Modulation of vascular smooth muscle cell migration by calcium/ calmodulin-dependent protein kinase II-{delta}2

Paul J. Pfleiderer,1 Katherine Kun Lu,1 Michael T. Crow,2 Rebecca S. Keller,1 and Harold A. Singer1

1Center for Cardiovascular Sciences, Albany Medical College, Albany, New York 12208; and 2Division of Pulmonary and Critical Care Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21224

Submitted 3 December 2003 ; accepted in final form 29 January 2004


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Previous studies demonstrated a requirement for multifunctional Ca2+/calmodulin-dependent protein kinase II (CaMKII) in PDGF-stimulated vascular smooth muscle (VSM) cell migration. In the present study, molecular approaches were used specifically to assess the role of the predominant CaMKII isoform ({delta}2 or {delta}C) on VSM cell migration. Kinase-negative (K43A) and constitutively active (T287D) mutant forms of CaMKII{delta}2 were expressed using recombinant adenoviruses. CaMKII activities were evaluated in vitro by using a peptide substrate and in intact cells by assessing the phosphorylation of overexpressed phospholamban on Thr17, a CaMKII-selective phosphorylation site. Expression of kinase-negative CaMKII{delta}2 inhibited substrate phosphorylation both in vitro and in the intact cell, indicating a dominant-negative function with respect to exogenous substrate. However, overexpression of the kinase-negative mutant failed to inhibit endogenous CaMKII{delta}2 autophosphorylation on Thr287 after activation of cells with ionomycin, and in fact, these subunits served as a substrate for the endogenous kinase. Constitutively active CaMKII{delta}2 phosphorylated substrate in vitro without added Ca2+/calmodulin and in the intact cell without added Ca2+-dependent stimuli, but it inhibited autophosphorylation of endogenous CaMKII{delta}2 on Thr287. Basal and PDGF-stimulated cell migration was significantly enhanced in cells expressing kinase-negative CaMKII{delta}2, an effect opposite that of KN-93, a chemical inhibitor of CaMKII activation. Expression of the constitutively active CaMKII{delta}2 mutant inhibited PDGF-stimulated cell migration. These studies point to a role for the CaMKII{delta}2 isoform in regulating VSM cell migration. An inclusive interpretation of results using both pharmacological and molecular approaches raises the hypothesis that CaMKII{delta}2 autophosphorylation may play an important role in PDGF-stimulated VSM cell migration.

calcium/calmodulin-dependent protein kinase II; cell migration; adenovirus; autophosphorylation; chemotaxis; platelet-derived growth factor


VASCULAR SMOOTH MUSCLE (VSM) cells in the medial walls of blood vessels are normally quiescent and express a differentiated phenotype that serves to generate and maintain vascular tone (18). However, vascular injury may result in dedifferentiation, migration across the internal elastic lamina, and proliferation of VSM cells to form a neointima (18, 33). Although the overall characterization of VSM within the neointima is well documented, the molecular mechanisms and signaling pathways that control VSM cell migration are not well understood.

One regulatory protein implicated in VSM cell migration is Ca2+/calmodulin-dependent protein kinase II (CaMKII) (13, 15, 35). CaMKII is a multifunctional serine/threonine protein kinase with numerous alternatively spliced isoforms arising from four genes ({alpha}, {beta}, {gamma}, and {delta}; see Refs. 10, 29). The isoforms have distinct tissue expression patterns, with the {alpha}- and {beta}-isoforms located almost exclusively in brain tissue, whereas the {delta}- and {gamma}-isoforms are found in both brain and peripheral tissues (10, 29). When free Ca2+ rises within the cell, Ca2+/calmodulin complexes bind to a conserved regulatory domain in CaMKII subunits, resulting in activation and substrate phosphorylation, including rapid autophosphorylation on Thr287 (Thr286 in the {alpha}-isoform) in the regulatory domain (9, 19). This autophosphorylation dramatically increases the binding affinity for calmodulin (16, 23) and renders the autoinhibitory domain inactive, providing the kinase with 50–70% autonomous activity in the absence of Ca2+/calmodulin (9). Functionally, this provides the kinase with the capacity to respond to Ca2+ transients in a frequency-dependent manner (6, 8). In addition, phosphorylation of this residue has been shown to be important in targeting the enzyme (26), facilitating the interaction of CaMKII and its substrates (34).

CaMKII is expressed in vivo as a large holoenzyme composed of up to 12 individual kinase subunits (10). Formation of the holoenzyme is dependent on a conserved COOH-terminal association domain (10) and has been shown to be important for autophosphorylation that results from an intersubunit, intraholoenzyme reaction (4). Because the holoenzyme structure can be heteromultimeric (29), a number of investigators are beginning to study how subunit composition affects holoenzyme targeting (2, 5, 27, 30). For example, a short, variable domain conserved in a number of subunits was demonstrated to contain a nuclear localization sequence capable of targeting CaMKII holoenzymes to the nucleus (25). In addition, the {beta}-isoform of CaMKII has been shown to contain domains that provide targeting to the cytoskeleton and F-actin (21, 30). Such findings emphasize the importance of defining the CaMKII isoforms expressed in a specific cell type and considering structural features that may result in distinct protein-protein interactions and unique function.

