1 Neuroscience Program and 3 Department of Cell and Structural Biology, University of Illinois at Urbana-Champaign, Urbana 61801; and 2 Department of Pharmacology and Biological Chemistry and Northwestern Drug Discovery Program, Northwestern University Medical School, Chicago, Illinois 60611
![]() |
ABSTRACT |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
The aim of this study was to identify the melatonin receptor type(s) (MT1 or MT2) mediating circadian clock resetting by melatonin in the mammalian suprachiasmatic nucleus (SCN). Quantitative receptor autoradiography with 2-[125I]iodomelatonin and in situ hybridization histochemistry, with either 33P- or digoxigenin-labeled antisense MT1 and MT2 melatonin receptor mRNA oligonucleotide probes, revealed specific expression of both melatonin receptor types in the SCN of inbred Long-Evans rats. The melatonin receptor type mediating phase advances of the circadian rhythm of neuronal firing rate in the SCN slice was assessed using competitive melatonin receptor antagonists, the MT1/MT2 nonselective luzindole and the MT2-selective 4-phenyl-2-propionamidotetraline (4P-PDOT). Luzindole and 4P-PDOT (1 nM-1 µM) did not affect circadian phase on their own; however, they blocked both the phase advances (~4 h) in the neuronal firing rate induced by melatonin (3 pM) at temporally distinct times of day [i.e., subjective dusk, circadian time (CT) 10; and dawn, CT 23], as well as the associated increases in protein kinase C activity. We conclude that melatonin mediates phase advances of the SCN circadian clock at both dusk and dawn via activation of MT2 melatonin receptor signaling.
suprachiasmatic nucleus; brain slice electrophysiology; luzindole; 4-phenyl-2-propionamidotetraline; protein kinase C
![]() |
INTRODUCTION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
THE BIOLOGICAL CLOCK located within the suprachiasmatic nucleus (SCN) times the near 24-h oscillations in neuroendocrine function (17). This clock signals production of the pineal hormone, melatonin, only at night. Thus the SCN clock generates the circadian rhythm of melatonin, ensuring that it is a neuroendocrine signal of darkness (16). However, melatonin can feed back on the clock to regulate its phase. The clock in the rat SCN brain slice is reset in response to melatonin at temporally distinct times, dusk and dawn (23, 24, 36). Nonselective melatonin receptor agonists, such as 2-iodomelatonin (23, 24), GR-196429 (6), and S-20098 (19), induce concentration-dependent phase advances when applied at dusk. In rodents, melatonin advances the phase of rhythms in wheel running activity at subjective dusk in vivo (3, 4, 14, 31). The melatonin-mediated phase advances in the rat SCN brain slice are blocked by treatment with pertussis toxin and specific inhibitors of protein kinase C (PKC) (24). Furthermore, melatonin activates PKC phosphotransferase activity at these windows of sensitivity but not at other times, and phorbol ester activators of PKC induce melatonin-like shifts. These data indicate that these phase shifts are mediated via activation of a G protein-coupled melatonin receptor signaling through a PKC pathway. This study probed the melatonin receptor type that mediates these effects on the circadian clock within the SCN.
In mammals, melatonin activates at least two distinct high-affinity membrane-bound receptors, the MT1 and MT2 receptors. These receptors show 60% homology at the amino acid level and are encoded by separate genes (32, 33, 35). The two melatonin receptors can be distinguished pharmacologically both in vivo and in vitro using subtype-selective melatonin receptor antagonists (10, 11, 13, 14). Acute inhibition of neuronal firing in the mouse SCN (22) and vascular vasoconstriction in the rat (8, 9) appear to be mediated through activation of the MT1 melatonin receptor. By contrast, activation of the MT2 melatonin receptor by melatonin inhibits dopamine release in the retina (13), mediates vasodilator responses in the rat vasculature (9), and phase advances circadian rhythms of wheel running activity in the C3H/HeN mouse (14). Although the expression of the MT1 melatonin receptor correlates with a high density of 2-[125I]iodomelatonin binding within the rodent brain (14, 22, 33), the expression pattern of the MT2 melatonin receptor within the rat SCN has not yet been reported.
The aim of this study was to assess the expression of both the MT1 and MT2 melatonin receptors and to identify the receptor mediating the action of melatonin on circadian clock resetting in the rat SCN. Using selective melatonin receptor antagonists, we demonstrated that melatonin acts via an MT2, but not an MT1, receptor to stimulate PKC activity and phase shift the circadian rhythm of neuronal firing activity in the rat suprachiasmatic circadian clock.
