1College of Physicians and Surgeons of Columbia University, New York 10032; 2Queens College and Graduate School and University Center of City University of New York, Flushing 11367; and 3State University of New York at Buffalo, Buffalo, New York 14214
Submitted 27 May 2004 ; accepted in final form 16 July 2004
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
iron regulatory proteins; iron-responsive element; labile iron pool; transferrin; HFE; neutrophil gelatinase-associated lipocalin; siderophore
|
Direct measurement of cytoplasmic iron is possible with calcein and phen-green. These dyes are very important reagents because they detect changes in iron over seconds to minutes and their responses can be quantified (20, 21). One must assume, however, that they chelate iron from the same pool that interacts with the IRPs. Moreover, the dyes are used at concentrations that could perturb these pools. In addition, reversal of the quenched signal can require changing pH or the addition of large doses of iron chelators (21), protocols that are difficult to use in complex tissues. Measurement of iron over hours to days is also not possible with calcein or phen-green because of bleaching and leakage of the dye. Hence, although the dyes are invaluable to detect initial changes in iron that, for example, might occur with acute modulation of iron transporters, new methods are required for continuous evaluation of iron loading in growing and differentiating cells.
The best approach to studying iron metabolism in complex organs is to use methods that can assay single cells, because mechanisms of iron acquisition may vary among adjacent cells. For example, we found a gradient of transferrin uptake and transferrin receptor 1 expression that correlated with the appearance of developmental milestones in the developing kidney (Refs. 19, 24, 87; Barasch J, unpublished observations). Similarly, stage-specific expression and a functional requirement for transferrin receptor 1 were found in the hematopoietic and lymphoid lineages (Refs. 8, 40, 49, 59, 76; reviewed in Ref. 64), but other cell types were indifferent to the absence of transferrin receptor 1 and hence must have obtained iron by an alternative pathway (59). Cellular iron content might also vary by stage and by lineage because different regions of the brain have a different content of ferritin (68, 74) and the IRPs are developmentally regulated (47, 74) and differentially expressed in different cells of an organ (56). These studies indicate that examination of tissue iron requires methods to analyze the IRP-IRE interaction and the labile iron pool at the level of single cells.
A simple method to follow IRP-IRE interactions was suggested by earlier studies that demonstrated that the 5'-IRE can regulate the expression of reporters in vitro (see, e.g., Refs. 29, 37, 52) and that a number of different promoters can be used to drive reporter constructs in vivo (see, e.g., Ref. 77). Analysis of an iron reporter in tissues, however, requires the simultaneous expression of two reporters that are differentially sensitive to iron, to permit ratio imaging of the fluorescent signal. Ratio imaging allows the measurement of iron to be normalized for an iron-insensitive component of reporter expression and for iron-insensitive variations in the detection of fluorescence. To produce two iron-dependent reporters that are differentially sensitive to iron, we ligated the 5'-UTR domain of the ferritin gene and the 3'-UTR domain of the transferrin receptor protein to destabilized forms of green fluorescent protein (GFP)-type proteins. We tested these reporters in cell cultures to learn whether they respond in a manner predicted by a variety of published experiments that have manipulated iron, transferrin, and the IRP system. We found that these reporters rapidly and reversibly respond to changes in cell iron or changes in the IRP-IRE interaction (Fig. 1). When we used both the 5' and the 3' configurations of the IREs with different fluors, we found that we could measure reciprocal responses to iron in the same cell. Because these reporters capitalize on endogenous mechanisms of iron-mediated gene expression, they are likely to assay the same pool of iron that regulates gene expression. We have used these reporters to monitor iron uptake from different sources, including a novel iron transporter called siderocalin, a lipocalin containing a bacterial siderophore (28). Some of these data have been presented in brief abstract form in 2002 (4) and 2003 (5) at the annual meeting of the American Society of Nephrology and in 2003 (3) at the annual meeting of the American Society of Hematology. An abstract by Henderson et al. (36) is also relevant.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Expression of iron reporters in 293 cells. The IRE and control reporters were introduced into 293 cell lines with Lipofectamine 2000 (Invitrogen), and plasmid-containing lines were then selected by neomycin (400 µg/ml) in DMEM (high glucose) with 10% FCS at 37°C in 5% CO2. Eight colonies with the 5'-IRE-YFP probe, six colonies with 3'-IRE-YFP, and eight colonies with non-IRE-YFP were expanded in neomycin and analyzed by a fluorescence-activated cell sorter (FACS; Excalibur) with a 488-nm laser. Before each experiment, the cells were rinsed and recultured in serum-free DMEM (0.2 µM iron) overnight to remove most of the serum. The response to iron loading was determined by culture with holotransferrin (1100 µg/ml; Sigma), iron-containing or iron-free siderocalin/neutrophil gelatinase-associated lipocalin (Ngal, 50 µg/ml; see below), or ferric ammonium citrate or ferric chloride (125 µM) in serum-free DMEM. The response to iron chelation was examined with deferoxamine (DFO) mesylate (10 or 20 µM). Single 293 cells expressing IRE-YFP were also followed by time-lapse cinematography. Cells were seeded in 25-mm dishes in DMEM with HEPES (10 mM, pH 7.4), and YFP fluorescence was detected in individual cells with a Nikon inverted microscope, a Hamamatsu digital camera and controller, a Prior Proscan positioner, and a Sage Aircurtain (Watanabe T and Costantini F, unpublished observations). Cells were observed for 3 h to establish baseline fluorescence and then were treated with ferric ammonium citrate (25 µM). Images were collected at 30-min intervals and quantified with the ImageJ program (http://rsb.info.nih.gov/ij/). A relative standard deviation was derived for analysis of ratio imaging (57). The response to iron was also detected by YFP immunoblot with rabbit anti-GFP/YFP antibodies (Clontech) and by fluorescent microscopy. Anti-GAPDH (Chemicon) and anti-transferrin receptor 1 (Zymed) antibodies were used in control experiments.