Previous studies using cultured VSM cells implicate a regulatory role for CaMKII in PDGF-stimulated chemotactic cell migration (13, 15). These studies relied on chemical inhibition of CaMKII (with KN-62 or KN-93) or molecular manipulation of CaMKII activity by expression of a constitutively active CaMKII{alpha}, an isoform not expressed in VSM (29, 35). We (20) previously reported that the {delta} gene is the main isoform expressed in cultured VSM, with the {delta}2 splice variant (also called {delta}c in some studies) being the major CaMKII product expressed, along with minor levels of {delta}3 ({delta}B) detectable by RT-PCR and Western blot analysis. In the present study, we inhibited endogenous CaMKII{delta}2 function by using an adenoviral infection approach to introduce a kinase-negative mutant of CaMKII{delta}2 that was demonstrated to act as a dominant negative with respect to CaMKII activity. Whereas KN-93 was shown to inhibit PDGF-stimulated VSM cell migration, overexpression of the kinase-negative CaMKII{delta}2 potentiated PDGF-induced migration. Furthermore, expression of a constitutively active {delta}2-isoform inhibited VSM cell migration. The results of these studies necessitate a careful reexamination of the mechanisms by which CaMKII regulates VSM cell migration, cognizant of potential isoform-specific functions and/or functions uniquely related to its autophosphorylation state.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Antibodies and other materials. Production and specificity of the antibodies used for detection of the {delta}2-specific isoform of CaMKII and the Thr287 phosphorylated form of CaMKII{delta}2 were described previously (20, 31). Polyclonal antibody specific for the hemagglutinin (HA) epitope was purchased from Upstate Biotechnology (Lake Placid, NY) and monoclonal antibody specific for the Flag epitope was obtained from Sigma (St. Louis, MO). Antibody specifically recognizing the phosphorylated form of phospholamban (PLB; PT17), was purchased from Cyclacel (Dundee, UK). All cell culture media and supplies were obtained from Fisher Scientific (Pittsburgh, PA) unless otherwise specified. Ionomycin was purchased from Calbiochem (La Jolla, CA). PDGF-BB and all other chemicals were purchased from Sigma.

Cell culture. VSM cells were dispersed from thoracic aortas of 200- to 300-g Sprague-Dawley rats as previously described (7). Cells were cultured in combined DMEM/F-12 medium supplemented with 10% fetal bovine serum (FBS) (HyClone, Logan, UT) at 37°C and 5% CO2. Cells from passages 3–10 were used for experiments. Cells were grown to 70% confluence before infection with adenoviral constructs.

Cloning and adenovirus generation. Mutations of CaMKII{delta}2 were engineered using the Transformer Site Directed Mutagenesis kit (Clontech, Palo Alto, CA). Kinase-negative CaMKII{delta}2 was generated by replacing Lys43 with an alanine. Amino acid substitution of Thr287 to aspartic acid generated a constitutively active CaMKII{delta}2 mutant. M. T. Crow provided adenoviral stocks encoding kinase-negative (Ad-KN:{delta}2) and constitutively active (Ad-CA:{delta}2) CaMKII. Adenovirus encoding {beta}-galactosidase (Ad-{beta}Gal) was a gift from R. S. Keller. RT-PCR was used (Titan one-tube RT-PCR kit; Roche, Indianapolis, IN) to clone PLB from isolated rat brain RNA. Primers were designed according to the rat PLB cDNA sequence (accession no. L03382.1): upstream, 5'-GAGAGGATCC(814)ATGGAAAAAGTCCAATACCT(833)-3', and downstream, 5'-GAGAACTCGAG(972)TCACAGAAGCATCACAATG(953)-3'. The amplified product containing the entire coding region was then cloned into pCMV-tag2B (Invitrogen, La Jolla, CA) and subcloned by digesting Flag:PLB cDNA with SnaB1 and Xho1 (New England Biolabs, Beverly, MA) followed by ligation into a pShuttle vector (provided by Dr. Peter A. Vincent, Center for Cardiovascular Sciences, Albany Medical College, Albany, NY) for virus generation. pShuttle:PLB was linearized and introduced by electroporation into BJ5183 cells containing the pAdEasy backbone for recombination. The resulting recombined vector was linearized by Pac1 digestion and transfected into HEK-293 cells for viral packaging.

All adenovirus stocks were propagated by adding small amounts of virus to HEK-293 cells. When cells were ~50% lysed, cells and media were collected, subjected to freeze-thaw cycles three times, and then aliquoted and stored at –80°C. Titer assays were performed according to the method of O'Carroll et al. (14). All assays were performed using {beta}-galactosidase as an adenoviral control at matching multiplicity of infection (MOI).

Cell lysates, immunoprecipitation, and immunoblotting. Thirty minutes before experimentation, growth medium was removed from VSM cells and replaced with Hanks' balanced salt solution (HBSS) supplemented with Ca2+/Mg2+ and 10 mM HEPES, pH 7.4. Reactions were stopped by removing HBSS, transferring the dishes to ice, and adding RIPA lysis buffer (4°C, 10 mM Tris, pH 7.4, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM NaF, 20 mM Na4P2O7, 2 mM Na3VO4, 1% Triton X-100, 10% glycerol, 0.1% SDS, 0.5% deoxycholate, 1 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride, 0.2 U/ml aprotinin) at 0.3 ml/60-mm dish. The lysates and cells were collected into 1.5-ml tubes and then centrifuged at 14,000 rpm at 4°C for 10 min, and the supernatant was collected for Western blot analysis or storage at –20°C.

For immunoprecipitation of PLB, 60-mm dishes infected and treated with an appropriate stimulus were lysed in 500 µl of immunoprecipitate (IP) buffer (500 mM Tris, pH 7.4, 50 mM NaF, 0.1 mM NaVO4, and 0.5% NP-40). Dishes were scraped, and lysates were cleared by centrifugation at 14,000 rpm at 4°C for 10 min. Monoclonal anti-Flag antibody (2 µg) and 40 µl of protein A beads were added to each IP (Pierce, Richmond, CA). After immunoprecipitation overnight at 4°C, they were washed three times the next day in lysis buffer followed by the addition of SDS sample buffer.