![]() |
MATERIALS AND METHODS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Melatonin receptor nomenclature and classification. We used the official nomenclature for melatonin receptors approved by the Nomenclature Committee of the International Union of Pharmacology (11). The designations "mt1" and "mt2" correspond to those of the recombinant melatonin receptors previously known as Mel1a (33) and Mel1b (32), respectively. These receptors should be referred to in upper case, i.e., MT1 and MT2, to reflect the identification of their molecular structure and the pharmacological characterization of their function in native tissues (9, 13, 14, 40). MT3 refers to the pharmacologically defined melatonin receptor, with yet unknown molecular structure, previously referred to as ML2 (10).
Drugs and chemicals. Luzindole was synthesized by Dr. Mike Flaugh at Eli Lilly (Indianapolis, IN). 4-Phenyl-2-propionamidotetraline (4P-PDOT) was obtained from Tocris Cookson (Ballwin, MO). Melatonin was obtained from Sigma (St. Louis, MO).
Preparation of frozen brain slices.
Male Long-Evans rats (8 wk old) from our colony, which have
been inbred for more than 33 generations at the University of Illinois
at Urbana-Champaign, were maintained in a 12:12-h light:dark cycle and
killed by decapitation at zeitgeber time (ZT) 10. ZT 0 is defined as
"lights on" in the rat colony; ZT 12 is "lights off".
Circadian time (CT) is used to describe the state of the clock in the
brain slice in constant conditions in vitro, using "lights on" as a
reference point for CT 0. Brains were dissected, embedded in OCT
compound, an embedding medium for frozen tissue specimens (Ted Pella,
Reading, PA), and kept frozen at 80°C until sectioning. Coronal
sections for receptor autoradiography (20 µm) or in situ
hybridization (30 µm) were cut on a Reichert-Jung cryostat (Leica,
Deerfield, IL) and mounted on either gelatin-coated or silane-coated
slides, respectively. Rostro-caudal brain sections containing the SCN
were successively placed on a series of nine slides so that sequential
sections through the whole SCN could be analyzed. Slides were kept at
80°C until used.
Preparation of fixed brain slices. At ZT 10 on the day of fixation, animals were anesthetized with pentobarbital sodium (75-150 mg/kg) and perfused via the left ventricle with 50 ml phosphate-buffered saline (PBS) at room temperature. This perfusion was followed by 500 ml of freshly made paraformaldehyde solution (4%) in PBS. Brains were removed rapidly and postfixed in the same fixative solution for 24 h at 4°C. Brains were allowed to equilibrate in PBS that contained 20% sucrose at 4°C and were then sectioned in 30-µm thick sections on a Reichert-Jung cryostat.
Receptor autoradiography. Brain sections were processed for receptor autoradiography as previously described (14). Briefly, slide-mounted sections were air dried, preincubated with Tris-Ca2+ buffer (50 mM Tris · HCl and 4 mM CaCl2, pH 7.4) for 30 min, and incubated with a saturating concentration of 2-[125I]iodomelatonin (200 pM) for 1 h at 25°C in the absence and presence of melatonin (1 µM) to evaluate total and nonspecific binding, respectively. Sections were then rinsed twice for 5 min in Tris-Ca2+ buffer followed by a rapid rinse in ice-cold distilled water. Labeled sections were dried and exposed to Kodak Biomax MR scientific imaging film for 7 days. Films were developed in a film processor (Medical Film Processor QX-70, Konica). Optical densities were measured with a computer-based image analysis system (Bioquant System IV; R & M Biometrics, Nashville, TN) using 14C standards calibrated for use with 125I as described previously (26, 34).
In situ hybridization.
Serial coronal rat brain sections were processed for isotopic or
nonisotopic in situ hybridization using 33P- or digoxigenin
(DIG)-labeled oligonucleotide probes, respectively. Selective antisense
and sense oligonucleotide probes corresponding to regions of the
MT1 and MT2 melatonin receptor mRNA that had little homology to the heterologous (i.e., MT2 and
MT1, respectively) sequences and with other published
nucleotide sequences were chosen on the basis of guanine/cyclase
content content and GenBank blast comparisons (2).
Antisense oligonucleotide probes 100% complementary to rat melatonin
receptor cDNA and their corresponding sense probes were used. The
MT1 antisense oligonucleotide probe
(GGGGTCGTACTGGAGAGTTCCGGTTTGCAGG, 31 mer) is complementary to bases
108-138 of the partial rat MT1 melatonin receptor cDNA
sequence (GenBank accession no. U14409), and the MT2
antisense oligonucleotide probe (CGGGTCATATTCTAGAGACCCCACAAAGAAA, 31 mer) is complementary to bases 111-141 of the partial rat
MT2 melatonin receptor cDNA sequence (GenBank accession no.