Retroviral constructs. The 5'-IRE-d2EYFP fragment was isolated by digestion with XhoI and NotI and then ligated into pMIG, a retroviral vector [based on MSCV; kindly provided by Dr. Luk van Parijs (14)], that was modified by inserting a 30-base pair linker containing NotI. The d2EYFP fragment was cloned into the modified MIG vector at the XhoI and NotI sites. For the 3'-IRE-d2EYFP fragment, the 3'-IRE sequence was transferred to the MIG-d2EYFP at the 3' NotI site. To produce viral particles, we cotransfected these constructs with retroviral packaging constructs (pCL-Eco) (58) and pSVS-G (Clontech) with Lipofectamine 2000 (Invitrogen) into 293 cells. Virus was collected from 48- to 72-h media.
Expression of iron reporters in TRvb-1 cells.
TRvb-1 cells [a kind gift of T. McGraw (54)] were grown in 24-well plates to 80% confluence under continuous selection with geneticin (200 µg/ml). TRvb-1/HFE and TRvb-1/HFE/2-microglobulin cells [kind gifts of W. Sly (81)] were grown with geneticin (200 µg/ml) and puromycin (10 µg/ml). The iron reporters were introduced by viral infection with polybrene (16 µg/ml) and centrifugation (1,800 rpm, 90 min). Cells were analyzed after two passages.
Siderocalin/Ngal. Recombinant, purified Ngal from BL-21 bacteria (87) was obtained by glutathione S-transferase (GST)-reduced glutathione (GSH) chromatography (Pharmacia) followed by gel filtration to remove impurities (Superdex75, SMART System, Pharmacia). Ngal was loaded with enterochelin in either its iron-free or in its iron-saturated form (EMC Microcollection), using a 2-to-1 molar ratio of siderophore:siderocalin/Ngal, washed in a 10-kDa microcon, and added to the reporter lines. Alternatively, 293 cells or TRvb-1 cells stably expressing 5'- and 3'-IRE-YFP reporters were transfected with 24p3/Ngal containing a signal sequence (pcDNAIII vector), and the cells were analyzed after 48 h by FACS.
IRP.
IRP-1 was analyzed by immunoblot (Alpha Diagnostics). IRP-1 and IRP-2 were analyzed by real-time PCR from 293 cell RNA prepared by on-column DNase digestion (Qiagen). Total RNA (1.3 µg in 50 µl) was reverse transcribed with an oligo(dT) primer (1 µM), 10 U of RNase inhibitor (Invitrogen), and 4 U of Omniscript reverse transcriptase for 60 min at 37°C. Human IRP-1 (GenBank accession no. M58510.1) was amplified with forward primer ATGCGTGATGCTGTGAAAAA (positions 81100) and reverse primer GTTGTGAAAAGCCTGGGAAC (positions 281262), and human IRP-2 (GenBank accession no. NM004136.1) was amplified with forward primer AGTCGGCACAGATTCACACA (positions 882901) and reverse primer AGCCACTCCTACTTGCCTGA (positions 11011082), using the cDNA (1 µl) and 200 nM of each primer with dNTP (200 nM), MgCl (2 mM), rTaq DNA polymerase (1.25 U, Invitrogen) for 35 cycles at 95°C (30 s), 60°C (30 s), and 72°C (30 s). The products were analyzed by 2% agarose gel and then sequenced. Real-time PCR used 0.2 µl of cDNA and 200 nM of each primer with 1x iQ SYBR green super mix (Bio-Rad) for 4060 cycles at 95°C (30 s) and 60°C (30 s) and the MyiQ single-color real-time PCR detection system (Bio-Rad). The product was quantified by comparison with -actin mRNA (GenBank accession no. BC014861) with forward primer CCTCGCCTTTGCCGATCC (positions 1330) and reverse primer GGATCTTCATGAGGTAGTCAGTC (positions 651629). Comparison of 293 cDNA and human liver cDNA (Clontech, BD Biosciences) was calculated according to the comparative threshold cycle for detection (CT) method, where the amount of target, normalized to endogenous
-actin, and relative to a calibrator, is given by 2
Ct. The specificity of the amplifications was checked by melting curve analysis. Electrophoretic mobility shift assay also evaluated IRP binding, but, as previously reported (6), IRP-1 dominates the gel shift in 293 cells.