Lysates and IPs were resolved by 9 or 15% SDS-PAGE gel and transferred to nitrocellulose. The membranes were blocked in Tris-buffered saline containing 0.2% Tween 20 (TBST) and 5% nonfat dry milk. After blocking, the membranes were incubated in primary antibody for 1 h at room temperature, washed three times with TBST, and incubated with horseradish peroxidase-conjugated secondary antibody (1:1,500 dilution; Amersham) for an additional hour at room temperature, then washed three times with TBST. Membranes were developed using chemiluminescence substrate (Amersham) and exposed to Hyperfilm ECL (Amersham Biosciences, Piscataway, NJ). PLB phosphorylation was quantified by densitometric analysis of the immunoblot enhanced chemiluminescence signals with the use of ImageQuant software (Molecular Dynamics, Sunnyvale, CA).

Additional antibody dilutions used included CaMKII{delta}2 antibody at 1:1,000, polyclonal antibody for phosphorylated CaMKII at 1:500, polyclonal HA and monoclonal Flag antibodies at 1:1,000, and phosphorylated PT17 at 1:5,000.

CaMKII activity assay. Thirty-six to forty-eight hours after infection with adenoviral constructs, 300 µl of lysis buffer (50 mM MOPS, pH 8.6, 100 mM Na4P2O7, 100 mM NaF, 250 mM NaCl, 2 mM Na3VO4, 3 mM EGTA, and 1% NP-40) was added to each 60-mm dish. Lysates were scraped and centrifuged at 14,000 rpm for 10 min at 4°C. Total CaMKII activity in the presence of saturating Ca2+ and calmodulin, as well as autonomous activity, assayed without added activators, was determined as described previously using autocamtide II, a specific peptide substrate (1).

Cell migration assays. Cultured VSM cells were grown in medium containing 10% FBS (as described in Cell culture) for 36–48 h after infection with adenoviral constructs. All 60-mm dishes were washed once in HBSS, trypsinized, and seeded at 150,000 cells/modified Boyden chamber (PET track-etched, 8-µM pores, 12-well format; Becton Dickinson, San Diego, CA) coated with 3 µg/ml fibronectin (Sigma). Chambers were prepared by adding to the lower chambers medium containing either DMEM with 0.4% FBS (control) or 10 ng/ml PDGF-BB in DMEM with 0.4% FBS. Cells were permitted to migrate for 4 h. The tops of the membranes were swabbed to remove cells, and then cells on the bottom surface of the membrane were fixed for 30 min in PBS containing 4% paraformaldehyde (pH 7.4). Cells were stained for 10 min in Coomassie blue. Filters were removed from the chamber and mounted onto microscope slides on which four identically located fields per membrane were averaged for quantification of cell number.

Adhesion assay. Thirty-six to forty-eight hours after infection with adenoviral constructs, the ability of the cells to adhere to a fibronectin-coated surface (10 µg/ml; Sigma) was assayed as previously described (3).

Statistical evaluations and comparisons. All data are expressed as means ± SE. Mean values of groups were compared by ANOVA with post hoc comparisons using the Newman-Keuls test. For all comparisons, P < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Expression and characterization of CaMKII{delta}2 mutants. CaMKII{delta}2 is the major subunit expressed in cultured rat aortic VSM cells (20). To probe the function of this subunit, two HA-tagged mutants were produced and expressed in VSM cells by using replication-deficient adenoviruses (Fig. 1A). One virus (Ad-KN:{delta}2) contained a kinase-negative construct as a result of amino acid substitution (K43A) that prevents the binding of ATP (17). The second adenovirus (Ad-CA:{delta}2) contained a constitutively active construct produced by a charged amino acid substitution at T287D, which mimics autophosphorylation at that site and results in autonomous activity in the absence of bound Ca2+/calmodulin (24).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. A: mutant Ca2+/calmodulin-dependent protein kinase II-{delta}2 (CaMKII{delta}2) subunits. Kinase-negative {delta}2 was generated by substituting alanine for Lys43 (K43A) within the ATP binding domain. Constitutively active {delta}2 (Ad-CA:{delta}2) was generated by substituting aspartic acid for Thr287 (T287D) in the CaMKII autoinhibitory domain. Both mutants contained an NH2-terminal HA epitope. B: immunoblot analysis with an antibody specific to the COOH-terminus of the {delta}2-isoform (IB: CaMKII{delta}2) after infection with adenoviruses containing the kinase-negative (Ad-KN:{delta}2) and constitutively active (Ad-CA:{delta}2) mutants. Adenovirus encoding {beta}-galactosidase (Ad-{beta}Gal) was used as a control for adenoviral infection and resulted in no significant change in endogenous CaMKII{delta}2 levels, indicated by the lower band. Western blot is representative of at least 4 separate experiments.

 
Preliminary experiments using adenoviruses to introduce green fluorescent protein (GFP) into VSM cells established that infection efficiencies in these cells were essentially 100% (data not shown). Increasing the MOI of both Ad-KN:{delta}2 and Ad-CA:{delta}2 resulted in expression of mutant {delta}2-subunits that resolved slightly larger than the endogenous isoform because of addition of the NH2-terminal HA tag. Infection with adenovirus itself did not significantly alter endogenous levels of CaMKII{delta}2, as demonstrated by addition of increasing MOI of Ad-{beta}Gal (Fig. 1B).