U28218). Oligonucleotide probes were prepared at the Biotechnology
Center of Northwestern University (Chicago, IL). For isotopic in situ hybridization, oligonucleotide probes were labeled with
[-33P]dATP (Amersham Pharmacia Biotech, Piscataway,
NJ) using terminal transferase (Roche Molecular Biochemicals,
Indianapolis, IN) and purified using Nick columns (Amersham Pharmacia
Biotech). For nonisotopic in situ hybridization, oligonucleotide probes
were 3' tailed with DIG-11-dUTP using the DIG-oligonucleotide tailing kit (Roche Molecular Biochemicals), according to manufacturer's instructions as previously described (14). Brain sections
were hybridized with 33P- or DIG-labeled oligoprobes
following methods previously reported (14, 27). The
hybridization signal generated by 33P-labeled probes was
detected by film autoradiography using Kodak Biomax MR scientific
imaging film for 4 wk. Films were developed in a film processor
(Medical Film Processor QX-70, Konica). The hybridization signal
generated by DIG-labeled probes was detected using alkaline
phosphatase-conjugated anti-DIG IgG (Roche Molecular Biochemicals),
followed by chromagen
5-bromo-4-chloro-3-indolylphosphate-p-toluidine salt/nitro blue tetrazolium (Vector Labs, Burlingame, CA) in the presence of 1 mM levamisole.
Animals and brain slice preparation. Male Long-Evans rats (6- to 10-wk old) were used. Rats were removed from the colony and quickly decapitated during the lights on period only, usually around ZT 5-7. A 500-µM coronal brain slice that contained the paired SCN was prepared within 5 min and placed at the interface of a Hatton-style brain slice chamber (20). Slices were continuously perifused with Earle's balanced salt solution (EBSS; Life Technologies, Grand Island, NY) supplemented with 24.6 mM glucose, 26.2 mM sodium bicarbonate, and 5 mg/l gentamicin and saturated with 95% O2-5% CO2 at 37°C (final pH 7.4). Slices were under constant illumination and were allowed to equilibrate at least 2 h before any experimental paradigms were initiated.
Electrophysiology recordings and data analysis. The extracellular single unit activity from SCN neurons was sampled throughout the nucleus with a glass microelectrode filled with 5 M NaCl and positioned by a hydraulic microdrive, as previously described (30). Every cell with a signal-to-noise ratio of at least 2:1 that was encountered was recorded, the average being 4-6 cells per hour. Each cell was monitored for 4 min, the action potentials were grouped into 10-s bins, and the mean firing rate was calculated for each cell. Data were collected using customized LabVIEW software (National Instruments, Austin, TX). Mean firing rates were grouped into 2-h bins and then smoothed by plotting the data as 15-min running averages. The time-of-peak was visually determined and compared with the time-of-peak of untreated control slices (peak = CT 7 ± 0.25, n = 4), which is coincident with the peak in vehicle-treated controls (24). Under these conditions, the SCN continues to generate stable circadian rhythms of neuronal activity that peak near CT 7 for up to 3 days (30).
Experimental treatments. Melatonin (1 µl) was applied directly to the SCN using the microdrop technique (25). For microdrop treatments, perifusion of the slice was stopped and a 1-µl droplet that contained melatonin at appropriate concentrations was applied to the SCN. Treatment was terminated by washing the reagent off the slice with a stream of fresh EBSS and continuing perifusion. Antagonists were administered by static bath application. The experimenter was blind to the identity of the antagonists being tested. For static bath treatments, perifusion of the slice was stopped at specified times, and the medium in the chamber was quickly removed and manually replaced with media that contained appropriate concentrations of vehicle or antagonists for 1 h. Static bath treatment was terminated by replacing the medium with fresh EBSS and resuming perifusion. For combination static bath/microdrop treatments, the antagonist being tested was bath applied to the slice for 25 min before a 1-µl microdrop that contained 3 pM melatonin was applied. After 10 min, the slice was washed off with EBSS that contained the antagonist, and the static bath incubation was continued for an additional 25 min. Media was replaced with fresh EBSS and perifusion resumed. Melatonin was dissolved to 1 mM in 95% ethanol and further diluted in EBSS. 4P-PDOT and luzindole were dissolved to 10 mM in 95% ethanol and diluted to 1 mM in 50% ethanol. Further serial dilutions were performed in EBSS. The maximal concentration of ethanol used in these experiments (0.001%) does not alter SCN phase (24).
PKC activity assays.