Nematode strains and manipulations. To create iron reporters in Caenorhabditis elegans, we inserted the sma-3 promoter (83) into pPD117.01-GFP between SalI and ClaI. 5'-IRE and 3'-IRE sequences were then amplified from the mammalian IRE-YFPs with primers 5'-IRE reverse(r) 5'-CCGGTACCGTCATGGCTGATCCGGAGT-3', 5'-IRE forward (f) 5'-CCATCGATCAGCGCCTTGGAGGTCCCGT-3', 3'-IREr 5'-CCGGGCCCTCACCAGCAAACATTATAAA-3', and 3'-IREf 5'-CCACTAGTAGACTCAATTTGTCAGACTT-3' and inserted into sma-3::GFP. Worms (N2 strain) were then microinjected with these plasmids (20 ng/µl) (55) together with 100 ng/µl pRF4 (rol-6 plasmid). Lines carrying these constructs had the roller phenotype. Worms were grown at 20°C on EZ plates (550 mg Tris-Cl, 240 mg Tris-OH, 3.1 g Bactopeptone, 8 mg cholesterol, 2.0 g NaCl, 200 mg streptomycin sulfate, and 20 g agar per liter) seeded with OP50 bacteria (9) and ferric ammonium citrate (100 µM) or DFO (20 µM) to vary iron.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
We produced an iron reporter by ligating the 5'-UTR of the mouse ferritin light chain, which contains a single IRE, with a destabilized form of YFP to produce a 5'-IRE-YFP reporter (Fig. 1). The 5'-IRE-YFP was expressed by a cytomegalovirus (CMV) promoter rather than the endogenous ferritin promoter because the ferritin promoter demonstrates both iron-dependent and iron-independent regulation.
When the 5'-IRE-YFP reporter was expressed in 293 cells, YFP was expressed in an iron-responsive fashion (Fig. 2A). As little as 1 µM ferric ammonium citrate (test doses ranged from 1 to 50 µM; Ref. 78) produced a small but often detectable increase in fluorescence, whereas 5 µM ferric ammonium citrate reproducibly increased fluorescence 2.41 ± 0.3-fold and the higher doses of iron increased the signal further. Other iron donors such as ferric and ferrous chloride and ferric sulfate had a similar effect. Clones expressing the 5'-IRE-YFP reporter (Fig. 2B) demonstrated reciprocal responses to iron (ferric ammonium citrate, 25 µM) and iron chelation by DFO (20 µM). Mean fluorescence varied sevenfold on average with these treatments [210 ± 26 vs. 33.3 ± 3.3 (mean ± SE) fluorescence units with iron and DFO, respectively; n = 8 independent clones; P < 0.001]. All cells responded to iron and DFO, suggesting that the 5'-IRE-YFP was not expressed in excess of the IRPs. In addition, the expression of ferritin and transferrin receptor 1 proteins was similar in transfected and parental 293 cells, indicating that the reporters did not squelch endogenous IRP-IRE interactions (not shown).
|
To demonstrate further the specificity of the response to iron, we created a reporter with 3'-IREs and an endonuclease site by using the 3'-UTR of mouse transferrin receptor 1 DNA and the destabilized YFP vector (Fig. 1). The 3'-IRE-YFP cells had the opposite set of responses to iron and DFO as the 5'-IRE-YFP clones. Iron repressed fluorescence of 3'-IRE-YFP cells (Fig. 2, E and F), whereas DFO enhanced fluorescence (93 ± 27 with 25 µM iron vs. 287 ± 66 with 20 µM DFO; n = 8 clones, P = 0.03). All cells in the 3'-YFP-IRE clones responded to iron or DFO, and DFO raised the 3'-IRE-YFP fluorescence to levels similar to those found in the non-IRE-YFP clones. These data demonstrate reversible regulation of 5'- and 3'-IRE YFP reporters by an iron-sensitive mechanism.
We used immunoblots to confirm that the IREs regulate the translation of YFP proteins and showed that, although the non-IRE-YFP protein was unresponsive to iron, the 5'- and 3'-IRE-YFP proteins varied with iron loading and iron chelation, in a manner similar to endogenous transferrin receptor 1 (Fig. 3). These reciprocal changes could also be detected by microscopy. Ligation of the 5'-IRE sequence to the YFP reporter markedly diminished the fluorescence (compare Fig. 4, A vs. C), but the addition of iron reactivated the signal (compare Fig. 4, C vs. D). Conversely, iron reduced the fluorescence of the 3'-IRE-YFP reporter (compare Fig. 4, E vs. F). These reciprocal responses cannot be explained simply by global changes in protein synthesis or degradation, but rather they depend on predicted functions of 5'- and 3'-IREs in reciprocally regulating the posttranscriptional expression of proteins.
|
|
|
Rapid responses to iron. Because translation of the 5'-IRE-YFP protein and degradation of 3'-IRE-YFP RNA after the addition of iron are time-consuming events, we examined how fast the reporters could respond to iron. Using FACS, we detected a response within 60 min of the addition of iron. Similarly, time-lapse cinematography of single cells detected a response to iron by 60 min and a plateau of the signal after 5 h (Fig. 6). 3'-IRE-YFP cells exhibited the reciprocal response (not shown), and non-IRE-YFP cells were not responsive to iron at all.