To determine the effects of expressing these constructs on CaMKII activity, in vitro kinase assays (1) were performed using lysates of control and infected cells (Fig. 2). CaMKII activity was assayed both with and without added Ca2+ and calmodulin to obtain total and autonomous kinase activity, respectively. Infection of cells with 10 MOI of Ad-KN:{delta}2, which produced approximately fivefold more mutant subunits relative to endogenous subunits (Fig. 1B), decreased total CaMKII specific activity in VSM cell lysates by ~50%. Basal autonomous activity was not detected in cells infected with 10 MOI of Ad-KN:{delta}2 (Fig. 2). Conversely, comparable increases in the expression levels of the constitutively active {delta}2 mutant after infection with 10 MOI of Ad-CA:{delta}2 significantly increased both autonomous and total CaMKII activity in VSM cell lysates (Fig. 2). The level of autonomous activity observed with this MOI of active {delta}2 is comparable to the total Ca2+/calmodulin-stimulated activity in control cells. Infection with Ad-{beta}Gal did not significantly alter CaMKII specific activity.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. CaMKII{delta}2 mutant overexpression affects kinase activity in vitro. CaMKII activity in vascular smooth muscle (VSM) cell lysates after infection with Ad-KN:{delta}2 or Ad-CA:{delta}2 was assayed in vitro using a selective peptide substrate, autocamtide II (1). After infection with 10 multiplicities of infection (MOI) of Ad-KN:{delta}2, total CaMKII (+Ca2+/CaM) activity was reduced to 50% of that in control lysates. Infection with 10 MOI of Ad-CA:{delta}2 resulted in a significant increase in autonomous CaMKII activity assayed in the absence of Ca2+/CaM. Infection of cells with control Ad-{beta}Gal (<=100 MOI) had no significant effect on CaMKII activity. Results are means of 2 determinations in 2 separate experiments.

 
To test the actions of mutant constructs on CaMKII activity within intact VSM cells, phosphorylation of a known substrate for CaMKII was evaluated after stimulation of cells with a Ca2+-dependent stimulus (ionomycin). Because endogenous substrates for CaMKII in VSM cells have not yet been well defined, we overexpressed PLB, which is known to be phosphorylated by CaMKII specifically on Thr17 (12, 22) and has been used as a readout of CaMKII activity in the heart (11, 36). PLB is not expressed significantly in these cultured VSM cells (data not shown); therefore, a Flag-tagged PLB cDNA was engineered into an adenovirus (Ad-PLB) for high-efficiency infection and expression. Infection with Ad-PLB resulted in PLB protein expression in the cells, as detected by immunoblotting with an anti-Flag antibody (Fig. 3, A and B). In VSM cells coinfected with control Ad-{beta}Gal (MOI = 10) and Ad-PLB (MOI = 160), ionomycin stimulated a significant increase in the phosphorylation of PLB on Thr17 (Fig. 3B), which was inhibited by KN-93 pretreatment (Fig. 3A), validating this as a readout of endogenous CaMKII activity. Introduction of the kinase-negative {delta}2 mutant resulted in inhibition of ionomycin-stimulated Thr17 phosphorylation by 65 ± 10% (n = 3), indicating a dominant-negative function of the construct with respect to endogenous CaMKII{delta}2-dependent substrate phosphorylation. Introduction of Ad-CA:{delta}2 stimulated PLB Thr17 phosphorylation even in the absence of the ionomycin stimulus, consistent with the constitutive activity of the expressed kinase (Fig. 3B). Addition of a Ca2+ stimulus resulted in further phosphorylation of PLB, consistent with in vitro assays (Fig. 2) indicating that the T287D mutation confers only partial activation of the kinase in the absence of added Ca2+/calmodulin.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. CaMKII{delta}2-dependent phosphorylation of phospholamban (PLB) in cultured VSM cells. Cultured VSM cells were infected with an adenovirus containing a Flag-tagged PLB at 320 (A) or 160 MOI (B). Expression was detected by immunoblotting with anti-Flag antibody (IB: Flag). CaMKII-dependent phosphorylation of PLB was detected by immunoblotting with an antibody recognizing the phosphorylated Thr17 residue (IB: PT17 PLB) of immunoprecipitated PLB. A: cells expressing the Ad-PLB construct were stimulated with ionomycin for 45 s, and phosphorylation on T17 of PLB was detected. The level of phosphorylation was attenuated by pretreating the cells for 30 min with 30 µM KN-93, the pharmacological inhibitor of CaMKII. B: cultured VSM cells were coinfected with 160 MOI of Ad-PLB and 10 MOI of Ad-KN:{delta}2, Ad-CA:{delta}2, or control Ad-{beta}Gal. Expression of mutant CaMKII{delta}2 constructs was detected by immunoblotting with anti-hemagglutinin (HA) antibody. Expression of kinase-negative CaMKII{delta}2 (K43A) attenuated ionomycin-stimulated phosphorylation of PLB. Expression of the constitutively active CaMKII{delta}2 (T287D) caused a significant increase in PLB Thr17 phosphorylation in the absence of a Ca2+-mobilizing stimulus. Blots are representatives of 3 separate experiments.

 
Effects of CaMKII{delta}2 mutants on Thr287 autophosphorylation. Autophosphorylation of CaMKII on Thr287 has been shown to be important not only for calmodulin trapping and autonomous activity of the enzyme (9, 23) but also for targeting the holoenzyme (2). To determine the effects of overexpressing the CaMKII{delta}2 mutants on Thr287 autophosphorylation, VSM cells were stimulated with ionomycin and the lysates were immunoblotted with an antibody that specifically recognizes phosphorylated Thr287, as previously described (31). In uninfected cells (Fig. 4, A and B) or in cells infected with Ad-{beta}Gal (MOI = 10) (Fig. 4B), stimulation with ionomycin resulted in transient Thr287 autophosphorylation, which peaked 45 s–1 min after the addition of ionomycin and fell to near basal levels after 5 min. Pretreatment of VSM cells for 30 min with the pharmacological inhibitor of CaMKII, KN-93, attenuated this autophosphorylation event (Fig. 4A). Conversely, infection with Ad-KN:{delta}2 (MOI = 10) did not inhibit ionomycin-stimulated Thr287 autophosphorylation. In fact, expressed kinase-negative subunits became phosphorylated on Thr287 in parallel with the endogenous subunits (Fig. 4B). The overexpression of constitutively active CaMKII{delta}2 after infection with Ad-CA:{delta}2 (MOI = 10) blocked ionomycin-stimulated autophosphorylation of Thr287 in the endogenous subunits and, because of the T287D mutation, was not itself a substrate for intersubunit autophosphorylation reactions (Fig. 4B).