PKC activity assays in SCN slices were performed as previously
described (24). Briefly, brain slices surgically reduced to contain the SCN and optic chiasm were incubated with antagonists (bath application, 25 min) and/or melatonin the same as for recording experiments, except that melatonin was applied as a microdrop for 1 min, because this has been shown to produce maximal activation of PKC
(24). Slices were then quickly frozen on dry ice. Slices were thawed in dilution buffer and phosphotransferase activity was
evaluated using a PKC assay kit (Upstate Biotechnology, Lake Placid,
NY). Activity was based on incorporation of [-32P]ATP
(DuPont-NEN, Boston, MA) into a synthetic substrate peptide corresponding to amino acid residues 4-14 of myelin basic protein, in the absence of lipids. The protein content of each slice was determined using the method of Bradford (7), and the
specific activity was expressed as counts per minute per microgram of protein.
![]() |
RESULTS |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Melatonin receptor expression in rat SCN.
Receptor autoradiography with the radioligand
2-[125I]iodomelatonin revealed robust specific binding in
the SCN at CT 10 (Fig. 1A). The specific
binding of a saturating concentration of
2-[125I]iodomelatonin (200 pM) defined with melatonin (1 µM) was 17.2 ± 0.4 fmol/mg protein (n = 3).
Nissl stain (Fig. 1B) of adjacent sections revealed almost
complete overlap of 2-[125I]iodomelatonin binding with
the SCN.
|
|
|
|
MT2 melatonin receptor-mediated phase shifts of
neuronal firing rate.
The peak in neuronal electrical activity in control SCN slices occurred
at CT 7.00 ± 0.25 (n = 4; Fig.
4A). Exposure of the SCN to
melatonin (0.1-3 pM) delivered by microdrops reset the circadian
clock in a concentration-dependent manner, reaching a plateau at 1 nM.
Melatonin (3 pM) applied by microdrop to the SCN at CT 10 induced a
nearly 4-h phase advance (ØA) in the peak of firing rate
(Fig. 4, B and D; ØA = 3.83 ± 0.29 h, n = 3). This is of similar
magnitude to the phase shift induced by bath application (24,
36).
|
|
MT2 receptor activation stimulates PKC activity.
To determine whether the melatonin receptor antagonists affected
melatonin-induced PKC activation, a necessary step in the signal
transduction pathway mediating phase shifts, enzyme assays were
performed at CT 10. Application of 3 pM melatonin to the SCN brain
slice doubled PKC phosphotransferase activity (P < 0.05, Student's t-test). Neither luzindole (1 µM) nor
4P-PDOT (1 µM) alone altered basal levels of PKC activity (Fig.
6). However, when luzindole or 4P-PDOT
was applied before 3 pM melatonin, the rise in PKC activity was fully
blocked (Fig. 6; P = 0.132, ANOVA on ranks). Thus the
pharmacology of the receptor mediating the effect of melatonin on PKC
activity is consistent with that mediating the effect of melatonin in
clock resetting.
|
![]() |
DISCUSSION |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
Here we report that in the rat SCN slice, the melatonin-mediated phase advances of circadian rhythms of neuronal firing rate and the increases in PKC activity are blocked by the selective and competitive MT2 melatonin receptor antagonist, 4P-PDOT. Furthermore, we demonstrated expression of melatonin receptors in the rat SCN by autoradiography with 2-[125I]iodomelatonin and by in situ hybridization using selective MT1 and MT2 melatonin receptor mRNA oligoprobes. We conclude that both the MT1 and MT2 melatonin receptors are expressed in the SCN of Long-Evans rats and that activation of MT2 melatonin receptor signaling through PKC mediates the phase-shifting effects of melatonin on the circadian clock at both dusk and dawn.
The accumulation of biochemical, molecular, and functional evidence consistently suggests the presence of two melatonin receptors, the MT1 and MT2, in the mammalian SCN (14, 22, 32, 38, 40). Expression of both the MT1 and MT2 melatonin receptor mRNAs in the rat SCN was recently demonstrated by RT-PCR (38, 40). Our in situ hybridization histochemistry studies, using highly selective and specific oligonucleotide probes, revealed for the first time cellular expression of these two receptors within the rat SCN. Specific hybridization of the MT1 and MT2 probes within the ventral and ventromedial crescent of the SCN was previously reported in the C3H/HeN mouse (14). The signal from isotopic in situ hybridization with 33P-labeled probes overlapped with SCN areas displaying specific 2[125I]iodomelatonin binding sites. mRNA hybridization with both the MT1 and MT2 antisense probes was observed within the cytoplasmatic region of rat SCN cells that had neuronal morphology. This is in contrast to hybridization of MT1 and MT2 antisense DIG-labeled oligonucleotides to distinct cellular elements (MT1: granule and basket cells; MT2: Bergman glia and astrocytes) of the human cerebellar cortex (1). In this report, the specificity of labeling of each probe to the corresponding melatonin receptor was clearly demonstrated (1, 14). In the present study, we show concordance of labeling patterns with 33P- and DIG-labeled probes and rigorously controlled for specificity by competition experiments. Thus our data reveal specific labeling of both MT1 and MT2 melatonin receptor mRNAs in the rat SCN and raise the question of the roles these receptors play in SCN function.