|
|
|
|
To examine these hypotheses further, we generated matched samples of iron-loaded and iron-free Ngal by combining a single lot of Ngal produced in BL-21 bacteria with either iron-loaded or iron-free enterochelin (EMC Microcollection). Iron-loaded Ngal-enterochelin was red in color, whereas the iron-free Ngal-enterochelin had no color (Fig. 10A). Iron-containing Ngal-enterochelin markedly enhanced the growth of rat kidney mesenchyme, the expression of epithelial E-cadherin, and de novo tubulogenesis, whereas the iron-poor Ngal-enterochelin had much less effect (Fig. 10B), suggesting that Fe-Ngal-enterochelin donated iron. To further test whether iron-loaded Ngal-enterochelin could donate iron, we added these preparations to the YFP reporter cells. We found that the iron-loaded Ngal-enterochelin doubled the fluorescence of the 5'-IRE-YFP cells [no addition: 43 ± 2.8 (n = 6); Fe-Ngal-enterochelin: 85 ± 9.7 (n = 6); P < 0.004] whereas the iron-poor Ngal-enterochelin reduced the fluorescence [Ngal-enterochelin: 33 ± 2.4 (n = 6); P < 0.04; Fig. 10C]. The opposite was found when the two preparations of Ngal were added to the 3'-IRE-YFP cells. Iron-loaded Ngal reduced the fluorescence [no addition: 149 ± 6.9 (n = 5), Fe-Ngal-enterochelin: 95 ± 21.8; P < 0.045] whereas iron-poor Ngal enhanced the fluorescence [Ngal-enterochelin: 191 ± 22 (n = 6); P < 0.004]. Control cells containing the YFP reporter lacking the IRE had no response to either form of Ngal [no addition: 980 ± 84 (n = 6); Fe-Ngal-enterochelin: 921 ± 178 (n = 6, P = 0.78); Ngal-enterochelin: 1,035 ± 86 (n = 6, P = 0.69)]. To determine whether Ngal might downregulate the message for IRP-1 or IRP-2, and hence mimic iron delivery, we measured IRP transcripts by real-time PCR, but we failed to find a difference when cells were treated with either iron-loaded or iron-poor Ngal-enterochelin or were left untreated. These data implicate iron-loaded Ngal-enterochelin as an iron donor and, conversely, iron-free Ngal-enterochelin as an iron chelator. The data also demonstrate that growth and epithelial conversion of the rat mesenchyme in vitro is enhanced by iron donation by this novel transporter.
|
We found that addition of SNP (1100 µM) to the reporter cells increased 5'-IRE fluorescence as much as 30-fold and decreased 3'-IRE fluorescence as much as 6-fold (Fig. 11). In contrast, there was no effect of SNP on the non-IRE-YFP reporters, indicating that these changes could not be attributed to global changes in protein synthesis. In addition, the effect of SNP could not be mimicked by adding the same concentration of iron (Fig. 11) or ferricyanide, a metabolite of SNP, or reversed or diminished by DFO (not shown), suggesting that the effect of SNP cannot be attributed to the delivery of iron alone. These findings are consistent with prior work (7, 41, 65) that showed that NO+ directly modifies IRP (44). The data indicate that the fluorescent IRE reporters are sensitive to modification of IRP activity.
|
5'-IRE-CFP was transiently introduced into 3'-IRE-YFP expressing clones. The ratio of 5'-IRE-CFP to 3'-IRE-YFP fluorescence decreased from 2.7 ± 0.03 (n = 2,481 cells) to 0.66 ± 0.007 (n = 2,628 cells) in the presence of DFO and increased in a dose-responsive fashion to 12.3 ± 0.18 (n = 1,588 cells) in the presence of ferric ammonium citrate. DFO (10 µM) and iron (10 µM) produced significant changes in mean CFP and YFP fluorescence (P < 0.001; n = 4 independent experiments; 515668 cells/measurement) (Fig. 12). These data show that the IRE reporters are useful to measure iron-dependent fluorescence with ratio analysis and data collection by confocal microscopy.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The IRE reporters were also useful to evaluate factors that directly effect IRP proteins. For example, we found that SNP, a NO+ generator, mimicked the addition of iron. The effect of SNP, however, was many times greater than the effect of the same concentration of iron or ferricyanide (a metabolite), consistent with prior data suggesting that NO+ directly inhibits IRP activity (see, e.g., Ref. 44). Curiously, the NO· generator S-nitroso-N-acetyl-penicillamine (SNAP) (61, 65, 75) did not reproduce the effect of nitroprusside, suggesting that the pool of iron that can be affected by NO· was quite small. Support for this explanation comes from the finding that the addition of iron generally had a greater effect on fluorescence than did DFO. In this light, the dramatic effect of SNP is likely attributable to inhibition of IRP binding to IRE, most likely the inhibition of IRP-2. This assignment is based on the dramatic effect of NO+ on IRP-2 (6, 41, 43, 44) and not IRP-1 (43) in other cells and the abundance of IRP-2 message in 293 cells. Because 293 cells also express IRP-1, and because they derive from kidney, where, unlike other organs, IRP-1 is required for basal iron sensing (56), an unequivocal assignment of the NO+ target, however, should await the introduction of the iron reporters into knockout cells.
We foresee that the IRE reporters will be useful to examine developing organs and to determine the effects of gene deletions. Given that transferrin receptor 1 is expressed in a stage- and cell type-specific manner in kidney, hematopoietic, and lymphoid cells (8, 19, 24, 40, 76, 87) and is absolutely required only at a single stage of development (8, 59) by the latter tissues, mechanisms of iron acquisition may be quite heterogeneous in vivo. This idea is also suggested by the fact that ferritin expression (68, 74) varies among different regions and stages of the developing brain, and the IRPs are themselves developmentally regulated (47, 74), indicating that cellular iron loading may vary from one cell type to another. Because the IRE-based reporters can monitor single cells in a reversible fashion, we propose that these constructs will be useful in vivo to detect changes in iron and IRP activity during organ development.