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 4. CaMKII{delta}2 mutant overexpression affects autophosphorylation of CaMKII{delta}2 subunits. Immunoblot analysis with an antibody that specifically recognizes the autophosphorylated Thr287 residue of CaMKII (IB: phospho-CaMKII) after treatment of cells with the Ca2+ ionophore ionomycin is shown. A: cultured VSM cells were treated with ionomycin for 45 s, resulting in an increase in Thr287 phosphorylation. Pretreatment with the pharmacological inhibitor KN-93 (30 µM) for 30 min before stimulation caused attenuation of autophosphorylation. B: in cells infected with Ad-KN:{delta}2 (MOI = 10), ionomycin stimulated autophosphorylation of overexpressed kinase-negative subunits. In cultured cells infected with Ad-CA:{delta}2 (MOI = 10) and expressing constitutively active CaMKII{delta}2, ionomycin-stimulated autophosphorylation of endogenous {delta}2-subunits was blocked. Infection with control adenovirus (Ad-{beta}Gal; MOI = 10) demonstrated no effects on CaMKII{delta}2 subunit autophosphorylation in response to ionomycin stimulation. All blots shown are representative of at least 4 separate experiments.

 
Kinase-negative or constitutively active CaMKII{delta}2 has no effect on VSM cell adhesion. To determine whether VSM cell adhesion was affected by the mutant {delta}2 constructs, cells were infected with either Ad-KN:{delta}2 or Ad-CA:{delta}2, and their adherence to fibronectin-coated dishes was assayed (3). As shown in Figure 5, VSM cell adherence increased for 2 h, and overexpression of either the kinase-negative or constitutively active mutant had no significant effects on adherence, suggesting that the effects of each mutant on cell migration in the modified Boyden chamber assay (described below) were not due to changes in adhesion efficiency.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5. Adhesion of VSM cells expressing CaMKII{delta}2 mutants. Cultured VSM cells were infected with 10 MOI of Ad-{beta}Gal, Ad-KN:{delta}2, or Ad-CA:{delta}2 . After 36 h, the cells were suspended, and adherence to fibronectin-coated dishes was assayed for 2 h. Adherent cells were stained with toluidine blue and lysed, and absorbance at 595 nm was determined. The mutant CaMKII{delta}2 constructs did not affect cell adhesion to fibronectin significantly at the assayed time points (n = 6 determinations). Values are means ± SE for 3 separate experiments.

 
Effects of kinase-negative and constitutively active CaMKII{delta} on VSM cell migration. The effects of overexpressing mutant CaMKII{delta}2 constructs on VSM cell migration were evaluated in a modified Boyden chamber assay by using PDGF-BB (Fig. 6A) as a chemotactic stimulus. In control VSM cells infected with 10 MOI of Ad-{beta}Gal, addition of PDGF to the lower chamber stimulated a threefold increase in the number of cells migrating to the lower side of the membrane. Expression of the kinase-negative CaMKII{delta}2 subunit, which inhibited endogenous CaMKII activity by 65% (Fig. 3), significantly increased the number of cells migrating to the lower chamber under unstimulated conditions and potentiated the response to PDGF (P < 0.05; Fig. 6, A and B). In contrast, pretreatment with KN-93, a purportedly selective CaMKII inhibitor, at concentrations previously shown to maximally inhibit CaMKII{delta}2 activity in these cells (1, 31), significantly inhibited PDGF-induced VSM migration in control cells (Fig. 7). Similar results were found with the use of a mixed stimulus (conditioned medium) for chemotaxis (data not shown). Furthermore, acute overexpression of the constitutively active CaMKII{delta}2 mutant significantly decreased the number of cells migrating in response to PDGF (P < 0.05; Fig. 6, A and B). The inhibitory effects of constitutively active CaMKII{delta}2 and KN-93 pretreatment were nonadditive (Fig. 7).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6. CaMKII{delta}2 mutant overexpression affects chemotactic VSM cell migration. VSM cells were infected with 10 MOI of Ad-{beta}Gal, Ad-KN:{delta}2, or Ad-CA:{delta}2. After 36 h, cell migration was assayed using a modified Boyden chamber approach. A: representative fields of infected VSM cells after 4 h migration in response to no stimulus (0.4% FBS) or to 10 ng/ml PDGF-BB added to the lower chamber. Cells on the lower surface of the membrane were stained with Coomassie blue. B: quantification of VSM cell migration in unstimulated controls and after addition of 10 ng/ml PDGF-BB to the lower chamber for 4 h. Values are means ± SE for 3 separate experiments with Ad-KN:{delta}2- and Ad-CA:{delta}2-infected cells (n = 6) and for 6 separate experiments with Ad-{beta}Gal control (n = 12). *P < 0.05, PDGF treated compared with unstimulated; {dagger}P < 0.05 compared with Ad-{beta}Gal controls.