Activation of melatonin receptors in the SCN regulates incoming (e.g., light) and output circadian signals and has a direct effect on circadian clock timing (3, 5, 41). In mammals, including humans, melatonin-mediated phase shifts of the clock are restricted to two times of sensitivity, dusk and dawn (4, 21, 24). Specifically, in the rat SCN brain slice, bath-applied melatonin induces concentration-dependent advances of circadian rhythm of neuronal firing rate at both CT 10 and CT 23, with maximal phase shifts of 4 h (23, 24, 36). This model was used here to test the hypothesis that the effects of melatonin on circadian phase within the SCN are mediated through activation of a specific melatonin receptor.
The competitive melatonin receptor antagonist, luzindole, blocked both the melatonin-mediated phase advances of circadian rhythms of neuronal firing rate and the increases in PKC activity in the rat SCN. These results are compatible with activation of a G protein-coupled melatonin receptor (24, 36). Luzindole shows 15-25 times higher affinity for the MT2 than the MT1 melatonin receptor (13, 14, 29). In the mammalian retina, it antagonizes melatonin-mediated inhibition of dopamine release through activation of MT2 melatonin receptors (13). Together, our data are consistent with melatonin acting at an MT2 receptor to phase advance the clock at CT 10. These experiments, however, do not exclude participation of the MT1 melatonin receptor in the phase shift induced by melatonin.
The case for the MT2 receptor as mediator of the melatonin clock effect is strengthened by experiments with the specific and selective MT2 melatonin receptor antagonist, 4P-PDOT (11). Exposure of the SCN slice to 4P-PDOT alone did not phase shift the clock, demonstrating that this analog is not acting as an agonist on melatonin or other G protein-coupled receptors within the SCN (12, 29). However, 4P-PDOT (1-10 nM, 1 µM) competitively antagonized melatonin-mediated phase advances of the circadian rhythm of neuronal firing rate in the rat SCN at two periods of melatonin sensitivity, CT 10 and CT 23. In vivo melatonin-mediated phase advances of circadian activity rhythms may occur primarily through activation of MT2 melatonin receptors within the SCN, rather than in other areas of the circadian timing system, such as retina or intergeniculate nucleus (3, 4, 14, 28). The role of MT2 melatonin receptors in the mammalian SCN in mediating phase advances of the biological clock is further supported by other findings. In the C57BL/6J mouse, targeted deletion of the MT1 receptor did not alter the effect of melatonin on the clock; however, the melatonin-mediated acute inhibition of neuronal firing rate in the SCN was abolished (22). Furthermore, in the C3H/HeN mouse, in vivo administration of either luzindole or 4P-PDOT antagonized phase advances of circadian rhythms of wheel running activity mediated by melatonin at CT 10 (14). Together, these results suggest that selective MT2 melatonin receptor agonists may mediate changes in clock phase and may have potential in the treatment of conditions characterized by alterations in circadian phase due to endogenous (e.g., delayed sleep phase syndrome and advanced sleep phase syndrome) or environmental (e.g., jet lag) causes (3).
In the rat SCN, phase shifting of circadian rhythms of neuronal firing
rate appears to be mediated through activation of the MT2
melatonin receptor signaling via activation of PKC. In support of this
hypothesis, both luzindole and 4P-PDOT completely antagonized activation of PKC by melatonin. Both the MT1 and
MT2 melatonin receptors were coupled to pertussis
toxin-sensitive G proteins that mediate inhibition of
forskolin-stimulated cAMP accumulation (18, 39). In the
rat SCN, MT2 melatonin receptors may signal through
stimulation of phospholipase C (PLC) by G-complexes generating
inositol trisphosphate and diacylglycerol (DAG), which in turn activate
PKC. In support of this hypothesis, direct activation of PKC with
phorbol esters induces phase advances equivalent to those elicited by
melatonin (24). Alternatively, MT2 melatonin receptor-mediated stimulation of PKC in the SCN may involve a signal
transduction mechanism as proposed for the MT1 melatonin receptors (18), whereby G
-subunits activate
phospholipase C
subsequent to PGF2
stimulation. The
aggregate data suggest that the MT2 receptor couples to a
pertussis toxin-sensitive G protein that activates PLC and DAG-mediated
PKC activation.