In sum, we have developed a method of iron sensing that is complementary to the fluorescent dyes. Although calcein and phen-green may be useful to detect the initial rates of iron flux and can be calibrated to yield absolute iron concentrations, our probes can be used to provide long-term, continuous monitoring of relative changes in cellular iron that accompany cell growth and development. Our probes detect the actions of IRP signal transducers in living cells.
![]() |
GRANTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
![]() |
ACKNOWLEDGMENTS |
---|
![]() |
FOOTNOTES |
---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* G. Ram and K. Gast contributed equally to this work.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
2. Aziz N and Munro HN. Iron regulates ferritin mRNA translation through a segment of its 5' untranslated region. Proc Natl Acad Sci USA 84: 84788482, 1987.[Abstract]
3. Barasch J. Iron, lipocalins and induction of nephrons (Abstract). Scientific Committee of the American Society of Hematology, 2003 (http://www.abstracts2view.com/hem/sessionindex.php?p=4).
4. Barasch J and Li JY. Measurement of intracellular iron (Abstract). J Am Soc Nephrol 13: 504A, 2002.
5. Barasch J, Mori K, and Li JY. Novel reporter for the regulatory pool of iron (Abstract). J Am Soc Nephrol 14: 329A, 2003.
6. Bourdon E, Kang DK, Ghosh MC, Drake SK, Wey J, Levine RL, and Rouault TA. The role of endogenous heme synthesis and degradation domain cysteines in cellular iron-dependent degradation of IRP2. Blood Cells Mol Dis 31: 247255, 2003.[CrossRef][ISI][Medline]
7. Bouton C, Oliveira L, and Drapier JC. Converse modulation of IRP1 and IRP2 by immunological stimuli in murine RAW 264.7 macrophages. J Biol Chem 273: 94039408, 1998.
8. Brekelmans P, van Soest P, Voerman J, Platenburg PP, Leenen PJ, and van Ewijk W. Transferrin receptor expression as a marker of immature cycling thymocytes in the mouse. Cell Immunol 159: 331339, 1994.[CrossRef][ISI][Medline]
9. Brenner S. The genetics of Caenorhabditis elegans. Genetics 77: 7194, 1974.
10. Busfield SJ, Tilbrook PA, Callus BA, Spadaccini A, Kuhn L, and Klinken SP. Complex regulation of transferrin receptors during erythropoietin-induced differentiation of J2E erythroid cellselevated transcription and mRNA stabilisation produce only a modest rise in protein content. Eur J Biochem 249: 7784, 1997.[Abstract]
11. Chan RY, Seiser C, Schulman HM, Kuhn LC, and Ponka P. Regulation of transferrin receptor mRNA expression. Distinct regulatory features in erythroid cells. Eur J Biochem 220: 683692, 1994.[Abstract]
12. Chaudhary J, Cupp AS, and Skinner MK. Role of basic-helix-loop-helix transcription factors in Sertoli cell differentiation: identification of an E-box response element in the transferrin promoter. Endocrinology 138: 667675, 1997.
13. Chen X, Wang LQ, Huang Y, Qiu P, Murgolo NJ, Greene JR, Wu CH, and Jiang Y. IRE_FINDER-computational search of iron response element in human and mouse UTRs. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 34: 743747, 2002.[Medline]
14. Cherry SR, Biniszkiewicz D, van Parijs L, Baltimore D, and Jaenisch R. Retroviral expression in embryonic stem cells and hematopoietic stem cells. Mol Cell Biol 20: 74197426, 2002.[CrossRef]
15. Chitambar CR and Wereley JP. Resistance to the antitumor agent gallium nitrate in human leukemic cells is associated with decreased gallium/iron uptake, increased activity of iron regulatory protein-1, and decreased ferritin production. J Biol Chem 272: 1215112157, 1997.
16. Constable A, Quick S, Gray NK, and Hentze MW. Modulation of the RNA-binding activity of a regulatory protein by iron in vitro: switching between enzymatic and genetic function? Proc Natl Acad Sci USA 89: 45544558, 1992.[Abstract]
17. Drapier JC, Hirling H, Wietzerbin J, Kaldy P, and Kuhn LC. Biosynthesis of nitric oxide activates iron regulatory factor in macrophages. EMBO J 12: 36433649, 1993.[Abstract]
18. Eisenstein R and Blemings KP. Iron regulatory proteins, iron responsive elements and iron homeostasis. J Nutr 128: 22952298, 1998.
19. Ekblom P, Thesleff I, Saxen L, Miettinen A, and Timpl R. Transferrin as a fetal growth factor: acquisition of responsiveness related to embryonic induction. Proc Natl Acad Sci USA 80: 26512655, 1983.[Abstract]
20. Epsztejn S, Kakhlon O, Glickstein H, Breuer W, and Cabantchik ZI. Fluorescence analysis of the labile iron pool of mammalian cells. Anal Biochem 248: 3140, 1997.[CrossRef][ISI][Medline]
21. Esposito BP, Epsztejn S, Breuer W, and Cabantchik ZI. A review of fluorescence methods for assessing labile iron in cells and biological fluids. Anal Biochem 304: 118, 2002.[CrossRef][ISI][Medline]
22. Feder JN, Penny DM, Irrinki A, Lee VK, Lebron JA, Watson N, Tsuchihashi Z, Sigal E, Bjorkman PJ, and Schatzman RC. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci USA 95: 14721477, 1998.