 


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 7. Effect of KN-93 on chemotactic VSM cell migration. VSM cells were infected with 10 MOI of Ad-{beta}Gal or Ad-CA:{delta}2. After 36 h, cell migration was assayed in response to addition of 10 ng/ml PDGF-BB with and without addition of the inhibitor of CaMKII activation, KN-93 (30 µM). Values are means ± SE (n = 6). *P < 0.05, KN-93 treated compared with PDGF alone; n.s., not statistically significant.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Although all CaMKII isoforms have conserved catalytic and regulatory domains and therefore have similar kinetic properties, recent studies have indicated significant isoform-dependent differences in subcellular localization and protein targeting (2, 21, 30). Therefore, in attempting to understand CaMKII function in a given cell type, it is important to consider the isoform expression pattern. We (20) previously identified the {delta}2-isoform of CaMKII as the major subtype within cultured rat aortic VSM cells. To determine specific functions of this subunit, in this study we validated and applied molecular approaches by using CaMKII{delta}2 mutants with altered regulatory properties to manipulate cellular CaMKII activity. Because this study, to our knowledge, is the first functional assessment of a kinase-negative CaMKII construct in any cell, the effects of expressing this mutant on endogenous CaMKII activity, including autophosphorylation reactions, were carefully characterized. To provide an unambiguous readout of endogenous or overexpressed kinase activity, PLB Thr17 phosphorylation was used as a specific substrate (11, 36). Our results indicate phosphorylation of PLB by endogenous CaMKII and inhibition of this activity with KN-93 or approximately fivefold overexpression of the kinase-negative CaMKII{delta}2 mutant relative to endogenous kinase. Furthermore, this level of kinase-negative mutant expression inhibited CaMKII activity in VSM lysates assayed in vitro. Thus the results of both approaches indicate that overexpression of this construct is dominant negative with respect to CaMKII substrate phosphorylation.

Analysis of CaMKII{delta}2 phosphorylation on Thr287, however, indicated that overexpression of the kinase-negative mutant at this level did not block the highly cooperative (17, 23) autophosphorylation reactions and, in fact, that it served as a substrate for these reactions (Fig. 4). Because the kinase-negative subunit is unable to catalyze autophosphorylation, and because these reactions have been demonstrated to be intersubunit within the multimeric holoenzyme (4), these data indicate that the mutant subunit integrates into holoenzymes with endogenous {delta}2-subunits and suggest proper targeting of the mutant subunits. Conversely, in cells overexpressing the constitutively active mutant, endogenous CaMKII{delta}2 Thr287 autophosphorylation was inhibited. This result has a number of potential explanations, including inactivating autophosphorylations catalyzed by the mutant on Thr306/307 in the calmodulin binding domain (19) and/or upregulated phosphatase activities enhancing reversal of the autophosphorylation events. Regardless of the mechanisms involved, overexpressing these mutants in Thr287 autophosphorylation could be an important consideration in interpreting the functional effects of these mutants, as in the present study and in previously published experiments in which acute (13) or stable (15, 35) overexpression approaches were used.

Several previous reports have indicated a role for CaMKII in VSM cell migration (13, 15, 35). A consistent finding confirmed in the present study is that selective pharmacological inhibitors of CaMKII (KN-62 or KN-93) inhibit migration of VSM cells toward chemotactic stimuli (13, 15). These agents act by interfering with Ca2+/calmodulin binding and subsequent activation, including autophosphorylation reactions (Fig. 4A). In the present study, however, introduction of the kinase-negative CaMKII{delta}2 mutant into VSM cells enhanced migration toward PDGF (Fig. 6) or conditioned medium. We currently have no definitive explanation for this discrepancy in results with the use of the different approaches. Potential explanations are that KN-93 exerts nonspecific effects on VSM cell migration or that the kinase-negative construct enhances migration through an effect unrelated to CaMKII per se. Another, more interesting explanation that is consistent with both the pharmacological and molecular approaches is that the requirement for CaMKII activation in cell migration necessitates autophosphorylation.

A requirement for CaMKII autophosphorylation in cell migration is also consistent with the results obtained with overexpression of the constitutively active CaMKII{delta}2 mutant. In these experiments, infection with constitutively active T287D mutant was titrated to achieve a level of expression that resulted in autonomous activity that was quantitatively comparable to the maximum levels of endogenous Ca2+/calmodulin-stimulated activity expressed in normal cells (Fig. 2). As discussed above, however, the effect of overexpressing this mutant on autophosphorylation of endogenous subunits was inhibitory, and the net effect on VSM cell migration also was inhibitory.

Similar studies using overexpressed constitutively active CaMKII mutants have been published, but with different conclusions. In general, the prior studies found enhanced VSM cell migration (35) or rescue of KN-62 or KN-93 inhibition of PDGF-stimulated cell migration (13, 15). Differences between the current and prior studies may factor into why essentially opposite results were found in our study. In many of the previous studies, the constitutively active construct was stably expressed (15, 35). It could be expected that this approach would result in significant adaptive changes, including the induction of phosphatase activity, as indicated by experiments evaluating CaMKII in VSM cell migration in response to wounding (35). With the use of the more acute adenoviral infection approach, as in the present study, there is less time for such adaptive changes to occur. In addition, in those prior experiments in which constitutively active CaMKII constructs were overexpressed using an adenoviral delivery system, the constructs were mutants of the CaMKII{alpha} isoform (13) and contained a second charged residue substitution (V287D) in addition to the charge substitution at the autophosphorylation site in the {alpha}-subunit (T286D). To the extent that unique sequences in the {delta}2-isoform and/or autophosphorylation levels may be important in holoenzyme targeting, the more densely charged, constitutively active {alpha}-subunit may act differently from the constitutively active {delta}2-construct used in the present study. A potential requirement for CaMKII autophosphorylation in VSM cell migration (discussed above) might be satisfied by the more densely charged mutant and not by the {delta}2-mutant, which also inhibited endogenous subunit autophosphorylation. Finally, an important limitation of any experiment expressing a constitutively active multifunctional serine/threonine kinase is persistent, unregulated phosphorylation of normal substrates as well as recruitment of nonphysiological substrates.