In the Siberian hamster, a melatonin receptor other than the MT2 appears to mediate phase shifting of circadian rhythms. This species expresses only the MT1 receptor, naturally lacking MT2 receptors, yet melatonin still phase advances the clock in vivo and in vitro (42). Species difference may account for this discrepancy. However, it is possible that the lack of functional MT2 receptors may have altered the function of the MT1 melatonin receptor, unmasking the contribution of this receptor to the phase shift. Alternatively, one may propose that the phase shifts induced by melatonin are mediated through activation of an MT2 melatonin receptor isoform or splice variant not yet discovered.
What are the physiological roles of the MT1 and MT2 melatonin receptors within the SCN? The MT1 contributes to the reversible decrease in firing rate in SCN neurons observed following acute melatonin treatment (22). This effect is limited to temporally sensitive times of day. In rat SCN neurons, the highest percentage of SCN cells shows acute alterations in firing rate to melatonin between CT 12 and CT 15 (37). This early night period corresponds to the time when melatonin production by the pineal begins to rise, thus suggesting that the MT1 receptor could play a role in altering the state of excitability of SCN neurons as the clock moves from day into night. By shifting the membranes to a more hyperpolarized state, it could gate other signals that might impinge concurrently on or within the SCN.
Activation of the MT2 melatonin receptor, on the other hand, affects clock phasing at dusk and dawn; these are times when endogenous melatonin production is low or nil. As night length increases in the fall, melatonin production expands into this clock phase. Thus perhaps MT2 melatonin receptor activation communicates information to the clock mechanisms concerning melatonin synthesized during long nights. The MT2 melatonin receptor may be of critical importance to maintain synchrony of photoperiodic responses under conditions of short photoperiod and also to modify clock responsiveness to other neurochemical regulators of clock phase during the dusk and dawn periods (15). In summary, these two melatonin receptors, MT1 and MT2, could provide integrated control of distinct aspects of SCN physiology by melatonin and insure that this hormonal signal of darkness within the organism provides an unambiguous message within the range of clock processes.
![]() |
ACKNOWLEDGEMENTS |
---|
We are grateful to Monica I. Masana for invaluable help with data analysis. Many thanks go to Shelley Tischkau, Hasanthi Reynolds, and Kathryn Helmin for help with tissue collection. A. E. Hunt contributed the functional studies, and W. M. Al-Ghoul contributed the in situ hybridization and receptor autoradiography studies.
![]() |
FOOTNOTES |
---|
This study was supported by National Institutes of Health Grants NS-22155 (to M. U. Gillette), MH-52685 (to M. L. Dubocovich), and T32-ES-07124 (to W. M. Al-Ghoul).
Address for reprint requests and other correspondence: A. E. Hunt, Dept. of Cell and Structural Biology, Univ. of Illinois, B107 CLSL, 601 S. Goodwin Ave., Urbana, IL 61801 (E-mail: a-hunt1{at}uiuc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 7 April 2000; accepted in final form 7 August 2000.
![]() |
REFERENCES |
---|
![]() ![]() ![]() ![]() ![]() ![]() ![]() |
---|
1.
Al-Ghoul, WM,
Herman MD,
and
Dubocovich ML.
Melatonin receptor subtype expression in human cerebellum.
Neuroreport
9:
4063-4068,
1998[ISI][Medline].
2.
Altschul, SF,
Madden TL,
Schaffer AA,
Zhang J,
Zhang Z,
Miller W,
and
Lipman DJ.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res
25:
3389-3402,
1997
3.
Armstrong, SM,
and
Redman JR.
Melatonin and circadian rhythmicity.
In: Melatonin: Biosynthesis, Physiological Effects and Clinical Applications, edited by Yu HS,
and Reiter RJ.. Boca Raton, FL: CRC, 1993, p. 187-224.
4.
Benloucif, S,
and
Dubocovich ML.
Melatonin and light induce phase shifts of circadian activity rhythms in the C3H/HeN mouse.
J Biol Rhythms
11:
113-125,
1996[ISI][Medline].
5.
Benloucif, S,
Masana MI,
Yun K,
and
Dubocovich ML.
Interactions between light and melatonin on the circadian clock of mice.
J Biol Rhythms
14:
281-289,
1999
6.
Beresford, IJM,
North PC,
Oakley NR,
Starkey S,
Brown J,
Ford SM,
Andrews J,
Coughlan J,
Stratton S,
Dubocovich ML,
and
Hagan RM.