23. Festa M, Ricciardelli G, Mele G, Pietropaolo C, Ruffo A, and Colonna A. Overexpression of H ferritin and up-regulation of iron regulatory protein genes during differentiation of 3T3-L1 pre-adipocytes. J Biol Chem 275: 3670836712, 2000.
24. Fleming S and Jones DB. Immunocytochemical evidence for transferrin-dependent proliferation during renal tubulogenesis. J Anat 153: 191201, 1987.[ISI][Medline]
25. Flower DR, North AC, and Sansom CE. The lipocalin protein family: structural and sequence overview. Biochim Biophys Acta 1482: 924, 2000.[ISI][Medline]
26. Garate MA and Nunez MT. Overexpression of the ferritin iron-responsive element decreases the labile iron pool and abolishes the regulation of iron absorption by intestinal epithelial (Caco-2) cells. J Biol Chem 275: 16511655, 2000.
27. Gazitt Y, Reddy SV, Alcantara O, Yang J, and Boldt DH. A new molecular role for iron in regulation of cell cycling and differentiation of HL-60 human leukemia cells: iron is required for transcription of p21(WAF1/CIP1) in cells induced by phorbol myristate acetate. J Cell Physiol 187: 124135, 2001.[CrossRef][ISI][Medline]
28. Goetz DH, Holmes MA, Borregaard N, Bluhm ME, Raymond KN, and Strong RK. The neutrophil lipocalin NGAL is a bacteriostatic agent that interferes with siderophore-mediated iron acquisition. Mol Cell 10: 10331043, 2002.[ISI][Medline]
29. Goetze B, Grunewald B, Kiebler MA, and Macchi P. Coupling the iron-responsive element to GFPan inducible system to study translation in a single living cell. Sci STKE 2003: PL12, 2003.[Medline]
30. Gourley BL, Parker SB, Jones BJ, Zumbrennen KB, and Leibold EA. Cytosolic aconitase and ferritin are regulated by iron in Caenorhabditis elegans. J Biol Chem 278: 32273234, 2003.
31. Gross CN, Irrinki A, Feder JN, and Enns CA. Co-trafficking of HFE, a nonclassical major histocompatibility complex class I protein, with the transferrin receptor implies a role in intracellular iron regulation. J Biol Chem 273: 2206822074, 1998.
32. Haile DJ. Regulation of genes of iron metabolism by the iron-response proteins. Am J Med Sci 318: 230240, 1999.[ISI][Medline]
33. Hanson ES and Leibold EA. Regulation of iron regulatory protein 1 during hypoxia and hypoxia/reoxygenation. J Biol Chem 273: 75887593, 1998.
34. Hanson ES, Rawlins ML, and Leibold EA. Oxygen and iron regulation of iron regulatory protein 2. J Biol Chem 278: 4033740342, 2003.
35. Henderson BR and Kuhn LC. Differential modulation of the RNA-binding proteins IRP-1 and IRP-2 in response to iron. IRP-2 inactivation requires translation of another protein. J Biol Chem 270: 2050920515, 1995.
36. Henderson RJ, Patton SM, and Connor JR. Development of a novel method for the measurement of cellular iron levels and iron-regulated protein expression. BioIron 2003. 16th International Conference of the International BioIron Society, NIH. Bethesda, MD, May 49, 2003 (poster abst 195).
37. Hentze MW, Caughman SW, Rouault TA, Barriocanal G, Dancis A, Harford JB, and Klausner RD. Identification of the iron-responsive element for the translational regulation of human ferritin mRNA. Science 238: 15701573, 1987.[ISI][Medline]
38. Hirsch S and Miskimins W. Mitogen induction of nuclear factors that interact with a delayed responsive region of the transferrin receptor gene promoter. Cell Growth Differ 6: 719726, 1995.[Abstract]
39. Iwai K, Klausner RD, and Rouault TA. Requirements for iron-regulated degradation of the RNA binding protein, iron regulatory protein 2. EMBO J 14: 53505357, 1995.[Abstract]
40. Kanayasu-Toyoda T, Yamaguchi T, Uchida E, and Hayakawa T. Commitment of neutrophilic differentiation and proliferation of HL-60 cells coincides with expression of transferrin receptor. Effect of granulocyte colony stimulating factor on differentiation and proliferation. J Biol Chem 274: 2547125480, 1999.
41. Kim S and Ponka P. Control of transferrin receptor expression via nitric oxide-mediated modulation of iron-regulatory protein 2. J Biol Chem 274: 3303533042, 1999.
42. Kim S and Ponka P. Effects of interferon- and lipopolysaccharide on macrophage iron metabolism are mediated by nitric oxide-induced degradation of iron regulatory protein 2. J Biol Chem 275: 62206226, 2000.
43. Kim S and Ponka P. Nitrogen monoxide-mediated control of ferritin synthesis: implications for macrophage iron homeostasis. Proc Natl Acad Sci USA 99: 1221412219, 2002.
44. Kim S, Wing SS, and Ponka P. S-nitrosylation of IRP2 regulates its stability via the ubiquitin-proteasome pathway. Mol Cell Biol 24: 330337, 2004.
45. Klausner RD and Rouault TA. The molecular basis of iron metabolism. In: The Harvey Lectures. New York: Wiley-Liss, 1998, vol. 92, p. 99112.