With the use of new molecular approaches, the present study indicates an important role for CaMKII{delta}2 in regulating cultured VSM cell migration. If interpreted strictly in the context of CaMKII{delta}2 activity toward substrates other than itself, the results are not consistent with the effects of chemical inhibitors of the kinase. Alternatively, an inclusive interpretation of the results could point to a requirement for CaMKII autophosphorylation in VSM cell chemotactic migration. Although it is speculation at this point, this possibility is consistent with an increasing number of results in other systems indicating the importance of autophosphorylation events in directing CaMKII holoenzyme targeting (2) and enzymatic activity (34). The ultimate cellular mechanisms underlying CaMKII actions on cell migration are also not yet known but could be related to effects of the kinase on the stability and turnover of focal adhesions (32) or on the activity of the contractile apparatus, perhaps by inhibiting myosin light chain kinase activity (28). The present results indicate the need for additional studies to clarify the mechanisms by which CaMKII{delta}2 regulates VSM cell migration and whether these results can be extrapolated to other cell systems.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the American Heart Association-Northeast Affiliate Predoctoral Training Grant 0215300T (to P. J. Pfleiderer), National Institutes of Health Predoctoral Training Grant T32-HL-07194, and National Heart, Lung, and Blood Institute Grant R01-HL-49426 (to H. A. Singer).


    ACKNOWLEDGMENTS
 
We acknowledge the technical assistance of Ginny Foster in the preparation and maintenance of cell cultures and thank Wendy Hobb for expert assistance in the preparation of the manuscript.


    FOOTNOTES
 

Address for reprint requests and other correspondence: H. A. Singer, Professor and Director, Center for Cardiovascular Sciences, Albany Medical College (MC8), 47 New Scotland Ave., Albany, NY 12208 (E-mail: singerh{at}mail.amc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
1. Abraham ST, Benscoter H, Schworer CM, and Singer HA. In situ Ca2+ dependence for activation of Ca2+/calmodulin-dependent protein kinase II in vascular smooth muscle cells. J Biol Chem 271: 2506–2513, 1996.[Abstract/Free Full Text]

2. Bayer KU and Schulman H. Regulation of signal transduction by protein targeting: the case for CaMKII. Biochem Biophys Res Commun 289: 917–923, 2001.[CrossRef][ISI][Medline]

3. Bilato C, Curto KA, Monticone RE, Pauly RR, White AJ, and Crow MT. The inhibition of vascular smooth muscle cell migration by peptide and antibody antagonists of the alphavbeta3 integrin complex is reversed by activated calcium/calmodulin-dependent protein kinase II. J Clin Invest 100: 693–704, 1997.[Abstract/Free Full Text]

4. Bradshaw JM, Hudmon A, and Schulman H. Chemical quenched flow kinetic studies indicate an intraholoenzyme autophosphorylation mechanism for Ca2+/calmodulin-dependent protein kinase II. J Biol Chem 277: 20991–20998, 2002.[Abstract/Free Full Text]

5. Caran N, Johnson LD, Jenkins KJ, and Tombes RM. Cytosolic targeting domains of gamma and delta calmodulin-dependent protein kinase II. J Biol Chem 276: 42514–42519, 2001.[Abstract/Free Full Text]

6. Dosemeci A and Albers RW. A mechanism for synaptic frequency detection through autophosphorylation of CaM kinase II. Biophys J 70: 2493–2501, 1996.[Abstract]

7. Geisterfer AA, Peach MJ, and Owens GK. Angiotensin II induces hypertrophy, not hyperplasia, of cultured rat aortic smooth muscle cells. Circ Res 62: 749–756, 1988.[Abstract]

8. Hanson PI, Meyer T, Stryer L, and Schulman H. Dual role of calmodulin in autophosphorylation of multifunctional CaM kinase may underlie decoding of calcium signals. Neuron 12: 943–956, 1994.[ISI][Medline]

9. Hashimoto Y, Schworer CM, Colbran RJ, and Soderling TR. Autophosphorylation of Ca2+/calmodulin-dependent protein kinase II. Effects on total and Ca2+-independent activities and kinetic parameters. J Biol Chem 262: 8051–8055, 1987.[Abstract/Free Full Text]

10. Hudmon A and Schulman H. Structure-function of the multifunctional Ca2+/calmodulin-dependent protein kinase II. Biochem J 364: 593–611, 2002.[CrossRef][ISI][Medline]

11. Ji Y, Li B, Reed TD, Lorenz JN, Kaetzel MA, and Dedman JR. Targeted inhibition of Ca2+/calmodulin-dependent protein kinase II in cardiac longitudinal sarcoplasmic reticulum results in decreased phospholamban phosphorylation at threonine 17. J Biol Chem 278: 25063–25071, 2003.[Abstract/Free Full Text]

12. Li L, Chu G, Kranias EG, and Bers DM. Cardiac myocyte calcium transport in phospholamban knockout mouse: relaxation and endogenous CaMKII effects. Am J Physiol Heart Circ Physiol 274: H1335–H1347, 1998.[Abstract/Free Full Text]

13. Lundberg MS, Curto KA, Bilato C, Monticone RE, and Crow MT. Regulation of vascular smooth muscle migration by mitogen-activated protein kinase and calcium/calmodulin-dependent protein kinase II signaling pathways. J Mol Cell Cardiol 30: 2377–2389, 1998.[CrossRef][ISI][Medline]

14. O'Carroll SJ, Hall AR, Myers CJ, Braithwaite AW, and Dix BR. Quantifying adenoviral titers by spectrophotometry. Biotechniques 28: 408–10, 412, 2000.[ISI][Medline]

15. Pauly RR, Bilato C, Sollott SJ, Monticone R, Kelly PT, Lakatta EG, and Crow MT. Role of calcium/calmodulin-dependent protein kinase II in the regulation of vascular smooth muscle cell migration. Circulation 91: 1107–1115, 1995.[Abstract/Free Full Text]