A non-indolic agonist at high affinity melatonin receptors.
J Pharmacol Exp Ther
285:
1239-1245,
1998
7.
Bradford, MM.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
72:
248-254,
1976[ISI][Medline].
8.
Bucher, B,
Gauer F,
Pevet P,
and
Masson-Pevet M.
Vasoconstrictor effects of various melatonin analogs on the rat tail artery in the presence of phenylephrine.
J Cardiovasc Pharmacol
33:
316-322,
1999[ISI][Medline].
9.
Doolen, S,
Krause DN,
Dubocovich ML,
and
Duckles SP.
Melatonin mediates two distinct responses in vascular smooth muscle.
Eur J Pharmacol
345:
67-69,
1998[ISI][Medline].
10.
Dubocovich, ML.
Melatonin receptors: are there multiple subtypes?
Trends Pharmacol Sci
16:
50-56,
1995[ISI][Medline].
11.
Dubocovich, ML,
Cardinali DP,
Guardiola-Lemaitre B,
Hagan RM,
Krause DN,
Sugden D,
Yocca FD,
and
Vanhoutte PM.
Melatonin receptors.
In: The IUPHAR Compendium of Receptor Characterization and Classification, edited by Girdlestone D.. London: IUPHAR Media, 1998a.
12.
Dubocovich, ML,
and
Masana MI.
The efficacy of melatonin receptor analogues is dependent on the level of human melatonin receptor subtype.
In: Biological Clocks, Mechanisms and Applications, edited by Touitou Y.. Amsterdam: Elsevier, 1998, p. 289-293.
13.
Dubocovich, ML,
Masana MI,
Iacob S,
and
Sauri DM.
Melatonin receptor antagonists that differentiate between the human Mel1a and Mel1b recombinant subtypes are used to assess the pharmacological profile of the rabbit retina ML1 presynaptic heteroreceptor.
Naunyn Schmiedebergs Arch Pharmacol
355:
365-375,
1997[ISI][Medline].
14.
Dubocovich, ML,
Yun K,
Al-Ghoul WM,
Benloucif S,
and
Masana MI.
Selective MT2 melatonin receptor antagonists block melatonin-mediated phase advances of circadian rhythms.
FASEB J
12:
1211-1220,
1998
15.
Gillette, MU.
Regulation of entrainment pathways by the suprachiasmatic circadian clock: sensitivities to second messengers.
In: Hypothalamic Integration of Circadian Rhythms, Progress in Brain Research, edited by Buijs R,
Romjin H,
Pennartz C,
and Mirmiran M.. Amsterdam: Elsevier, 1996, vol. 111, p. 119-130.
16.
Gillette, MU,
and
McArthur AJ.
Circadian actions of melatonin at the suprachiasmatic nucleus.
Behav Brain Res
73:
135-139,
1996[ISI][Medline].
17.
Gillette, MU,
and
Tischkau SA.
Suprachiasmatic nucleus: the brain's circadian clock.
Recent Prog Horm Res
54:
33-58,
1999[Medline].
18.
Godson, C,
and
Reppert SM.
The Mel1a melatonin receptor is coupled to parallel signal transduction pathways.
Endocrinology
138:
397-404,
1997
19.
Guardiola-Lemaitre, B.
Melatonin agonist/antagonist: from the receptor to therapeutic applications.
In: Advances in Pineal Research, edited by Moller M,
and Pevet P.. London: Libbey, 1994, p. 333-348.
20.
Hatton, GI,
Doran AD,
Salm AK,
and
Tweedle CD.
Brain slice preparation: hypothalamus.
Brain Res Bull
5:
405-414,
1980[ISI][Medline].
21.
Lewy, AJ,
Ahmed S,
Jackson JM,
and
Sack RL.
Melatonin shifts human circadian rhythms according to a phase-response curve.
Chronobiol Int
9:
380-392,
1992[ISI][Medline].
22.
Liu, C,
Weaver DR,
Jin X,
Shearman LP,
Pieschl RL,
Gribkoff VK,
and
Reppert SM.
Molecular dissection of two distinct actions of melatonin on the suprachiasmatic circadian clock.
Neuron
19:
91-102,
1997[ISI][Medline].
23.
McArthur, JJ,
Gillette MU,
and
Prosser RA.
Melatonin directly resets the rat suprachiasmatic circadian clock in vitro.
Brain Res
565:
158-161,
1991[ISI][Medline].
24.
McArthur, JJ,
Hunt AE,
and
Gillette MU.
Melatonin action and signal transduction in the rat suprachiasmatic circadian clock: activation of protein kinase C at dusk and dawn.