46. LaVaute T, Smith S, Cooperman S, Iwai K, Land W, Meyron-Holtz E, Drake SK, Miller G, Abu-Asab M, Tsokos M, Switzer R, Grinberg A, Love P, Tresser N, and Rouault TA. Targeted deletion of the gene encoding iron regulatory protein-2 causes misregulation of iron metabolism and neurodegenerative disease in mice. Nat Genet 27: 209214, 2001.[CrossRef][ISI][Medline]
47. Leibold EA, Gahring LC, and Rogers SW. Immunolocalization of iron regulatory protein expression in the murine central nervous system. Histochem Cell Biol 115: 195203, 2001.[ISI][Medline]
48. Leibold EA and Munro HN. Cytoplasmic protein binds in vitro to a highly conserved sequence in the 5' untranslated region of ferritin heavy- and light-subunit mRNAs. Proc Natl Acad Sci USA 85: 21712175, 1988.[Abstract]
49. Levy JE, Jin O, Fujiwara Y, Kuo F, and Andrews NC. Transferrin receptor is necessary for development of erythrocytes and the nervous system. Nat Genet 21: 396399, 1999.[CrossRef][ISI][Medline]
50. Lok CN and Ponka P. Identification of a hypoxia response element in the transferrin receptor gene. J Biol Chem 274: 2414725152, 1999.
51. Lok CN, Chan KF, and Loh TT. Transcriptional regulation of transferrin receptor expression during phorbol-ester-induced HL-60 cell differentiation. Evidence for a negative regulatory role of the phorbol-ester-responsive element-like sequence. Eur J Biochem 236: 614619, 1996.[Abstract]
52. Macchi P, Hemraj I, Goetze B, Grunewald B, Mallardo M, and Kiebler MA. A GFP-based system to uncouple mRNA transport from translation in a single living neuron. Mol Biol Cell 14: 15701582, 2003.
53. Marziali G, Perrotti E, Ilari R, Lulli V, Coccia EM, Moret R, Kuhn LC, Testa U, and Battistini A. Role of Ets-1 in transcriptional regulation of transferrin receptor and erythroid differentiation. Oncogene 21: 79337944, 2002.[CrossRef][ISI][Medline]
54. McGraw TE, Greenfield L, and Maxfield FR. Functional expression of the human transferrin receptor cDNA in Chinese hamster ovary cells deficient in endogenous transferrin receptor. J Cell Biol 105: 207214, 1987.[Abstract]
55. Mello CC, Kramer JM, Stinchcomb DT, and Ambros V. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J 10: 39593970, 1991.[Abstract]
56. Meyron-Holtz EG, Ghosh MC, Iwai K, LaVaute T, Brazzolotto X, Berger UV, Land W, Ollivierre-Wilson H, Grinberg A, Love P, and Rouault TA. Genetic ablations of iron regulatory proteins 1 and 2 reveal why iron regulatory protein 2 dominates iron homeostasis. EMBO J 23: 386395, 2004.
57. Miller JC and Miller JN. Statistics for Analytical Chemistry. New York: Wiley, 1984, chapts. 2 and 3, p. 4648.
58. Naviaux RK, Costanzi E, Haas M, and Verma IM. The pCL vector system: rapid production of helper-free, high-titer, recombinant retroviruses. J Virol 70: 57015705, 1996.[Abstract]
59. Ned RM, Swat W, and Andrews NC. Transferrin receptor 1 is differentially required in lymphocyte development. Blood 102: 37113718, 2003.
60. Oshiro S, Nozawa K, Hori M, Zhang C, Hashimoto Y, Kitajima S, and Kawamura K. Modulation of iron regulatory protein-1 by various metals. Biochem Biophys Res Commun 290: 213218, 2002.[CrossRef][ISI][Medline]
61. Pantopoulos K, Weiss G, and Hentze MW. Nitric oxide and oxidative stress (H2O2) control mammalian iron metabolism by different pathways. Mol Cell Biol 16: 37813788, 1996.[Abstract]
62. Ponka P. Tissue-specific regulation of iron metabolism and heme synthesis: distinct control mechanisms in erythroid cells. Blood 89: 125, 1997.
63. Ponka P and Lok C. The transferrin receptor: role in health and disease. Int J Biochem Cell Biol 31: 11111137, 1999.[CrossRef][ISI][Medline]
64. Ponka P, Schulman HM, and Woodworth RC. Iron Transport and Storage. Boston, MA: CRC, 1990, chapt. 10.
65. Richardson DR, Neumannova V, Nagy E, and Ponka P. The effect of redox-related species of nitrogen monoxide on transferrin and iron uptake and cellular proliferation of erythroleukemia (K562) cells. Blood 86: 32113219, 1995.
66. Riedel HD, Muckenthaler MU, Gehrke SG, Mohr I, Brennan K, Herrmann T, Fitscher BA, Hentze MW, and Stremmel W. HFE downregulates iron uptake from transferrin and induces iron-regulatory protein activity in stably transfected cells. Blood 94: 39153921, 1999.
67. Rogers JT. Ferritin translation by interleukin-1 and interleukin-6: the role of sequences upstream of the start codons of the heavy and light subunit genes. Blood 87: 25252537, 1996.
