collagen synthesis. J Surg Res 69: 113-118, 1997.[CrossRef][ISI][Medline]
32. Reusch HP, Schaefer M, Plum C, Schultz G, and Paul M. Gbeta gamma mediates differentiation of vascular smooth muscle cells. J Biol Chem 276: 19540-19547, 2001.
33. Roque M, Cordon-Cardo C, Fuster V, Reis ED, Drobnjak M, and Badimon JJ. Modulation of apoptosis, proliferation, and p27 expression in a porcine coronary angioplasty model. Atherosclerosis 153: 315-322, 2000.[CrossRef][ISI][Medline]
34. Schauwienold D, Plum C, Helbing T, Voigt P, Bobbert T, Hoffmann D, Paul M, and Reusch HP. ERK1/2-dependent contractile protein expression in vascular smooth muscle cells. Hypertension 41: 546-552, 2003.
35. Shah NM, Groves AK, and Anderson DJ. Alternative neural crest cell fates are instructively promoted by TGFbeta superfamily members. Cell 85: 331-343, 1996.[ISI][Medline]
36. Smith RC, Branellec D, Gorski DH, Guo K, Perlman H, Dedieu JF, Pastore C, Mahfoudi A, Denefle P, Isner JM, and Walsh K. p21CIP1-mediated inhibition of cell proliferation by overexpression of the gax homeodomain gene. Genes Dev 11: 1674-1689, 1997.[Abstract]
37. Sobue K, Hayashi K, and Nishida W. Expressional regulation of smooth muscle cell-specific genes in association with phenotypic modulation. Mol Cell Biochem 190: 105-118, 1999.[CrossRef][ISI][Medline]
38. Sousa JE, Costa MA, Abizaid AC, Rensing BJ, Abizaid AS, Tanajura LF, Kozuma K, Van Langenhove G, Sousa AG, Falotico R, Jaeger J, Popma JJ, and Serruys PW. Sustained suppression of neointimal proliferation by sirolimus-eluting stents: one-year angiographic and intravascular ultrasound follow-up. Circulation 104: 2007-2011, 2001.
39. Stefanovic B and Brenner DA. 5' stem-loop of collagen alpha 1(I) mRNA inhibits translation in vitro but is required for triple helical collagen synthesis in vivo. J Biol Chem 278: 927-933, 2003.
40. Sun J, Marx SO, Chen HJ, Poon M, Marks AR, and Rabbani LE. Role for p27(Kip1) in vascular smooth muscle cell migration. Circulation 103: 2967-2972, 2001.
41. Viñals F, Chambard JC, and Pouysségur J. p70 S6 kinase-mediated protein synthesis is a critical step for vascular endothelial cell proliferation. J Biol Chem 274: 26776-26782, 1999.
42. Walsh K and Takahashi A. Transcriptional regulation of vascular smooth muscle cell phenotype. Z Kardiol 90: 12-16, 2001.[CrossRef][ISI]
43. Yamamoto-Yamaguchi Y, Okabe-Kado J, Kasukabe T, and Honma Y. Induction of differentiation of human myeloid leukemia cells by immunosuppressant macrolides (rapamycin and FK506) and calcium/calmodulin-dependent kinase inhibitors. Exp Hematol 29: 582-588, 2001.[CrossRef][ISI][Medline]
44. Zhu L and Skoultchi AI. Coordinating cell proliferation and differentiation. Curr Opin Genet Dev 11: 91-97, 2001.[CrossRef][ISI][Medline]