Endocrinology
138:
627-634,
1997
25.
Medanic, M,
and
Gillette MU.
Serotonin regulates the phase of the rat suprachiasmatic circadian pacemaker in vitro only during the subjective day.
J Physiol (Lond)
450:
629-642,
1992[Abstract].
26.
Miller, JA,
and
Zahniser NR.
The use of 14C-labeled tissue paste standards for the calibration of 125I-labeled ligands in quantitative autoradiography.
Neurosci Lett
81:
345-350,
1987[ISI][Medline].
27.
Miranda, RC,
and
Toran-Allerand CD.
Developmental expression of estrogen receptor mRNA in the rat cerebral cortex: a nonisotopic in situ hybridization histochemistry study.
Cereb Cortex
2:
1-15,
1992[Abstract].
28.
Moore, RY.
Organization of the mammalian circadian system.
In: Circadian Clocks and Their Adjustment, edited by Chadwick DJ,
and Ackrill K.. New York: Wiley, 1995, p. 88-106. (Ciba Foundation Symp., London 1993)
29.
Nonno, R,
Pannacci M,
Lucini V,
Angeloni D,
Fraschini F,
and
Stankov BM.
Ligand efficacy and potency at recombinant human MT2 melatonin receptors: evidence for agonist activity of some mt1 antagonists.
Br J Pharmacol
127:
1288-1294,
1999
30.
Prosser, RA,
and
Gillette MU.
The mammalian circadian clock in the suprachiasmatic nucleus is reset in vitro by cAMP.
J Neurosci
9:
1073-1081,
1989[Abstract].
31.
Redman, J,
and
Armstrong S.
Free-running activity rhythms in the rat: entrainment by melatonin.
Science
219:
1089-1091,
1983[ISI][Medline].
32.
Reppert, SM,
Godson C,
Mahle CD,
Weaver DR,
Slaugenhaupt SA,
and
Gusella JF.
Molecular characterization of a second melatonin receptor expressed in human retina and brain: the Mel1b melatonin receptor.
Proc Natl Acad Sci USA
92:
8734-8738,
1995[Abstract].
33.
Reppert, SM,
Weaver DR,
and
Ebisawa T.
Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses.
Neuron
13:
1177-1185,
1994[ISI][Medline].
34.
Siuciak, JA,
Krause DN,
and
Dubocovich ML.
Quantitative pharmacological analysis of 2-125I-iodomelatonin binding sites in discrete areas of the chicken brain.
J Neurosci
11:
2855-2864,
1991[Abstract].
35.
Slaugenhaupt, SA,
Roca AL,
Liebert CB,
Altherr MR,
Gusella JF,
and
Reppert SM.
Mapping of the gene for the Mel1a-melatonin receptor to human chromosome 4 (MTNR1A) and mouse chromosome 8 (Mtnr1a).
Genomics
27:
355-357,
1995[ISI][Medline].
36.
Starkey, SJ,
Walker MP,
Beresford IJM,
and
Hagan RM.
Modulation of the rat suprachiasmatic circadian clock by melatonin in vitro.
Neuroreport
6:
1947-1951,
1995[ISI][Medline].
37.
Stehle, J,
Vanecek J,
and
Vollrath L.
Effects of melatonin on spontaneous electrical activity of neurons in the rat suprachiasmatic nuclei: an in vitro iontophoretic study.
J Neural Transm
78:
173-177,
1989.
38.
Sugden, D,
McArthur AJ,
Ajppru S,
Dunie K,
and
Piggins HD.
Expression of mt(1) receptor subtype mRNA in the entrained rat suprachiasmatic nucleus: a quantitative RT-PCR study across the diurnal cycle.
Brain Res Mol Brain Res
72:
176-182,
1999[ISI][Medline].
39.
Sugden, D,
Yeh LK,
and
Teh MT.
Design of subtype selective melatonin receptor agonists and antagonists.
Reprod Nutr Dev
39:
335-344,
1999[ISI][Medline].
40.
Ting, KN,
Blaylock NA,
and
Sugden D.
Molecular and pharmacological evidence for MT1 melatonin receptor subtype in tail artery of juvenile Wistar rats.
Br J Pharmacol
127:
987-995,
1999
41.
Vanecek, J.
Cellular mechanisms of melatonin action.
Physiol Rev
78:
687-721,
1998
42.
Weaver, DR,
Liu C,
and
Reppert SM.
Nature's knockout: the Mel1b receptor is not necessary for reproductive and circadian responses to melatonin in Siberian hamsters.
Mol Endocrinol
10:
1478-1487,
1996[Abstract].