68. Roskams AJ and Connor JR. Iron, transferrin, and ferritin in the rat brain during development and aging. J Neurochem 63: 709716, 1994.[ISI][Medline]
69. Rouault TA, Hentze MW, Caughman SW, Harford JB, and Klausner RD. Binding of a cytosolic protein to the iron-responsive element of human ferritin messenger RNA. Science 241: 12071210, 1988.[ISI][Medline]
70. Rouault TA and Klausner R. Regulation of iron metabolism in eukaryotes. Curr Top Cell Regul 35: 119, 1997.[ISI][Medline]
71. Roy CN, Blemings KP, Deck KM, Davies PS, Anderson EL, Eisenstein RS, and Enns CA. Increased IRP-1 and IRP-2 RNA binding activity accompanies a reduction of the labile iron pool in HFE-expressing cells. J Cell Physiol 190: 218226, 2002.[CrossRef][ISI][Medline]
72. Roy CN, Penny DM, Feder JN, and Enns CA. The hereditary hemochromatosis protein, HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells. J Biol Chem 274: 90229028, 1999.
73. Seiser C, Teixeira S, and Kuhn LC. Interleukin-2-dependent transcriptional and post-transcriptional regulation of transferrin receptor mRNA. J Biol Chem 268: 1307413080, 1993.
74. Siddappa AJ, Rao RB, Wobken JD, Leibold EA, Connor JR, and Georgieff MK. Developmental changes in the expression of iron regulatory proteins and iron transport proteins in the perinatal rat brain. J Neurosci Res 68: 761775, 2002.[CrossRef][ISI][Medline]
75. Soum E and Drapier JC. Nitric oxide and peroxynitrite promote complete disruption of the [4Fe-4S] cluster of recombinant human iron regulatory protein 1. J Biol Inorg Chem 8: 226232, 2003.[CrossRef][ISI][Medline]
76. Sposi N, Cianetti L, Tritarelli E, Pelosi E, Militi S, Barberi T, Gabbianelli M, Saulle E, Kuhn L, Peschle C, and Testa U. Mechanisms of differential transferrin receptor expression in normal hematopoiesis. Eur J Biochem 267: 67626774, 2000.
77. Srinivas S, Watanabe T, Lin CS, William CM, Tanabe Y, Jessell TM, and Costantini F. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev Biol 1: 4, 2001.[CrossRef][Medline]
78. Sturrock A, Alexander J, Lamb J, Craven C, and Kaplan J. Characterization of a transferrin-independent uptake system for iron in HeLa cells. J Biol Chem 265: 31393145, 1990.
79. Tacchini L, Bianchi L, Bernelli ZA, and Cairo G. Transferrin receptor induction by hypoxia. HIF-1-mediated transcriptional activation and cell-specific post-transcriptional regulation. J Biol Chem 274: 2414224146, 1999.
80. Testa U, Kuhn L, Petrini M, Quaranta MT, Pelosi E, and Peschle C. Differential regulation of iron regulatory element-binding protein(s) in cell extracts of activated lymphocytes versus monocytes-macrophages. J Biol Chem 266: 1392513930, 1991.
81. Waheed A, Grubb JH, Zhou XY, Tomatsu S, Fleming R, Costaldi M, Britton RS, Bacon BS, and Sly WS. Regulation of transferrin-mediated iron uptake by HFE, the protein defective in hereditary hemochromatosis. Proc Natl Acad Sci USA 99: 31173122, 2002.
82. Wang J, Chen GH, Muckenthaler M, Galy B, Hentze MW, and Pantopoulos K. Iron-mediated degradation of IRP2, an unexpected pathway involving a 2-oxoglutarate-dependent oxygenase activity. Mol Cell Biol 24: 954965, 2004.
83. Wang J, Tokarz R, and Savage-Dunn C. The expression of TGF signal transducers in the hypodermis regulates body size in C. elegans. Development 129: 49894998, 2002.
84. Weiss G, Bogdan G, and Hentze MW. Pathways for the regulation of macrophage iron metabolism by the anti-inflammatory cytokines IL-4 and IL-13. J Immunol 158: 420425, 1997.[Abstract]
85. Weiss G, Goossen B, Doppler W, Fuchs D, Pantopoulos K, Werner-Felmayer G, Wachter H, and Hentze MW. Translational regulation via iron-responsive elements by the nitric oxide/NO-synthase pathway. EMBO J 12: 36513657, 1993.[Abstract]
86. Yamaguchi-Iwai Y, Ueta R, Fukunaka A, and Sasaki R. Subcellular localization of Aft1 transcription factor responds to iron status in Saccharomyces cerevisiae. J Biol Chem 277: 1891418918, 2002.
87. Yang J, Goetz D, Li JY, Wang W, Mori K, Setlik D, Du T, Erdjument-Bromage H, Tempst P, Strong R, and Barasch J. An iron delivery pathway mediated by a lipocalin. Mol Cell 10: 10451056, 2002.[ISI][Medline]
88. Yang J, Mori K, Li JY, and Barasch J. Iron, lipocalin, and kidney epithelia. Am J Physiol Renal Physiol 285: F9F18, 2003.
89. Ye Z and Connor J. Screening of transcriptionally regulated genes following iron chelation in human astrocytoma cells. Biochem Biophys Res Commun 264: 709713, 1999.[CrossRef][ISI][Medline]
90. Zakin MM, Baron B, and Guillou F. Regulation of the tissue-specific expression of transferrin gene. Dev Neurosci 24: 222226, 2002.[CrossRef][ISI][Medline]