16. Putkey JA and Waxham MN. A peptide model for calmodulin trapping by calcium/calmodulin-dependent protein kinase II. J Biol Chem 271: 29619–29623, 1996.[Abstract/Free Full Text]

17. Rich RC and Schulman H. Substrate-directed function of calmodulin in autophosphorylation of Ca2+/calmodulin-dependent protein kinase II. J Biol Chem 273: 28424–28429, 1998.[Abstract/Free Full Text]

18. Schwartz SM, Campbell GR, and Campbell JH. Replication of smooth muscle cells in vascular disease. Circ Res 58: 427–444, 1986.[Abstract]

19. Schworer CM, Colbran RJ, Keefer JR, and Soderling TR. Ca2+/calmodulin-dependent protein kinase II. Identification of a regulatory autophosphorylation site adjacent to the inhibitory and calmodulin-binding domains. J Biol Chem 263: 13486–13489, 1988.[Abstract/Free Full Text]

20. Schworer CM, Rothblum LI, Thekkumkara TJ, and Singer HA. Identification of novel isoforms of the delta subunit of Ca2+/calmodulin-dependent protein kinase II. Differential expression in rat brain and aorta. J Biol Chem 268: 14443–14449, 1993.[Abstract/Free Full Text]

21. Shen K, Teruel MN, Subramanian K, and Meyer T. CaMKIIbeta functions as an F-actin targeting module that localizes CaMKIIalpha/beta heterooligomers to dendritic spines. Neuron 21: 593–606, 1998.[ISI][Medline]

22. Simmerman HK, Collins JH, Theibert JL, Wegener AD, and Jones LR. Sequence analysis of phospholamban. Identification of phosphorylation sites and two major structural domains. J Biol Chem 261: 13333–13341, 1986.[Abstract/Free Full Text]

23. Singla SI, Hudmon A, Goldberg JM, Smith JL, and Schulman H. Molecular characterization of calmodulin trapping by calcium/calmodulin-dependent protein kinase II. J Biol Chem 276: 29353–29360, 2001.[Abstract/Free Full Text]

24. Smith MK, Colbran RJ, Brickey DA, and Soderling TR. Functional determinants in the autoinhibitory domain of calcium/calmodulin-dependent protein kinase II. Role of His282 and multiple basic residues. J Biol Chem 267: 1761–1768, 1992.[Abstract/Free Full Text]

25. Srinivasan M, Edman CF, and Schulman H. Alternative splicing introduces a nuclear localization signal that targets multifunctional CaM kinase to the nucleus. J Cell Biol 126: 839–852, 1994.[Abstract]

26. Strack S and Colbran RJ. Autophosphorylation-dependent targeting of calcium/ calmodulin-dependent protein kinase II by the NR2B subunit of the N-methyl-d-aspartate receptor. J Biol Chem 273: 20689–20692, 1998.[Abstract/Free Full Text]

27. Takeuchi Y, Yamamoto H, Fukunaga K, Miyakawa T, and Miyamoto E. Identification of the isoforms of Ca2+/calmodulin-dependent protein kinase II in rat astrocytes and their subcellular localization. J Neurochem 74: 2557–2567, 2000.[CrossRef][ISI][Medline]

28. Tansey MG, Luby-Phelps K, Kamm KE, and Stull JT. Ca2+-dependent phosphorylation of myosin light chain kinase decreases the Ca2+ sensitivity of light chain phosphorylation within smooth muscle cells. J Biol Chem 269: 9912–9920, 1994.[Abstract/Free Full Text]

29. Tobimatsu T and Fujisawa H. Tissue-specific expression of four types of rat calmodulin-dependent protein kinase II mRNAs. J Biol Chem 264: 17907–17912, 1989.[Abstract/Free Full Text]

30. Urushihara M and Yamauchi T. Role of beta isoform-specific insertions of Ca2+/calmodulin-dependent protein kinase II. Eur J Biochem 268: 4802–4808, 2001.[Abstract/Free Full Text]

31. Van Riper DA, Schworer CM, and Singer HA. Ca2+-induced redistribution of Ca2+/calmodulin-dependent protein kinase II associated with an endoplasmic reticulum stress response in vascular smooth muscle. Mol Cell Biochem 213: 83–92, 2000.[CrossRef][ISI][Medline]

32. Wehrle-Haller B and Imhof BA. Actin, microtubules and focal adhesion dynamics during cell migration. Int J Biochem Cell Biol 35: 39–50, 2003.[CrossRef][ISI][Medline]

33. Welt FG and Rogers C. Inflammation and restenosis in the stent era. Arterioscler Thromb Vasc Biol 22: 1769–1776, 2002.[Abstract/Free Full Text]

34. Yasugawa S, Fukunaga K, Yamamoto H, Miyakawa T, and Miyamoto E. Autophosphorylation of Ca2+/calmodulin-dependent protein kinase II: effects on interaction between enzyme and substrate. Jpn J Pharmacol 55: 263–274, 1991.[ISI][Medline]

35. Zhang S, Yang Y, Kone BC, Allen JC, and Kahn AM. Insulin-stimulated cyclic guanosine monophosphate inhibits vascular smooth muscle cell migration by inhibiting Ca/calmodulin-dependent protein kinase II. Circulation 107: 1539–1544, 2003.[Abstract/Free Full Text]

36. Zhang T, Maier LS, Dalton ND, Miyamoto S, Ross J Jr, Bers DM, and Brown JH. The deltaC isoform of CaMKII is activated in cardiac hypertrophy and induces dilated cardiomyopathy and heart failure. Circ Res 92: 912–919, 2003.[Abstract/Free Full Text]